Sample records for binding sites immunoreactive

  1. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  2. Antibody-dendrimer conjugates: the number, not the size of the dendrimers, determines the immunoreactivity.

    PubMed

    Wängler, C; Moldenhauer, G; Eisenhut, M; Haberkorn, U; Mier, W

    2008-04-01

    Radioimmunotherapy using antibodies with favorable tumor targeting properties and high binding affinity is increasingly applied in cancer therapy. The potential of this valuable cancer treatment modality could be further improved by increasing the specific activity of the labeled proteins. This can be done either by coupling a large number of chelators which leads to a decreased immunoreactivity or by conjugating a small number of multimeric chelators. In order to systematically investigate the influence of conjugations on immunoreactivity with respect to size and number of the conjugates, the anti-EGFR antibody hMAb425 was reacted with PAMAM dendrimers of different size containing up to 128 chelating agents per conjugation site. An improved dendrimer synthesis protocol was established to obtain compounds of high homogeneity suitable for the formation of defined protein conjugates. The quantitative derivatization of the PAMAM dendrimers with DOTA moieties and the characterization of the products by isotopic dilution titration using (111)In/(nat)In are shown. The DOTA-containing dendrimers were conjugated with high efficiency to hMAb425 by applying Sulfo-SMCC as cross-linking agent and a 10- to 25-fold excess of the thiol-containing dendrimers. The determination of the immunoreactivities of the antibody-dendrimer conjugates by FACS analysis revealed a median retained immunoreactivity of 62.3% for 1.7 derivatization sites per antibody molecule, 55.4% for 2.8, 27.9% for 5.3, and 17.1% for 10.0 derivatization sites per antibody but no significant differences in immunoreactivity for different dendrimer sizes. These results show that the dendrimer size does not influence the immunoreactivity of the derivatized antibody significantly over a wide molecular weight range, whereas the number of derivatization sites has a crucial effect.

  3. Immunoreactive GnRH Type I Receptors in the Mouse and Sheep Brain

    PubMed Central

    Albertson, Asher J.; Navratil, Amy; Mignot, Mallory; Dufourny, Laurence; Cherrington, Brian; Skinner, Donal C.

    2008-01-01

    GnRH has been implicated in an array of functions outside the neuroendocrine reproductive axis. Previous investigations have reported extensive GnRH binding in numerous sites and this has been supported by in situ hybridization studies reporting GnRH receptor mRNA distribution. The present study on mice and sheep supports and extends these earlier investigations by revealing the distribution of cells immunoreactive for the GnRH receptor. In addition to sites previously shown to express GnRH receptors such as the hippocampus, amygdala and the arcuate nucleus, the improved resolution afforded by immunocytochemistry detected cells in the mitral cell lay of the olfactory bulb as well as the central grey of the mesencephalon. In addition, GnRH receptor immunoreactive neurons in the hippocampus and mesencephalon of the sheep were shown to colocalize with estrogen receptor β. Although GnRH may act at some of these sites to regulate reproductive processes, evidence is accumulating to support an extra-reproductive role for this hypothalamic decapeptide. PMID:18439800

  4. Studies on the cellular localization of spinal cord substance P receptors.

    PubMed

    Helke, C J; Charlton, C G; Wiley, R G

    1986-10-01

    Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

  5. Organization, development, and effects of infraorbital nerve transection on galanin binding sites in the trigeminal brainstem complex.

    PubMed

    Bodie, D; Bennett-Clarke, C A; Davis, K; Postelwaite, J P; Chiaia, N L; Rhoades, R W

    1997-01-01

    Previous experiments from this laboratory have indicated that transection of the infraorbital nerve (ION, the trigeminal [V] branch that supplies the mystacial vibrissae follicles) at birth and in adulthood has markedly different effects on galanin immunoreactivity in the V brainstem complex. Adult nerve transection increases galanin immunoreactivity in the superficial layers of V subnucleus caudalis (SpC) only, while neonatal nerve transection results in increased galanin expression in vibrissae-related primary afferents throughout the V brainstem complex. The present study describes the distribution of binding sites for this peptide in the mature and developing V ganglion and brainstem complex and determines the effects of neonatal and adult ION damage and the associated changes in galanin levels upon their distribution and density. Galanin binding sites are densely distributed in all V brainstem subnuclei and are particularly dense in V subnucleus interpolaris and the superficial layers of SpC. They are present at birth (P-0) and their distribution is similar to that in adult animals. Transection of the ION in adulthood and examination of brainstem 7 days later indicated marked reductions in the density of galanin binding sites in the V brainstem complex. With the exception of the superficial laminae of SpC, the same reduction in density remained apparent in rats that survived > 45 days after nerve cuts. Transection of the ION on P-0 resulted in no change in the density of galanin binding sites in the brainstem after either 7 or > 60 days survival. These results indicate that densely distributed galanin binding sites are present in the V brainstem complex of both neonatal and adult rats, that they are located in regions not innervated by galanin-positive axons, and that their density is not significantly influenced by large lesion-induced changes in the primary afferent content of their natural ligand.

  6. Immunohistochemical localization of calcium-binding proteins in the brainstem vestibular nuclei of the jaundiced Gunn rat.

    PubMed

    Shaia, Wayne T; Shapiro, Steven M; Heller, Andrew J; Galiani, David L; Sismanis, Aristides; Spencer, Robert F

    2002-11-01

    Vestibular gaze and postural abnormalities are major sequelae of neonatal hyperbilirubinemia. The sites and cellular effects of bilirubin toxicity in the brainstem vestibular pathway are not easily detected. Since altered intracellular calcium homeostasis may play a role in neuronal cell death, we hypothesized that altered expression of calcium-binding proteins may occur in brainstem vestibular nuclei of the classic animal model of bilirubin neurotoxicity. The expression of the calcium-binding proteins calbindin-D28k and parvalbumin in the brainstem vestibular pathways and cerebellum of homozygous recessive jaundiced (jj) Gunn rats was examined by light microscopy and immunohistochemistry at 18 days postnatally and compared to the findings obtained from age-matched non-jaundiced heterozygous (Nj) littermate controls. Jaundiced animals exhibited decreased parvalbumin immunoreactivity specifically in synaptic inputs to superior, medial, and inferior vestibular nuclei, and to oculomotor and trochlear nuclei, whereas the neurons retained their normal immunoreactivity. Jaundiced animals also demonstrated a decrease in calbindin expression in the lateral vestibular nuclei and a paucity of calbindin-immunoreactive synaptic endings on the somata of Deiters' neurons. The involved regions are related to the control of the vestibulo-ocular and vestibulospinal reflexes. Decreased expression of calcium-binding proteins in brainstem vestibular neurons may relate to the vestibulo-ocular and vestibulospinal dysfunction seen with clinical kernicterus, and may provide a sensitive new way to assess bilirubin toxicity in the vestibular system.

  7. Changes in the expression of DNA-binding/differentiation protein inhibitors in neurons and glial cells of the gerbil hippocampus following transient global cerebral ischemia

    PubMed Central

    LEE, JAE-CHUL; CHEN, BAI HUI; CHO, JEONG-HWI; KIM, IN HYE; AHN, JI HYEON; PARK, JOON HA; TAE, HYUN-JIN; CHO, GEUM-SIL; YAN, BING CHUN; KIM, DAE WON; HWANG, IN KOO; PARK, JINSEU; LEE, YUN LYUL; CHOI, SOO YOUNG; WON, MOO-HO

    2015-01-01

    Inhibitors of DNA-binding/differentiation (ID) proteins bind to basic helix-loop-helix (bHLH) transcription factors, including those that regulate differentiation and cell-cycle progression during development, and regulate gene transcription. However, little is known about the role of ID proteins in the brain under transient cerebral ischemic conditions. In the present study, we examined the effects of ischemia-reperfusion (I-R) injury on the immunoreactivity and protein levels of IDs 1–4 in the gerbil hippocampus proper Cornu Ammonis regions CA1–3 following 5 min of transient cerebral ischemia. Strong ID1 immunoreactivity was detected in the nuclei of pyramidal neurons in the hippocampal CA1–3 regions; immunoreactivity was significantly changed following I-R in the CA1 region, but not in the CA2/3 region. Five days following I-R, ID1 immunoreactivity was not detected in the CA1 pyramidal neurons. ID1 immunoreactivity was detected only in GABAergic interneurons in the ischemic CA1 region. Weak ID4 immunoreactivity was detected in non-pyramidal cells, and immunoreactivity was again only changed in the ischemic CA1 region. Five days following I-R, strong ID4 immunoreactivity was detected in non-pyramidal cells, which were identified as microglia, and not astrocytes, in the ischemic CA1 region. Furthermore, changes in the protein levels of ID1 and ID4 in the ischemic CA1 region studied by western blot were consistent with patterns of immunoreactivity. In summary, these results indicate that immunoreactivity and protein levels of ID1 and ID4 are distinctively altered following transient cerebral ischemia only in the CA1 region, and that the changes in ID1 and ID4 expression may relate to the ischemia-induced delayed neuronal death. PMID:25503067

  8. Expression of epidermal fatty acid binding protein (E-FABP) in septoclasts in the growth plate cartilage of mice.

    PubMed

    Bando, Yasuhiko; Yamamoto, Miyuki; Sakiyama, Koji; Inoue, Katsuyuki; Takizawa, Shota; Owada, Yuji; Iseki, Shoichi; Kondo, Hisatake; Amano, Osamu

    2014-10-01

    n-3 Polyunsaturated fatty acids play a role in regulating the growth of the long bones. Fatty acid-binding proteins (FABPs) bind and transport hydrophobic long-chain fatty acids intracellularly, and epidermal-type FABP (E-FABP) has an affinity for n-3 fatty acids. This study aimed to clarify the localization of E-FABP in the growth plate of the mouse tibia. At the chondro-osseous junction (COJ) of the growth plate, E-FABP-immunoreactivity was exclusively localized in mononuclear, spindle-shaped cells with several long processes. These E-FABP-immunoreactive cells were identified as being septoclasts, i.e., cells that resorb uncalcified transverse septa. The processes of these immunoreactive septoclasts terminated between the longitudinal and transverse septa. E-FABP-immunoreactivity was found in the entire cytoplasm and on the mitochondrial outer membrane. In ontogeny, immunoreactive septoclasts were observed immediately after emergence of the primary ossifying center and were distributed not only at the COJ but also in the metaphysis near the COJ. The number of septoclasts increased at the postnatal age of 1 week (P1w)-P2w, and thereafter gradually decreased; and the cells became concentrated at the COJ after P3w-P4w. The immunoreactivity for peroxisome proliferator-activated receptor (PPAR)β/δ was detected in these E-FABP-immunoreactive septoclasts. The present results suggest that fatty acids, preferably n-3 ones, are intracellularly transported by E-FABP to various targets, including mitochondria and nucleus, in which PPARβ/δ may play functional roles in the transcriptional regulation of genes involved in the endochondral ossification.

  9. Neuropathologic features of frontotemporal lobar degeneration with ubiquitin-positive inclusions visualized with ubiquitin-binding protein p62 immunohistochemistry.

    PubMed

    Pikkarainen, Maria; Hartikainen, Päivi; Alafuzoff, Irina

    2008-04-01

    Genetic, clinical, and neuropathologic heterogeneity have been observed in frontotemporal lobar degeneration with ubiquitin (Ubq)-positive inclusions (FTLD-U) and FTLD-U with motor neuron disease. Here, the distribution and morphologic features of neuronal and glial inclusions in the brains of 20 FTLD-U and 2 FTLD-U/motor neuron disease cases were assessed using immunohistochemistry for Ubq-binding protein p62. Eighteen cases displayed TAR DNA-binding protein 43-immunoreactive lesions and were classified as Types 3 (neuronal cytoplasmic inclusions and neurites; 72%), 2 (primarily neuronal cytoplasmic inclusions; 17%), or 1 (primarily neurites; 11%) FTLD-U. The distribution of p62-immunoreactivity varied considerably in each type. Of 4 unclassifiable cases, 2 displayed p62-immunoreactive lesions suggestive of FTLD-U with a mutation in the charged multivesicular body protein 2B gene; 1 suggested basophilic inclusion body disease, and 1 was of a type not previously described. By immunohistochemistry for Ubq-binding protein p62, the distribution of abnormalities was wider than expected; in approximately half of the cases, there were p62-positive but TAR DNA-binding protein 43-negative inclusions in the cerebellum, a region not previously considered to be affected. In other regions, TAR DNA-binding protein 43-, Ubq-, and Ubq-binding protein p62 labeling of inclusions was variable. Whether variations in inclusion morphologies, immunoreactivity, and topographic distribution are due to methodologic factors, different stages of inclusion and disease evolution, different disease entities or biologic modifications of the same disease are presently unclear.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lewis, M.E.; Khachaturian, H.; Watson, S.J.

    Using adjacent section autoradiography-immunocytochemistry, the distribution of (TH)naloxone binding sites was studied in relation to neuronal systems containing (Leu)enkephalin, dynorphin A, or beta-endorphin immunoreactivity in rat brain. Brain sections from formaldehyde-perfused rats show robust specific binding of (TH)naloxone, the pharmacological (mu-like) properties of which appear unaltered. In contrast, specific binding of the delta ligand (TH)D-Ala2,D-Leu5-enkephalin was virtually totally eliminated as a result of formaldehyde perfusion. Using adjacent section analysis, the authors have noted associations between (TH)naloxone binding sites and one, two, or all three opioid systems in different brain regions; however, in some areas, no apparent relationship could be observed.more » Within regions, the relationship was complex. The complexity of the association between (TH)naloxone binding sites and the multiple opioid systems, and previous reports of co-localization of mu and kappa receptors in rat brain, are inconsistent with a simple-one-to-one relationship between a given opioid precursor and opioid receptor subtype. Instead, since differential processing of the three precursors gives rise to peptides of varying receptor subtype potencies and selectivities, the multiple peptide-receptor relationships may point to a key role of post-translational processing in determining the physiological consequences of opioid neurotransmission.« less

  11. Immunoreactive Proteins of Bifidobacterium longum ssp. longum CCM 7952 and Bifidobacterium longum ssp. longum CCDM 372 Identified by Gnotobiotic Mono-Colonized Mice Sera, Immune Rabbit Sera and Non-immune Human Sera

    PubMed Central

    Górska, Sabina; Dylus, Ewa; Rudawska, Angelika; Brzozowska, Ewa; Srutkova, Dagmar; Schwarzer, Martin; Razim, Agnieszka; Kozakova, Hana; Gamian, Andrzej

    2016-01-01

    The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK (B. longum ssp. longum CCM 7952) and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase (B. longum ssp. longum CCDM 372). PMID:27746766

  12. Immunoreactive Proteins of Bifidobacterium longum ssp. longum CCM 7952 and Bifidobacterium longum ssp. longum CCDM 372 Identified by Gnotobiotic Mono-Colonized Mice Sera, Immune Rabbit Sera and Non-immune Human Sera.

    PubMed

    Górska, Sabina; Dylus, Ewa; Rudawska, Angelika; Brzozowska, Ewa; Srutkova, Dagmar; Schwarzer, Martin; Razim, Agnieszka; Kozakova, Hana; Gamian, Andrzej

    2016-01-01

    The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK ( B. longum ssp. longum CCM 7952) and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase ( B. longum ssp. longum CCDM 372).

  13. Calcitonin: regional distribution of the hormone and its binding sites in the human brain and pituitary.

    PubMed

    Fischer, J A; Tobler, P H; Kaufmann, M; Born, W; Henke, H; Cooper, P E; Sagar, S M; Martin, J B

    1981-12-01

    Immunoreactive calcitonin (CT), indistinguishable from human CT-(1-32) and its sulfoxide, has been identified in extracts of the hypothalamus, the pituitary, and the thyroid obtained from human subjects at autopsy. DCT concentrations were highest in a region encompassing the posterior hypothalamus, the median eminence, and the pituitary; intermediate in the substantia nigra, the anterior hypothalamus, the globus pallidus, and the inferior colliculus; and low in the caudate nucleus, the hippocampus, the amygdala, and the cerebral and cerebellar cortices. Specific CT binding measured with 125I-labeled salmon CT was highest in homogenates of the posterior hypothalamus and the median eminence, shown to contain the highest concentrations of endogenous CT in the brain; CT binding was less than 12% of hypothalamic binding in all of the other regions of the brain examined and was negligible in the pituitary. Half-maximal binding was achieved with 0.1 nM nonradioactive salmon CT-(1-32), and the binding was directed to structural or conformational sites, or both, in the COOH-terminal half of salmon CT. The rank order of the inhibition of the binding by CT from different species and analogues of the human hormone was the same as in receptors on a human lymphoid cell line (Moran, J., Hunziker, W. & Fischer, J. A. (1978) Proc. Natl. Acad. Sci. USA 75, 3984-3988). The functional role of CT and of its binding sites in the brain remains to be elucidated.

  14. Calretinin immunoreactivity in the claustrum of the rat

    PubMed Central

    Druga, Rastislav; Salaj, Martin; Barinka, Filip; Edelstein, Lawrence; Kubová, Hana

    2015-01-01

    The claustrum is a telencephalic structure which consists of dorsal segment adjoining the insular cortex and a ventral segment termed also endopiriform nucleus (END). The dorsal segment (claustrum) is divided into a dorsal and ventral zone, while the END is parcellated into dorsal, ventral and intermediate END. The claustrum and the END consist of glutamatergic projection neurons and GABAergic local interneurons coexpressing calcium binding proteins. Among neurons expressing calcium binding proteins the calretinin (CR)-immunoreactive interneurons exert specific functions in neuronal circuits, including disinhibition of excitatory neurons. Previous anatomical data indicate extensive and reciprocally organized claustral projections with cerebral cortex. We asked if the distribution of cells immunoreactive for CR delineates anatomical or functional subdivisions in the claustrum and in the END. Both segments of the claustrum and all subdivisions of the END contained CR immunoreactive neurons with varying distribution. The ventral zone of the claustrum exhibited weak labeling with isolated cell bodies and thin fibers and is devoid of immunoreactive puncta. Within the medial margin of the intermediate END we noted a group of strongly positive neurons. Cells immunoreactive for CR in all subdivisions of the claustrum and END were bipolar, multipolar and oval with smooth, beaded aspiny dendrites. Small number of CR-immunoreactive neurons displayed thin dendrites which enter to adjoining structures. Penetration of dendrites was reciprocal. These results show an inhomogenity over the claustrum and the END in distribution and types of CR immunoreactive neurons. The distribution of the CR-immunoreactive neurons respects the anatomical but not functional zones of the claustral complex. PMID:25653596

  15. [Partial dorsal root rhizotomy increases the anterograde transportation of neunotrophic factors in primary sensory neuron].

    PubMed

    Long, Shuang-lian; Li, Yong-mei; Yuan, Yuan; Wang, Ting-hua; Wu, Lin-yan

    2005-05-01

    To investigate whether partial dorsal root rhizotomy promotes the anterograde Five adult cats were transportation of BDNF, NT-3 and GDNF in the primary sensory neuron. Subjected to unilateral spared root rhizotomy (the DRGs of L1-L5 and L7-S2 were removed, but L6 DRG was spared) and bilateral dorsal roots of L6 were ligated at the same time. Three days after operation, dorsal roots were taken out and made into frozen sections 20 microm in thickness. The sections were stained using specific BDNF, NT-3, GDNF antibody (1:1500) by ABC method. The immunoreactive density was observed in a site near DRG and a site near spinal cord. In the control group (with spared L6 DRG), there were no marked differences in NT-3 and GDNF immunoreactivity between the site near DRG and the site near spinal cord, while BDNF immunoreactivity was more intense in the site near DRG than that in the site near spinal cord. In the operation group, the immunoreactivity of each neurotrophin in the site near DRG was stronger than that in the site near spinal cord, and the immunoreactivities of BDNF, NT-3, GDNF in the site near DRG of the operation were stronger than those of the control group respectively. The increasing of immunoreactivities of neurotrophins near DRG following partial dorsal root rhizotomy suggests that partial dorsal root rhizotomy can promote their anterograde transportation from spared DRG to the spinal cord.

  16. Protection of Dentate Hilar Cells from Prolonged Stimulation by Intracellular Calcium Chelation

    NASA Astrophysics Data System (ADS)

    Scharfman, Helen E.; Schwartzkroin, Philip A.

    1989-10-01

    Prolonged afferent stimulation of the rat dentate gyrus in vivo leads to degeneration only of those cells that lack immunoreactivity for the calcium binding proteins parvalbumin and calbindin. In order to test the hypothesis that calcium binding proteins protect against the effects of prolonged stimulation, intracellular recordings were made in hippocampal slices from cells that lack immunoreactivity for calcium binding proteins. Calcium binding protein--negative cells showed electrophysiological signs of deterioration during prolonged stimulation; cells containing calcium binding protein did not. When neurons without calcium binding proteins were impaled with microelectrodes containing the calcium chelator BAPTA, and BAPTA was allowed to diffuse into the cells, these cells showed no deterioration. These results indicate that, in a complex tissue of the central nervous system, an activity-induced increase in intracellular calcium can trigger processes leading to cell deterioration, and that increasing the calcium binding capacity of a cell decreases its vulnerability to damage.

  17. Modulation by K+ Plus NH4+ of microsomal (Na+, K+)-ATPase activity in selected ontogenetic stages of the diadromous river shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae).

    PubMed

    Leone, Francisco A; Bezerra, Thais M S; Garçon, Daniela P; Lucena, Malson N; Pinto, Marcelo R; Fontes, Carlos F L; McNamara, John C

    2014-01-01

    We investigate the synergistic stimulation by K(+) plus NH4 (+) of (Na(+), K(+))-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na(+), K(+))-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K(+) and NH4 (+) binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na(+), K(+))-ATPase activity is stimulated synergistically by ≈ 50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na(+), K(+))-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K(+) and NH4 (+) of gill (Na(+), K(+))-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 (+) during ontogenetic development in M. amazonicum.

  18. Modulation By K+ Plus NH4 + of Microsomal (Na+, K+)-ATPase Activity in Selected Ontogenetic Stages of the Diadromous River Shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae)

    PubMed Central

    Leone, Francisco A.; Bezerra, Thais M. S.; Garçon, Daniela P.; Lucena, Malson N.; Pinto, Marcelo R.; Fontes, Carlos F. L.; McNamara, John C.

    2014-01-01

    We investigate the synergistic stimulation by K+ plus NH4 + of (Na+, K+)-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na+, K+)-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K+ and NH4 + binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na+, K+)-ATPase activity is stimulated synergistically by ≈50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na+, K+)-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K+ and NH4 + of gill (Na+, K+)-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 + during ontogenetic development in M. amazonicum. PMID:24586919

  19. Site-Specific 64Cu Labeling of the Serine Protease, Active Site Inhibited Factor Seven Azide (FVIIai-N3), Using Copper Free Click Chemistry.

    PubMed

    Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas

    2018-01-17

    A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.

  20. Binding and degradation of 125I-gastrin by plasma membranes from homogenized rat gastric mucosa.

    PubMed

    Kleveland, P M; Waldum, H L

    1986-06-01

    Binding of 125I-gastrin to the 270-30,000 g fraction from homogenized rat oxyntic mucosa was studied. 'Specific' binding was calculated by subtracting the binding at excess cold gastrin from the binding with labelled gastrin (250 pM) only. At 30 degrees C specific binding rose rapidly to a short-lived maximum before falling gradually, whereas at 15 degrees C and 0 degree C specific binding rose gradually to a higher plateau level. The reduced binding at 30 degrees C could be caused by degradation of either the tracer or the binding site or by a combination of these two events. Degradation of 125I-gastrin was evaluated by trichloroacetic acid (TCA) precipitation, fast protein liquid chromatography, and binding to a gastrin antibody (immunoreactivity). The effect of incubation on the binding site was evaluated by preincubation of the homogenate fraction before adding gastrin. In separate studies, the proteolytic activity of the homogenate fraction was studied by TCA precipitation of radioactive casein. Different enzyme inhibitors tested were virtually ineffective in preventing gastrin and casein degradation. Only lowering the incubation temperature to 15 degrees C or lower could prevent this degradation. The reduced and transient binding of 125I-gastrin at 30 degrees C most probably reflects tracer degradation. Accordingly, the gastrin binding experiments were performed at 15 degrees C. Only homogenates from the oxyntic area of the stomach bound 125I-gastrin specifically and with a Kd of 0.8 nM (Scatchard analysis). However, micromolar concentrations of unlabelled gastrin were required to inhibit half maximal binding of the tracer. The tracer binding was unaffected by secretin, slightly reduced by a CCK-9 analogue, and more markedly reduced by pentagastrin.

  1. Lysergic acid diethylamide-induced Fos expression in rat brain: role of serotonin-2A receptors.

    PubMed

    Gresch, P J; Strickland, L V; Sanders-Bush, E

    2002-01-01

    Lysergic acid diethylamide (LSD) produces altered mood and hallucinations in humans and binds with high affinity to serotonin-2A (5-HT(2A)) receptors. Although LSD interacts with other receptors, the activation of 5-HT(2A) receptors is thought to mediate the hallucinogenic properties of LSD. The goal of this study was to identify the brain sites activated by LSD and to determine the influence of 5-HT(2A) receptors in this activation. Rats were pretreated with the 5-HT(2A) receptor antagonist MDL 100907 (0.3 mg/kg, i.p.) or vehicle 30 min prior to LSD (500 microg/kg, i.p.) administration and killed 3 h later. Brain tissue was examined for Fos protein expression by immunohistochemistry. LSD administration produced a five- to eight-fold increase in Fos-like immunoreactivity in medial prefrontal cortex, anterior cingulate cortex, and central nucleus of amygdala. However, in dorsal striatum and nucleus accumbens no increase in Fos-like immunoreactivity was observed. Pretreatment with MDL 100907 completely blocked LSD-induced Fos-like immunoreactivity in medial prefrontal cortex and anterior cingulate cortex, but only partially blocked LSD-induced Fos-like immunoreactivity in amygdala. Double-labeled immunohistochemistry revealed that LSD did not induce Fos-like immunoreactivity in cortical cells expressing 5-HT(2A) receptors, suggesting an indirect activation of cortical neurons. These results indicate that the LSD activation of medial prefrontal cortex and anterior cingulate cortex is mediated by 5-HT(2A) receptors, whereas in amygdala 5-HT(2A) receptor activation is a component of the response. These findings support the hypothesis that the medial prefrontal cortex, anterior cingulate cortex, and perhaps the amygdala, are important regions involved in the production of hallucinations. Copyright 2002 IBRO

  2. Optoelectrofluidic enhanced immunoreaction based on optically-induced dynamic AC electroosmosis.

    PubMed

    Han, Dongsik; Park, Je-Kyun

    2016-04-07

    We report a novel optoelectrofluidic immunoreaction system based on electroosmotic flow for enhancing antibody-analyte binding efficiency on a surface-based sensing system. Two conventional indium tin oxide glass slides are assembled to provide a reaction chamber for a tiny volume of sample droplet (∼5 μL), in which the top layer is employed as an antibody-immobilized substrate and the bottom layer acts as a photoconductive layer of an optoelectrofluidic device. Under the application of an AC voltage, an illuminated light pattern on the photoconductive layer causes strong counter-rotating vortices to transport analytes from the bulk solution to the vicinity of the assay spot on the glass substrate. This configuration overcomes the slow immunoreaction problem of a diffusion-based sensing system, resulting in the enhancement of binding efficiency via an optoelectrofluidic method. Furthermore, we investigate the effect of optically-induced dynamic AC electroosmotic flow on optoelectrofluidic enhancement for surface-based immunoreaction with a mathematical simulation study and real experiments using immunoglobulin G (IgG) and anti-IgG. As a result, dynamic light patterns provided better immunoreaction efficiency than static light patterns due to effective mass transport of the target analyte, resulting in an achievement of 2.18-fold enhancement under a growing circular light pattern compared to the passive mode.

  3. Quantitative analysis of species specificity of two anti-parvalbumin antibodies for detecting southern hemisphere fish species demonstrating strong phylogenetic association.

    PubMed

    Liang, Ji; Tan, Chui Choo; Taylor, Steve L; Baumert, Joseph L; Lopata, Andreas L; Lee, N Alice

    2017-12-15

    This study aimed to develop a novel approach to determine the correlation between the parvalbumin (PAV) contents and their corresponding immunoreactivity (detectability) in southern hemisphere fish species. The immuno-detected PAV contents of the test fish species were estimated by a quantitative SDS-PAGE. A quantitative Enzyme-Linked ImmunoSorbent Assay (ELISA) was formatted to assess relative immunoreactivity of PAV. Sixteen species (forty-three percent) displayed a positive correlation with the anti-cod PAV polyclonal antibody, but no correlation with the anti-carp PAV monoclonal antibody. There was a strong phylogenetic association of the PAV immunoreactivity. Species from the order of Perciformes showed strong binding with both antibodies; whereas species from Salmoniformes, Ophidiiformes, Scombriformes, Scorpaeniformes, and Tetraodontiformes showed weak or no binding. This approach showed for the first time a statistical correlation between the PAV content and the immunoreactivity and allowed to rank the relative species/order specificity of the two antibodies for the southern hemisphere fish PAV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. SUBFIELD AND LAYER-SPECIFIC DEPLETION IN CALBINDIN-D28K, CALRETININ AND PARVALBUMIN IMMUNOREACTIVITY IN THE DENTATE GYRUS OF APP/PS1 TRANSGENIC MICE

    PubMed Central

    Popovi, Miroljub; Caballero-Bleda, María; Kadish, Inga; van Groen, Thomas

    2008-01-01

    The depletion of neuronal calcium binding proteins deprives neurons of the capacity to buffer high levels of intracellular Ca2+ and this leaves them vulnerable to pathological processes, such as those present in Alzheimer’s disease (AD). The aim of the present study was to investigate the expression of the calcium binding proteins, calbindin-D28K, calretinin and parvalbumin in the dentate gyrus (DG) of APP/PS1 transgenic mice and their non-Tg littermates, as well as the relation with the deposition of human Aβ. We measured the expression of these three proteins at seven different rostro-caudal levels, and in the molecular, granular and polymorphic layers of the DG. We found that, except in the most caudal part of the DG, there is a substantial loss of calbindin-D28K immunoreactivity in all three layers of the DG in APP/PS1 mice compared to the non-Tg mice. Significant loss of calretinin immunoreactivity is present in most of the polymorphic layer of the DG of APP/PS1 mice compared to the non-Tg mice, as well as in the rostral and intermediate part of the inner molecular layer. Compared to the non-Tg mice parvalbumin immunoreactivity is significantly reduced throughout the whole polymorphic layer as well as in the rostral and intermediate part of the granular layer of DG in APP/PS1 mice. The relatively preservation of calbindin immunoreactivity in the caudal part of molecular and granular layers as well as calretinin immunoreactivity in the caudal part of polymorphic layer of the DG is likely related to the lower Aβ expression in those parts of DG. The present data suggest an involvement of calcium-dependent pathways in the pathogenesis of AD and indicate that there exists a subfield and layer-specific decrease in immunoreactivity which is related to the type of calcium-binding protein in APP/PS1 mice. Moreover, it seems that APP expression affects more the calbindin expression then parvalbumin and calretinin expression in the DG of APP/PS1 transgenic mice. PMID:18583063

  5. Photoaffinity labeling of protoporphyrinogen oxidase, the molecular target of diphenylether-type herbicides.

    PubMed

    Camadro, J M; Matringe, M; Thome, F; Brouillet, N; Mornet, R; Labbe, P

    1995-05-01

    Diphenylether-type herbicides are extremely potent inhibitors of protoporphyrinogen oxidase, a membrane-bound enzyme involved in the heme and chlorophyll biosynthesis pathways. Tritiated acifluorfen and a diazoketone derivative of tritiated acifluorfen were specifically bound to a single class of high-affinity binding sites on yeast mitochondrial membranes with apparent dissociation constants of 7 nM and 12.5 nM, respectively. The maximum density of specific binding sites, determined by Scatchard analysis, was 3 pmol.mg-1 protein. Protoporphyrinogen oxidase specific activity was estimated to be 2500 nmol protoporphyrinogen oxidized h-1.mol-1 enzyme. The diazoketone derivative of tritiated acifluorfen was used to specifically photolabel yeast protoporphyrinogen oxidase. The specifically labeled polypeptide in wild-type mitochondrial membranes had an apparent molecular mass of 55 kDa, identical to the molecular mass of the purified enzyme. This photolabeled polypeptide was not detected in a protoporphyrinogen-oxidase-deficient yeast strain, but the membranes contained an equivalent amount of inactive immunoreactive protoporphyrinogen oxidase protein.

  6. Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Milius, R.P.

    1985-01-01

    Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less

  7. γ-secretase binding sites in aged and Alzheimer's disease human cerebrum: the choroid plexus as a putative origin of CSF Aβ.

    PubMed

    Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R; Rose, Gregory M; Cai, Huaibin; Struble, Robert G; Cai, Yan; Yan, Xiao-Xin

    2013-05-01

    Deposition of β -amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer's disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although changes in the enzyme's activity in AD brain are unclear. Cerebrospinal fluid (CSF) Aβ peptides are thought to derive from brain parenchyma and thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored the possibility of Aβ production and secretion by the choroid plexus (CP). The specific binding density of [(3) H]-L-685,458, a radiolabeled high-affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with similar ages and post-mortem delays. The CP in post-mortem samples exhibited exceptionally high [(3) H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins and released Aβ40 and Aβ42 into the medium. Overall, our results suggest that γ-secretase activity appears unaltered in the cerebrum in AD and is not correlated with regional amyloid plaque pathology. The CP appears to be a previously unrecognised non-neuronal contributor to CSF Aβ, probably at reduced levels in AD. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  8. γ-Secretase binding sites in aged and Alzheimer’s disease human cerebrum: The choroid plexus as a putative origin of CSF Aβ

    PubMed Central

    Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R.; Rose, Gregory M.; Cai, Huaibin; Struble, Robert G.; Cai, Yan; Yan, Xiao-Xin

    2013-01-01

    Deposition of β-amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer’s disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although less is clear about the change of the enzyme’s activity in AD brain. Cerebrospinal fluid (CSF) Aβ peptides are considered to derive from brain parenchyma, thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored a possibility of Aβ production and secretion by the choroid plexus (CP). Specific binding density of [3H]-L-685,458, a radiolabeled high affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with comparable ages and postmortem delays. The CP in postmortem samples exhibited exceptionally high [3H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins but released Aβ40 and Aβ42 into the medium. These results suggest that γ-secretase activity appears not altered in the cerebrum in AD related to aged control, nor correlated with regional amyloid plaque pathology. The choroid plexus appears to represent a novel non-neuronal source in the brain that may contribute Aβ into cerebrospinal fluid, probably at reduced levels in AD. PMID:23432732

  9. Comparison of alpha-synuclein immunoreactivity in the spinal cord between the adult and aged beagle dog

    PubMed Central

    Ahn, Ji-Hyeon; Choi, Jung-Hoon; Park, Joon-Ha; Yan, Bing-Chun; Kim, In-Hye; Lee, Jae-Chul; Lee, Dae-Hwan; Kim, Jin-Sang

    2012-01-01

    Alpha-synuclein (α-syn) is a presynaptic protein that is richly expressed in the central and peripheral nervous systems of mammals, and it is related to the pathogenesis of Parkinson's disease and other neurodegenerative disorders. In the present study, we compared the distribution of the immunoreactivity of α-syn and its related gliosis in the spinal cord of young adult (2-3 years) and aged (10-12 years) beagle dogs. We discovered that α-syn immunoreactivity was present in many neurons in the thoracic level of the aged spinal cord, however, its protein level was not distinct inform that of the adult spinal cord. In addition, ionized calcium-binding adapter molecule-1 (a marker for microglia) immunoreactivity, and not glial fibrillary acidic protein (a marker for astrocytes) immunoreactivity, was somewhat increased in the aged group compared to the adult group. These results indicate that α-syn immunoreactivity was not dramatically changed in the dog spinal cord during aging. PMID:23091516

  10. Oxysterol-binding Protein Activation at Endoplasmic Reticulum-Golgi Contact Sites Reorganizes Phosphatidylinositol 4-Phosphate Pools*

    PubMed Central

    Goto, Asako; Charman, Mark; Ridgway, Neale D.

    2016-01-01

    Oxysterol-binding protein (OSBP) exchanges cholesterol and phosphatidylinositol 4-phosphate (PI-4P) at contact sites between the endoplasmic reticulum (ER) and the trans-Golgi/trans-Golgi network. 25-Hydroxycholesterol (25OH) competitively inhibits this exchange reaction in vitro and causes the constitutive localization of OSBP at the ER/Golgi interface and PI-4P-dependent recruitment of ceramide transfer protein (CERT) for sphingomyelin synthesis. We used PI-4P probes and mass analysis to determine how OSBP controls the availability of PI-4P for this metabolic pathway. Treatment of fibroblasts or Chinese hamster ovary (CHO) cells with 25OH caused a 50–70% reduction in Golgi-associated immunoreactive PI-4P that correlated with Golgi localization of OSBP. In contrast, 25OH caused an OSBP-dependent enrichment in Golgi PI-4P that was detected with a pleckstrin homology domain probe. The cellular mass of phosphatidylinositol monophosphates and Golgi PI-4P measured with an unbiased PI-4P probe (P4M) was unaffected by 25OH and OSBP silencing, indicating that OSBP shifts the distribution of PI-4P upon localization to ER-Golgi contact sites. The PI-4P and sterol binding activities of OSBP were both required for 25OH activation of sphingomyelin synthesis, suggesting that 25OH must be exchanged for PI-4P to be concentrated at contact sites. We propose a model wherein 25OH activation of OSBP promotes the binding and retention of PI-4P at ER-Golgi contact sites. This pool of PI-4P specifically recruits pleckstrin homology domain-containing proteins involved in lipid transfer and metabolism, such as CERT. PMID:26601944

  11. Oxysterol-binding Protein Activation at Endoplasmic Reticulum-Golgi Contact Sites Reorganizes Phosphatidylinositol 4-Phosphate Pools.

    PubMed

    Goto, Asako; Charman, Mark; Ridgway, Neale D

    2016-01-15

    Oxysterol-binding protein (OSBP) exchanges cholesterol and phosphatidylinositol 4-phosphate (PI-4P) at contact sites between the endoplasmic reticulum (ER) and the trans-Golgi/trans-Golgi network. 25-Hydroxycholesterol (25OH) competitively inhibits this exchange reaction in vitro and causes the constitutive localization of OSBP at the ER/Golgi interface and PI-4P-dependent recruitment of ceramide transfer protein (CERT) for sphingomyelin synthesis. We used PI-4P probes and mass analysis to determine how OSBP controls the availability of PI-4P for this metabolic pathway. Treatment of fibroblasts or Chinese hamster ovary (CHO) cells with 25OH caused a 50-70% reduction in Golgi-associated immunoreactive PI-4P that correlated with Golgi localization of OSBP. In contrast, 25OH caused an OSBP-dependent enrichment in Golgi PI-4P that was detected with a pleckstrin homology domain probe. The cellular mass of phosphatidylinositol monophosphates and Golgi PI-4P measured with an unbiased PI-4P probe (P4M) was unaffected by 25OH and OSBP silencing, indicating that OSBP shifts the distribution of PI-4P upon localization to ER-Golgi contact sites. The PI-4P and sterol binding activities of OSBP were both required for 25OH activation of sphingomyelin synthesis, suggesting that 25OH must be exchanged for PI-4P to be concentrated at contact sites. We propose a model wherein 25OH activation of OSBP promotes the binding and retention of PI-4P at ER-Golgi contact sites. This pool of PI-4P specifically recruits pleckstrin homology domain-containing proteins involved in lipid transfer and metabolism, such as CERT. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Exploration of the immunoreactivity of the Traditional Chinese medicine Shenrouyangzhentang to vasoactive intestinal polypeptide

    PubMed Central

    Gu, Yu-Chun; Chen, De-Zhen

    1997-01-01

    AIM: To study the immunoreactivity of the Chinese medicine Shenrouyangzhentang to vasoactive intestinal polypeptide (VIP) and its therapeutic mechanism. METHODS: The immunoreactivity of the Chinese medicine Shenrouyangzhentang to VIP was detected in the plasma of 20 normal people and 20 patients with Piyinxu (Spleen Yin deficiency) using the radioimmunoassay (RIA) method. RESULTS: The maximum binding rate B0/T was 53.29%, the non-specific binding rate N0/T was 1.170%, and the VIP standard curve was Y = 0.81983 + 0.44319X - 0.28927X2, R2 = 0.990. The VIP content in Shenrouyangzhentang was 106.6 ng/L ± 20 ng/L), while it was 90.16 ng/L ± 15 ng/L in normal human plasma and 63.25 ng/L ± 11 ng/L in the plasma of Pixinxu patients. The difference between normal plasma and Pixinxu patient plasma was statistically significant (P < 0.05). CONCLUSION: The Chinese medicine Shenrouyangzhentang demonstrated VIP immunoreactivity similar to that of normal plasma. The (vasoactive intestinal polypeptide) VIP content in Pixinxu patient plasma was lower than that in healthy subjects (P < 0.05). PMID:27041949

  13. Immunological Reactivity Using Monoclonal and Polyclonal Antibodies of Autoimmune Thyroid Target Sites with Dietary Proteins

    PubMed Central

    Herbert, Martha

    2017-01-01

    Many hypothyroid and autoimmune thyroid patients experience reactions with specific foods. Additionally, food interactions may play a role in a subset of individuals who have difficulty finding a suitable thyroid hormone dosage. Our study was designed to investigate the potential role of dietary protein immune reactivity with thyroid hormones and thyroid axis target sites. We identified immune reactivity between dietary proteins and target sites on the thyroid axis that includes thyroid hormones, thyroid receptors, enzymes, and transport proteins. We also measured immune reactivity of either target specific monoclonal or polyclonal antibodies for thyroid-stimulating hormone (TSH) receptor, 5′deiodinase, thyroid peroxidase, thyroglobulin, thyroxine-binding globulin, thyroxine, and triiodothyronine against 204 purified dietary proteins commonly consumed in cooked and raw forms. Dietary protein determinants included unmodified (raw) and modified (cooked and roasted) foods, herbs, spices, food gums, brewed beverages, and additives. There were no dietary protein immune reactions with TSH receptor, thyroid peroxidase, and thyroxine-binding globulin. However, specific antigen-antibody immune reactivity was identified with several purified food proteins with triiodothyronine, thyroxine, thyroglobulin, and 5′deiodinase. Laboratory analysis of immunological cross-reactivity between thyroid target sites and dietary proteins is the initial step necessary in determining whether dietary proteins may play a potential immunoreactive role in autoimmune thyroid disease. PMID:28894619

  14. Autoregulation of human relaxin-2 gene expression critically involves relaxin and glucocorticoid receptor binding to glucocorticoid response half-sites in the relaxin-2 promoter.

    PubMed

    Dschietzig, Thomas; Bartsch, Cornelia; Wessler, Silja; Baumann, Gert; Stangl, Karl

    2009-06-05

    Relaxin peptides act in brain, reproductive and cardiovascular systems, kidneys, and connective tissue through different G protein-coupled receptors. We reported that human relaxin-2 and porcine relaxin are both agonists at the human glucocorticoid receptor (GR). Here, we investigated the possible auto-regulation of relaxin-2 gene expression via recently discovered GR-binding sites in the relaxin-2 promoter. We found that porcine relaxin increased the secretion of human relaxin-like immunoreactivity in HeLa and THP-1 cells. Silencing of GR gene expression completely abolished this effect whereas transfection of wild-type GR into naturally GR-devoid HT-29 cells established relaxin sensitivity. Relaxin was shown to stimulate CAT expression driven by different deletion constructs of the 5'-flanking region of the relaxin-2 promoter. In chromatin immunoprecipitation assays, we detected both GR and relaxin binding to the relaxin-2 promoter. Gel shift assays indicated binding of relaxin-activated GR to half-GREs located between 160 and 200 bp upstream of transcription start but not to the GRE at -900 bp. Relaxin bound to human GR and displaced established GR agonists. Immunofluorescence experiments visualized nuclear co-localization of relaxin and GR in response to relaxin. In conclusion, we have identified a positive auto-regulatory loop of human relaxin-2 expression which involves GR and relaxin/GR binding to half-GREs in the relaxin-2 promoter.

  15. Fifteen novel immunoreactive proteins of Chinese virulent Haemophilus parasuis serotype 5 verified by an immunoproteomic assay.

    PubMed

    Yu, Yanfei; Wu, Guangyan; Zhai, Zhipeng; Yao, Huochun; Lu, Chengping; Zhang, Wei

    2015-01-01

    Haemophilus parasuis (H. parasuis) is associated with meningitis, polyserositis, polyarthritis and bacterial pneumonia. At present, its prevention and control is difficult because of the lack of suitable subunit vaccines. Nowadays, high-throughput methods, immunoproteomics, are available to screen for more vaccine candidates. A protein extraction method for H. parasuis and two-dimensional electrophoresis (2-DE) were optimized to provide high-resolution profiles covering pH 3 to 10. Twenty immunoreactive spots were excised from gels after strict comparison between 2-DE Western blot membranes and the relevant gels. Matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF-MS) and MALDI-TOF-TOF-MS successfully identified 16 different proteins. Fifteen of them were reported as immunoreactive proteins in H. parasuis for the first time. In addition, recombinant HP5-7 (ABC transporter, periplasmic-binding protein) showed immunoreactivity both with hyperimmune rabbit serum and convalescent swine serum. Four recombinants of the 14 successfully expressed genes showed immunoreactivity with hyperimmune rabbit serum.

  16. Lipoprotein(A) with An Intact Lysine Binding Site Protects the Retina From an Age-Related Macular Degeneration Phenotype in Mice (An American Ophthalmological Society Thesis)

    PubMed Central

    Handa, James T.; Tagami, Mizuki; Ebrahimi, Katayoon; Leibundgut, Gregor; Janiak, Anna; Witztum, Joseph L.; Tsimikas, Sotirios

    2015-01-01

    Purpose: To test the hypothesis that the accumulation of oxidized phospholipids (OxPL) in the macula is toxic to the retina unless neutralized by a variety of mechanisms, including binding by lipoprotein(a) [Lp(a)], which is composed of apolipoprotein(a) [apo(a)] and apolipoprotein B-100 (apoB). Methods: Human maculas and eyes from two Lp(a) transgenic murine models were subjected to morphologic, ultrastructural, and immunohistochemical analysis. “Wild-type Lp(a)” mice, which express human apoB-100 and apo(a) that contains oxidized phospholipid, and “mutant LBS− Lp(a)” mice with a defective apo(a) lysine binding site (LBS) for oxidized phospholipid binding, were fed a chow or high-fat diet for 2 to 12 months. Oxidized phospholipid–containing lipoproteins were detected by immunoreactivity to E06, a murine monoclonal antibody binding to the phosphocholine headgroup of oxidized, but not native, phospholipids. Results: Oxidized phospholipids, apo(a), and apoB accumulate in maculas, including drusen, of age-related macular degeneration (AMD) samples and age-matched controls. Lp(a) mice fed a high-fat diet developed age-related changes. However, mutant LBS− Lp(a) mice fed a high-fat diet developed retinal pigment epithelial cell degeneration and drusen. These changes were associated with increased OxPL, decreased antioxidant defenses, increased complement, and decreased complement regulators. Conclusions: Human maculas accumulate Lp(a) and OxPL. Mutant LBS− Lp(a) mice, lacking the ability to bind E06-detectable oxidized phospholipid, develop AMD-like changes. The ability of Lp(a) to bind E06-detectable OxPL may play a protective role in AMD. PMID:26538774

  17. Agonist-induced internalization of the substance P (NK1) receptor expressed in epithelial cells.

    PubMed

    Garland, A M; Grady, E F; Payan, D G; Vigna, S R; Bunnett, N W

    1994-10-01

    Internalization of the NK1 receptor (NK1R) and substance P was observed in cells transfected with cDNA encoding the rat NK1R by using anti-receptor antibodies and cyanine 3-labelled substance P (cy3-substance P). After incubation at 4 degrees C, NK1R immunoreactivity and cy3-substance P were confined to the plasma membrane. Within 3 min of incubation at 37 degrees C, NK1R immunoreactivity and cy3-substance P were internalized into small intracellular vesicles located beneath the plasma membrane. Fluorescein isothiocyanate-labelled transferrin and cy3-substance P were internalized into the same vesicles, identifying them as early endosomes. After 60 min at 37 degrees C, NK1R immunoreactivity was detected in larger, perinuclear vesicles. Internalization of 125I-labelled substance P was studied by using an acid wash to dissociate cell-surface label from that which has been internalized. Binding reached equilibrium after incubation for 60 min at 4 degrees C with no detectable internalization. After 10 min incubation at 37 degrees C, 83.5 +/- 1.0% of specifically bound counts were internalized. Hyperosmolar sucrose and phenylarsine oxide, which are inhibitors of endocytosis, prevented internalization of 125I-labelled substance P and accumulation of NK1R immunoreactivity into endosomes. Acidotropic agents caused retention of 125I-labelled substance P within the cell and inhibited degradation of the internalized peptide. Continuous incubation of cells with substance P at 37 degrees C reduced 125I-substance P binding at the cell surface. Therefore, substance P and its receptor are internalized into early endosomes within minutes of binding, and internalized substance P is degraded. Internalization depletes NK1Rs from the cell surface and may down-regulate the response of a cell to substance P.

  18. The ontogenetic development of neurons containing calcium-binding proteins in the septum of the guinea pig: Late onset of parvalbumin immunoreactivity versus calbindin and calretinin.

    PubMed

    Hermanowicz-Sobieraj, Beata; Robak, Anna

    2017-01-01

    The study describes the immunoreactivity of calbindin (CB), calretinin (CR) and parvalbumin (PV), their distribution pattern and the co-distribution of CB and CR as well as CB and PV in the septum of the guinea pig during development. Immunohistochemistry was conducted on embryonic (E40, E50, E60), newborn (P0) and postnatal (P5, P10, P20, P40, P100) guinea pig brains. The presence of both CB and CR was detected at E40, while PV began to be observed at E60. Immunoreactivity for CB was constant throughout ontogeny. In contrast to CR immunoreactivity, PV immunoreactivity was higher in the postnatal stages than in the prenatal and newborn stages. Double immunostaining showed that CB co-localized with CR from E40 onwards, while with PV from P5 onwards, suggesting that CB co-operates with these proteins in the guinea pig septum during different periods of ontogeny. Our results also indicate that among the studied CaBPs, CB exhibited the highest immunoreactivity during both embryonic and postnatal development. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Peroxiredoxin 6 expression is inversely correlated with nuclear factor-κB activation during Clonorchis sinensis infestation.

    PubMed

    Pak, Jhang Ho; Son, Woo Chan; Seo, Sang-Beom; Hong, Sung-Jong; Sohn, Woon-Mok; Na, Byoung-Kuk; Kim, Tong-Soo

    2016-10-01

    Clonorchis sinensis is a carcinogenic human liver fluke. Its infection promotes persistent oxidative stress and chronic inflammation environments in the bile duct and surrounding liver tissues owing to direct contact with worms and their excretory-secretory products (ESPs), provoking epithelial hyperplasia, periductal fibrosis, and cholangiocarcinogenesis. We examined the reciprocal regulation of two ESP-induced redox-active proteins, NF-κB and peroxiredoxin 6 (Prdx6), during C. sinensis infection. Prdx6 overexpression suppressed intracellular free-radical generation by inhibiting NADPH oxidase2 and inducible nitric oxide synthase activation in the ESP-treated cholangiocarcinoma cells, substantially attenuating NF-κB-mediated inflammation. NF-κB overexpression decreased Prdx6 transcription levels by binding to two κB sites within the promoter. This transcriptional repression was compensated for by other ESP-induced redox-active transcription factors, including erythroid 2-related factor 2 (Nrf2), hypoxia inducible factor 1α (HIF1α), and CCAAT/enhancer-binding protein β (C/EBPβ). Distribution of immunoreactive Prdx6 and NF-κB was distinct in the early stages of infection in mouse livers but shared concomitant localization in the later stages. The intensity and extent of their immunoreactive staining in infected mouse livers are proportional to lesion severity and infection duration. The constitutive elevations of Prdx6 and NF-κB during C. sinensis infection may be associated with more severe persistent hepatobiliary abnormalities mediated by clonorchiasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Immunocytochemical localization of calretinin containing neurons in retina from rabbit, cat, and dog.

    PubMed

    Jeon, M H; Jeon, C J

    1998-09-01

    Calcium homeostasis is critical for many neuronal functions, yet the distribution of calcium-binding protein is not always conserved among species, even between closely related species. We decided therefore to study the distribution of one of these calcium-binding proteins calretinin, in retina from rabbit, cat, and dog. Calretinin was localized using antibody immunocytochemistry. Calretinin immunoreactivity was found in numerous cell bodies in the ganglion cell layer in all three animals. These cells had small to medium-sized somas. Large ganglion cells, however, were not labeled using antiserum against calretinin. In the inner nuclear layer, calretinin immunoreactivity was found in many neurons in all three species. The regular distribution of neurons, the inner marginal location of their cell bodies in the inner nuclear layer, and the distinctive bilaminar morphologies of their dendritic arbors in the inner plexiform layer suggested that these calretinin-positive cells were AII amacrine cells. Calretinin immunoreactivity was observed in both A- and B-type horizontal cells in cat and dog retina. However, horizontal cells in the rabbit retina were not labeled by this antibody. Neurons in the photoreceptor cell layer were not labeled by this antibody. The present study suggests that calretinin immunoreactivity is present in several populations in the retina. In particular, calretinin labels AII amacrine cells and a subpopulation of ganglion cells in all three animals. Horizontal cells, however, were not labeled in rabbit.

  1. Galanin inhibits acetylcholine release in the ventral hippocampus of the rat: histochemical, autoradiographic, in vivo, and in vitro studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fisone, G.; Wu, C.F.; Consolo, S.

    1987-10-01

    A high density of galanin binding sites was found by using /sup 125/I-labeled galanin, iodinated by chloramine-T, followed by autoradiography in the ventral, but not in the dorsal, hippocampus of the rat. Lesions of the fimbria and of the septum caused disappearance of a major population of these binding sites, suggesting that a large proportion of them is localized on cholinergic nerve terminals of septal afferents. As a functional correlate to these putative galanin receptor sites, it was shown, both in vivo and in vitro, that galanin, in a concentration-dependent manner, inhibited the evoked release of acetylcholine in the ventral,more » but not in the dorsal, hippocampus. Intracerebroventricularly applied galanin fully inhibited the scopolamine stimulated release of acetylcholine in the ventral, but not in the dorsal, hippocampus, as measured by the microdialysis technique. In vitro, galanin inhibited the 25 mM K/sup +/-evoked release of (/sup 3/H)acetylcholine from slices of the ventral hippocampus, with an IC/sub 50/ value of approx. = 50 nM. These results are discussed with respect to the colocalization of galanin- and choline acetyltransferase-like immunoreactivity in septal somata projecting to the hippocampus.« less

  2. Different populations of parvalbumin- and calbindin-D28k-immunoreactive neurons contain GABA and accumulate 3H-D-aspartate in the dorsal horn of the rat spinal cord.

    PubMed

    Antal, M; Polgár, E; Chalmers, J; Minson, J B; Llewellyn-Smith, I; Heizmann, C W; Somogyi, P

    1991-12-01

    The colocalization of parvalbumin (PV), calbindin-D28k (CaBP), GABA immunoreactivities, and the ability to accumulate 3H-D-aspartate selectively were investigated in neurons of laminae I-IV of the dorsal horn of the rat spinal cord. Following injection of 3H-D-aspartate into the basal dorsal horn (laminae IV-VI), perikarya selectively accumulating 3H-D-aspartate were detected in araldite embedded semithin sections by autoradiography, and consecutive semithin sections were treated to reveal PV, CaBP and GABA by postembedding immunocytochemistry. Perikarya accumulating 3H-D-aspartate were found exclusively in laminae I-III, and no labelled somata were found in deeper layers or in the intermediolateral column although the labelled amino acid clearly spread to these regions. More than half of the labelled cells were localized in lamina II. In this layer, 16.4% of 3H-D-aspartate-labelled perikarya were also stained for CaBP. In contrast to CaBP, PV or GABA was never detected in neurons accumulating 3H-D-aspartate. A high proportion of PV-immunoreactive perikarya were also stained for GABA in laminae II and III (70.0% and 61.2% respectively). However, the majority of CaBP-immunoreactive perikarya were GABA-negative. GABA-immunoreactivity was found in less than 2% of the total population of cells stained for CaBP in laminae I-IV. A significant proportion of the GABA-negative but PV-immunoreactive neurons also showed CaBP-immunoreactivity in laminae II and IV. These results show that out of the two calcium-binding proteins, CaBP is a characteristic protein of a small subpopulation of neurons using excitatory amino acids and PV is a characteristic protein of a subpopulation of neurons utilizing GABA as a transmitter. However, both proteins are present in additional subgroups of neurons, and neuronal populations using inhibitory or excitatory amino acid transmitters are heterogeneous with regard to their content of calcium-binding proteins in the dorsal horn of the rat spinal cord.

  3. Forms of immunoreactive beta-endorphin in the intermediate pituitary of the holostean fish, Amia calva.

    PubMed

    Dores, R M; Sei, C A; Morrissey, M A; Crim, J W; Kawauchi, H

    1988-01-01

    Acid extracts of the intermediate pituitary of the holostean fish, Amia calva, were fractionated by gel filtration chromatography and analyzed with radioimmunoassays specific for N-acetylated beta-endorphin and C-terminally amidated alpha-MSH. In these extracts beta-endorphin-related immunoreactive material and alpha-MSH-related immunoreactive material were present in roughly equimolar amounts. The immunoreactive beta-endorphin-sized material was tested for opiate receptor binding activity using a beta-endorphin radioreceptor assay. The results of these studies were negative. The immunoreactive beta-endorphin-sized material was further analyzed by cation exchange chromatography at pH 2.5. Two major and three minor peaks of immunoreactive material were isolated. Peak 5 exhibited a net charge of +7 at pH 2.5 and represented 53% of the total immunoreactivity recovered. Peak 2 with a net charge of +3 at this pH represented 38% of the total immunoreactivity recovered. The minor forms, Peaks 1, 3 and 4, exhibited net charges of +2, +4 and +6, respectively. The apparent molecular weights of Peaks 2 and 5 were determined on a Sephadex G-50 column. Peak 2 had an apparent molecular weight of 2.7 Kd and Peak 5 had an apparent molecular weight of 3.5 Kd. Reverse phase HPLC analysis of Peak 5 indicates that this form of Amia beta-endorphin had chromatographic properties similar to salmon beta-endorphin II. These results would suggest that N-terminal acetylation and C-terminal proteolytic cleavage are important post-translational modifications of the forms of Amia beta-endorphin.

  4. Intraspinal release of immunoreactive calcitonin gene-related peptide during development of inflammation in the joint in vivo--a study with antibody microprobes in cat and rat.

    PubMed

    Schaible, H G; Freudenberger, U; Neugebauer, V; Stiller, R U

    1994-10-01

    This study addressed the intraspinal release of immunoreactive calcitonin gene-related peptide in vivo during mechanical stimulation of the normal joint and during the development of an acute experimental inflammation in the knee joint in the anaesthetized cat (spinalized) and rat (not spinalized). Release was assessed using microprobes coated with antibody to calcitonin gene-related peptide; inhibition of binding of [125I]calcitonin gene-related peptide to these probes following insertion into the spinal cord is equated with intraspinal release of the endogenous (unlabelled) peptide. Probes inserted prior to inflammation showed marked basal release of immunoreactive calcitonin gene-related peptide in the dorsal horn with a maximum in the superficial dorsal horn in the absence of intentional stimulation. The pattern of binding of [125I]calcitonin gene-related peptide was not or only minimally changed by innocuous mechanical stimuli (flexion of and innocuous pressure to the knee in the cat and innocuous pressure to the knee of the rat) but was significantly altered by electrical stimulation of the tibial nerve in the cat (sufficient to excite unmyelinated afferent fibres), indicating release of the peptide by the latter stimulus. During the first hours of the development of an experimental inflammation in the knee joint induced by intra-articular injections of kaolin and carrageenan, the pattern of binding of [125I]calcitonin gene-related peptide changed. In the cat, the level of immunoreactive calcitonin gene-related peptide showed a persistent increase in the gray matter and up to the surface of the cord and release was slightly increased by innocuous stimuli. In the rat, increased levels of immunoreactive calcitonin gene-related peptide were mainly seen in the superficial and deep dorsal horn during innocuous pressure (this stimulus did not evoke release of the peptide prior to inflammation) and noxious pressure applied to the injected knee, whereas increased basal levels were only observed at later stages. These data show that the development of an acute experimental inflammation in the joint is associated with an enhancement of the intraspinal release of immunoreactive calcitonin gene-related peptide. Since the changes in the release were noted at an early stage, within the first hours, they could contribute to the generation of inflammation-evoked changes of the responsiveness of spinal cord neurons and hence to the mechanisms inducing inflammatory pain.

  5. Innervation of the Uvea by Galanin and Somatostatin Immunoreactive Axons in Macaques and Baboons

    PubMed Central

    Firth, Sally I.; Kaufman, Paul L.; De Jean, Baptiste J.; Byers, John M.; Marshak, David W.

    2014-01-01

    The neuropeptide galanin has not been localized previously in the primate uvea, and the neuropeptide somatostatin has not been localized in the uvea of any mammal. Here, the distribution of galanin-like and somatostatin-like immunoreactive axons in the iris, ciliary body and choroid of macaques and baboons using double and triple immunofluorescence labeling techniques and confocal microscopy was reported. In the ciliary body, galanin-like immunoreactive axons innervated blood vessels and the ciliary processes, particularly at their bases. In the iris, the majority of these axons was associated with the loose connective tissue in the stroma. Somatostatin-like immunoreactive axons were found in many of the same areas of the uvea supplied by cholinergic nerves. In the ciliary body, there were labelled axons within the ciliary processes and ciliary muscle. They were also found alongside blood vessels in the ciliary stroma. In the iris, somatostatin-like immunoreactive axons were abundant in the sphincter muscle and less so in the dilator muscle. A unilateral sympathectomy had no effect on the distribution of somatostatin-like or galanin-like immunoreactive axons, and these axons did not contain the sympathetic marker tyrosine hydroxylase. They did not contain the parasympathetic marker choline acetyltransferase, either. The galanin-like immunoreactive axons contained other neuropeptides found in sensory nerves, including calcitonin gene-related peptide, substance P and cholecystokinin. Somatostatin-like immunoreactive axons did not contain any of these sensory neuropeptides or galanin-like immunoreactivity, and they were neither labelled with an antibody to 200 kDa neurofilament protein, nor did they bind isolectin-IB4. Nevertheless, they are likely to be of sensory origin because somatostatin-like immunoreactive perikarya have previously been localized in the trigeminal ganglion of primates. Taken together, these findings indicate galanin and somatostatin are present in two different subsets of sensory axons in primate uvea. PMID:12123636

  6. Robust syntaxin-4 immunoreactivity in mammalian horizontal cell processes

    PubMed Central

    HIRANO, ARLENE A.; BRANDSTÄTTER, JOHANN HELMUT; VILA, ALEJANDRO; BRECHA, NICHOLAS C.

    2009-01-01

    Horizontal cells mediate inhibitory feed-forward and feedback communication in the outer retina; however, mechanisms that underlie transmitter release from mammalian horizontal cells are poorly understood. Toward determining whether the molecular machinery for exocytosis is present in horizontal cells, we investigated the localization of syntaxin-4, a SNARE protein involved in targeting vesicles to the plasma membrane, in mouse, rat, and rabbit retinae using immunocytochemistry. We report robust expression of syntaxin-4 in the outer plexiform layer of all three species. Syntaxin-4 occurred in processes and tips of horizontal cells, with regularly spaced, thicker sandwich-like structures along the processes. Double labeling with syntaxin-4 and calbindin antibodies, a horizontal cell marker, demonstrated syntaxin-4 localization to horizontal cell processes; whereas, double labeling with PKC antibodies, a rod bipolar cell (RBC) marker, showed a lack of co-localization, with syntaxin-4 immunolabeling occurring just distal to RBC dendritic tips. Syntaxin-4 immunolabeling occurred within VGLUT-1-immunoreactive photoreceptor terminals and underneath synaptic ribbons, labeled by CtBP2/RIBEYE antibodies, consistent with localization in invaginating horizontal cell tips at photoreceptor triad synapses. Vertical sections of retina immunostained for syntaxin-4 and peanut agglutinin (PNA) established that the prominent patches of syntaxin-4 immunoreactivity were adjacent to the base of cone pedicles. Horizontal sections through the OPL indicate a one-to-one co-localization of syntaxin-4 densities at likely all cone pedicles, with syntaxin-4 immunoreactivity interdigitating with PNA labeling. Pre-embedding immuno-electron microscopy confirmed the subcellular localization of syntaxin-4 labeling to lateral elements at both rod and cone triad synapses. Finally, co-localization with SNAP-25, a possible binding partner of syntaxin-4, indicated co-expression of these SNARE proteins in the same subcellular compartment of the horizontal cell. Taken together, the strong expression of these two SNARE proteins in the processes and endings of horizontal cells at rod and cone terminals suggests that horizontal cell axons and dendrites are likely sites of exocytotic activity. PMID:17640443

  7. Identification of the G protein-coupled estrogen receptor (GPER) in human prostate: expression site of the estrogen receptor in the benign and neoplastic gland.

    PubMed

    Rago, V; Romeo, F; Giordano, F; Ferraro, A; Carpino, A

    2016-01-01

    Estrogens are involved in growth, differentiation and pathogenesis of human prostate through the mediation of the classical estrogen receptors ERα and ERβ. The G protein-coupled estrogen receptor (GPER) is a 'novel' mediator of estrogen signaling which has been recently recognized in some human reproductive tissues, but its expression in the prostate gland is still unknown. Here, we investigated GPER in benign (from 5 patients) and neoplastic prostatic tissues (from 50 patients) by immunohistochemical analysis and Western blotting. Normal areas of benign prostates revealed a strong GPER immunoreactivity in the basal epithelial cells while luminal epithelial cells were unreactive and stromal cells were weakly immunostained. GPER was also immunolocalized in adenocarcinoma samples but the immunoreactivity of tumoral areas decreased from Gleason pattern 2 to Gleason pattern 4. Furthermore, a strong GPER immunostaining was also revealed in cells of pre-neoplastic lesions (high-grade prostatic intra-epithelial neoplasia). Western blot analysis of benign and tumor protein extracts showed the presence of a ~42 kDa band, consistent with the GPER molecular weight. An increase in both pAkt and p cAMP-response-binding protein (pCREB) levels was also observed in poorly differentiated PCa samples. Finally, this work identified GPER in the epithelial basal cells of benign human prostate, with a different localization with respect to the classical estrogen receptors. Furthermore, the expression of GPER in prostatic adenocarcinoma cells was also observed but with a modulation of the immunoreactivity according to tumor cell arrangements. © 2015 American Society of Andrology and European Academy of Andrology.

  8. Production of Antiserum to LH-Releasing Hormone (LH-RH) Associated with Gonadal Atrophy in Rabbits: Development of Radioimmunoassays for LH-RH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    ARIMURA, A.; SATO, H.; KUMASAKA, T.

    1973-11-01

    Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less

  9. Purification of a benzodiazepine from bovine brain and detection of benzodiazepine-like immunoreactivity in human brain.

    PubMed Central

    Sangameswaran, L; Fales, H M; Friedrich, P; De Blas, A L

    1986-01-01

    An endogenous brain substance that binds to the central-type benzodiazepine receptors with agonist properties is present in both rat and bovine brains. This substance has been purified to homogeneity from bovine brain by immunoaffinity chromatography on immobilized monoclonal anti-benzodiazepine antibody followed by gel filtration on Sephadex G-25 and two reversed-phase HPLC steps. The purified substance was characterized as the benzodiazepine N-desmethyldiazepam (nordiazepam). The techniques used for the identification were mass spectrometry, HPLC, spectrophotometry, benzodiazepine receptor binding, and immunological techniques. Benzodiazepine-like immunoreactivity was also found in all the human brains tested, including six brains that had been stored in paraffin since 1940, fifteen years before the first synthesis of benzodiazepines. These results show that benzodiazepine-like molecules of natural origin--and possibly benzodiazepines themselves--are present in human and other mammalian brains. Images PMID:3024172

  10. Effect of hyperthermia on calbindin-D 28k immunoreactivity in the hippocampal formation following transient global cerebral ischemia in gerbils

    PubMed Central

    Lee, Jae-Chul; Cho, Jeong-Hwi; Lee, Tae-Kyeong; Kim, In Hye; Won, Moo-Ho; Cho, Geum-Sil; Shin, Bich-Na; Hwang, In Koo; Park, Joon Ha; Ahn, Ji Hyeon; Kang, Il Jun; Lee, Young Joo; Kim, Yang Hee

    2017-01-01

    Calbindin D-28K (CB), a Ca2+-binding protein, maintains Ca2+ homeostasis and protects neurons against various insults. Hyperthermia can exacerbate brain damage produced by ischemic insults. However, little is reported about the role of CB in the brain under hyperthermic condition during ischemic insults. We investigated the effects of transient global cerebral ischemia on CB immunoreactivity as well as neuronal damage in the hippocampal formation under hyperthermic condition using immunohistochemistry for neuronal nuclei (NeuN) and CB, and Fluoro-Jade B histofluorescence staining in gerbils. Hyperthermia (39.5 ± 0.2°C) was induced for 30 minutes before and during transient ischemia. Hyperthermic ischemia resulted in neuronal damage/death in the pyramidal layer of CA1–3 area and in the polymorphic layer of the dentate gyrus at 1, 2, 5 days after ischemia. In addition, hyperthermic ischemia significantly decreaced CB immunoreactivity in damaged or dying neurons at 1, 2, 5 days after ischemia. In brief, hyperthermic condition produced more extensive and severer neuronal damage/death, and reduced CB immunoreactivity in the hippocampus following transient global cerebral ischemia. Present findings indicate that the degree of reduced CB immunoreactivity might be related with various neuronal damage/death overtime and corresponding areas after ischemic insults. PMID:29089991

  11. Reproduction-associated immunoreactive peptides in the nervous systems of prosobranch gastropods.

    PubMed

    Ram, J L; Gallardo, C S; Ram, M L; Croll, R P

    1998-12-01

    Antibodies against reproductive peptides of Aplysia and Lymnaea were used to localize homologous immunoreactive peptides in the nervous systems of three prosobranch species: Busycon canaliculatum, Concholepas concholepas, and Tegula atra. Positive control experiments in L. stagnalis demonstrated the broad species range of the anti-egg-laying hormone (anti-ELH) antibody used in this study, and showed binding of anti-alpha-caudodorsal-cell peptide (anti-alpha-CDCP) to the same cells in cerebral and buccal ganglia. Dot immunoassays with synthetic ELH confirmed the reactivity and sensitivity (< 0.1 microgram) of the anti-ELH antibody. Experiments with preadsorbed antibody or no primary antibody confirmed its specificity. In B. canaliculatum, clusters of more than 300 neuronal cell bodies immunoreactive to both anti-ELH and anti-alpha-CDCP were observed along the medial margins of left and right cerebral ganglia. Anti-alpha-CDCP reacted with additional small populations of cerebral ganglion neurons not stained by anti-ELH. Anti-ELH and anti-alpha-CDCP also reacted with overlapping but different small populations of neurons in buccal ganglia. In C. concholepas and T atra, ELH-like immunoreactivity was found in cerebral ganglia, and in T. atra in fibers in the cerebral ganglia and cerebral-pedal connectives. Thus, cerebral ganglia are the major locus of the ELH-like immunoreactivity in prosobranchs.

  12. A synthetic peptide derived from alpha-fetoprotein inhibits the estradiol-induced proliferation of mammary tumor cells in culture through the modulation of p21.

    PubMed

    Sierralta, Walter D; Epuñan, María J; Reyes, José M; Valladares, Luis E; Pino, Ana M

    2008-01-01

    A stable cyclized 9-mer peptide (cP) containing the active site of alpha-alpha fetoprotein (alphaFP) has been shown to be effective for prevention of estrogen-stimulated tumor cell proliferation in culture or of xenographt growth in immunodeficient mice. cP does not block 17beta-estradiol (E2) binding to its receptors, but rather appears to interfere with intracellular processing of the signal that supports growth. To obtain insight on that mechanism we studied the effect of cP on the proliferation of MCF-7 cells in culture. Proliferation in the presence of 2 microM E2 is decreased up to 40% upon addition of 2 microg ml(-1) cP to the medium; the presence of cP did not increase cell death, cP reduced also the proliferation of estrogen-dependent ZR75-1 cells but had no effect on autonomous MDA-MB-231 cells, cP did not modify the number of binding sites for labeled E2 or affected cell death. We detected increased nuclear p21Cip1 immunoreactivity after cP treatment. Our results suggest that cP acts via p21Cip1 to slow the process of MCF-7 cells through the cycle.

  13. Substance P and neurokinin A in human nasal mucosa.

    PubMed

    Baraniuk, J N; Lundgren, J D; Okayama, M; Goff, J; Mullol, J; Merida, M; Shelhamer, J H; Kaliner, M A

    1991-03-01

    The tachykinins substance P (SP) and neurokinin A (NKA) were studied in human inferior turbinate nasal mucosa by radioimmunoassay, immunohistochemistry, and autoradiography and for their effect upon mucus release in an in vitro culture system in order to infer their potential functions in the upper respiratory tract. Similar amounts of SP (1.03 +/- 0.12 pmol/g wet weight; mean +/- SEM; n = 26) and NKA (0.76 +/- 0.23; n = 7) were found. NKA and SP immunoreactive nerve fibers were found in the walls of arterioles, venules, and sinusoids and as individual fibers in gland acini, near the basement membrane, and in the epithelium. [125I]SP bound to arterioles, venules, and glands. [125I]NKA bound only to arterioles. In short-term explant culture of fragments of human nasal mucosa, both 1 microM SP and 1 microM NKA stimulated release of [3H]glucosamine-labeled respiratory glycoconjugates. These results indicate that SP and NKA have similar distributions in nociceptive sensory nerves in human nasal mucosa. The distribution of [125I]SP binding sites is consistent with a role for SP as a vasodilator and mucous secretagogue. The presence of [125I] NKA binding sites on vessels suggests a primary role for NKA in regulating vasomotor tone.

  14. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    ERIC Educational Resources Information Center

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  15. Immunoreactivity of specific epitopes of PrPSc is enhanced by pretreatment in a hydrated autoclave.

    PubMed Central

    Yokoyama, T; Momotani, E; Kimura, K; Yuasa, N

    1996-01-01

    An abnormal protein (PrPSc) accumulates in animals affected with scrapie. Immunoblotting procedures have been used widely to detect PrPSc. Blotted membranes were subjected to pretreatment in a hydrated autoclave, and the subsequent immunoreactivity of PrPSc was examined. The immunoreactivity of PrPSc to antisera against the synthetic peptides of the mouse PrP amino acid sequences 199 to 208 and 213 to 226 was enhanced by the pretreatment. However, the reactivity to antisera of peptide sequences 100 to 115 and 165 to 174 was not affected. The antibody-binding ability of the specific epitopes which are located close to the C-terminal end of PrP27-30 the proteinase-resistant portion of PrPSc, was enhanced by pretreatment in a hydrated autoclave. This pretreatment increased the sensitivity of PrPSc, and it would be useful for diagnosis of scrapie. PMID:8807215

  16. Expression of GDNF and GFR alpha 1 in mouse taste bud cells.

    PubMed

    Takeda, Masako; Suzuki, Yuko; Obara, Nobuko; Uchida, Nobuhiko; Kawakoshi, Kentaro

    2004-11-01

    GDNF (glial cell line-derived neurotrophic factor) affects the survival and maintenance of central and peripheral neurons. Using an immunocytochemical method, we examined whether the taste bud cells in the circumvallate papillae of normal mice expressed GDNF and its GFR alpha 1 receptor. Using double immunostaining for either of them and NCAM, PGP 9.5, or alpha-gustducin, we additionally sought to determine what type of taste bud cells expressed GDNF or GFR alpha 1, because NCAM is reported to be expressed in type-III cells, PGP 9.5, in type-III and some type-II cells, and alpha-gustducin, in some type-II cells. Normal taste bud cells expressed both GDNF and GFR alpha 1. The percentage of GDNF-immunoreactive cells among all taste bud cells was 31.63%, and that of GFR alpha 1-immunoreactive cells, 83.21%. Confocal laser scanning microscopic observations after double immunostaining showed that almost none of the GDNF-immunoreactive cells in the taste buds were reactive with anti-NCAM or anti-PGP 9.5 antibody, but could be stained with anti-alpha-gustducin antibody. On the other hand, almost all anti-PGP 9.5- or anti-alpha-gustducin-immunoreactive cells were positive for GFR alpha 1. Thus, GDNF-immunoreactive cells did not include type-III cells, but type-II cells, which are alpha-gustducin-immunoreactive; on the other hand, GFR alpha 1-immunoreactive cells included type-II and -III cells, and perhaps type-I cells. We conclude that GDNF in the type-II cells may exert trophic actions on type-I, -II, and -III taste bud cells by binding to their GFR alpha 1 receptors.

  17. Cell–specific Variation in E-selectin Ligand Expression Among Human Peripheral Blood Mononuclear Cells: Implications for Immunosurveillance and Pathobiology

    PubMed Central

    Silva, Mariana; Fung, Ronald Kam Fai; Donnelly, Conor Brian; Videira, Paula Alexandra; Sackstein, Robert

    2017-01-01

    Both host defense and immunopathology are shaped by the ordered recruitment of circulating leukocytes to affected sites, a process initiated by binding of blood-borne cells to E-selectin displayed at target endothelial beds. Accordingly, knowledge of the expression and function of leukocyte E-selectin ligands is key to understanding the tempo and specificity of immunoreactivity. Here, we performed E-selectin adherence assays under hemodynamic flow conditions coupled with flow cytometry and western blot analysis to elucidate the function and structural biology of glycoprotein E-selectin ligands expressed on human peripheral blood mononuclear cells (PBMCs). Circulating monocytes uniformly express high levels of the canonical E-selectin binding determinant sLeX and display markedly greater adhesive interactions with E-selectin than do circulating lymphocytes, which exhibit variable E-selectin binding among CD4+ and CD8+ T-cells but no binding by B-cells. Monocytes prominently present sLeX decorations on an array of protein scaffolds including PSGL-1, CD43, and CD44 (rendering the E-selectin ligands CLA, CD43E, and HCELL, respectively), and B-cells altogether lack E-selectin ligands. Quantitative PCR gene expression studies of glycosyltransferases that regulate display of sLeX reveal high transcript levels among circulating monocytes and low levels among circulating B-cells, and, commensurately, cell surface α(1,3)-fucosylation reveals that acceptor sialyllactosaminyl glycans convertible into sLeX are abundantly expressed on human monocytes yet are relatively deficient on B-cells. Collectively, these findings unveil distinct cell-specific patterns of E-selectin ligand expression among human PBMCs, indicating that circulating monocytes are specialized to engage E-selectin and providing key insights into the molecular effectors mediating recruitment of these cells at inflammatory sites. PMID:28330896

  18. Pretargeting of carcinoembryonic antigen-expressing cancers with a trivalent bispecific fusion protein produced in myeloma cells.

    PubMed

    Rossi, Edmund A; Chang, Chien-Hsing; Losman, Michele J; Sharkey, Robert M; Karacay, Habibe; McBride, William; Cardillo, Thomas M; Hansen, Hans J; Qu, Zhengxing; Horak, Ivan D; Goldenberg, David M

    2005-10-01

    To characterize a novel trivalent bispecific fusion protein and evaluate its potential utility for pretargeted delivery of radionuclides to tumors. hBS14, a recombinant fusion protein that binds bispecifically to carcinoembryonic antigen (CEA) and the hapten, histamine-succinyl-glycine (HSG), was produced by transgenic myeloma cells and purified to near homogeneity in a single step using a novel HSG-based affinity chromatography system. Biochemical characterization included size-exclusion high-performance liquid chromatography (SE-HPLC), SDS-PAGE, and isoelectric focusing. Functional characterization was provided by BIAcore and SE-HPLC. The efficacy of hBS14 for tumor pretargeting was evaluated in CEA-expressing GW-39 human colon tumor-bearing nude mice using a bivalent HSG hapten (IMP-241) labeled with (111)In. Biochemical analysis showed that single-step affinity chromatography provided highly purified material. SE-HPLC shows a single protein peak consistent with the predicted molecular size of hBS14. SDS-PAGE analysis shows only two polypeptide bands, which are consistent with the calculated molecular weights of the hBS14 polypeptides. BIAcore showed the bispecific binding properties and suggested that hBS14 possesses two functional CEA-binding sites. This was supported by SE-HPLC immunoreactivity experiments. All of the data suggest that the structure of hBS14 is an 80 kDa heterodimer with one HSG and two CEA binding sites. Pretargeting experiments in the mouse model showed high uptake of radiopeptide in the tumor, with favorable tumor-to-nontumor ratios as early as 3 hours postinjection. The results indicate that hBS14 is an attractive candidate for use in a variety of pretargeting applications, particularly tumor therapy with radionuclides and drugs.

  19. Precipitation of the thyrotropin receptor and identification of thyroid autoantigens using Graves' disease immunoglobulins.

    PubMed Central

    Heyma, P; Harrison, L C

    1984-01-01

    The thyrotropin (TSH) receptor is a putative target for autoantibodies in Graves' hyperthyroidism and therefore, should be capable of being identified, isolated, and structurally characterized by immunological means. To this end, four sera from patients with hyperthyroidism, three of which inhibited the binding of 125I-TSH to Triton-solubilized human thyroid membranes, were used to isolate TSH receptors by immunoprecipitation. To account for an effect of TSH binding or receptor occupancy on the ability of Graves' immunoglobulins to precipitate TSH receptors, two approaches were taken: (a) specific 125I-TSH binding activity was measured after solubilized thyroid membranes had been incubated with Graves' sera followed by precipitation with Staphylococcus protein A ("receptor depletion"); (b) TSH binding sites were labeled with 125I-TSH and the complexes were precipitated using Graves' sera and Staphylococcus protein A ("receptor precipitation"). The three sera which inhibited 125I-TSH binding depleted 125I-TSH binding activity between 30-80%. Preformed complexes between Staphylococcus protein A and immunoglobulins in these sera were also able to deplete 125I-TSH binding activity. However, after receptor depletion, the one serum that did not inhibit 125I-TSH binding was associated with a significant increase in 125I-TSH binding. All four sera specifically precipitated 80-100% of receptors identified by prelabeling with 125I-TSH. The dilutions of sera that precipitated 50% of 125I-TSH-receptor complexes ranged from 1:150-1:20. Complexes were partially precipitated by high concentrations of control sera (1:20), but the relative potency of control sera was at least fourfold less than Graves' sera. Immunoprecipitates of 125I-labeled thyroid membranes were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography to reveal Graves'-specific bands of reduced molecular weights of 100-110,000, 80-90,000, and 70-75,000. These bands were similar to those obtained from 125I-labeled thyroid membranes purified by TSH affinity chromatography. Thus, Graves' immunoglobulins: (a) precipitate unoccupied and occupied TSH receptors, (b) in one case, neither inhibit binding nor immunodeplete the unoccupied receptor but immunoprecipitate 125I-TSH-receptor complexes, suggesting that binding of TSH may initiate an interaction between the binding site and a separate immunoreactive molecule, and (c) identify the molecular structure of Graves' autoantigens, putatively, the TSH receptor. Images PMID:6088581

  20. Ezrin is a cyclic AMP-dependent protein kinase anchoring protein.

    PubMed Central

    Dransfield, D T; Bradford, A J; Smith, J; Martin, M; Roy, C; Mangeat, P H; Goldenring, J R

    1997-01-01

    cAMP-dependent protein kinase (A-kinase) anchoring proteins (AKAPs) are responsible for the subcellular sequestration of the type II A-kinase. Previously, we identified a 78 kDa AKAP which was enriched in gastric parietal cells. We have now purified the 78 kDa AKAP to homogeneity from gastric fundic mucosal supernates using type II A-kinase regulatory subunit (RII) affinity chromatography. The purified 78 kDa AKAP was recognized by monoclonal antibodies against ezrin, the canalicular actin-associated protein. Recombinant ezrin produced in either Sf9 cells or bacteria also bound RII. Recombinant radixin and moesin, ezrin-related proteins, also bound RII in blot overlay. Analysis of recombinant truncations of ezrin mapped the RII binding site to a region between amino acids 373 and 439. This region contained a 14-amino-acid amphipathic alpha-helical putative RII binding region. A synthetic peptide containing the amphipathic helical region (ezrin409-438) blocked RII binding to ezrin, but a peptide with a leucine to proline substitution at amino acid 421 failed to inhibit RII binding. In mouse fundic mucosa, RII immunoreactivity redistributed from a predominantly cytosolic location in resting parietal cells, to a canalicular pattern in mucosa from animals stimulated with gastrin. These results demonstrate that ezrin is a major AKAP in gastric parietal cells and may function to tether type II A-kinase to a region near the secretory canaliculus. PMID:9009265

  1. Altered (/sup 125/I)epidermal growth factor binding and receptor distribution in psoriasis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.

    1986-03-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normalmore » epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that (/sup 125/I)EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers.« less

  2. Prostaglandin E2 induces expression of P-selectin (CD62P) on cultured human umbilical vein endothelial cells and enhances endothelial binding of CD4-T-cells.

    PubMed

    Hailer, N P; Oppermann, E; Leckel, K; Cinatl, J; Markus, B H; Blaheta, R A

    2000-07-15

    Interaction of endothelial P-selectin with sialyl Lewis(x)-glycoprotein or P-selectin glycoprotein ligand (PSGL)-1 on leukocytes represents an early step in leukocyte recruitment. Redistribution of P-selectin to the endothelial cell surface occurs rapidly after challenge with several proinflammatory agents, for example, histamine, leucopterins, or lipopolysaccharide. We present evidence that prostaglandin E2 (PGE2) is an efficient inductor of surface P-selectin on cultured human umbilical vein endothelial cells (HUVEC). The increase in P-selectin-immunoreactivity coincided with redistribution of cytoplasmic P-selectin-reactive granulae to the endothelial cell surface, as visualized by confocal laser microscopic examination. CD4-T-cell adhesion to PGE2-stimulated HUVEC was also enhanced by a factor of 4, and blocking mAb directed against the binding site of P-selectin almost completely abrogated this increase in CD4-T-cell adhesion. In summary, our findings show that liberation of PGE2 is an important inductor of P-selectin surface expression on endothelial cells, resulting in enhanced recruitment of inflammatory cells.

  3. Gastrin-releasing peptide in human nasal mucosa.

    PubMed

    Baraniuk, J N; Lundgren, J D; Goff, J; Peden, D; Merida, M; Shelhamer, J; Kaliner, M

    1990-04-01

    Gastrin-releasing peptide (GRP), the 27 amino acid mammalian form of bombesin, was studied in human inferior turbinate nasal mucosa. The GRP content of the mucosa measured by radioimmunoassay was 0.60 +/- 0.25 pmol/g tissue (n = 9 patients; mean +/- SEM). GRP-immunoreactive nerves detected by the immunogold method of indirect immunohistochemistry were found predominantly in small muscular arteries, arterioles, venous sinusoids, and between submucosal gland acini. 125I-GRP binding sites determined by autoradiography were exclusively and specifically localized to nasal epithelium and submucosal glands. There was no binding to vessels. The effects of GRP on submucosal gland product release were studied in short-term explant culture. GRP (10 microM) significantly stimulated the release of the serous cell-specific product lactoferrin, and [3H]glucosamine-labeled glycoconjugates which are products of epithelial goblet cells and submucosal gland cells. These observations indicate that GRP released from nerve fibers probably acts on glandular GRP receptors to induce glycoconjugate release from submucosal glands and epithelium and lactoferrin release from serous cells, but that GRP would probably not affect vascular permeability.

  4. Neuroanatomy of pars intercerebralis neurons with special reference to their connections with neurons immunoreactive for pigment-dispersing factor in the blow fly Protophormia terraenovae.

    PubMed

    Yasuyama, Kouji; Hase, Hiroaki; Shiga, Sakiko

    2015-10-01

    Input regions of pars intercerebralis (PI) neurons are examined by confocal and electron microscopies with special reference to their connections with neurons immunoreactive for pigment-dispersing factor (PDF) in the blow fly, Protophormia terraenovae. PI neurons are a prerequisite for ovarian development under long-day conditions. Backfills from the cardiac recurrent nerve after severance of the posterior lateral tracts labeled thin fibers derived from the PI neurons in the superior medial protocerebrum. These PI fibers were mainly synapsin-negative and postsynaptic to unknown varicose profiles containing dense-core vesicles. Backfilled fibers in the periesophageal neuropils, derived from the PI neurons or neurons with somata in the subesophageal zone, were varicose and some were synapsin-positive. Electron microscopy revealed the presence of both presynaptic and postsynaptic sites in backfilled fibers in the periesophageal neuropils. Many PDF-immunoreactive varicosities were found in the superior medial and lateral protocerebrum and double-labeling showed that 60-88 % of PDF-immunoreactive varicosities were also synapsin-immunoreactive. Double-labeling with the backfills and PDF immunocytochemistry showed that the PI fibers and PDF-immunoreactive varicosities were located close to each other in the superior medial protocerebrum. Results of triple-labeling of PI neurons, PDF-immunoreactive neurons and synapsin-immunoreactive terminals demonstrated that the synapsin-positive PDF-immunoreactive varicosities contacted the PI fibers. These data suggest that PI neurons receive synaptic contacts from PDF-immunoreactive fibers, which are derived from circadian clock neurons, of small ventral lateral neurons (previously called OL2) or posterior dorsal (PD) neurons with somata in the pars lateralis.

  5. Muscarinic Acetylcholine Receptors in Macaque V1 Are Most Frequently Expressed by Parvalbumin-Immunoreactive Neurons

    PubMed Central

    Disney, Anita A.; Aoki, Chiye

    2010-01-01

    Acetylcholine (ACh) is believed to underlie mechanisms of arousal and attention in mammals. ACh also has a demonstrated functional effect in visual cortex that is both diverse and profound. We have reported previously that cholinergic modulation in V1 of the macaque monkey is strongly targeted toward GABAergic interneurons. Here we examine the localization of m1 and m2 muscarinic receptor subtypes across subpopulations of GABAergic interneurons—identified by their expression of the calcium-binding proteins parvalbumin, calbindin, and calretinin—using dual-immunofluorescence confocal microscopy in V1 of the macaque monkey. In doing so, we find that the vast majority (87%) of parvalbumin-immunoreactive neurons express m1-type muscarinic ACh receptors. m1 receptors are also expressed by 60% of calbindin-immunoreactive neurons and 40% of calretinin-immunoreactive neurons. m2 AChRs, on the other hand, are expressed by only 31% of parvalbumin neurons, 23% of calbindin neurons, and 25% of calretinin neurons. Parvalbumin-immunoreactive cells comprise ≈75% of the inhibitory neuronal population in V1 and included in this large subpopulation are neurons known to veto and regulate the synchrony of principal cell spiking. Through the expression of m1 ACh receptors on nearly all of these PV cells, the cholinergic system avails itself of powerful control of information flow through and processing within the network of principal cells in the cortical circuit. PMID:18265004

  6. Fractone-heparan sulphates mediate FGF-2 stimulation of cell proliferation in the adult subventricular zone.

    PubMed

    Douet, V; Kerever, A; Arikawa-Hirasawa, E; Mercier, F

    2013-04-01

    Fractones are extracellular matrix structures that form a niche for neural stem cells and their immediate progeny in the subventricular zone of the lateral ventricle (SVZa), the primary neurogenic zone in the adult brain. We have previously shown that heparan sulphates (HS) associated with fractones bind fibroblast growth factor-2 (FGF-2), a powerful mitotic growth factor in the SVZa. Here, our objective was to determine whether the binding of FGF-2 to fractone-HS is implicated in the mechanism leading to cell proliferation in the SVZa. Heparitinase-1 was intracerebroventricularly injected with FGF-2 to N-desulfate HS proteoglycans and determine whether the loss of HS and of FGF-2 binding to fractones modifies FGF-2 effect on cell proliferation. We also examined in vivo the binding of Alexa-Fluor-FGF-2 in relationship with the location of HS immunoreactivity in the SVZa. Heparatinase-1 drastically reduced the stimulatory effect of FGF-2 on cell proliferation in the SVZa. Alexa-Fluor-FGF-2 binding was strictly co-localized with HS immunoreactivity in fractones and adjacent vascular basement membranes in the SVZa. Our results demonstrate that FGF-2 requires HS to stimulate cell proliferation in the SVZa and suggest that HS associated with fractones and vascular basement membranes are responsible for activating FGF-2. Therefore, fractones and vascular basement membranes may function as a HS niche to drive cell proliferation in the adult neurogenic zone. © 2013 Blackwell Publishing Ltd.

  7. Cyto- and chemoarchitecture of the sensory trigeminal nuclei of the echidna, platypus and rat.

    PubMed

    Ashwell, Ken W S; Hardman, Craig D; Paxinos, George

    2006-02-01

    We have examined the cyto- and chemoarchitecture of the trigeminal nuclei of two monotremes using Nissl staining, enzyme reactivity for cytochrome oxidase, immunoreactivity for calcium binding proteins and non-phosphorylated neurofilament (SMI-32 antibody) and lectin histochemistry (Griffonia simplicifolia isolectin B4). The principal trigeminal nucleus and the oralis and interpolaris spinal trigeminal nuclei were substantially larger in the platypus than in either the echidna or rat, but the caudalis subnucleus was similar in size in both monotremes and the rat. The numerical density of Nissl stained neurons was higher in the principal, oralis and interpolaris nuclei of the platypus relative to the echidna, but similar to that in the rat. Neuropil immunoreactivity for parvalbumin was particularly intense in the principal trigeminal, oralis and interpolaris subnuclei of the platypus, but the numerical density of parvalbumin immunoreactive neurons was not particularly high in these nuclei of the platypus. Neuropil immunoreactivity for calbindin and calretinin was relatively weak in both monotremes, although calretinin immunoreactive somata made up a large proportion of neurons in the principal, oralis and interpolaris subnuclei of the echidna. Distribution of calretinin immunoreactivity and Griffonia simplicifolia B4 isolectin reactivity suggested that the caudalis subnucleus of the echidna does not have a clearly defined gelatinosus region. Our findings indicate that the trigeminal nuclei of the echidna do not appear to be highly specialized, but that the principal, oralis and interpolaris subnuclei of the platypus trigeminal complex are highly differentiated, presumably for processing of tactile and electrosensory information from the bill.

  8. Response of the gut neuroendocrine system of Leuciscus cephalus (L.) to the presence of Pomphorhynchus laevis Müller, 1776 (Acanthocephala).

    PubMed

    Bosi, G; Domeneghini, C; Arrighi, S; Giari, L; Simoni, E; Dezfuli, B S

    2005-04-01

    Immunohistochemical tests were applied to sections of intestine of uninfected and Pomphorhynchus laevis Muller-infected chub, Leuciscus cephalus (L.) using 15 different antisera. Nerve cell bodies and fibres immunoreactive (IR) to the anti-bombesin, -Cholecystokinin-8 (CCK-8), -galanin, -Gastrin-Releasing Peptide (-GRP), -Nitric Oxide Synthase (-NOS), -Substance P (-SP), and -Vasoactive Intestinal Peptide (-VIP) sera were observed in the myenteric plexus of uninfected chub. The density of nerve components immunoreactive to these antisera was high in the intestine of the infected fish, especially near the site of attachment. Moreover, numerous nerve fibres, immunoreactive to anti-bombesin, -GRP, -galanin, -SP, and -VIP sera, were encountered in the connective tissue capsule surrounding the bulb and proboscis of P. laevis. The occurrence of P. laevis in the chub gut significantly increased the number of endocrine cells per intestinal fold immunoreactive to galanin, met-enkephalin and leu-enkephalin antisera. CCK-8, Neuropeptide Y and glucagon-like immunoreactive cells were less numerous in the intestine of infected chub. A large number of cells in the tunica propria-submucosa of L. cephalus infected with P. laevis were immunoreactive to anti-serotonin and -leu-enkephalin sera.

  9. Immunohistochemical demonstration of enkephalin-containing nerve fibers in guinea pig and rat lungs.

    PubMed

    Shimosegawa, T; Foda, H D; Said, S I

    1989-08-01

    Met-enkephalin (Met-Enk) and Leu-enkephalin (Leu-Enk), the opioid peptides originally isolated from the brain, are believed to act as inhibitory neuromodulators at various synaptic sites. In this immunohistochemical study, we have investigated the localization and distribution of Met- and Leu-Enk immunoreactivities in airways and pulmonary vessels of guinea pigs and rats. Immunoreactivities to both peptides were found in nerve fibers and nerve terminals distributed mainly to the trachea and major bronchi, and were especially prevalent in the smooth muscle layer, in the lamina propria, and around tracheal and bronchial glands, but not in the epithelium. Few immunoreactive nerve fibers were detected in smaller bronchi, bronchioles, and alveoli. Enkephalin-immunoreactive nerve fibers were also localized in the walls of pulmonary and bronchial vessels. Within airway microganglia, immunoreactivity was observed in a few nerve terminals, but not in ganglion cell bodies. Met- and Leu-Enk immunoreactive nerve fibers showed similar distribution patterns, though minor differences were noted between the two species: Enk-immunoreactive nerve fibers in the smooth muscle layer were more abundant in guinea pigs than in rats, whereas those in mucous glands were richer in rats than in guinea pigs. These results document the presence of Met- and Leu-Enk immunoreactivity in nerve fibers supplying guinea pig and rat airways and pulmonary vessels, and provide a morphologic basis for the view that enkephalins are likely neurotransmitters or neuromodulators in the lung.

  10. DEVELOPMENTAL HYPOTHYROIDISM REDUCES PARVALBUMIN EXPRESSION IN GABAERGIC NEURONS OF CORTEX AND HIPPOCAMPUS: IMMUNOHISTOCHEMICAL FINDINGS AND FUNCTIONAL CORRELATES.

    EPA Science Inventory

    GABAergic interneurons comprise the bulk of local inhibitory neuronal circuitry in cortex and hippocampus and a subpopulation of these interneurons contain the calcium binding protein, parvalbumin (PV). A previous report indicated that severe hypothyroidism reduced PV immunoreact...

  11. Heat and pressure treatments effects on peanut allergenicity

    USDA-ARS?s Scientific Manuscript database

    Peanut allergy is recognized as one of the most severe food allergies. The aim of this study was to investigate the changes in IgE binding capacity of peanut proteins produced by thermal-processing methods, including autoclaving. Immunoreactivity to raw and thermally processed peanut extracts was ev...

  12. Distinct interneuron types express m2 muscarinic receptor immunoreactivity on their dendrites or axon terminals in the hippocampus.

    PubMed

    Hájos, N; Papp, E C; Acsády, L; Levey, A I; Freund, T F

    1998-01-01

    In previous studies m2 muscarinic acetylcholine receptor-immunoreactive interneurons and various types of m2-positive axon terminals have been described in the hippocampal formation. The aim of the present study was to identify the types of interneurons expressing m2 receptor and to examine whether the somadendritic and axonal m2 immunostaining labels the same or distinct cell populations. In the CA1 subfield, neurons immunoreactive for m2 have horizontal dendrites, they are located at the stratum oriens/alveus border and have an axon that project to the dendritic region of pyramidal cells. In the CA3 subfield and the hilus, m2-positive neurons are multipolar and are scattered in all layers except stratum lacunosum-moleculare. In stratum pyramidale of the CA1 and CA3 regions, striking axon terminal staining for m2 was observed, surrounding the somata and axon initial segments of pyramidal cells in a basket-like manner. The co-localization of m2 with neurochemical markers and GABA was studied using the "mirror" technique and fluorescent double-immunostaining at the light microscopic level and with double-labelling using colloidal gold-conjugated antisera and immunoperoxidase reaction (diaminobenzidine) at the electron microscopic level. GABA was shown to be present in the somata of most m2-immunoreactive interneurons, as well as in the majority of m2-positive terminals in all layers. The calcium-binding protein parvalbumin was absent from practically all m2-immunoreactive cell bodies and dendrites. In contrast, many of the terminals synapsing on pyramidal cell somata and axon initial segments co-localized parvalbumin and m2, suggesting a differential distribution of m2 receptor immunoreactivity on the axonal and somadendritic membrane of parvalbumin-containing basket and axo-axonic cells. The co-existence of m2 receptors with the calcium-binding protein calbindin and the neuropeptides cholecystokinin and vasoactive intestinal polypeptide was rare throughout the hippocampal formation. Only calretinin and somatostatin showed an appreciable degree of co-localization with m2 (20% and 15%, respectively). Using retrograde tracing, some of the m2-positive cells in stratum oriens were shown to project to the medial septum, accouting for 38% of all projection neurons. The present results demonstrate that there is a differential distribution of m2 receptor immunoreactivity on the axonal vs the somadendritic membranes of distinct interneuron types and suggest that acetylcholine via m2 receptors may reduce GABA release presynaptically from the terminals of perisomatic inhibitory cells, while it may act to increase the activity of another class of interneuron, which innervates the dendritic region of pyramidal cells.

  13. Localisation of atrial natriuretic peptide immunoreactivity in the ventricular myocardium and conduction system of the human fetal and adult heart.

    PubMed Central

    Wharton, J; Anderson, R H; Springall, D; Power, R F; Rose, M; Smith, A; Espejo, R; Khaghani, A; Wallwork, J; Yacoub, M H

    1988-01-01

    Atrial natriuretic peptide immunoreactivity was found in ventricular and atrial tissues with specific antisera raised to the amino and carboxy terminal regions of the precursor molecule. In 13 developing human hearts (7-24 weeks' gestation) the immunoreactivity was concentrated in the atrial myocardium and ventricular conduction system but it was also detected in the early fetal ventricular myocardium. Immunoreactivity in five normal adults was largely confined to the atrial myocardium although it was also found in the ventricular conduction tissues of hearts removed from 10 patients who were undergoing cardiac transplantation. The ventricular conduction system is an extra-atrial site for the synthesis of atrial natriuretic peptide. In the failing heart this synthesis may be further supplemented by expression of the gene in the ventricular myocardium. It is possible that ventricular production of the peptide contributes to the raised circulating concentrations of atrial natriuretic peptide immunoreactivity found in severe congestive heart disease, particularly in patients with dilated cardiomyopathy. Images Fig 1 Fig 2 Fig 3 Fig 4 Fig 5 PMID:2973340

  14. Assessment transcallosal Diaschisis in a model of focal cerebral ischemia in rats.

    PubMed

    Arango-Dávila, César Augusto; Muñoz Ospina, Beatriz Elena; Castaño, Daniel Manrique; Potes, Laura; Umbarila Prieto, John

    2016-06-30

    To evaluate transcallosal changes after a local ischemic injury in rats by using the monoclonal marker anti-NeuN (Mouse anti-neuronal nuclei). Twenty-eight adult, male, Wistar rats were subjected to focal injury in the right hemisphere. The technique used was the experimental model of focal ischemic injury through intraluminal suture of the middle cerebral artery. Analyses were made for the five groups: after the lesion (control), at 24 h, 96 h, 10 days and 20 days. Exofocal neuronal damage was inferred from neuronal immunoreactivity changes to NeuN. In the cortex contralateral to the lesion, immunoreactivity was diminished. This finding was most notable in the supra-granular sheets 24 h post ischemia. After 96 h, there was a generalized diminishment of the inmmunoreactivity in the supra and infra-granular sheets. At 10 and 20 days, the tissue recovered some immunoreactivity to NeuN, but there were some changes in the VI layer. The immunoreactive changes to NeuN support the process of inter-hemispheric diaschisis. Changes in immunoreactivity could indicate metabolic stress secondary to the disruption in connectivity to the site of lesion.

  15. Stability and immunogenicity of hypoallergenic peanut protein-polyphenol complexes during in vitro pepsin digestion.

    PubMed

    Plundrich, Nathalie J; White, Brittany L; Dean, Lisa L; Davis, Jack P; Foegeding, E Allen; Lila, Mary Ann

    2015-07-01

    Allergenic peanut proteins are relatively resistant to digestion, and if digested, metabolized peptides tend to remain large and immunoreactive, triggering allergic reactions in sensitive individuals. In this study, the stability of hypoallergenic peanut protein-polyphenol complexes was evaluated during simulated in vitro gastric digestion. When digested with pepsin, the basic subunit of the peanut allergen Ara h 3 was more rapidly hydrolyzed in peanut protein-cranberry or green tea polyphenol complexes compared to uncomplexed peanut flour. Ara h 2 was also hydrolyzed more quickly in the peanut protein-cranberry polyphenol complex than in uncomplexed peanut flour. Peptides from peanut protein-cranberry polyphenol complexes and peanut protein-green tea polyphenol complexes were substantially less immunoreactive (based on their capacity to bind to peanut-specific IgE from patient plasma) compared to peptides from uncomplexed peanut flour. These results suggest that peanut protein-polyphenol complexes may be less immunoreactive passing through the digestive tract in vivo, contributing to their attenuated allergenicity.

  16. Serial alterations in digital hemodynamics and endothelin-1 immunoreactivity, platelet-neutrophil aggregation, and concentrations of nitric oxide, insulin, and glucose in blood obtained from horses following carbohydrate overload.

    PubMed

    Eades, Susan C; Stokes, Ashley M; Johnson, Philip J; LeBlanc, Casey J; Ganjam, Venkataseshu K; Buff, Preston R; Moore, Rustin M

    2007-01-01

    To quantify changes in endothelium-derived factors and relate those changes to various aspects of digital hemodynamics during the prodromal stages of carbohydrate overload (CHO)-induced laminitis in horses. 20 adult horses without abnormalities of the digit. Digital and jugular venous blood samples were collected at 1-hour intervals (for assessment of endothelin-1 [ET-1] immunoreactivity and measurement of glucose, insulin, and nitric oxide [NO] concentrations) or 4-hour intervals (CBC and platelet-neutrophil aggregate assessment) for 8 hours or 16 hours after induction of CHO-associated laminitis in horses treated with an ET-1 antagonist. Effects of treatment, collection site, and time and the random effects of horse on each variable were analyzed by use of a repeated-measures model. Where treatment and collection site had no significant effect, data were combined. Compared with baseline values, CHO resulted in changes in several variables, including a significant increase from baseline in digital blood ET-like immunoreactivity at 11 hours; digital blood ET-like immunoreactivity was significantly greater than that in jugular venous blood at 8, 9, 11, and 12 hours. Digital and jugular venous blood concentrations of glucose increased from baseline significantly at 3, 4, and 5 hours; insulin concentration increased significantly at 5 hours; and the number of platelet-neutrophil aggregates increased significantly at 12 hours. In horses, concurrent increases in venous blood ET-1 immunoreactivity, insulin and glucose concentrations, and platelet-neutrophil aggregates support a role of endothelial dysfunction in the pathogenesis of CHO-induced laminitis.

  17. Chondroitin sulfates do not impede axonal regeneration in goldfish spinal cord.

    PubMed

    Takeda, Akihito; Okada, Soichiro; Funakoshi, Kengo

    2017-10-15

    Chondroitin sulfate proteoglycans produced in glial scar tissue are a major inhibitory factor for axonal regeneration after central nervous system injury in mammals. The inhibition is largely due to chondroitin sulfates, whose effects differ according to the sulfation pattern. In contrast to mammals, fish nerves spontaneously regenerate beyond the scar tissue after spinal cord injury, although the mechanisms that allow for axons to pass through the scar are unclear. Here, we used immunohistochemistry to examine the expression of two chondroitin sulfates with different sulfation variants at the lesion site in goldfish spinal cord. The intact spinal cord was immunoreactive for both chondroitin sulfate-A (CS-A) and chondroitin sulfate-C (CS-C), and CS-A immunoreactivity overlapped extensively with glial processes positive for glial fibrillary acidic protein. At 1week after inducing the spinal lesion, CS-A immunoreactivity was observed in the cell bodies and extracellular matrix, as well as in glial processes surrounding the lesion center. At 2weeks after the spinal lesion, regenerating axons entering the lesion center overtook the CS-A abundant area. In contrast, at 1week after lesion induction, CS-C immunoreactivity was significantly decreased, and at 2weeks after lesion induction, CS-C immunoreactivity was observed along the regenerating axons entering the lesion center. The present findings suggest that after spinal cord injury in goldfish, chondroitin sulfate proteoglycans are deposited in the extracellular matrix at the lesion site but do not form an impenetrable barrier to the growth of regenerating axons. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. FMRFamide-like immunoreactive nervus terminalis innervation to the pituitary in the catfish, Clarias batrachus (Linn.): demonstration by lesion and immunocytochemical techniques

    NASA Technical Reports Server (NTRS)

    Krishna, N. S.; Subhedar, N.; Schreibman, M. P.

    1992-01-01

    Certain thick FMRFamide-like immunoreactive fibers arising from the ganglion cells of nervus terminalis in the olfactory bulb of Clarias batrachus can be traced centripetally through the medial olfactory tract, telencephalon, lateral preoptic area, tuberal area, and hypothalamohypophysial tract to the pituitary. Following 6 days of bilateral olfactory tract transection, the immunoreactivity in the thick fibers, caudal to the lesion site, was partially eliminated, whereas after 10 and 14 days, it was totally abolished in the processes en route to the pituitary. The results indicate a direct innervation of the pituitary gland by the FMRFamide-like peptide containing fibers of the nervus terminalis.

  19. Rufinamide, an antiepileptic drug, improves cognition and increases neurogenesis in the aged gerbil hippocampal dentate gyrus via increasing expressions of IGF-1, IGF-1R and p-CREB.

    PubMed

    Chen, Bai Hui; Ahn, Ji Hyeon; Park, Joon Ha; Song, Minah; Kim, Hyunjung; Lee, Tae-Kyeong; Lee, Jae Chul; Kim, Young-Myeong; Hwang, In Koo; Kim, Dae Won; Lee, Choong-Hyun; Yan, Bing Chun; Kang, Il Jun; Won, Moo-Ho

    2018-04-25

    Rufinamide is a novel antiepileptic drug and commonly used in the treatment of Lennox-Gastaut syndrome. In the present study, we investigated effects of rufinamide on cognitive function using passive avoidance test and neurogenesis in the hippocampal dentate gyrus using Ki-67 (a marker for cell proliferation), doublecortin (DCX, a marker for neuroblast) and BrdU/NeuN (markers for newly generated mature neurons) immunohistochemistry in aged gerbils. Aged gerbils (24-month old) were treated with 1 mg/kg and 3 mg/kg rufinamide for 4 weeks. Treatment with 3 mg/kg rufinamide, not 1 mg/kg rufinamide, significantly improved cognitive function and increased neurogenesis, showing that proliferating cells (Ki-67-immunoreactive cells), differentiating neuroblasts (DCX-immunoreactive neuroblasts) and mature neurons (BrdU/NeuN-immunoreactive cells) in the aged dentate gyrus compared with those in the control group. When we examined its mechanisms, rufinamide significantly increased immunoreactivities of insulin-like growth factor-1 (IGF-1), its receptor (IGF-1R), and phosphorylated cAMP response element binding protein (p-CREB). However, rufinamide did not show any increase in immunoreactivities of brain-derived neurotrophic factor and its receptor. Therefore, our results indicate that rufinamide can improve cognitive function and increase neurogenesis in the hippocampus of the aged gerbil via increasing expressions of IGF-1, IGF-1R and p-CREB. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Cortical orofacial motor representation in Old World monkeys, great apes, and humans. II. Stereologic analysis of chemoarchitecture.

    PubMed

    Sherwood, Chet C; Holloway, Ralph L; Erwin, Joseph M; Hof, Patrick R

    2004-01-01

    This study presents a comparative stereologic investigation of neurofilament protein- and calcium-binding protein-immunoreactive neurons within the region of orofacial representation of primary motor cortex (Brodmann's area 4) in several catarrhine primate species (Macaca fascicularis, Papio anubis, Pongo pygmaeus, Gorilla gorilla, Pan troglodytes, and Homo sapiens). Results showed that the density of interneurons involved in vertical interlaminar processing (i.e., calbindin- and calretinin-immunoreactive neurons) as well pyramidal neurons that supply heavily-myelinated projections (i.e., neurofilament protein-immunoreactive neurons) are correlated with overall neuronal density, whereas interneurons making transcolumnar connections (i.e., parvalbumin-immunoreactive neurons) do not exhibit such a relationship. These results suggest that differential scaling rules apply to different neuronal subtypes depending on their functional role in cortical circuitry. For example, cortical columns across catarrhine species appear to involve a similar conserved network of intracolumnar inhibitory interconnections, as represented by the distribution of calbindin- and calretinin-immunoreactive neurons. The subpopulation of horizontally-oriented wide-arbor interneurons, on the other hand, increases in density relative to other interneuron subpopulations in large brains. Due to these scaling trends, the region of orofacial representation of primary motor cortex in great apes and humans is characterized by a greater proportion of neurons enriched in neurofilament protein and parvalbumin compared to the Old World monkeys examined. These modifications might contribute to the voluntary dexterous control of orofacial muscles in great ape and human communication. Copyright 2004 S. Karger AG, Basel

  1. Suppression of amyloid beta A11 antibody immunoreactivity by vitamin C: possible role of heparan sulfate oligosaccharides derived from glypican-1 by ascorbate-induced, nitric oxide (NO)-catalyzed degradation.

    PubMed

    Cheng, Fang; Cappai, Roberto; Ciccotosto, Giuseppe D; Svensson, Gabriel; Multhaup, Gerd; Fransson, Lars-Åke; Mani, Katrin

    2011-08-05

    Amyloid β (Aβ) is generated from the copper- and heparan sulfate (HS)-binding amyloid precursor protein (APP) by proteolytic processing. APP supports S-nitrosylation of the HS proteoglycan glypican-1 (Gpc-1). In the presence of ascorbate, there is NO-catalyzed release of anhydromannose (anMan)-containing oligosaccharides from Gpc-1-nitrosothiol. We investigated whether these oligosaccharides interact with Aβ during APP processing and plaque formation. anMan immunoreactivity was detected in amyloid plaques of Alzheimer (AD) and APP transgenic (Tg2576) mouse brains by immunofluorescence microscopy. APP/APP degradation products detected by antibodies to the C terminus of APP, but not Aβ oligomers detected by the anti-Aβ A11 antibody, colocalized with anMan immunoreactivity in Tg2576 fibroblasts. A 50-55-kDa anionic, sodium dodecyl sulfate-stable, anMan- and Aβ-immunoreactive species was obtained from Tg2576 fibroblasts using immunoprecipitation with anti-APP (C terminus). anMan-containing HS oligo- and disaccharide preparations modulated or suppressed A11 immunoreactivity and oligomerization of Aβ42 peptide in an in vitro assay. A11 immunoreactivity increased in Tg2576 fibroblasts when Gpc-1 autoprocessing was inhibited by 3-β[2(diethylamino)ethoxy]androst-5-en-17-one (U18666A) and decreased when Gpc-1 autoprocessing was stimulated by ascorbate. Neither overexpression of Gpc-1 in Tg2576 fibroblasts nor addition of copper ion and NO donor to hippocampal slices from 3xTg-AD mice affected A11 immunoreactivity levels. However, A11 immunoreactivity was greatly suppressed by the subsequent addition of ascorbate. We speculate that temporary interaction between the Aβ domain and small, anMan-containing oligosaccharides may preclude formation of toxic Aβ oligomers. A portion of the oligosaccharides are co-secreted with the Aβ peptides and deposited in plaques. These results support the notion that an inadequate supply of vitamin C could contribute to late onset AD in humans.

  2. Cocaine- and amphetamine-regulated transcript peptide and calcium binding proteins immunoreactivity in the deep layers of the superior colliculus of the guinea pig: Implications for multisensory and visuomotor processing.

    PubMed

    Najdzion, Janusz

    2018-03-01

    The superior colliculus (SC) of mammals is a midbrain center, that can be subdivided into the superficial (SCs) and deep layers (SCd). In contrast to the visual SCs, the SCd are involved in multisensory and motor processing. This study investigated the pattern of distribution and colocalization of cocaine- and amphetamine-regulated transcript peptide (CART) and three calcium-binding proteins (CaBPs) i.e. calbindin (CB), calretinin (CR) and parvalbumin (PV) in the SCd of the guinea pig. CART labeling was seen almost exclusively in the neuropil and fibers, which differed in regard to morphology and location. CART-positive neurons were very rare and restricted to a narrow area of the SCd. The most intense CART immunoreactivity was observed in the most dorsally located sublayer of the SCd, which is anatomically and functionally connected with the SCs. CART immunoreactivity in the remaining SCd was less intensive, but still relatively high. This characteristic pattern of immunoreactivity indicates that CART as a putative neurotransmitter or neuromodulator may play an important role in processing of visual information, while its involvement in the auditory and visuomotor processing is less significant, but still possible. CaBPs-positive neurons were morphologically diverse and widely distributed throughout all SCd. From studied CaBPs, CR showed a markedly different distribution compared to CB and PV. Overall, the patterns of distribution of CB and PV were similar in the entire SCd. Consequently, the complementarity of these patterns in the guinea pig was very weak. Double immunostaining revealed that CART did not colocalize with either CaBPs, which suggested that these neurochemical substances might not coexist in the multisensory and visuomotor parts of the SC. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Assessment transcallosal Diaschisis in a model of focal cerebral ischemia in rats

    PubMed Central

    Muñoz Ospina, Beatriz Elena; Castaño, Daniel Manrique; Potes, Laura; Umbarila Prieto, John

    2016-01-01

    Objective: To evaluate transcallosal changes after a local ischemic injury in rats by using the monoclonal marker anti-NeuN (Mouse anti-neuronal nuclei). Methods: Twenty-eight adult, male, Wistar rats were subjected to focal injury in the right hemisphere. The technique used was the experimental model of focal ischemic injury through intraluminal suture of the middle cerebral artery. Analyses were made for the five groups: after the lesion (control), at 24 h, 96 h, 10 days and 20 days. Exofocal neuronal damage was inferred from neuronal immunoreactivity changes to NeuN. Results: In the cortex contralateral to the lesion, immunoreactivity was diminished. This finding was most notable in the supra-granular sheets 24 h post ischemia. After 96 h, there was a generalized diminishment of the inmmunoreactivity in the supra and infra-granular sheets. At 10 and 20 days, the tissue recovered some immunoreactivity to NeuN, but there were some changes in the VI layer. Conclusion: The immunoreactive changes to NeuN support the process of inter-hemispheric diaschisis. Changes in immunoreactivity could indicate metabolic stress secondary to the disruption in connectivity to the site of lesion. PMID:27546930

  4. Postmortem changes in the neuroanatomical characteristics of the primate brain: the hippocampal formation

    PubMed Central

    Lavenex, Pierre; Lavenex, Pamela Banta; Bennett, Jeffrey L.; Amaral, David G.

    2009-01-01

    Comparative studies of the structural organization of the brain are fundamental to our understanding of human brain function. However, whereas brains of experimental animals are fixed by perfusion of a fixative through the vasculature, human or ape brains are fixed by immersion after varying postmortem intervals. Although differential treatments might affect the fundamental characteristics of the tissue, this question has not been evaluated empirically in primate brains. Monkey brains were either perfused, or acquired after varying postmortem intervals before immersion-fixation in 4% paraformaldehyde. We found that the fixation method affected the neuroanatomical characteristics of the monkey hippocampal formation. Soma size was smaller in Nissl-stained, immersion-fixed tissue, although overall brain volume was larger, as compared to perfusion-fixed tissue. Non-phosphorylated high-molecular-weight neurofilament immunoreactivity was lower in CA3 pyramidal neurons, dentate mossy cells and the entorhinal cortex, whereas it was higher in the mossy fiber pathway in immersion-fixed tissue. Serotonin-immunoreactive fibers were well-stained in perfused tissue but were undetectable in immersion-fixed tissue. Although regional immunoreactivity patterns for calcium-binding proteins were not affected, intracellular staining degraded with increasing postmortem intervals. Somatostatin-immunoreactive clusters of large axonal varicosities, previously reported only in humans, were observed in immersion-fixed monkey tissue. In addition, calretinin-immunoreactive multipolar neurons, previously observed only in rodents, were found in the rostral dentate gyrus in both perfused and immersion-fixed brains. In conclusion, comparative studies of the brain must evaluate the effects of fixation on the staining pattern of each marker in every structure of interest before drawing conclusions about species differences. PMID:18972553

  5. Postmortem changes in the neuroanatomical characteristics of the primate brain: hippocampal formation.

    PubMed

    Lavenex, Pierre; Lavenex, Pamela Banta; Bennett, Jeffrey L; Amaral, David G

    2009-01-01

    Comparative studies of the structural organization of the brain are fundamental to our understanding of human brain function. However, whereas brains of experimental animals are fixed by perfusion of a fixative through the vasculature, human or ape brains are fixed by immersion after varying postmortem intervals. Although differential treatments might affect the fundamental characteristics of the tissue, this question has not been evaluated empirically in primate brains. Monkey brains were either perfused or acquired after varying postmortem intervals before immersion-fixation in 4% paraformaldehyde. We found that the fixation method affected the neuroanatomical characteristics of the monkey hippocampal formation. Soma size was smaller in Nissl-stained, immersion-fixed tissue, although overall brain volume was larger as compared to perfusion-fixed tissue. Nonphosphorylated high-molecular-weight neurofilament immunoreactivity was lower in CA3 pyramidal neurons, dentate mossy cells, and the entorhinal cortex, whereas it was higher in the mossy fiber pathway in immersion-fixed tissue. Serotonin-immunoreactive fibers were well stained in perfused tissue but were undetectable in immersion-fixed tissue. Although regional immunoreactivity patterns for calcium-binding proteins were not affected, intracellular staining degraded with increasing postmortem intervals. Somatostatin-immunoreactive clusters of large axonal varicosities, previously reported only in humans, were observed in immersion-fixed monkey tissue. In addition, calretinin-immunoreactive multipolar neurons, previously observed only in rodents, were found in the rostral dentate gyrus in both perfused and immersion-fixed brains. In conclusion, comparative studies of the brain must evaluate the effects of fixation on the staining pattern of each marker in every structure of interest before drawing conclusions about species differences.

  6. Effect of peptidase inhibition on the pattern of intraspinally released immunoreactive substance P detected with antibody microprobes.

    PubMed

    Duggan, A W; Schaible, H G; Hope, P J; Lang, C W

    1992-05-08

    Antibody microprobes bearing antibodies to the C-terminus of substance P (SP) were used to measure release of immunoreactive (ir) SP in the dorsal horn of barbiturate anaesthetized spinal cats. Electrical stimulation of unmyelinated primary afferents of the ipsilateral tibial nerve produced a relatively localised release of ir SP in the superficial dorsal horn. Prior microinjection of the peptidase inhibitors kelatorphan and enalaprilat in the dorsal horn resulted in ir SP being detected over the whole of the dorsal horn and the overlying dorsal column. This pattern had previously been observed with evoked release of ir neurokinin A and supports the proposal that a slow degradation results in a neuropeptide accessing many sites remote from sites of release.

  7. Antiphospholipid reactivity against cardiolipin metabolites occurring during endothelial cell apoptosis

    PubMed Central

    Alessandri, Cristiano; Sorice, Maurizio; Bombardieri, Michele; Conigliaro, Paola; Longo, Agostina; Garofalo, Tina; Manganelli, Valeria; Conti, Fabrizio; Esposti, Mauro Degli; Valesini, Guido

    2006-01-01

    We have recently shown that cardiolipin (CL) and its metabolites move from mitochondria to other cellular membranes during death receptor-mediated apoptosis. In this study, we investigate the immunoreactivity to CL derivatives occurring during endothelial apoptosis in patients with antiphospholipid syndrome (APS) and systemic lupus erythematosus (SLE). We compared the serum immunoreactivity to CL with that of its derivatives monolysocardiolipin (MCL), dilysocardiolipin (DCL), and hydrocardiolipin (HCL) by means of both enzyme-linked immunosorbent assay and thin-layer chromatography (TLC) immunostaining. In addition, we investigated the composition of phospholipid extracts from the plasma membrane of apoptotic endothelial cells and the binding of patients' sera to the surface of the same cells by using high-performance TLC and immunofluorescence analysis. The average reactivity to MCL was comparable with that of CL and significantly higher than that for DCL and HCL in patients studied, both in the presence or in the absence of beta2-glycoprotein I. Of relevance for the pathogenic role of these autoantibodies, immunoglobulin G from patients' sera showed an increased focal reactivity with the plasma membrane of endothelial cells undergoing apoptosis. Interestingly, the phospholipid analysis of these light membrane fractions showed an accumulation of both CL and MCL. Our results demonstrated that a critical number of acyl chains in CL derivatives is important for the binding of antiphospholipid antibodies and that MCL is an antigenic target with immunoreactivity comparable with CL in APS and SLE. Our finding also suggests a link between apoptotic perturbation of CL metabolism and the production of these antibodies. PMID:17150088

  8. Preparation and biological evaluation of (177)Lu conjugated PR81 for radioimmunotherapy of breast cancer.

    PubMed

    Salouti, Mojtaba; Babaei, Mohammad Hossein; Rajabi, Hossein; Rasaee, Mohammad javad

    2011-08-01

    PR81 is a monoclonal antibody that binds with high affinity to MUC1 antigen that is over expressed in 80% of breast cancers. In this study, we developed a method for indirect labeling of PR81 with lutetium-177 and performed all preclinical qualifications in production of a biologic agent for radioimmunotherapy of breast cancer. The radiochemical purity and in vitro stability of (177)Lu labeled PR81 was determined by instant thin layer chromatography. The immunoreactivity and cell toxicity of the complex were tested on MCF7 cell line. The biodistribution and scintigraphy studies were performed in BALB/c mice with breast tumor. The radiochemical purity was 91.2±3.8% after 2 h. The in vitro stabilities in phosphate buffer and human blood serum were 83.1±3.4% and 76.2±3.6% at 96 h, respectively. The immunoreactivity of the complex was 83.4±2.4%. The cell toxicity study showed that the complex inhibited 85.2±3.4% growth of MCF7 cells at a concentration of 2500 ng/ml after 96 h. The biodistribution and scintigraphy studies showed the accumulation of the complex at the site of tumors with high sensitivity and specificity. The results showed that one may consider (177)Lu-DOTA-PR81 as a potential radiopharmaceutical for therapy of human breast cancer, which needs further investigations. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. No differences in calcium-binding protein immunoreactivity in the posterior cingulate and visual cortex: schizophrenia and controls.

    PubMed

    Wheeler, David G; Dixon, Gavin; Harper, Clive G

    2006-06-01

    Schizophrenia-specific alterations in the densities of interneurons immunoreactive (ir) to the calcium binding proteins are reported for several cortical regions. However, no reported studies have searched for such differences within the posterior cingulate cortex using antibodies to a specific calcium binding protein, calbindin (Cb). Compare the (a) relative density of Cb-ir neurons (ratio of labeled neurons to total neurons), (b) relative width of cortical layers II/III and (c) somal areas of Cb-ir neurons in people with schizophrenia and non-psychiatric age-, gender- and postmortem index-matched controls (9 per group). Tissue from Brodmann's area (BA) 30 and 23 and an internal control region, the visual cortex (BA 18) were labeled with polyclonal Cb antibodies then Nissl counter-stained. Cb-ir neurons as well as counter-stained neurons with clearly visible nucleoli were plotted and counted within their area 1 and laminar boundaries. No qualitative or statistical differences in the relative density of Cb-ir neurons were observed. A trend towards a significant effect was detected in BA 30, the relative density of Cb-ir neurons for controls was greater than for schizophrenics (P=0.0518). There were no significant differences in the relative cortical widths or somal areas. The data from this study suggest that the posterior cingulate cortex may not be involved in schizophrenia, at least not as far as Cb-ir neurons are concerned.

  10. The Characterization of AT1 Expression in the Dorsal Root Ganglia After Chronic Constriction Injury.

    PubMed

    Oroszova, Zuzana; Hricova, Ludmila; Stropkovska, Andrea; Lukacova, Nadezda; Pavel, Jaroslav

    2017-04-01

    To clarify the role of Angiotensin II in the regulation of sensory signaling, we characterized the AT 1 expression in neuronal subpopulation of lower lumbar dorsal root ganglia under normal conditions and its alteration in neuropathic pain model. The characterization of AT 1 expression was done under control and after the chronic constriction injury induced by four loose ligatures of the sciatic nerve representing the model of posttraumatic painful peripheral neuropathy. Major Angiotensin II receptor type was expressed in approximately 43 % of small-sized and 62 % of large-sized neurons in control. The AT 1 overexpression after sciatic nerve ligation lasting 7 days was detected predominantly in small-sized AT 1 immunoreactive neurons (about 38 % increase). Chronic constriction injury caused a statistically marked increase in number of the small-sized peptidergic (CGRP immunoreactive) neuronal subpopulation expressing AT 1 (about 64 %). The subpopulations of AT 1 -immunoreactive and nonpeptide-containing primary sensory neurons revealed by IB4 binding, tyrosine hydroxylase- and parvalbumin-immunoreactive neurons were not markedly changed. Our results indicate that: (1) the AT 1 overexpression after the chronic constriction injury is an important factor in Angiotensin II-potentiated pain perception; (2) Angiotensin II is involved in pathological mechanisms of neuropathic pain and this effect can be mediated perhaps in combination with other neuropeptides synthesized in the primary sensory neurons.

  11. Changes in Binding of [(123)I]CLINDE, a High-Affinity Translocator Protein 18 kDa (TSPO) Selective Radioligand in a Rat Model of Traumatic Brain Injury.

    PubMed

    Donat, Cornelius K; Gaber, Khaled; Meixensberger, Jürgen; Brust, Peter; Pinborg, Lars H; Hansen, Henrik H; Mikkelsen, Jens D

    2016-06-01

    After traumatic brain injury (TBI), secondary injuries develop, including neuroinflammatory processes that contribute to long-lasting impairments. These secondary injuries represent potential targets for treatment and diagnostics. The translocator protein 18 kDa (TSPO) is expressed in activated microglia cells and upregulated in response to brain injury and therefore a potential biomarker of the neuroinflammatory processes. Second-generation radioligands of TSPO, such as [(123)I]CLINDE, have a higher signal-to-noise ratio as the prototype ligand PK11195. [(123)I]CLINDE has been employed in human studies using single-photon emission computed tomography to image the neuroinflammatory response after stroke. In this study, we used the same tracer in a rat model of TBI to determine changes in TSPO expression. Adult Sprague-Dawley rats were subjected to moderate controlled cortical impact injury and sacrificed at 6, 24, 72 h and 28 days post surgery. TSPO expression was assessed in brain sections employing [(123)I]CLINDE in vitro autoradiography. From 24 h to 28 days post surgery, injured animals exhibited a marked and time-dependent increase in [(123)I]CLINDE binding in the ipsilateral motor, somatosensory and parietal cortex, as well as in the hippocampus and thalamus. Interestingly, binding was also significantly elevated in the contralateral M1 motor cortex following TBI. Craniotomy without TBI caused a less marked increase in [(123)I]CLINDE binding, restricted to the ipsilateral hemisphere. Radioligand binding was consistent with an increase in TSPO mRNA expression and CD11b immunoreactivity at the contusion site. This study demonstrates the applicability of [(123)I]CLINDE for detailed regional and quantitative assessment of glial activity in experimental models of TBI.

  12. Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.

    PubMed

    Yu, J C; Pickard, J D; Davenport, A P

    1995-11-01

    1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD151242 competed for the binding of [125I]-ET-1 monophasically and analysis of the competition curves indicated that a one-site fit was preferred over a two-site model, implying that the cultures express mainly ETA receptors. 6. Although messenger RNA encoding both ETA and ETB receptors was detected, autoradiographical analysis, as well as binding studies indicate that human cultured brain smooth muscle cells express only ETA receptor protein. Antagonism of this sub-type may be necessary to block the actions of ET-1 in the human cerebral resistance vessels in the vasospasm observed subsequent to subarachnoid haemorrhage.

  13. The nuclear matrix protein NMP-1 is the transcription factor YY1.

    PubMed Central

    Guo, B; Odgren, P R; van Wijnen, A J; Last, T J; Nickerson, J; Penman, S; Lian, J B; Stein, J L; Stein, G S

    1995-01-01

    NMP-1 was initially identified as a nuclear matrix-associated DNA-binding factor that exhibits sequence-specific recognition for the site IV regulatory element of a histone H4 gene. This distal promoter domain is a nuclear matrix interaction site. In the present study, we show that NMP-1 is the multifunctional transcription factor YY1. Gel-shift and Western blot analyses demonstrate that NMP-1 is immunoreactive with YY1 antibody. Furthermore, purified YY1 protein specifically recognizes site IV and reconstitutes the NMP-1 complex. Western blot and gel-shift analyses indicate that YY1 is present within the nuclear matrix. In situ immunofluorescence studies show that a significant fraction of YY1 is localized in the nuclear matrix, principally but not exclusively associated with residual nucleoli. Our results confirm that NMP-1/YY1 is a ubiquitous protein that is present in both human cells and in rat osteosarcoma ROS 17/2.8 cells. The finding that NMP-1 is identical to YY1 suggests that this transcriptional regulator may mediate gene-matrix interactions. Our results are consistent with the concept that the nuclear matrix may functionally compartmentalize the eukaryotic nucleus to support regulation of gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7479833

  14. Postischemic changes in the immunophilin FKBP12 in the rat brain.

    PubMed

    Kato, H; Oikawa, T; Otsuka, K; Takahashi, A; Itoyama, Y

    2000-12-08

    An immunosuppressant tacrolimus (FK506) protects against neuronal damage following cerebral ischemia. On the other hand, the major physiological role of the immunophilin FK506-binding protein-12 (FKBP12) is a modulation of intracellular calcium flux. Since an increase in intracellular calcium concentration is a major mediator of ischemic neuronal death, we investigated the changes in FKBP12 following cerebral ischemia in the rat. We induced focal cerebral ischemia by intraluminal occlusion of the middle cerebral artery for 1 h, and global cerebral ischemia for 10 min by bilateral carotid artery occlusion combined with hypotension. The animals were killed at 4 h to 7 days after reperfusion. Immunohistochemistry was performed on paraffin sections using a monoclonal antibody raised against recombinant FKBP12. Immunoreactivity to FKBP12 in control brains was most pronounced in the CA1 subfield of the hippocampus and the striatum, the localization being primarily neuronal. Following focal ischemia, FKBP12 immunoreactivity decreased rapidly in the ischemic core by 4 h, but increased in surviving neurons in penumbra areas (4 h-7 days). Within an area of infarction, invading leukocytes and macrophages exhibited immunoreactivity to FKBP12 (3-7 days). Following global ischemia, FKBP12 immunoreactivity in CA1 neurons decreased after 1 day, and then it was lost between 2 and 7 days, although many CA1 neurons showed a transient increase in FKBP12 at 2 days. No FKBP12 immunoreactivity was observed in reactive glial cells. Thus, FKBP12 declined in dying neurons, whereas FKBP12 was upregulated in less severely injured neurons. The findings suggest that (1) FKBP12 plays an important role in the process of neuronal survival and death following cerebral ischemia, and (2) FKBP12 is involved in inflammatory reactions that occur within an area of infarction.

  15. Involvement of neuropeptide Y Y1 receptors in the regulation of neuroendocrine corticotropin-releasing hormone neuronal activity.

    PubMed

    Dimitrov, Eugene L; DeJoseph, M Regina; Brownfield, Mark S; Urban, Janice H

    2007-08-01

    The neuroendocrine parvocellular CRH neurons in the paraventricular nucleus (PVN) of the hypothalamus are the main integrators of neural inputs that initiate hypothalamic-pituitary-adrenal (HPA) axis activation. Neuropeptide Y (NPY) expression is prominent within the PVN, and previous reports indicated that NPY stimulates CRH mRNA levels. The purpose of these studies was to examine the participation of NPY receptors in HPA axis activation and determine whether neuroendocrine CRH neurons express NPY receptor immunoreactivity. Infusion of 0.5 nmol NPY into the third ventricle increased plasma corticosterone levels in conscious rats, with the peak of hormone levels occurring 30 min after injection. This increase was prevented by pretreatment with the Y1 receptor antagonist BIBP3226. Immunohistochemistry showed that CRH-immunoreactive neurons coexpressed Y1 receptor immunoreactivity (Y1r-ir) in the PVN, and a majority of these neurons (88.8%) were neuroendocrine as determined by ip injections of FluoroGold. Bilateral infusion of the Y1/Y5 agonist, [leu(31)pro(34)]NPY (110 pmol), into the PVN increased c-Fos and phosphorylated cAMP response element-binding protein expression and elevated plasma corticosterone levels. Increased expression of c-Fos and phosphorylated cAMP response element-binding protein was observed in populations of CRH/Y1r-ir cells. The current findings present a comprehensive study of NPY Y1 receptor distribution and activation with respect to CRH neurons in the PVN. The expression of NPY Y1r-ir by neuroendocrine CRH cells suggests that alterations in NPY release and subsequent activation of NPY Y1 receptors plays an important role in the regulation of the HPA.

  16. Cocaine- and amphetamine-regulated transcript and calcium binding proteins immunoreactivity in the subicular complex of the guinea pig.

    PubMed

    Wasilewska, Barbara; Najdzion, Janusz; Równiak, Maciej; Bogus-Nowakowska, Krystyna; Hermanowicz, Beata; Kolenkiewicz, Małgorzata; Żakowski, Witold; Robak, Anna

    2016-03-01

    In this study we present the distribution and colocalization pattern of cocaine- and amphetamine-regulated transcript (CART) and three calcium-binding proteins: calbindin (CB), calretinin (CR) and parvalbumin (PV) in the subicular complex (SC) of the guinea pig. The subiculum (S) and presubiculum (PrS) showed higher CART-immunoreactivity (-IR) than the parasubiculum (PaS) as far as the perikarya and neuropil were concerned. CART- IR cells were mainly observed in the pyramidal layer and occasionally in the molecular layer of the S. In the PrS and PaS, single CART-IR perikarya were dispersed, however with a tendency to be found only in superficial layers. CART-IR fibers were observed throughout the entire guinea pig subicular neuropil. Double-labeling immunofluorescence showed that CART-IR perikarya, as well as fibers, did not stain positively for any of the three CaBPs. CART-IR fibers were only located near the CB-, CR-, PV-IR perikarya, whereas CART-IR fibers occasionally intersected fibers containing one of the three CaBPs. The distribution pattern of CART was more similar to that of CB and CR than to that of PV. In the PrS, the CART, CB and CR immunoreactivity showed a laminar distribution pattern. In the case of the PV, this distribution pattern in the PrS was much less prominent than that of CART, CB and CR. We conclude that a heterogeneous distribution of the CART and CaBPs in the guinea pig SC is in keeping with findings from other mammals, however species specific differences have been observed. Copyright © 2015 Elsevier GmbH. All rights reserved.

  17. Dexamethasone upregulates ANP C-receptor protein in human mesangial cells without affecting mRNA.

    PubMed

    Ardaillou, N; Blaise, V; Placier, S; Amestoy, F; Ardaillou, R

    1996-03-01

    The objective of this study was to examine the role of dexamethasone on the expression of natriuretic peptide B-type and C-type receptors (ANPR-B and ANPR-C) in cultured human mesangial cells, which only possess these two subtypes. Dexamethasone caused concentration- and time-dependent increases in 125I-labeled ANP binding, which were prevented by glucocorticoid receptor inhibition with RU-38486. A lag time of 24 h and a concentration of dexamethasone of at least 1 nmol/l were necessary for this effect to occur. Dexamethasone-induced upregulation of 125I-ANP binding resulted from increased receptor density. No change in dissociation constant (Kd) was observed. Only ANPR-C were affected by dexamethasone. Indeed, dexamethasone did not modify C-type natriuretic peptide (i.e., CNP)-dependent cGMP production by mesangial cells. Moreover, dexamethasone upregulated ANPR-C protein expression as shown by Western blot analysis and by an increase in ANPR-C immunoreactivity at the cell surface. In contrast, dexamethasone did not modify ANPR-C mRNA expression. In conclusion, glucocorticoids increase ANPR-C density on mesangial cells through a mechanism implying, successively, interaction with the glucocorticoid receptor and increase of ANPR-C protein synthesis at a posttranscriptional stage. Thus dexamethasone may influence availability of natriuretic peptides at their glomerular target sites.

  18. Loss of calretinin immunoreactive fibers in subcortical visual recipient structures of the RCS dystrophic rat.

    PubMed

    Vugler, Anthony A; Coffey, Peter J

    2003-11-01

    The retinae of dystrophic Royal College of Surgeons (RCS) rats exhibit progressive photoreceptor degeneration accompanied by pathology of ganglion cells. To date, little work has examined the consequences of retinal degeneration for central visual structures in dystrophic rats. Here, we use immunohistochemistry for calretinin (CR) to label retinal afferents in the superior colliculus (SC), lateral geniculate nucleus, and olivary pretectal nucleus of RCS rats aged between 2 and 26 months of age. Early indications of fiber loss in the medial dystrophic SC were apparent between 9 and 13 months. Quantitative methods reveal a significant reduction in the level of CR immunoreactivity in visual layers of the medial dystrophic SC at 13 months (P < 0.02). In dystrophic animals aged 19-26 months the loss of CR fibers in SC was dramatic, with well-defined patches of fiber degeneration predominating in medial aspects of the structure. This fiber degeneration in SC was accompanied by increased detection of cells immunoreactive for CR. In several animals, regions of fiber loss were also found to contain strongly parvalbumin-immunoreactive cells. Loss of CR fibers was also observed in the lateral geniculate nucleus and olivary pretectal nucleus. Patterns of fiber loss in the dystrophic SC compliment reports of ganglion cell degeneration in these animals and the response of collicular neurons to degeneration is discussed in terms of plasticity of the dystrophic visual system and properties of calcium binding proteins.

  19. Immunohistochemical expression of c-KIT protein in feline soft tissue fibrosarcomas.

    PubMed

    Smith, A J; Njaa, B L; Lamm, C G

    2009-09-01

    C-KIT is the cellular homolog of the feline sarcoma viral oncogene v-KIT, which encodes the tyrosine kinase receptor protein KIT. Mutations and varied expression of this gene have been demonstrated within multiple neoplasms in people and domestic animals. The purpose of this study was to determine if KIT protein is expressed in feline soft tissue fibrosarcomas (ST FSA) using immunohistochemistry (IHC). The computer database at the Oklahoma Animal Disease Diagnostic Laboratory was searched from January 1, 2006, to December 31, 2007, for any domestic cat with an ST FSA. Routinely stained slides from 46 feline ST FSAs were reviewed and graded based on the scale outlined by Kuntz et al. Immunohistochemistry for KIT protein was performed on one representative section from each cat. There were a total of 12/46 (26%) cats that were immunoreactive for KIT. Immunoreactivity was detected in greater than 80% of the neoplastic cells in 4/46 (9%) cats. Immunoreactivity was detected in less than 10% of the neoplastic cells in 8/46 (17%) cats. Immunoreactivity was characterized by evenly distributed cytoplasmic stippling within the neoplastic spindle-shaped cells and/or multinucleated giant cells. Based on these results, KIT immunoreactivity can be detected within feline ST FSAs using IHC. The results of this study also indicate that KIT immunoreactivity in feline ST FSA does not correlate with the histologic grade (P = .141, X(2) = 2.166), survivability (P = .241, X(2) = 1.373), or whether the neoplasm was a spontaneous or an injection site FSA (P = .074, X(2) = 3.184).

  20. Gamma-aminobutyric acid and related molecules in the sea fan Eunicella cavolini (Cnidaria: Octocorallia): a biochemical and immunohistochemical approach.

    PubMed

    Girosi, Laura; Ferrando, Sara; Beltrame, Francesco; Ciarcia, Gaetano; Diaspro, Alberto; Fato, Marco; Magnone, Mirko; Raiteri, Luca; Ramoino, Paola; Tagliafierro, Grazia

    2007-07-01

    The aim of this study has been the biochemical demonstration of the presence of gamma-aminobutyric acid (GABA) in the Mediterranean sea fan Eunicella cavolini by means of high-performance liquid chromatography, and the description of the distribution pattern of GABA and its related molecules, glutamic acid decarboxylase (GAD), vesicular GABA transporter (VGAT) and one of the GABA receptors (GABA(B) R) by immunohistochemical methods. The interrelationships of GABA, GAD and GABA receptor immunoreactivity have been established by using double-immunohistochemical methods and confocal microscopy. The immunodetection of monoclonal and/or polyclonal antibodies has revealed GABA immunoreactivity throughout the polyp tissue, both in neuronal and non-neuronal elements. GAD immunoreactivity has been mostly localized in the neuronal compartment, contacting epithelial and muscular elements. GABA(B) R immunoreactivity appears particularly intense in the nematocytes and in the oocyte envelope; its presence in GAD-immunoreactive neurons in the tentacles suggests an autocrine type of regulation. Western blot analysis has confirmed that a GABA(B) R, with a molecular weight of 142 kDa, similar to that of rat brain, is present in E. cavolini polyp tissue. The identification of the sites of the synthesis, vesicular transport, storage and reception of GABA strongly suggests the presence of an almost complete set of GABA-related molecules for the functioning of the GABAergic system in this simple nervous system. The distribution of these different immunoreactivities has allowed us to hypothesize GABA involvement in nematocyst discharge, in body wall and enteric muscular contraction, in neuronal integration and in male gametocyte differentiation.

  1. Heterogeneity of chromatoid bodies in adult pluripotent stem cells of planarian Dugesia japonica.

    PubMed

    Kashima, Makoto; Kumagai, Nobuyoshi; Agata, Kiyokazu; Shibata, Norito

    2016-02-01

    The robust regenerative ability of planarians is known to be dependent on adult pluripotent stem cells called neoblasts. One of the morphological features of neoblasts is cytoplasmic ribonucleoprotein granules (chromatoid bodies: CBs), which resemble germ granules present in germline cells in other animals. Previously, we showed by immuno-electron microscopic analysis that DjCBC-1, a planarian Me31B/Dhh1/DDX6 homologue, which is a component of ribonucleoprotein granules, was localized in CBs in the planarian Dugesia japonica. Also, recently it was reported using another planarian species that Y12 antibody recognizing symmetrical dimethylarginine (sDMA) specifically binds to CBs in which histone mRNA is co-localized. Here, we showed by double immunostaining and RNA interference (RNAi) that DjCBC-1-containing CBs and Y12-immunoreactive CBs are distinct structures, suggesting that CBs are composed of heterogeneous populations. We also found that the Y12-immunoreactive CBs specifically contained a cytoplasmic type of planarian PIWI protein (DjPiwiC). We revealed by RNAi experiments that Y12-immunoreactive CBs may have anti-transposable element activity involving the DjPiwiC protein in the neoblasts. © 2016 Japanese Society of Developmental Biologists.

  2. Neuroprotective Effect of Ginseng against Alteration of Calcium Binding Proteins Immunoreactivity in the Mice Hippocampus after Radiofrequency Exposure

    PubMed Central

    Maskey, Dhiraj

    2013-01-01

    Calcium binding proteins (CaBPs) such as calbindin D28-k, parvalbumin, and calretinin are able to bind Ca2+ with high affinity. Changes in Ca2+ concentrations via CaBPs can disturb Ca2+ homeostasis. Brain damage can be induced by the prolonged electromagnetic field (EMF) exposure with loss of interacellular Ca2+ balance. The present study investigated the radioprotective effect of ginseng in regard to CaBPs immunoreactivity (IR) in the hippocampus through immunohistochemistry after one-month exposure at 1.6 SAR value by comparing sham control with exposed and ginseng-treated exposed groups separately. Loss of dendritic arborization was noted with the CaBPs in the Cornu Ammonis areas as well as a decrease of staining intensity of the granule cells in the dentate gyrus after exposure while no loss was observed in the ginseng-treated group. A significant difference in the relative mean density was noted between control and exposed groups but was nonsignificant in the ginseng-treated group. Decrease in CaBP IR with changes in the neuronal staining as observed in the exposed group would affect the hippocampal trisynaptic circuit by alteration of the Ca2+ concentration which could be prevented by ginseng. Hence, ginseng could contribute as a radioprotective agent against EMF exposure, contributing to the maintenance of Ca2+ homeostasis by preventing impairment of intracellular Ca2+ levels in the hippocampus. PMID:24069603

  3. Influence of different calcium supplies and a single vitamin D injection on vitamin D receptor and calbindin D9k immunoreactivities in the gastrointestinal tract of goat kids.

    PubMed

    Sidler-Lauff, K; Boos, A; Kraenzlin, M; Liesegang, A

    2010-11-01

    The purpose of this study was to investigate whether diets differing in Ca concentration would have an influence on vitamin D (VitD) receptor (VDR) and calbindin D9k (Calb9k) immunoreactivities in the gastrointestinal tract of growing goats. In addition, the effect of a single VitD injection was studied, to clarify whether exogenous VitD would further increase the active Ca absorption mechanisms. The hypothesis of the study was that reduced Ca intake would lead to greater active Ca absorption, and with that, to greater amounts of VDR and Calb9k immunoreactivities. The normal Ca kid group (according to age requirements) received 2.5 to 6 g of Ca/d, whereas the lesser Ca kid group (less than requirements) received 1.5 to 4 g of Ca/d from wk 6 (weaning) to 15 (slaughter). In addition, 5 and 6 goat kids, respectively, of each group (normal Ca kid group, lesser Ca kid group), were injected with VitD (0.05 mg of cholecalciferol/kg of BW) in wk 14 of life. Blood samples were taken in wk 14 and 15. Calcium and VitD (25-hydroxyvitamin D and 1,25-dihydroxyvitamin D) concentrations were determined in serum. Immediately after slaughter, the duodenum (DD) and rumen (RU) were mounted in conventional Ussing chambers. Unidirectional flux rates of Ca across gastrointestinal tissues were measured. Additionally, tissue specimens of the gastrointestinal tract were collected, and formaldehyde-fixed paraffin sections were used for VDR and Calb9k immunohistochemistry. In all kid groups, a net absorption in the RU and a net secretion of Ca in the DD were observed. Immunoreactions of VDR were greatest in the duodenal mucosa, whereas Calb9k immunoreactions were observed in the forestomach and intestinal tissues. The greatest expression was observed in the duodenal surface epithelium. Additionally, in the VitD-injected groups, an immunoreaction occurred in the jejunal superficial and basal glands and the ileal superficial epithelium. In contrast, the other groups showed no Calb9k immunoreactions at these sites. In conclusion, there is clear evidence for the RU as a main site for Ca absorption. The results of this study also indicate that VDR and Calb9k are highly expressed in the duodenal mucosa. The active absorption may not have such an important role in the DD because active transport was also evident in the RU. However, Calb9k expression seems to be stimulated by VitD administration.

  4. I1 Imidazoline Receptor: Novel Potential Cytoprotective Target of TVP1022, the S-Enantiomer of Rasagiline

    PubMed Central

    Frolov, Luba; Ovcharenko, Elena; Angel, Itzchak; Youdim, Moussa B. H.; Binah, Ofer

    2012-01-01

    TVP1022, the S-enantiomer of rasagiline (Azilect®) (N-propargyl-1R-aminoindan), exerts cyto/cardio-protective effects in a variety of experimental cardiac and neuronal models. Previous studies have demonstrated that the protective activity of TVP1022 and other propargyl derivatives involve the activation of p42/44 mitogen-activated protein kinase (MAPK) signaling pathway. In the current study, we further investigated the molecular mechanism of action and signaling pathways of TVP1022 which may account for the cyto/cardio-protective efficacy of the drug. Using specific receptor binding and enzyme assays, we demonstrated that the imidazoline 1 and 2 binding sites (I1 & I2) are potential targets for TVP1022 (IC50 = 9.5E-08 M and IC50 = 1.4E-07 M, respectively). Western blotting analysis showed that TVP1022 (1–20 µM) dose-dependently increased the immunoreactivity of phosphorylated p42 and p44 MAPK in rat pheochromocytoma PC12 cells and in neonatal rat ventricular myocytes (NRVM). This effect of TVP1022 was significantly attenuated by efaroxan, a selective I1 imidazoline receptor antagonist. In addition, the cytoprotective effect of TVP1022 demonstrated in NRVM against serum deprivation-induced toxicity was markedly inhibited by efaroxan, thus suggesting the importance of I1imidazoline receptor in mediating the cardioprotective activity of the drug. Our findings suggest that the I1imidazoline receptor represents a novel site of action for the cyto/cardio-protective efficacy of TVP1022. PMID:23166584

  5. I1 imidazoline receptor: novel potential cytoprotective target of TVP1022, the S-enantiomer of rasagiline.

    PubMed

    Barac, Yaron D; Bar-Am, Orit; Liani, Esti; Amit, Tamar; Frolov, Luba; Ovcharenko, Elena; Angel, Itzchak; Youdim, Moussa B H; Binah, Ofer

    2012-01-01

    TVP1022, the S-enantiomer of rasagiline (Azilect®) (N-propargyl-1R-aminoindan), exerts cyto/cardio-protective effects in a variety of experimental cardiac and neuronal models. Previous studies have demonstrated that the protective activity of TVP1022 and other propargyl derivatives involve the activation of p42/44 mitogen-activated protein kinase (MAPK) signaling pathway. In the current study, we further investigated the molecular mechanism of action and signaling pathways of TVP1022 which may account for the cyto/cardio-protective efficacy of the drug. Using specific receptor binding and enzyme assays, we demonstrated that the imidazoline 1 and 2 binding sites (I(1) & I(2)) are potential targets for TVP1022 (IC(50) =9.5E-08 M and IC(50) =1.4E-07 M, respectively). Western blotting analysis showed that TVP1022 (1-20 µM) dose-dependently increased the immunoreactivity of phosphorylated p42 and p44 MAPK in rat pheochromocytoma PC12 cells and in neonatal rat ventricular myocytes (NRVM). This effect of TVP1022 was significantly attenuated by efaroxan, a selective I(1) imidazoline receptor antagonist. In addition, the cytoprotective effect of TVP1022 demonstrated in NRVM against serum deprivation-induced toxicity was markedly inhibited by efaroxan, thus suggesting the importance of I(1)imidazoline receptor in mediating the cardioprotective activity of the drug. Our findings suggest that the I(1)imidazoline receptor represents a novel site of action for the cyto/cardio-protective efficacy of TVP1022.

  6. Cloning and characteristics of fish glial fibrillary acidic protein: implications for optic nerve regeneration.

    PubMed

    Cohen, I; Shani, Y; Schwartz, M

    1993-08-15

    Mammalian central nervous system neurons do not regenerate after axonal injury, unlike their counterparts in fish and amphibians. After axonal injury, glial cells in mammals do not support regrowth of axons, while in fish they support the regeneration process. Controversy exists as to whether or not the intact fish optic nerve expresses glial fibrillary acidic protein, a well-known marker for mature astrocytes, and thus whether its astrocytes differ in this respect from those of the brain and spinal cord, as well as from optic nerve astrocytes of other species. In an attempt to resolve this question we cloned fish glial fibrillary acidic protein. Two different complementary DNA clones were isolated from a carp brain complementary DNA library, each encoding a different form of glial fibrillary acidic protein apparently originating from different genes. Monospecific polyclonal antibodies were raised against a peptide synthesized according to the predicted amino acid sequence, and used to identify and localize the fish glial fibrillary acidic protein. Two glial fibrillary acidic proteins (of 49 kDa and 51 kDa) were identified by the antibodies in all tested fish central nervous system tissues. The antibodies were then used to examine glial fibrillary acidic protein immunoreactivity in sections taken from uninjured and injured optic nerves of goldfish. Injury was followed by an elevation in glial fibrillary acidic protein immunoreactivity along the whole length of the nerve, except at the site of the injury, where--as in the case of vimentin--no immunoreactivity was detectable. However, in contrast to vimentin-positive glial cells, which repopulate the site of the injury soon after the optic nerve is injured, glial fibrillary acidic protein-positive glial cells remained outside the injury site for as long as 6 weeks after the injury. Despite the injury-induced changes in glial fibrillary acidic protein immunoreactivity, no change was observed in the level of transcript encoding glial fibrillary acidic protein after injury, while there was an increase in the amount of glial fibrillary acidic protein associated with the cytoskeleton and a reduction in the soluble form. These results suggest that the injury-induced changes in immunoreactivity on sections involve changes not in transcription or translation of glial fibrillary acidic protein, but in glial fibrillary acidic protein compartmentalization.

  7. Rapid diagnosis of occult abscesses using sup 99m Tc-labeled monoclonal antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coons, T.A.; Rhodes, B.A.; Thakur, M.L.

    1991-01-01

    Acute infections, such as appendicitis and occult infections in AIDS patients, can be diagnosed within two hours by gamma scintigraphy after i.v. administration of {sup 99m}Tc labeled antibodies reactive with human granulocytes. The antibody, murine IgM anti-SSEA-1, is partially reduced using Sn(II) to expose and protect reactive sulfide groups. The antibody is then purified, stannous tartrate and stabilizers are added, and the mixture is lyophilized. To label, sodium pertechnetate is added. After a 15 minute incubation the tracer drug is injected. The rate of accumulation and degree of concentration at the site of infection is presumptively determinative of the severitymore » of the infection. Acceptance criteria and tests for the {sup 99m}Tc labeled antibody product have been established and validated. Greater than 93% of the {sup 99m}Tc is firmly bound to the protein as determined by quantitative HPLC. Radiochemical impurities, colloidal {sup 99m}Tc and free pertechnetate are together less than 4% as determined by thin layer chromatography. The immunoreactive fraction, measured by binding to solid phase antigen, and affinity measured be ELISA, are unchanged by the {sup 99m}Tc-direct labeling process. Two hour blood clearance in rats is within 90% of the value of the {sup 125}I labeled analog. The immunoreactive fraction decreases less than 10% when incubated in human plasma for 24 hours. This method has been compared to other direct labeling methods, and found to give higher radiochemical yields. 5 figs.« less

  8. Age-dependent differences in myelin basic protein expression in the hippocampus of young, adult and aged gerbils

    PubMed Central

    Ahn, Ji Hyeon; Lee, Tae-Kyeong; Park, Joon Ha; Cho, Jeong Hwi; Kim, In Hye; Lee, Jae Chul; Hong, Seongkweon; Jeon, Yong Hwan; Kang, Il Jun; Lee, Young Joo

    2017-01-01

    Myelin degeneration is one of the characteristics of aging and degenerative diseases. This study investigated age-related alterations in expression of myelin basic protein (MBP) in the hippocampal subregions (dentate gyrus, CA2/3 and CA1 areas) of gerbils of various ages; young (1 month), adult (6 months) and aged (24 months), using western blot and immunohistochemistry. Western blot results showed tendencies of age-related reductions of MBP levels. MBP immunoreactivity was significantly decreased with age in synaptic sites of trisynaptic loops, perforant paths, mossy fibers, and Schaffer collaterals. In particular, MBP immunoreactive fibers in the dentate molecular cell layer (perforant path) was significantly reduced in adult and aged subjects. In addition, MBP immunoreactive mossy fibers in the dentate polymorphic layer and in the CA3 striatum radiatum was significantly decreased in the aged group. Furthermore, we observed similar age-related alterations in the CA1 stratum radiatum (Schaffer collaterals). However, the density of MBP immunoreactive fibers in the dentate granular cell layer and CA stratum pyramidale was decreased with aging. These findings indicate that expression of MBP is age-dependent and tissue specific according to hippocampal layers. PMID:29046699

  9. Cell-specific expression of calcineurin immunoreactivity within the rat basolateral amygdala complex and colocalization with the neuropeptide Y Y1 receptor.

    PubMed

    Leitermann, Randy J; Sajdyk, Tammy J; Urban, Janice H

    2012-10-01

    Neuropeptide Y (NPY) produces potent anxiolytic effects via activation of NPY Y1 receptors (Y1r) within the basolateral amygdaloid complex (BLA). The role of NPY in the BLA was recently expanded to include the ability to produce stress resilience and long-lasting reductions in anxiety-like behavior. These persistent behavioral effects are dependent upon activity of the protein phosphatase, calcineurin (CaN), which has long been associated with shaping long-term synaptic signaling. Furthermore, NPY-induced reductions in anxiety-like behavior persist months after intra-BLA delivery, which together indicate a form of neuronal plasticity had likely occurred. To define a site of action for NPY-induced CaN signaling within the BLA, we employed multi-label immunohistochemistry to determine which cell types express CaN and if CaN colocalizes with the Y1r. We have previously reported that both major neuronal cell populations in the BLA, pyramidal projection neurons and GABAergic interneurons, express the Y1r. Therefore, this current study evaluated CaN immunoreactivity in these cell types, along with Y1r immunoreactivity. Antibodies against calcium-calmodulin kinase II (CaMKII) and GABA were used to identify pyramidal neurons and GABAergic interneurons, respectively. A large population of CaN immunoreactive cells displayed Y1r immunoreactivity (90%). Nearly all (98%) pyramidal neurons displayed CaN immunoreactivity, while only a small percentage of interneurons (10%) contained CaN immunoreactivity. Overall, these anatomical findings provide a model whereby NPY could directly regulate CaN activity in the BLA via activation of the Y1r on CaN-expressing, pyramidal neurons. Importantly, they support BLA pyramidal neurons as prime targets for neuronal plasticity associated with the long-term reductions in anxiety-like behavior produced by NPY injections into the BLA. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Neurokinin B-producing projection neurons in the lateral stripe of the striatum and cell clusters of the accumbens nucleus in the rat.

    PubMed

    Zhou, Ligang; Furuta, Takahiro; Kaneko, Takeshi

    2004-12-06

    Neurons producing preprotachykinin B (PPTB), the precursor of neurokinin B, constitute 5% of neurons in the dorsal striatum and project to the substantia innominata (SI) selectively. In the ventral striatum, PPTB-producing neurons are collected mainly in the lateral stripe of the striatum (LSS) and cell clusters of the accumbens nucleus (Acb). In the present study, we first examined the distribution of PPTB-immunoreactive neurons in rat ventral striatum and found that a large part of the PPTB-immunoreactive cell clusters was continuous to the LSS, but a smaller part was not. Thus, we divided the PPTB-immunoreactive cell clusters into the LSS-associated and non-LSS-associated ones. We next investigated the projection targets of the PPTB-producing ventral striatal neurons by combining immunofluorescence labeling and retrograde tracing. After injection of Fluoro-Gold into the basal component of the SI (SIb) and medial part of the interstitial nucleus of posterior limb of the anterior commissure, many PPTB-immunoreactive neurons were retrogradely labeled in the LSS-associated cell clusters and LSS, respectively. When the injection site included the ventral part of the sublenticular component of the SI(SIsl), retrogradely labeled neurons showed PPTB-immunoreactivity frequently in non-LSS-associated cell clusters. Furthermore, these PPTB-immunoreactive projections were confirmed by the double-fluorescence method after anterograde tracer injection into the ventral striatum containing the cell clusters. Since the dorsalmost part of the SIsl is known to receive strong inputs from PPTB-producing dorsal striatal neurons, the present results indicate that PPTB-producing ventral striatal neurons project to basal forebrain target regions in parallel with dorsal striatal neurons without significant convergence. 2004 Wiley-Liss, Inc.

  11. Vanillin improves scopolamine-induced memory impairment through restoration of ID1 expression in the mouse hippocampus

    PubMed Central

    Lee, Jae-Chul; Kim, In Hye; Cho, Jeong Hwi; Lee, Tae-Kyeong; Park, Joon Ha; Ahn, Ji Hyeon; Shin, Bich Na; Yan, Bing Chun; Kim, Jong-Dai; Jeon, Yong Hwan; Lee, Young Joo; Won, Moo-Ho; Kang, Il Jun

    2018-01-01

    4-Hydroxy-3-methoxybenzaldehyde (vanillin), contained in a number of species of plant, has been reported to display beneficial effects against brain injuries. In the present study, the impact of vanillin on scopolamine-induced alterations in cognition and the expression of DNA binding protein inhibitor ID-1 (ID1), one of the inhibitors of DNA binding/differentiation proteins that regulate gene transcription, in the mouse hippocampus. Mice were treated with 1 mg/kg scopolamine with or without 40 mg/kg vanillin once daily for 4 weeks. Scopolamine-induced cognitive impairment was observed from 1 week and was deemed to be severe 4 weeks following the administration of scopolamine. However, treatment with vanillin in scopolamine-treated mice markedly attenuated cognitive impairment 4 weeks following treatment with scopolamine. ID1-immunoreactive cells were revealed in the hippocampus of vehicle-treated mice, and were hardly detected 4 weeks following treatment with scopolamine. However, treatment with vanillin in scopolamine-treated mice markedly restored ID1-immunoreactive cells and expression 4 weeks subsequent to treatment. The results of the present study suggested that vanillin may be beneficial for cognitive impairment, by preventing the reduction of ID1 expression which may be associated with cognitive impairment. PMID:29328430

  12. An electro-active system of immuno-assay (EASI assay) utilising self assembled monolayer modified electrodes.

    PubMed

    Porter, R; van der Logt, P; Howell, S; Kyröläinen-Reay, M; Badley, A

    2001-12-01

    Most immunoassays currently rely on optical methods for signal generation e.g. in ELISA and rapid assay formats. It has become apparent as in the Glucose sensor market that there is a need for simple direct electrical immuno-sensors. We have investigated the novel use of organic conducting monolayers used as a direct electrochemical detection support for an immuno-reaction. It was found that antibodies raised to a carbazole dimer monolayer could increase the charge movement across that monolayer surface. Antibody fragments were taken from a specific anti-carbazole antibody fragment library and combined with an antibody fragment directed to the hormone estrone 3 glucuronide (E3G), the target antigen to form a bispecific antibody fragment. The device utilised these specific antibody fragments and incorporated them on the top plate of a capillary fill format as the immuno-assay components. The immuno-reaction utilised a competition assay. Free E3G analyte in the sample displaced the bispecific antibody fragment from the immuno-surface leaving it free to bind the carbazole monolayer surface. There the binding was detected using amperometric or coulometric methods. By combining all there element it was possible to develop a sensitive immuno-assay that could detect E3G in a reproducible calibrated fashion down to 10 ng/ml.

  13. Effects of Maillard reaction on allergenicity of buckwheat allergen Fag t 3 during thermal processing.

    PubMed

    Yang, Zhen-Huang; Li, Chen; Li, Yu-Ying; Wang, Zhuan-Hua

    2013-04-01

    Fag t 3 is a major allergenic protein in tartary buckwheat. The Maillard reaction commonly occurs in food processing, but few studies have been conducted on the influence of thermal processing on the allergenic potential of buckwheat allergen. The aim of the present study was to investigate the effects of autologous plant polysaccharides on the immunoreactivity of buckwheat Fag t 3 (11S globulin) following the Maillard reaction. Fag t 3 and crude polysaccharides were prepared from tartary buckwheat (Fagopyrum tataricum) flour. After heating, the polysaccharides were covalently linked to Fag t 3 via a Maillard reaction, and the IgE/IgG-binding properties of Fag t 3 decreased dramatically, with significant changes also being observed in the electrophoretic mobility, secondary structure and solubility of the glycated Fag t 3. The great influence of glycation on IgE/IgG binding to Fag t 3 was correlated with a significant change in the structure and epitopes of the allergenic protein. These data indicated that conjugation of polysaccharides to Fag t 3 markedly reduced the allergen's immunoreactivity. Glycation that occurs via the Maillard reaction during the processing of buckwheat food may be an efficient method to reduce Fag t 3 allergenicity. © 2012 Society of Chemical Industry.

  14. Radioimmunoassay of neuropeptide Y.

    PubMed

    Allen, J M; Yeats, J C; Adrian, T E; Bloom, S R

    1984-01-01

    The development of a radioimmunoassay to the newly isolated peptide, neuropeptide Y is described. Four separate antisera have been developed using different immunisation schedules. Two of these antisera (YNI and YNIO) are directed to the C-terminal region of the peptide and cross-react with the related peptide PYY, whereas YN7 is specific being directed to the N-terminal region of NPY, YN6 is similarly specific for NPY, but is unable to bind the available fragments. These four antisera provide similar results for determination of NPY immunoreactivity within porcine brain extracts, however YN6 consistently undervalues all extracts from the other species examined (human, rat, guinea pig, cat and mouse). Chromatographic analysis by means of reverse phase high pressure liquid chromatography (HPLC) shows that NPY immunoreactivity of human extracts elutes in an earlier position than the porcine standard. It seems likely therefore that human and porcine NPY differ in their amino acid sequences.

  15. Calbindin-D28k immunoreactivity is a marker for a subdivision of the sexually dimorphic nucleus of the preoptic area of the rat: developmental profile and gonadal steroid modulation.

    PubMed

    Sickel, M J; McCarthy, M M

    2000-05-01

    Calbindin-D28k (calbindin) is a 28 kilodalton calcium binding protein which potentially plays a role in neuroprotection. We report here the normal development and gonadal steroid modulation of a sexually dimorphic group of calbindin immunoreactive cells within the sexually dimorphic nucleus of the preoptic area (SDN) which we call the calbindin-immunoreactive SDN or CALB-SDN. Beginning on PN2, a faintly immunoreactive CALB-SDN is present, however, the volume is not sexually dimorphic. On PN4, the staining of the CALB-SDN appears more robust but the volume is still not sexually dimorphic. By PN8 and extending through PN12 and PN26, the latest age analysed, the volume of the CALB-SDN is larger in males by two- to fourfold. Cresyl violet counterstain reveals a similar developmental profile of the SDN as well as clusters of darkly staining calbindin immunonegative cells which lie around the CALB-SDN. Castration of males on PN0 decreases the volume of the CALB-SDN by PN12 and administration on the day of birth and PN1 of either testosterone propionate or oestradiol benzoate, but not dihydrotestosterone propionate to females increases the volume of the CALB-SDN by PN12. By demonstrating the sexual dimorphism and gonadal steroid modulation of the CALB-SDN, we hereby establish that calbindin is a specific marker of a subdivision of the SDN and can be used as such in future studies.

  16. Glucose Transporter-1 Distribution in Fibrotic Lung Disease

    PubMed Central

    Malide, Daniela; Yao, Jianhua; Nathan, Steven D.; Rosas, Ivan O.; Gahl, William A.; Moss, Joel; Gochuico, Bernadette R.

    2013-01-01

    Background: [18F]-2-fluoro-2-deoxyglucose (FDG)-PET scan uptake is increased in areas of fibrosis and honeycombing in patients with idiopathic pulmonary fibrosis (IPF). Glucose transporter-1 (Glut-1) is known to be the main transporter for FDG. There is a paucity of data regarding the distribution of Glut-1 and the cells responsible for FDG binding in fibrotic lung diseases. Methods: We applied immunofluorescence to localize Glut-1 in normal, IPF, and Hermansky-Pudlak syndrome (HPS) pulmonary fibrosis lung tissue specimens as well as an array of 19 different lung neoplasms. In addition, we investigated Glut-1 expression in inflammatory cells from BAL fluid (BALF) from healthy volunteers, subjects with IPF, and subjects with HPS pulmonary fibrosis. Results: In normal lung tissue, Glut-1 immunoreactivity was seen on the surface of erythrocytes. In tissue sections from fibrotic lung diseases (IPF and HPS pulmonary fibrosis), Glut-1 immunoreactivity was present on the surface of erythrocytes and inflammatory cells. BALF inflammatory cells from healthy control subjects showed no immunoreactivity; BALF cells from subjects with IPF and HPS pulmonary fibrosis showed Glut-1 immunoreactivity associated with neutrophils and alveolar macrophages. Conclusions: Glut-1 transporter expression in normal lung is limited to erythrocytes. In fibrotic lung, erythrocytes and inflammatory cells express Glut-1. Together, these data suggest that FDG-PET scan uptake in IPF could be explained by enhanced inflammatory and erythrocytes uptake due to neovascularization seen in IPF and not an upregulation of metabolic rate in pneumocytes. Thus, FDG-PET scan may detect inflammation and neovascularization in lung fibrosis. PMID:23699745

  17. Increased serotonin axons (immunoreactive to 5-HT transporter) in postmortem brains from young autism donors.

    PubMed

    Azmitia, Efrain C; Singh, Jorawer S; Whitaker-Azmitia, Patricia M

    2011-06-01

    Imaging studies of serotonin transporter binding or tryptophan retention in autistic patients suggest that the brain serotonin system is decreased. However, treatment with drugs which increase serotonin (5-HT) levels, specific serotonin reuptake inhibitors (SSRIs), commonly produce a worsening of the symptoms. In this study we examined 5-HT axons that were immunoreactive to a serotonin transporter (5-HTT) antibody in a number of postmortem brains from autistic patients and controls with no known diagnosis who ranged in age from 2 to 29 years. Fine, highly branched, and thick straight fibers were found in forebrain pathways (e.g. medial forebrain bundle, stria terminalis and ansa lenticularis). Many immunoreactive varicose fine fibers were seen in target areas (e.g. globus pallidus, amygdala and temporal cortex). Morphometric analysis of the stained axons at all ages studied indicated that the number of serotonin axons was increased in both pathways and terminal regions in cortex from autism donors. Our findings provide morphological evidence to warrant caution when using serotonin enhancing drugs (e.g. SSRIs and receptor agonist) to treat autistic children. This article is part of a Special Issue entitled 'Trends in neuropharmacology: in memory of Erminio Costa'. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Schistosoma mansoni P-glycoprotein levels increase in response to praziquantel exposure and correlate with reduced praziquantel susceptibility.

    PubMed

    Messerli, Shanta M; Kasinathan, Ravi S; Morgan, William; Spranger, Stefani; Greenberg, Robert M

    2009-09-01

    One potential physiological target for new antischistosomals is the parasite's system for excretion of wastes and xenobiotics. P-glycoprotein (Pgp), a member of the ATP-binding-cassette superfamily of proteins, is an ATP-dependent efflux pump involved in transport of toxins and xenobiotics from cells. In vertebrates, increased expression of Pgp is associated with multidrug resistance in tumor cells. Pgp may also play a role in drug resistance in helminths. In this report, we examine the relationship between praziquantel (PZQ), the current drug of choice against schistosomiasis, and Pgp expression in Schistosoma mansoni. We show that levels of RNA for SMDR2, a Pgp homolog from S. mansoni, increase transiently in adult male worms following exposure to sub-lethal concentrations (100-500 nM) of PZQ. A corresponding, though delayed, increase in anti-Pgp immunoreactive protein expression occurs in adult males following exposure to PZQ. The level of anti-Pgp immunoreactivity in particular regions of adult worms also increases in response to PZQ. Adult worms from an Egyptian S. mansoni isolate with reduced sensitivity to PZQ express increased levels of SMDR2 RNA and anti-Pgp-immunoreactive protein, perhaps indicating a role for multidrug resistance proteins in development or maintenance of PZQ resistance.

  19. Schistosoma mansoni P-glycoprotein levels increase in response to praziquantel exposure and correlate with reduced praziquantel susceptibility

    PubMed Central

    Messerli, Shanta M.; Kasinathan, Ravi S.; Morgan, William; Spranger, Stefani; Greenberg, Robert M.

    2009-01-01

    One potential physiological target for new antischistosomals is the parasite’s system for excretion of wastes and xenobiotics. P-glycoprotein (Pgp), a member of the ATP-binding cassette superfamily of proteins, is an ATP-dependent efflux pump involved in transport of toxins and xenobiotics from cells. In vertebrates, increased expression of Pgp is associated with multidrug resistance in tumor cells. Pgp may also play a role in drug resistance in helminths. In this report, we examine the relationship between praziquantel (PZQ), the current drug of choice against schistosomiasis, and Pgp expression in Schistosoma mansoni. We show that levels of RNA for SMDR2, a Pgp homolog from S. mansoni, increase transiently in adult male worms following exposure to sublethal concentrations (100 – 500 nM) of PZQ. A corresponding, though delayed, increase in anti-Pgp immunoreactive protein expression occurs in adult males following exposure to PZQ. The level of anti-Pgp immunoreactivity in particular regions of adult worms also increases in response to PZQ. Adult worms from an Egyptian S. mansoni isolate with reduced sensitivity to PZQ express increased levels of SMDR2 RNA and anti-Pgp-immunoreactive protein, perhaps indicating a role for multidrug resistance proteins in development or maintenance of PZQ resistance. PMID:19406169

  20. Effect of bombesin and cholecystokinin on plasma immunoreactive trypsin in humans.

    PubMed

    de Jong, A J; Klamer, M; Jansen, J B; Hopman, W P; Lamers, C B

    1987-01-01

    Since bombesin is a potent stimulus of the release of cholecystokinin (CCK), it has been suggested that the stimulatory effect of bombesin on pancreatic enzyme secretion is mediated by CCK. The present study was undertaken to determine the role of CCK in the bombesin-induced stimulation of plasma immunoreactive trypsin. Plasma CCK was measured by radioimmunoassay using the antibody T204, which binds to all biologically active sulfated COOH-terminal CCK-peptides. Plasma trypsin was also measured by radioimmunoassay. Infusion of 5 ng/kg/min bombesin in 6 healthy volunteers increased plasma CCK from 1.2 +/- 0.2-8.9 +/- 0.7 pM (p less than 0.0001). The peak increment in plasma CCK during bombesin (9.3 +/- 0.6 pM) was accompanied by a significant rise in plasma trypsin from 206 +/- 21-334 +/- 44 ng/ml (p less than 0.01). However, when similar increases in plasma CCK were achieved by infusion of 0.018 CU/kg/min CCK-33 (9.9 +/- 0.8 pM) or by intraduodenal instillation of 250 ml 20% Intralipid (9.7 +/- 1.9 pM), no significant changes in plasma trypsin were observed. It is therefore concluded that the stimulatory effect of bombesin on plasma immunoreactive trypsin is not mediated by CCK.

  1. Immunization Against Specific Fragments of Neurotrophin p75 Receptor Protects Forebrain Cholinergic Neurons in the Olfactory Bulbectomized Mice

    PubMed Central

    Bobkova, Natalia; Vorobyov, Vasily; Medvinskaya, Natalia; Nesterova, Inna; Tatarnikova, Olga; Nekrasov, Pavel; Samokhin, Alexander; Deev, Alexander; Sengpiel, Frank; Koroev, Dmitry; Volpina, Olga

    2016-01-01

    Alzheimer’s disease (AD) is characterized by progressive cognitive impairment associated with marked cholinergic neuron loss and amyloid-β (Aβ) peptide accumulation in the brain. The cytotoxicity in AD is mediated, at least in part, by Aβ binding with the extracellular domain of the p75 neurotrophin receptor (p75NTR), localized predominantly in the membranes of acetylcholine-producing neurons in the basal forebrain. Hypothesizing that an open unstructured loop of p75NTR might be the effective site for Aβ binding, we have immunized both olfactory bulbectomized (OBX) and sham-operated (SO) mice (n = 82 and 49, respectively) with synthetic peptides, structurally similar to different parts of the loops, aiming to block them by specific antibodies. OBX-mice have been shown in previous studies, and confirmed in the present one, to be characterized by typical behavioral, morphological, and biochemical AD hallmarks, including cholinergic deficits in forebrain neurons. Immunization of OBX- or SO-mice with KLH conjugated fragments of p75NTR induced high titers of specific serum antibodies for each of nine chosen fragments. However, maximal protective effects on spatial memory, evaluated in a Morris water maze, and on activity of choline acetyltransferase in forebrain neurons, detected by immunoreactivity to specific antibodies, were revealed only for peptides with amino acid residue sequences of 155–164 and 167–176. We conclude that the approach based on immunological blockade of specific p75NTR sites, linked with the cytotoxicity, is a useful and effective tool for study of AD-associated mechanisms and for development of highly selective therapy of cholinergic malfunctioning in AD patients. PMID:27163825

  2. The RNA binding and transport proteins staufen and fragile X mental retardation protein are expressed by rat primary afferent neurons and localize to peripheral and central axons.

    PubMed

    Price, T J; Flores, C M; Cervero, F; Hargreaves, K M

    2006-09-15

    Neuronal proteins have been traditionally viewed as being derived solely from the soma; however, accumulating evidence indicates that dendritic and axonal sites are capable of a more autonomous role in terms of new protein synthesis. Such extra-somal translation allows for more rapid, on-demand regulation of neuronal structure and function than would otherwise be possible. While mechanisms of dendritic RNA transport have been elucidated, it remains unclear how RNA is trafficked into the axon for this purpose. Primary afferent neurons of the dorsal root (DRG) and trigeminal (TG) ganglia have among the longest axons in the neuraxis and such axonal protein synthesis would be advantageous, given the greater time involved for protein trafficking to occur via axonal transport. Therefore, we hypothesized that these primary sensory neurons might express proteins involved in RNA transport. Rat DRG and TG neurons expressed staufen (stau) 1 and 2 (detected at the mRNA level) and stau2 and fragile x mental retardation protein (FMRP; detected at the protein level). Stau2 mRNA was also detected in human TG neurons. Stau2 and FMRP protein were localized to the sciatic nerve and dorsal roots by immunohistochemistry and to dorsal roots by Western blot. Stau2 and FMRP immunoreactivities colocalized with transient receptor potential channel type 1 immunoreactivity in sensory axons of the sciatic nerve and dorsal root, suggesting that these proteins are being transported into the peripheral and central terminals of nociceptive sensory axons. Based on these findings, we propose that stau2 and FMRP proteins are attractive candidates to subserve RNA transport in sensory neurons, linking somal transcriptional events to axonal translation.

  3. THE RNA BINDING AND TRANSPORT PROTEINS STAUFEN AND FRAGILE X MENTAL RETARDATION PROTEIN ARE EXPRESSED BY RAT PRIMARY AFFERENT NEURONS AND LOCALIZE TO PERIPHERAL AND CENTRAL AXONS

    PubMed Central

    PRICE, T. J.; FLORES, C. M.; CERVERO, F.; HARGREAVES, K. M.

    2007-01-01

    Neuronal proteins have been traditionally viewed as being derived solely from the soma; however, accumulating evidence indicates that dendritic and axonal sites are capable of a more autonomous role in terms of new protein synthesis. Such extra-somal translation allows for more rapid, on-demand regulation of neuronal structure and function than would otherwise be possible. While mechanisms of dendritic RNA transport have been elucidated, it remains unclear how RNA is trafficked into the axon for this purpose. Primary afferent neurons of the dorsal root (DRG) and trigeminal (TG) ganglia have among the longest axons in the neuraxis and such axonal protein synthesis would be advantageous, given the greater time involved for protein trafficking to occur via axonal transport. Therefore, we hypothesized that these primary sensory neurons might express proteins involved in RNA transport. Rat DRG and TG neurons expressed staufen (stau) 1 and 2 (detected at the mRNA level) and stau2 and fragile × mental retardation protein (FMRP; detected at the protein level). Stau2 mRNA was also detected in human TG neurons. Stau2 and FMRP protein were localized to the sciatic nerve and dorsal roots by immunohistochemistry and to dorsal roots by Western blot. Stau2 and FMRP immunoreactivities colocalized with transient receptor potential channel type 1 immunoreactivity in sensory axons of the sciatic nerve and dorsal root, suggesting that these proteins are being transported into the peripheral and central terminals of nociceptive sensory axons. Based on these findings, we propose that stau2 and FMRP proteins are attractive candidates to subserve RNA transport in sensory neurons, linking somal transcriptional events to axonal translation. PMID:16809002

  4. Abhydrolase domain containing 2, an androgen target gene, promotes prostate cancer cell proliferation and migration.

    PubMed

    Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi

    2016-04-01

    The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Release of neuropeptide FF (FLFQPQRF-NH2) from rat spinal cord.

    PubMed

    Zhu, J; Jhamandas, K; Yang, H Y

    1992-10-02

    Neuropeptide FF (FLFQPQRF-NH2), originally isolated from bovine brain, is an FMRF-NH2-like peptide with morphine-modulating activity. Neuropeptide FF (NPFF) is highly localized in the dorsal spinal cords where there are also specific NPFF binding sites. Furthermore, there have been studies indicating that NPFF may participate in the regulation of pain threshold in the spinal cord. However, whether NPFF can be released from the spinal cord is not known. The present experiments, using an in vitro superfusion of an isolated whole rat spinal cord, demonstrated that high concentrations of KCl or substance P caused a release of NPFF immunoreactive material (IR) from the spinal cord into the perfusion medium in a calcium-dependent manner. Substance P (1-11) also produced a detectable release of NPFF-IR in vivo although the response was quite variable. The released NPFF-IR was analyzed by an HPLC study and found to consist of NPFF and other minor immunoreactive peptides. Further studies with substance P-related peptides showed that the in vitro release of NPFF-IR could also be induced by substance P (1-7) but not by [pGlu5,Me-Phe8,Sar9]-substance P (5-11) or substance K. These results suggest that the specific substance P receptor (SP-N), which is recognized by both substance P (1-11) and substance P (1-7) rather than the tachykinin receptor, is involved in NPFF secretion from the spinal cord. In view of the role of substance P (1-11) and substance P (1-7) in sensory transmission, the results of this study further support the role of NPFF in the modulation of antinociception in the spinal cord.

  6. Development of [⁶⁴Cu]-DOTA-PR81 radioimmunoconjugate for MUC-1 positive PET imaging.

    PubMed

    Alirezapour, Behrouz; Rasaee, Mohammad Javad; Jalilian, Amir Reza; Rajabifar, Saeed; Mohammadnejad, Javad; Paknejad, Malihe; Maadi, Ehsan; Moradkhani, Sedigheh

    2016-01-01

    Breast cancer radioimmunoscintigraphy targeting MUC1 expression is a growing field of work in nuclear medicine research. PR81 is a monoclonal antibody that binds with high affinity to MUC1, which is over expressed on breast tumors. In this study, we report production, quality control and preclinical qualifications of a copper-64 labeled PR81 for PET imaging of breast cancer. PR81 was conjugated with DOTA-NHS-ester and purified by molecular filtration followed by chelate:mAb ratio determination by spectrophotometric method. DOTA-PR81 was labeled with (64)Cu followed by radiochemical purity, in vitro stability, in vitro internalization and immunoreactivity determination. The tissue biodistribution of the (64)Cu-DOTA-PR81 and (64)Cu-DOTA-hIgG was evaluated in BALB/c mice with breast carcinoma tumors using tissue counting and imaging. The radiochemical purity of radioimmunoconjugate was >95±1.9% (ITLC) (specific activity; 4.6 μCi/μg). The average number of chelators per antibody was 3.4±0.3:1. The (64)Cu-DOTA-PR81 showed immunoreactivity towards MUC1 antigen and MCF7 cell line with significant in vitro stability (>89% in PBS and 78±0.5% in human serum) over 48 h. Maximum internalized activity of radiolabeled PR81 in 4-8 h was 81.5%. The biodistribution and scintigraphy studies showed the accumulation of the complex at the site of tumors with high sensitivity and specificity compared to control probes. The results showed that (64)Cu-DOTA-PR81 may be considered as a potential PET tracer for diagnosis and follow-up of MUC1 expression in oncology. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Polyvalent immunoglobulin binding is an obstacle to accurate measurement of specific antibodies with ELISA despite inclusion of blocking agents.

    PubMed

    Loeffler, David A; Klaver, Andrea C

    2017-11-01

    Specific antibody concentrations are frequently measured in serum (and plasma and intravenous immunoglobulin) samples by enzyme-linked immunosorbent assay (ELISA). The standard negative control involves incubation of buffer alone on antigen-coated wells. The immunoreactivity that develops in antigen-coated wells in which diluted serum has been incubated is assumed to represent specific antibody binding. This approach can result in marked overestimation of specific antibody levels, because serum contains specific polyvalent antibodies which bind, primarily with low affinity, to multiple antigens (including those on ELISA plates) despite the use of blocking agents. Non-denaturing purification of serum IgG, followed by assessment of the antigen binding or antigen-binding affinity of this purified IgG, can reduce but not eliminate the problem of polyvalent antibody binding in indirect ELISAs. Alternatively, polyvalent antibody binding can be estimated by incubating a diluted serum sample on wells coated with an irrelevant protein (such as bovine serum albumin or a scrambled peptide sequence) or buffer alone, then subtracting this reactivity from the sample's binding to wells coated with the antigen of interest. Polyvalent binding of immunoglobulins must be accounted for in order to obtain accurate ELISA measurements of serum, plasma, or intravenous immunoglobulin antibodies. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. High-resolution immunogold localization of AMPA type glutamate receptor subunits at synaptic and non-synaptic sites in rat hippocampus.

    PubMed

    Baude, A; Nusser, Z; Molnár, E; McIlhinney, R A; Somogyi, P

    1995-12-01

    The cellular and subcellular localization of the GluRA, GluRB/C and GluRD subunits of the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) type glutamate receptor was determined in the rat hippocampus using polyclonal antipeptide antibodies in immunoperoxidase and immunogold procedures. For the localization of the GluRD subunit a new polyclonal antiserum was developed using the C-terminal sequence of the protein (residues 869-881), conjugated to carrier protein and absorbed to colloidal gold for immunization. The purified antibodies immunoprecipitated about 25% of 3[H]AMPA binding activity from the hippocampus, cerebellum or whole brain, but very little from neocortex. These antibodies did not precipitate a significant amount of 3[H]kainate binding activity. The antibodies also recognize the GluRD subunit, but not the other AMPA receptor subunits, when expressed in transfected COS-7 cells and only when permeabilized with detergent, indicating an intracellular epitope. All subunits were enriched in the neuropil of the dendritic layers of the hippocampus and in the molecular layer of the dentate gyrus. The cellular distribution of the GluRD subunit was studied more extensively. The strata radiatum, oriens and the dentate molecular layer were more strongly immunoreactive than the stratum lacunosum moleculare, the stratum lucidum and the hilus. However, in the stratum lucidum of the CA3 area and in the hilus the weakly reacting dendrites were surrounded by immunopositive rosettes, shown in subsequent electron microscopic studies to correspond to complex dendritic spines. In the stratum radiatum, the weakly reacting apical dendrites contrasted with the surrounding intensely stained neuropil. The cell bodies of pyramidal and granule cells were moderately reactive. Some non-principal cells and their dendrites in the pyramidal cell layer and in the alveus also reacted very strongly for the GluRD subunit. At the subcellular level, silver intensified immunogold particles for the GluRA, GluRB/C and GluRD subunits were present at type 1 synaptic membrane specializations on dendritic spines of pyramidal cells throughout all layers of the CA1 and CA3 areas. The most densely labelled synapses tended to be on the largest spines and many smaller spines remained unlabelled. Immunoparticle density at type 1 synapses on dendritic shafts of some non-principal cells was consistently higher than at labelled synapses of dendritic spines of pyramidal cells. Synapses established between dendritic spines and mossy fibre terminals, were immunoreactive for all studied subunits in stratum lucidum of the CA3 area. The postembedding immunogold method revealed that the AMPA type receptors are concentrated within the main body of the anatomically defined type 1 (asymmetrical) synaptic junction. Often only a part of the membrane specialization showed clustered immunoparticles. There was a sharp decrease in immunoreactive receptor density at the edge of the synaptic specialization. Immunolabelling was consistently demonstrated at extrasynaptic sites on dendrites, dendritic spines and somata. The results demonstrate that the GluRA, B/C and D subunits of the AMPA type glutamate receptor are present in many of the glutamatergic synapses formed by the entorhinal, CA3 pyramidal and mossy fibre terminals. Some interneurons have a higher density of AMPA type receptors in their asymmetrical afferent synapses than pyramidal cells. This may contribute to a lower activation threshold of interneurons as compared to principal cells by the same afferents in the hippocampal formation.

  9. Protein adsorption/desorption and antibody binding stoichiometry on silicon interferometric biosensors examined with TOF-SIMS

    NASA Astrophysics Data System (ADS)

    Gajos, Katarzyna; Budkowski, Andrzej; Petrou, Panagiota; Pagkali, Varvara; Awsiuk, Kamil; Rysz, Jakub; Bernasik, Andrzej; Misiakos, Konstantinos; Raptis, Ioannis; Kakabakos, Sotirios

    2018-06-01

    Time-of-flight secondary ion mass spectrometry has been employed to examine, with biomolecular discrimination, sensing arm areas (20 μm × 600 μm) of integrated onto silicon chips Mach-Zehnder interferometers aiming to optimize their biofunctionalization with regard to indirect immunochemical (competitive) detection of ochratoxin A. Sensing areas are examined after: modification with (3-aminopropyl)triethoxysilane, spotting of OTA-ovalbumin conjugate (probe) from solutions with different concentration, blocking with bovine serum albumin, reaction with OTA-specific mouse monoclonal antibody followed by goat anti-mouse IgG secondary antibody. Component mass loadings of all proteins involved in immunodetection are determined from TOF-SIMS micro-analysis combined with ellipsometry of planar surfaces. These data show that partial desorption of surface-bound probe and blocking protein takes place upon primary immunoreaction to a degree that depends on probe concentration in spotting solution. Taking into account this desorption, apparent binding stoichiometry of both antibodies in immune complexes formed onto chip surface is determined more accurately than the respective evaluation based on real-time sensor response. In addition, mass loadings for probe and secondary antibody is observed to saturate for optimum probe concentrations. Also, principal component analysis of TOF-SIMS data could resolve both immunoreactions and biofunctionalization and discriminate surfaces prepared with optimum probe concentrations from those prepared using suboptimum ones.

  10. Overexpression of Receptor for Advanced Glycation End Products and High-Mobility Group Box 1 in Human Dental Pulp Inflammation

    PubMed Central

    Tancharoen, Salunya; Tengrungsun, Tassanee; Suddhasthira, Theeralaksna; Kikuchi, Kiyoshi; Vechvongvan, Nuttavun; Maruyama, Ikuro

    2014-01-01

    High mobility group box 1 (HMGB1), a nonhistone DNA-binding protein, is released into the extracellular space and promotes inflammation. HMGB1 binds to related cell signaling transduction receptors, including receptor for advanced glycation end products (RAGE), which actively participate in vascular and inflammatory diseases. The aim of this study was to examine whether RAGE and HMGB1 are involved in the pathogenesis of pulpitis and investigate the effect of Prevotella intermedia (P. intermedia) lipopolysaccharide (LPS) on RAGE and HMGB1 expression in odontoblast-like cells (OLC-1). RAGE and HMGB1 expression levels in clinically inflamed dental pulp were higher than those in healthy dental pulp. Upregulated expression of RAGE was observed in odontoblasts, stromal pulp fibroblasts-like cells, and endothelial-like cell lining human pulpitis tissue. Strong cytoplasmic HMGB1 immunoreactivity was noted in odontoblasts, whereas nuclear HMGB1 immunoreactivity was seen in stromal pulp fibroblasts-like cells in human pulpitis tissue. LPS stimulated OLC-1 cells produced HMGB1 in a dose-dependent manner through RAGE. HMGB1 translocation towards the cytoplasm and secretion from OLC-1 in response to LPS was inhibited by TPCA-1, an inhibitor of NF-κB activation. These findings suggest that RAGE and HMGB1 play an important role in the pulpal immune response to oral bacterial infection. PMID:25114379

  11. Brain metastasis of crystal-deficient, CD68-positive alveolar soft part sarcoma: ultrastructural features and differential diagnosis

    PubMed Central

    Cykowski, Matthew D.; Hicks, John; Sandberg, David I.; Olar, Adriana; Bridge, Julia A.; Greipp, Patricia T.; Navarro, Patricia; Kolodziej, Steven; Bhattacharjee, Meenakshi B.

    2014-01-01

    We report a case of alveolar soft part sarcoma (ASPS) presenting as an isolated frontal lobe metastasis. The tumor demonstrated little or no immunoreactivity for a broad panel of antibodies yet strong, diffuse immunoreactivity with CD68. On electron microscopy, characteristic rectangular to rhomboid crystalline inclusions were not present. Electron-dense granules resembling peroxisomes were present, sometimes in association with elongated granular structures having a periodic, lattice-like arrangement. Metastatic ASPS was confirmed by demonstration of an ASPSCR1-TFE3 fusion and imaging studies that excluded metastatic Xp11.2 translocation renal cell carcinoma. The primary site was subsequently identified in the lower extremity. PMID:25268941

  12. Deficient RNA-editing enzyme ADAR2 in an amyotrophic lateral sclerosis patient with a FUS(P525L) mutation.

    PubMed

    Aizawa, Hitoshi; Hideyama, Takuto; Yamashita, Takenari; Kimura, Takashi; Suzuki, Naoki; Aoki, Masashi; Kwak, Shin

    2016-10-01

    Mutations in the fused in sarcoma (FUS) gene can cause amyotrophic lateral sclerosis (ALS), and FUS gene mutations have been reported in sporadic ALS patients with basophilic cytoplasmic inclusions. Deficiency of adenosine deaminase acting on RNA 2 (ADAR2), an enzyme that specifically catalyzes GluA2 Q/R site-editing, has been reported in considerable proportions of spinal motor neurons of the majority of sporadic ALS patients. We describe the relationship between GluA2 Q/R site-editing efficiency and FUS-positive inclusions in a patient with FUS(P525L). A 24-year-old woman with ALS presented with basophilic cytoplasmic inclusions, significantly reduced GluA2 Q/R site-editing efficiency in the spinal motor neurons, and markedly decreased ADAR2 mRNA levels. Neuropathologic examination showed that not all spinal motor neurons expressed ADAR2 and revealed FUS-positive cytoplasmic inclusions in motor neurons irrespective of ADAR2 immunoreactivity. There were no phosphorylated transactive response (TAR) DNA-binding protein 43 kDa (TDP-43)-positive inclusions, indicating that there was no tight correlation between ADAR2 deficiency and TDP-43 deposition. ADAR2 deficiency can occur in ALS patients with a FUS(P525L) mutation and is unrelated to the presence of FUS-positive inclusions. FUS-associated ALS may share neurodegenerative characteristics with classical sporadic ALS. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Immunogenic proteins of Brucella abortus to minimize cross reactions in brucellosis diagnosis.

    PubMed

    Ko, Kyung Yuk; Kim, Jong-Wan; Her, Moon; Kang, Sung-Il; Jung, Suk Chan; Cho, Dong Hee; Kim, Ji-Yeon

    2012-05-04

    To overcome the limitations of serological diagnosis, including false positive reactions caused by other pathogens, specific antigens for diagnosis of brucellosis other than LPS have been required. The present study was conducted to separate and identify immuno-dominant insoluble proteins of Brucella abortus against the antisera of cattle infected with B. abortus, or/and Yersinia enterocolitica, or the sera of non-infected cattle. After separating insoluble proteins of B. abortus by two dimensional electrophoresis (2-DE), their immuno-reactivity was determined by western blotting. A portion of the immunogenic spots against the positive antisera of B. abortus that have the potential for use as specific antigens were identified by MS/MS analysis. Overall, 18 immunogenic insoluble proteins of B. abortus 1119-3 showed immuno-reactivity against only the positive antisera of B. abortus, but failed to have immunogenicity toward both the positive sera of Y. enterocolitica and the negative sera of B. abortus. Identification of these proteins revealed the following: F0F1 ATP synthase subunit β, solute-binding family 5 protein, 28 kDa OMP, Leu/Ile/Val-binding family protein, Histidinol dehyddrogenase, Hypothetical protein, Twin-arginine translocation pathway signal sequence domain-containing protein, Dihydroorotase, Serine protease family protein, β-hydroxyacyl-(acyl-carrier-protein) dehydratase FabA, Short-chain dehydrogenase-/reductase carbonic anhydrase, Orinithine carbamoyltransferase, Leucyl aminopeptidase, Cold shock DNA-binding domain-containing protein, Cu/Zn superoxide dismutase, and Methionine aminopeptidase. The 18 immunogenic proteins separated in the present study can be considered candidate antigens to minimize cross reaction in the diagnosis of brucellosis and useful sources for Brucella vaccine development. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Effects of beta-phenylethylamine on the hypothalamo-pituitary-adrenal axis in the male rat.

    PubMed

    Kosa, E; Marcilhac-Flouriot, A; Fache, M P; Siaud, P

    2000-11-01

    beta-Phenylethylamine (PEA) is a trace neuroactive amine implicated in the regulation of the hypothalamic-pituitary-adrenal (HPA) response to stress. To test this hypothesis, effects of subchronic levels of PEA (50 mg/kg/day treatment for 10 days) on the corticotroph function were studied. PEA treatment induces: (i) a significant increase of corticotrophin releasing hormone (CRH) immunoreactivity in the median eminence (ME), as measured by semi-quantitative immunofluorescence labeling techniques, (ii) a significant increase in CRH mRNA levels in paraventricular nuclei, as detected by in situ hybridization, and (iii) an increase in plasma adreno-corticotrophin hormone (ACTH) and corticosterone levels in responses to stress. PEA treatment has no effect on the number of binding sites and on the dissociation constant of the glucocorticoid receptors in any structure studied. Results of the dexamethasone suppression test were similar in PEA- and saline-treated rats. Taken together, these results suggest that PEA treatment stimulated the HPA axis activity levels directly via the CRH hypothalamic neurons, without altering the negative feed back control exerted by the glucocorticoids.

  15. Rapid isolation of choriocapillary endothelial cells by Lycopersicon esculentum-coated Dynabeads.

    PubMed

    Hoffmann, S; Spee, C; Murata, T; Cui, J Z; Ryan, S J; Hinton, D R

    1998-10-01

    In vitro studies of choroidal endothelial cells may be critical for understanding the pathogenesis of neovascularization in age-related macular degeneration, since endothelial cells from different sites are highly heterogeneous in their morphology and behavior. Isolation of choroidal endothelial cells is complicated and labor intensive because of the small size of the choroid and the difficulty of excluding contaminating cells. We describe a rapid, simplified method for the isolation of bovine choroidal endothelial cells using microdissection followed by the use of superparamagnetic beads (Dynabeads) coated with the endothelial cell-specific lectin Lycopersicon esculentum, which selectively binds to fucose residues on the endothelial cell surface. Cells bound to beads are isolated using a magnetic particle concentrator. Isolated cells grew to confluence in a monolayer with a cobblestone morphology and were shown to be endothelial cells by their greater than 95% immunoreactivity to von Willebrand factor and phagocytosis of dil-acetylated LDL. Isolated cells grew as tubes in three-dimensional cultures. This method markedly reduces the time needed for pure culture of cells and makes the in vitro study of choroidal endothelial cells practical and reproducible.

  16. Increased (/sup 125/I)trypsin-binding in serum from cystic fibrosis patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cox, K.L.; Frates, R.C. Jr.; Sheikholislam, B.M.

    1982-01-01

    The capacities of normal and cystic fibrosis (CF) sera to bind to exogenous human (/sup 125/I)trypsin were compared. Sera from eight older CF patients bound significantly more exogenous human (/sup 125/I)trypsin than did sera from eight normal subjects (p less than 0.001). Disregarding the increased trypsin-binding (TB) of CF sera, serum immunoreactive trypsinogen (SIRT) levels were not detectable in these eight older CF patients. However, when SIRT levels were corrected for TB, four CF patients had normal SIRT concentrations and four had low but detectable SIRT levels. As compared to five normal newborns' sera, serum from a newborn with CFmore » had normal TB and the SIRT levels were very high. In conclusion, increased TB in CF serum lowers results of SIRT assays. Therefore, unless SIRT levels are corrected for TB, results obtained from currently available SIRT kits may be invalid.« less

  17. Rat Sertoli cells acquire a beta-adrenergic response during primary culture.

    PubMed Central

    Kierszenbaum, A L; Spruill, W A; White, M G; Tres, L L; Perkins, J P

    1985-01-01

    Two-dimensional polyacrylamide gel electrophoresis and the radioligand (-)-[125I]iodopindolol (125I-Pin) have been used to study isoproterenol-dependent protein phosphorylation and beta-adrenergic receptor availability, respectively, in cultured Sertoli cells and freshly isolated seminiferous tubular segments of sexually immature and mature rats. Sertoli cells prepared from sexually immature rats show progressive 125I-Pin binding in primary cultures that correlates with isoproterenol-induced cell shape changes, redistribution of immunoreactive vimentin, and phosphorylation of this intermediate filament protein. The development of 125I-Pin binding to Sertoli cell lysates is blocked by cycloheximide. Seminiferous tubules do not show significant isoproterenol-dependent vimentin phosphorylation nor 125I-Pin binding. However, vimentin phosphorylation can be induced by follicle-stimulating hormone or a cyclic nucleotide analog. This study stresses the need for correlating pharmacological-induced responses observed in Sertoli cell primary cultures with those in the intact seminiferous tubule. Images PMID:2984678

  18. Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frankfurt, O.S.

    A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

  19. FUS immunogold labelling TEM analysis of the neuronal cytoplasmic inclusions of neuronal intermediate filament inclusion disease: a frontotemporal lobar degeneration with FUS proteinopathy

    PubMed Central

    Page, Tristan; Gitcho, Michael A.; Mosaheb, Sabrina; Carter, Deborah; Chakraverty, Sumi; Perry, Robert H.; Bigio, Eileen H.; Gearing, Marla; Ferrer, Isidre; Goate, Alison M.; Cairns, Nigel J.; Thorpe, Julian R.

    2012-01-01

    Fused in sarcoma (FUS)-immunoreactive neuronal and glial inclusions define a novel molecular pathology called FUS proteinopathy. FUS has been shown to be a component of inclusions of familial amyotrophic lateral sclerosis with FUS mutation and three FTLD entities, including neuronal intermediate filament inclusion disease (NIFID). The pathogenic role of FUS is unknown. In addition to FUS, many neuronal cytoplasmic inclusions (NCI) of NIFID contain aggregates of α-internexin and neurofilament proteins. Herein, we have: (1) shown that FUS becomes relatively insoluble in NIFID and there are no post-translational modifications; (2) shown there are no pathogenic abnormalities in the FUS gene in NIFID; (3) performed an immunoelectron microscopy analysis of the precise localizations of FUS in NIFID, as this has not previously been described. FUS localized to euchromatin, and strongly with paraspeckles, in nuclei, consistent with its RNA/DNA-binding functions. NCI of varying morphologies were observed. Most frequent were the ‘loosely aggregated cytoplasmic inclusions’ (LACI), 81% of which had moderate or high levels of FUS-immunoreactivity. Much rarer ‘compact cytoplasmic inclusions’ (CCI) and ‘Tangled twine ball inclusions’ (TTBI) were FUS-immunoreactive at their granular peripheries, or heavily FUS-positive throughout, respectively. Thus FUS may aggregate in the cytoplasm and then admix with neuronal intermediate filament accumulations. PMID:21603978

  20. Evaluation and Characterization of Fasciola hepatica Tegument Protein Extract for Serodiagnosis of Human Fascioliasis

    PubMed Central

    Morales, Adelaida

    2012-01-01

    Tegument protein extract from Fasciola hepatica adult flukes (FhTA) was obtained and assessed for its potential as a diagnostic agent for the serological detection of human fascioliasis using an indirect enzyme-linked immunosorbent assay (ELISA). In an analysis of sera from 45 patients infected with F. hepatica, sera from 41 patients with other parasitic infections, and sera from 33 healthy controls, the FhTA-ELISA showed sensitivity, specificity, and accuracy of 91.1%, 97.3%, and 95%, respectively. Specific IgG1 and IgG4 were the antibody isotypes mainly detected in sera from patients with fascioliasis. Polypeptides of 52, 38, 24 to 26, and 12 to 14 kDa were identified by Western blotting as the most immunoreactive components of the FhTA. A proteomic approach led us to identify enolase, aldolase, glutathione S-transferase, and fatty acid binding protein as the major immunoreactive components of the FhTA. PMID:23015645

  1. Localization of the calcium channel subunits Cav1.2 (alpha1C) and Cav2.3 (alpha1E) in the mouse organ of Corti.

    PubMed

    Waka, N; Knipper, M; Engel, J

    2003-10-01

    Voltage-activated Ca2+ channels play an important role in synaptic transmission, signal processing and development. The immunohistochemical localization of Cav1.2 (alpha1C) and Cav2.3 (alpha1E) Ca2+ channels was studied in the developing and adult mouse organ of Corti using subunit-specific antibodies and fluorescent secondary antibodies with cochlear cryosections. Cav1.2 immunoreactivity has been detected from postnatal day 14 (P14) onwards at the synapses between cholinergic medial efferents and outer hair cells as revealed by co-staining with anti-synaptophysin and anti-choline acetyltransferase. Most likely the Cav1.2 immunoreactivity was located presynaptically at the site of contact of the efferent bouton with the outer hair cell which suggests a role for class C L-type Ca2+ channels in synaptic transmission of the medial efferent system. The localization of the second Ca2+ channel tested, Cav2.3, showed a pronounced change during cochlear development. From P2 until P10, Cav2.3 immunoreactivity was found in the outer spiral bundle followed by the inner spiral bundle, efferent endings and by medial efferent fibers. Around P14, Cav2.3 immunoreactivity disappeared from these structures and from P19 onwards it was observed in the basal poles of the outer hair cell membranes.

  2. TDP-43 and ubiquitinated cytoplasmic aggregates in sporadic ALS are low frequency and widely distributed in the lower motor neuron columns independent of disease spread

    PubMed Central

    Bodansky, Aaron; Kim, Jae Mun ‘Hugo’; Tempest, Lynne; Velagapudi, Amit; Libby, Ryan; Ravits, John

    2010-01-01

    Abstract Ubiqitinated and TDP-43 immunoreactive cytoplasmic aggregates are hallmark features of ALS molecular pathology. Since clinically most ALS begins focally and advances contiguously, it is important to characterize their distribution. Our objective was to determine the extent and distribution of TDP-43 immunoreactive aggregates in the lower motor neuron columns as a function of disease onset, and to correlate ubiquitinated with TDP-43 aggregates in the lumbar region. We examined TDP-43 cytoplasmic aggregates at four separate neuraxis levels – hypoglossal nucleus and cervical, thoracic, and lumbar anterior horns – in five controls and 20 sporadic ALS nervous systems from patients whose disease began in various sites, i.e. five bulbar, five arm, five trunk, and five leg onsets. We correlated ubiquitinated to TDP-43 aggregates on adjacent histological sections for the lumbar regions. We found that TDP-43 cytoplasmic aggregates are seen in about 8% of motor neurons but there is marked variability between nervous systems, ranging from 0.4% to 20.6%. The aggregates are uniformly distributed within individual nervous systems. There is no obvious correlation between site of disease onset and rate of spread. Almost all ubiquitinated aggregates correlate to TDP-43 aggregates. Thus, TDP-43 immunoreactive cytoplasmic aggregates have a low overall average frequency that does not correlate with either disease course or clinical spread and is the prime ubiquitinated protein. PMID:20225928

  3. Differential co-localization with choline acetyltransferase in nervus terminalis suggests functional differences for GnRH isoforms in bonnethead sharks (Sphyrna tiburo)

    PubMed Central

    Moeller, John F.; Meredith, Michael

    2010-01-01

    The nervus terminalis (NT) is a vertebrate cranial nerve whose function in adults is unknown. In bonnethead sharks the nerve is anatomically independent of the olfactory system, with two major cell populations within one or more ganglia along its exposed length. Most cells are immunoreactive for either gonadotropin-releasing hormone (GnRH) or RFamide-like peptides. To define further the cell populations and connectivity, we used double-label immuno-cytochemistry with antisera to different isoforms of GnRH and to choline acetyltransferase (ChAT). The labeling patterns of two GnRH antisera revealed different populations of GnRH immunoreactive (ir) cell-profiles in the NT ganglion. One antiserum labeled a large group of cells and fibers, which likely contain mammalian GnRH (GnRH-I) as described in previous studies, and which were ChAT immunoreactive. The other antiserum labeled large club-like structures, which were anuclear, and a sparse number of fibers, but with no clear labeling of cell bodies in the ganglion. These club structures were choline acetyltrasferase (ChAT) negative, and preabsorption control tests suggest they may contain chicken-GnRH-II (GnRH-II) or dogfish GnRH. The second major NT ganglion cell-type was immunoreactive for RF-amides, which regulate GnRH release in other vertebrates, and may provide an intraganglionic influence on GnRH release. The immunocytochemical and anatomical differences between the two GnRH immunoreactive profile types indicate possible functional differences for these isoforms in the NT. The club-like structures may be sites of GnRH release into the general circulation since these structures were observed near blood vessels and resembled structures seen in the median eminence of rats. PMID:20950589

  4. Differential co-localization with choline acetyltransferase in nervus terminalis suggests functional differences for GnRH isoforms in bonnethead sharks (Sphyrna tiburo).

    PubMed

    Moeller, John F; Meredith, Michael

    2010-12-17

    The nervus terminalis (NT) is a vertebrate cranial nerve whose function in adults is unknown. In bonnethead sharks, the nerve is anatomically independent of the olfactory system, with two major cell populations within one or more ganglia along its exposed length. Most cells are immunoreactive for either gonadotropin-releasing hormone (GnRH) or RF-amide-like peptides. To define further the cell populations and connectivity, we used double-label immunocytochemistry with antisera to different isoforms of GnRH and to choline acetyltransferase (ChAT). The labeling patterns of two GnRH antisera revealed different populations of GnRH-immunoreactive (ir) cell profiles in the NT ganglion. One antiserum labeled a large group of cells and fibers, which likely contain mammalian GnRH (GnRH-I) as described in previous studies and which were ChAT immunoreactive. The other antiserum labeled large club-like structures, which were anuclear, and a sparse number of fibers, but with no clear labeling of cell bodies in the ganglion. These club structures were choline acetyltrasferase (ChAT)-negative, and preabsorption control tests suggest they may contain chicken-GnRH-II (GnRH-II) or dogfish GnRH. The second major NT ganglion cell-type was immunoreactive for RF-amides, which regulate GnRH release in other vertebrates, and may provide an intraganglionic influence on GnRH release. The immunocytochemical and anatomical differences between the two GnRH-immunoreactive profile types indicate possible functional differences for these isoforms in the NT. The club-like structures may be sites of GnRH release into the general circulation since these structures were observed near blood vessels and resembled structures seen in the median eminence of rats. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Dopamine- and Tyrosine Hydroxylase-Immunoreactive Neurons in the Brain of the American Cockroach, Periplaneta americana

    PubMed Central

    Hamanaka, Yoshitaka; Minoura, Run; Nishino, Hiroshi; Miura, Toru; Mizunami, Makoto

    2016-01-01

    The catecholamine dopamine plays several vital roles in the central nervous system of many species, but its neural mechanisms remain elusive. Detailed neuroanatomical characterization of dopamine neurons is a prerequisite for elucidating dopamine’s actions in the brain. In the present study, we investigated the distribution of dopaminergic neurons in the brain of the American cockroach, Periplaneta americana, using two antisera: 1) an antiserum against dopamine, and 2) an antiserum against tyrosine hydroxylase (TH, an enzyme required for dopamine synthesis), and identified about 250 putatively dopaminergic neurons. The patterns of dopamine- and TH-immunoreactive neurons were strikingly similar, suggesting that both antisera recognize the same sets of “dopaminergic” neurons. The dopamine and TH antibodies intensively or moderately immunolabeled prominent brain neuropils, e.g. the mushroom body (memory center), antennal lobe (first-order olfactory center) and central complex (motor coordination center). All subdivisions of the mushroom body exhibit both dopamine and TH immunoreactivity. Comparison of immunolabeled neurons with those filled by dye injection revealed that a group of immunolabeled neurons with cell bodies near the calyx projects into a distal region of the vertical lobe, which is a plausible site for olfactory memory formation in insects. In the antennal lobe, ordinary glomeruli as well as macroglomeruli exhibit both dopamine and TH immunoreactivity. It is noteworthy that the dopamine antiserum labeled tiny granular structures inside the glomeruli whereas the TH antiserum labeled processes in the marginal regions of the glomeruli, suggesting a different origin. In the central complex, all subdivisions excluding part of the noduli and protocerebral bridge exhibit both dopamine and TH immunoreactivity. These anatomical findings will accelerate our understanding of dopaminergic systems, specifically in neural circuits underlying aversive memory formation and arousal, in insects. PMID:27494326

  6. Estradiol and progesterone regulate the expression of insulin-like growth factor-I receptor and insulin-like growth factor binding protein-2 in the hypothalamus of adult female rats.

    PubMed

    Cardona-Gómez, G P; Chowen, J A; Garcia-Segura, L M

    2000-06-05

    Gonadal hormones interact with insulin-like growthfactor-I (IGF-I) to regulate synaptic plasticity during the estrous cycle in the rat mediobasal hypothalamus. It has been proposed that tanycytes, specialized glial cells lining the ventral region of the third ventricle, may regulate the availability of IGF-I to hypothalamic neurons. IGF-I levels in tanycytes fluctuate during the estrous cycle. Furthermore, estrogen administration to ovariectomized rats increases IGF-I levels in tanycytes, while progesterone, injected simultaneously with estrogen, blocks the estrogen-induced increase of IGF-I levels in tanycytes. To test whether hormonal regulation of IGF-I receptor (IGF-IR) and IGF binding protein-2 (IGFBP-2) may be involved in the accumulation of IGF-I in tanycytes, we assessed the effect of ovarian hormones on the levels of these molecules in the mediobasal hypothalamus of adult female rats. Ovariectomized animals were treated with either oil, estrogen, progesterone, or estrogen and progesterone simultaneously and then killed 6 or 24 h later. Some neurons, some astrocytes, and many tanycytes in the mediobasal hypothalamus were found by confocal microscopy to be immunoreactive for IGF-IR. IGFBP-2 immunoreactivity was restricted almost exclusively to tanycytes and ependymal cells and was colocalized with IGF-IR immunoreactivity in tanycytes. By electron microscope immunocytochemistry using colloidal gold labeling, IGF-IR and IGFBP-2 immunoreactivities were observed in the microvilli of tanycytes in the lumen of the third ventricle. IGF-IR and IGFBP-2 immunoreactive levels on the apical surface of tanycytes were significantly decreased by the administration of progesterone, either alone or in the presence of estradiol. IGF-IR levels in the mediobasal hypothalamus, measured by Western blotting, were not significantly affected by the separate administration of estradiol or progesterone to ovariectomized rats. However, the simultaneous administration of both hormones resulted in a marked decrease in IGF-IR protein levels. Estradiol administration to ovariectomized rats increased IGFBP-2 immunoreactive levels in the hypothalamus. While progesterone did not significantly affect IGFBP-2 expression, the simultaneous injection of estradiol and progesterone resulted in a marked decrease in IGFBP-2 protein levels. The effect of estradiol on IGFBP-2 was observed both in protein and mRNA levels, suggesting a transcriptional regulation. However, the simultaneous administration of progesterone and estradiol had different effects on IGF-IR protein and IGF-IR mRNA levels, as well as on IGFBP-2 protein and IGFBP-2 mRNA levels, suggesting a postranscriptional action. These findings indicate that estradiol and progesterone regulate the expression of IGF-IR and IGFBP-2 in the mediobasal hypothalamus of adult female rats. Regulation of the hypothalamic IGF-I system by ovarian hormones may be physiologically relevant for neuroendocrine regulation and for synaptic plasticity during the estrous cycle. These results do not support the hypothesis that estrogen-induced accumulation of IGF-I by tanycytes is mediated by the hormonal regulation of IGF-IR. However, estrogen-induced up-regulation of IGFBP-2 and progesterone-induced down-regulation of IGF-IR and IGFBP-2 levels in the apical plasma membrane of tanycytes may be involved in the fluctuation of IGF-I levels in the mediobasal hypothalamus during the estrous cycle. Copyright 2000 John Wiley & Sons, Inc.

  7. 21 CFR 862.1405 - Immunoreactive insulin test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Immunoreactive insulin test system. 862.1405... Systems § 862.1405 Immunoreactive insulin test system. (a) Identification. An immunoreactive insulin test system is a device intended to measure immunoreactive insulin in serum and plasma. Immunoreactive insulin...

  8. 21 CFR 862.1405 - Immunoreactive insulin test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Immunoreactive insulin test system. 862.1405... Systems § 862.1405 Immunoreactive insulin test system. (a) Identification. An immunoreactive insulin test system is a device intended to measure immunoreactive insulin in serum and plasma. Immunoreactive insulin...

  9. 21 CFR 862.1405 - Immunoreactive insulin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoreactive insulin test system. 862.1405... Systems § 862.1405 Immunoreactive insulin test system. (a) Identification. An immunoreactive insulin test system is a device intended to measure immunoreactive insulin in serum and plasma. Immunoreactive insulin...

  10. 21 CFR 862.1405 - Immunoreactive insulin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Immunoreactive insulin test system. 862.1405... Systems § 862.1405 Immunoreactive insulin test system. (a) Identification. An immunoreactive insulin test system is a device intended to measure immunoreactive insulin in serum and plasma. Immunoreactive insulin...

  11. Effect of heat and enzymatic treatments on human IgE and rabbit IgG sensitivity to white bean allergens.

    PubMed

    Bousfiha, Amal; Lotfi, Aarab

    2013-08-28

    The aim of this study was to evaluate the sensitivity of the population of Fez and Casablanca in Morocco to dry white beans (Phaseolus Vulgaris) and to investigate the effect of food processing (heat and/or enzymatic hydrolysis by pepsin) on this sensitivity. Work was based on a bank consisting of 146 sera from patients with atopic hypersensitivity in order to evaluate specific immunoglobulin E (IgE) levels to native and processed white bean proteins by ELISA. Under the same conditions, we assessed the immunoreactivity of rabbit IgG obtained by immunization with native white bean proteins.Evaluation of specific IgE to the white bean proteins showed that 51% of children and 39% of adults had positive values. The heat treatment and pepsin hydrolysis of dry bean proteins showed a reduction of 68% of IgE binding recognition in more than 65% of all patients. After heating, all patients indicated a reduction greater than 36%. With rabbit IgG, we observed a decrease by 25% of binding under heat treatment while enzymatic digestion reduced IgG recognition by 46.6%.These findings suggest that epitopes recognized by IgE in the studied population were conformational sites whereas those recognized by rabbit IgG were probably sequential. In conclusion, these results demonstrate that the Moroccan population was very sensitive to white beans and this sensitivity could be reduced after heat treatment or enzymatic hydrolysis.

  12. Morphology of P2X3-immunoreactive nerve endings in the rat laryngeal mucosa.

    PubMed

    Takahashi, Natsumi; Nakamuta, Nobuaki; Yamamoto, Yoshio

    2016-02-01

    The morphological characteristics of P2X3-immunoreactive nerve endings in the laryngeal mucosa were herein examined using immunohistochemistry with confocal laser microscopy. Ramified intraepithelial nerve endings immunoreactive to P2X3 were distributed in the epiglottis and arytenoid region. The axon terminals of P2X3-immunoreactive ramified endings were beaded or flat in shape. These endings were also immunoreactive to P2X2 and not identical to the nerve endings immunoreactive to Na(+)-K(+)-ATPase α3-subunit, substance P (SP), and calcitonin gene-related peptide (CGRP). P2X3-immunoreactive axon terminals were also immunoreactive to vGLUT1, vGLUT2, and vGLUT3. In addition to ramified endings, P2X3-immunoreactive nerve endings were associated with α-gustducin-immunoreactive solitary chemosensory cells and/or SNAP25-immunoreactive neuroendocrine cells. Furthermore, P2X3-immunoreactive nerve endings were also observed in the taste bud-like chemosensory cell clusters of the stratified squamous epithelium covering epiglottic and arytenoid cartilage. The P2X3-immunoreactive nerve endings that associated with sensory and/or endocrine cells and chemosensory cell clusters were also immunoreactive to P2X2, vGLUT1, vGLUT2, and vGLUT3, but not to SP or CGRP. In conclusion, P2X3-immunoreactive nerve endings may be classified into two types, i.e., intraepithelial ramified nerve endings and nerve endings associated with chemosensory cells and neuroendocrine cells.

  13. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  14. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  15. Evaluation of 89Zr-pertuzumab in Breast Cancer Xenografts

    DOE PAGES

    Marquez, Bernadette V.; Ikotun, Oluwatayo F.; Zheleznyak, Alexander; ...

    2014-07-24

    Here, pertuzumab is a monoclonal antibody that binds to HER2 and is used in combination with another HER2–specific monoclonal antibody, trastuzumab, for the treatment of HER2+ metastatic breast cancer. Pertuzumab binds to an HER2 binding site distinct from that of trastuzumab, and its affinity is enhanced when trastuzumab is present. We aim to exploit this enhanced affinity of pertuzumab for its HER2 binding epitope and adapt this antibody as a PET imaging agent by radiolabeling with 89Zr to increase the sensitivity of HER2 detection in vivo. Here, we investigate the biodistribution of 89Zr-pertuzumab in HER2–expressing BT-474 and HER2–nonexpressing MDA-MB-231 xenograftsmore » to quantitatively assess HER2 expression in vivo. In vitro cell binding studies were performed resulting in retained immunoreactivity and specificity for HER2–expressing cells. In vivo evaluation of 89Zr-pertuzumab was conducted in severely combined immunodeficient mice, subcutaneously inoculated with BT-474 and MDA-MB-231 cells. 89Zr-pertuzumab was systemically administered and imaged at 7 days postinjection (p.i.) followed by terminal biodistribution studies. Higher tumor uptake was observed in BT-474 compared to MDA-MB-231 xenografts with 47.5 ± 32.9 and 9.5 ± 1.7% ID/g, respectively at 7 days p.i (P = 0.0009) and blocking studies with excess unlabeled pertuzumab showed a 5-fold decrease in BT-474 tumor uptake (P = 0.0006), confirming the in vivo specificity of this radiotracer. Importantly, we observed that the tumor accumulation of 89Zr-pertuzumab was increased in the presence of unlabeled trastuzumab, at 173 ± 74.5% ID/g (P = 0.01). Biodistribution studies correlate with PET imaging quantification using max SUV (r = 0.98, P = 0.01). Collectively, these results illustrate that 89Zr-pertuzumab as a PET imaging agent may be beneficial for the quantitative and noninvasive assessment of HER2 expression in vivo especially for patients undergoing trastuzumab therapy.« less

  16. Ulex europaeus agglutinin-I binding to dental primary afferent projections in the spinal trigeminal complex combined with double immunolabeling of substance P and GABA elements using peroxidase and colloidal gold.

    PubMed

    Matthews, M A; Hoffmann, K D; Hernandez, T V

    1989-01-01

    Ulex europaeus agglutinin I (UEA-I) is a plant lectin with an affinity for L-fucosyl residues in the chains of lactoseries oligosaccharides associated with medium- and smaller-diameter dorsal root ganglion neurons and their axonal processes. These enter Lissauer's tract and terminate within the superficial laminae of the spinal cord overlapping projections known to have a nociceptive function. This implies that the surface coatings of neuronal membranes may have a relationship with functional modalities. The present investigation further examined this concept by studying a neuronal projection with a nociceptive function to determine whether fucosyl-lactoseries residues were incorporated in its primary afferent terminals. Transganglionic transport of horseradish peroxidase (HRP) following injection into tooth pulp chambers was employed to demonstrate dental pulp terminals in the trigeminal spinal complex, while peroxidase and fluorescent tags were used concomitantly to stain for UEA-I. Double immunolabeling for substance P (SP) and gamma-aminobutyric acid (GABA) using peroxidase and colloidal gold allowed a comparison of the distribution of a known excitatory nociceptive transmitter with that of UEA-I binding in specific subnuclei. Synaptic interrelationships between UEA-I positive dental pulp primary afferent inputs and specific inhibitory terminals were also examined. SP immunoreactivity occurred in laminae I and outer lamina II (IIo) of subnucleus caudalis (Vc) and in the ventrolateral and lateral marginal region of the caudal half of subnucleus interpolaris (Vi), including the periobex area in which Vi is slightly overlapped on its lateral aspect by cellular elements of Vc. The adjacent interstitial nucleus (IN) also showed an intense immunoreactivity for this peptide antibody. UEA-I binding displayed a similar distribution pattern in both Vc and Vi, but extended into lamina IIi and the superficial part of Lamina III in Vc. Dental pulp terminals were found to have a comparable distribution; however, many extended into the dorsal portion of the caudal half of Vi and the ventromedial quadrant of rostral Vi. Electron-microscopic analysis showed that transganglionically labeled dental pulp terminals contained ovoid, complex membrane-bound vacuoles laden with transported HRP. The preterminal axon and synaptic membranes of those dental pulp terminals located in zones of Vc and Vi displaying an affinity for UEA-I were usually characterized by a patchy, electron-dense coating of the peroxidase tag. SP was demonstrated ultrastructurally with Protein-A colloidal gold (3-nm particles), whereas GABA immunoreactivity was revealed by the avidin-biotin-peroxidase method.(ABSTRACT TRUNCATED AT 400 WORDS)

  17. Focal inhibitory interneuron loss and principal cell hyperexcitability in the rat hippocampus after microinjection of a neurotoxic conjugate of saporin and a peptidase-resistant analog of Substance P.

    PubMed

    Martin, J L; Sloviter, R S

    2001-07-23

    Episodes of prolonged seizures or head trauma produce chronic hippocampal network hyperexcitability hypothesized to result primarily from inhibitory interneuron loss or dysfunction. The possibly causal role of inhibitory neuron failure in the development of epileptiform pathophysiology remains unclear because global neurologic injuries produce such a multitude of effects. The recent finding that Substance P receptors (SPRs) are expressed exclusively in the rat hippocampus by inhibitory interneurons provided the rationale for attempting to ablate interneurons selectively by using neurotoxic conjugates of SPR ligands and the ribosome inactivating protein saporin that specifically target Substance P receptor-expressing cells. Whereas intrahippocampal microinjection of a conjugate of native SP and saporin produced significant nonspecific damage at concentrations needed to produce even limited selective loss of SPR-positive cells, a conjugate of saporin and the more potent and peptidase-resistant SP analog [Sar(9), Met(O(2))(11)] Substance P (SSP-saporin) caused negligible nonspecific damage at the injection site, and a virtually complete loss of SPR-like immunoreactivity (LI) up to 1 mm from the injection site. Within the SPR depletion zone, immunoreactivities for most GABA-, parvalbumin-, somatostatin-, and cholecystokinin-immunoreactive cells and fibers were eliminated. The few interneurons detectable within the affected zone were devoid of SPR-LI. The apparent loss of interneurons was selective in that calbindin- and glutamate receptor subunit 2 (GluR2) -positive principal cells survived within the affected zone, as did myelinated fibers and the extrinsic calretinin- and tyrosine hydroxylase--immunoreactive terminals of subcortical afferents. An apparent lack of reactive synaptic reorganization in response to interneuron loss was indicated by zinc transporter-3 (ZnT3)-- and beta-synuclein--LI, as well as by Timm staining, all of which revealed relatively normal patterns of excitatory terminal distribution. Control injections produced minor damage at the injection site, but no apparent specific loss of SPR-LI. One to 12 weeks after injection of SSP-saporin, extracellular electrophysiological field responses recorded in the CA1 pyramidal and dentate granule cell layers in response to afferent stimulation were blindly evaluated simultaneously in two sites 1-2 mm apart along the longitudinal hippocampal axis. SSP-saporin-treated rats exhibited relatively normal responses in some sites, whereas disinhibition and hyperexcitability indistinguishable from the pathophysiology produced by experimental status epilepticus were simultaneously recorded at adjacent sites. Anatomic analysis of the recording sites in each animal revealed that epileptiform pathophysiology was consistently observed only within areas of SPR ablation, whereas relatively normal evoked responses were recorded from immediately adjacent and relatively unaffected regions. These data establish the efficacy of [Sar(9), Met(O(2))(11)] Substance P-saporin for producing a selective and spatially extensive ablation of hippocampal inhibitory interneurons in vivo and a highly focal disinhibition that was restricted to the site of interneuron loss. These results also demonstrate that the "epileptic" pathophysiology produced by experimental status epilepticus or head trauma can be replicated by focal interneuron loss per se, without involving principal cell loss and other interpretive confounds inherent in the use of global neurologic injury models. Copyright 2001 Wiley-Liss, Inc.

  18. Peripheral gabapentin regulates mosquito allergy-induced itch in mice.

    PubMed

    Akiyama, Tasuku; Andoh, Tsugunobu; Ohtsuka, Eiji; Nojima, Hiroshi; Ouchi, Hidekazu; Takahata, Hiroki; Kuraishi, Yasushi

    2018-05-26

    The antipruritic activity of gabapentin, an anticonvulsant, was studied in a mouse model of allergic itch. In mice sensitized by an extract of the salivary glands of the mosquito (ESGM), an intradermal injection of ESGM elicited scratching and increased peripheral nerve firing. Oral or intradermal administration of gabapentin at the ESGM injection site inhibited ESGM-induced scratching and peripheral nerve firing. However, gabapentin did not affect histamine-induced scratching. The distributions of immunoreactivity to the voltage-dependent calcium channel α 2 δ-1 subunit, a site of gabapentin action, and the histamine H 1 receptor differed in the mouse dorsal root ganglia. The α 2 δ-1 subunit was mainly found in neurons that were 15-20 µm in diameter, whereas the H 1 receptor was mainly in 20-30 µm neurons. In addition, α 2 δ-1 subunit immunoreactivity co-localized with that of transient receptor potential vanilloid 1 (TRPV1). These results suggest that gabapentin regulates allergic itch by acting on the calcium channel α 2 δ-1 subunit in peripheral TRPV1-positive neurons. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  20. An Enzyme-Mediated Methodology for the Site-Specific Radiolabeling of Antibodies Based on Catalyst-Free Click Chemistry

    PubMed Central

    Zeglis, Brian M.; Davis, Charles B.; Aggeler, Robert; Kang, Hee Chol; Chen, Aimei; Agnew, Brian J.; Lewis, Jason S.

    2013-01-01

    An enzyme- and click chemistry-mediated methodology for the site-selective radiolabeling of antibodies on the heavy chain glycans has been developed and validated. To this end, a model system based on the prostate specific membrane antigen-targeting antibody J591, the positron-emitting radiometal 89Zr, and the chelator desferrioxamine has been employed. The methodology consists of four steps: (1) the removal of sugars on the heavy chain region of the antibody to expose terminal N-acetylglucosamine residues; (2) the incorporation of azide-modified N-acetylgalactosamine monosaccharides into the glycans of the antibody; (3) the catalyst-free click conjugation of desferrioxamine-modified dibenzocyclooctynes to the azide-bearing sugars; and (4) the radiolabeling of the chelator-modified antibody with 89Zr. The site-selective labeling methodology has proven facile, reproducible, and robust, producing 89Zr-labeled radioimmunoconjguates that display high stability and immunoreactivity in vitro (>95%) in addition to high selective tumor uptake (67.5 ± 5.0 %ID/g) and tumor-to-background contrast in athymic nude mice bearing PSMA-expressing subcutaneous LNCaP xenografts. Ultimately, this strategy could play a critical role in the development of novel well-defined and highly immunoreactive radioimmunoconjugates for both the laboratory and clinic. PMID:23688208

  1. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  2. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  3. Postsynaptic density protein (PSD)-95 expression is markedly decreased in the hippocampal CA1 region after experimental ischemia-reperfusion injury.

    PubMed

    Yan, Bing Chun; Park, Joon Ha; Ahn, Ji Hyeon; Lee, Jae-Chul; Won, Moo-Ho; Kang, Il-Jun

    2013-07-15

    Synaptic plasticity is important for functional recovery after cerebral ischemic injury. In the present study, we investigated chronological change in the immunoreactivity of PSD-95, a kind of postsynaptic density protein, in the hippocampus proper (CA1-3 regions) after 5 min of transient cerebral ischemia in gerbils. PSD-95 immunoreactivity was observed in MAP-2-immunoreactive dendrites in the CA1-3 regions of the sham group. The PSD-95 immunoreactivity was shown as beaded structure in the MAP-2-immunoreactive dendrites. However, PSD-95 immunoreactivity began to be dramatically decreased in MAP-2-immunoreactive dendrites in the CA1 region, not CA2-3 region, at early time after ischemia-reperfusion. At 5 days after ischemia-reperfusion, MAP-2 immunoreactivity almost disappeared in the ischemic CA1 region, and PSD-95 immunoreactivity was much lower than that in the sham group. In brief, PSD-95 immunoreactivity in the CA1 dendrites was markedly decreased at early time after ischemia-reperfusion. We suggest that decreased PSD-95 immunoreactivity in the ischemic CA1 region may lead to a deficit of postsynaptic plasticity in the brain. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. The goldfish nervus terminalis: a luteinizing hormone-releasing hormone and molluscan cardioexcitatory peptide immunoreactive olfactoretinal pathway.

    PubMed

    Stell, W K; Walker, S E; Chohan, K S; Ball, A K

    1984-02-01

    Antisera to two putative neurotransmitters, luteinizing hormone-releasing hormone (LHRH) and molluscan cardioexcitatory tetrapeptide (H-Phe-Met-Arg-Phe-NH2; FMRF-amide), bind specifically to neurites in the inner nuclear and inner plexiform layers of the goldfish retina. Retrograde labeling showed that intraocular axon terminals originate from the nervus terminalis, whose cell bodies are located in the olfactory nerves. Double immunocytochemical and retrograde labeling showed that some terminalis neurons project to the retina; others may project only within the brain. All terminalis neurons having proven retinal projections were both LHRH- and FMRF-amide-immunoreactive. The activity of retinal ganglion cells was recorded with microelectrodes in isolated superfused goldfish retinas. In ON- and OFF-center double-color-opponent cells, micromolar FMRF-amide and salmon brain gonadotropin-releasing factor ( [Trp7, Leu8] LHRH) caused increased spontaneous activity in the dark, loss of light-induced inhibition, and increased incidence of light-entrained pulsatile response. The nervus terminalis is therefore a putatively peptidergic retinopetal projection. Sex-related olfactory stimuli may act through it, thereby modulating the output of ganglion cells responsive to color contrast.

  5. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  6. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  7. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  8. A constitutively-active IKK-complex at the axon initial segment.

    PubMed

    König, Hans-Georg; Watters, Orla; Kinsella, Sinéad; Ameen, Mohammed; Fenner, Beau J; Prehn, Jochen H M

    2018-01-01

    Previous studies provided evidence for an accumulation of IκB-kinase (IKK) α/β at the axon initial segment (AIS), a neuronal compartment defined by ankyrin-G expression. Here we explored whether the presence of the IKK-complex at the AIS was associated with the activation of IKK signaling at this site. Proximity-ligation assays (PLAs) using pan-IKKα/β, phospho-IKKα/β-specific as well as ankyrin-G specific antibodies validated their binding to proximal epitopes in the AIS, while antibodies to other phosphorylated signaling proteins showed no preference for the AIS. Small-hairpin mediated silencing of IKKβ significantly reduced anti-phospho-IKKα/β-immunoreactivities in the AIS. ank3 gene-deficient cerebellar Purkinje cells also exhibited no phosphorylated IKKα/β at the proximal region of their axons. Transient ankyrin-G overexpression in PC12 cells augmented NF-κB transactivation in an ankyrin-G death-domain dependent manner. Finally, small molecule inhibitors of IKK-activity, including Aspirin, inhibited the accumulation of activated IKK proteins in the AIS. Our data suggest the existence of a constitutively-active IKK signaling complex in the AIS. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Colocalization of neurotensin receptors and of the neurotensin-degrading enzyme endopeptidase 24-16 in primary cultures of neurons.

    PubMed

    Chabry, J; Checler, F; Vincent, J P; Mazella, J

    1990-12-01

    This paper compares the localization of neurotensin receptors and of endopeptidase 24-16, a peptidase likely involved in the inactivation of neurotensin in primary cultures of neurons. Neurotensin binding sites were radiolabeled with 125I-Tyr3-neurotensin, whereas endopeptidase 24-16 was stained by immunohistochemical techniques using a monospecific polyclonal antibody. Endopeptidase 24-16 is present in 80-85% of the nondifferentiated neurons. The proportion of immunoreactive neurons decreased during maturation to reach 35-40% after 4-8 d of culture. By contrast, neurotensin receptors were not detectable in nondifferentiated cells and appear during maturation. Specific 125I-Tyr3-neurotensin labeling is maximal after 4 d of culture and is located on about 10% of differentiated neurons. Double-labeling experiments show that about 90% of cortical, hypothalamic, and mesencephalic neurons bearing the neurotensin receptor also contained endopeptidase 24-16, supporting the hypothesis that one of the functions of endopeptidase 24-16 is the physiological inactivation of neurotensin. However, the presence of endopeptidase 24-16 on numerous neurons that do not contain neurotensin receptors also suggests that the enzyme could be involved in the degradation and/or maturation of other neuropeptides.

  10. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  11. Na(+)-D-glucose cotransporter in the kidney of Squalus acanthias: molecular identification and intrarenal distribution.

    PubMed

    Althoff, Thorsten; Hentschel, Hartmut; Luig, Jutta; Schütz, Hendrike; Kasch, Myriam; Kinne, Rolf K-H

    2006-04-01

    Using primers against conserved regions of mammalian Na(+)-d-glucose cotransporters (SGLT), a cDNA was cloned from the kidney of spiny dogfish shark (Squalus acanthias). On the basis of comparison of amino acid sequence, membrane topology, and putative glycosylation and phosphorylation sites, the cDNA could be shown to belong to the family of sglt genes. Indeed, Na(+)-dependent d-glucose uptake could be demonstrated after expression of the gene in Xenopus laevis oocytes. In a dendrogram, the SGLT from shark kidney has a high homology to the mammalian SGLT2. Computer analysis revealed that the elasmobranch protein is most similar to the mammalian proteins in the transmembrane regions and contains already all the amino acids identified to be functionally important, suggesting early conservation during evolution. Extramembraneous loops show larger variations. This holds especially for loop 13, which has been implied as a phlorizin-binding domain. Antibodies were generated and the intrarenal distribution of the SGLT was studied in cryosections. In parallel, the nephron segments were identified by lectins. Positive immunoreactions were found in the proximal tubule in the early parts PIa and PIb and the late segment PIIb. The large PIIa segment of the proximal tubule showed no reaction. In contrast to the mammalian kidney also the late distal tubule, the collecting tubule, and the collecting duct showed immunoreactivity. The molecular information confirms previous vesicle studies in which a low affinity SGLT with a low stoichiometry has been observed and supports the notion of a similarity of the shark kidney SGLT to the mammalian SGLT2. Despite its presence in the late parts of the nephron, the absence of SGLT in the major part of the proximal tubule, the relatively low affinity, and in particular the low stoichiometry might explain the lack of a T(m) for d-glucose in the shark kidney.

  12. CRTC2 activation in the suprachiasmatic nucleus, but not paraventricular nucleus, varies in a diurnal fashion and increases with nighttime light exposure.

    PubMed

    Highland, Julie A; Weiser, Michael J; Hinds, Laura R; Spencer, Robert L

    2014-10-01

    Entrainment of the intrinsic suprachiasmatic nucleus (SCN) molecular clock to the light-dark cycle depends on photic-driven intracellular signal transduction responses of SCN neurons that converge on cAMP response element-binding protein (CREB)-mediated regulation of gene transcription. Characterization of the CREB coactivator proteins CREB-regulated transcriptional coactivators (CRTCs) has revealed a greater degree of differential activity-dependent modulation of CREB transactivational function than previously appreciated. In confirmation of recent reports, we found an enrichment of crtc2 mRNA and prominent CRTC2 protein expression within the SCN of adult male rats. With use of a hypothalamic organotypic culture preparation for initial CRTC2-reactive antibody characterization, we found that CRTC2 immunoreactivity in hypothalamic neurons shifted from a predominantly cytoplasmic profile under basal culture conditions to a primarily nuclear localization (CRTC2 activation) 30 min after adenylate cyclase stimulation. In adult rat SCN, we found a diurnal variation in CRTC2 activation (peak at zeitgeber time of 4 h and trough at zeitgeber time of 16-20 h) but no variation in the total number of CRTC2-immunoreactive cells. There was no diurnal variation of CRTC2 activation in the hypothalamic paraventricular nucleus, another site of enriched CRTC2 expression. Exposure of rats to light (50 lux) for 30 min during the second half of their dark (nighttime) phase produced CRTC2 activation. We observed in the SCN a parallel change in the expression of a CREB-regulated gene (FOS). In contrast, nighttime light exposure had no effect on CRTC2 activation or FOS expression in the paraventricular nucleus, nor did it affect corticosterone hormone levels. These results suggest that CRTC2 participates in CREB-dependent photic entrainment of SCN function. Copyright © 2014 the American Physiological Society.

  13. Antibody recognition of melphalan adducts characterized using immobilized DNA: enhanced alkylation of G-Rich regions in cells compared to in vitro.

    PubMed

    McCartney, H; Martin, A M; Middleton, P G; Tilby, M J

    2001-01-01

    The bifunctional alkylating agent, melphalan, forms adducts on DNA that are recognized by two previously described monoclonal antibodies, MP5/73 and Amp4/42. Immunoreactivity to MP5/73 was lost when alkylated DNA was exposed to alkaline pH, while Amp4/42 only recognized the structures formed after the alkali treatment. Competitive enzyme-linked immunoadsorbent assays (ELISAs) indicated that in 0.01 and 0.1 M NaOH, loss of immunoreactivity to MP5/73 occurred with half-lives that were at least 2-fold longer than half-lives for gain of immunoreactivity to Amp4/42. This supported previously published evidence that Amp4/42 did not simply recognize all the products formed by alkali treatment of adducts that were initially recognized by MP5/73. Adducts recognized by MP5/73 on RNA were considerably more stable at 100 degrees C and pH 7 than adducts on DNA. This was consistent with the hypothesis that immunorecognition involved N7 guanine adducts and ruled out the involvement of phosphotriesters in immunoreactivity. Synthetic oligodeoxyribonucleotides, covalently immobilized onto 96-well plates, were reacted with melphalan and incubated for various periods with alkali, and then the levels of adducts recognized by each antibody in replicate wells were assayed by a direct binding ELISA. Adducts formed on oligodeoxyguanylic acid were recognized very weakly by Amp4/42, unlike other DNA sequences that were tested. Retention of immobilized DNA during alkali treatment was confirmed by immunoassay of cisplatin adducts. Poor recognition by Amp4/42 of adducts in oligodeoxyguanylic acid was confirmed by a competitive ELISA. Amp4/42, unlike MP5/73, efficiently recognized adducts resulting from alkylation of DNA with chlorambucil. It is concluded that the two antibodies recognized melphalan adducts in different DNA sequence environments and that this explains (a) the different alkali stability of immunoreactive adducts and (b) previous results which showed that, in DNA from melphalan-treated cells, adducts recognized by Amp4/42 formed a smaller proportion of total adducts compared to DNA alkylated in vitro. The results presented here indicate that this was caused by a marked cellular influence on the overall sequence-dependent pattern of DNA alkylation or repair.

  14. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  15. Determination of the specificity of monoclonal antibodies against Schistosoma mansoni CAA glycoprotein antigen using neoglycoconjugate variants.

    PubMed

    Carvalho de Souza, Adriana; van Remoortere, Alexandra; Hokke, Cornelis H; Deelder, André M; Vliegenthart, Johannes F G; Kamerling, Johannis P

    2005-09-01

    The immunogenic O-glycan of circulating anodic antigen (CAA) is a high-molecular-mass polysaccharide with the unique -->6)-[beta-D-GlcpA-(1-->3)]-beta-D-GalpNAc-(1--> repeating unit. To obtain information at the molecular level about the specificity of monoclonal antibodies against CAA, the immunoreactivity of two series of bovine serum albumin-coupled synthetic oligosaccharides related to the CAA O-glycan was monitored using ELISA and surface plasmon resonance spectroscopy. The importance of the axial hydroxyl group of beta-D-GalpNAc for antibody binding was investigated using the following series of analogues: beta-D-GlcpA-(1-->3)-beta-D-GlcpNAc-(1-->O); beta-D-GlcpNAc-(1-->6)-[beta-D-GlcpA-(1-->3)]-beta-D-GlcpNAc-(1-->O); and beta-D-GlcpA-(1-->3)-beta-D-GlcpNAc-(1-->6)-[beta-D-GlcpA-(1-->3)]-beta-D-GlcpNAc-(1-->O). In the second series of analogues, beta-D-Glcp6S-(1-->3)-beta-D-GalpNAc-(1-->O), beta-D-GalpNAc-(1-->6)-[beta-D-Glcp6S-(1-->3)]-beta-D-GalpNAc-(1-->O), and beta-D-Glcp6S-(1-->3)-beta-D-Gal-pNAc-(1-->6)-[beta-D-Glcp6S-(1-->3)]-beta-D-GalpNAc-(1-->O), the native beta-D-GlcpA moiety was replaced by beta-D-Glcp6S to evaluate the influence of the nature of the charge on antibody recognition. Comparison of the immunoreactivity of these series with that measured for conjugates containing corresponding synthetic CAA fragments showed that the antibody binding levels can be correlated to the antibody specificity to CAA fragments. For the most reactive antibodies, the structural changes chosen (beta-D-GalpNAc replaced by beta-D-GlcpNAc, and beta-D-GlcpA replaced by beta-D-Glcp6S) completely eradicated the binding.

  16. Lipopolysaccharide binding protein enhances the responsiveness of alveolar macrophages to bacterial lipopolysaccharide. Implications for cytokine production in normal and injured lungs.

    PubMed Central

    Martin, T R; Mathison, J C; Tobias, P S; Letúrcq, D J; Moriarty, A M; Maunder, R J; Ulevitch, R J

    1992-01-01

    A plasma lipopolysaccharide (LPS)-binding protein (LBP) has been shown to regulate the response of rabbit peritoneal macrophages and human blood monocytes to endotoxin (LPS). We investigated whether LBP is present in lung fluids and the effects of LBP on the response of lung macrophages to LPS. Immunoreactive LBP was detectable in the lavage fluids of patients with the adult respiratory distress syndrome by immunoprecipitation followed by Western blotting, and also by specific immunoassay. In rabbits, the LBP appeared to originate outside of the lungs, inasmuch as mRNA transcripts for LBP were identified in total cellular RNA from liver, but not from lung homogenates or alveolar macrophages. Purified LBP enhanced the response of human and rabbit alveolar macrophages to both smooth form LPS (Escherichia coli O111B:4) and rough form LPS (Salmonella minnesota Re595). In the presence of LBP and LPS, the onset of tumor necrosis factor-alpha (TNF alpha) production occurred earlier and at an LPS threshold dose that was as much as 1,000-fold lower for both types of LPS. In rabbit alveolar macrophages treated with LBP and LPS, TNF alpha mRNA appeared earlier, reached higher levels, and had a prolonged half-life as compared with LPS treatment alone. Neither LPS nor LPS and LBP affected pHi or [Cai++] in alveolar macrophages. Specific monoclonal antibodies to CD14, a receptor that binds LPS/LBP complexes, inhibited TNF alpha production by human alveolar macrophages stimulated with LPS alone or with LPS/LBP complexes, indicating the importance of CD14 in mediating the effects of LPS on alveolar macrophages. Thus, immunoreactive LBP accumulates in lung lavage fluids in patients with lung injury and enhances LPS-stimulated TNF alpha gene expression in alveolar macrophages by a pathway that depends on the CD14 receptor. LBP may play an important role in augmenting TNF alpha expression by alveolar macrophages within the lungs. Images PMID:1281827

  17. Effects of high-dose fenfluramine treatment on monoamine uptake sites in rat brain: Assessment using quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Appel, N.M.; Mitchell, W.M.; Contrera, J.F.

    1990-01-01

    Fenfluramine is an amphetamine derivative that in humans is used primarily as an anorectic agent in the treatment of obesity. In rats, subchronic high-dose d,l-fenfluramine treatment (24 mg/kg subcutaneously, twice daily for 4 days) causes long-lasting decreases in brain serotonin (5HT), its metabolite 5-hydroxyindoleacetic acid, and high-affinity 5HT uptake sites. Moreover, this high-dose treatment regimen causes both selective long-lasting decreases in fine-caliber 5HT-immunoreactive axons and appearance of other 5HT-immunoreactive axons with morphology characteristic of degenerating axons. Determination of the potential neurotoxic effects of fenfluramine treatment using immunohistochemistry is limited from the perspectives that staining is difficult to quantify and thatmore » it relies on presence of the antigen (in this case 5HT), and the 5HT-depleting effects of fenfluramine are well known. In the present study, we used quantitative in vitro autoradiography to assess, in detail, the density and regional distribution of (3H)paroxetine-labeled 5HT and (3H)mazindol-labeled catecholamine uptake sites in response to the high-dose fenfluramine treatment described above. Because monoamine uptake sites are concentrated on monoamine-containing nerve terminals, decreases in uptake site density would provide a quantitative assessment of potential neurotoxicity resulting from this fenfluramine treatment regimen. Marked decreases in densities of (3H)paroxetine-labeled 5HT uptake sites occurred in brain regions in which fenfluramine treatment decreased the density of 5HT-like immunostaining when compared to saline-treated control rats. These included cerebral cortex, caudate putamen, hippocampus, thalamus, and medial hypothalamus.« less

  18. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  19. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  20. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  2. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  3. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  4. Ultrastructure of cholinergic neurons in the laterodorsal tegmental nucleus of the rat: interaction with catecholamine fibers.

    PubMed

    Kubota, Y; Leung, E; Vincent, S R

    1992-01-01

    The ultrastructure of choline acetyltransferase (ChAT)-immunoreactive neurons in the laterodorsal tegmental nucleus (TLD) of the rat was investigated by immunohistochemical techniques. The immunoreactive neurons were medium to large in size, with a few elongated dendrites, contained well-developed cytoplasm, and a nucleus with deep infoldings. They received many nonimmunoreactive, mostly asymmetric synaptic inputs on their soma and dendrites. ChAT-immunoreactive, usually myelinated, axons were occasionally seen in TLD. Only one immunoreactive axon terminal was observed within TLD, and it made synaptic contact with a nonimmunoreactive neuronal perikaryon. The synaptic interactions between ChAT-immunoreactive neurons and tyrosine hydroxylase (TH)-immunoreactive fibers in the TLD were investigated with a double immunohistochemical staining method. ChAT-immunoreactivity detected with a beta-galactosidase method was light blue-green in the light microscope and formed dot-like electron dense particles at the electron microscopic level. TH-immunoreactivity, visualized with a nickel-enhanced immunoperoxidase method, was dark blue-black in the light microscope and diffusely opaque in the electron microscope. Therefore, the difference between these two kinds of immunoreactivity could be quite easily distinguished at both light and electron microscopic levels. In the light microscope, TH-positive fibers were often closely apposed to ChAT-immunoreactive cell bodies and dendrites in TLD. In the electron microscope, the cell soma and proximal dendrites of ChAT-immunoreactive neurons received synaptic contacts from TH-immunoreactive axon terminals. These results provide a morphological basis for catecholaminergic regulation of the cholinergic reticular system.

  5. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  6. Alzheimer's-associated A{beta} oligomers show altered structure, immunoreactivity and synaptotoxicity with low doses of oleocanthal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pitt, Jason; Roth, William; Lacor, Pascale

    2009-10-15

    It now appears likely that soluble oligomers of amyloid-{beta}{sub 1-42} peptide, rather than insoluble fibrils, act as the primary neurotoxin in Alzheimer's disease (AD). Consequently, compounds capable of altering the assembly state of these oligomers (referred to as ADDLs) may have potential for AD therapeutics. Phenolic compounds are of particular interest for their ability to disrupt A{beta} oligomerization and reduce pathogenicity. This study has focused on oleocanthal (OC), a naturally-occurring phenolic compound found in extra-virgin olive oil. OC increased the immunoreactivity of soluble A{beta} species, when assayed with both sequence- and conformation-specific A{beta} antibodies, indicating changes in oligomer structure. Analysismore » of oligomers in the presence of OC showed an upward shift in MW and a ladder-like distribution of SDS-stable ADDL subspecies. In comparison with control ADDLs, oligomers formed in the presence of OC (A{beta}-OC) showed equivalent colocalization at synapses but exhibited greater immunofluorescence as a result of increased antibody recognition. The enhanced signal at synapses was not due to increased synaptic binding, as direct detection of fluorescently-labeled ADDLs showed an overall reduction in ADDL signal in the presence of OC. Decreased binding to synapses was accompanied by significantly less synaptic deterioration assayed by drebrin loss. Additionally, treatment with OC improved antibody clearance of ADDLs. These results indicate oleocanthal is capable of altering the oligomerization state of ADDLs while protecting neurons from the synaptopathological effects of ADDLs and suggest OC as a lead compound for development in AD therapeutics.« less

  7. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  8. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  9. An immunoelectron microscopic study of methionine-enkephalin structures in cat prevertebral ganglia.

    PubMed

    Benfares, J; Henry, M; Cupo, A; Julé, Y

    1995-03-01

    Methionine-enkephalin-like immunoreactivity was detected in presynaptic nerve fibers and SIF cells in cat prevertebral ganglia. The immunoreactive nerve fibers contained a mixture of numerous small clear vesicles and a few large vesicles; the immunoreactivity was only confined to the large vesicles. Most of the immunoreactive fibers were in apposition with non-immunoreactive neuronal profiles, without any detectable synaptic membrane specializations. The other immunoreactive fibers formed synaptic contacts mainly with non-immunostained dendrites and to a lesser extent with axons and neuronal soma. The characterization at the ultrastructural level of the enkephalin-like immunoreactive structures is discussed as regards the modalities whereby opiates may be involved in sympathetic ganglionic transmission.

  10. Enkephalin-like immunoreactive principal ganglion cells and nerve fibres in the inferior mesenteric ganglion of the cat.

    PubMed

    Balayadi, M; Jule, Y; Cupo, A

    1988-10-05

    The occurrence and distribution of methionine-enkephalin (ME), leucine-enkephalin (LE) and methionine-enkephalin-Arg6-Gly7-Leu8 (MERGL)-like (LI) immunoreactive material in the inferior mesenteric ganglion (IMG) of the cat were studied by immunohistochemical techniques using the peroxidase-antiperoxidase method. Numerous ME-Li, LE-Li and MERGL-Li immunoreactive fibres with the same distribution pattern were observed. They were varicose and often surrounded closely neighbouring unlabelled ganglion cell bodies. Sometimes they ran in strands between ganglion cells. ME-Li immunoreactive material was detected in a number of cell bodies, the diameter of which was similar to that of unlabelled principal ganglion cell bodies, and which were probably Enk-Li-containing principal ganglion cells. These immunoreactive cells were often surrounded by ME-Li immunoreactive fibres. No LE-Li or MERGL-Li immunoreactive ganglion cell bodies were observed. The presence of ME-Li immunoreactive principal ganglion cells raises the possibility that the Enk-Li immunoreactive fibres present in the IMG may have a prevertebral ganglionic source. The possibility that the Enk-Li material present in nerve fibres might be derived from preproenkephalin-A was suggested by the occurrence of MERGL-Li immunoreactivity.

  11. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  12. Distribution of 3H-GABA uptake sites in the nematode Ascaris

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guastella, J.; Stretton, A.O.

    1991-05-22

    The distribution of uptake sites for the inhibitory neurotransmitter gamma-aminobutyric acid (GABA) in the nematode Ascaris suum was examined by autoradiography of 3H-GABA uptake. Single neural processes in both the ventral and dorsal nerve cords were labeled with 3H-GABA. Serial section analysis identified the cells of origin of these processes as the RMEV-like and RMED-like neurons. These cells belong to a set of four neurons in the nerve ring, all of which are labeled by 3H-GABA. 3H-GABA labeling of at least two other sets of cephalic neurons was seen. One of these pairs consists of medium-sized lateral ganglia neurons, locatedmore » at the level of the amphid commissure bundle. A second pair is located in the lateral ganglia at the level of the deirid commissure bundle. The position and size of these lateral ganglia cells suggest that they are the GABA-immunoreactive lateral ganglia cells frequently seen in whole-mount immunocytochemical preparations. Four neuronal cell bodies located in the retrovesicular ganglion were also labeled with 3H-GABA. These cells, which are probably cholinergic excitatory motor neurons, do not contain detectable GABA-like immunoreactivity. Heavy labeling of muscle cells was also observed. The ventral and dorsal nerve cord inhibitory motor neurons, which are known to contain GABA-like immunoreactivity, were not labeled above background with 3H-GABA. Together with the experiments reported previously, these results define three classes of GABA-associated neurons in Ascaris: (1) neurons that contain endogenous GABA and possess a GABA uptake system; (2) neurons that contain endogenous GABA, but that either lack a GABA uptake system or possess a GABA uptake system of low activity; (3) neurons that possess a GABA uptake system, but that lack endogenous GABA.« less

  13. Neuroprotection and Blood-Brain Barrier Restoration by Salubrinal After a Cortical Stab Injury.

    PubMed

    Barreda-Manso, M Asunción; Yanguas-Casás, Natalia; Nieto-Sampedro, Manuel; Romero-Ramírez, Lorenzo

    2017-06-01

    Following a central nervous system (CNS) injury, restoration of the blood-brain barrier (BBB) integrity is essential for recovering homeostasis. When this process is delayed or impeded, blood substances and cells enter the CNS parenchyma, initiating an additional inflammatory process that extends the initial injury and causes so-called secondary neuronal loss. Astrocytes and profibrotic mesenchymal cells react to the injury and migrate to the lesion site, creating a new glia limitans that restores the BBB. This process is beneficial for the resolution of the inflammation, neuronal survival, and the initiation of the healing process. Salubrinal is a small molecule with neuroprotective properties in different animal models of stroke and trauma to the CNS. Here, we show that salubrinal increased neuronal survival in the neighbourhood of a cerebral cortex stab injury. Moreover, salubrinal reduced cortical blood leakage into the parenchyma of injured animals compared with injured controls. Adjacent to the site of injury, salubrinal induced immunoreactivity for platelet-derived growth factor subunit B (PDGF-B), a specific mitogenic factor for mesenchymal cells. This effect might be responsible for the increased immunoreactivity for fibronectin and the decreased activation of microglia and macrophages in injured mice treated with salubrinal, compared with injured controls. The immunoreactivity for PDGF-B colocalized with neuronal nuclei (NeuN), suggesting that cortical neurons in the proximity of the injury were the main source of PDGF-B. Our results suggest that after an injury, neurons play an important role in both, the healing process and the restoration of the BBB integrity. J. Cell. Physiol. 232: 1501-1510, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Mutations in STRA6 Cause a Broad Spectrum of Malformations Including Anophthalmia, Congenital Heart Defects, Diaphragmatic Hernia, Alveolar Capillary Dysplasia, Lung Hypoplasia, and Mental Retardation

    PubMed Central

    Pasutto, Francesca; Sticht, Heinrich; Hammersen, Gerhard; Gillessen-Kaesbach, Gabriele; FitzPatrick, David R.; Nürnberg, Gudrun; Brasch, Frank; Schirmer-Zimmermann, Heidemarie; Tolmie, John L.; Chitayat, David; Houge, Gunnar; Fernández-Martínez, Lorena; Keating, Sarah; Mortier, Geert; Hennekam, Raoul C. M.; von der Wense, Axel; Slavotinek, Anne; Meinecke, Peter; Bitoun, Pierre; Becker, Christian; Nürnberg, Peter; Reis, André; Rauch, Anita

    2007-01-01

    We observed two unrelated consanguineous families with malformation syndromes sharing anophthalmia and distinct eyebrows as common signs, but differing for alveolar capillary dysplasia or complex congenital heart defect in one and diaphragmatic hernia in the other family. Homozygosity mapping revealed linkage to a common locus on chromosome 15, and pathogenic homozygous mutations were identified in STRA6, a member of a large group of “stimulated by retinoic acid” genes encoding novel transmembrane proteins, transcription factors, and secreted signaling molecules or proteins of largely unknown function. Subsequently, homozygous STRA6 mutations were also demonstrated in 3 of 13 patients chosen on the basis of significant phenotypic overlap to the original cases. While a homozygous deletion generating a premature stop codon (p.G50AfsX22) led to absence of the immunoreactive protein in patient’s fibroblast culture, structural analysis of three missense mutations (P90L, P293L, and T321P) suggested significant effects on the geometry of the loops connecting the transmembrane helices of STRA6. Two further variations in the C-terminus (T644M and R655C) alter specific functional sites, an SH2-binding motif and a phosphorylation site, respectively. STRA6 mutations thus define a pleiotropic malformation syndrome representing the first human phenotype associated with mutations in a gene from the “STRA” group. PMID:17273977

  15. Norepinephrine transporter function and desipramine: residual drug effects versus short-term regulation.

    PubMed

    Ordway, Gregory A; Jia, Weihong; Li, Jing; Zhu, Meng-Yang; Mandela, Prashant; Pan, Jun

    2005-04-30

    Previous research has shown that exposure of norepinephrine transporter (NET)-expressing cells to desipramine (DMI) downregulates the norepinephrine transporter, although changes in the several transporter parameters do not demonstrate the same time course. Exposures to desipramine for <1 day reduces only radioligand binding and uptake capacity while transporter-immunoreactivity is unaffected. Recent demonstration of persistent drug retention in cells following desipramine exposures raises the possibility that previous reported changes in the norepinephrine transporter may be partly accountable by residual drug. In this study, potential effects of residual desipramine on norepinephrine transporter binding and uptake were re-evaluated following exposures of PC12 cells to desipramine using different methods to remove residual drug. Using a method that minimizes residual drug, exposure of intact PC12 cells to desipramine for 4h had no effect on uptake capacity or [(3)H]nisoxetine binding to the norepinephrine transporter, while exposures for > or =16 h reduced uptake capacity. Desipramine-induced reductions in binding to the transporter required >24 h or greater periods of desipramine exposure. This study confirms that uptake capacity of the norepinephrine transporter is reduced earlier than changes in radioligand binding, but with a different time course than originally shown. Special pre-incubation procedures are required to abolish effects of residual transporter inhibitor when studying inhibitor-induced transporter regulation.

  16. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  17. Short-Term Exposure to Enriched Environment in Adult Rats Restores MK-801-Induced Cognitive Deficits and GABAergic Interneuron Immunoreactivity Loss.

    PubMed

    Murueta-Goyena, Ane; Ortuzar, Naiara; Gargiulo, Pascual Ángel; Lafuente, José Vicente; Bengoetxea, Harkaitz

    2018-01-01

    Perinatal injections of N-methyl-D-aspartate (NMDA) receptor antagonist in rodents emulate some cognitive impairments and neurochemical alterations, such as decreased GABAergic (gamma aminobutyric acid) interneuron immunoreactivity, also found in schizophrenia. These features are pervasive, and developing neuroprotective or neurorestorative strategies is of special interest. In this work, we aimed to investigate if a short exposure to enriched environment (EE) in early adulthood (P55-P73) was an effective strategy to improve cognitive dysfunction and to restore interneuron expression in medial prefrontal cortex (mPFC) and hippocampus (HPC). For that purpose, we administered MK-801 intraperitoneally to Long Evans rats from postnatal days 10 to 20. Twenty-four hours after the last injection, MK-801 produced a transient decrease in spontaneous motor activity and exploration, but those abnormalities were absent at P24 and P55. The open field test on P73 manifested that EE reduced anxiety-like behavior. In addition, MK-801-treated rats showed cognitive impairment in novel object recognition test that was reversed by EE. We quantified different interneuron populations based on their calcium-binding protein expression (parvalbumin, calretinin, and calbindin), glutamic acid decarboxylase 67, and neuronal nuclei-positive cells by means of unbiased stereology and found that EE enhanced interneuron immunoreactivity up to normal values in MK-801-treated rats. Our results demonstrate that a timely intervention with EE is a powerful tool to reverse long-lasting changes in cognition and neurochemical markers of interneurons in an animal model of schizophrenia.

  18. Study on the Immunoreactivity of Triticum monococcum (Einkorn) Wheat in Patients with Wheat-Dependent Exercise-Induced Anaphylaxis for the Production of Hypoallergenic Foods.

    PubMed

    Lombardo, Carla; Bolla, Michela; Chignola, Roberto; Senna, Gianenrico; Rossin, Giacomo; Caruso, Beatrice; Tomelleri, Carlo; Cecconi, Daniela; Brandolini, Andrea; Zoccatelli, Gianni

    2015-09-23

    Wheat [Triticum aestivum (T.a.)] ingestion can cause a specific allergic reaction, which is called wheat-dependent exercise-induced anaphylaxis (WDEIA). The major allergen involved is ω-5 gliadin, a gluten protein coded by genes located on the B genome. Our aim was to study the immunoreactivity of proteins in Triticum monococcum (einkorn, T.m.), a diploid ancestral wheat lacking B chromosomes, for possible use in the production of hypoallergenic foods. A total of 14 patients with a clear history of WDEIA and specific immunoglobulin E (IgE) to ω-5 gliadin were enrolled. Skin prick test (SPT) with a commercial wheat extract and an in-house T.a. gluten diagnostic solution tested positive for 43 and 100% of the cases, respectively. No reactivity in patients tested with solutions prepared from four T.m. accessions was observed. The immunoblotting of T.m. gluten proteins performed with the sera of patients showed different IgE-binding profiles with respect to T.a., confirming the absence of ω-5 gliadin. A general lower immunoreactivity of T.m. gluten proteins with scarce cross-reactivity to ω-5 gliadin epitopes was assessed by an enzyme-linked immunosorbent assay (ELISA). Given the absence of reactivity by SPT and the limited cross-reactivity with ω-5 gliadin, T.m. might represent a potential candidate in the production of hypoallergenic bakery products for patients sensitized to ω-5 gliadin. Further analyses need to be carried out regarding its safety.

  19. Immunohistochemical study of calretinin in normal skin and cutaneous adnexal proliferations.

    PubMed

    González-Guerra, Elena; Kutzner, Heinz; Rutten, Arno; Requena, Luis

    2012-07-01

    Calretinin is a calcium-binding protein member of the EF-hand family. The presence of calretinin has been demonstrated in certain stages of the cellular cycle in a wide variety of normal and neoplastic tissues. The main aims of our study were (1) to investigate what structures of the normal skin and cutaneous adnexal proliferations express immunoreactivity for calretinin and (2) to determine the value of immunohistochemical expression for calretinin as a marker for follicular, sebaceous, apocrine, and eccrine differentiation in cutaneous adnexal proliferations. We studied 139 biopsy specimens, including 10 cases of normal skin of different locations and 129 benign and malignant cutaneous adnexal proliferations. In normal skin, we found that calretinin is expressed in the innermost cell layer of the outer root sheath in anagen hair follicle, in both the duct and sebolemma of the sebaceous gland, in the secretory portion of eccrine glands, and in mast cells of the stroma. In cutaneous adnexal proliferations, we found strong immunoreactivity for calretinin in tricholemmal cysts, tricholemmomas/inverted follicular keratoses, tumors of follicular infundibulum, and in some basal cell carcinomas. Focal positivity was also seen in trichoadenomas, trichoblastomas/trichoepitheliomas, pilomatricomas, proliferating tricholemmal tumors, pilar sheath acanthomas, trichofolliculomas, follicular hybrid cysts, cutaneous mixed tumors, steatocystomas, sebaceous hyperplasias, and sebaceomas. These results demonstrate that immunohistochemical study for calretinin may be helpful to identify the innermost cell layer of the outer root sheath in anagen hair follicle and the cutaneous adnexal proliferations showing differentiation toward this structure. Calretinin immunoreactivity supports eccrine differentiation in some sweat gland neoplasms, and it is also useful in identifying neoplasms with ductal sebaceous differentiation.

  20. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  1. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  3. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  4. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  5. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  6. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  7. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  8. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  9. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  10. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  11. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  12. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  13. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  14. Expression and characterization of an iron-regulated hemin-binding protein, HbpA, from Leptospira interrogans serovar Lai.

    PubMed

    Asuthkar, Swapna; Velineni, Sridhar; Stadlmann, Johannes; Altmann, Friedrich; Sritharan, Manjula

    2007-09-01

    In an earlier study, based on the ferric enterobactin receptor FepA of Escherichia coli, we identified and modeled a TonB-dependent outer membrane receptor protein (LB191) from the genome of Leptospira interrogans serovar Lai. Based on in silico analysis, we hypothesized that this protein was an iron-dependent hemin-binding protein. In this study, we provide experimental evidence to prove that this protein, termed HbpA (hemin-binding protein A), is indeed an iron-regulated hemin-binding protein. We cloned and expressed the full-length 81-kDa recombinant rHbpA protein and a truncated 55-kDa protein from L. interrogans serovar Lai, both of which bind hemin-agarose. Assay of hemin-associated peroxidase activity and spectrofluorimetric analysis provided confirmatory evidence of hemin binding by HbpA. Immunofluorescence studies by confocal microscopy and the microscopic agglutination test demonstrated the surface localization and the iron-regulated expression of HbpA in L. interrogans. Southern blot analysis confirmed our earlier observation that the hbpA gene was present only in some of the pathogenic serovars and was absent in Leptospira biflexa. Hemin-agarose affinity studies showed another hemin-binding protein with a molecular mass of approximately 44 kDa, whose expression was independent of iron levels. This protein was seen in several serovars, including nonpathogenic L. biflexa. Sequence analysis and immunoreactivity with specific antibodies showed this protein to be LipL41.

  15. Expression of the Intermediate Filament Nestin in Gastrointestinal Stromal Tumors and Interstitial Cells of Cajal

    PubMed Central

    Tsujimura, Tohru; Makiishi-Shimobayashi, Chiaki; Lundkvist, Johan; Lendahl, Urban; Nakasho, Keiji; Sugihara, Ayako; Iwasaki, Teruo; Mano, Masayuki; Yamada, Naoko; Yamashita, Kunihiro; Toyosaka, Akihiro; Terada, Nobuyuki

    2001-01-01

    It has recently been proposed that gastrointestinal stromal tumors (GISTs) originate from stem cells that differentiate toward a phenotype of interstitial cells of Cajal (ICCs). Nestin is a newly identified intermediate filament protein, and is predominantly expressed in immature cells, such as neuroectodermal stem cells and skeletal muscle progenitor cells, and tumors originating from these cells. In this study, we examined, using immunohistochemistry, the nestin expression in GISTs and ICCs to clarify the origin of GISTs. Strong immunoreactivity for nestin was observed in all 18 GISTs, and its expression was confirmed by Western blot and Northern blot analyses. In contrast, three leiomyomas and a schwannoma that developed in the gastrointestinal tract showed no apparent immunoreactivity for nestin. Among 17 mesenchymal tumors (seven leiomyosarcomas, five malignant peripheral nerve sheath tumors, and five fibrosarcomas) that occurred in sites other than the gastrointestinal tract, only two malignant peripheral nerve sheath tumors were moderately immunoreactive for nestin. Furthermore, with fluorescence double immunostaining of the normal small intestine, nestin expression was demonstrated in ICCs. These results show that nestin may be a useful marker for diagnosis of GISTs, and support the current hypothesis that GISTs are tumors of stem cells that differentiate toward an ICC phenotype. PMID:11238030

  16. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  17. VGLUT1 and VGLUT2 innervation in autonomic regions of intact and transected rat spinal cord.

    PubMed

    Llewellyn-Smith, Ida J; Martin, Carolyn L; Fenwick, Natalie M; Dicarlo, Stephen E; Lujan, Heidi L; Schreihofer, Ann M

    2007-08-20

    Fast excitatory neurotransmission to sympathetic and parasympathetic preganglionic neurons (SPN and PPN) is glutamatergic. To characterize this innervation in spinal autonomic regions, we localized immunoreactivity for vesicular glutamate transporters (VGLUTs) 1 and 2 in intact cords and after upper thoracic complete transections. Preganglionic neurons were retrogradely labeled by intraperitoneal Fluoro-Gold or with cholera toxin B (CTB) from superior cervical, celiac, or major pelvic ganglia or adrenal medulla. Glutamatergic somata were localized with in situ hybridization for VGLUT mRNA. In intact cords, all autonomic areas contained abundant VGLUT2-immunoreactive axons and synapses. CTB-immunoreactive SPN and PPN received many close appositions from VGLUT2-immunoreactive axons. VGLUT2-immunoreactive synapses occurred on Fluoro-Gold-labeled SPN. Somata with VGLUT2 mRNA occurred throughout the spinal gray matter. VGLUT2 immunoreactivity was not noticeably affected caudal to a transection. In contrast, in intact cords, VGLUT1-immunoreactive axons were sparse in the intermediolateral cell column (IML) and lumbosacral parasympathetic nucleus but moderately dense above the central canal. VGLUT1-immunoreactive close appositions were rare on SPN in the IML and the central autonomic area and on PPN. Transection reduced the density of VGLUT1-immunoreactive axons in sympathetic subnuclei but increased their density in the parasympathetic nucleus. Neuronal cell bodies with VGLUT1 mRNA occurred only in Clarke's column. These data indicate that SPN and PPN are densely innervated by VGLUT2-immunoreactive axons, some of which arise from spinal neurons. In contrast, the VGLUT1-immunoreactive innervation of spinal preganglionic neurons is sparse, and some may arise from supraspinal sources. Increased VGLUT1 immunoreactivity after transection may correlate with increased glutamatergic transmission to PPN. (c) 2007 Wiley-Liss, Inc.

  18. ATZ11 recognizes not only Z-α1-antitrypsin-polymers and complexed forms of non-Z-α1-antitrypsin but also the von Willebrand factor.

    PubMed

    Goltz, Diane; Hittetiya, Kanishka; Yadegari, Hamideh; Driesen, Julia; Kirfel, Jutta; Neuhaus, Thomas; Steiner, Susanne; Esch, Christiane; Bedorf, Jörg; Hertfelder, Hans-Jörg; Fischer, Hans-Peter

    2014-01-01

    The ATZ11 antibody has been well established for the identification of α1-anti-trypsin (AAT) molecule type PiZ (Z-AAT) in blood samples and liver tissue. In this study, we systematically analyzed the antibody for additional binding sites in human tissue. Ultrastructural ATZ11 binding was investigated immunoelectron microscopically in human umbilical vein endothelial cells (HUVECs) and in platelets of a healthy individual. Human embryonic kidney (HEK293) cells were transiently transfected with Von Willebrand factor (VWF) and analyzed immunocytochemically using confocal microscopy and SDS-PAGE electrophoresis followed by western blotting (WB). Platelets and serum samples of VWF-competent and VWF-deficient patients were investigated using native PAGE and SDS-PAGE electrophoresis followed by WB. The specificity of the ATZ11 reaction was tested immunohistochemically by extensive antibody-mediated blocking of AAT- and VWF-antigens. ATZ11-positive epitopes could be detected in Weibel-Palade bodies (WPBs) of HUVECs and α-granules of platelets. ATZ11 stains pseudo-WBP containing recombinant wild-type VWF (rVWF-WT) in HEK293 cells. In SDS-PAGE electrophoresis followed by WB, anti-VWF and ATZ11 both identified rVWF-WT. However, neither rVWF-WT-multimers, human VWF-multimers, nor serum proteins of VWF-deficient patients were detected using ATZ11 by WB, whereas anti-VWF antibody (anti-VWF) detected rVWF-WT-multimers as well as human VWF-multimers. In human tissue specimens, AAT-antigen blockade using anti-AAT antibody abolished ATZ11 staining of Z-AAT in a heterozygous AAT-deficient patient, whereas VWF-antigen blockade using anti-VWF abolished ATZ11 staining of endothelial cells and megakaryocytes. ATZ11 reacts with cellular bound and denatured rVWF-WT and human VWF as shown using immunocytochemistry and subsequent confocal imaging, immunoelectron microscopy, SDS-PAGE and WB, and immunohistology. These immunoreactions are independent of the binding of Z-AAT-molecules and non-Z-AAT complexes.

  19. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  20. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  1. A two-step enzymatic modification method to reduce immuno-reactivity of milk proteins.

    PubMed

    Damodaran, Srinivasan; Li, Yan

    2017-12-15

    A two-step enzymatic approach to reduce immuno-reactivity of whey protein isolate and casein has been studied. The method involves partial hydrolysis of proteins with proteases, followed by repolymerization with microbial transglutaminase. Whey protein isolate partially hydrolyzed with chymotrypsin, trypsin, or thermolysin retained about 80%, 30%, and 20% of the original immuno-reactivity, respectively. Upon repolymerization the immuno-reactivity decreased to 45%, 35%, and 5%, respectively. The immuno-reactivity of hydrolyzed and repolymerized casein was negligible compared to native casein. The repolymerized products were partially resistant to in vitro digestion. Peptides released during digestion of repolymerized thermolysin-whey protein hydrolysate had less than 5% immuno-reactivity, whereas those of whey protein control exhibited a sinusoidal immuno-reactivity ranging from 5 to 20%. Peptides released during digestion of repolymerized thermolysin-casein hydrolysates had no immuno-reactivity. These results indicated that it is possible to produce hypoallergenic milk protein products using the two-step enzymatic modification method involving thermolysin and transglutaminase. Copyright © 2017. Published by Elsevier Ltd.

  2. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  3. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  4. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  5. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  6. Immunohistochemical localization of fatty acid transporters and MCT1 in the sebaceous glands of mouse skin.

    PubMed

    Zheng, Miao; Lee, Shinhye; Tsuzuki, Satoshi; Inoue, Kazuo; Masuda, Daisaku; Yamashita, Shizuya; Iwanaga, Toshihiko

    2016-01-01

    The sebaceous glands secrete sebum to protect the epidermis and hairs by the oily products. The glands express several transporters and binding proteins for the production of fatty acids and uptake of their sources. The present immunohistochemical study examined the expression and localization of CD36, MCT1, FATP4, and E-FABP in the sebaceous glands, including the meibomian and preputial glands of mice. CD36 and MCT1 in sebaceous glands were largely co-localized along the plasma membrane of secretory cells, while they were separately expressed in the glandular portion of meibomian and preputial glands. Immunoreactivities for FATP4 and E-FABP appeared diffusely in the cytoplasm of secretory cells. Genetic deletion of CD36 did not affect the immunolocalization of the three other molecules. The sebaceous glands were judged to be useful for analyzing the functions and relation of fatty acid transporters and binding proteins.

  7. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  8. Synaptology of luteinizing hormone-releasing hormone (LHRH)-immunoreactive cells in the nervus terminalis of the gray short-tailed opossum (Monodelphis domestica).

    PubMed

    Zheng, L M; Pfaff, D W; Schwanzel-Fukuda, M

    1990-05-08

    Light and electron microscopic immunocytochemistry were used to examine the structure of LHRH neurons and fibers in the nervus terminalis of the gray short-tailed opossum (Monodelphis domestica). LHRH-immunoreactive neurons and fibers form a loose plexus within the fascicular network of the ganglion terminale on the median surface of the olfactory bulb. There are at least two populations of LHRH-immunoreactive neurons within the network of the ganglion terminale: fusiform and round neurons similar to those described in the forebrain. At the ultrastructural level, axosomatic and axodendritic contacts were seen between LHRH-immunoreactive and nonimmunoreactive elements in the ganglion terminale. These contacts were classified as 1) synaptic input, with asymmetric synapses seen between a nonimmunoreactive axon terminal and a LHRH-immunoreactive cell body or a nonimmunoreactive axon terminal and a LHRH-immunoreactive dendritic process. 2) synaptic output, with symmetric synapses seen between LHRH-immunoreactive and nonimmunoreactive processes. This study is the first systematic examination of the ultrastructure of the LHRH-immunoreactive neurons and their synaptic contacts in the nervus terminalis. The possible integrative roles for this LHRH-immunoreactive system are discussed.

  9. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  10. Correlation Between Extravasation and Alterations of Cerebrovascular Laminin and β-Dystroglycan Immunoreactivity Following Cryogenic Lesions in Rats.

    PubMed

    Kálmán, Mihály; Tóth, László; Szöllosi, Dávid; Oszwald, Erzsébet; Mahalek, Judit; Sadeghian, Sam

    2017-11-01

    The blood-brain barrier becomes "leaky" following lesions. Former studies revealed that following lesions the immunoreactivity of cerebrovascular laminin becomes detectable whereas that of β-dystroglycan disappears. These alterations may be indicators of glio-vascular decoupling that may result in the impairment of the blood-brain-barrier. This study investigates correlation between the post-lesion extravasation and the above-mentioned immunohistochemical alterations. Following cryogenic lesions, the survival periods lasted 5, 10, 30 minutes, 1 or 12 hours, or 1 day. Some brains were fixed immediately post-lesion. Immunofluorescent reactions were performed in floating sections. The extravasation was detected with immunostaining for plasma fibronectin and rat immunoglobulins. When the survival period was 30 minutes or longer, the area of extravasation corresponded to the area of altered laminin and β-dystroglycan immunoreactivities. Following immediate fixation some laminin immunoreactivity was already detected. The extravasation seemed to precede this early appearance of laminin immunoreactivity. The β-dystroglycan immunoreactivity disappeared later. When the extravasation spread into the corpus callosum, vascular laminin immunoreactivity appeared but the β-dystroglycan immunoreactivity persisted. It seems that extravasation separates the glial and vascular basal laminae, which results in the appearance of laminin immunoreactivity. The disappearance of β-dystroglycan immunoreactivity is neither a condition nor an inevitable consequence of the 2 other phenomena. © 2017 American Association of Neuropathologists, Inc. All rights reserved.

  11. Immunoreactive prohormone atrial natriuretic peptides 1-30 and 31-67 - Existence of a single circulating amino-terminal peptide

    NASA Technical Reports Server (NTRS)

    Chen, Yu-Ming; Whitson, Peggy A.; Cintron, Nitza M.

    1990-01-01

    Sep-Pak C18 extraction of human plasma and radioimmunoassay using antibodies which recognize atrial natriuretic peptide (99-128) and the prohormone sequences 1-30 and 31-67 resulted in mean values from 20 normal subjects of 26.2 (+/- 9.2), 362 (+/- 173) and 368 (+/- 160) pg/ml, respectively. A high correlation coefficient between values obtained using antibodies recognizing prohormone sequences 1-30 and 31-67 was observed (R = 0.84). Extracted plasma immunoreactivity of 1-30 and 31-67 both eluted at 46 percent acetonitrile. In contrast, chromatographic elution of synthetic peptides 1-30 and 31-67 was observed at 48 and 39 percent acetonitrile, respectively. Data suggest that the radioimmunoassay of plasma using antibodies recognizing prohormone sequences 1-30 and 31-67 may represent the measurement of a unique larger amino-terminal peptide fragment containing antigenic sites recognized by both antisera.

  12. Independent inputs by VGLUT2- and VGLUT3-positive glutamatergic terminals onto rat sympathetic preganglionic neurons.

    PubMed

    Nakamura, Kazuhiro; Wu, Sheng-Xi; Fujiyama, Fumino; Okamoto, Keiko; Hioki, Hiroyuki; Kaneko, Takeshi

    2004-03-01

    To characterize glutamatergic axon terminals onto sympathetic preganglionic neurons (SPNs), we visualized immunohistochemically three vesicular glutamate transporters (VGLUTs) in the intermediolateral cell column (IML) of rat thoracic spinal cord. VGLUT2 and VGLUT3 immunoreactivities but not VGLUT1 immunoreactivity were distributed in the IML and found in terminals making asymmetric synapses and apposed to dendrites immunopositive for choline acetyltransferase, an SPN marker. VGLUT2 and VGLUT3 immunoreactivities were not co-localized with each other. A population of VGLUT2-immunoreactive but not VGLUT3-immunoreactive terminals were adrenergic or noradrenergic. Some of VGLUT3-immunoreactive but not VGLUT2-immunoreactive terminals contained serotonin. These results indicate at least two independent glutamatergic terminal populations, which include a distinct monoaminergic subpopulation, making excitatory inputs onto SPNs. Copyright 2004 Lippincott Williams & Wilkins

  13. The morphological and chemical characteristics of striatal neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the rat.

    PubMed

    Waldvogel, H J; Kubota, Y; Trevallyan, S C; Kawaguchi, Y; Fritschy, J M; Mohler, H; Faull, R L

    1997-10-01

    The distribution, morphology and chemical characteristics of neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the striatum of the basal ganglia in the rat brain were investigated at the light, confocal and electron microscope levels using single, double and triple immunohistochemical labelling techniques. The results showed that alpha1-subunit immunoreactive neurons were sparsely distributed throughout the rat striatum. Double and triple labelling results showed that all the alpha1-subunit-immunoreactive neurons were positive for glutamate decarboxylase and immunoreactive for the beta2,3 and gamma2 subunits of the GABA(A) receptor. Three types of alpha1-subunit-immunoreactive neurons were identified in the striatum on the basis of cellular morphology and chemical characteristics. The most numerous alpha1-subunit-immunoreactive neurons were medium-sized, aspiny neurons with a widely branching dendritic tree. They were parvalbumin-negative and were located mainly in the dorsolateral regions of the striatum. Electron microscopy showed that these neurons had an indented nuclear membrane, typical of striatal interneurons, and were surrounded by small numbers of axon terminals which established alpha1-subunit-immunoreactive synaptic contacts with the soma and dendrites. These cells were classified as type 1 alpha1-subunit-immunoreactive neurons and comprised 75% of the total population of alpha1-subunit-immunoreactive neurons in the striatum. The remaining alpha1-subunit-immunoreactive neurons comprised of a heterogeneous population of large-sized neurons localized in the ventral and medial regions of the striatum. The most numerous large-sized cells were parvalbumin-negative, had two to three relatively short branching dendrites and were designated type 2 alpha1-subunit-immunoreactive neurons. Electron microscopy showed that the type 2 neurons were characterized by a highly convoluted nuclear membrane and were sparsely covered with small axon terminals. The type 2 neurons comprised 20% of the total population of alpha1-subunit-immunoreactive neurons. The remaining large-sized alpha1-immunoreactive cells were designated type 3 cells; they were positive for parvalbumin and were distinguished by long branching dendrites extending dorsally for 600-800 microm into the striatum. These neurons comprised 5% of the total population of alpha1-subunit-immunoreactive neurons and were surrounded by enkephalin-immunoreactive terminals. Electron microscopy showed that the alpha1-subunit type 3 neurons had an indented nuclear membrane and were densely covered with small axon terminals which established alpha1-subunit-immunoreactive symmetrical synaptic contacts with the soma and dendrites. These results provide a detailed characterization of the distribution, morphology and chemical characteristics of the alpha1-subunit-immunoreactive neurons in the rat striatum and suggest that the type 1 and type 2 neurons comprise of separate populations of striatal interneurons while the type 3 neurons may represent the large striatonigral projection neurons described by Bolam et al. [Bolam J. P., Somogyi P., Totterdell S. and Smith A. D. (1981) Neuroscience 6, 2141-2157.].

  14. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  15. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  16. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  17. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  18. Highly sensitive and selective surface plasmon resonance sensor for detection of sub-ppb levels of benzo[a]pyrene by indirect competitive immunoreaction method.

    PubMed

    Miura, Norio; Sasaki, Makoto; Gobi, K Vengatajalabathy; Kataoka, Chiwa; Shoyama, Yukihiro

    2003-07-01

    A surface plasmon resonance (SPR)-immunosensor for detection of benzo[a]pyrene (BaP) is developed by using a model BaP-hapten compound, BaP-bovine serum albumin conjugate (BaP-BSA), and an anti-BaP-BSA monoclonal antibody. BaP-BSA conjugate is immobilized on a gold thin-film sensor chip by means of simple physical adsorption. The number of BaP-hapten units in BaP-BSA conjugate is estimated to be 28 from the difference in molecular weight (MW) between BaP-BSA conjugate and BSA based on the results of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) measurement. Anti-BaP-BSA antibody on contact with the BaP-BSA conjugate immobilized sensor chip causes an increase in the incident angle of the sensor chip. Binding of anti-BaP-BSA antibody with surface-immobilized BaP-BSA conjugate is inhibited by the presence of BaP in analyte solution, because of the inhibition effect of BaP. The SPR immunosensor for BaP functioning with the indirect competitive immunoreaction of anti-BaP-BSA antibody between the analyte (BaP) in testing solution and the BaP-BSA conjugate immobilized on the sensor chip provides a rapid determination (response time: ca. 15 min) of BaP in the concentration range of 0.01-1000 ppb. The antibody anchored to the sensor chip by antigen-antibody binding is removed on treatment with a pepsin solution (pH 2.0) for few minutes. The SPR sensor chip is found to be reusable for more than 20 times with a little decrease (<7%) in the sensor response. Detection of BaP by direct competitive immunoreactions is also carried out by enzyme-linked immunosorbent assay (ELISA). The concentration of BaP could be determined as low as 0.01 ppb and 2 ppb using the SPR sensor and the ELISA method, respectively. The SPR sensor is found to detect BaP selectively in the presence of 2-hydroxybiphenyl (HBP); the incident angle shift of the SPR sensor for BaP is found to be same irrespective to the presence or the absence of a same concentration (as much as 30 ppb) of HBP together.

  19. Comparative Distribution of Relaxin-3 Inputs and Calcium-Binding Protein-Positive Neurons in Rat Amygdala

    PubMed Central

    Santos, Fabio N.; Pereira, Celia W.; Sánchez-Pérez, Ana M.; Otero-García, Marcos; Ma, Sherie; Gundlach, Andrew L.; Olucha-Bordonau, Francisco E.

    2016-01-01

    The neural circuits involved in mediating complex behaviors are being rapidly elucidated using various newly developed and powerful anatomical and molecular techniques, providing insights into the neural basis for anxiety disorders, depression, addiction, and dysfunctional social behaviors. Many of these behaviors and associated physiological processes involve the activation of the amygdala in conjunction with cortical and hippocampal circuits. Ascending subcortical projections provide modulatory inputs to the extended amygdala and its related nodes (or “hubs”) within these key circuits. One such input arises from the nucleus incertus (NI) in the tegmentum, which sends amino acid- and peptide-containing projections throughout the forebrain. Notably, a distinct population of GABAergic NI neurons expresses the highly-conserved neuropeptide, relaxin-3, and relaxin-3 signaling has been implicated in the modulation of reward/motivation and anxiety- and depressive-like behaviors in rodents via actions within the extended amygdala. Thus, a detailed description of the relaxin-3 innervation of the extended amygdala would provide an anatomical framework for an improved understanding of NI and relaxin-3 modulation of these and other specific amygdala-related functions. Therefore, in this study, we examined the distribution of NI projections and relaxin-3-positive elements (axons/fibers/terminals) within the amygdala, relative to the distribution of neurons expressing the calcium-binding proteins, parvalbumin (PV), calretinin (CR) and/or calbindin. Anterograde tracer injections into the NI revealed a topographic distribution of NI efferents within the amygdala that was near identical to the distribution of relaxin-3-immunoreactive fibers. Highest densities of anterogradely-labeled elements and relaxin-3-immunoreactive fibers were observed in the medial nucleus of the amygdala, medial divisions of the bed nucleus of the stria terminalis (BST) and in the endopiriform nucleus. In contrast, sparse anterogradely-labeled and relaxin-3-immunoreactive fibers were observed in other amygdala nuclei, including the lateral, central and basal nuclei, while the nucleus accumbens lacked any innervation. Using synaptophysin as a synaptic marker, we identified relaxin-3 positive synaptic terminals in the medial amygdala, BST and endopiriform nucleus of amygdala. Our findings demonstrate the existence of topographic NI and relaxin-3-containing projections to specific nuclei of the extended amygdala, consistent with a likely role for this putative integrative arousal system in the regulation of amygdala-dependent social and emotional behaviors. PMID:27092060

  20. Comparative Distribution of Relaxin-3 Inputs and Calcium-Binding Protein-Positive Neurons in Rat Amygdala.

    PubMed

    Santos, Fabio N; Pereira, Celia W; Sánchez-Pérez, Ana M; Otero-García, Marcos; Ma, Sherie; Gundlach, Andrew L; Olucha-Bordonau, Francisco E

    2016-01-01

    The neural circuits involved in mediating complex behaviors are being rapidly elucidated using various newly developed and powerful anatomical and molecular techniques, providing insights into the neural basis for anxiety disorders, depression, addiction, and dysfunctional social behaviors. Many of these behaviors and associated physiological processes involve the activation of the amygdala in conjunction with cortical and hippocampal circuits. Ascending subcortical projections provide modulatory inputs to the extended amygdala and its related nodes (or "hubs") within these key circuits. One such input arises from the nucleus incertus (NI) in the tegmentum, which sends amino acid- and peptide-containing projections throughout the forebrain. Notably, a distinct population of GABAergic NI neurons expresses the highly-conserved neuropeptide, relaxin-3, and relaxin-3 signaling has been implicated in the modulation of reward/motivation and anxiety- and depressive-like behaviors in rodents via actions within the extended amygdala. Thus, a detailed description of the relaxin-3 innervation of the extended amygdala would provide an anatomical framework for an improved understanding of NI and relaxin-3 modulation of these and other specific amygdala-related functions. Therefore, in this study, we examined the distribution of NI projections and relaxin-3-positive elements (axons/fibers/terminals) within the amygdala, relative to the distribution of neurons expressing the calcium-binding proteins, parvalbumin (PV), calretinin (CR) and/or calbindin. Anterograde tracer injections into the NI revealed a topographic distribution of NI efferents within the amygdala that was near identical to the distribution of relaxin-3-immunoreactive fibers. Highest densities of anterogradely-labeled elements and relaxin-3-immunoreactive fibers were observed in the medial nucleus of the amygdala, medial divisions of the bed nucleus of the stria terminalis (BST) and in the endopiriform nucleus. In contrast, sparse anterogradely-labeled and relaxin-3-immunoreactive fibers were observed in other amygdala nuclei, including the lateral, central and basal nuclei, while the nucleus accumbens lacked any innervation. Using synaptophysin as a synaptic marker, we identified relaxin-3 positive synaptic terminals in the medial amygdala, BST and endopiriform nucleus of amygdala. Our findings demonstrate the existence of topographic NI and relaxin-3-containing projections to specific nuclei of the extended amygdala, consistent with a likely role for this putative integrative arousal system in the regulation of amygdala-dependent social and emotional behaviors.

  1. Ultrastructural characterization of the tau-immunoreactive tubules in the oligodendroglial perikarya and their inner loop processes in progressive supranuclear palsy.

    PubMed

    Arima, K; Nakamura, M; Sunohara, N; Ogawa, M; Anno, M; Izumiyama, Y; Hirai, S; Ikeda, K

    1997-06-01

    Coiled bodies and interfascicular threads are conspicuous white matter abnormalities of brains of patients with progressive supranuclear palsy (PSP). Both structures are argyrophilic and immunoreactive for the microtubule-binding protein tau. This report concerns the ultrastructural localization of interfascicular threads and their relationship to coiled bodies in five PSP patients. We showed for the first time that abnormal tubules with a 13- to 15-nm diameter and fuzzy outer contours were the common structures of coiled bodies in the oligodendroglial perikarya and of interfascicular threads. Moreover, the tubules were immunolabeled by anti-tau antibodies. The abnormal tau-positive tubules of interfascicular threads were located in the inner loop of the myelin sheath. Our study further indicated that the thread-like structures in the white matter comprised, at least in part, oligodendroglial processes, and that they were also present in gray matter. We consider that the formation of coiled bodies in the perikarya and of interfascicular threads represents a common cytoskeletal abnormality of the oligodendroglia of PSP patients. Moreover, even though the white matter alterations of PSP resemble those of corticobasal degeneration, there are certain ultrastructural differences in the abnormal oligodendroglial tubules of the two diseases.

  2. Pre-treated Populus tomentiglandulosa extract inhibits neuronal loss and alleviates gliosis in the gerbil hippocampal CA1 area induced by transient global cerebral ischemia

    PubMed Central

    Park, Joon Ha; Lee, Tae-Kyeong; Ahn, Ji Hyeon; Shin, Bich-Na; Cho, Jeong Hwi; Kim, In Hye; Lee, Jae-Chul; Kim, Jong-Dai; Lee, Young Joo; Kang, Il Jun; Hong, Seongkweon; Kim, Yang Hee; Jeon, Yong Hwan

    2017-01-01

    The genus Populus (poplar) belonging to the Salicaceae family has been used in traditional medicine, and its several species show various pharmacological properties including antioxidant and anti-inflammatory effects. No study regarding protective effects of Populus species against cerebral ischemia has been reported. Therefore, in the present study, we examined neuroprotective effects of ethanol extract from Populus tomentiglandulosa (Korea poplar) in the hippocampal cornu ammonis (CA1) area of gerbils subjected to 5 minutes of transient global cerebral ischemia. Pretreatment with 200 mg/kg of P. tomentiglandulosa extract effectively protected CA1 pyramidal neurons from transient global cerebral ischemia. In addition, glial fibrillary acidic protein immunoreactive astrocytes and ionized calcium binding adapter molecule 1 immunoreactive microglia were significantly diminished in the ischemic CA1 area by pretreatment with 200 mg/kg of P. tomentiglandulosa extract. Briefly, our results indicate that pretreatment with P. tomentiglandulosa extract protects neurons from transient cerebral ischemic injury and diminish cerebral ischemia-induced reactive gliosis in ischemic CA1 area. Based on these results, we suggest that P. tomentiglandulosa can be used as a potential candidate for prevention of ischemic injury. PMID:29354300

  3. The goldfish nervus terminalis: a luteinizing hormone-releasing hormone and molluscan cardioexcitatory peptide immunoreactive olfactoretinal pathway.

    PubMed Central

    Stell, W K; Walker, S E; Chohan, K S; Ball, A K

    1984-01-01

    Antisera to two putative neurotransmitters, luteinizing hormone-releasing hormone (LHRH) and molluscan cardioexcitatory tetrapeptide (H-Phe-Met-Arg-Phe-NH2; FMRF-amide), bind specifically to neurites in the inner nuclear and inner plexiform layers of the goldfish retina. Retrograde labeling showed that intraocular axon terminals originate from the nervus terminalis, whose cell bodies are located in the olfactory nerves. Double immunocytochemical and retrograde labeling showed that some terminalis neurons project to the retina; others may project only within the brain. All terminalis neurons having proven retinal projections were both LHRH- and FMRF-amide-immunoreactive. The activity of retinal ganglion cells was recorded with microelectrodes in isolated superfused goldfish retinas. In ON- and OFF-center double-color-opponent cells, micromolar FMRF-amide and salmon brain gonadotropin-releasing factor ( [Trp7, Leu8] LHRH) caused increased spontaneous activity in the dark, loss of light-induced inhibition, and increased incidence of light-entrained pulsatile response. The nervus terminalis is therefore a putatively peptidergic retinopetal projection. Sex-related olfactory stimuli may act through it, thereby modulating the output of ganglion cells responsive to color contrast. Images PMID:6199789

  4. Action of substance P and interaction of calcitonin gene-related peptide and substance P on the cat antral circular muscle.

    PubMed

    Ouyang, A; Broussard, D L; Feng, H S

    1998-10-16

    The actions of substance P (SP) and calcitonin gene-related peptide (CGRP) and their interaction were examined in vitro in the feline antrum and colon. Circular muscle contraction was seen in the antrum to both peptides, but only to SP in the proximal colon. Antral contraction was enhanced when both peptides were given together. This interaction was inhibited by tetrodotoxin or atropine. SP acted at the antrum via a smooth muscle neurokinin receptor which is not a (NK)-1 receptor. SP binding was displaced by neurokinin A but not by the NK-1 receptor antagonist, CP-96345. The colonic response was inhibited by CP-96345. Immunohistochemistry revealed SP-like immunoreactivity (SP-LI) in fibers in the antral myenteric plexus and circular muscle, while CGRP-like immunoreactivity (CGRP-LI) was seen in the myenteric plexus only, without co-localization. These studies supported the hypothesis that SP acted via the NK-2 receptor at the feline circular muscle in the antrum to induce contraction and at the NK-1 receptor in the proximal colon. CGRP enhanced the effect of SP via a cholinergic pathway.

  5. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  6. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  7. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  8. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  10. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  11. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  12. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  13. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  15. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Serial measurement of pancreatic lipase immunoreactivity concentration in dogs with immune-mediated disease treated with prednisolone.

    PubMed

    Ohta, H; Morita, T; Yokoyama, N; Osuga, T; Sasaki, N; Morishita, K; Nakamura, K; Takiguchi, M

    2017-06-01

    In this pilot study, serum canine pancreatic lipase immunoreactivity was measured repeatedly in dogs with various immune-mediated diseases that were treated with immunosuppressive doses of prednisolone. Ten client-owned dogs with newly diagnosed immune-mediated disease that had normal canine pancreatic lipase immunoreactivity concentrations (≤200 µg/l) were treated with 2 to 2.2 mg/kg prednisolone orally once daily as the initial treatment. Serum samples were obtained from each of the dogs prior to treatment and at 1- to 4-week intervals during immunosuppressive treatment. The highest canine pancreatic lipase immunoreactivity concentration detected during immunosuppressive treatment was defined as the peak canine pancreatic lipase immunoreactivity. Peak canine pancreatic lipase immunoreactivity concentrations were classified as normal in two dogs, questionable (201 to 399 µg/l) in three dogs, and abnormal (≥400 µg/l) in five dogs. Peak canine pancreatic lipase immunoreactivity concentrations were significantly higher than baseline canine pancreatic lipase immunoreactivity concentrations but there was no evidence of clinical pancreatitis. It remains unclear whether the five of 10 dogs with elevated canine pancreatic lipase immunoreactivity during prednisone treatment had subclinical pancreatitis or whether the abnormal results were a consequence of prednisolone administration. © 2017 British Small Animal Veterinary Association.

  17. Distribution of TRPV1- and TRPV2-immunoreactive afferent nerve endings in rat trachea.

    PubMed

    Yamamoto, Yoshio; Sato, Yoshikazu; Taniguchi, Kazuyuki

    2007-12-01

    Nociception in the trachea is important for respiratory modulation. We investigated the distribution, neurochemical characteristics, and origin of nerve endings with immunoreactivity for candidate sensor channels, TRPV1 and TRPV2, in rat trachea. In the epithelial layer, the intraepithelial nerve endings and dense subepithelial network of nerve fibers were immunoreactive for TRPV1. In contrast, TRPV2 immunoreactivity was observed mainly in nerve fibers of the tracheal submucosal layer and in several intrinsic ganglion cells in the peritracheal plexus. Double immunostaining revealed that some TRPV1-immunoreactive nerve fibers were also immunoreactive for substance P or calcitonin gene-related peptide, but neither neuropeptide colocalized with TRPV2. Injection of the retrograde tracer, fast blue, into the tracheal wall near the thoracic inlet demonstrated labeled neurons in the jugular, nodose, and dorsal root ganglia at segmental levels of C2-C8. In the jugular and nodose ganglia, 59.3% (70/118) and 10.7% (17/159), respectively, of fast blue-labeled neurons were immunoreactive for TRPV1, compared to 8.8% (8/91) and 2.6% (5/191) for TRPV2-immunoreactive. Our results indicate that TRPV1-immunoreactive nerve endings are important for tracheal nociception, and the different expression patterns of TRPV1 and TRPV2 with neuropeptides may reflect different subpopulations of sensory neurons.

  18. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  19. Preparation and preclinical evaluation of 131 I-trastuzumab for breast cancer.

    PubMed

    Kameswaran, Mythili; Gota, Vikram; Ambade, Rajwardhan; Gupta, Sudeep; Dash, Ashutosh

    2017-01-01

    Trastuzumab that targets the human epidermal growth factor receptor type 2 (HER2) is known to benefit patients with HER2+ metastatic breast cancer. The objective was to explore the potential of 131 I-trastuzumab for treatment of breast cancers. Radioiodination of trastuzumab was carried out by chloramine-T method, purified by using PD-10 column, and characterized by size exclusion high-performance liquid chromatography on a gel column. In vitro studies were carried out in HER2+ cells to determine the specificity of the radioimmunoconjugate. Uptake and retention of 131 I-trastuzumab were determined by biodistribution studies in tumor-bearing non-obese diabetic/severe combined immunodeficiency and normal severe combined immunodeficiency mice. The radiochemical purity (RCP) of 131 I-trastuzumab was 98 ± 0.4% with retention time of 17 minutes by high-performance liquid chromatography. In vitro stability studies exhibited RCP of more than 90% in serum at 37°C after 120 hours of radioiodination. In vitro cell binding with 131 I-trastuzumab in HER2+ cells showed binding of 28% to 35% which was inhibited significantly, with unlabeled trastuzumab confirming its specificity. K d value of 131 I-trastuzumab was 0.5 nM, while its immunoreactivity was more than 80%. Uptake of more than 12% and retention were observed in the tumors up to 120 hours p.i. 131 I-trastuzumab prepared in-house-exhibited RCP of more than 98%, excellent immunoreactivity, affinity to HER2+ cell lines and good tumor uptake thereby indicating its potential for further evaluation in HER2+ breast cancers. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Effects of pyridoxine on a high-fat diet-induced reduction of cell proliferation and neuroblast differentiation depend on cyclic adenosine monophosphate response element binding protein in the mouse dentate gyrus.

    PubMed

    Yoo, Dae Young; Kim, Woosuk; Yoo, Ki-Yeon; Nam, Sung Min; Chung, Jin Young; Yoon, Yeo Sung; Won, Moo-Ho; Hwang, In Koo

    2012-08-01

    In this study, we challenged pyridoxine to mice fed a high-fat diet (HFD) and investigated the effects of pyridoxine on HFD-induced phenotypes such as blood glucose, reduction of cell proliferation and neuroblast differentiation in the dentate gyrus using Ki67 and doublecortin (DCX), respectively. Mice were fed a commercially available low-fat diet (LFD) as control diet or HFD (60% fat) for 8 weeks. After 5 weeks of LFD or HFD treatment, 350 mg/kg pyridoxine was administered for 3 weeks. The administration of pyridoxine significantly decreased body weight in the HFD-treated group. In addition, there were no significant differences in hepatic histology and pancreatic insulin-immunoreactive (-ir) and glucagon-ir cells of the HFD-treated group after pyridoxine treatment. In the HFD-fed group, Ki67-positive nuclei and DCX-ir neuroblasts were significantly decreased in the dentate gyrus compared with those in the LFD-fed mice. However, the administration of pyridoxine significantly increased Ki67-positive nuclei and DCX-ir neuroblasts in the dentate gyrus in both LFD- and HFD-fed mice. In addition, the administration of pyridoxine significantly increased the protein levels of glutamic acid decarboxylase 67 (GAD67) and brain-derived neurotrophic factor (BDNF) and the immunoreactivity of phosphorylated cyclic AMP response element binding protein (pCREB) compared with the vehicle-treated LFD- and HFD-fed mice. In contrast, the administration of pyridoxine significantly decreased HFD-induced malondialdehyde (MDA) levels in the hippocampus. These results showed that pyridoxine supplement reduced the HFD-induced reduction of cell proliferation and neuroblast differentiation in the dentate gyrus via controlling the levels of GAD67, pCREB, BDNF, and MDA. Copyright © 2012 Wiley Periodicals, Inc.

  1. Topographic specializations of catecholaminergic cells and ganglion cells and distribution of calcium binding proteins in the crepuscular rock cavy (Kerodon rupestris) retina.

    PubMed

    Oliveira, Francisco Gilberto; Nascimento-Júnior, Expedito Silva do; Cavalcante, Judney Cley; Guzen, Fausto Pierdoná; Cavalcante, Jeferson de Souza; Soares, Joacil Germano; Cavalcanti, José Rodolfo Lopes de Paiva; Freitas, Leandro Moura de; Costa, Miriam Stela Maris de Oliveira; Andrade-da-Costa, Belmira Lara da Silveira

    2018-07-01

    The rock cavy (Kerodon rupestris) is a crepuscular Hystricomorpha rodent that has been used in comparative analysis of retinal targets, but its retinal organization remains to be investigated. In order to better characterize its visual system, the present study analyzed neurochemical features related to the topographic organization of catecholaminergic cells and ganglion cells, as well the distribution of calcium-binding proteins in the outer and inner retina. Retinal sections and/or wholemounts were processed using tyrosine hydroxylase (TH), GABA, calbindin, parvalbumin and calretinin immunohistochemistry or Nissl staining. Two types of TH-immunoreactive (TH-IR) cells were found which differ in soma size, dendritic arborization, intensity of TH immunoreactivity and stratification pattern in the inner plexiform layer. The topographic distribution of all TH-IR cells defines a visual streak along the horizontal meridian in the superior retina. The ganglion cells are also distributed in a visual streak and the visual acuity estimated considering their peak density is 4.13 cycles/degree. A subset of TH-IR cells express GABA or calbindin. Calretinin is abundant in most of retinal layers and coexists with calbindin in horizontal cells. Parvalbumin is less abundant and expressed by presumed amacrine cells in the INL and some ganglion cells in the GCL. The topographic distribution of TH-IR cells and ganglion cells in the rock cavy retina indicate a suitable adaptation for using a broad extension of its inferior visual field in aspects that involve resolution, adjustment to ambient light intensity and movement detection without specialized eye movements. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Endogenous ghrelin-O-acyltransferase (GOAT) acylates local ghrelin in the hippocampus.

    PubMed

    Murtuza, Mohammad I; Isokawa, Masako

    2018-01-01

    Ghrelin is an appetite-stimulating peptide. Serine 3 on ghrelin must be acylated by octanoate via the enzyme ghrelin-O-acyltransferase (GOAT) for the peptide to bind and activate the cognate receptor, growth hormone secretagogue receptor type 1a (GHSR1a). Interest in GHSR1a increased dramatically when GHSR1a mRNA was demonstrated to be widespread in the brain, including the cortex and hippocampus, indicating that it has multifaceted functions beyond the regulation of metabolism. However, the source of octanoylated ghrelin for GHSR1a in the brain, outside of the hypothalamus, is not well understood. Here, we report the presence of GOAT and its ability to acylate non-octanoylated ghrelin in the hippocampus. GOAT immunoreactivity is aggregated at the base of the dentate granule cell layer in the rat and wild-type mouse. This immunoreactivity was not affected by the pharmacological inhibition of GHSR1a or the metabolic state-dependent fluctuation of systemic ghrelin levels. However, it was absent in the GHSR1a knockout mouse hippocampus, pointing the possibility that the expression of GHSR1a may be a prerequisite for the production of GOAT. Application of fluorescein isothiocyanate (FITC)-conjugated non-octanoylated ghrelin in live hippocampal slice culture (but not in fixed culture or in the presence of GOAT inhibitors) mimicked the binding profile of FITC-conjugated octanoylated ghrelin, suggesting that extracellularly applied non-octanoylated ghrelin was acylated by endogenous GOAT in the live hippocampus while GOAT being mobilized out of neurons. Our results will advance the understanding for the role of endogenous GOAT in the hippocampus and facilitate the search for the source of ghrelin that is intrinsic to the brain. © 2017 International Society for Neurochemistry.

  3. Neuroprotective efficacy of curcumin in arsenic induced cholinergic dysfunctions in rats.

    PubMed

    Yadav, Rajesh S; Chandravanshi, Lalit P; Shukla, Rajendra K; Sankhwar, Madhu L; Ansari, Reyaz W; Shukla, Pradeep K; Pant, Aditya B; Khanna, Vinay K

    2011-12-01

    Our recent studies have shown that curcumin protects arsenic induced neurotoxicity by modulating oxidative stress, neurotransmitter levels and dopaminergic system in rats. As chronic exposure to arsenic has been associated with cognitive deficits in humans, the present study has been carried out to implore the neuroprotective potential of curcumin in arsenic induced cholinergic dysfunctions in rats. Rats treated with arsenic (sodium arsenite, 20mg/kg body weight, p.o., 28 days) exhibited a significant decrease in the learning activity, assessed by passive avoidance response associated with decreased binding of (3)H-QNB, known to label muscarinic-cholinergic receptors in hippocampus (54%) and frontal cortex (27%) as compared to controls. Decrease in the activity of acetylcholinesterase in hippocampus (46%) and frontal cortex (33%), staining of Nissl body, immunoreactivity of choline acetyltransferase (ChAT) and expression of ChAT protein in hippocampal region was also observed in arsenic treated rats as compared to controls. Simultaneous treatment with arsenic and curcumin (100mg/kg body weight, p.o., 28 days) increased learning and memory performance associated with increased binding of (3)H-QNB in hippocampus (54%), frontal cortex (25%) and activity of acetylcholinesterase in hippocampus (41%) and frontal cortex (29%) as compared to arsenic treated rats. Increase in the expression of ChAT protein, immunoreactivity of ChAT and staining of Nissl body in hippocampal region was also observed in rats simultaneously treated with arsenic and curcumin as compared to those treated with arsenic alone. The results of the present study suggest that curcumin significantly modulates arsenic induced cholinergic dysfunctions in brain and also exhibits neuroprotective efficacy of curcumin. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. KChIPs and Kv4 alpha subunits as integral components of A-type potassium channels in mammalian brain.

    PubMed

    Rhodes, Kenneth J; Carroll, Karen I; Sung, M Amy; Doliveira, Lisa C; Monaghan, Michael M; Burke, Sharon L; Strassle, Brian W; Buchwalder, Lynn; Menegola, Milena; Cao, Jie; An, W Frank; Trimmer, James S

    2004-09-08

    Voltage-gated potassium (Kv) channels from the Kv4, or Shal-related, gene family underlie a major component of the A-type potassium current in mammalian central neurons. We recently identified a family of calcium-binding proteins, termed KChIPs (Kv channel interacting proteins), that bind to the cytoplasmic N termini of Kv4 family alpha subunits and modulate their surface density, inactivation kinetics, and rate of recovery from inactivation (An et al., 2000). Here, we used single and double-label immunohistochemistry, together with circumscribed lesions and coimmunoprecipitation analyses, to examine the regional and subcellular distribution of KChIPs1-4 and Kv4 family alpha subunits in adult rat brain. Immunohistochemical staining using KChIP-specific monoclonal antibodies revealed that the KChIP polypeptides are concentrated in neuronal somata and dendrites where their cellular and subcellular distribution overlaps, in an isoform-specific manner, with that of Kv4.2 and Kv4.3. For example, immunoreactivity for KChIP1 and Kv4.3 is concentrated in the somata and dendrites of hippocampal, striatal, and neocortical interneurons. Immunoreactivity for KChIP2, KChIP4, and Kv4.2 is concentrated in the apical and basal dendrites of hippocampal and neocortical pyramidal cells. Double-label immunofluorescence labeling revealed that throughout the forebrain, KChIP2 and KChIP4 are frequently colocalized with Kv4.2, whereas in cortical, hippocampal, and striatal interneurons, KChIP1 is frequently colocalized with Kv4.3. Coimmunoprecipitation analyses confirmed that all KChIPs coassociate with Kv4 alpha subunits in brain membranes, indicating that KChIPs 1-4 are integral components of native A-type Kv channel complexes and are likely to play a major role as modulators of somatodendritic excitability.

  5. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  6. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  7. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  8. Calbindin-immunoreactive cells in the fish enteric nervous system.

    PubMed

    Olsson, Catharina

    2011-01-20

    Calbindin is present in a large proportion of the intrinsic primary afferent neurons (IPANs) in the mammalian gut. Little is known about either calbindin or IPANs in fish. In the present study, calbindin immunoreactivity was investigated in the enteric nervous system of the teleost shorthorn sculpin (Myoxocephalus scorpius). Calbindin-immunoreactive nerve cell bodies and nerve fibres were present in all the gut regions except the cardiac stomach. The highest proportion was found in the proximal intestine where calbindin-immunoreactive cells constituted 59±6% (N=3) of the total Hu C/D-immunoreactive myenteric nerve cell population. In other regions, calbindin-immunoreactive cells constituted around 30% of the total population. The cells were generally multipolar with one long axon. The size distribution differed significantly between calbindin-positive and calbindin-negative cells in each of the three animals examined. Calbindin-positive neurons in the proximal intestine had a mean cross-sectional soma area of 163±73μm(2) (n=183 cells) while calbindin-negative cells were 348±221μm(2) (n=127 cells). Calbindin immunoreactivity colocalised to a large extent with serotonin immunoreactivity, but not with choline acetyltransferase (ChAT)-immunoreactivity. Thus, the calbindin-immunoreactive nerve cell population in the shorthorn sculpin gut seems to constitute a homogenous subpopulation of the enteric neurons, at least when considering the size and content of some transmitters. Whether markers other than serotonin and ChAT would differentiate the population remains to be tested. In conclusion, the calbindin-immunoreactive cells in the sculpin differ from mammalian IPANs with regard to several parameters and future functional studies could hopefully add information about the role of this large group of cells in the fish enteric nervous system. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Amyloid-β expression in retrosplenial cortex of 3xTg-AD mice: relationship to cholinergic axonal afferents from medial septum

    PubMed Central

    Robertson, Richard T.; Baratta, Janie; Yu, Jen; LaFerla, Frank M.

    2009-01-01

    Triple transgenic (3xTg-AD) mice harboring the presenilin 1, amyloid precursor protein, and tau transgenes (Oddo et al., 2003) display prominent levels of amyloid-beta (Aβ) immunoreactivity in forebrain regions. The Aβ immunoreactivity is first seen intracellularly in neurons and later as extracellular plaque deposits. The present study examined Aβ immunoreactivity that occurs in layer III of the granular division of retrosplenial cortex (RSg). This pattern of Aβ immunoreactivity in layer III of RSg develops relatively late, and is seen in animals older than 14 mo. The appearance of the Aβ immunoreactivity is similar to an axonal terminal field and thus may offer a unique opportunity to study the relationship between afferent projections and the formation of Aβ deposits. Axonal tract tracing techniques demonstrated that the pattern of axon terminal labeling in layer III of RSg, following placement of DiI in medial septum, is remarkably similar to the pattern of cholinergic axons in RSg, as detected by acetylcholinesterase histochemical staining, choline acetyltransferase immunoreactivity, or p75 receptor immunoreactivity; this pattern also is strikingly similar to the band of Aβ immunoreactivity. In animals sustaining early damage to the medial septal nucleus (prior to the advent of Aβ immunoreactivity), the band of Aβ in layer III of RSg does not develop; the corresponding band of cholinergic markers also is eliminated. In older animals (after the appearance of the Aβ immunoreactivity) damage to cholinergic afferents by electrolytic lesions, immunotoxin lesions, or cutting the cingulate bundle, result in a rapid loss of the cholinergic markers and a slower reduction of Aβ immunoreactivity. These results suggest that the septal cholinergic axonal projections transport Aβ or APP to layer III of RSg. PMID:19772895

  10. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  11. Interleukin (IL)-8 immunoreactivity of injured axons and surrounding oligodendrocytes in traumatic head injury.

    PubMed

    Hayashi, Takahito; Ago, Kazutoshi; Nakamae, Takuma; Higo, Eri; Ogata, Mamoru

    2016-06-01

    Interleukin (IL)-8 has been suggested to be a positive regulator of myelination in the central nervous system, in addition to its principal role as a chemokine for neutrophils. Immunostaining for beta-amyloid precursor protein (AβPP) is an effective tool for detecting traumatic axonal injury, although AβPP immunoreactivity can also indicate axonal injury due to hypoxic causes. In this study, we examined IL-8 and AβPP immunoreactivity in sections of corpus callosum obtained from deceased patients with blunt head injury and from equivalent control tissue. AβPP immunoreactivity was detected in injured axons, such as axonal bulbs and varicose axons, in 24 of 44 head injury cases. These AβPP immunoreactive cases had survived for more than 3h. The AβPP immunostaining pattern can be classified into two types: traumatic (Pattern 1) and non-traumatic (Pattern 2) axonal injuries, which we described previously [Hayashi et al. Int. J. Legal Med. 129 (2015) 1085-1090]. Three of 44 control cases also showed AβPP immunoreactive injured axons as Pattern 2. In contrast, IL-8 immunoreactivity was detected in 7 AβPP immunoreactive and in 2 non-AβPP immunoreactive head injury cases, but was not detected in any of the 44 control cases, including the 3 AβPP immunoreactive control cases. The IL-8 immunoreactive cases had survived from 3 to 24 days, whereas those cases who survived less than 3 days (n=29) and who survived 90 days (n=1) were not IL-8 immunoreactive. Moreover, IL-8 was detected as Pattern 1 axons only. In addition, double immunofluorescence analysis showed that IL-8 is expressed by oligodendrocytes surrounding injured axons. In conclusion, our results suggest that immunohistochemical detection of IL-8 may be useful as a complementary diagnostic marker of traumatic axonal injury. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  13. An ultrastructural study of calcitonin gene-related peptide-immunoreactive nerve fibers innervating the rat posterior longitudinal ligament. A morphologic basis for their possible efferent actions.

    PubMed

    Imai, S; Konttinen, Y T; Tokunaga, Y; Maeda, T; Hukuda, S; Santavirta, S

    1997-09-01

    The present study investigated ultrastructural characteristics of calcitonin gene-related peptide-immunoreactive nerve fibers in the posterior longitudinal ligament of the rat lumbar spine. To provide a morphologic basis for assessment of the afferent and, in particular, efferent functions of calcitonin gene-related peptide immunoreactive nerves in the posterior longitudinal ligament and their eventual role in degenerative spondylarthropathies and low back pain. Previous studies using light-microscopic localization of sensory neuronal markers such as calcitonin gene-related peptide have reported the presence of sensory fibers in the supporting structures of the vertebral column. Meanwhile, accumulating research data have suggested efferent properties for calcitonin gene-related peptide, i.e., a trophic action that alters the intrinsic properties of target cells not through transient action of synaptic transmission, but through long-lasting signal transmission by the secreted neuropeptides. To verify such trophic, paracrine actions of the calcitonin gene-related peptide-containing fibers in the posterior longitudinal ligament, however, ultrastructural details of the terminals and their spatial relationship to their eventual target structures have to be elucidated. Rat posterior longitudinal ligaments were stained immunohistochemically for calcitonin gene-related peptide. Light-microscopic analysis of the semithin sections facilitated subsequent electron microscopy of specific sites of the posterior longitudinal ligament to determine ultrastructural details and nerve fiber-target relationships. The rat lumbar posterior longitudinal ligament was found to be innervated by two distinctive calcitonin gene-related peptide immunoreactive nerve networks. In immunoelectronmicroscopy, the fibers of the deep network had numerous free nerve endings, whereas those of the superficial network showed spatial associations with other non-calcitonin gene-related peptide immunoreactive components of the network. In both systems, naked axons not covered by the Schwann cells made close spatial contact with smooth muscle cells: of blood vessels and resident posterior longitudinal ligament fibroblasts. The ultrastructural characteristics of the innervation of the rat posterior longitudinal ligament would be compatible not only with a nociceptive function, but also with neuromodulatory, vasoregulatory, and trophic functions, as has already been established in some visceral organs.

  14. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  15. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  16. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  17. FNA cytology of solitary fibrous tumors and the diagnostic value of STAT6 immunocytochemistry.

    PubMed

    Tani, Edneia; Wejde, Johan; Åström, Kristina; Wingmo, Inga-Lill; Larsson, Olle; Haglund, Felix

    2018-01-01

    Solitary fibrous tumors (SFTs) are rare mesenchymal tumors commonly located in the pleura, soft tissues, or meninges and are characterized by the NGFI-A-binding protein 2 (NAB2)-signal transducer and activator of transcription 6 (STAT6) fusion gene. Recent studies have indicated that nuclear STAT6 immunohistochemistry is a specific marker for SFTs. The authors reviewed fine-needle aspiration (FNA) specimens from extracranial SFTs diagnosed at their institution between 1993 and 2017. Histologic blocks and available formalin-fixed smears of FNA specimens from SFTs were investigated for STAT6 immunoreactivity using a monoclonal antibody. STAT6 immunocytochemistry was also investigated in schwannomas and spindle cell lipomas. Cytopathologic and clinical characteristics were described. Nineteen benign and 9 malignant SFTs were identified. Both benign and malignant SFTs had a female predominance (female-to-male ratio, 2.8:1 and 1.25, respectively). Localization varied, and approximately one-half of the extrapleural tumors were located in the extremities and frequently were intramuscular. Benign and malignant primary tumors had limited differences in cytologic presentation, the most notable feature being nuclear pleomorphism. Cytomorphologic features included low-to-moderate cellularity of mixed oval, elongated, round, and stellate cells with pink collagenous stroma and hypercellular clusters with infrequent atypia. In metastatic SFTs, the cytopathology was suggestive of sarcoma. Immunohistochemistry revealed nuclear STAT6 immunoreactivity in SFTs (n = 5) with cytoplasmic reactivity in cytologic mimickers. Benign and malignant SFTs have common cytopathologic features, and the ability to distinguish between them is limited. Nuclear STAT6 immunoreactivity is a valuable cytologic marker for SFTs. Cancer Cytopathol 2018;126:36-43. © 2017 American Cancer Society. © 2017 American Cancer Society.

  18. Six commercially available angiotensin II AT1 receptor antibodies are non-specific.

    PubMed

    Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti; Saavedra, Juan M

    2012-11-01

    Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization.

  19. Six Commercially Available Angiotensin II AT1 Receptor Antibodies are Non-specific

    PubMed Central

    Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti

    2012-01-01

    Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization. PMID:22843099

  20. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  1. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  2. Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

    PubMed

    Eklund, E A; Kakar, R

    1997-04-04

    The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

  3. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  4. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  5. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  6. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  7. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  8. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  9. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  10. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  11. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  12. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  13. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  14. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  15. Colocalization of neurotensin receptors and of the neurotensin-degrading enzyme endopeptidase 24-16 in primary cultures of neurons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chabry, J.; Checler, F.; Vincent, J.P.

    1990-12-01

    This paper compares the localization of neurotensin receptors and of endopeptidase 24-16, a peptidase likely involved in the inactivation of neurotensin in primary cultures of neurons. Neurotensin binding sites were radiolabeled with {sup 125}I-Tyr3-neurotensin, whereas endopeptidase 24-16 was stained by immunohistochemical techniques using a monospecific polyclonal antibody. Endopeptidase 24-16 is present in 80-85% of the nondifferentiated neurons. The proportion of immunoreactive neurons decreased during maturation to reach 35-40% after 4-8 d of culture. By contrast, neurotensin receptors were not detectable in nondifferentiated cells and appear during maturation. Specific {sup 125}I-Tyr3-neurotensin labeling is maximal after 4 d of culture and ismore » located on about 10% of differentiated neurons. Double-labeling experiments show that about 90% of cortical, hypothalamic, and mesencephalic neurons bearing the neurotensin receptor also contained endopeptidase 24-16, supporting the hypothesis that one of the functions of endopeptidase 24-16 is the physiological inactivation of neurotensin. However, the presence of endopeptidase 24-16 on numerous neurons that do not contain neurotensin receptors also suggests that the enzyme could be involved in the degradation and/or maturation of other neuropeptides.« less

  16. Immunodetection and intracellular localization of caldesmon-like proteins in Amoeba proteus.

    PubMed

    Gagola, M; Kłopocka, W; Greebecki, A; Makuch, R

    2003-09-01

    Caldesmon immunoanalogues were detected in Amoeba proteus cell homogenates by the Western blot technique. Three immunoreactive bands were recognized by polyclonal antibodies against the whole molecule of chicken gizzard caldesmon as well as by a monoclonal antibody against its C-terminal domain: one major and two minor bands corresponding to proteins with apparent molecular masses of 150, 69, and 60 kDa. The presence of caldesmon-like protein(s) in amoebae was revealed as well in single cells after their fixation, staining with the same antibodies, and recording their total fluorescence in a confocal laser scanning microscope. Proteins recognized by the antibodies bind to filamentous actin. This was established by a cosedimentation assay in cell homogenates and by colocalization of the caldesmon-related immunofluorescence with the fluorescence of filamentous actin stained with rhodamine-labelled phalloidin, demonstrated in optical sections of single cells in a confocal microscope. Caldesmon is colocalized with filamentous actin in the withdrawn cell regions where the cortical actomyosin network contracts and actin is depolymerized, in the frontal zone where actin is polymerized again and the cortical cytoskeleton is reconstructed, inside the nucleus and in the perinuclear cytoskeleton, and probably at the cell-to-substratum adhesion sites. The regulatory role of caldesmon in these functionally different regions of locomoting amoebae is discussed.

  17. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  18. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  19. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  20. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  1. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  2. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  3. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  4. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  5. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  6. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  7. Effects of halothane and methoxyflurane on regional brain and spinal cord substance P-like and beta-endorphin-like immunoreactivities in the rat.

    PubMed

    Karuri, A R; Agarwal, R K; Engelking, L R; Kumar, M S

    1998-03-15

    Effects of acute exposure (2 hr) to either 1.5% halothane or 0.5% methoxyflurane were investigated in the Sprague Dawley rat. Pituitary (PIT) and central nervous system (CNS) substance P (SP)-like and beta-endorphin (beta-end)-like immunoreactivities were evaluated immediately after anesthetic exposure (2 h), after righting reflex (4 h) or 24 hr postexposure (24 h). Only halothane significantly reduced SP-like immunoreactivity in olfactory bulbs in both the 2-h and 4-h groups. Halothane elevated SP-like immunoreactivity of hippocampus at all three time periods, and in the hypothalamus at 2 h. Both anesthetics significantly depleted thalamic concentrations of SP-like immunoreactivity. Methoxyflurane anesthesia resulted in a drastic decrease in SP-like immunoreactivity in PIT at all three time periods periods, while halothane elevated PIT concentrations of this peptide at 4 h. Both anesthetics significantly decreased beta-end-like immunoreactivity in the olfactory bulbs and thalami at 2, 4, and 24 h. However, halothane alone significantly elevated beta-end-like immunoreactivity in the spinal cord at 24 h. Halothane significantly elevated PIT beta-end-like immunoreactivity at 2 and 24 h, while methoxyflurane significantly lowered it in the 4-h group, but elevated the levels of the same in the 24-h group. Brain stem beta-end immunoreactivity were significantly reduced at 2 h by both anesthetics, and at 4 h by methoxyflurane. Results indicate that halothane and methoxyflurane may differ significantly in their actions on SP and beta-end secreting neurons in the CNS.

  8. Cloning, sequencing, and expression of the gene coding for bile acid 7 alpha-hydroxysteroid dehydrogenase from Eubacterium sp. strain VPI 12708.

    PubMed Central

    Baron, S F; Franklund, C V; Hylemon, P B

    1991-01-01

    Southern blot analysis indicated that the gene encoding the constitutive, NADP-linked bile acid 7 alpha-hydroxysteroid dehydrogenase of Eubacterium sp. strain VPI 12708 was located on a 6.5-kb EcoRI fragment of the chromosomal DNA. This fragment was cloned into bacteriophage lambda gt11, and a 2.9-kb piece of this insert was subcloned into pUC19, yielding the recombinant plasmid pBH51. DNA sequence analysis of the 7 alpha-hydroxysteroid dehydrogenase gene in pBH51 revealed a 798-bp open reading frame, coding for a protein with a calculated molecular weight of 28,500. A putative promoter sequence and ribosome binding site were identified. The 7 alpha-hydroxysteroid dehydrogenase mRNA transcript in Eubacterium sp. strain VPI 12708 was about 0.94 kb in length, suggesting that it is monocistronic. An Escherichia coli DH5 alpha transformant harboring pBH51 had approximately 30-fold greater levels of 7 alpha-hydroxysteroid dehydrogenase mRNA, immunoreactive protein, and specific activity than Eubacterium sp. strain VPI 12708. The 7 alpha-hydroxysteroid dehydrogenase purified from the pBH51 transformant was similar in subunit molecular weight, specific activity, and kinetic properties to that from Eubacterium sp. strain VPI 12708, and it reached with antiserum raised against the authentic enzyme on Western immunoblots. Alignment of the amino acid sequence of the 7 alpha-hydroxysteroid dehydrogenase with those of 10 other pyridine nucleotide-linked alcohol/polyol dehydrogenases revealed six conserved amino acid residues in the N-terminal regions thought to function in coenzyme binding. Images PMID:1856160

  9. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  10. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  11. Interaction of Aluminum with PHFτ in Alzheimer’s Disease Neurofibrillary Degeneration Evidenced by Desferrioxamine-Assisted Chelating Autoclave Method

    PubMed Central

    Murayama, Harunobu; Shin, Ryong-Woon; Higuchi, Jun; Shibuya, Satoshi; Muramoto, Tamaki; Kitamoto, Tetsuyuki

    1999-01-01

    To demonstrate that aluminum III (Al) interacts with PHFτ in neurofibrillary degeneration (NFD) of Alzheimer’s disease (AD) brain, we developed a “chelating autoclave method” that allows Al chelation by using trivalent-cationic chelator desferrioxamine. Its application to AD brain sections before Morin histochemistry for Al attenuated the positive fluorescence of neurofibrillary tangles, indicating Al removal from them. This method, applied for immunostaining with phosphorylation-dependent anti-τ antibodies, significantly enhanced the PHFτ immunoreactivity of the NFD. These results suggest that each of the phosphorylated epitopes in PHFτ are partially masked by Al binding. Incubation of AD sections with AlCl3 before Morin staining revealed Al accumulation with association to neurofibrillary tangles. Such incubation before immunostaining with the phosphorylation-dependent anti-τ antibodies abolished the immunolabeling of the NFD and this abolition was reversed by the Al chelation. These findings indicate cumulative Al binding to and thereby antigenic masking of the phosphorylated epitopes of PHFτ. Al binding was further documented for electrophoretically-resolved PHFτ on immunoblots, indicating direct Al binding to PHFτ. In vitro aggregation by AlCl3 was observed for PHFτ but was lost on dephosphorylation of PHFτ. Taken together, phosphorylation-dependent and direct PHFτ-Al interaction occurs in the NFD of the AD brain. PMID:10487845

  12. FMRFamide: low affinity inhibition of opioid binding to rabbit brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, X.Z.; Raffa, R.B.

    1986-03-05

    FMRFamide (Phe-Met-Arg-Phe-NH/sub 2/) was first isolated from the ganglia of molluscs by Price and Greenberg in 1977. The peptide was subsequently shown to have diverse actions on various types of molluscan and mammalian tissues. The presence of immunoreactive FMRFamide-like material (irFMRF) in multiple areas of rat brain, spinal cord, and gastrointestinal tract suggests that irFMRF may have a physiological role in mammals. Tang, Yang and Costa recently demonstrated that FMRFamide attenuates morphine antinociception in rats and postulated, based on this and several other lines of evidence, that irFMRF might be an endogenous opioid antagonist. In the present study, they testedmore » the ability of FMRFamide to inhibit the binding of opioid receptor ligands to rabbit membrane preparations. FMRFamide inhibited the specific binding of both /sup 3/(H)-dihydromorphine and /sup 3/(H)-ethylketocyclazocine (IC/sub 50/ = 14 ..mu..M and 320 ..mu..M, respectively) in a dose-related manner, suggesting that FMRFamide may affect binding to at least two types of opioid receptors (mu and kappa). These data are consistent with the concept that irFMRF might act as an endogenous opioid antagonist. However, the low affinity of FMRFamide leaves open the possibility of another mechanism of opioid antagonism, such as neuromodulation.« less

  13. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  14. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  15. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  16. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  17. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  18. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  19. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  20. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  1. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  2. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  3. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  4. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  5. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  6. (131)I-Nimotuzumab - A potential radioimmunotherapeutic agent in treatment of tumors expressing EGFR.

    PubMed

    Kameswaran, Mythili; Samuel, Grace; Dev Sarma, Haladhar; Shinde, Swamirao N; Dash, Ashutosh; Venkatesh, Meera

    2015-08-01

    The anti-EGFR antibody Nimotuzumab was radioiodinated with I-131 by Chloramine T and Iodogen methods. The (131)I-Nimotuzumab was purified and characterized by HPLC. Purified (131)I-Nimotuzumab exhibited radiochemical purity of >95% and retained good in vitro stability upto 24h at room temperature by both the methods. Cell binding studies carried out in A431 cells expressing EGF receptors showed good immunoreactivity of the product upto 5 days post radioiodination. Biodistribution studies in normal Swiss mice showed fast clearance by both renal and gastrointestinal routes with minimal thyroid uptake. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Quality control of murine monoclonal antibodies using isoelectric focusing affinity immunoblot analysis

    NASA Technical Reports Server (NTRS)

    Hamilton, Robert G.; Rodkey, L. Scott; Reimer, Charles B.

    1987-01-01

    The quality control of murine hybridoma secretory products has been performed using two approaches for isoelectric focusing affinity immunoblot analysis: (1) a method in which antigen-coated nitrocellulose is placed on top of an acrylamide gel containing isoelectrically focused ascites to bind the antigen specific monoclonal antibody; and (2) a method in which focused ascite proteins were passively blotted onto nitrocellulose and specific monoclonal antibodies were detected with enzyme-conjugated antigen. Analysis by both methods of batches of ascites containing antihuman IgG antibodies that were produced by six hybridomas permitted effective monitoring of immunoreactive antibodies for pI microheterogeneity.

  8. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  9. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  11. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  12. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  13. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  14. Platelet-derived growth factor receptor-β and epidermal growth factor receptor in pulmonary vasculature of systemic sclerosis-associated pulmonary arterial hypertension versus idiopathic pulmonary arterial hypertension and pulmonary veno-occlusive disease: a case-control study.

    PubMed

    Overbeek, Maria J; Boonstra, Anco; Voskuyl, Alexandre E; Vonk, Madelon C; Vonk-Noordegraaf, Anton; van Berkel, Maria P A; Mooi, Wolter J; Dijkmans, Ben A C; Hondema, Laurens S; Smit, Egbert F; Grünberg, Katrien

    2011-04-14

    Systemic sclerosis (SSc) complicated by pulmonary arterial hypertension (PAH) carries a poor prognosis, despite pulmonary vascular dilating therapy. Platelet-derived growth factor receptor-β (PDGFR-β) and epidermal growth factor receptor (EGFR) are potential therapeutic targets for PAH because of their proliferative effects on vessel remodelling. To explore their role in SScPAH, we compared PDGFR- and EGFR-mmunoreactivity in lung tissue specimens from SScPAH. We compared staining patterns with idiopathic PAH (IPAH) and pulmonary veno-occlusive disease (PVOD), as SScPAH vasculopathy differs from IPAH and sometimes displays features of PVOD. Immunoreactivity patterns of phosphorylated PDGFR-β (pPDGFR-β) and the ligand PDGF-B were evaluated to provide more insight into the patterns of PDGFR-b activation. Lung tissue specimens from five SScPAH, nine IPAH, six PVOD patients and five controls were examined. Immunoreactivity was scored for presence, distribution and intensity. All SScPAH and three of nine IPAH cases (P = 0.03) showed PDGFR-β-immunoreactivity in small vessels (arterioles/venules); of five SScPAH vs. two of nine IPAH cases (P = 0.02) showed venous immunoreactivity. In small vessels, intensity was stronger in SScPAH vs. IPAH. No differences were found between SScPAH and PVOD. One of five normal controls demonstrated focally mild immunoreactivity. There were no differences in PDGF-ligand and pPDGFR-b-immunoreactivity between patient groups; however, pPDGFR-b-immunoreactivity tended to be more prevalent in SScPAH small vasculature compared to IPAH. Vascular EGFR-immunoreactivity was limited to arterial and arteriolar walls, without differences between groups. No immunoreactivity was observed in vasculature of normals. PDGFR-β-immunoreactivity in SScPAH is more common and intense in small- and post-capillary vessels than in IPAH and does not differ from PVOD, fitting in with histomorphological distribution of vasculopathy. PDGFR-β immunoreactivity pattern is not paralleled by pPDGFR-β or PDGF-B patterns. PDGFR-β- and EGFR-immunoreactivity of pulmonary vessels distinguishes PAH patients from controls.

  15. Stress-Induced Transcriptional Regulation in the Developing Rat Brain Involves Increased Cyclic Adenosine 3′,5′-Monophosphate-Regulatory Element Binding Activity

    PubMed Central

    Hatalski, Carolyn G.; Baram, Tallie Z.

    2012-01-01

    The cAMP-regulatory element (CRE) binding protein (CREB) functions as a trans-acting regulator of genes containing the CRE sequence in their promoter. These include a number of critical genes, such as CRF, involved in the hypothalamic response to stressful stimuli in the adult. The ability of the developing rat (during the first 2 postnatal weeks) to mount the full complement of this stress response has been questioned. We have previously demonstrated the stress-induced up-regulation of the transcription of hypothalamic CRF during the second postnatal week in the rat. The focus of the current study was to explore the mechanism of transcriptional regulation in response to stress through the physiological induction of transcriptional trans-activators that bind to the CRE in the developing rat brain. CRE-binding activity was detected via gel shift analysis in extracts from both the hypothalamus and the cerebral cortex of the developing rat. CREB was identified in these extracts by Western blot analysis and was shown to be the major contributor to the CRE-binding activity by gel shift analysis with two specific antibodies directed against CREB. After acute hypothermic stress, the abundance of CRE-binding activity (but not of total immunoreactive CREB), increased in hypothalamic extracts. This enhanced CRE-binding activity was blocked by an antiserum directed against CREB and was accompanied by an apparent increase in CREB phosphorylation. These results indicate that posttranslational enhancement of CRE-binding activity is likely to constitute an important mechanism for up-regulation of genes possessing the CRE sequence in the developing rat hypothalamus by adverse external signals. PMID:9415405

  16. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  17. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  18. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  19. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  20. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  1. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  2. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  3. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  4. Neuropeptide Y in the olfactory system, forebrain and pituitary of the teleost, Clarias batrachus.

    PubMed

    Gaikwad, Archana; Biju, K C; Saha, Subhash G; Subhedar, Nishikant

    2004-03-01

    Distribution of neuropeptide Y (NPY)-like immunoreactivity in the forebrain of catfish Clarias batrachus was examined with immunocytochemistry. Conspicuous immunoreactivity was seen in the olfactory receptor neurons (ORNs), their projections in the olfactory nerve, fascicles of the olfactory nerve layer in the periphery of bulb and in the medial olfactory tracts as they extend to the telencephalic lobes. Ablation of the olfactory organ resulted in loss of immunoreactivity in the olfactory nerve layer of the bulb and also in the fascicles of the medial olfactory tracts. This evidence suggests that NPY may serve as a neurotransmitter in the ORNs and convey chemosensory information to the olfactory bulb, and also to the telencephalon over the extrabulbar projections. In addition, network of beaded immunoreactive fibers was noticed throughout the olfactory bulb, which did not respond to ablation experiment. These fibers may represent centrifugal innervation of the bulb. Strong immunoreactivity was encountered in some ganglion cells of nervus terminalis. Immunoreactive fibers and terminal fields were widely distributed in the telencephalon. Several neurons of nucleus entopeduncularis were moderately immunoreactive; and a small population of neurons in nucleus preopticus periventricularis was also labeled. Immunoreactive terminal fields were particularly conspicuous in the preoptic, the tuberal areas, and the periventricular zone around the third ventricle and inferior lobes. NPY immunoreactive cells and fibers were detected in all the lobes of the pituitary gland. Present results describing the localization of NPY in the forebrain of C. batrachus are in concurrence with the pattern of the immunoreactivity encountered in other teleosts. However, NPY in olfactory system of C. batrachus is a novel feature that suggests a role for the peptide in processing of chemosensory information.

  5. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  6. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  7. Neuronal control of localized inflammation through expressed nicotinic acetylcholine receptors: a study carried out in mice.

    PubMed

    Thayabaran, M; Yasawardene, S G

    2015-12-01

    Although the local inflammatory reactions are known to be regulated through cholinergic anti-inflammatory pathways, the exact subtypes of nicotinic acetylcholine receptors involved in neuroimmune modulation are not well identified. Immunohistochemical localisation of a1 subunit of nicotinic acetylcholine receptors (a1nAChR) in sites of localised inflammation induced by injecting turpentine to the hind limbs of Balb/C mice. Localised inflammation and subsequent development of sterile abscesses was induced by injecting sterile turpentine subcutaneously into thighs of Balb/C mice. Sterile saline was used in the control.. Skin and muscle tissues of inflammatory sites were recovered from the animals after 48 hours and were stained with hematoxylin and eosin. Indirect immunohistochemistry was done using anti-a1nAChR as the primary antibody and biotinylated anti-rat IgG as the secondary antibody. Labeled streptavidin biotin (LSAB) technique was used with diaminobenzedene to detect the immunoreactivity (IR). Intensity of immunostaining was determined based upon a score of 0 - 3+ by qualitative computerised image analysis using FSX 100 Olympus microscope. H and E stained slides showed polymorphonuclear leukocytes (PNL) infiltration at the abscess sites while the saline injected control tissue sections did not show PNL infiltration. A 2+ immunoreactivity (IR) of a1nAChRs was visible at peripheral zones of sterile abscesses where PNL infiltrations were high while the central area with necrotic tissue did not show IR. A subcutaneous lymph node found within the inflammatory region expressed IR of a1nAChR in its capsular sinuses, subcapsular sinuses and trabecular regions. The findings suggest the possible role of controlling localised inflammatory response by parasympathetic cholinergic nerves through a1nAChRs of inflammation sites.

  8. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  9. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  10. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  11. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  12. FoxP3 and indoleamine 2,3-dioxygenase immunoreactivity in sentinel nodes from melanoma patients.

    PubMed

    Ryan, Marisa; Crow, Jennifer; Kahmke, Russel; Fisher, Samuel R; Su, Zuowei; Lee, Walter T

    2014-01-01

    1) Assess FoxP3/indoleamine 2,3-dioxygenase immunoreactivity in head and neck melanoma sentinel lymph nodes and 2) correlate FoxP3/indoleamine 2,3-dioxygenase with sentinel lymph node metastasis and clinical recurrence. Retrospective cohort study. Patients with sentinel lymph node biopsy for head and neck melanoma between 2004 and 2011 were identified. FoxP3/indoleamine 2,3-dioxygenase prevalence and intensity were determined from the nodes. Poor outcome was defined as local, regional or distant recurrence. The overall immunoreactivity score was correlated with clinical recurrence and sentinel lymph node metastasis using the chi-square test for trend. Fifty-six sentinel lymph nodes were reviewed, with 47 negative and 9 positive for melanoma. Patients with poor outcomes had a statistically significant trend for higher immunoreactivity scores (p=0.03). Positive nodes compared to negative nodes also had a statistically significant trend for higher immunoreactivity scores (p=0.03). Among the negative nodes, there was a statistically significant trend for a poor outcome with higher immunoreactivity scores (p=0.02). FoxP3/indoleamine 2,3-dioxygenase immunoreactivity correlates with sentinel lymph node positivity and poor outcome. Even in negative nodes, higher immunoreactivity correlated with poor outcome. Therefore higher immunoreactivity may portend a worse prognosis even without metastasis in the sentinel lymph node. This could identify a subset of patients that may benefit from future trials and treatment for melanoma through Treg and IDO suppression. Published by Elsevier Inc.

  13. Cyto- and chemoarchitecture of the dorsal thalamus of the monotreme Tachyglossus aculeatus, the short beaked echidna.

    PubMed

    Ashwell, Ken W S; Paxinos, George

    2005-12-01

    We have examined the cyto- and chemoarchitecture of the dorsal thalamus of the short beaked echidna (Tachyglossus aculeatus), using Nissl and myelin staining, immunoreactivity for parvalbumin, calbindin, calretinin and non-phosphorylated neurofilament protein (SMI-32 antibody), and histochemistry for acetylcholinesterase and NADPH diaphorase. Immunohistochemical methods revealed many nuclear boundaries, which were difficult to discern with Nissl staining. Parvalbumin immunoreactive somata were concentrated in the ventral posterior, reticular, posterior, lateral and medial geniculate nuclei, while parvalbumin immunoreactivity of the neuropil was present throughout all but the midline nuclei. Large numbers of calbindin immunoreactive somata were also found within the midline thalamic nuclei, and thalamic sensory relay nuclei. Immunoreactivity for calretinin was found in many small somata within the lateral geniculate "a" nucleus, with other labelled somata found in the lateral geniculate "b" nucleus, ventral posterior medial and ventral posterior lateral nuclei. Immunoreactivity with the SMI-32 antibody was largely confined to somata and neuropil within the thalamocortical relay nuclei (ventral posterior medial and lateral nuclei, lateral and medial geniculate nuclei and the posterior thalamic nucleus). In broad terms there were many similarities between the thalamus of this monotreme and that of eutheria (e.g. disposition of somatosensory thalamus, complementarity of parvalbumin and calbindin immunoreactive structures), but there were some unique features of the thalamus of the echidna. These include the relatively small size of the thalamic reticular nucleus and the preponderance of calbindin immunoreactive neurons over parvalbumin immunoreactive neurons in the ventral posterior nucleus.

  14. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  15. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  16. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  17. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  18. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  19. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  20. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  1. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  2. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  3. Localization of amylin-like immunoreactivity in melanocyte-stimulating hormone-containing cells of the pars intermedia but not those of the pars distalis in the axolotl (Ambystoma mexicanum) pituitary.

    PubMed

    Suzuki, Hirohumi; Yamamoto, Toshiharu

    2016-04-01

    Immunohistochemical techniques were employed to investigate the distribution of amylin-like immunoreactivity in the axolotl (Ambystoma mexicanum) pituitary. Amylin-immunoreactive cells were observed in the pars intermedia, and these cells were found to be immunoreactive for α-melanocyte-stimulating hormone (αMSH) as well. In contrast, αMSH-immunoreactive cells in the pars distalis were immuno-negaitive for amylin. These light microscopic findings were confirmed by immunoelectron microscopy. Amylin-immunoreactive signals were located on the haloes of presumable secretory granules in association with αMSH-immunoreactive signals in the amylin-positive cells. However, in the pars distalis, the αMSH-positive cells did not contain amylin-immunoreactive secretory granules. Western blot analysis of axolotl pituitary extracts revealed the labeling of a protein band at approximately 10.5-kDa by the anti-rat amylin serum, which was not labeled by the anti-αMSH antibody. These findings indicate that amylin secreted from MSH-producing cells in the pars intermedia may modulate MSH secretion in an autocrine fashion and may participate in MSH functions such as fatty homeostasis together with MSH. Copyright © 2016 Elsevier GmbH. All rights reserved.

  4. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Identification and distribution of gonadotropin-releasing hormone-like peptides in the brain of horseshoe crab Tachypleus tridentatus

    NASA Astrophysics Data System (ADS)

    Huang, Huiyang; Li, Linming; Ye, Haihui; Feng, Biyun; Li, Shaojing

    2013-03-01

    Gonadotropin-releasing hormone (GnRH) is a crucial peptide for the regulation of reproduction. Using immunological techniques, we investigated the presence of GnRH in horseshoe crab Tachypleus tridentatus. Octopus GnRH-like immunoreactivity, tunicate GnRH-like immunoreactivity, and lamprey GnRH-I-like immunoreactivity were detected in the neurons and fibers of the protocerebrum. However, no mammal GnRH-like immunoreactivity or lamprey GnRH-III-like immunoreactivity was observed. Our results suggest that a GnRH-like factor, an ancient peptide, existed in the brain of T. tridentatus and may be involved in the reproductive endocrine system.

  7. Immunocytochemical localization of choline acetyltransferase-like immunoreactivity in the guinea pig cochlea.

    PubMed

    Altschuler, R A; Kachar, B; Rubio, J A; Parakkal, M H; Fex, J

    1985-07-08

    The immunocytochemical localization of the enzyme choline acetyltransferase (ChAT) was examined in the guinea pig organ of Corti to determine if both lateral and medial systems of efferents would show immunoreactive labeling for this specific enzyme marker of cholinergic neurons. Cochleae were also examined after lesion of efferents to determine if ChAT-like immunoreactivity is confined to efferents. ChAT-like immunoreactivity was seen in the inner spiral bundle, tunnel spiral bundle and by the bases of inner hair cells corresponding to the lateral system of efferents. ChAT-like immunoreactivity was also seen in crossing fibers and puncta at the bases and by the nuclei of outer hair cells corresponding to the medial system of efferents. With the use of video enhanced contrast microscopy more than 9 ChAT-like immunoreactive puncta at the bases of outer hair cells could be resolved. In cochleae examined 6 weeks after ipsilateral lesion of efferents, no ChAT-like immunoreactivity was observed. These results add strong evidence that acetylcholine is a transmitter of both the medial and lateral systems of efferents.

  8. Colocalization of numerous immunoreactivities in endocrine cells of the chicken proventriculus at hatching.

    PubMed

    Martínez, A; Buchan, A M; López, J; Sesma, P

    2000-05-01

    The colocalization of regulatory peptide immunoreactivities in endocrine cells of the chicken proventriculus at hatching has been investigated using the avidin-biotin technique in serial sections and double immunofluorescence in the same section for light microscopy, and double immunogold staining for electron microscopy. In addition to the eight immunoreactivities previously described in this organ, cells immunoreactive for peptide histidine isoleucine (PHI), peptide gene product 9.5 (PGP), and the amidating enzyme, peptidylglycine alpha-amidating monooxygenase (PAM) were observed. All the cells immunoreactive to glucagon were also immunostained by the PHI antiserum. In addition, all the glucagon-like peptide 1, avian pancreatic polypeptide, and some of the neurotensin-like cells costored also glucagon- and PHI-immunoreactive substances. PGP- and PAM-immunoreactivities were also found in the glucagon-positive cells. A small proportion of the somatostatin-containing cells were positive for PHI but not for other regulatory peptides. These results could suggest either the existence of a very complex regulatory system or that the endocrine system of the newborn chickens is not yet fully developed.

  9. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  10. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  11. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  12. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  14. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  15. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  16. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  17. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  18. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  19. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  20. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  1. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  2. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  3. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  4. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  5. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  6. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  7. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  8. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  9. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  10. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  11. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  12. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  13. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The Role of Mesopontine NGF in Sleep and Wakefulness

    PubMed Central

    Ramos, Oscar V.; Torterolo, Pablo; Lim, Vincent; Chase, Michael H.; Sampogna, Sharon; Yamuy, Jack

    2011-01-01

    The microinjection of nerve growth factor (NGF) into the cat pontine tegmentum rapidly induces rapid eye movement (REM) sleep. To determine if NGF is involved in naturally-occurring REM sleep, we examined whether it is present in mesopontine cholinergic structures that promote the initiation of REM sleep, and whether the blockade of NGF production in these structures suppresses REM sleep. We found that cholinergic neurons in the cat dorsolateral mesopontine tegmentum exhibited NGF-like immunoreactivity. In addition, the microinjection of an oligodeoxyribonucleotide (OD) directed against cat NGF mRNA into this region resulted in a reduction in the time spent in REM sleep in conjunction with an increase in the time spent in wakefulness. Sleep and wakefulness returned to baseline conditions 2 to 5 days after antisense OD administration. The preceding antisense OD-induced effects occurred in conjunction with the suppression of NGF-like immunoreactivity within the site of antisense OD injection. These data support the hypothesis that NGF is involved in the modulation of naturally-occurring sleep and wakefulness. PMID:21840513

  15. Parvalbumin and calbindin immunoreactivity in the cerebral cortex of the hedgehog (Erinaceus europaeus).

    PubMed Central

    Ferrer, I; Zujar, M J; Admella, C; Alcantara, S

    1992-01-01

    To investigate the morphology and distribution of nonpyramidal neurons in the brain of insectivores, parvalbumin and calbindin 28 kDa immunoreactivity was examined in the cerebral cortex of the hedgehog (Erinaceus europaeus). Parvalbumin-immunoreactive cells were found in all layers of the isocortex, but in contrast to other mammals, a laminar organisation or specific regional distribution was not seen. Characteristic parvalbumin-immunoreactive neurons were multipolar cells with large ascending and descending dendrites extending throughout several layers. Calbindin-immunoreactive neurons were similar to those found in other species, although appearing in smaller numbers than in the cerebral cortex of more advanced mammals. The morphology and distribution of parvalbumin- and calbindin-immunoreactive cells in the piriform and entorhinal cortices were similar in hedgehogs and rodents. Parvalbumin-immunoreactive cells in the hippocampal complex were pyramidal-like and bitufted neurons, which were mainly found in the stratum oriens and stratum pyramidale of the hippocampus, and in the stratum moleculare and hilus of the fascia dentata. Heavily stained cells were found in the deep part of the stratum granulare. Intense calbindin immunoreactivity occurred mainly in the granule cell and molecular layers of the dentate gyrus and in the mossy fibre layer. The most outstanding feature in the hippocampal complex of the hedgehog was the extension of calbindin immunoreactivity to CA1 field of the hippocampus, suggesting, in agreement with other reports, that mossy fibres can establish synaptic contacts throughout the pyramidal cell layer. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:1452472

  16. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  17. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  18. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  19. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  1. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  2. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  3. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  4. Noradrenergic innervation of the hypothalamus of rhesus monkeys: distribution of dopamine-beta-hydroxylase immunoreactive fibers and quantitative analysis of varicosities in the paraventricular nucleus.

    PubMed

    Ginsberg, S D; Hof, P R; Young, W G; Morrison, J H

    1993-01-22

    The distribution of noradrenergic processes within the hypothalamus of rhesus monkeys (Macaca mulatta) was examined by immunohistochemistry with an antibody against dopamine-beta-hydroxylase. The results revealed that the pattern of dopamine-beta-hydroxylase immunoreactivity varied systematically throughout the rhesus monkey hypothalamus. Extremely high densities of dopamine-beta-hydroxylase-immunoreactive processes were observed in the paraventricular and supraoptic nuclei, while relatively lower levels were found in the arcuate and dorsomedial nuclei and in the medial preoptic, perifornical, and suprachiasmatic areas. Moderate levels of dopamine-beta-hydroxylase immunoreactivity were found throughout the lateral hypothalamic area and in the internal lamina of the median eminence. Very few immunoreactive processes were found in the ventromedial nucleus or in the mammillary complex. Other midline diencephalic structures were found to have high densities of dopamine-beta-hydroxylase immunoreactivity, including the paraventricular nucleus of the thalamus and a discrete subregion of nucleus reuniens, the magnocellular subfascicular nucleus. A moderate density of dopamine-beta-hydroxylase immunoreactive processes were found in the rhomboid nucleus and zona incerta whereas little dopamine-beta-hydroxylase immunoreactivity was found in the fields of Forel, nucleus reuniens, or subthalamic nucleus. The differential distribution of dopamine-beta-hydroxylase-immunoreactive processes may reflect a potential role of norepinephrine as a regulator of a variety of functions associated with the nuclei that are most heavily innervated, e.g., neuroendocrine release from the paraventricular and supraoptic nuclei, and gonadotropin release from the medial preoptic area and mediobasal hypothalamus. Additionally, quantitative analysis of dopamine-beta-hydroxylase-immunoreactive varicosities was performed on a laser scanning microscope in both magnocellular and parvicellular regions of the paraventricular nucleus of the hypothalamus. The methodology employed in this study allowed for the high resolution of immunoreactive profiles through the volume of tissue being analyzed, and was more accurate than conventional light microscopy in terms of varicosity quantification. Quantitatively, a significant difference in the density of dopamine-beta-hydroxylase-immunoreactive varicosities was found between magnocellular and parvicellular regions, suggesting that parvicellular neurons received a denser noradrenergic input. These differential patterns may reflect an important functional role for norepinephrine in the regulation of anterior pituitary secretion through the hypothalamic-pituitary-adrenal stress axis.

  5. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  6. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  7. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  8. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  9. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  10. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  11. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  12. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  13. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  14. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  15. Introducing novel amorphous carbon nanoparticles as energy acceptors into a chemiluminescence resonance energy transfer immunoassay system.

    PubMed

    Wang, Zhenxing; Gao, Hongfei; Fu, Zhifeng

    2013-11-21

    A novel chemiluminescence resonance energy transfer (CRET) system for competitive immunoassay of biomolecules was developed by using novel amorphous carbon nanoparticles (CNPs) prepared from candle soot as energy acceptors. The CNPs were firstly prepared to bind with the antigen (Ag) for obtaining the nanocomposite CNP-Ag, and this obtained CNP-Ag was then reacted with the horseradish peroxidase-labeled antibody (HRP-Ab) to assemble the CRET system. The luminol catalyzed by HRP serving as the energy donor for CNPs triggered the CRET phenomenon between luminol and CNPs, which led to the chemiluminescence signal decrease. Due to the competitive immunoreaction of the target antigen and the CNP-Ag, a part of the CNP-Ag was replaced from the HRP-Ab, and then resulted in a weaker interaction between luminol and CNPs. Thus the competitive immunoreaction led to a higher chemiluminescence emission. This CNP-based CRET system was successfully applied to detect the human IgG as a model analyte, and a linear range of 10-200 ng mL(-1) and a detection limit of 1.9 ng mL(-1) (S/N = 3) were obtained. The results for real sample analysis demonstrated its application potential in some important areas such as clinical diagnosis.

  16. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  17. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  18. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  19. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  20. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  1. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  2. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  3. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  4. Nanoplasmonic Biosensor Using Localized Surface Plasmon Resonance Spectroscopy for Biochemical Detection.

    PubMed

    Zhang, Diming; Zhang, Qian; Lu, Yanli; Yao, Yao; Li, Shuang; Liu, Qingjun

    2017-01-01

    Localized surface plasmon resonance (LSPR) associated with metal nanostructures has developed into a highly useful sensor technique. Optical LSPR spectroscopy of nanostructures often shows sharp absorption and scattering peaks, which can be used to probe several bio-molecular interactions. Here, we report nanoplasmonic biosensors using LSPR on nanocup arrays (nanoCA) to recognize bio-molecular binding for biochemical detection. These sensors can be modified to quantify binding of small molecules to proteins for odorant and explosive detections. Electrochemical LSPR biosensors can also be designed by coupling electrochemistry and LSPR spectroscopy measurements. Multiple sensing information can be obtained and electrochemical LSPR property can be investigated for biosensors. In some applications, the electrochemical LSPR biosensor can be used to quantify immunoreactions and enzymatic activity. The biosensors exhibit better performance than those of conventional optical LSPR measurements. With multi-transducers, the nanoplasmonic biosensor can provide a promising approach for bio-detection in environmental monitoring, healthcare diagnostics, and food quality control.

  5. The amyloid fold of Gad m 1 epitopes governs IgE binding

    PubMed Central

    Sánchez, Rosa; Martínez, Javier; Castro, Ana; Pedrosa, María; Quirce, Santiago; Rodríguez-Pérez, Rosa; Gasset, María

    2016-01-01

    Amyloids are polymeric structural states formed from locally or totally unfolded protein chains that permit surface reorganizations, stability enhancements and interaction properties that are absent in the precursor monomers. β-Parvalbumin, the major allergen in fish allergy, forms amyloids that are recognized by IgE in the patient sera, suggesting a yet unknown pathological role for these assemblies. We used Gad m 1 as the fish β-parvalbumin model and a combination of approaches, including peptide arrays, recombinant wt and mutant chains, biophysical characterizations, protease digestions, mass spectrometry, dot-blot and ELISA assays to gain insights into the role of amyloids in the IgE interaction. We found that Gad m 1 immunoreactive regions behave as sequence-dependent conformational epitopes that provide a 1000-fold increase in affinity and the structural repetitiveness required for optimal IgE binding and cross-linking upon folding into amyloids. These findings support the amyloid state as a key entity in type I food allergy. PMID:27597317

  6. Conformational changes induced in the protein tyrosine kinase p72syk by tyrosine phosphorylation or by binding of phosphorylated immunoreceptor tyrosine-based activation motif peptides.

    PubMed Central

    Kimura, T; Sakamoto, H; Appella, E; Siraganian, R P

    1996-01-01

    A critical event in signaling in immune cells is the interaction of Syk or ZAP-70 protein tyrosine kinases with multisubunit receptors that contain an approximately 18-amino-acid domain called the immunoreceptor tyrosine-based activation motif (ITAM). Tyrosine-phosphorylated Syk from activated cells was in a conformation different from that in nonstimulated cells as demonstrated by changes in immunoreactivity. The addition of tyrosine-diphosphorylated ITAM peptides resulted in a similar conformational change in Syk from nonactivated cells. The peptides based on FcepsilonRIgamma were more active than those based on Fcepsilon RIbeta. In vitro autophosphorylation of Syk was dramatically enhanced by the addition of the diphosphorylated ITAM peptides. The conformational change and the enhanced autophosphorylation required the presence of both phosphorylated tyrosines on the same molecule. These conformational changes in Syk by tyrosine phosphorylation or binding to diphosphorylated ITAM could be critical for Syk activation and downstream propagation of intracellular signals. PMID:8657120

  7. Immunoreactivity reduction of soybean meal by fermentation, effect on amino acid composition and antigenicity of commercial soy products.

    PubMed

    Song, Y-S; Frias, J; Martinez-Villaluenga, C; Vidal-Valdeverde, C; de Mejia, E Gonzalez

    2008-05-15

    Food allergy has become a public health problem that continues to challenge both the consumer and the food industry. The objectives of this study were to evaluate the reduction of immunoreactivity by natural and induced fermentation of soybean meal (SBM) with Lactobacillus plantarum, Bifidobacterium lactis, Saccharomyces cereviseae, and to assess the effect on amino acid concentration. Immunoreactivity of commercially available fermented soybean products and ingredients was also evaluated. ELISA and western blot were used to measure IgE immunoreactivity using plasma from soy sensitive individuals. Commercial soy products included tempeh, miso and yogurt. Fermented SBM showed reduced immunoreactivity to human plasma, particularly if proteins were <20kDa. S. cereviseae and naturally fermented SBM showed the highest reduction in IgE immunoreactivity, up to 89% and 88%, respectively, against human pooled plasma. When SBM was subjected to fermentation with different microorganisms, most of the total amino acids increased significantly (p<0.05) and only few of them suffered a decrease depending on the type of fermentation. All commercial soy containing products tested showed very low immunoreactivity. Thus, fermentation can decrease soy immunoreactivity and can be optimized to develop nutritious hypoallergenic soy products. However, the clinical relevance of these findings needs to be determined by human challenge studies. Copyright © 2007 Elsevier Ltd. All rights reserved.

  8. Changes of immunocytochemical localization of vesicular glutamate transporters in the rat visual system after the retinofugal denervation.

    PubMed

    Fujiyama, Fumino; Hioki, Hiroyuki; Tomioka, Ryohei; Taki, Kousuke; Tamamaki, Nobuaki; Nomura, Sakashi; Okamoto, Keiko; Kaneko, Takeshi

    2003-10-13

    To clarify which vesicular glutamate transporter (VGluT) is used by excitatory axon terminals of the retinofugal system, we examined immunoreactivities and mRNA signals for VGluT1 and VGluT2 in the rat retina and compared immunoreactivities for VGluT1 and VGluT2 in the retinorecipient regions using double immunofluorescence method, anterograde tracing, and immunoelectron microscopy. Furthermore, the changes of VGluT1 and VGluT2 immunoreactivities were studied after eyeball enucleation. Intense immunoreactivity and mRNA signal for VGluT2, but not for VGluT1 immunoreactivity, were observed in most perikarya of ganglion cells in the retina. Immunoelectron microscopy revealed that VGluT1- and VGluT2-immunolabeled terminals made asymmetrical synapses, suggesting that they were excitatory synapses, and that VGluT1-immunolabeled terminals were smaller than VGluT2-labeled ones in many retinorecipient regions, such as the dorsal lateral geniculate nucleus (LGd) and superior colliculus (SC). Double immunofluorescence study further revealed that almost no VGluT2 immunoreactivity was colocalized with VGluT1 in the retinorecipient regions. After wheat germ agglutinin (WGA) injection into the eyeballs, WGA immunoreactivity was colocalized in the single axon terminals of LGd and SC with VGluT2 but not VGluT1 immunoreactivity. After unilateral enucleation, VGluT2 immunoreactivity in the LGd, SC, nucleus of the optic tract, and nuclei of the accessory optic tract in the contralateral side of the enucleated eye was clearly decreased. Although only a small change of VGluT2 immunoreactivity was observed in the contra- and ipsilateral suprachiasmatic nuclei, olivary pretectal nucleus, anterior pretectal nucleus, and posterior pretectal nucleus, moderate reduction of VGluT2 was found in these regions after bilateral enucleation. On the other hand, almost no change in VGluT1 immunoreactivity was found in the structures examined in the present enucleation study. Thus, the present results support the notion that the retinofugal pathways are glutamatergic, and indicate that VGluT2, but not VGluT1, is employed for accumulating glutamate into synaptic vesicles of retinofugal axons. Copyright 2003 Wiley-Liss, Inc.

  9. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  10. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  11. Characterization of Sarcoptes scabiei Tropomyosin and Paramyosin: Immunoreactive Allergens in Scabies.

    PubMed

    Naz, Shumaila; Desclozeaux, Marion; Mounsey, Kate E; Chaudhry, Farhana Riaz; Walton, Shelley F

    2017-09-01

    Scabies is a human skin disease due to the burrowing ectoparasite Sarcoptes scabiei var. hominis resulting in intense itching and inflammation and manifesting as a skin allergy. Because of insufficient mite material and lack of in vitro propagation system for antigen preparation, scabies is a challenging disease to develop serological diagnostics. For allergen characterization, full-length S. scabiei tropomyosin (Sar s 10) was cloned, expressed in pET-15b, and assessed for reactivity with IgE antibodies from human sera. IgE binding was observed to Sar s 10 with sera collected from subjects with ordinary scabies, house dust mite (HDM)-positive and naive subjects and a diagnostic sensitivity of < 30% was observed. S. scabiei paramyosin (Sar s 11) was cloned, and expressed in pET-28a in three overlapping fragments designated Sspara1, Sspara2, and Sspara3. IgE and IgG binding was observed to Sspara2 and Sspara3 antigens with sera collected from ordinary scabies, and HDM-positive subjects, but no binding was observed with sera collected from naive subjects. Sspara2 displayed excellent diagnostic potential with 98% sensitivity and 90% specificity observed for IgE binding and 70% sensitivity for IgG. In contrast, the diagnostic sensitivity of Sspara3 was 84% for IgE binding and 40% for IgG binding. In combination, Sspara2 and Sspara3 provided an IgE sensitivity of 94%. This study shows that IgE binding to Sspara2 and Sspara3 is a highly sensitive method for diagnosis of scabies infestation in clinical practice. The developed enzyme-linked immunosorbent assay helps direct future development of a specific diagnostic tool for scabies.

  12. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  13. Localized cortical chronic traumatic encephalopathy pathology after single, severe axonal injury in human brain.

    PubMed

    Shively, Sharon B; Edgerton, Sarah L; Iacono, Diego; Purohit, Dushyant P; Qu, Bao-Xi; Haroutunian, Vahram; Davis, Kenneth L; Diaz-Arrastia, Ramon; Perl, Daniel P

    2017-03-01

    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease associated with repetitive mild impact traumatic brain injury from contact sports. Recently, a consensus panel defined the pathognomonic lesion for CTE as accumulations of abnormally hyperphosphorylated tau (p-tau) in neurons (neurofibrillary tangles), astrocytes and cell processes distributed around small blood vessels at sulcal depths in irregular patterns within the cortex. The pathophysiological mechanism for this lesion is unknown. Moreover, a subset of CTE cases harbors cortical β-amyloid plaques. In this study, we analyzed postmortem brain tissues from five institutionalized patients with schizophrenia and history of surgical leucotomy with subsequent survival of at least another 40 years. Because leucotomy involves severing axons bilaterally in prefrontal cortex, this surgical procedure represents a human model of single traumatic brain injury with severe axonal damage and no external impact. We examined cortical tissues at the leucotomy site and at both prefrontal cortex rostral and frontal cortex caudal to the leucotomy site. For comparison, we analyzed brain tissues at equivalent neuroanatomical sites from non-leucotomized patients with schizophrenia, matched in age and gender. All five leucotomy cases revealed severe white matter damage with dense astrogliosis at the axotomy site and also neurofibrillary tangles and p-tau immunoreactive neurites in the overlying gray matter. Four cases displayed p-tau immunoreactivity in neurons, astrocytes and cell processes encompassing blood vessels at cortical sulcal depths in irregular patterns, similar to CTE. The three cases with apolipoprotein E ε4 haplotype showed scattered β-amyloid plaques in the overlying gray matter, but not the two cases with apolipoprotein E ε3/3 genotype. Brain tissue samples from prefrontal cortex rostral and frontal cortex caudal to the leucotomy site, and all cortical samples from the non-leucotomized patients, showed minimal p-tau and β-amyloid pathology. These findings suggest that chronic axonal damage contributes to the unique pathology of CTE over time.

  14. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  15. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  16. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  17. Measurement of lipocortin 1 levels in murine peripheral blood leukocytes by flow cytometry: modulation by glucocorticoids and inflammation.

    PubMed

    Perretti, M; Flower, R J

    1996-06-01

    1. Lipocortin 1 (LC1) immunoreactivity in murine peripheral blood leukocytes was quantified by use of a flow cytometric technique associated with a permeabilisation protocol with saponin. Using specific antisera raised against the whole protein or against its N-terminus peptide, cell-associated LC1-like immunoreactivity was easily detected in circulating neutrophils and monocytes, whereas very low levels were found in lymphocytes. Of the total protein measured 17.6% and 36% were associated with the external plasma membrane in neutrophils and monocytes, as assessed in the absence of cell permeabilisation, whereas no signal was detected on lymphocyte plasma membrane. 2. Treatment of mice with dexamethasone (Dex; 0.5-5 micrograms per mouse corresponding to approximately 0.015-1.5 mg kg-1) increased LC1 levels in neutrophils and monocytes. The 2-3 fold increase in LC1 levels was time-dependent with a peak at 2 h. Treatment of mice with the steroid antagonist, RU486 (two doses of 20 mg kg-1 orally) decreased LC1-like immunoreactivity in all three types of circulating leukocytes by > or = 50%. 3. Extravasation of blood neutrophils into inflamed tissue sites resulted in a consistent reduction (> or = 50%) in LC1 levels compared with circulating neutrophils. A high LC1-like immunoreactivity was also measured in resident macrophages, of which approximately one third was membrane-associated. Induction of an acute inflammatory response in the murine peritoneal cavity did not modify total LC1 levels measured in macrophages, but reduced membrane-associated LC1 to a significant extent, i.e. up to 70%. 4. In conclusion, flow cytometric analysis is a rapid and convenient method for detecting and measuring LC1 in murine leukocytes. We confirmed that LC1 protein expression is controlled by exogenous and endogenous glucocorticoids. Amongst other factor(s) influencing protein concentrations, extravasation was found to be associated with a reduced LC1 expression in the emigrated cells.

  18. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  19. Canine pancreatic lipase immunoreactivity concentrations associated with intervertebral disc disease in 84 dogs.

    PubMed

    Schueler, R O; White, G; Schueler, R L; Steiner, J M; Wassef, A

    2018-05-01

    To determine the differences in serum canine pancreatic lipase immunoreactivity between dogs with intervertebral disc herniation and healthy control dogs. Eighty-four client-owned dogs with intervertebral disc herniation, diagnosed by neurologic examination and imaging, and 18 healthy control dogs. Samples of whole blood were collected within 90 minutes of admission. Serum canine pancreatic lipase immunoreactivity concentrations were measured by a commercial immunoassay and evaluated for association with intervertebral disc herniation, signalment, neurolocalisation and the preadmission administration of glucocorticosteriods or non-steroidal anti-inflammatory drugs. Serum canine pancreatic lipase immunoreactivity concentrations were statistically increased in dogs with intervertebral disc herniation (P<0·01, n=38). A subgroup of dogs (19/38) with elevated canine pancreatic lipase immunoreactivity concentrations was re-evaluated between 2 and 4 weeks later, and 15 had resolution of clinical signs and values less than 200 μg/L. Serum canine pancreatic lipase immunoreactivity concentrations were not significantly correlated with clinical gastrointestinal disease, neurolocalisation or the preadmission administration of corticosteroids or non-steroidal anti-inflammatory drugs. These results suggest that serum canine pancreatic lipase immunoreactivity concentrations are significantly elevated in dogs with intervertebral disc herniation. © 2018 British Small Animal Veterinary Association.

  20. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  1. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  2. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  3. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  5. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  6. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  7. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  8. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  9. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  10. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  11. Sequence of Fibrinogen Proteolysis and Platelet Release after Intrauterine Infusion of Hypertonic Saline

    PubMed Central

    Nossel, H. L.; Wasser, J.; Kaplan, K. L.; Lagamma, K. S.; Yudelman, I.; Canfield, R. E.

    1979-01-01

    Plasma fibrinopeptide B (Bβ1-14 or FPB) immunoreactivity was studied by radioimmunoassay in patients who received intrauterine infusion of hypertonic saline to terminate pregnancy. FPB immunoreactivity increased with thrombin treatment (TIFPB) suggesting the presence of a larger FPB-containing peptide, since purified FPB is not altered by thrombin, whereas thrombin increases the immunoreactivity of Bβ1-42 (which includes FPB) 10-fold. TIFPB immunoreactivity in plasma, drawn 4 h after hypertonic saline infusion eluted from Sephadex G-50 similarly to isolated Bβ1-42. Streptokinase, incubated with normal plasma progressively generated TIFPB immunoreactivity, which showed a major component which eluted from Sephadex G-50 similarly to Bβ1-42. Streptokinase generated TIFPB much more rapidly in reptilase-treated plasma that contains fibrin I, (which still includes FPB), indicating that fibrin I is preferred over fibrinogen as a substrate for plasmin cleavage of arginine (Bβ42)-alanine (Bβ43). Serial studies were then made in 10 patients receiving intrauterine hypertonic saline. Fibrinopeptide A (FPA) levels rose immediately, reached a peak between 1 and 2 h, were declining at 4 h, and were normal at 24 and 48 h. TIFPB levels rose slightly in the 1st h, reached a peak at 4 h, and had returned to base-line values at 24 h. Serum fibrinogen degradation product levels were unchanged at 1 h, reached their highest level at 4 h, and were still markedly elevated at 24 and 48 h. Fibrinogen levels dropped slightly being lowest at 4 and 24 h. Platelet counts declined in parallel with the fibrinogen levels over the first 4 h, but continued to decrease through 48 h. Beta thromboglobulin (βTG) levels generally paralleled FPA levels whereas platelet factor 4 (PF4) levels showed only slight changes. The data indicate that immediately after intrauterine hypertonic saline infusion thrombin is formed that cleaves FPA from fibrinogen to produce fibrin I and releases βTG and PF4 from platelets. Later plasmin cleaves Bβ1-42 from fibrin I to produce fragment X, which is further degraded to form serum fibrinogen degradation products. This sequence of proteolysis indicates that plasmin action on fibrin I serves as a mechanism that regulates fibrin II formation by removing the Bβ chain cleavage site, which is required for thrombin action in converting fibrin I to fibrin II. PMID:500818

  12. Immunocytochemical analysis of P2X2 in rat circumvallate taste buds.

    PubMed

    Yang, Ruibiao; Montoya, Alana; Bond, Amanda; Walton, Jenna; Kinnamon, John C

    2012-05-23

    Our laboratory has shown that classical synapses and synaptic proteins are associated with Type III cells. Yet it is generally accepted that Type II cells transduce bitter, sweet and umami stimuli. No classical synapses, however, have been found associated with Type II cells. Recent studies indicate that the ionotropic purinergic receptors P2X2/P2X3 are present in rodent taste buds. Taste nerve processes express the ionotropic purinergic receptors (P2X2/P2X3). P2X2/P2X3(Dbl-/-) mice are not responsive to sweet, umami and bitter stimuli, and it has been proposed that ATP acts as a neurotransmitter in taste buds. The goal of the present study is to learn more about the nature of purinergic contacts in rat circumvallate taste buds by examining immunoreactivity to antisera directed against the purinergic receptor P2X2. P2X2-like immunoreactivity is present in intragemmal nerve processes in rat circumvallate taste buds. Intense immunoreactivity can also be seen in the subgemmal nerve plexuses located below the basal lamina. The P2X2 immunoreactive nerve processes also display syntaxin-1-LIR. The immunoreactive nerves are in close contact with the IP(3)R3-LIR Type II cells and syntaxin-1-LIR and/or 5-HT-LIR Type III cells. Taste cell synapses are observed only from Type III taste cells onto P2X2-LIR nerve processes. Unusually large, "atypical" mitochondria in the Type II taste cells are found only at close appositions with P2X2-LIR nerve processes. P2X2 immunogold particles are concentrated at the membranes of nerve processes at close appositions with taste cells. Based on our immunofluorescence and immunoelectron microscopical studies we believe that both perigemmal and most all intragemmal nerve processes display P2X2-LIR. Moreover, colloidal gold immunoelectron microscopy indicates that P2X2-LIR in nerve processes is concentrated at sites of close apposition with Type II cells. This supports the hypothesis that ATP may be a key neurotransmitter in taste transduction and that Type II cells release ATP, activating P2X2 receptors in nerve processes.

  13. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  14. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  15. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  16. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  17. Immunoreactive serum opsonic alpha 2 sb glycoprotein as a noninvasive index of RES systemic defense after trauma.

    PubMed

    Kaplan, J E; Saba, T M

    1979-01-01

    Reticuloendothelial system (RES) depression has been correlated with diminished resistance to trauma, shock, and sepsis in man and animals. Previous studies have related the depression of RES hepatic Kupffer cell phagocytic function after trauma to diminished bioassayable opsonic activity. The present study determined if the loss of biological activity and RES alteration correlated with immunoreactive serum opsonic alpha 2 SB glycoprotein levels after trauma. Serum opsonic activity was measured by liver slice bioassay, and immunoreactive opsonic protein was measured by rocket electroimmunoassay. RE function was determined by colloid clearance over a 24-hour post-trauma period. Anesthetized rats (250-300 gm) subjected to sublethal or severe (greater than LD50) whole-body NCD trauma were the shock models investigated. Immunoreactive levels in 63 rats prior to injury were 518 +/- 24 microgram/ml. Neither biological nor immunoreactive levels were altered over 24 hours in anesthetized sham-traumatized controls. Temporal alteration in the initial decrease and recovery pattern of biologically active and immunoreactive opsonic protein levels significantly correlated following both sublethal and severe injury. Moreover, the patterns of immunoreactive levels of the opsonic protein correlated with the functional phagocytic activity of the RES as determined by vascular clearance of a test dose of blood-borne radiolabeled particulates. This glycoprotein falls after trauma, and the magnitude and duration of the decline increases with severity of injury. Immunoreactive opsonic alpha 2 SB glycoprotein appears to be an accurate measurement of circulating opsonic activity and RE Kupffer cell function after trauma, especially with respect to clearance. Thus, immunoreactive opsonic protein warrants clinical consideration as a noninvasive measure of reticuloendothelial systemic defense in patients after trauma and burn.

  18. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  19. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  20. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  1. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  2. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  3. The non-human primate striatum undergoes marked prolonged remodeling during postnatal development

    PubMed Central

    Martin, Lee J.; Cork, Linda C.

    2014-01-01

    We examined the postnatal ontogeny of the striatum in rhesus monkeys (Macaca mulatta) to identify temporal and spatial patterns of histological and chemical maturation. Our goal was to determine whether this forebrain structure is developmentally static or dynamic in postnatal life. Brains from monkeys at 1 day, 1, 4, 6, 9, and 12 months of age (N = 12) and adult monkeys (N = 4) were analyzed. Nissl staining was used to assess striatal volume, cytoarchitecture, and apoptosis. Immunohistochemistry was used to localize and measure substance P (SP), leucine-enkephalin (LENK), tyrosine hydroxylase (TH), and calbindin D28 (CAL) immunoreactivities. Mature brain to body weight ratio was achieved at 4 months of age, and striatal volume increased from ∼1.2 to ∼1.4 cm3 during the first postnatal year. Nissl staining identified, prominently in the caudate nucleus, developmentally persistent discrete cell islands with neuronal densities greater than the surrounding striatal parenchyma (matrix). Losses in neuronal density were observed in island and matrix regions during maturation, and differential developmental programmed cell death was observed in islands and matrix regions. Immunohistochemistry revealed striking changes occurring postnatally in striatal chemical neuroanatomy. At birth, the immature dopaminergic nigrostriatal innervation was characterized by islands enriched in TH-immunoreactive puncta (putative terminals) in the neuropil; TH-enriched islands aligned completely with areas enriched in SP immunoreactivity but low in LENK immunoreactivity. These areas enriched in SP immunoreactivity but low in LENK immunoreactivity were identified as striosome and matrix areas, respectively, because CAL immunoreactivity clearly delineated these territories. SP, LENK, and CAL immunoreactivities appeared as positive neuronal cell bodies, processes, and puncta. The matrix compartment at birth contained relatively low TH-immunoreactive processes and few SP-positive neurons but was densely populated with LENK-immunoreactive neurons. The nucleus accumbens part of the ventral striatum also showed prominent differences in SP, LENK, and CAL immunoreactivities in shell and core territories. During 12 months of postnatal maturation salient changes occurred in neurotransmitter marker localization: TH-positive afferents densely innervated the matrix to exceed levels of immunoreactivity in the striosomes; SP immunoreactivity levels increased in the matrix; and LENK-immunoreactivity levels decreased in the matrix and increased in the striosomes. At 12 months of age, striatal chemoarchitecture was similar qualitatively to adult patterns, but quantitatively different in LENK and SP in caudate, putamen, and nucleus accumbens. This study shows for the first time that the rhesus monkey striatum requires more than 12 months after birth to develop an adult-like pattern of chemical neuroanatomy and that principal neurons within striosomes and matrix have different developmental programs for neuropeptide expression. We conclude that postnatal maturation of the striatal mosaic in primates is not static but, rather, is a protracted and dynamic process that requires many synchronous and compartment-selective changes in afferent innervation and in the expression of genes that regulate neuronal phenotypes. PMID:25294985

  4. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  5. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  6. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  7. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  8. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  9. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  10. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  11. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  12. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  13. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  14. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  15. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  16. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  17. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  18. Elevated expression in situ of selectin and immunoglobulin superfamily type adhesion molecules in retroocular connective tissues from patients with Graves' ophthalmopathy.

    PubMed Central

    Heufelder, A E; Bahn, R S

    1993-01-01

    Activation of certain adhesion molecules within vascular endothelium and the surrounding extravascular space is a critical event in the recruitment and targeting of an inflammatory response or autoimmune attack to a particular tissue site. We have recently demonstrated that the adhesion of lymphocytes to cultured retroocular fibroblasts obtained from patients with Graves' ophthalmopathy (GO) is mediated predominantly by the interaction of lymphocyte function-associated antigen-1 (LFA-1), expressed on lymphocytes, with intercellular adhesion molecule-1 (ICAM-1), expressed by these cells following exposure to interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha), IL-1 alpha or purified thyroid-stimulating immunoglobulins. We now report the expression and localization in situ of several adhesion molecules, ICAM-1, endothelial leucocyte adhesion molecule-1 (ELAM-1), vascular cell adhesion molecule-1 (VCAM-1), and LFA-3 in retroocular tissues derived from patients with severe GO (n = 4) and normal individuals (n = 3). Serial cryostat sections of tissue specimens were processed for immunoperoxidase staining using various MoAbs against ICAM-1, ELAM-1, VCAM-1 and LFA-3. In addition, consecutive sections were stained with MoAbs against LFA-1, CD45RO (UCHL-1)DR-human leucocyte antigen (HLA-DR), CD11b/CD18 (Mac-1), and CD11c/CD18 (p150,95). In GO-retroocular tissues, strong immunoreactivity for ICAM-1 and LFA-3 was detected in blood vessels (> 90%), in perimysial fibroblasts surrounding extraocular muscle fibres, and in connective tissue distinct from extraocular muscle. No ICAM-1 or LFA-3 immunoreactivity was present in extraocular muscle cells themselves. ICAM-1 and LFA-3 immunoreactivity in normal tissues was minimal or absent both in connective and muscle tissues. Vascular endothelium was strongly positive for ELAM-1 and VCAM-1 in GO-retroocular tissues, while VCAM-1 immunoreactivity was minimal (< 5% of blood vessels) and ELAM-1 immunoreactivity was generally absent in normal retroocular tissue. LFA-1-expressing, activated mononuclear cells and memory T lymphocytes (CD3+/CD45RO+) were only detected in GO-retrocular tissues, and were mainly localized around blood vessels and in areas of ICAM-1-expressing connective and perimysial tissue. HLA-DR expression was restricted to GO-tissue specimens, with strong immunoreactivity detected in blood vessels, macrophages and connective tissue and perimysial fibroblasts. No HLA-DR was detectable in extraocular muscle cells. In conclusion, infiltration of the orbit in GO by mononuclear cells, and their targeting within the orbit, may depend upon the coordinate expression of certain adhesion and MHC molecules.(ABSTRACT TRUNCATED AT 400 WORDS) Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:7680294

  19. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  20. Osteocalcin and Osteonectin Expression in Canine Osteosarcoma.

    PubMed

    Wehrle-Martinez, A S; Dittmer, K E; Aberdein, D; Thompson, K G

    2016-07-01

    Osteosarcoma (OSA) is a malignant heterogeneous primary bone tumor responsible for up to 90% of all primary bone tumors in dogs. In this study, osteocalcin (OC) and osteonectin (ON) immunoreactivity was evaluated in 23 canine OSAs, 4 chondrosarcomas, 4 fibrosarcomas, 2 hemangiosarcomas, and 4 histiocytic sarcomas. The effects of three different decalcification agents (ethylenediaminetetraetic acid [EDTA], formic acid and hydrochloric acid [HCl]) on the immunoreactivity for OC and ON was also assessed. Immunoreactivity to OC was present in 19/23 (83%) cases of OSA and all cases of chondrosarcoma. In three OSAs the extracellular matrix showed immunoreactivity to OC. None of the fibrosarcomas, histiocytic sarcomas or hemangiosarcomas showed immunoreactivity to OC. The sensitivity and specificity for OC in canine OSA in this study was 83% and 71% respectively. For ON, 100% of both OSAs (23/23) and non-OSAs (14/14) showed cytoplasmic immunoreactivity to this antibody, giving a sensitivity of 100% but a complete lack of specificity. There were no significant differences in immunoreactivity for OC and ON between the different decalcification agents used. In conclusion, OC showed high sensitivity for identifying OSA but it failed to distinguish between OSA and chondrosarcoma, and the osteoid produced by neoplastic cells in most cases did not show immunoreactivity to OC. These factors may limit the practical utility of OC in the diagnosis of OSA in dogs when chondrosarcoma is a differential diagnosis. ON showed no specificity in detecting OSA and has little practical application for the diagnosis of OSA in dogs. © The Author(s) 2016.

  1. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  2. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  3. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  4. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  5. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  6. The association of metal ion exposure with alpha-synuclein-like immunoreactivity in the central nervous system of fish, Catostomus commersoni.

    PubMed

    Boudreau, Heather S; Krol, Karmen M; Eibl, Joseph K; Williams, Linda D; Rossiter, John P; Palace, Vincent P; Ross, Gregory M

    2009-05-17

    Alpha-synuclein protein aggregates are a major component of Lewy bodies, the intracytoplasmic inclusions found in dopaminergic neurons that are a defining characteristic of Parkinson's disease. Other "synucleopathies" include dementia with Lewy bodies and multisystem atrophy. In vitro, the formation of these deposits can be induced by a number of substances, including metal ions. Fish provide a useful model to study the long-term biological effects of metal ion exposure, but to date no studies have been reported concerning such exposures with respect to alpha-synuclein aggregation. Mature white sucker fish (Catostomus commersoni; aged 5-8 years) were sampled from two sites within the Red Lake area of Northwestern Ontario, a region highly contaminated by metal ions due to mining activity. Individual fish were characterized with respect to liver metal ion uptake and metallothionein levels. Central nervous system (CNS) tissues of fish from test sites representing high and low metal ion contamination were examined immunohistochemically using a polyclonal antibody recognising alpha-synuclein protein. We demonstrate here that the CNS of fish exposed to elevated metal ion environments had increased alpha-synuclein-like immunoreactive aggregates, potentially reflecting metal ion exposure leading to CNS toxicity. These findings demonstrate that fish may be an important new model for studying environmental risk factors and the pathology associated with Parkinson's disease.

  7. Immunohistochemical evaluation of neuroreceptors in healthy and pathological temporo-mandibular joint.

    PubMed

    Favia, Gianfranco; Corsalini, Massimo; Di Venere, Daniela; Pettini, Francesco; Favia, Giorgio; Capodiferro, Saverio; Maiorano, Eugenio

    2013-01-01

    A study was performed on the articular disk and periarticular tissues of the temporo-mandibular joint (TMJ) with immunohistochemical techniques to give evidence to the presence of neuroreceptors (NRec) in these sites. The study was carried out on tissue samples obtained from 10 subjects without TMJ disease and from 7 patients with severe TMJ arthritis and arthrosis. We use antibodies directed against following antigens: Gliofibrillary Acidic Protein (GFAP), Leu-7, Myelin Basic Protein (MBP), Neurofilaments 68 kD (NF), Neuron Specific Enolase (NSE), S-100 protein (S-100) and Synaptophysin (SYN). This study revealed that Ruffini's-like, Pacini's-like and Golgi's-like receptors can be demonstrated in TMJ periarticular tissues and that free nervous endings are present in the subsynovial tissues but not within the articular disk. We observed elongated cytoplamic processes of chondrocytes that demonstrated strong S-100 immunoreactivity but they were unreactive with all other antibodies. These cytoplamic processes were more abundant and thicker in the samples obtained from patients with disease TMJ. The results of this study confirm that different Nrec are detectable in TMJ periarticular tissues but they are absent within the articular disk. In the latter site, only condrocytic processes are evident, especially in diseased TMJ, and they might have been confused with nervous endings in previous morphological studies. Nevertheless the absence of immunoreactivity for NF, NSE and SYN proves that they are not of neural origin.

  8. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  9. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  10. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  11. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  12. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  13. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  14. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  17. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  19. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  20. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Top