Sample records for binding sites induced

  1. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  2. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  3. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  4. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  5. Tannic acid and chromic chloride-induced binding of protein to red cells: a preliminary study of possible binding sites and reaction mechanisms.

    PubMed

    Hunt, A F; Reed, M I

    1990-07-01

    The binding mechanisms and binding sites involved in the tannic acid and chromic chloride-induced binding of protein to red cells were investigated using the binding of IgA paraprotein to red cells as model systems. Inhibition studies of these model systems using amino acid homopolymers and compounds (common as red cell membrane constituents) suggest that the mechanisms involved are similar to those proposed for the conversion of hide or skin collagen to leather, as in commercial tanning. These studies also suggest that tannic acid-induced binding of IgA paraprotein to red cells involves the amino acid residues of L-arginine, L-lysine, L-histidine, and L-proline analogous to tanning with phenolic plant extracts. The amino acid residues of L-aspartate, L-glutamate and L-asparagine are involved in a similar manner in chronic chloride-induced binding of protein to red cells.

  6. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Fukuda, H.

    1985-07-22

    When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  9. Tolerance to LSD and DOB induced shaking behaviour: differential adaptations of frontocortical 5-HT(2A) and glutamate receptor binding sites.

    PubMed

    Buchborn, Tobias; Schröder, Helmut; Dieterich, Daniela C; Grecksch, Gisela; Höllt, Volker

    2015-03-15

    Serotonergic hallucinogens, such as lysergic acid diethylamide (LSD) and dimethoxy-bromoamphetamine (DOB), provoke stereotype-like shaking behaviour in rodents, which is hypothesised to engage frontocortical glutamate receptor activation secondary to serotonin2A (5-HT2A) related glutamate release. Challenging this hypothesis, we here investigate whether tolerance to LSD and DOB correlates with frontocortical adaptations of 5-HT2A and/or overall-glutamate binding sites. LSD and DOB (0.025 and 0.25 mg/kg, i.p.) induce a ketanserin-sensitive (0.5 mg/kg, i.p., 30-min pretreatment) increase in shaking behaviour (including head twitches and wet dog shakes), which with repeated application (7× in 4 ds) is undermined by tolerance. Tolerance to DOB, as indexed by DOB-sensitive [(3)H]spiroperidol and DOB induced [(35)S]GTP-gamma-S binding, is accompanied by a frontocortical decrease in 5-HT2A binding sites and 5-HT2 signalling, respectively; glutamate-sensitive [(3)H]glutamate binding sites, in contrast, remain unchanged. As to LSD, 5-HT2 signalling and 5-HT2A binding, respectively, are not or only marginally affected, yet [(3)H]glutamate binding is significantly decreased. Correlation analysis interrelates tolerance to DOB to the reduced 5-HT2A (r=.80) as well as the unchanged [(3)H]glutamate binding sites (r=.84); tolerance to LSD, as opposed, shares variance with the reduction in [(3)H]glutamate binding sites only (r=.86). Given that DOB and LSD both induce tolerance, one correlating with 5-HT2A, the other with glutamate receptor adaptations, it might be inferred that tolerance can arise at either level. That is, if a hallucinogen (like LSD in our study) fails to induce 5-HT2A (down-)regulation, glutamate receptors (activated postsynaptic to 5-HT2A related glutamate release) might instead adapt and thus prevent further overstimulation of the cortex. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Lanthanide ions induce hydrolysis of hemoglobin-bound 2,3-diphosphoglycerate (2,3-DPG), conformational changes of globin and bidirectional changes of 2,3-DPG-hemoglobin's oxygen affinity.

    PubMed

    Cheng, Y; Lin, H; Xue, D; Li, R; Wang, K

    2001-02-14

    The changes in structure and function of 2,3-diphosphoglycerate-hemoglobin (2,3-DPG-Hb) induced by Ln(3+) binding were studied by spectroscopic methods. The binding of lanthanide cations to 2,3-DPG is prior to that to Hb. Ln(3+) binding causes the hydrolysis of either one from the two phosphomonoester bonds in 2,3-DPG non-specifically. The results using the ultrafiltration method indicate that Ln(3+) binding sites for Hb can be classified into three categories: i.e. positive cooperative sites (N(I)), non-cooperative strong sites (N(S)) and non-cooperative weak sites (N(W)) with binding constants in decreasing order: K(I)>K(S)>K(W). The total number of binding sites amounts to about 65 per Hb tetramer. Information on reaction kinetics was obtained from the change of intrinsic fluorescence in Hb monitored by stopped-flow fluorometry. Fluctuation of fluorescence dependent on Ln(3+) concentration and temperature was observed and can be attributed to the successive conformational changes induced by Ln(3+) binding. The results also reveal the bidirectional changes of the oxygen affinity of Hb in the dependence on Ln(3+) concentration. At the range of [Ln(3+)]/[Hb]<2, the marked increase of oxygen affinity (P(50) decrease) with the Ln(3+) concentration can be attributed to the hydrolysis of 2,3-DPG, while the slight rebound of oxygen affinity in higher Ln(3+) concentration can be interpreted by the transition to the T-state of the Hb tetramer induced by Ln(3+) binding. This was indicated by the changes in secondary structure characterized by the decrease of alpha-helix content.

  11. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

    2010-12-03

    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

  12. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  13. Tension-induced binding of semiflexible biopolymers

    NASA Astrophysics Data System (ADS)

    Benetatos, Panayotis; von der Heydt, Alice; Zippelius, Annette

    2015-03-01

    We investigate theoretically the effect of polymer tension on the collective behaviour of reversible cross-links. We use a model of two parallel-aligned, weakly-bending wormlike chains with a regularly spaced sequence of binding sites subjected to a tensile force. Reversible cross-links attach and detach at the binding sites with an affinity controlled by a chemical potential. In a mean-field approach, we calculate the free energy of the system and we show the emergence of a free energy barrier which controls the reversible (un)binding. The tension affects the conformational entropy of the chains which competes with the binding energy of the cross-links. This competition gives rise to a sudden increase in the fraction of bound sites as the polymer tension increases. The force-induced first-order transition in the number of cross-links implies a sudden force-induced stiffening of the effective stretching modulus of the polymers. This mechanism may be relevant to the formation and stress-induced strengthening of stress fibers in the cytoskeleton. We acknowledge support by the Deutsche Forschungsgemeinschaft (DFG) via grant SFB-937/A1.

  14. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  15. Oxidation-induced Structural Changes of Ceruloplasmin Foster NGR Motif Deamidation That Promotes Integrin Binding and Signaling

    PubMed Central

    Barbariga, Marco; Curnis, Flavio; Spitaleri, Andrea; Andolfo, Annapaola; Zucchelli, Chiara; Lazzaro, Massimo; Magnani, Giuseppe; Musco, Giovanna; Corti, Angelo; Alessio, Massimo

    2014-01-01

    Asparagine deamidation occurs spontaneously in proteins during aging; deamidation of Asn-Gly-Arg (NGR) sites can lead to the formation of isoAsp-Gly-Arg (isoDGR), a motif that can recognize the RGD-binding site of integrins. Ceruloplasmin (Cp), a ferroxidase present in the cerebrospinal fluid (CSF), contains two NGR sites in its sequence: one exposed on the protein surface (568NGR) and the other buried in the tertiary structure (962NGR). Considering that Cp can undergo oxidative modifications in the CSF of neurodegenerative diseases, we investigated the effect of oxidation on the deamidation of both NGR motifs and, consequently, on the acquisition of integrin binding properties. We observed that the exposed 568NGR site can deamidate under conditions mimicking accelerated Asn aging. In contrast, the hidden 962NGR site can deamidate exclusively when aging occurs under oxidative conditions, suggesting that oxidation-induced structural changes foster deamidation at this site. NGR deamidation in Cp was associated with gain of integrin-binding function, intracellular signaling, and cell pro-adhesive activity. Finally, Cp aging in the CSF from Alzheimer disease patients, but not in control CSF, causes Cp deamidation with gain of integrin-binding function, suggesting that this transition might also occur in pathological conditions. In conclusion, both Cp NGR sites can deamidate during aging under oxidative conditions, likely as a consequence of oxidative-induced structural changes, thereby promoting a gain of function in integrin binding, signaling, and cell adhesion. PMID:24366863

  16. Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

    PubMed

    Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

    2002-09-01

    Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

  17. Down-regulation of sup 3 H-imipramine binding sites in rat cerebral cortex prenatal exposure to antidepressants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montero, D.; de Ceballos, M.L.; Del Rio, J.

    1990-01-01

    Several antidepressant drugs were given to pregnant rats in the last 15 days of gestation and {sup 3}H-imipramine binding ({sup 3}H-IMI) was subsequently measured in the cerebral cortex of the offspring. The selective serotonin (5-HT) uptake blockers chlorimipramine and fluoxetine as well as the selective monoamine oxidase (MAO) inhibitors clorgyline and deprenyl induced, after prenatal exposure, a down-regulation of {sup 3}H-IMI binding sites at postnatal day 25. The density of these binding sites was still reduced at postnatal day 90 in rats exposed in utero to the MAO inhibitors. The antidepressants desipramine and nomifensine were ineffective in this respect. Aftermore » chronic treatment of adult animals, only chlorimipramine was able to down-regulate the {sup 3}H-IMI binding sites. Consequently, prenatal exposure of rats to different antidepressant drugs affecting predominantly the 5-HT systems induces more marked and long-lasting effects on cortical {sup 3}H-IMI binding sites. The results suggest that the developing brain is more susceptible to the actions of antidepressants.« less

  18. Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

    PubMed Central

    Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

    2006-01-01

    The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

  19. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  20. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  1. Modeling Shear Induced Von Willebrand Factor Binding to Collagen

    NASA Astrophysics Data System (ADS)

    Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

    2017-11-01

    Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

  2. ADP binding to TF1 and its subunits induces ultraviolet spectral changes.

    PubMed

    Hisabori, T; Yoshida, M; Sakurai, H

    1986-09-01

    Adenine nucleotide binding sites on the coupling factor ATPase of thermophilic bacterium PS3 (TF1) were investigated by UV spectroscopy and by equilibrium dialysis. When ADP was mixed with TF1 in the presence and in the absence of Mg2+, an UV absorbance change was induced (t1/2 approximately 1 min) with a peak at about 278 nm and a trough at about 250 nm. Similar spectral changes were induced by ADP with the isolated beta subunits in the presence and in the absence of Mg2+, and with the isolated alpha subunits in the presence of Mg2+ although the magnitudes of the changes were different. From equilibrium dialysis measurement we identified two classes of nucleotide binding sites in TF1 in the presence of Mg2+, three high-affinity sites (Kd = 61 nM) and three low-affinity sites (Kd = 87 microM). In the absence of Mg2+, TF1 has one high-affinity site (Kd less than 10 nM) and five low-affinity sites (Kd = 100 microM). Moreover, we found a single Mg2+-dependent ADP binding site on the isolated alpha subunit and a single Mg2+-independent ADP binding site on the isolated beta subunit. From the above observations, we concluded that the three Mg2+-dependent high-affinity sites for ADP are located on the alpha subunit in TF1 and that the single high-affinity site is located on one of the beta subunits in TF1 in the absence of Mg2+.

  3. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  4. Tiron Inhibits UVB-Induced AP-1 Binding Sites Transcriptional Activation on MMP-1 and MMP-3 Promoters by MAPK Signaling Pathway in Human Dermal Fibroblasts

    PubMed Central

    Zhang, Chao; Zhao, Mei; Zhang, Quan-Wu; Gao, Feng-Hou

    2016-01-01

    Recent research found that Tiron was an effective antioxidant that could act as the intracellular reactive oxygen species (ROS) scavenger or alleviate the acute toxic metal overload in vivo. In this study, we investigated the inhibitory effect of Tiron on matrix metalloproteinase (MMP)-1 and MMP-3 expression in human dermal fibroblast cells. Western blot and ELISA analysis revealed that Tiron inhibited ultraviolet B (UVB)-induced protein expression of MMP-1 and MMP-3. Real-time quantitative PCR confirmed that Tiron could inhibit UVB-induced mRNA expression of MMP-1 and MMP-3. Furthermore, Tiron significantly blocked UVB-induced activation of the MAPK signaling pathway and activator protein (AP)-1 in the downstream of this transduction pathway in fibroblasts. Through the AP-1 binding site mutation, it was found that Tiron could inhibit AP-1-induced upregulation of MMP-1 and MMP-3 expression through blocking AP-1 binding to the AP-1 binding sites in the MMP-1 and MMP-3 promoter region. In conclusion, Tiron may be a novel antioxidant for preventing and treating skin photoaging UV-induced. PMID:27486852

  5. Regulation of uterine progesterone receptors by the nonsteroidal anti-androgen hydroxyflutamide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chandrasekhar, Y.; Armstrong, D.T.

    1991-07-01

    The authors have recently reported that the anti-androgen hydroxyflutamide causes delayed implantation and exhibits antideciduogenic activity in the rat. The present experiments were conducted to examine whether hydroxyflutamide binds to the uterine progesterone receptors and/or alters the progesterone binding sites in the uterus. Cytosol and nuclear fractions from decidualized rat uterus were incubated with (3H)-R5020 without or with increasing concentrations of radioinert R5020, RU486, dihydrotestosterone, or hydroxyflutamide. From the log-dose inhibition curves, the relative binding affinity of both hydroxyflutamide and dihydrotestosterone was less than 0.1% and 2%, compared with R5020 (100%) for displacing (3H)-R5020 bound to uterine cytosol and nuclearmore » fractions, respectively. Injection of estradiol-17 beta (1 microgram/rat) to ovariectomized prepubertal rats induced a 1.85-fold increase in uterine weight by 24 h. Hydroxyflutamide at 2.5 or 5.0 mg did not significantly alter the estrogen-induced increase in uterine weight. Compared to vehicle alone, estrogen induced an approximately 5-fold increase in uterine cytosolic progesterone binding sites. Hydroxyflutamide at both 2.5- and 5.0-mg doses significantly attenuated the estrogen-induced elevation in uterine progesterone binding sites. These studies demonstrate that hydroxyflutamide does not bind with high affinity to progesterone receptors, but suppresses the estrogen-induced elevation in progesterone receptor levels in the uterus.« less

  6. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed Central

    Brierley, I; Hoggett, J G

    1992-01-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129

  7. Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells

    PubMed Central

    Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele

    2014-01-01

    Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548

  8. Molecular mechanism of the allosteric regulation of the αγ heterodimer of human NAD-dependent isocitrate dehydrogenase

    PubMed Central

    Ma, Tengfei; Peng, Yingjie; Huang, Wei; Ding, Jianping

    2017-01-01

    Human NAD-dependent isocitrate dehydrogenase catalyzes the decarboxylation of isocitrate (ICT) into α-ketoglutarate in the Krebs cycle. It exists as the α2βγ heterotetramer composed of the αβ and αγ heterodimers. Previously, we have demonstrated biochemically that the α2βγ heterotetramer and αγ heterodimer can be allosterically activated by citrate (CIT) and ADP. In this work, we report the crystal structures of the αγ heterodimer with the γ subunit bound without or with different activators. Structural analyses show that CIT, ADP and Mg2+ bind adjacent to each other at the allosteric site. The CIT binding induces conformational changes at the allosteric site, which are transmitted to the active site through the heterodimer interface, leading to stabilization of the ICT binding at the active site and thus activation of the enzyme. The ADP binding induces no further conformational changes but enhances the CIT binding through Mg2+-mediated interactions, yielding a synergistic activation effect. ICT can also bind to the CIT-binding subsite, which induces similar conformational changes but exhibits a weaker activation effect. The functional roles of the key residues are verified by mutagenesis, kinetic and structural studies. Our structural and functional data together reveal the molecular mechanism of the allosteric regulation of the αγ heterodimer. PMID:28098230

  9. Rational design of a conformation-switchable Ca2+- and Tb3+-binding protein without the use of multiple coupled metal-binding sites.

    PubMed

    Li, Shunyi; Yang, Wei; Maniccia, Anna W; Barrow, Doyle; Tjong, Harianto; Zhou, Huan-Xiang; Yang, Jenny J

    2008-10-01

    Ca2+, as a messenger of signal transduction, regulates numerous target molecules via Ca2+-induced conformational changes. Investigation into the determinants for Ca2+-induced conformational change is often impeded by cooperativity between multiple metal-binding sites or protein oligomerization in naturally occurring proteins. To dissect the relative contributions of key determinants for Ca2+-dependent conformational changes, we report the design of a single-site Ca2+-binding protein (CD2.trigger) created by altering charged residues at an electrostatically sensitive location on the surface of the host protein rat Cluster of Differentiation 2 (CD2).CD2.trigger binds to Tb3+ and Ca2+ with dissociation constants of 0.3 +/- 0.1 and 90 +/- 25 microM, respectively. This protein is largely unfolded in the absence of metal ions at physiological pH, but Tb3+ or Ca2+ binding results in folding of the native-like conformation. Neutralization of the charged coordination residues, either by mutation or protonation, similarly induces folding of the protein. The control of a major conformational change by a single Ca2+ ion, achieved on a protein designed without reliance on sequence similarity to known Ca2+-dependent proteins and coupled metal-binding sites, represents an important step in the design of trigger proteins.

  10. Deciphering Cryptic Binding Sites on Proteins by Mixed-Solvent Molecular Dynamics.

    PubMed

    Kimura, S Roy; Hu, Hai Peng; Ruvinsky, Anatoly M; Sherman, Woody; Favia, Angelo D

    2017-06-26

    In recent years, molecular dynamics simulations of proteins in explicit mixed solvents have been applied to various problems in protein biophysics and drug discovery, including protein folding, protein surface characterization, fragment screening, allostery, and druggability assessment. In this study, we perform a systematic study on how mixtures of organic solvent probes in water can reveal cryptic ligand binding pockets that are not evident in crystal structures of apo proteins. We examine a diverse set of eight PDB proteins that show pocket opening induced by ligand binding and investigate whether solvent MD simulations on the apo structures can induce the binding site observed in the holo structures. The cosolvent simulations were found to induce conformational changes on the protein surface, which were characterized and compared with the holo structures. Analyses of the biological systems, choice of probes and concentrations, druggability of the resulting induced pockets, and application to drug discovery are discussed here.

  11. The allosteric citalopram binding site differentially interferes with neuronal firing rate and SERT trafficking in serotonergic neurons.

    PubMed

    Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten

    2016-11-01

    Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

  12. Specific ganglioside binding to receptor sites on T lymphocytes that couple to ganglioside-induced decrease of CD4 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morrison, W.J.; Offner, H.; Vandenbark, A.A.

    1989-01-01

    The binding of different gangliosides to rat T-helper lymphocytes was characterized under conditions that decrease CD4 expression on different mammalian T-helper lymphoctyes. Saturation binding by monosialylated ({sub 3}H)-GM{sub 1} to rat T-lymphocytes was time- and temperature-dependent, had a dissociation constant (K{sub D}) of 2.2 {plus minus} 1.4 {mu}M and a binding capacity near 2 fmoles/cell. Competitive inhibition of ({sup 3}H)- GM{sub 1} binding demonstrated a structural-activity related to the number of unconstrained sialic acid moieties on GM{sub 1}-congeneric gangliosides. A comparison between the results of these binding studies and gangliosides-induced decrease of CD4 expression demonstrated that every aspect of ({supmore » 3}H)-GM{sub 1} binding concurs with ganglioside modulation of CD4 expression. It is concluded that the specific decrease of CD4 expression induced by pretreatment with gangliosides involves the initial process of gangliosides binding to specific sites on CD4{sup {double dagger}} T-helper lymphocytes.« less

  13. Increased /sup 3/H-spiperone binding sites in mesolimbic area related to methamphetamine-induced behavioral hypersensitivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akiyama, K.; Sato, M.; Otsuki, S.

    1982-02-01

    The specific /sup 3/H-spiperone binding to membrane homogenates of the striatum, mesolimbic area, and frontal cortex was examined in two groups of rats pretreated once daily with saline or 4 mg/kg of methamphetamine (MAP) for 14 days. At 7 days following cessation of chronic pretreatment, all rats received an injection of 4 mg/kg of MAP and were decapitated 1 hr after the injection. In the chronic saline-pretreatment group, the single administration of MAP induced significant changes in the number (Bmax) of specific /sup 3/H-spiperone binding sites (a decrease in the striatum and an increase in the mesolimbic area and frontalmore » cortex), but no significant changes in the affinity (KD) in any brain area. The chronic MAP pretreatment markedly augmented the changes in Bmax in the striatum and mesolimbic area. The increase in specific /sup 3/H-spiperone binding sites in the mesolimbic area is discussed in relation to MAP-induced behavioral hypersensitivity.« less

  14. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse

    PubMed Central

    Jacobsen, Jacob P.R.; Plenge, Per; Sachs, Benjamin D.; Pehrson, Alan L.; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L.; Dalvi, Prachiti; Robinson, Taylor J.; O’Neill, Sharon P.; Khoo, King S.; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G.

    2015-01-01

    Rationale Escitalopram is a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and antidepressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram’s inhibition hereof. Objectives Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Methods Recombinant technology; in vivo microdialysis; receptor binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). Results We generated mice expressing either the wild-type human SERT (hSERTWT) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERTALI/VFL+SI/TT). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. Importantly, escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment. Further, escitalopram-induced 5-HTExt elevation was not affected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small, tending to be enhanced by R-citalopram co-administration. Conclusions We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram. Our findings points to mechanisms for R-citalopram antagonism of escitalopram’s antidepressant action other than direct antagonistic binding interactions at the hSERT. PMID:24810106

  16. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  17. Interaction of U-69,593 with. mu. -, delta- and k-opioid binding sites and its analgesic and intestinal effects in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    La Regina, A.; Petrillo, P.; Sbacchi, M.

    1988-01-01

    The k-opioid compound U-69,593 was studied in rats in vitro in binding assays to assess its selectivity at the single types of opioid sites and in vivo to assess its analgesic activity and effect on intestinal propulsion. In vitro the U-69,593 inhibition curve of (/sup 3/H)-(-)-bremazocine binding suppressed at ..mu..- and delta-sites was biphasic and the inhibition constant (K/sub l/) at the high-affinity site (10-18nM) was two orders of magnitude smaller the K/sub l/ at the low-affinity site. The K/sub l/ at ..mu..- and delta-sites were respectively 3.3 and 8.5 ..mu..M. Thus (/sup 3/H)-(-)-bremazocine, suppressed at ..mu..- and delta-sites, maymore » still bind more than one site, which U-69,593 might distinguish. In vivo U-69,593 i.p. prolonged the reaction time of rats on a 55/sup 0/C hot-plate and the dose of naloxone required to antagonize this effect was 40 times the dose that antagonized morphine-induced antinociception, suggesting the involvement of the k-receptor. In the intestinal transit test U-69,593 at doses between 0.5 and 15 mg/kg i.p. only slightly slowed intestinal transit of a charcoal meal in rats with no dose-relation; it partly but significantly antagonized morphine-induced constipation. These results suggest that the k-type of opioid receptor, with which U-69,593 interacts may induce analgesia, but has no appreciable role in the mechanisms of opioid-induced inhibition of intestinal transit in rats.« less

  18. Genistein and bisphenol A exposure cause estrogen receptor 1 to bind thousands of sites in a cell type-specific manner

    PubMed Central

    Gertz, Jason; Reddy, Timothy E.; Varley, Katherine E.; Garabedian, Michael J.; Myers, Richard M.

    2012-01-01

    Endogenous estrogens that are synthesized in the body impact gene regulation by activating estrogen receptors in diverse cell types. Exogenous compounds that have estrogenic properties can also be found circulating in the blood in both children and adults. The genome-wide impact of these environmental estrogens on gene regulation is unclear. To obtain an integrated view of gene regulation in response to environmental and endogenous estrogens on a genome-wide scale, we performed ChIP-seq to identify estrogen receptor 1 (ESR1; previously estrogen receptor α) binding sites, and RNA-seq in endometrial cancer cells exposed to bisphenol A (BPA; found in plastics), genistein (GEN; found in soybean), or 17β-estradiol (E2; an endogenous estrogen). GEN and BPA treatment induces thousands of ESR1 binding sites and >50 gene expression changes, representing a subset of E2-induced gene regulation changes. Genes affected by E2 were highly enriched for ribosome-associated proteins; however, GEN and BPA failed to regulate most ribosome-associated proteins and instead enriched for transporters of carboxylic acids. Treatment-dependent changes in gene expression were associated with treatment-dependent ESR1 binding sites, with the exception that many genes up-regulated by E2 harbored a BPA-induced ESR1 binding site but failed to show any expression change after BPA treatment. GEN and BPA exhibited a similar relationship to E2 in the breast cancer line T-47D, where cell type specificity played a much larger role than treatment specificity. Overall, both environmental estrogens clearly regulate gene expression through ESR1 on a genome-wide scale, although with lower potency resulting in less ESR1 binding sites and less gene expression changes compared to the endogenous estrogen, E2. PMID:23019147

  19. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  20. Evidence for a modulatory effect of sulbutiamine on glutamatergic and dopaminergic cortical transmissions in the rat brain.

    PubMed

    Trovero, F; Gobbi, M; Weil-Fuggaza, J; Besson, M J; Brochet, D; Pirot, S

    2000-09-29

    Chronic treatment of rats by sulbutiamine induced no change in density of N-methyl-D-aspartate (NMDA) and (+/-)-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors in the cingular cortex, but a significant decrease of the kainate binding sites, as measured by quantitative autoradiography. In the same treated animals, an increase of D1 dopaminergic (DA) binding sites was measured both in the prefrontal and the cingular cortex, while no modification of the D2 binding sites was detected. Furthermore, an acute sulbutiamine administration induced a decrease of kainate binding sites but no change of the density of D1 and D2 DA receptors. Acute sulbutiamine injection led to a decrease of the DA levels in the prefrontal cortex and 3,4-dihydroxyphenylacetic acid levels in both the cingular and the prefrontal cortex. These observations are discussed in terms of a modulatory effect of sulbutiamine on both dopaminergic and glutamatergic cortical transmissions.

  1. NF-κB is required for dengue virus NS5-induced RANTES expression.

    PubMed

    Khunchai, Sasiprapa; Junking, Mutita; Suttitheptumrong, Aroonroong; Kooptiwut, Suwattanee; Haegeman, Guy; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai

    2015-02-02

    Dengue virus (DENV) infection associates with renal disorders. Patients with dengue hemorrhagic fever and acute kidney injury have a high mortality rate. Increased levels of cytokines may contribute to the pathogenesis of DENV-induced kidney injury. Currently, molecular mechanisms how DENV induces kidney cell injury has not been thoroughly investigated. Excessive cytokine production may be involved in this process. Using human cytokine RT(2) Profiler PCR array, 14 genes including IP-10, RANTES, IL-8, CXCL-9 and MIP-1β were up-regulated more than 2 folds in DENV-infected HEK 293 cells compared to that of mock-infected HEK 293 cells. In the present study, RANTES was suppressed by the NF-κB inhibitor, compound A (CpdA), in DENV-infected HEK 293 cells implying the role of NF-κB in RANTES expression. Chromatin immunoprecipitation (ChIP) assay showed that NF-κB binds more efficiently to its binding sites on the RANTES promoter in NS5-transfected HEK 293 cells than in HEK 293 cells expressing the vector lacking NS5 gene. To further examine whether the NS5-activated RANTES promoter is mediated through NF-κB, the two NF-κB binding sites on the RANTES promoter were mutated and this promoter was coupled to the luciferase cDNA. The result showed that when both binding sites of NF-κB in the RANTES promoter were mutated, the ability of NS5 to induce the luciferase activity was significantly decreased. Therefore, DENV NS5 activates RANTES production by increasing NF-κB binding to its binding sites on the RANTES promoter. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  3. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  4. Histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and alters HagB-induced chemokine responses

    NASA Astrophysics Data System (ADS)

    Borgwardt, Derek S.; Martin, Aaron D.; van Hemert, Jonathan R.; Yang, Jianyi; Fischer, Carol L.; Recker, Erica N.; Nair, Prashant R.; Vidva, Robinson; Chandrashekaraiah, Shwetha; Progulske-Fox, Ann; Drake, David; Cavanaugh, Joseph E.; Vali, Shireen; Zhang, Yang; Brogden, Kim A.

    2014-01-01

    Histatins are human salivary gland peptides with anti-microbial and anti-inflammatory activities. In this study, we hypothesized that histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and attenuates HagB-induced chemokine responses in human myeloid dendritic cells. Histatin 5 bound to immobilized HagB in a surface plasmon resonance (SPR) spectroscopy-based biosensor system. SPR spectroscopy kinetic and equilibrium analyses, protein microarray studies, and I-TASSER structural modeling studies all demonstrated two histatin 5 binding sites on HagB. One site had a stronger affinity with a KD1 of 1.9 μM and one site had a weaker affinity with a KD2 of 60.0 μM. Binding has biological implications and predictive modeling studies and exposure of dendritic cells both demonstrated that 20.0 μM histatin 5 attenuated (p < 0.05) 0.02 μM HagB-induced CCL3/MIP-1α, CCL4/MIP-1β, and TNFα responses. Thus histatin 5 is capable of attenuating chemokine responses, which may help control oral inflammation.

  5. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  6. Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

    PubMed

    Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

    2017-09-09

    The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Interactions of divalent cations with calcium binding sites of BK channels reveal independent motions within the gating ring.

    PubMed

    Miranda, Pablo; Giraldez, Teresa; Holmgren, Miguel

    2016-12-06

    Large-conductance voltage- and calcium-activated K + (BK) channels are key physiological players in muscle, nerve, and endocrine function by integrating intracellular Ca 2+ and membrane voltage signals. The open probability of BK channels is regulated by the intracellular concentration of divalent cations sensed by a large structure in the BK channel called the "gating ring," which is formed by four tandems of regulator of conductance for K + (RCK1 and RCK2) domains. In contrast to Ca 2+ that binds to both RCK domains, Mg 2+ , Cd 2+ , or Ba 2+ interact preferentially with either one or the other. Interaction of cations with their binding sites causes molecular rearrangements of the gating ring, but how these motions occur remains elusive. We have assessed the separate contributions of each RCK domain to the cation-induced gating-ring structural rearrangements, using patch-clamp fluorometry. Here we show that Mg 2+ and Ba 2+ selectively induce structural movement of the RCK2 domain, whereas Cd 2+ causes motions of RCK1, in all cases substantially smaller than those elicited by Ca 2+ By combining divalent species interacting with unique sites, we demonstrate that RCK1 and RCK2 domains move independently when their specific binding sites are occupied. Moreover, binding of chemically distinct cations to both RCK domains is additive, emulating the effect of fully occupied Ca 2+ binding sites.

  8. Epigallocatechin-3-gallate preferentially induces aggregation of amyloidogenic immunoglobulin light chains

    PubMed Central

    Hora, Manuel; Carballo-Pacheco, Martin; Weber, Benedikt; Morris, Vanessa K.; Wittkopf, Antje; Buchner, Johannes; Strodel, Birgit; Reif, Bernd

    2017-01-01

    Antibody light chain amyloidosis is a rare disease caused by fibril formation of secreted immunoglobulin light chains (LCs). The huge variety of antibody sequences puts a serious challenge to drug discovery. The green tea polyphenol epigallocatechin-3-gallate (EGCG) is known to interfere with fibril formation in general. Here we present solution- and solid-state NMR studies as well as MD simulations to characterise the interaction of EGCG with LC variable domains. We identified two distinct EGCG binding sites, both of which include a proline as an important recognition element. The binding sites were confirmed by site-directed mutagenesis and solid-state NMR analysis. The EGCG-induced protein complexes are unstructured. We propose a general mechanistic model for EGCG binding to a conserved site in LCs. We find that EGCG reacts selectively with amyloidogenic mutants. This makes this compound a promising lead structure, that can handle the immense sequence variability of antibody LCs. PMID:28128355

  9. Comparative analysis of allyl isothiocyanate (AITC)-induced carbohydrate oxidation changes via TRPV1 between mice and chickens.

    PubMed

    Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji

    2017-01-01

    Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.

  10. NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR

    PubMed Central

    Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

    2012-01-01

    The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the 2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury, et. al. 2011). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. PMID:23000369

  11. NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR.

    PubMed

    Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

    2013-02-01

    The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the β2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury et al., [32]). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  13. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  14. Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

    NASA Astrophysics Data System (ADS)

    Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

    2017-03-01

    Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

  15. The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse.

    PubMed

    Jacobsen, Jacob P R; Plenge, Per; Sachs, Benjamin D; Pehrson, Alan L; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L; Dalvi, Prachiti; Robinson, Taylor J; O'Neill, Sharon P; Khoo, King S; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G

    2014-12-01

    Escitalopram appears to be a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, there by curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and hence anti-depressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram's inhibition here of. Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Recombinant generation of hSERT transgenic mice; in vivo microdialysis; SERT binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). We generated mice expressing either the wild-type human SERT (hSERT(WT)) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERT(ALI/VFL+SI/TT)). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. The hSERT mice showed normal basal 5-HTExt levels. Escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment and was unaffected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small and tended to be enhanced by R-citalopram co-administration. We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram.

  16. Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

    PubMed

    Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

    2017-04-01

    Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Actin-induced dimerization of palladin promotes actin-bundling

    PubMed Central

    Vattepu, Ravi; Yadav, Rahul; Beck, Moriah R

    2015-01-01

    A subset of actin binding proteins is able to form crosslinks between two or more actin filaments, thus producing structures of parallel or networked bundles. These actin crosslinking proteins interact with actin through either bivalent binding or dimerization. We recently identified two binding sites within the actin binding domain of palladin, an actin crosslinking protein that plays an important role in normal cell adhesion and motility during wound healing and embryonic development. In this study, we show that actin induces dimerization of palladin. Furthermore, the extent of dimerization reflects earlier comparisons of actin binding and bundling between different domains of palladin. On the basis of these results we hypothesized that actin binding may promote a conformational change that results in dimerization of palladin, which in turn may drive the crosslinking of actin filaments. The proximal distance between two actin binding sites on crosslinking proteins determines the ultrastructural properties of the filament network, therefore we also explored interdomain interactions using a combination of chemical crosslinking experiments and actin cosedimentation assays. Limited proteolysis data reveals that palladin is less susceptible to enzyme digestion after actin binding. Our results suggest that domain movements in palladin are necessary for interactions with actin and are induced by interactions with actin filaments. Accordingly, we put forth a model linking the structural changes to functional dynamics. PMID:25307943

  18. Time-resolved absorbance changes induced by fast acidification of bacteriorhodopsin in vesicle systems.

    PubMed Central

    Druckmann, S; Ottolenghi, M; Korenstein, R

    1985-01-01

    The direction of the accessibility to protons of the binding site in bacteriorhodopsin is of primary importance in elucidating the proton-pump mechanism. The problem is approached via the pH-dependent equilibrium bR560 in equilibrium bR605 in vesicles with preferentially oriented purple membranes. Fast acidification (stopped-flow) experiments with inside-out, monomeric, bR vesicles were carried out with and without a buffer enclosed in the vesicle interior. The results, showing a buffer-induced delay in the formation of bR605, indicate that the binding site is accessible to protons from the inside of the vesicles. We arrive at this conclusion also by working with inside-out trimeric vesicles in the presence and in the absence of H+ (and K+) ionophores. The results suggest that in Halobacterium halobium, the binding site and thus the retinal Schiff base are exposed to the outside of the cell. This conclusion is consistent with a pumping mechanism based on a light-induced pK change. PMID:3978185

  19. Determining antibody-binding site of streptococcal pyrogenic exotoxin B to protect mice from group a streptococcus infection.

    PubMed

    Tsao, Nina; Cheng, Miao-Hui; Yang, Hsiu-Chen; Wang, Yu-Chieh; Liu, Yi-Ling; Kuo, Chih-Feng

    2013-01-01

    Streptococcal pyrogenic exotoxin B (SPE B), a cysteine protease, is an important virulence factor in group A streptococcal (GAS) infection. SPE B binds and cleaves antibody isotypes and further impairs the immune system by inhibiting complement activation. In this study, we examined the antibody-binding site of SPE B and used it to block SPE B actions during GAS infection. We constructed different segments of the spe B gene and induced them to express different recombinant fragments of SPE B. Using an enzyme-linked immunosorbent assay (ELISA), we found that residues 345-398 of the C-terminal domain of SPE B (rSPE B(345-398)), but not the N-terminal domain, was the major binding site for antibody isotypes. Using a competitive ELISA, we also found that rSPE B(345-398) bound to the Fc portion of IgG. The in vitro functional assays indicate that rSPE B(345-398) not only interfered with cleavage of antibody isotypes but also interfered with SPE B-induced inhibition of complement activation. Immunization of BALB/c mice using rSPE B(345-398) was able to induce production of a high titer of anti-rSPE B(345-398) antibodies and efficiently protected mice from GAS-induced death. These findings suggest that SPE B uses its C-terminal domain to bind the Fc portion of IgG and that immunization of mice with this binding domain (rSPE B(345-398)) could protect mice from GAS infection.

  20. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  1. Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum

    PubMed Central

    2013-01-01

    Background METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. Methods We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Results Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Conclusion Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites. PMID:23937714

  2. Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum.

    PubMed

    Cadet, Jean Lud; Jayanthi, Subramaniam; McCoy, Michael T; Ladenheim, Bruce; Saint-Preux, Fabienne; Lehrmann, Elin; De, Supriyo; Becker, Kevin G; Brannock, Christie

    2013-08-12

    METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites.

  3. Effects of Iron Deficiency on Iron Binding and Internalization into Acidic Vacuoles in Dunaliella salina1[W][OA

    PubMed Central

    Paz, Yakov; Shimoni, Eyal; Weiss, Meira; Pick, Uri

    2007-01-01

    Uptake of iron in the halotolerant alga Dunaliella salina is mediated by a transferrin-like protein (TTf), which binds and internalizes Fe3+ ions. Recently, we found that iron deficiency induces a large enhancement of iron binding, which is associated with accumulation of three other plasma membrane proteins that associate with TTf. In this study, we characterized the kinetic properties of iron binding and internalization and identified the site of iron internalization. Iron deficiency induces a 4-fold increase in Fe binding, but only 50% enhancement in the rate of iron uptake and also increases the affinity for iron and bicarbonate, a coligand for iron binding. These results indicate that iron deprivation leads to accumulation and modification of iron-binding sites. Iron uptake in iron-sufficient cells is preceded by an apparent time lag, resulting from prebound iron, which can be eliminated by unloading iron-binding sites. Iron is tightly bound to surface-exposed sites and hardly exchanges with medium iron. All bound iron is subsequently internalized. Accumulation of iron inhibits further iron binding and internalization. The vacuolar inhibitor bafilomycin inhibits iron uptake and internalization. Internalized iron was localized by electron microscopy within vacuolar structures that were identified as acidic vacuoles. Iron internalization is accompanied by endocytosis of surface proteins into these acidic vacuoles. A novel kinetic mechanism for iron uptake is proposed, which includes two pools of bound/compartmentalized iron separated by a rate-limiting internalization stage. The major parameter that is modulated by iron deficiency is the iron-binding capacity. We propose that excessive iron binding in iron-deficient cells serves as a temporary reservoir for iron that is subsequently internalized. This mechanism is particularly suitable for organisms that are exposed to large fluctuations in iron availability. PMID:17513481

  4. Calmodulin fishing with a structurally disordered bait triggers CyaA catalysis

    PubMed Central

    O’Brien, Darragh P.; Durand, Dominique; Voegele, Alexis; Hourdel, Véronique; Davi, Marilyne; Chamot-Rooke, Julia; Vachette, Patrice; Brier, Sébastien; Ladant, Daniel

    2017-01-01

    Once translocated into the cytosol of target cells, the catalytic domain (AC) of the adenylate cyclase toxin (CyaA), a major virulence factor of Bordetella pertussis, is potently activated by binding calmodulin (CaM) to produce supraphysiological levels of cAMP, inducing cell death. Using a combination of small-angle X-ray scattering (SAXS), hydrogen/deuterium exchange mass spectrometry (HDX-MS), and synchrotron radiation circular dichroism (SR-CD), we show that, in the absence of CaM, AC exhibits significant structural disorder, and a 75-residue-long stretch within AC undergoes a disorder-to-order transition upon CaM binding. Beyond this local folding, CaM binding induces long-range allosteric effects that stabilize the distant catalytic site, whilst preserving catalytic loop flexibility. We propose that the high enzymatic activity of AC is due to a tight balance between the CaM-induced decrease of structural flexibility around the catalytic site and the preservation of catalytic loop flexibility, allowing for fast substrate binding and product release. The CaM-induced dampening of AC conformational disorder is likely relevant to other CaM-activated enzymes. PMID:29287065

  5. Crystallographic characterization of the ribosomal binding site and molecular mechanism of action of Hygromycin A

    PubMed Central

    Kaminishi, Tatsuya; Schedlbauer, Andreas; Fabbretti, Attilio; Brandi, Letizia; Ochoa-Lizarralde, Borja; He, Cheng-Guang; Milón, Pohl; Connell, Sean R.; Gualerzi, Claudio O.; Fucini, Paola

    2015-01-01

    Hygromycin A (HygA) binds to the large ribosomal subunit and inhibits its peptidyl transferase (PT) activity. The presented structural and biochemical data indicate that HygA does not interfere with the initial binding of aminoacyl-tRNA to the A site, but prevents its subsequent adjustment such that it fails to act as a substrate in the PT reaction. Structurally we demonstrate that HygA binds within the peptidyl transferase center (PTC) and induces a unique conformation. Specifically in its ribosomal binding site HygA would overlap and clash with aminoacyl-A76 ribose moiety and, therefore, its primary mode of action involves sterically restricting access of the incoming aminoacyl-tRNA to the PTC. PMID:26464437

  6. Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

    PubMed Central

    Fox, K R; Grigg, G W

    1988-01-01

    DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

  7. A novel Rieske-type protein derived from an apoptosis-inducing factor-like (AIFL) transcript with a retained intron 4 induces change in mitochondrial morphology and growth arrest

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murata, Yasuhiko, E-mail: 97318@ib.k.u-tokyo.ac.jp; Furuyama, Isao; Oda, Shoji

    2011-04-01

    Highlights: {yields} A novel major transcript, AIFL-I4, is found. {yields} Nuclear localization of AIFL-I4 induces mitochondrial morphology change and suppression of cell proliferation. {yields} AIFL-I4 mutant with a lesion in [2Fe-2S] cluster binding site does not induce these phenotypes. {yields} [2Fe-2S] cluster binding site is essential for these phenotypes. -- Abstract: Apoptosis-inducing factor-like (AIFL) protein contains a Rieske domain and pyridine nucleotide-disulfide oxidoreductase (Pyr{sub r}edox) domain that shows 35% homology to that of apoptosis-inducing factor (AIF) protein. We identified a novel major transcript of the medaka (Oryzias latipes) AIFL gene that retained intron 4 (AIFL-I4) in embryos and tissues frommore » adult fish. The product of this transcript, AIFL-I4 protein, lacked the Pyr{sub r}edox domain because of a nonsense codon in intron 4. Both AIFL-I4 and full-length AIFL (fAIFL) transcripts were highly expressed in the brain and late embryos, and relative fAIFL and AIFL-I4 expression levels differed among tissues. Transient expression of AIFL-I4 and fAIFL tagged with GFP showed that AIFL-I4 localized in the nucleus, while fAIFL localized throughout the cytoplasm. We also found that overexpression of AIFL-I4 induced a change in mitochondrial morphology and suppression of cell proliferation. AIFL-I4 mutant with a lesion in [2Fe-2S] cluster binding site of the Rieske domain did not induce these phenotypes. This report is the first to demonstrate nuclear localization of a Rieske-type protein translated from the AIFL gene. Our data suggested that the [2Fe-2S] cluster binding site was essential for the nuclear localization and involved in mitochondrial morphology and suppression of cell proliferation.« less

  8. Endogenously Generated Plasmin at the Vascular Wall Injury Site Amplifies Lysine Binding Site-Dependent Plasminogen Accumulation in Microthrombi

    PubMed Central

    Brzoska, Tomasz; Tanaka-Murakami, Aki; Suzuki, Yuko; Sano, Hideto; Kanayama, Naohiro; Urano, Tetsumei

    2015-01-01

    The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP). The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg) on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation. PMID:25806939

  9. ABFs, a family of ABA-responsive element binding factors.

    PubMed

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  10. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    PubMed

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. The mechanistic basis for noncompetitive ibogaine inhibition of serotonin and dopamine transporters.

    PubMed

    Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter

    2012-05-25

    Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study.

  12. The Mechanistic Basis for Noncompetitive Ibogaine Inhibition of Serotonin and Dopamine Transporters*

    PubMed Central

    Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W.; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter

    2012-01-01

    Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study. PMID:22451652

  13. Repeated seizures induce long-term increase in hippocampal benzodiazepine receptors.

    PubMed Central

    McNamara, J O; Peper, A M; Patrone, V

    1980-01-01

    Repeated seizures, whether induced by kindling or electroshock, caused a long-lasting (at least 24 hr) increase of [3H]diazepam binding in hippocampal membranes of Sprague-Dawley rats. Scatchard analyses demonstrated that increased numbers of binding sites accounted for the increase. Neither repeated hypoxia nor repeated administration of electrical current without inducing seizures caused an increase of [3H]diazepam binding. Regardless of the method used for seizure induction, the response was graded in that large numbers of seizures were required to induce significant increases, whereas fewer seizures induced only slight increases. We suggest that the receptor increases imply a heightened response to benzodiazepines and more powerful hippocampal recurrent inhibition. PMID:6930682

  14. Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

    PubMed Central

    Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

    2013-01-01

    β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

  15. Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    PubMed Central

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-01-01

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

  16. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  17. Identification and functional characterization of an Src homology domain 3 domain-binding site on Cbl.

    PubMed

    Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland

    2006-12-01

    Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.

  18. Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raymond, Marc-Andre; Desormeaux, Anik; Labelle, Andree

    2005-12-23

    Endothelial cells (EC) under stress release paracrine mediators that facilitate accumulation of vascular smooth muscle cells (VSCM) at sites of vascular injury. We found that medium conditioned by serum-starved EC increase proliferation and migration of VSCM in vitro. Fractionation of the conditioned medium followed by mass spectral analysis identified one bioactive component as vitamin D-binding protein (DBP). DBP induced both proliferation and migration of VSMC in vitro in association with increased phosphorylation of ERK 1/2. PD 98059, a biochemical inhibitor of ERK 1/2, abrogated these proliferative and migratory responses in VSMC. DBP is an important carrier for the vitamin-D sterols,more » 25-hydroxyvitamin-D, and 1{alpha},25-dihydroxyvitamin-D. Both sterols inhibited the activity of DBP on VSMC, suggesting that vitamin D binding sites are important for initiating the activities of DBP on VSMC. Release of DBP at sites of endothelial injury represents a novel pathway favoring accumulation of VSMC at sites of vascular injury.« less

  19. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  20. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  1. Dynamic Localization of a Transcription Factor in Bacillus subtilis: the LicT Antiterminator Relocalizes in Response to Inducer Availability

    PubMed Central

    Rothe, Fabian M.; Wrede, Christoph; Lehnik-Habrink, Martin; Görke, Boris

    2013-01-01

    Bacillus subtilis transports β-glucosides such as salicin by a dedicated phosphotransferase system (PTS). The expression of the β-glucoside permease BglP is induced in the presence of the substrate salicin, and this induction requires the binding of the antiterminator protein LicT to a specific RNA target in the 5′ region of the bglP mRNA to prevent the formation of a transcription terminator. LicT is composed of an N-terminal RNA-binding domain and two consecutive PTS regulation domains, PRD1 and PRD2. In the absence of salicin, LicT is phosphorylated on PRD1 by BglP and thereby inactivated. In the presence of the inducer, the phosphate group from PRD1 is transferred back to BglP and consequently to the incoming substrate, resulting in the activation of LicT. In this study, we have investigated the intracellular localization of LicT. While the protein was evenly distributed in the cell in the absence of the inducer, we observed a subpolar localization of LicT if salicin was present in the medium. Upon addition or removal of the inducer, LicT rapidly relocalized in the cells. This dynamic relocalization did not depend on the binding of LicT to its RNA target sites, since the localization pattern was not affected by deletion of all LicT binding sites. In contrast, experiments with mutants affected in the PTS components as well as mutations of the LicT phosphorylation sites revealed that phosphorylation of LicT by the PTS components plays a major role in the control of the subcellular localization of this RNA-binding transcription factor. PMID:23475962

  2. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  3. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  4. A possible molecular mechanism of the action of digitalis: ouabain action on calcium binding to sites associated with a purified sodium-potassium-activated adenosine triphosphatase from kidney.

    PubMed

    Gervais, A; Lane, L K; Anner, B M; Lindenmayer, G E; Schwartz, A

    1977-01-01

    Calcium binding at 0 degrees C to a purified sheep kidney Na+,K+-ATPase was described by linear Scatchard plots. Binding at saturating free calcium was 65-80 nmol/mg of protein, or 30-40 mol of calcium/mol of enzyme. Aqueous emulsions of lipids extracted from Na+,K+-ATPase yielded dissociation constants and maximum calcium-binding values that were similar to those for native Na+,K+-ATPase. Phospholipase A treatment markedly reduced calcium binding. Pretreatment of native Na+,K+-ATPase with ouabain increased the dissociation constant for calcium binding from 131 +/- 7 to 192 +/- 7 muM without altering maximum calcium binding. Ouabain pretreatment did not affect calcium binding to extracted phospholipids, ouabain-insensitive ATPases, or heat denatured Na+,K+-ATPase, Na+ and K+ (5-20 mM) increased the dissociation constants for calcium, which suggests competition between the monovalent cations and calcium for the binding sites. At higher concentrations of monovalent cations, ouabain increased the apparent affinity of binding sites for calcium. Extrapolation to physiological cation concentrations revealed that the ouabain-induced increase in apparent affinity for calcium may be as much as 2- to 3-fold. These results suggest: (1) calcium binds to phospholipids associated with Na+,K+-ATPase; (2) ouabain interaction with Na+,K+-ATPase induces a perturbation that is transmitted to adjacent phospholipids, altering their affinity for calcium; and (3) at physiological concentrations of Na+ or K+, or both, ouabain interaction with Na+,K+-ATPase may lead to an increased pool of membrane-bound calcium.

  5. Photoactivable antibody binding protein: site-selective and covalent coupling of antibody.

    PubMed

    Jung, Yongwon; Lee, Jeong Min; Kim, Jung-won; Yoon, Jeongwon; Cho, Hyunmin; Chung, Bong Hyun

    2009-02-01

    Here we report new photoactivable antibody binding proteins, which site-selectively capture antibodies and form covalent conjugates with captured antibodies upon irradiation. The proteins allow the site-selective tagging and/or immobilization of antibodies with a highly preferred orientation and omit the need for prior antibody modifications. The minimal Fc-binding domain of protein G, a widely used antibody binding protein, was genetically and chemically engineered to contain a site-specific photo cross-linker, benzophenone. In addition, the domain was further mutated to have an enhanced Fc-targeting ability. This small engineered protein was successfully cross-linked only to the Fc region of the antibody without any nonspecific reactivity. SPR analysis indicated that antibodies can be site-selectively biotinylated through the present photoactivable protein. Furthermore, the system enabled light-induced covalent immobilization of antibodies directly on various solid surfaces, such as those of glass slides, gold chips, and small particles. Antibody coupling via photoactivable antibody binding proteins overcomes several limitations of conventional approaches, such as random chemical reactions or reversible protein binding, and offers a versatile tool for the field of immunosensors.

  6. A Single Amino Acid Substitution in the Active Site of Escherichia coli Aspartate Transcarbamoylase Prevents the Allosteric Transition

    PubMed Central

    Stieglitz, Kimberly A.; Pastra-Landis, Styliani C.; Xia, Jiarong; Tsuruta, Hiro; Kantrowitz, Evan R.

    2005-01-01

    Modeling of the tetrahedral intermediate within the active site of Escherichia coli aspartate transcarbamoylase revealed a specific interaction with the side chain of Gln137, an interaction not previously observed in the structure of the X-ray enzyme in the presence of N-phosphonacetyl-L-aspartate (PALA). Previous site-specific mutagenesis experiments showed that when Gln137 was replaced by alanine, the resulting mutant enzyme (Q137A) exhibited approximately 50-fold less activity than the wild-type enzyme, exhibited no homotropic cooperativity, and the binding of both carbamoyl phosphate and aspartate were extremely compromised. To elucidate the structural alterations in the mutant enzyme that might lead to such pronounced changes in kinetic and binding properties, the Q137A enzyme was studied by time-resolved small-angle X-ray scattering and its structure was determined in the presence of PALA to 2.7Å resolution. Time-resolved small-angle X-ray scattering established that the natural substrates, carbamoyl phosphate and L-aspartate, do not induce in the Q137A enzyme the same conformational changes as observed for the wild-type enzyme, although the scattering pattern of the Q137A and wild-type enzymes in the presence of PALA were identical. The overall structure of the Q137A enzyme is similar to that of the R-state structure of wild-type enzyme with PALA bound. However, there are differences in the manner by which the Q137A enzyme coordinates PALA, especially in the side chain positions of Arg105 and His134. The replacement of Gln137 by Ala also has a dramatic effect on the electrostatics of the active site. These data taken together suggest that the side chain of Gln137 in the wild-type enzyme is required for the binding of carbamoyl phosphate in the proper orientation so as to induce conformational changes required for the creation of the high-affinity aspartate binding site. The inability of carbamoyl phosphate to create the high-affinity binding site in the Q137A enzyme results in an enzyme locked in the low activity low affinity T state. These results emphasize the absolute requirement of the binding of carbamoyl phosphate for the creation of the high-affinity aspartate binding site and for inducing the homotropic cooperativity in aspartate transcarbamoylase. PMID:15890205

  7. Evaluation of the rate constants of sugar transport through maltoporin (LamB) of Escherichia coli from the sugar-induced current noise

    PubMed Central

    1995-01-01

    LamB (maltoporin) of Escherichia coli outer membrane was reconstituted into artificial lipid bilayer membranes. The channel contains a binding site for sugars and is blocked for ions when the site is occupied by a sugar. The on and off reactions of sugar binding cause an increase of the noise of the current through the channel. The sugar-induced current noise of maltoporin was used for the evaluation of the sugar-binding kinetics for different sugars of the maltooligosaccharide series and for sucrose. The on rate constant for sugar binding was between 10(6) and 10(7) M-1.s-1 for the maltooligosaccharides and corresponds to the movement of the sugars from the aqueous phase to the central binding site. The off rate (corresponding to the release of the sugars from the channel) decreased with increasing number of glucose residues in the maltooligosaccharides from approximately 2,000 s-1 for maltotriose to 180 s-1 for maltoheptaose. The kinetics for sucrose movement was considerably slower. The activation energies of the stability constant and of the rate constants for sugar binding were evaluated from noise experiments at different temperatures. The role of LamB in the transport of maltooligosaccharides across the outer membrane is discussed. PMID:7539481

  8. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    PubMed

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  9. Influence of differentiation on muscarinic receptors in N1E 115 neuroblastoma cells.

    PubMed

    Buyse, M A; Lefebvre, R A; Fraeyman, N H

    1989-01-01

    The effect of inducing morphological differentiation in N1E 115 mouse neuroblastoma cells on the number of muscarinic receptors and the ligand binding affinity was investigated using the lipophylic quinuclidinyl benzylate and the hydrophylic N-methylscopolamine as tritiated ligands. Induction of morphological differentiation was accompanied by a two- to three-fold increase of the number of receptors when assayed in a broken cell preparation; the ligand binding affinity was unaffected by differentiation. Using intact cells, this increase was not paralleled by a similar increase in binding sites accessible for N-methylscopolamine, which binds preferentially to extracellular sites.

  10. The Platelet Function Defect of Cardiopulmonary Bypass.

    DTIC Science & Technology

    1992-11-24

    K complex, not to uncomplexed GPIb or GPDC.31 FMC25 (provided by Dr. Berndt) is directed against GPK .32-33 A panel of platelet GPIIb-IIIa-specific...on GPIb (Fig 2, panel B), GPK (Fig 2, panel C), or the GPIb-K complex (Fig 2, panel D). 14 In addition, we examined the ristocetin-induced binding...on GPIb (6D1), the thrombin binding site on GPIb (TM60), GPK (FMC25), and the GPIb-K complex (AK1). Panel E: ristocetin-induced binding of exogenous

  11. Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

    NASA Astrophysics Data System (ADS)

    Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

    1985-05-01

    The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

  12. Impairment of Fas-ligand-caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death.

    PubMed

    Glukhova, Xenia A; Trizna, Julia A; Proussakova, Olga V; Gogvadze, Vladimir; Beletsky, Igor P

    2018-01-22

    Fas-ligand/CD178 belongs to the TNF family proteins and can induce apoptosis through death receptor Fas/CD95. The important requirement for Fas-ligand-dependent cell death induction is its localization to rafts, cholesterol- and sphingolipid-enriched micro-domains of membrane, involved in regulation of different signaling complexes. Here, we demonstrate that Fas-ligand physically associates with caveolin-1, the main protein component of rafts. Experiments with cells overexpressing Fas-ligand revealed a FasL N-terminal pre-prolin-rich region, which is essential for the association with caveolin-1. We found that the N-terminal domain of Fas-ligand bears two caveolin-binding sites. The first caveolin-binding site binds the N-terminal domain of caveolin-1, whereas the second one appears to interact with the C-terminal domain of caveolin-1. The deletion of both caveolin-binding sites in Fas-ligand impairs its distribution between cellular membranes, and attenuates a Fas-ligand-induced cytotoxicity. These results demonstrate that the interaction of Fas-ligand and caveolin-1 represents a molecular basis for Fas-ligand translocation to rafts, and the subsequent induction of Fas-ligand-dependent cell death. A possibility of a similar association between other TNF family members and caveolin-1 is discussed.

  13. Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

    PubMed

    Pindyurin, Alexey V

    2017-01-01

    A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

  14. Modeling the Interaction between Quinolinate and the Receptor for Advanced Glycation End Products (RAGE): Relevance for Early Neuropathological Processes

    PubMed Central

    Serratos, Iris N.; Castellanos, Pilar; Pastor, Nina; Millán-Pacheco, César; Rembao, Daniel; Pérez-Montfort, Ruy; Cabrera, Nallely; Reyes-Espinosa, Francisco; Díaz-Garrido, Paulina; López-Macay, Ambar; Martínez-Flores, Karina; López-Reyes, Alberto; Sánchez-García, Aurora; Cuevas, Elvis; Santamaria, Abel

    2015-01-01

    The receptor for advanced glycation end products (RAGE) is a pattern-recognition receptor involved in neurodegenerative and inflammatory disorders. RAGE induces cellular signaling upon binding to a variety of ligands. Evidence suggests that RAGE up-regulation is involved in quinolinate (QUIN)-induced toxicity. We investigated the QUIN-induced toxic events associated with early noxious responses, which might be linked to signaling cascades leading to cell death. The extent of early cellular damage caused by this receptor in the rat striatum was characterized by image processing methods. To document the direct interaction between QUIN and RAGE, we determined the binding constant (Kb) of RAGE (VC1 domain) with QUIN through a fluorescence assay. We modeled possible binding sites of QUIN to the VC1 domain for both rat and human RAGE. QUIN was found to bind at multiple sites to the VC1 dimer, each leading to particular mechanistic scenarios for the signaling evoked by QUIN binding, some of which directly alter RAGE oligomerization. This work contributes to the understanding of the phenomenon of RAGE-QUIN recognition, leading to the modulation of RAGE function. PMID:25757085

  15. Integrin binding and mechanical tension induce movement of mRNA and ribosomes to focal adhesions

    NASA Technical Reports Server (NTRS)

    Chicurel, M. E.; Singer, R. H.; Meyer, C. J.; Ingber, D. E.

    1998-01-01

    The extracellular matrix (ECM) activates signalling pathways that control cell behaviour by binding to cell-surface integrin receptors and inducing the formation of focal adhesion complexes (FACs). In addition to clustered integrins, FACs contain proteins that mechanically couple the integrins to the cytoskeleton and to immobilized signal-transducing molecules. Cell adhesion to the ECM also induces a rapid increase in the translation of preexisting messenger RNAs. Gene expression can be controlled locally by targeting mRNAs to specialized cytoskeletal domains. Here we investigate whether cell binding to the ECM promotes formation of a cytoskeletal microcompartment specialized for translational control at the site of integrin binding. High-resolution in situ hybridization revealed that mRNA and ribosomes rapidly and specifically localized to FACs that form when cells bind to ECM-coated microbeads. Relocation of these protein synthesis components to the FAC depended on the ability of integrins to mechanically couple the ECM to the contractile cytoskeleton and on associated tension-moulding of the actin lattice. Our results suggest a new type of gene regulation by integrins and by mechanical stress which may involve translation of mRNAs into proteins near the sites of signal reception.

  16. Dephosphorylation of microtubule-binding sites at the neurofilament-H tail domain by alkaline, acid, and protein phosphatases.

    PubMed

    Hisanaga, S; Yasugawa, S; Yamakawa, T; Miyamoto, E; Ikebe, M; Uchiyama, M; Kishimoto, T

    1993-06-01

    The dephosphorylation-induced interaction of neurofilaments (NFs) with microtubules (MTs) was investigated by using several phosphatases. Escherichia coli alkaline and wheat germ acid phosphatases increased the electrophoretic mobility of NF-H and NF-M by dephosphorylation, and induced the binding of NF-H to MTs. The binding of NFs to MTs was observed only after the electrophoretic mobility of NF-H approached the exhaustively dephosphorylated level when alkaline phosphatase was used. The number of phosphate remaining when NF-H began to bind to MTs was estimated by measuring phosphate bound to NF-H. NF-H did not bind to MTs even when about 40 phosphates from the total of 51 had been removed by alkaline phosphatase. The removal of 6 further phosphates finally resulted in the association of NF-H with MTs. A similar finding, that the restricted phosphorylation sites in the NF-H tail domain, but not the total amount of phosphates, were important for binding to MTs, was also obtained with acid phosphatases. In contrast to alkaline and acid phosphatases, four classes of protein phosphatases (protein phosphatases 1, 2A, 2B, and 2C) were ineffective for shifting the electrophoretic mobility of NF proteins and for inducing the association of NFs to MTs.

  17. Riboswitches: emerging themes in RNA structure and function.

    PubMed

    Montange, Rebecca K; Batey, Robert T

    2008-01-01

    Riboswitches are RNAs capable of binding cellular metabolites using a diverse array of secondary and tertiary structures to modulate gene expression. The recent determination of the three-dimensional structures of parts of six different riboswitches illuminates common features that allow riboswitches to be grouped into one of two types. Type I riboswitches, as exemplified by the purine riboswitch, are characterized by a single, localized binding pocket supported by a largely pre-established global fold. This arrangement limits ligand-induced conformational changes in the RNA to a small region. In contrast, Type II riboswitches, such as the thiamine pyrophosphate riboswitch, contain binding pockets split into at least two spatially distinct sites. As a result, binding induces both local changes to the binding pocket and global architecture. Similar organizational themes are found in other noncoding RNAs, making it possible to begin to build a hierarchical classification of RNA structure based on the spatial organization of their active sites and associated secondary structural elements.

  18. The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

    PubMed Central

    Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

    2014-01-01

    Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

  19. Identification of an inducible regulator of c-myb expression during T-cell activation.

    PubMed Central

    Phan, S C; Feeley, B; Withers, D; Boxer, L M

    1996-01-01

    Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

  20. Cytokinin induces genome-wide binding of the type-B response regulator ARR10 to regulate growth and development in Arabidopsis

    PubMed Central

    Zubo, Yan O.; Blakley, Ivory Clabaugh; Yamburenko, Maria V.; Worthen, Jennifer M.; Street, Ian H.; Franco-Zorrilla, José M.; Zhang, Wenjing; Raines, Tracy; Kieber, Joseph J.; Loraine, Ann E.

    2017-01-01

    The plant hormone cytokinin affects a diverse array of growth and development processes and responses to the environment. How a signaling molecule mediates such a diverse array of outputs and how these response pathways are integrated with other inputs remain fundamental questions in plant biology. To this end, we characterized the transcriptional network initiated by the type-B ARABIDOPSIS RESPONSE REGULATORs (ARRs) that mediate the cytokinin primary response, making use of chromatin immunoprecipitation sequencing (ChIP-seq), protein-binding microarrays, and transcriptomic approaches. By ectopic overexpression of ARR10, Arabidopsis lines hypersensitive to cytokinin were generated and used to clarify the role of cytokinin in regulation of various physiological responses. ChIP-seq was used to identify the cytokinin-dependent targets for ARR10, thereby defining a crucial link between the cytokinin primary-response pathway and the transcriptional changes that mediate physiological responses to this phytohormone. Binding of ARR10 was induced by cytokinin with binding sites enriched toward the transcriptional start sites for both induced and repressed genes. Three type-B ARR DNA-binding motifs, determined by use of protein-binding microarrays, were enriched at ARR10 binding sites, confirming their physiological relevance. WUSCHEL was identified as a direct target of ARR10, with its cytokinin-enhanced expression resulting in enhanced shooting in tissue culture. Results from our analyses shed light on the physiological role of the type-B ARRs in regulating the cytokinin response, mechanism of type-B ARR activation, and basis by which cytokinin regulates diverse aspects of growth and development as well as responses to biotic and abiotic factors. PMID:28673986

  1. Fluoxetine (Prozac) Binding to Serotonin Transporter Is Modulated by Chloride and Conformational Changes

    PubMed Central

    Tavoulari, Sotiria; Forrest, Lucy R.; Rudnick, Gary

    2010-01-01

    Serotonin transporter (SERT) is the main target for widely used antidepressant agents. Several of these drugs, including imipramine, citalopram, sertraline, and fluoxetine (Prozac), bound more avidly to SERT in the presence of Cl–. In contrast, Cl– did not enhance cocaine or paroxetine binding. A Cl– binding site recently identified in SERT, and shown to be important for Cl– dependent transport, was also critical for the Cl– dependence of antidepressant affinity. Mutation of the residues contributing to this site eliminated the Cl–-mediated affinity increase for imipramine and fluoxetine. Analysis of ligand docking to a single state of SERT indicated only small differences in the energy of interaction between bound ligands and Cl–. These differences in interaction energy cannot account for the affinity differences observed for Cl– dependence. However, fluoxetine binding led to a conformational change, detected by cysteine accessibility experiments, that was qualitatively different from that induced by cocaine or other ligands. Given the known Cl– requirement for serotonin-induced conformational changes, we propose that Cl– binding facilitates conformational changes required for optimal binding of fluoxetine and other antidepressant drugs. PMID:19641126

  2. Differential effects of short- and long-term zolpidem treatment on recombinant α1β2γ2s subtype of GABAA receptors in vitro

    PubMed Central

    Vlainić, Josipa; Jembrek, Maja Jazvinšćak; Vlainić, Toni; Štrac, Dubravka Švob; Peričić, Danka

    2012-01-01

    Aim: Zolpidem is a non-benzodiazepine agonist at benzodiazepine binding site in GABAA receptors, which is increasingly prescribed. Recent studies suggest that prolonged zolpidem treatment induces tolerance. The aim of this study was to explore the adaptive changes in GABAA receptors following short and long-term exposure to zolpidem in vitro. Methods: Human embryonic kidney (HEK) 293 cells stably expressing recombinant α1β2γ2s GABAA receptors were exposed to zolpidem (1 and 10 μmol/L) for short-term (2 h daily for 1, 2, or 3 consecutive days) or long-term (continuously for 48 h). Radioligand binding studies were used to determine the parameters of [3H]flunitrazepam binding sites. Results: A single (2 h) or repeated (2 h daily for 2 or 3 d) short-term exposure to zolpidem affected neither the maximum number of [3H]flunitrazepam binding sites nor the affinity. In both control and short-term zolpidem treated groups, addition of GABA (1 nmol/L–1 mmol/L) enhanced [3H]flunitrazepam binding in a concentration-dependent manner. The maximum enhancement of [3H]flunitrazepam binding in short-term zolpidem treated group was not significantly different from that in the control group. In contrast, long-term exposure to zolpidem resulted in significantly increase in the maximum number of [3H]flunitrazepam binding sites without changing the affinity. Furthermore, long-term exposure to zolpidem significantly decreased the ability of GABA to stimulate [3H]flunitrazepam binding. Conclusion: The results suggest that continuous, but not intermittent and short-term, zolpidem-exposure is able to induce adaptive changes in GABAA receptors that could be related to the development of tolerance and dependence. PMID:22922343

  3. 14-3-3 proteins mediate inhibitory effects of cAMP on salt-inducible kinases (SIKs).

    PubMed

    Sonntag, Tim; Vaughan, Joan M; Montminy, Marc

    2018-02-01

    The salt-inducible kinase (SIK) family regulates cellular gene expression via the phosphorylation of cAMP-regulated transcriptional coactivators (CRTCs) and class IIA histone deacetylases, which are sequestered in the cytoplasm by phosphorylation-dependent 14-3-3 interactions. SIK activity toward these substrates is inhibited by increases in cAMP signaling, although the underlying mechanism is unclear. Here, we show that the protein kinase A (PKA)-dependent phosphorylation of SIKs inhibits their catalytic activity by inducing 14-3-3 protein binding. SIK1 and SIK3 contain two functional PKA/14-3-3 sites, while SIK2 has four. In keeping with the dimeric nature of 14-3-3s, the presence of multiple binding sites within target proteins dramatically increases binding affinity. As a result, loss of a single 14-3-3-binding site in SIK1 and SIK3 abolished 14-3-3 association and rendered them insensitive to cAMP. In contrast, mutation of three sites in SIK2 was necessary to fully block cAMP regulation. Superimposed on the effects of PKA phosphorylation and 14-3-3 association, an evolutionary conserved domain in SIK1 and SIK2 (the so called RK-rich region; 595-624 in hSIK2) is also required for the inhibition of SIK2 activity. Collectively, these results point to a dual role for 14-3-3 proteins in repressing a family of Ser/Thr kinases as well as their substrates. © 2017 Federation of European Biochemical Societies.

  4. Kinetic analysis of cooperative interactions induced by Mn2+ binding to the chloroplast H(+)-ATPase.

    PubMed

    Hiller, R; Carmeli, C

    1990-07-03

    The kinetics of Mn2+ binding to three cooperatively interacting sites in chloroplast H(+)-ATPase (CF1) were measured by EPR following rapid mixing of the enzyme with MnCl2 with a time resolution of 8 ms. Mixing of the enzyme-bound Mn2+ with MgCl2 gave a measure of the rate of exchange. The data could be best fitted to a kinetic model assuming three sequential, positively cooperative binding sites. (1) In the latent CF1, the binding to all three sites had a similar on-rate constants of (1.1 +/- 0.04) X 10(4) M-1s-1. (2) Site segregation was found in the release of ions with off-rate constants of 0.69 +/- 0.04 s-1 for the first two and 0.055 +/- 0.003 s-1 for the third. (3) Addition of one ADP per CF1 caused a decrease in the off-rate constants to 0.31 +/- 0.02 and 0.033 +/- 0.008 s-1 for the first two and the third sites, respectively. (4) Heat activation of CF1 increased the on-rate constant to (4.2 +/- 0.92) X 10(4) M-1s-1 and the off-rate constants of the first two and the third site to 1.34 +/- 0.08 and 0.16 +/- 0.07 s-1, respectively. (5) The calculated thermodynamic dissociation constants were similar to those previously obtained from equilibrium binding studies. These findings were correlated to the rate constants obtained from studies of the catalysis and regulation of the H(+)-ATPase. The data support the suggestion that regulation induces sequential progress of catalysis through the three active sites of the enzyme.

  5. PGV04, an HIV-1 gp120 CD4 Binding Site Antibody, Is Broad and Potent in Neutralization but Does Not Induce Conformational Changes Characteristic of CD4

    PubMed Central

    Falkowska, Emilia; Ramos, Alejandra; Feng, Yu; Zhou, Tongqing; Moquin, Stephanie; Walker, Laura M.; Wu, Xueling; Seaman, Michael S.; Wrin, Terri; Kwong, Peter D.; Wyatt, Richard T.; Mascola, John R.; Poignard, Pascal

    2012-01-01

    Recently, several broadly neutralizing monoclonal antibodies (bnMAbs) directed to the CD4-binding site (CD4bs) of gp120 have been isolated from HIV-1-positive donors. These include VRC01, 3BNC117, and NIH45-46, all of which are capable of neutralizing about 90% of circulating HIV-1 isolates and all of which induce conformational changes in the HIV-1 gp120 monomer similar to those induced by the CD4 receptor. In this study, we characterize PGV04 (also known as VRC-PG04), a MAb with potency and breadth that rivals those of the prototypic VRC01 and 3BNC117. When screened on a large panel of viruses, the neutralizing profile of PGV04 was distinct from those of CD4, b12, and VRC01. Furthermore, the ability of PGV04 to neutralize pseudovirus containing single alanine substitutions exhibited a pattern distinct from those of the other CD4bs MAbs. In particular, substitutions D279A, I420A, and I423A were found to abrogate PGV04 neutralization. In contrast to VRC01, PGV04 did not enhance the binding of 17b or X5 to their epitopes (the CD4-induced [CD4i] site) in the coreceptor region on the gp120 monomer. Furthermore, in contrast to CD4, none of the anti-CD4bs MAbs induced the expression of the 17b epitope on cell surface-expressed cleaved Env trimers. We conclude that potent CD4bs bnMAbs can display differences in the way they recognize and access the CD4bs and that mimicry of CD4, as assessed by inducing conformational changes in monomeric gp120 that lead to enhanced exposure of the CD4i site, is not uniquely correlated with effective neutralization at the site of CD4 binding on HIV-1. PMID:22345481

  6. Fusion proteins of HIV-1 envelope glycoprotein gp120 with CD4-induced antibodies showed enhanced binding to CD4 and CD4 binding site antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Weizao, E-mail: chenw3@mail.nih.gov; Feng, Yang; Wang, Yanping

    Highlights: Black-Right-Pointing-Pointer Some recombinant HIV-1 gp120s do not preserve their conformations on gp140s. Black-Right-Pointing-Pointer We hypothesize that CD4i antibodies could induce conformational changes in gp120. Black-Right-Pointing-Pointer CD4i antibodies enhance binding of CD4 and CD4bs antibodies to gp120. Black-Right-Pointing-Pointer CD4i antibody-gp120 fusion proteins could have potential as vaccine immunogens. -- Abstract: Development of successful AIDS vaccine immunogens continues to be a major challenge. One of the mechanisms by which HIV-1 evades antibody-mediated neutralizing responses is the remarkable conformational flexibility of its envelope glycoprotein (Env) gp120. Some recombinant gp120s do not preserve their conformations on gp140s and functional viral spikes, and exhibitmore » decreased recognition by CD4 and neutralizing antibodies. CD4 binding induces conformational changes in gp120 leading to exposure of the coreceptor-binding site (CoRbs). In this study, we test our hypothesis that CD4-induced (CD4i) antibodies, which target the CoRbs, could also induce conformational changes in gp120 leading to better exposed conserved neutralizing antibody epitopes including the CD4-binding site (CD4bs). We found that a mixture of CD4i antibodies with gp120 only weakly enhanced CD4 binding. However, such interactions in single-chain fusion proteins resulted in gp120 conformations which bound to CD4 and CD4bs antibodies better than the original or mutagenically stabilized gp120s. Moreover, the two molecules in the fusion proteins synergized with each other in neutralizing HIV-1. Therefore, fusion proteins of gp120 with CD4i antibodies could have potential as components of HIV-1 vaccines and inhibitors of HIV-1 entry, and could be used as reagents to explore the conformational flexibility of gp120 and mechanisms of entry and immune evasion.« less

  7. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  8. A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

    PubMed Central

    Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

    2017-01-01

    PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

  9. Hydrazine and hydroxylamine as probes for O2-reduction site of mitochondrial cytochrome c oxidase.

    PubMed Central

    Kubota, T; Yoshikawa, S

    1993-01-01

    Reactions of hydrazine and hydroxylamine with bovine heart cytochrome c oxidase in the fully reduced state were investigated under anaerobic conditions following the visible-Soret spectral change. Hydrazine gave a sharp band at 575 nm with 20% decrease in the alpha band at 603 nm, and hydroxylamine induced a 2 nm blue-shift for the alpha band without any clear splitting. The Soret band at 443 nm was decreased significantly in intensity, with the concomitant appearance of a shoulder with hydrazine or a peak with hydroxylamine, both near 430 nm. The dependence on pH of the affinity of these reagents for the enzyme indicates that only the deprotonated forms of these reagents bind to the enzyme, suggesting a highly hydrophobic environment of the haem ligand-biding site. These spectral changes were largely removed by addition of cyanide or CO. However, detailed analysis of these spectral changes indicates that hydrazine perturbs the shape of the spectral change induced by cyanide and hydroxylamine perturbs that induced by CO. These results suggest that these aldehyde reagents bind to haem a3 iron as well as to a second site which is most likely to be the formyl group on the haem periphery, and that these two sites bind these reagents anti-cooperatively with each other. PMID:8389138

  10. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  11. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  12. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  13. Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

    PubMed

    Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

    2016-10-01

    During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  14. Stoichiometry for α-bungarotoxin block of α7 acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Dacosta, Corrie J. B.; Free, Chris R.; Sine, Steven M.

    2015-08-01

    α-Bungarotoxin (α-Btx) binds to the five agonist binding sites on the homopentameric α7-acetylcholine receptor, yet the number of bound α-Btx molecules required to prevent agonist-induced channel opening remains unknown. To determine the stoichiometry for α-Btx blockade, we generate receptors comprised of wild-type and α-Btx-resistant subunits, tag one of the subunit types with conductance mutations to report subunit stoichiometry, and following incubation with α-Btx, monitor opening of individual receptor channels with defined subunit stoichiometry. We find that a single α-Btx-sensitive subunit confers nearly maximal suppression of channel opening, despite four binding sites remaining unoccupied by α-Btx and accessible to the agonist. Given structural evidence that α-Btx locks the agonist binding site in an inactive conformation, we conclude that the dominant mechanism of antagonism is non-competitive, originating from conformational arrest of the binding sites, and that the five α7 subunits are interdependent and maintain conformational symmetry in the open channel state.

  15. The Structure of the Metal Transporter Tp34 and its Affinity for Divalent Metal Ions

    NASA Astrophysics Data System (ADS)

    Knutsen, Gregory; Deka, Ranjit; Brautigam, Chad; Tomchick, Diana; Machius, Mischa; Norgard, Michael

    2007-10-01

    Tp34 is periplasmic membrane protein of the nonculitvatable spirochete Treponema pallidum, the pathogen of syphillis. It was proposed that Tp34 is a divalent metal transporter, but the identity of the preferred metal ion(s) was unclear. In this study we investigated the ability of divalent metal ions to induce rTp34 dimerization using hydrodynamic techniques and determine the crystal structure of metal bound forms. Using analytical ultracentrifugation sedimentation velocity experiments, we determined that cobalt is superior to nickel at inducing the dimerization of rTp34. rTp34 was crystallized and selected crystals were incubated at a pH 7.5 with CuSO4 and NiSO4. Diffraction experiments were conducted and the processed electron density maps showed that copper was bound to the major metal binding site as well as to three additional minor binding sites. By contrast nickel was only bound to the major metal binding site in one monomer and to three additional minor sites. These results along with previous findings support evidence of Tp34 being involved with metal transport and/or iron utilization.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Honda, T.; Adachi, H.; Noguchi, M.

    The authors have examined the effect of carbamylcholine on the binding of cholecystokinin (CCK) to dispersed acini from rat pancreas. The CCK receptor on pancreatic acini possesses two classes of binding sites. Simultaneous addition of carbamylcholine inhibited binding of CCK binding sites. Atropine prevented the inhibitory effect of carbamylcholine, whereas calcium ionophore A23187 did not alter binding of CCK. 12-O-tetradecanoylphorbol-13-acetate (TPA) inhibited binding of CCK in the same manner as carbamylcholine. Inhibition by carbamylcholine was reversible and the recovery was time dependent. By contrast, inhibition of binding of CCK by TPA did not reverse after a 60-min incubation without themore » agent. These findings, at least in part, account for the inhibition of the CCK-induced stimulation of amylase secretion by carbamylcholine. The action of TPA on binding of CCK suggests the possible involvement of the activation of protein kinase C in the inhibition of binding.« less

  17. SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

    PubMed

    Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

    2018-05-22

    Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

  18. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  19. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  20. Activation of the edema factor of Bacillus anthracis by calmodulin: evidence of an interplay between the EF-calmodulin interaction and calcium binding.

    PubMed

    Laine, Elodie; Martínez, Leandro; Blondel, Arnaud; Malliavin, Thérèse E

    2010-10-06

    Calmodulin (CaM) is a remarkably flexible protein which can bind multiple targets in response to changes in intracellular calcium concentration. It contains four calcium-binding sites, arranged in two globular domains. The calcium affinity of CaM N-terminal domain (N-CaM) is dramatically reduced when the complex with the edema factor (EF) of Bacillus anthracis is formed. Here, an atomic explanation for this reduced affinity is proposed through molecular dynamics simulations and free energy perturbation calculations of the EF-CaM complex starting from different crystallographic models. The simulations show that electrostatic interactions between CaM and EF disfavor the opening of N-CaM domains usually induced by calcium binding. Relative calcium affinities of the N-CaM binding sites are probed by free energy perturbation, and dissociation probabilities are evaluated with locally enhanced sampling simulations. We show that EF impairs calcium binding on N-CaM through a direct conformational restraint on Site 1, by an indirect destabilization of Site 2, and by reducing the cooperativity between the two sites. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  1. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  2. Modulation of the NMDA receptor by polyamines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, K.; Romano, C.; Dichter, M.A.

    1991-01-01

    Results of recent biochemical and electrophysiological studies have suggested that a recognition site for polyamines exists as part of the NMDA receptor complex. The endogenous polyamines spermine and spermidine increase the binding of open-channel blockers and increase NMDA-elicited currents in cultured neutrons. These polyamines have been termed agonists at the polyamine recognition site. Studies of the effects of natural and synthetic polyamines on the binding of ({sup 3}H)MK-801 and on NMDA-elicited currents in cultured neurons have led to the identification of compounds classified as partial agonists, antagonists, and inverse agonists at the polyamine recognition site. Polyamines have also been foundmore » to affect the binding of ligands to the recognition sites for glutamate and glycine. However, these effects may be mediated at a site distinct from that at which polyamines act to modulate the binding of open-channel blockers. Endogenous polyamines may modulate excitatory synaptic transmission by acting at the polyamine recognition site of the NMDA receptor. This site could represent a novel therapeutic target for the treatment of ischemia-induced neurotoxicity, epilepsy, and neurodegenerative diseases.« less

  3. Alteration of human serum albumin binding properties induced by modifications: A review

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, Małgorzata; Szkudlarek, Agnieszka; Chudzik, Mariola; Pożycka, Jadwiga; Sułkowska, Anna

    2018-01-01

    Albumin, a major transporting protein in the blood, is the main target of modification that affects the binding of drugs to Sudlow's site I and II. These modification of serum protein moderates its physiological function, and works as a biomarker of some diseases. The main goal of the paper was to explain the possible alteration of human serum albumin binding properties induced by modifications such as glycation, oxidation and ageing, their origin, methods of evaluation and positive and negative meaning described by significant researchers.

  4. The kinetics of effector binding to phosphofructokinase. The allosteric conformational transition induced by 1,N6-ethenoadenosine triphosphate.

    PubMed Central

    Roberts, D; Kellett, G L

    1979-01-01

    1. The fluorescent ATP analogue 1,N6-etheno-ATP is a good substrate and an efficient allosteric inhibitor of rabbit skeletal-muscle phosphofructokinase. 2. Fluorescence energy transfer occurs between bound 1,N6-etheno-ATP and phosphofructokinase. 1,N6-Etheno-ATP fluorescence is enhanced, intrinsic protein fluorescence is quenched, and the excitation spectrum of 1,N6-etheno-ATP fluorescence is characteristic of protein absorption. 3. The binding reaction of 1,N6-etheno-ATP observed by stopped-flow fluorimetry is biphasic. The fast phase results from binding to the catalytic site alone. The slow phase results from the allosteric transition of the R conformation into the T conformation induced by the binding of 1,N6-etheno-ATP to the regulatory site. 4. The fluorescence signal that allows the transition of the R conformation into the T conformation to be observed does not arise from 1,N6-etheno-ATP bound to the regulatory site. It arises instead from 1,N6-etheno-ATP bound to the catalytic site as a consequence of changes at the catalytic site caused by the transition of the R conformation into the T conformation. 5. In the presence of excess of Mg2+, the affinity of 1,N6-etheno-ATP for the regulatory site is very much greater in the T state than in the R state. Images Fig. 5. Fig. 8. PMID:160791

  5. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  6. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  7. Effect of H2 binding on the nonadiabatic transition probability between singlet and triplet states of the [NiFe]-hydrogenase active site.

    PubMed

    Kaliakin, Danil S; Zaari, Ryan R; Varganov, Sergey A

    2015-02-12

    We investigate the effect of H2 binding on the spin-forbidden nonadiabatic transition probability between the lowest energy singlet and triplet electronic states of [NiFe]-hydrogenase active site model, using a velocity averaged Landau-Zener theory. Density functional and multireference perturbation theories were used to provide parameters for the Landau-Zener calculations. It was found that variation of the torsion angle between the terminal thiolate ligands around the Ni center induces an intersystem crossing between the lowest energy singlet and triplet electronic states in the bare active site and in the active site with bound H2. Potential energy curves between the singlet and triplet minima along the torsion angle and H2 binding energies to the two spin states were calculated. Upon H2 binding to the active site, there is a decrease in the torsion angle at the minimum energy crossing point between the singlet and triplet states. The probability of nonadiabatic transitions at temperatures between 270 and 370 K ranges from 35% to 32% for the active site with bound H2 and from 42% to 38% for the bare active site, thus indicating the importance of spin-forbidden nonadiabatic pathways for H2 binding on the [NiFe]-hydrogenase active site.

  8. Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

    DOE PAGES

    Celik, Fuat E.; Mavrikakis, Manos

    2015-01-12

    Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

  9. Stability of Surface and Subsurface Hydrogen on and in Au/Ni Near-Surface Alloys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Celik, Fuat E.; Mavrikakis, Manos

    2015-10-01

    Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

  10. Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

    NASA Astrophysics Data System (ADS)

    Celik, Fuat E.; Mavrikakis, Manos

    2015-10-01

    Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While the metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.

  11. Characterization of the mouse junD promoter--high basal level activity due to an octamer motif.

    PubMed Central

    de Groot, R P; Karperien, M; Pals, C; Kruijer, W

    1991-01-01

    The product of the junD gene belongs to the Jun/Fos family of nuclear DNA binding transcription factors. This family regulates the expression of TPA responsive genes by binding to the TPA responsive element (TRE). Unlike its counterparts c-jun and junB, junD expression is hardly inducible by growth factors and phorbol esters. In fact, junD is constitutively expressed at high levels in a wide variety of cells. To unravel the molecular mechanisms underlying constitutive junD expression, we have cloned and characterized the mouse junD promoter. We show that the high constitutive expression is caused by multiple cis-acting elements in its promoter, including an SP1 binding site, an octamer motif, a CAAT box, a Zif268 binding site and a TRE-like sequence. The octamer motif is the major determinant of junD promoter activity, while somewhat smaller contributions are made by the TRE and Zif268 binding site. The SP1 and CAAT box are shown to be of minor importance. The junD TRE is in its behavior indistinguishable from previously identified TREs. However, the junD promoter is not TPA inducible due to the presence of the octamer motif. Images PMID:1714380

  12. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  13. Mixed nicotinic and muscarinic features of cholinergic receptor coupled to secretion in bovine chromaffin cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shirvan, M.H.; Pollard, H.B.; Heldman, E.

    Acetylcholine evokes release from cultured bovine chromaffin cells by a mechanism that is believed to be classically nicotinic. However, the authors found that the full muscarinic agonist oxotremorine-M (Oxo-M) induced a robust catecholamine (CA) secretion. By contrast, muscarine, pilocarpine, bethanechol, and McN-A-343 did not elicit any secretory response. Desensitization of the response to nicotine by Oxo-M and desensitization of the response to Oxo-M by nicotine suggest that both nicotine and Oxo-M were acting at the same receptor. Additional experiments supporting this conclusion show that nicotine-induced secretion and Oxo-M-induced secretion were similarly blocked by various muscarinic and nicotinic antagonists. Moreover, secretionmore » induced by nicotine and Oxo-M were Ca{sup 2+} dependent, and both agonists induced {sup 45}Ca{sup 2+} uptake. Equilibrium binding studies showed that ({sup 3}H)Oxo-M bound to chromaffin cell membranes with a K{sub d} value of 3.08 {times} 10{sup {minus}8}M and a Hill coefficient of 1.00, suggesting one binding site for this ligand. Nicotine inhibited Oxo-M binding in a noncompetitive manner, suggesting that both ligands bind at two different sites on the same receptor. They propose that the receptor on bovine chromaffin cells that is coupled to secretion represents an unusual cholinergic receptor that has both nicotinic and muscarinic features.« less

  14. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    PubMed Central

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity chromosome may be partially transcriptionally autonomous, but there are also extensive transcriptional connections between core and accessory chromosomes. PMID:27855160

  15. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

  16. Development of sodium channel protein during chemically induced differentiation of neuroblastoma cells.

    PubMed

    Baumgold, J; Spector, I

    1987-04-01

    We have previously shown that the [3H]saxitoxin binding site of the sodium channel is expressed independently of the [125I]scorpion toxin binding site in chick muscle cultures and in rat brain. In the present work, we studied the development of the sodium channel protein during chemically induced differentiation of N1E-115 neuroblastoma cells, using [3H]saxitoxin binding, [125I]scorpion toxin binding, and 22Na uptake techniques. When grown in their normal culture medium, these cells are mostly undifferentiated, bind 90 +/- 10 fmol of [3H]saxitoxin/mg of protein and 112 +/- 14 fmol of [125I]scorpion toxin/mg protein, and, when stimulated with scorpion toxin and batrachotoxin, take up 70 +/- 5 nmol of 22Na/min/mg of protein. Cells treated with dimethyl sulfoxide (DMSO) or hexamethylene-bis-acetamide (HMBA) differentiate morphologically within 3 days. At this time, the [3H]saxitoxin binding, the [125I]scorpion toxin binding, and the 22Na uptake values are not very different from those of undifferentiated cells. With subsequent time in DMSO or HMBA, these values continue to increase, a result indicating that the main period of sodium channel expression occurs well after the cells have assumed the morphologically differentiated state. The data indicate that the expression of sodium channels and morphological differentiation are independently regulated neuronal properties, that the attainment of morphological differentiation is necessary but not in itself sufficient for full expression of the sodium channel proteins, and that, in contrast to the chick muscle cultures and rat brain, the [3H]saxitoxin site and [125I]scorpion toxin site appear to be coregulated in N1E-115 cells.

  17. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  18. Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

    PubMed Central

    Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

    2013-01-01

    The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

  19. Changes in signal transducer and activator of transcription 3 (STAT3) dynamics induced by complexation with pharmacological inhibitors of Src homology 2 (SH2) domain dimerization.

    PubMed

    Resetca, Diana; Haftchenary, Sina; Gunning, Patrick T; Wilson, Derek J

    2014-11-21

    The activity of the transcription factor signal transducer and activator of transcription 3 (STAT3) is dysregulated in a number of hematological and solid malignancies. Development of pharmacological STAT3 Src homology 2 (SH2) domain interaction inhibitors holds great promise for cancer therapy, and a novel class of salicylic acid-based STAT3 dimerization inhibitors that includes orally bioavailable drug candidates has been recently developed. The compounds SF-1-066 and BP-1-102 are predicted to bind to the STAT3 SH2 domain. However, given the highly unstructured and dynamic nature of the SH2 domain, experimental confirmation of this prediction was elusive. We have interrogated the protein-ligand interaction of STAT3 with these small molecule inhibitors by means of time-resolved electrospray ionization hydrogen-deuterium exchange mass spectrometry. Analysis of site-specific evolution of deuterium uptake induced by the complexation of STAT3 with SF-1-066 or BP-1-102 under physiological conditions enabled the mapping of the in silico predicted inhibitor binding site to the STAT3 SH2 domain. The binding of both inhibitors to the SH2 domain resulted in significant local decreases in dynamics, consistent with solvent exclusion at the inhibitor binding site and increased rigidity of the inhibitor-complexed SH2 domain. Interestingly, inhibitor binding induced hot spots of allosteric perturbations outside of the SH2 domain, manifesting mainly as increased deuterium uptake, in regions of STAT3 important for DNA binding and nuclear localization. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Identification of an allosteric binding site for RORγt inhibition

    PubMed Central

    Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

    2015-01-01

    RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126

  1. An exclusive α/β code directs allostery in TetR-peptide complexes.

    PubMed

    Sevvana, Madhumati; Goetz, Christoph; Goeke, Dagmar; Wimmer, Cornelius; Berens, Christian; Hillen, Wolfgang; Muller, Yves A

    2012-02-10

    The allosteric mechanism of one of the best characterized bacterial transcription regulators, tetracycline repressor (TetR), has recently been questioned. Tetracycline binding induces cooperative folding of TetR, as suggested by recent unfolding studies, rather than switching between two defined conformational states, namely a DNA-binding-competent conformation and a non-DNA-binding conformation. Upon ligand binding, a host of near-native multiconformational structures collapse into a single, highly stabilized protein conformation that is no longer able to bind DNA. Here, structure-function studies performed with four synthetic peptides that bind to TetR and mimic the function of low-molecular-weight effectors, such as tetracyclines, provide new means to discriminate between different allosteric models. Whereas two inducing peptides bind in an extended β-like conformation, two anti-inducing peptides form an α-helix in the effector binding site of TetR. This exclusive bimodal interaction mode coincides with two distinct overall conformations of TetR, namely one that is identical with induced TetR and one that mirrors the DNA-bound state of TetR. Urea-induced unfolding studies show no increase in thermodynamic stability for any of the peptide complexes, although fluorescence measurements demonstrate peptide binding to TetR. This strongly suggests that, at least for these peptide effectors, a classical two-state allosteric model best describes TetR function. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  3. Complementation analysis of mutants of nitric oxide synthase reveals that the active site requires two hemes.

    PubMed Central

    Xie, Q W; Leung, M; Fuortes, M; Sassa, S; Nathan, C

    1996-01-01

    For catalytic activity, nitric oxide synthases (NOSs) must be dimeric. Previous work revealed that the requirements for stable dimerization included binding of tetrahydrobiopterin (BH4), arginine, and heme. Here we asked what function is served by dimerization. We assessed the ability of individually inactive mutants of mouse inducible NOS (iNOS; NOS2), each deficient in binding a particular cofactor or cosubstrate, to complement each other by generating NO upon cotransfection into human epithelial cells. The ability of the mutants to homodimerize was gauged by gel filtration and/or PAGE under partially denaturing conditions, both followed by immunoblot. Their ability to heterodimerize was assessed by coimmunoprecipitation. Heterodimers that contained only one COOH-terminal hemimer and only one BH4-binding site could both form and function, even though the NADPH-, FAD-, and FMN-binding domains (in the COOH-terminal hemimer) and the BH4-binding sites (in the NH2-terminal hemimer) were contributed by opposite chains. Heterodimers that contained only one heme-binding site (Cys-194) could also form, either in cis or in trans to the nucleotide-binding domains. However, for NO production, both chains had to bind heme. Thus, NO production by iNOS requires dimerization because the active site requires two hemes. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:8643499

  4. Ionotropic GABA receptor antagonism-induced adverse outcome pathways for potential neurotoxicity biomarkers.

    PubMed

    Gong, Ping; Hong, Huixiao; Perkins, Edward J

    2015-01-01

    Antagonism of ionotropic GABA receptors (iGABARs) can occur at three distinct types of receptor binding sites causing chemically induced epileptic seizures. Here we review three adverse outcome pathways, each characterized by a specific molecular initiating event where an antagonist competitively binds to active sites, negatively modulates allosteric sites or noncompetitively blocks ion channel on the iGABAR. This leads to decreased chloride conductance, followed by depolarization of affected neurons, epilepsy-related death and ultimately decreased population. Supporting evidence for causal linkages from the molecular to population levels is presented and differential sensitivity to iGABAR antagonists in different GABA receptors and organisms discussed. Adverse outcome pathways are poised to become important tools for linking mechanism-based biomarkers to regulated outcomes in next-generation risk assessment.

  5. Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

    PubMed Central

    Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

    2000-01-01

    Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

  6. Regulation of Hippocampal Glutamate Receptors: Evidence for the Involvement of a Calcium-Activated Protease

    NASA Astrophysics Data System (ADS)

    Baudry, Michel; Lynch, Gary

    1980-04-01

    Specific [3H]glutamate binding to rat hippocampal membranes and the calcium-induced increase in this binding are markedly temperature-sensitive and are inhibited by alkylating or reducing agents as well as by various protease inhibitors. N-Ethylmaleimide, chloromethyl ketone derivatives of lysine and phenylalanine, and tosylarginine methyl ester decrease the maximum number of [3H]glutamate binding sites without changing their affinity for glutamate. Preincubation of the membranes with glutamate does not protect the glutamate ``receptors'' from the suppressive effects of these agents. The proteases trypsin and α -chymotrypsin increase the maximum number of [3H]glutamate binding sites. The effects of calcium on glutamate binding are different across brain regions. Cerebellar membranes are almost insensitive whereas hippocampal and striatal membranes exhibit a strong increase in the number of binding sites after exposure to even low concentrations of calcium. These results suggest that an endogenous membrane-associated thiol protease regulates the number of [3H]glutamate binding sites in hippocampal membranes and that this is the mechanism by which calcium stimulates glutamate binding. The possibility is discussed that the postulated mechanisms participate in synaptic physiology and in particular may be related to the long-term potentiation of transmission found in hippocampus under certain conditions.

  7. The D-galactose specific lectin of field bean (Dolichos lablab) seed binds sugars with extreme negative cooperativity and half-of-the-sites binding.

    PubMed

    Rao, Devavratha H; Gowda, Lalitha R

    2012-08-15

    The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  9. Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

    PubMed

    Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

    2017-02-07

    We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

  10. Conformational changes in the M2 muscarinic receptor induced by membrane voltage and agonist binding

    PubMed Central

    Navarro-Polanco, Ricardo A; Galindo, Eloy G Moreno; Ferrer-Villada, Tania; Arias, Marcelo; Rigby, J Ryan; Sánchez-Chapula, José A; Tristani-Firouzi, Martin

    2011-01-01

    Abstract The ability to sense transmembrane voltage is a central feature of many membrane proteins, most notably voltage-gated ion channels. Gating current measurements provide valuable information on protein conformational changes induced by voltage. The recent observation that muscarinic G-protein-coupled receptors (GPCRs) generate gating currents confirms their intrinsic capacity to sense the membrane electrical field. Here, we studied the effect of voltage on agonist activation of M2 muscarinic receptors (M2R) in atrial myocytes and how agonist binding alters M2R gating currents. Membrane depolarization decreased the potency of acetylcholine (ACh), but increased the potency and efficacy of pilocarpine (Pilo), as measured by ACh-activated K+ current, IKACh. Voltage-induced conformational changes in M2R were modified in a ligand-selective manner: ACh reduced gating charge displacement while Pilo increased the amount of charge displaced. Thus, these ligands manifest opposite voltage-dependent IKACh modulation and exert opposite effects on M2R gating charge displacement. Finally, mutations in the putative ligand binding site perturbed the movement of the M2R voltage sensor. Our data suggest that changes in voltage induce conformational changes in the ligand binding site that alter the agonist–receptor interaction in a ligand-dependent manner. Voltage-dependent GPCR modulation has important implications for cellular signalling in excitable tissues. Gating current measurement allows for the tracking of subtle conformational changes in the receptor that accompany agonist binding and changes in membrane voltage. PMID:21282291

  11. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

    PubMed Central

    Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

    2009-01-01

    Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

  12. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  13. Investigating plausible mechanisms for the photo-induced partial unfolding of a globular protein

    NASA Astrophysics Data System (ADS)

    Parker, James E.

    Two hypotheses are proposed to explain the photo-induced unfolding of β-lactoglobulin (BLG) that occurs when non-covalently bound to a dye molecule, meso-tetrakis (p-sulfonatophenyl) porphyrin (TSPP), and illuminated by a laser in the post-Tanford transition configuration. The first involves a photo-induced electron transfer from the porphyrin to the protein. The second involves the production of kynurenine by singlet oxygen that is generated during photo-excitation of the porphyrin. To evaluate these hypotheses, a series of computational and experimental results have been combined to establish the physical state of the BLG-TSPP complex and to estimate the likelihood of a post-irradiation event to initiate the partial unfolding. Determining the binding site location is crucial to establish the position of the photo-induced events and the likely end-product. A study of the vibronic state of the BLG-TSPP complex using resonant Raman and absorption spectroscopy coupled with density functional theory (DFT) and docking simulations is used to estimate the location of the binding site. Once the binding site is found, molecular dynamics simulations of the post-irradiation event relaxations in the protein are used to estimate the resulting secondary structure. This structure is compared to experimental estimates of the secondary structure of the unfolded protein to determine which hypothesis is the most likely mechanism to explain the unfolding.

  14. Methamphetamine and 3,4-methylenedioxymethamphetamine interact with central nicotinic receptors and induce their up-regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia-Rates, Sara; Camarasa, Jordi; Escubedo, Elena

    2007-09-15

    Previous work from our group indicated that {alpha}7 nicotinic acetylcholine receptors ({alpha}7 nAChR) potentially play a role in methamphetamine (METH) and 3,4-methylenedioxymethamphetamine (MDMA) neurotoxicity. The aims of the present study were two-fold: (1) to demonstrate the interaction of METH and MDMA with homomeric {alpha}7 nAChR ([{sup 3}H]methyllycaconitine binding) and other heteromeric subtypes ([{sup 3}H]epibatidine binding); and (2) to show the effects of amphetamine derivative pretreatment on the density of binding sites. METH and MDMA displaced [{sup 3}H]methyllycaconitine and [{sup 3}H]epibatidine binding in membranes from NGF-differentiated PC 12 cells and mouse brain, with K{sub i} values in the micromolar range, MDMAmore » revealing a greater affinity than METH. In addition, METH and MDMA induced a time- and concentration-dependent increase in [{sup 3}H]methyllycaconitine and [{sup 3}H]epibatidine binding; which had already been apparent after 6 h of pretreatment, and which peaked in differentiated PC 12 cells after 48 h. The highest increases were found in [{sup 3}H]epibatidine binding, with MDMA inducing higher increases than METH. Treatment with METH and MDMA increased B{sub max} of high-affinity sites for both radioligands without affecting K{sub d}. The heightened binding was inhibited by pretreatment with cycloheximide, suggesting the participation of newly synthesised proteins while inhibition of protein trafficking to plasma membrane did not block up-regulation. The effects of protein kinase and cyclophilin inhibitors on such up-regulation were explored, revealing a rapid, differential and complex regulation, similar to that described for nicotinic ligands. All of these results demonstrate that METH and MDMA have affinity for, and can interact with, nAChR, inducing their up-regulation, specially when higher doses are used. Such effects may have a role in METH- and MDMA-induced neurotoxicity, cholinergic neurotransmission, and in processes related to addiction and dependence.« less

  15. Apigenin shows synergistic anticancer activity with curcumin by binding at different sites of tubulin.

    PubMed

    Choudhury, Diptiman; Ganguli, Arnab; Dastidar, Debabrata Ghosh; Acharya, Bipul R; Das, Amlan; Chakrabarti, Gopal

    2013-06-01

    Apigenin, a natural flavone, present in many plants sources, induced apoptosis and cell death in lung epithelium cancer (A549) cells with an IC50 value of 93.7 ± 3.7 μM for 48 h treatment. Target identification investigations using A549 cells and also in cell-free system demonstrated that apigenin depolymerized microtubules and inhibited reassembly of cold depolymerized microtubules of A549 cells. Again apigenin inhibited polymerization of purified tubulin with an IC50 value of 79.8 ± 2.4 μM. It bounds to tubulin in cell-free system and quenched the intrinsic fluorescence of tubulin in a concentration- and time-dependent manner. The interaction was temperature-dependent and kinetics of binding was biphasic in nature with binding rate constants of 11.5 × 10(-7) M(-1) s(-1) and 4.0 × 10(-9) M(-1) s(-1) for fast and slow phases at 37 °C, respectively. The stoichiometry of tubulin-apigenin binding was 1:1 and binding the binding constant (Kd) was 6.08 ± 0.096 μM. Interestingly, apigenin showed synergistic anti-cancer effect with another natural anti-tubulin agent curcumin. Apigenin and curcumin synergistically induced cell death and apoptosis and also blocked cell cycle progression at G2/M phase of A549 cells. The synergistic activity of apigenin and curcumin was also apparent from their strong depolymerizing effects on interphase microtubules and inhibitory effect of reassembly of cold depolymerized microtubules when used in combinations, indicating that these ligands bind to tubulin at different sites. In silico modeling suggested apigenin bounds at the interphase of α-β-subunit of tubulin. The binding site is 19 Å in distance from the previously predicted curcumin binding site. Binding studies with purified protein also showed both apigenin and curcumin can simultaneously bind to purified tubulin. Understanding the mechanism of synergistic effect of apigenin and curcumin could be helped to develop anti-cancer combination drugs from cheap and readily available nutraceuticals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  17. Interaction between Saikosaponin D, Paeoniflorin, and Human Serum Albumin.

    PubMed

    Liang, Guo-Wu; Chen, Yi-Cun; Wang, Yi; Wang, Hong-Mei; Pan, Xiang-Yu; Chen, Pei-Hong; Niu, Qing-Xia

    2018-01-27

    Saikosaponin D (SSD) and paeoniflorin (PF) are the major active constituents of Bupleuri Radix and Paeonia lactiflora Pall , respectively, and have been widely used in China to treat liver and other diseases for many centuries. We explored the binding of SSD/PF to human serum albumin (HSA) by using fluorospectrophotometry, circular dichroism (CD) and molecular docking. Both SSD and PF produced a conformational change in HSA. Fluorescence quenching was accompanied by a blue shift in the fluorescence spectra. Co-binding of PF and SSD also induced quenching and a conformational change in HSA. The Stern-Volmer equation showed that quenching was dominated by static quenching. The binding constant for ternary interaction was below that for binary interaction. Site-competitive experiments demonstrated that SSD/PF bound to site I (subdomain IIA) and site II (subdomain IIIA) in HSA. Analysis of thermodynamic parameters indicated that hydrogen bonding and van der Waals forces were mostly responsible for the binary association. Also, there was energy transfer upon binary interaction. Molecular docking supported the experimental findings in conformation, binding sites and binding forces.

  18. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  19. Elucidating the Influence of Gold Nanoparticles on the Binding of Salvianolic Acid B and Rosmarinic Acid to Bovine Serum Albumin

    PubMed Central

    Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

    2015-01-01

    Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047

  20. Berberine Induces Toxicity in HeLa Cells through Perturbation of Microtubule Polymerization by Binding to Tubulin at a Unique Site.

    PubMed

    Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan

    2017-05-23

    Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.

  1. NF-kappaB binds to a polymorphic repressor element in the MMP-3 promoter.

    PubMed

    Borghaei, Ruth C; Rawlings, P Lyle; Javadi, Masoud; Woloshin, Joanna

    2004-03-26

    A 5T/6T polymorphic site in the matrix metalloproteinase-3 (MMP-3) promoter has been identified as a repressor element involved in inhibiting induction of MMP-3 transcription by interleukin 1; and the 6T allele has been associated with decreased expression of MMP-3 as compared to the 5T allele. Zinc-binding protein-89 (ZBP-89) was cloned from a yeast one-hybrid assay via its ability to interact with this site, but when the protein was over-expressed, it resulted in activation of the MMP-3 promoter rather than repression. Here we show that in nuclear extracts isolated from human gingival fibroblasts stimulated with IL-1, this site is bound by p50 and p65 components of NF-kappaB in addition to ZBP-89, and that recombinant p50 binds preferentially to the 6T binding site. These results are consistent with a role for NF-kappaB in limiting the cytokine induced expression of MMP-3.

  2. Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

    PubMed Central

    2016-01-01

    Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

  3. Substrate-Induced Facilitated Dissociation of the Competitive Inhibitor from the Active Site of O-Acetyl Serine Sulfhydrylase Reveals a Competitive-Allostery Mechanism.

    PubMed

    Singh, Appu Kumar; Ekka, Mary Krishna; Kaushik, Abhishek; Pandya, Vaibhav; Singh, Ravi P; Banerjee, Shrijita; Mittal, Monica; Singh, Vijay; Kumaran, S

    2017-09-19

    By classical competitive antagonism, a substrate and competitive inhibitor must bind mutually exclusively to the active site. The competitive inhibition of O-acetyl serine sulfhydrylase (OASS) by the C-terminus of serine acetyltransferase (SAT) presents a paradox, because the C-terminus of SAT binds to the active site of OASS with an affinity that is 4-6 log-fold (10 4 -10 6 ) greater than that of the substrate. Therefore, we employed multiple approaches to understand how the substrate gains access to the OASS active site under physiological conditions. Single-molecule and ensemble approaches showed that the active site-bound high-affinity competitive inhibitor is actively dissociated by the substrate, which is not consistent with classical views of competitive antagonism. We employed fast-flow kinetic approaches to demonstrate that substrate-mediated dissociation of full length SAT-OASS (cysteine regulatory complex) follows a noncanonical "facilitated dissociation" mechanism. To understand the mechanism by which the substrate induces inhibitor dissociation, we resolved the crystal structures of enzyme·inhibitor·substrate ternary complexes. Crystal structures reveal a competitive allosteric binding mechanism in which the substrate intrudes into the inhibitor-bound active site and disengages the inhibitor before occupying the site vacated by the inhibitor. In summary, here we reveal a new type of competitive allosteric binding mechanism by which one of the competitive antagonists facilitates the dissociation of the other. Together, our results indicate that "competitive allostery" is the general feature of noncanonical "facilitated/accelerated dissociation" mechanisms. Further understanding of the mechanistic framework of "competitive allosteric" mechanism may allow us to design a new family of "competitive allosteric drugs/small molecules" that will have improved selectivity and specificity as compared to their competitive and allosteric counterparts.

  4. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

    2012-01-01

    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  5. Specific phosphopeptide binding regulates a conformational change in the PI 3-kinase SH2 domain associated with enzyme activation.

    PubMed Central

    Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A

    1993-01-01

    SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612

  6. A dopamine D2 receptor mutant capable of G protein-mediated signaling but deficient in arrestin binding.

    PubMed

    Lan, Hongxiang; Liu, Yong; Bell, Michal I; Gurevich, Vsevolod V; Neve, Kim A

    2009-01-01

    Arrestins mediate G protein-coupled receptor desensitization, internalization, and signaling. Dopamine D(2) and D(3) receptors have similar structures but distinct characteristics of interaction with arrestins. The goals of this study were to compare arrestin-binding determinants in D(2) and D(3) receptors other than phosphorylation sites and to create a D(2) receptor that is deficient in arrestin binding. We first assessed the ability of purified arrestins to bind to glutathione transferase (GST) fusion proteins containing the receptor third intracellular loops (IC3). Arrestin3 bound to IC3 of both D(2) and D(3) receptors, with the affinity and localization of the binding site indistinguishable between the receptor subtypes. Mutagenesis of the GST-IC3 fusion proteins identified an important determinant of the binding of arrestin3 in the N-terminal region of IC3. Alanine mutations of this determinant (IYIV212-215) in the full-length D(2) receptor generated a signaling-biased receptor with intact ligand binding and G-protein coupling and activation, but deficient in receptor-mediated arrestin3 translocation to the membrane, agonist-induced receptor internalization, and agonist-induced desensitization in human embryonic kidney 293 cells. This mutation also decreased arrestin-dependent activation of extracellular signal-regulated kinases. The finding that nonphosphorylated D(2)-IC3 and D(3)-IC3 have similar affinity for arrestin is consistent with previous suggestions that the differential effects of D(2) and D(3) receptor activation on membrane translocation of arrestin and receptor internalization are due, at least in part, to differential phosphorylation of the receptors. In addition, these results imply that the sequence IYIV212-215 at the N terminus of IC3 of the D(2) receptor is a key element of the arrestin binding site.

  7. C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation.

    PubMed

    Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen

    2018-05-05

    Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.

  8. Acteoside and Acyl-Migrated Acteoside, Compounds in Chinese Kudingcha Tea, Inhibit α-Amylase In Vitro.

    PubMed

    Lu, Yuqin; Zhou, Wenyu; Feng, Yue; Li, Yao; Liu, Ke; Liu, Lizhong; Lin, Dongxu; He, Zhendan; Wu, Xuli

    2017-06-01

    Acteoside, the predominant polyphenol of small-leaved kudingcha, the Chinese tea, has various biological activities. In this study, we examined the acyl migration of acteoside to isoacteoside with high-temperature treatment of acteoside. The inhibitory effects of acyl-migrated acteoside and acteoside on α-amylase were investigated, as were their binding interaction with α-amylase. The binding of acteoside and isoacteoside to α-amylase was investigated by using the fluorescence spectra assay, circular dichroism, and protein-ligand docking studies. Acteoside was more effective than preheated acteoside and isoacteoside in inhibiting α-amylase activity. Acteoside and isoacteoside binding to α-amylase may induce conformational changes to α-amylase, and the binding site of acteoside and isoacteoside being near the active site pocket of α-amylase may explain the decreased activity of α-amylase. The different affinities and binding sites of acteoside and isoacteoside for α-amylase resulted in different inhibition rates, which may be due to structural differences between acteoside and isoacteoside.

  9. An Inductive Logic Programming Approach to Validate Hexose Binding Biochemical Knowledge.

    PubMed

    Nassif, Houssam; Al-Ali, Hassan; Khuri, Sawsan; Keirouz, Walid; Page, David

    2010-01-01

    Hexoses are simple sugars that play a key role in many cellular pathways, and in the regulation of development and disease mechanisms. Current protein-sugar computational models are based, at least partially, on prior biochemical findings and knowledge. They incorporate different parts of these findings in predictive black-box models. We investigate the empirical support for biochemical findings by comparing Inductive Logic Programming (ILP) induced rules to actual biochemical results. We mine the Protein Data Bank for a representative data set of hexose binding sites, non-hexose binding sites and surface grooves. We build an ILP model of hexose-binding sites and evaluate our results against several baseline machine learning classifiers. Our method achieves an accuracy similar to that of other black-box classifiers while providing insight into the discriminating process. In addition, it confirms wet-lab findings and reveals a previously unreported Trp-Glu amino acids dependency.

  10. Cooperativity in Monomeric Enzymes with Single Ligand-Binding Sites

    PubMed Central

    Porter, Carol M.

    2011-01-01

    Cooperativity is widespread in biology. It empowers a variety of regulatory mechanisms and impacts both the kinetic and thermodynamic properties of macromolecular systems. Traditionally, cooperativity is viewed as requiring the participation of multiple, spatially distinct binding sites that communicate via ligand-induced structural rearrangements; however, cooperativity requires neither multiple ligand binding events nor multimeric assemblies. An underappreciated manifestation of cooperativity has been observed in the non-Michaelis-Menten kinetic response of certain monomeric enzymes that possess only a single ligand-binding site. In this review, we present an overview of kinetic cooperativity in monomeric enzymes. We discuss the primary mechanisms postulated to give rise to monomeric cooperativity and highlight modern experimental methods that could offer new insights into the nature of this phenomenon. We conclude with an updated list of single subunit enzymes that are suspected of displaying cooperativity, and a discussion of the biological significance of this unique kinetic response. PMID:22137502

  11. Structure of isocitrate dehydrogenase with alpha-ketoglutarate at 2.7-A resolution: conformational changes induced by decarboxylation of isocitrate.

    PubMed

    Stoddard, B L; Koshland, D E

    1993-09-14

    The structure of the isocitrate dehydrogenase (IDH) complex with bound alpha-ketoglutarate, Ca2+, and NADPH was solved at 2.7-A resolution. The alpha-ketoglutarate binds in the active site at the same position and orientation as isocitrate, with a difference between the two bound molecules of about 0.8 A. The Ca2+ metal is coordinated by alpha-ketoglutarate, three conserved aspartate residues, and a pair of water molecules. The largest motion in the active site relative to the isocitrate enzyme complex is observed for tyrosine 160, which originally forms a hydrogen bond to the labile carboxyl group of isocitrate and moves to form a new hydrogen bond to Asp 307 in the complex with alpha-ketoglutarate. This triggers a number of significant movements among several short loops and adjoining secondary structural elements in the enzyme, most of which participate in dimer stabilization and formation of the active-site cleft. These rearrangements are similar to the ligand-binding-induced movements observed in globins and insulin and serve as a model for an enzymatic mechanism which involves local shifts of secondary structural elements during turnover, rather than large-scale domain closures or loop transitions induced by substrate binding such as those observed in hexokinase or triosephosphate isomerase.

  12. Agonistic aptamer to the insulin receptor leads to biased signaling and functional selectivity through allosteric modulation

    PubMed Central

    Yunn, Na-Oh; Koh, Ara; Han, Seungmin; Lim, Jong Hun; Park, Sehoon; Lee, Jiyoun; Kim, Eui; Jang, Sung Key; Berggren, Per-Olof; Ryu, Sung Ho

    2015-01-01

    Due to their high affinity and specificity, aptamers have been widely used as effective inhibitors in clinical applications. However, the ability to activate protein function through aptamer-protein interaction has not been well-elucidated. To investigate their potential as target-specific agonists, we used SELEX to generate aptamers to the insulin receptor (IR) and identified an agonistic aptamer named IR-A48 that specifically binds to IR, but not to IGF-1 receptor. Despite its capacity to stimulate IR autophosphorylation, similar to insulin, we found that IR-A48 not only binds to an allosteric site distinct from the insulin binding site, but also preferentially induces Y1150 phosphorylation in the IR kinase domain. Moreover, Y1150-biased phosphorylation induced by IR-A48 selectively activates specific signaling pathways downstream of IR. In contrast to insulin-mediated activation of IR, IR-A48 binding has little effect on the MAPK pathway and proliferation of cancer cells. Instead, AKT S473 phosphorylation is highly stimulated by IR-A48, resulting in increased glucose uptake both in vitro and in vivo. Here, we present IR-A48 as a biased agonist able to selectively induce the metabolic activity of IR through allosteric binding. Furthermore, our study also suggests that aptamers can be a promising tool for developing artificial biased agonists to targeted receptors. PMID:26245346

  13. Conserved neutralizing epitope at globular head of hemagglutinin in H3N2 influenza viruses.

    PubMed

    Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Kurosawa, Yoshikazu; Yokoyama, Shigeyuki

    2014-07-01

    Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Conserved Neutralizing Epitope at Globular Head of Hemagglutinin in H3N2 Influenza Viruses

    PubMed Central

    Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Yokoyama, Shigeyuki

    2014-01-01

    ABSTRACT Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. IMPORTANCE Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. PMID:24719430

  15. Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

    PubMed

    Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

    2006-11-01

    The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

  16. Structure-activity relationship of ibogaine analogs interacting with nicotinic acetylcholine receptors in different conformational states.

    PubMed

    Arias, Hugo R; Feuerbach, Dominik; Targowska-Duda, Katarzyna M; Jozwiak, Krzysztof

    2011-09-01

    The interaction of ibogaine analogs with nicotinic acetylcholine receptors (AChRs) in different conformational states was studied by functional and structural approaches. The results established that ibogaine analogs: (a) inhibit (±)-epibatidine-induced Ca²⁺ influx in human embryonic muscle AChRs with the following potency sequence (IC(50) in μM): (±)-18-methylaminocoronaridine (5.9±0.3)∼(±)-18-methoxycoronaridine (18-MC) (6.8±0.8)>(-)-ibogaine (17±3)∼(+)-catharanthine (20±1)>(±)-albifloranine (46±13), (b) bind to the [³H]TCP binding site with higher affinity when the Torpedo AChR is in the desensitized state compared to that in the resting state. Similar results were obtained using [³H]18-MC. These and docking results suggest a steric interaction between TCP and ibogaine analogs for the same site, (c) enhance [³H]cytisine binding to resting but not to desensitized AChRs, with desensitizing potencies (apparent EC₅₀) that correlate very well with the pK(i) values in the desensitized state, and (d) there are good bilinear correlations between the ligand molecular volumes and their affinities in the desensitized and resting states, with an optimal volume of ∼345 ų for the ibogaine site. These results indicate that the size of the binding sites for ibogaine analogs, located between the serine and nonpolar rings and shared with TCP, is an important structural feature for binding and for inducing desensitization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

    PubMed

    Chen, Ying-Jung; Chang, Long-Sen

    2015-10-01

    The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Dual interaction of agmatine with the rat α2D-adrenoceptor: competitive antagonism and allosteric activation

    PubMed Central

    Molderings, G J; Menzel, S; Kathmann, M; Schlicker, E; Göthert, M

    2000-01-01

    In segments of rat vena cava preincubated with [3H]-noradrenaline and superfused with physiological salt solution, the influence of agmatine on the electrically evoked [3H]-noradrenaline release, the EP3 prostaglandin receptor-mediated and the α2D-adrenoceptor-mediated inhibition of evoked [3H]-noradrenaline release was investigated. Agmatine (0.1–10 μM) by itself was without effect on evoked [3H]-noradrenaline release. In the presence of 10 μM agmatine, the prostaglandin E2(PGE2)-induced EP3-receptor-mediated inhibition of [3H]-noradrenaline release was not modified, whereas the α2D-adrenoceptor-mediated inhibition of [3H]-noradrenaline release induced by noradrenaline, moxonidine or clonidine was more pronounced than in the absence of agmatine. However, 1 mM agmatine antagonized the moxonidine-induced inhibition of [3H]-noradrenaline release. Agmatine concentration-dependently inhibited the binding of [3H]-clonidine and [3H]-rauwolscine to rat brain cortex membranes (Ki values 6 μM and 12 μM, respectively). In addition, 30 and 100 μM agmatine increased the rate of association and decreased the rate of dissociation of [3H]-clonidine resulting in an increased affinity of the radioligand for the α2D-adrenoceptors. [14C]-agmatine labelled specific binding sites on rat brain cortex membranes. In competition experiments. [14C]-agmatine was inhibited from binding to its specific recognition sites by unlabelled agmatine, but not by rauwolscine and moxonidine. In conclusion, the present data indicate that agmatine both acts as an antagonist at the ligand recognition site of the α2D-adrenoceptor and enhances the effects of α2-adrenoceptor agonists probably by binding to an allosteric binding site of the α2D-adrenoceptor which seems to be labelled by [14C]-agmatine. PMID:10928978

  19. Interplay between membrane curvature and protein conformational equilibrium investigated by solid-state NMR.

    PubMed

    Liao, Shu Y; Lee, Myungwoon; Hong, Mei

    2018-03-01

    Many membrane proteins sense and induce membrane curvature for function, but structural information about how proteins modulate their structures to cause membrane curvature is sparse. We review our recent solid-state NMR studies of two virus membrane proteins whose conformational equilibrium is tightly coupled to membrane curvature. The influenza M2 proton channel has a drug-binding site in the transmembrane (TM) pore. Previous chemical shift data indicated that this pore-binding site is lost in an M2 construct that contains the TM domain and a curvature-inducing amphipathic helix. We have now obtained chemical shift perturbation, protein-drug proximity, and drug orientation data that indicate that the pore-binding site is restored when the full cytoplasmic domain is present. This finding indicates that the curvature-inducing amphipathic helix distorts the TM structure to interfere with drug binding, while the cytoplasmic tail attenuates this effect. In the second example, we review our studies of a parainfluenza virus fusion protein that merges the cell membrane and the virus envelope during virus entry. Chemical shifts of two hydrophobic domains of the protein indicate that both domains have membrane-dependent backbone conformations, with the β-strand structure dominating in negative-curvature phosphatidylethanolamine (PE) membranes. 31 P NMR spectra and 1 H- 31 P correlation spectra indicate that the β-strand-rich conformation induces saddle-splay curvature to PE membranes and dehydrates them, thus stabilizing the hemifusion state. These results highlight the indispensable role of solid-state NMR to simultaneously determine membrane protein structures and characterize the membrane curvature in which these protein structures exist. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Examination of the Mechanism of Human Brain Aspartoacylase through the Binding of an Intermediate Analogue†‡

    PubMed Central

    Le Coq, Johanne; Pavlovsky, Alexander; Malik, Radhika; Sanishvili, Ruslan; Xu, Chengfu; Viola, Ronald E.

    2009-01-01

    Canavan disease is a fatal neurological disorder caused by the malfunctioning of a single metabolic enzyme, aspartoacylase, that catalyzes the deacetylation of N-acetyl-l-aspartate to produce l-aspartate and acetate. The structure of human brain aspartoacylase has been determined in complex with a stable tetrahedral intermediate analogue, N-phosphonomethyl-l-aspartate. This potent inhibitor forms multiple interactions between each of its heteroatoms and the substrate binding groups arrayed within the active site. The binding of the catalytic intermediate analogue induces the conformational ordering of several substrate binding groups, thereby setting up the active site for catalysis. The highly ordered binding of this inhibitor has allowed assignments to be made for substrate binding groups and provides strong support for a carboxypeptidase-type mechanism for the hydrolysis of the amide bond of the substrate, N-acetyl-l-aspartate. PMID:18293939

  1. Examination of the mechanism of human brain aspartoacylase through the binding of an intermediate analogue.

    PubMed

    Le Coq, Johanne; Pavlovsky, Alexander; Malik, Radhika; Sanishvili, Ruslan; Xu, Chengfu; Viola, Ronald E

    2008-03-18

    Canavan disease is a fatal neurological disorder caused by the malfunctioning of a single metabolic enzyme, aspartoacylase, that catalyzes the deacetylation of N-acetyl-L-aspartate to produce L-aspartate and acetate. The structure of human brain aspartoacylase has been determined in complex with a stable tetrahedral intermediate analogue, N-phosphonomethyl-L-aspartate. This potent inhibitor forms multiple interactions between each of its heteroatoms and the substrate binding groups arrayed within the active site. The binding of the catalytic intermediate analogue induces the conformational ordering of several substrate binding groups, thereby setting up the active site for catalysis. The highly ordered binding of this inhibitor has allowed assignments to be made for substrate binding groups and provides strong support for a carboxypeptidase-type mechanism for the hydrolysis of the amide bond of the substrate, N-acetyl- l-aspartate.

  2. Pressure reversal of the action of octanol on postsynaptic membranes from Torpedo.

    PubMed Central

    Braswell, L. M.; Miller, K. W.; Sauter, J. F.

    1984-01-01

    Octanol increases the binding of [3H]-acetylcholine to the desensitized state of the nicotinic receptor in postsynaptic membranes prepared from Torpedo californica. This increase in binding results from an increase in the affinity of [3H]-acetylcholine for its receptor without any change in the number of sites or the shape of the acetylcholine binding curve. High pressures of helium (300 atm) decrease [3H]-acetylcholine binding by a mechanism that changes only the affinity of acetylcholine binding. Helium pressure reverses the effect of octanol on the affinity of [3H]-acetylcholine for its receptor. This pressure reversal of the action of octanol at a postsynaptic membrane is consistent either with pressure counteracting an octanol-induced membrane expansion or with independent mechanisms for the actions of octanol and pressure. The data do not conform with a mechanism in which pressure displaces octanol from a binding site on the receptor protein. PMID:6487895

  3. Cyclophilin B binding to platelets supports calcium-dependent adhesion to collagen.

    PubMed

    Allain, F; Durieux, S; Denys, A; Carpentier, M; Spik, G

    1999-08-01

    We have recently reported that cyclophilin B (CyPB), a secreted cyclosporine-binding protein, could bind to T lymphocytes through interactions with two types of binding sites. The first ones, referred to as type I, involve interactions with the conserved domain of CyPB and promote the endocytosis of surface-bound ligand, while the second type of binding sites, termed type II, are represented by glycosaminoglycans (GAG). Here, we further investigated the interactions of CyPB with blood cell populations. In addition to lymphocytes, CyPB was found to interact mainly with platelets. The binding is specific, with a dissociation constant (kd) of 9 +/- 3 nmol/L and the number of sites estimated at 960 +/- 60 per cell. Platelet glycosaminoglycans are not required for the interactions, but the binding is dramatically reduced by active cyclosporine derivatives. We then analyzed the biologic effects of CyPB and found a significant increase in platelet adhesion to collagen. Concurrently, CyPB initiates a transmembranous influx of Ca(2+) and induces the phosphorylation of the P-20 light chains of myosin. Taken together, the present results demonstrate for the first time that extracellular CyPB specifically interacts with platelets through a functional receptor related to the lymphocyte type I binding sites and might act by regulating the activity of a receptor-operated membrane Ca(2+) channel.

  4. A novel mode for transcription inhibition mediated by PNA-induced R-loops with a model in vitro system.

    PubMed

    D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C

    2018-02-01

    The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Chemical Carcinogen-Induced Changes in tRNA Metabolism in Human Cells

    DTIC Science & Technology

    1984-11-20

    uptake Chart 7 by POD was not affected by concurrent treatment with 0.1 mM quercetin (Chart 7). Epidermal growth factor (100 nM) also had no affect on...Therefore, we examined the affect on queuine uptake of quercetin , a flavanoid inhibitor of protein kinase C which binds to a site separate from the...phorbol ester binding site (12). Quercetin did not relieve the POO-effected inhibition of rQT3 uptake.. Although some residual activity of membrane bound

  6. Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

    PubMed Central

    Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

    2016-01-01

    The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

  7. Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor

    PubMed Central

    Kuban-Jankowska, Alicja; Sahu, Kamlesh K.; Gorska, Magdalena; Tuszynski, Jack A.; Wozniak, Michal

    2016-01-01

    Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding. PMID:26735581

  8. Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor.

    PubMed

    Kuban-Jankowska, Alicja; Sahu, Kamlesh K; Gorska, Magdalena; Tuszynski, Jack A; Wozniak, Michal

    2016-01-19

    Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding.

  9. Muramyl peptides in mammalian tissues and their effects at the cellular level.

    PubMed

    Karnovsky, M L

    1986-10-01

    Muramyl peptides (MPs), presumably breakdown products of bacterial cell walls, have been found in the brain, liver, and kidney of the rat. They exert multiple physiological effects on higher animals as immunoadjuvants, activators of macrophages, pyrogens, antitumor agents, inducers of contractility of smooth muscle, and promoters of slow-wave sleep, as well as nonspecific protectors of animals against infection. Structure-function relationships of these substances have been extensively studied, especially with respect to somnogenicity. In the role an intact muramyl ring is required, and the 1,6-anhydro form is active. The presence of free carboxyls or amides on the glutamyl and diaminopimelyl entities have important effects. The stereochemistry is crucial: the alanine adjacent to the N-acetylmuramyl entity must be L, and the glutamate must be D. Studies were carried out with murine macrophages to establish mechanisms of action of these glycopeptides. There are two populations of binding sites for MPs on those cells. When compounds of different structure are compared, binding ability correlates with pyrogenic and somnogenic activity. Serotonin competes with these agents for binding sites. Binding of that substance induces at least one macrophage response characteristic of the binding of MP.

  10. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  11. Genetically designed biosensing systems for high-throughput screening of pharmaceuticals, clinical diagnostics, and environmental monitoring

    NASA Astrophysics Data System (ADS)

    Wenner, Brett R.; Douglass, Phillip; Shrestha, Suresh; Sharma, Bethel V.; Lai, Siyi; Madou, Marc J.; Daunert, Sylvia

    2001-05-01

    The genetically-modified binding proteins calmodulin, the phosphate binding protein, the sulfate binding protein, and the galactose/glucose binding protein have been successfully employed as biosensing elements for the detection of phenothiazines, phosphate, sulfate, and glucose, respectively. Mutant proteins containing unique cysteine residues were utilized in the site-specific labeling of environment-sensitive fluorescent probes. Changes in the environment of the probes upon ligand-induced conformational changes of the proteins result in changes in fluorescence intensity.

  12. Malathion-induced inhibition of human plasma cholinesterase studied by the fluorescence spectroscopy method

    NASA Astrophysics Data System (ADS)

    Pavelkić, V. M.; Krinulović, K. S.; Savić, J. Z.; Ilić, M. A.

    2008-05-01

    The in vitro effect of technical grade malathion was assessed via the kinetic parameters of human plasma butyrylcholinesterase (BChE) using N-methylindoxyl acetate as a substrate for BChE. An inhibitor kinetics study demonstrated the existence of a biphasic inhibition curve, indicating high-and low-affinity binding sites of malathion. The IC 50 values as calculated from the experimental inhibition curves were 1.33 × 10-9 and 1.48 × 10-5 M for the high-and low-affinity binding sites, respectively; Hill’s analysis gave 1.29 × 10-9 and 1.38 × 10-6 M. The Cornish-Bowden plots and their secondary plots indicated that the nature of inhibition was of mixed type with the predominant competitive character of both affinity binding sites.

  13. Synthesis of molecularly imprinted organic-inorganic hybrid azobenzene materials by sol-gel for radiation induced selective recognition of 2,4-dichlorophenoxyacetic acid

    NASA Astrophysics Data System (ADS)

    Shuai Jiang, Guang; An Zhong, Shi; Chen, Lan; Blakey, Idriss; Whitaker, Andrew

    2011-02-01

    A novel photoresponsive functional monomer bearing a siloxane polymerisable group and azobenzene moieties was synthesized. This monomer was then used to prepare photoresponsive molecularly imprinted polymers (MIP), which have specific binding sites for 2,4-dichlorophenoxyacetic acid (2,4-D) through hydrogen bonding moieties. The binding affinity of the imprinted recognition sites was switchable by alternate irradiations with ultraviolet and visible light, suggesting that azobenzene groups located inside the binding sites could be used as chemical sensors and the trans-cis isomerization could regulate the affinity for the 2,4-D. In addition, the concentration of the 2,4-D was able to be quantified by monitoring the trans-to-cis photoisomerization rate constant.

  14. Retro-binding thrombin active site inhibitors: identification of an orally active inhibitor of thrombin catalytic activity.

    PubMed

    Iwanowicz, Edwin J; Kimball, S David; Lin, James; Lau, Wan; Han, W-C; Wang, Tammy C; Roberts, Daniel G M; Schumacher, W A; Ogletree, Martin L; Seiler, Steven M

    2002-11-04

    A series of retro-binding inhibitors of human alpha-thrombin was prepared to elucidate structure-activity relationships (SAR) and optimize in vivo performance. Compounds 9 and 11, orally active inhibitors of thrombin catalytic activity, were identified to be efficacious in a thrombin-induced lethality model in mice.

  15. [Binding studies with Ulex europaeus agglutinin I (UEA-I) of the vascular endothelium of the synovial membrane].

    PubMed

    Zschäbitz, A; Stofft, E

    1988-01-01

    The lectin binding sites of the synovium of patients with rheumatoid arthritis and osteoarthritis were investigated. It was shown that Ulex europaeus agglutinin is a constant marker of the vascular endothelium and is not induced during the course of inflammatory process in rheumatoid arthritis.

  16. Warfarin and Flavonoids Do Not Share the Same Binding Region in Binding to the IIA Subdomain of Human Serum Albumin.

    PubMed

    Rimac, Hrvoje; Dufour, Claire; Debeljak, Željko; Zorc, Branka; Bojić, Mirza

    2017-07-11

    Human serum albumin (HSA) binds a variety of xenobiotics, including flavonoids and warfarin. The binding of another ligand to the IIA binding site on HSA can cause warfarin displacement and potentially the elevation of its free concentration in blood. Studies dealing with flavonoid-induced warfarin displacement from HSA provided controversial results: estimated risk of displacement ranged from none to serious. To resolve these controversies, in vitro study of simultaneous binding of warfarin and eight different flavonoid aglycons and glycosides to HSA was carried out by fluorescence spectroscopy as well as molecular docking. Results show that warfarin and flavonoids do not share the same binding region in binding to HSA. Interactions were only observed at high warfarin concentrations not attainable under recommended dosing regimes. Docking experiments show that flavonoid aglycons and glycosides do not bind at warfarin high affinity sites, but rather to different regions within the IIA HSA subdomain. Thus, the risk of clinically significant warfarin-flavonoid interaction in binding to HSA should be regarded as negligible.

  17. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jingjing; Kitova, Elena N.; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S.

    2016-01-01

    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (β-Gal-(1→3)-β-GalNAc-(1→4)[α-Neu5Ac-(2→3)]-β-Gal-(1→4)-Glc), Pk trisaccharide (α-Gal-(1→4)-β-Gal-(1→4)-Glc) and CD-grease (α-Gal-(1→3)-β-Gal-(1→4)-β-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics.

  18. Characterization of Short Range DNA Looping in Endotoxin-mediated Transcription of the Murine Inducible Nitric-oxide Synthase (iNOS) Gene*

    PubMed Central

    Guo, Hongtao; Mi, Zhiyong; Kuo, Paul C.

    2008-01-01

    The local structural properties and spatial conformations of chromosomes are intimately associated with gene expression. The spatial associations of critical genomic elements in inducible nitric-oxide synthase (iNOS) transcription have not been previously examined. In this regard, the murine iNOS promoter contains 2 NF-κB binding sites (nt –86 and nt –972) that are essential for maximal transactivation of iNOS by LPS. Although AP-1 is commonly listed as an essential transcription factor for LPS-mediated iNOS transactivation, the relationship between AP-1 and NF-κB in this setting is not well studied. In this study using a model of LPS-stimulated ANA-1 murine macrophages, we demonstrate that short range DNA looping occurs at the iNOS promoter. This looping requires the presence of AP-1, c-Jun, NF-κB p65, and p300-associated acetyltransferase activity. The distal AP-1 binding site interacts via p300 with the proximal NF-κB binding site to create this DNA loop to participate in iNOS transcription. Other geographically distant AP-1 and NF-κB sites are certainly occupied, but selected sites are critical for iNOS transcription and the formation of the c-Jun, p65, and p300 transcriptional complex. In this “simplified” model of murine iNOS promoter, numerous transcription factors recognize and bind to various response elements, but these locales do not equally contribute to iNOS gene transcription. PMID:18596035

  19. Fatty acid modulated human serum albumin binding of the β-carboline alkaloids norharmane and harmane.

    PubMed

    Domonkos, Celesztina; Fitos, Ilona; Visy, Júlia; Zsila, Ferenc

    2013-12-02

    Harmane and norharmane are representative members of the large group of natural β-carboline alkaloids featured with diverse pharmacological activities. In blood, these agents are transported by human serum albumin (HSA) which has a profound impact on the pharmacokinetic and pharmacodynamic properties of many therapeutic drugs and xenobiotics. By combination of various spectroscopic methods, the present contribution is aimed to elucidate how nonesterified fatty acids (FAs), the primary endogenous ligands of HSA, affect the binding properties of harmane and norharmane. Analysis of induced circular dichroism (CD) and fluorescence spectroscopic data indicates the inclusion of the neutral form of both molecules into the binding pocket of subdomain IIIA, which hosts two FA binding sites, too. The induced CD and UV absorption spectra of harmane and norharmane exhibit peculiar changes upon addition of FAs, suggesting the formation of ternary complexes in which the lipid ligands significantly alter the binding mode of the alkaloids via cooperative allosteric mechanism. To our knowledge, it is the first instance of the demonstration of drug-FA cobinding at site IIIA. In line with these results, molecular docking calculations showed two distinct binding positions of norharmane within subdomain IIIA. The profound increase in the affinity constants of β-carbolines estimated in the presence of FAs predicts that the unbound, pharmacologically active serum fraction of these compounds strongly depends on the actual lipid binding profile of HSA.

  20. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques.

    PubMed

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-03-30

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5  M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

  1. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

    PubMed Central

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-01-01

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124

  2. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

    NASA Astrophysics Data System (ADS)

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-03-01

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

  3. Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel

    PubMed Central

    Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel

    2010-01-01

    Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839

  4. Inducible model for β-six-mediated site-specific recombination in mammalian cells

    PubMed Central

    Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

    2006-01-01

    The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

  5. Reversibly bound chloride in the atrial natriuretic peptide receptor hormone-binding domain: possible allosteric regulation and a conserved structural motif for the chloride-binding site.

    PubMed

    Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S

    2010-03-01

    The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.

  6. Reversibly Bound Chloride in the Atrial Natriuretic Peptide Receptor Hormone Binding Domain: Possible Allosteric Regulation and a Conserved Structural Motif for the Chloride-binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogawa, H.; Qiu, Y; Philo, J

    2010-01-01

    The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. Amore » new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.« less

  7. Reversibly bound chloride in the atrial natriuretic peptide receptor hormone-binding domain: Possible allosteric regulation and a conserved structural motif for the chloride-binding site

    PubMed Central

    Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S

    2010-01-01

    The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(−)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(−) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(−) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis. PMID:20066666

  8. In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

    PubMed

    Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

    2016-11-01

    Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  10. Expression of melatonin receptors in arteries involved in thermoregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viswanathan, M.; Laitinen, J.T.; Saavedra, J.M.

    Melatonin binding sites were localized and characterized in the vasculature of the rat by using the melatonin analogue 2-(125I)iodomelatonin (125I-melatonin) and quantitative in vitro autoradiography. The expression of these sites was restricted to the caudal artery and to the arteries that form the circle of Willis at the base of the brain. The arterial 125I-melatonin binding was stable, saturable, and reversible. Saturation studies revealed that the binding represented a single class of high-affinity binding sites with a dissociation constant (Kd) of 3.4 x 10(-11) M in the anterior cerebral artery and 1.05 x 10(-10) M in the caudal artery. Themore » binding capacities (Bmax) in these arteries were 19 and 15 fmol/mg of protein, respectively. The relative order of potency of indoles for inhibition of 125I-melatonin binding at these sites was typical of a melatonin receptor: 2-iodomelatonin greater than melatonin greater than N-acetylserotonin much much greater than 5-hydroxytryptamine. Norepinephrine-induced contraction of the caudal artery in vitro was significantly prolonged and potentiated by melatonin in a concentration-dependent manner, suggesting that these arterial binding sites are functional melatonin receptors. Neither primary steps in smooth muscle contraction (inositol phospholipid hydrolysis) nor relaxation (adenylate cyclase activation) were affected by melatonin. Melatonin, through its action on the tone of these arteries, may cause circulatory adjustments in these arteries, which are believed to be involved in thermoregulation.« less

  11. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  12. Rhodopsin TM6 Can Interact with Two Separate and Distinct Sites on Arrestin: Evidence for Structural Plasticity and Multiple Docking Modes in Arrestin–Rhodopsin Binding

    PubMed Central

    2015-01-01

    Various studies have implicated the concave surface of arrestin in the binding of the cytosolic surface of rhodopsin. However, specific sites of contact between the two proteins have not previously been defined in detail. Here, we report that arrestin shares part of the same binding site on rhodopsin as does the transducin Gα subunit C-terminal tail, suggesting binding of both proteins to rhodopsin may share some similar underlying mechanisms. We also identify two areas of contact between the proteins near this region. Both sites lie in the arrestin N-domain, one in the so-called “finger” loop (residues 67–79) and the other in the 160 loop (residues 155–165). We mapped these sites using a novel tryptophan-induced quenching method, in which we introduced Trp residues into arrestin and measured their ability to quench the fluorescence of bimane probes attached to cysteine residues on TM6 of rhodopsin (T242C and T243C). The involvement of finger loop binding to rhodopsin was expected, but the evidence of the arrestin 160 loop contacting rhodopsin was not. Remarkably, our data indicate one site on rhodopsin can interact with multiple structurally separate sites on arrestin that are almost 30 Å apart. Although this observation at first seems paradoxical, in fact, it provides strong support for recent hypotheses that structural plasticity and conformational changes are involved in the arrestin–rhodopsin binding interface and that the two proteins may be able to interact through multiple docking modes, with arrestin binding to both monomeric and dimeric rhodopsin. PMID:24724832

  13. Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms

    PubMed Central

    Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.

    1999-01-01

    Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138

  14. Rhodopsin TM6 can interact with two separate and distinct sites on arrestin: evidence for structural plasticity and multiple docking modes in arrestin-rhodopsin binding.

    PubMed

    Sinha, Abhinav; Jones Brunette, Amber M; Fay, Jonathan F; Schafer, Christopher T; Farrens, David L

    2014-05-27

    Various studies have implicated the concave surface of arrestin in the binding of the cytosolic surface of rhodopsin. However, specific sites of contact between the two proteins have not previously been defined in detail. Here, we report that arrestin shares part of the same binding site on rhodopsin as does the transducin Gα subunit C-terminal tail, suggesting binding of both proteins to rhodopsin may share some similar underlying mechanisms. We also identify two areas of contact between the proteins near this region. Both sites lie in the arrestin N-domain, one in the so-called "finger" loop (residues 67-79) and the other in the 160 loop (residues 155-165). We mapped these sites using a novel tryptophan-induced quenching method, in which we introduced Trp residues into arrestin and measured their ability to quench the fluorescence of bimane probes attached to cysteine residues on TM6 of rhodopsin (T242C and T243C). The involvement of finger loop binding to rhodopsin was expected, but the evidence of the arrestin 160 loop contacting rhodopsin was not. Remarkably, our data indicate one site on rhodopsin can interact with multiple structurally separate sites on arrestin that are almost 30 Å apart. Although this observation at first seems paradoxical, in fact, it provides strong support for recent hypotheses that structural plasticity and conformational changes are involved in the arrestin-rhodopsin binding interface and that the two proteins may be able to interact through multiple docking modes, with arrestin binding to both monomeric and dimeric rhodopsin.

  15. Importance of the Extracellular Loop 4 in the Human Serotonin Transporter for Inhibitor Binding and Substrate Translocation*

    PubMed Central

    Rannversson, Hafsteinn; Wilson, Pamela; Kristensen, Kristina Birch; Sinning, Steffen; Kristensen, Anders Skov; Strømgaard, Kristian; Andersen, Jacob

    2015-01-01

    The serotonin transporter (SERT) terminates serotonergic neurotransmission by performing reuptake of released serotonin, and SERT is the primary target for antidepressants. SERT mediates the reuptake of serotonin through an alternating access mechanism, implying that a central substrate site is connected to both sides of the membrane by permeation pathways, of which only one is accessible at a time. The coordinated conformational changes in SERT associated with substrate translocation are not fully understood. Here, we have identified a Leu to Glu mutation at position 406 (L406E) in the extracellular loop 4 (EL4) of human SERT, which induced a remarkable gain-of-potency (up to >40-fold) for a range of SERT inhibitors. The effects were highly specific for L406E relative to six other mutations in the same position, including the closely related L406D mutation, showing that the effects induced by L406E are not simply charge-related effects. Leu406 is located >10 Å from the central inhibitor binding site indicating that the mutation affects inhibitor binding in an indirect manner. We found that L406E decreased accessibility to a residue in the cytoplasmic pathway. The shift in equilibrium to favor a more outward-facing conformation of SERT can explain the reduced turnover rate and increased association rate of inhibitor binding we found for L406E. Together, our findings show that EL4 allosterically can modulate inhibitor binding within the central binding site, and substantiates that EL4 has an important role in controlling the conformational equilibrium of human SERT. PMID:25903124

  16. Structures of a Na+-coupled, substrate-bound MATE multidrug transporter

    PubMed Central

    Lu, Min; Symersky, Jindrich; Radchenko, Martha; Koide, Akiko; Guo, Yi; Nie, Rongxin; Koide, Shohei

    2013-01-01

    Multidrug transporters belonging to the multidrug and toxic compound extrusion (MATE) family expel dissimilar lipophilic and cationic drugs across cell membranes by dissipating a preexisting Na+ or H+ gradient. Despite its clinical relevance, the transport mechanism of MATE proteins remains poorly understood, largely owing to a lack of structural information on the substrate-bound transporter. Here we report crystal structures of a Na+-coupled MATE transporter NorM from Neisseria gonorrheae in complexes with three distinct translocation substrates (ethidium, rhodamine 6G, and tetraphenylphosphonium), as well as Cs+ (a Na+ congener), all captured in extracellular-facing and drug-bound states. The structures revealed a multidrug-binding cavity festooned with four negatively charged amino acids and surprisingly limited hydrophobic moieties, in stark contrast to the general belief that aromatic amino acids play a prominent role in multidrug recognition. Furthermore, we discovered an uncommon cation–π interaction in the Na+-binding site located outside the drug-binding cavity and validated the biological relevance of both the substrate- and cation-binding sites by conducting drug resistance and transport assays. Additionally, we uncovered potential rearrangement of at least two transmembrane helices upon Na+-induced drug export. Based on our structural and functional analyses, we suggest that Na+ triggers multidrug extrusion by inducing protein conformational changes rather than by directly competing for the substrate-binding amino acids. This scenario is distinct from the canonical antiport mechanism, in which both substrate and counterion compete for a shared binding site in the transporter. Collectively, our findings provide an important step toward a detailed and mechanistic understanding of multidrug transport. PMID:23341609

  17. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  18. Mutation Induced Conformational Change In CaMKII Peptide Alters Binding Affinity to CaM Through Alternate Binding Site

    NASA Astrophysics Data System (ADS)

    Ezerski, Jacob; Cheung, Margaret

    CaM forms distinct conformation states through modifications in its charge distribution upon binding to Ca2+ ions. The occurrence of protein structural change resulting from an altered charge distribution is paramount in the scheme of cellular signaling. Not only is charge induced structural change observed in CaM, it is also seen in an essential binding target: calmodulin-depended protein kinase II (CaMKII). In order to investigate the mechanism of selectivity in relation to changes in secondary structure, the CaM binding domain of CaMKII is isolated. Experimentally, charged residues of the CaMKII peptide are systematically mutated to alanine, resulting in altered binding kinetics between the peptide and the Ca2+ saturated state of CaM. We perform an all atom simulation of the wildtype (RRK) and mutated (AAA) CaMKII peptides and generate structures from the trajectory. We analyze RRK and AAA using DSSP and find significant structural differences due to the mutation. Structures from the RRK and AAA ensembles are then selected and docked onto the crystal structure of Ca2+ saturated CaM. We observe that RRK binds to CaM at the C-terminus, whereas the 3-residue mutation, AAA, shows increased patterns of binding to the N-terminus and linker regions of CaM. Due to the conformational change of the peptide ensemble from charged residue mutation, a distinct change in the binding site can be seen, which offers an explanation to experimentally observed changes in kinetic binding rates

  19. Fragment-based screen against HIV protease.

    PubMed

    Perryman, Alexander L; Zhang, Qing; Soutter, Holly H; Rosenfeld, Robin; McRee, Duncan E; Olson, Arthur J; Elder, John E; Stout, C David

    2010-03-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 A resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the 'exo site' adjacent to the Gly(16)Gly(17)Gln(18)loop where the amide of Gly(17)is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys(14)and Leu(63). Another fragment, indole-6-carboxylic acid, binds on the 'outside/top of the flap' via hydrophobic contacts with Trp(42), Pro(44), Met(46), and Lys(55), a hydrogen bond with Val(56), and a salt-bridge with Arg(57). 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target.

  20. Structural and biochemical studies on ATP binding and hydrolysis by the Escherichia coli RNA chaperone Hfq.

    PubMed

    Hämmerle, Hermann; Beich-Frandsen, Mads; Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)(15) and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq(65)) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions.

  1. Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins.

    PubMed

    Cogliati, Clelia; Tomaselli, Simona; Assfalg, Michael; Pedò, Massimo; Ferranti, Pasquale; Zetta, Lucia; Molinari, Henriette; Ragona, Laura

    2009-10-01

    Bile acid-binding proteins (BABPs) are cytosolic lipid chaperones that play central roles in driving bile flow, as well as in the adaptation to various pathological conditions, contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Understanding the mode of binding of bile acids with their cytoplasmic transporters is a key issue in providing a model for the mechanism of their transfer from the cytoplasm to the nucleus, for delivery to nuclear receptors. A number of factors have been shown to modulate bile salt selectivity, stoichiometry, and affinity of binding to BABPs, e.g. chemistry of the ligand, protein plasticity and, possibly, the formation of disulfide bridges. Here, the effects of the presence of a naturally occurring disulfide bridge on liver BABP ligand-binding properties and backbone dynamics have been investigated by NMR. Interestingly, the disulfide bridge does not modify the protein-binding stoichiometry, but has a key role in modulating recognition at both sites, inducing site selectivity for glycocholic and glycochenodeoxycholic acid. Protein conformational changes following the introduction of a disulfide bridge are small and located around the inner binding site, whereas significant changes in backbone motions are observed for several residues distributed over the entire protein, both in the apo form and in the holo form. Site selectivity appears, therefore, to be dependent on protein mobility rather than being governed by steric factors. The detected properties further establish a parallelism with the behaviour of human ileal BABP, substantiating the proposal that BABPs have parallel functions in hepatocytes and enterocytes.

  2. Zinc-induced modulation of SRSF6 activity alters Bim splicing to promote generation of the most potent apoptotic isoform BimS.

    PubMed

    Hara, Hirokazu; Takeda, Tatsuya; Yamamoto, Nozomi; Furuya, Keisuke; Hirose, Kazuya; Kamiya, Tetsuro; Adachi, Tetsuo

    2013-07-01

    Bim is a member of the pro-apoptotic BH3-only Bcl-2 family of proteins. Bim gene undergoes alternative splicing to produce three predominant splicing variants (BimEL, BimL and BimS). The smallest variant BimS is the most potent inducer of apoptosis. Zinc (Zn(2+)) has been reported to stimulate apoptosis in various cell types. In this study, we examined whether Zn(2+) affects the expression of Bim in human neuroblastoma SH-SY5Y cells. Zn(2+) triggered alterations in Bim splicing and induced preferential generation of BimS, but not BimEL and BimL, in a dose- and time-dependent manner. Other metals (cadmium, cobalt and copper) and stresses (oxidative, endoplasmic reticulum and genotoxic stresses) had little or no effect on the expression of BimS. To address the mechanism of Zn(2+)-induced preferential generation of BimS, which lacks exon 4, we developed a Bim mini-gene construct. Deletion analysis using the Bim mini-gene revealed that predicted binding sites of the SR protein SRSF6, also known as SRp55, are located in the intronic region adjacent to exon 4. We also found that mutations in the predicted SRSF6-binding sites abolished generation of BimS mRNA from the mutated Bim mini-gene. In addition, a UV cross-linking assay followed by Western blotting showed that SRSF6 directly bound to the predicted binding site and Zn(2+) suppressed this binding. Moreover, Zn(2+) stimulated SRSF6 hyper-phosphorylation. TG003, a cdc2-like kinase inhibitor, partially prevented Zn(2+)-induced generation of BimS and SRSF6 hyper-phosphorylation. Taken together, our findings suggest that Zn(2+) inhibits the activity of SRSF6 and promotes elimination of exon 4, leading to preferential generation of BimS. © 2013 FEBS.

  3. Barbiturates Bind in the GLIC Ion Channel Pore and Cause Inhibition by Stabilizing a Closed State*♦

    PubMed Central

    Fourati, Zaineb; Ruza, Reinis Reinholds; Laverty, Duncan; Drège, Emmanuelle; Delarue-Cochin, Sandrine; Joseph, Delphine; Koehl, Patrice; Smart, Trevor; Delarue, Marc

    2017-01-01

    Barbiturates induce anesthesia by modulating the activity of anionic and cationic pentameric ligand-gated ion channels (pLGICs). Despite more than a century of use in clinical practice, the prototypic binding site for this class of drugs within pLGICs is yet to be described. In this study, we present the first X-ray structures of barbiturates bound to GLIC, a cationic prokaryotic pLGIC with excellent structural homology to other relevant channels sensitive to general anesthetics and, as shown here, to barbiturates, at clinically relevant concentrations. Several derivatives of barbiturates containing anomalous scatterers were synthesized, and these derivatives helped us unambiguously identify a unique barbiturate binding site within the central ion channel pore in a closed conformation. In addition, docking calculations around the observed binding site for all three states of the receptor, including a model of the desensitized state, showed that barbiturates preferentially stabilize the closed state. The identification of this pore binding site sheds light on the mechanism of barbiturate inhibition of cationic pLGICs and allows the rationalization of several structural and functional features previously observed for barbiturates. PMID:27986812

  4. LH-RH binding to purified pituitary plasma membranes: absence of adenylate cyclase activation.

    PubMed

    Clayton, R N; Shakespear, R A; Marshall, J C

    1978-06-01

    Purified bovine pituitary plasma membranes possess two specific LH-RH binding sites. The high affinity site (2.5 X 10(9) l/mol) has low capacity (9 X 10(-15) mol/mg membrane protein) while the low affinity site 6.1 X 10(5) l/mol) has a much higher capacity (1.1 X 10(-10) mol/mg). Specific LH-RH binding to plasma membranes is increased 8.5-fold during purification from homogenate whilst adenylate cyclase activity is enriched 7--8-fold. Distribution of specific LH-RH binding to sucrose density gradient interface fractions parallels that of adenylate cyclase activity. Mg2+ and Ca2+ inhibit specific [125I]LH-RH binding at micromolar concentrations. Synthetic LH-RH, up to 250 microgram/ml, failed to stimulate adenylase cyclase activity of the purified bovine membranes. Using a crude 10,800 g rat pituitary membrane preparation, LH-RH similarly failed to activate adenylate cyclase even in the presence of guanyl nucleotides. These data confirm the presence of LH-RH receptor sites on pituitary plasma membranes and suggest that LH-RH-induced gonadotrophin release may be mediated by mechanisms other than activation of adenylate cyclase.

  5. Rate constants of agonist binding to muscarinic receptors in rat brain medulla. Evaluation by competition kinetics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schreiber, G.; Henis, Y.I.; Sokolovsky, M.

    The method of competition kinetics, which measures the binding kinetics of an unlabeled ligand through its effect on the binding kinetics of a labeled ligand, was employed to investigate the kinetics of muscarinic agonist binding to rat brain medulla pons homogenates. The agonists studied were acetylcholine, carbamylcholine, and oxotremorine, with N-methyl-4-(TH)piperidyl benzilate employed as the radiolabeled ligand. Our results suggested that the binding of muscarinic agonists to the high affinity sites is characterized by dissociation rate constants higher by 2 orders of magnitude than those of antagonists, with rather similar association rate constants. Our findings also suggest that isomerization ofmore » the muscarinic receptors following ligand binding is significant in the case of antagonists, but not of agonists. Moreover, it is demonstrated that in the medulla pons preparation, agonist-induced interconversion between high and low affinity bindings sites does not occur to an appreciable extent.« less

  6. TALE-PvuII fusion proteins--novel tools for gene targeting.

    PubMed

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  7. RDX Binds to the GABAA Receptor–Convulsant Site and Blocks GABAA Receptor–Mediated Currents in the Amygdala: A Mechanism for RDX-Induced Seizures

    PubMed Central

    Williams, Larry R.; Aroniadou-Anderjaska, Vassiliki; Qashu, Felicia; Finne, Huckelberry; Pidoplichko, Volodymyr; Bannon, Desmond I.; Braga, Maria F. M.

    2011-01-01

    Background Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) is a high-energy, trinitrated cyclic compound that has been used worldwide since World War II as an explosive in both military and civilian applications. RDX can be released in the environment by way of waste streams generated during the manufacture, use, and disposal of RDX-containing munitions and can leach into groundwater from unexploded munitions found on training ranges. For > 60 years, it has been known that exposure to high doses of RDX causes generalized seizures, but the mechanism has remained unknown. Objective We investigated the mechanism by which RDX induces seizures. Methods and results By screening the affinity of RDX for a number of neurotransmitter receptors, we found that RDX binds exclusively to the picrotoxin convulsant site of the γ-aminobutyric acid type A (GABAA) ionophore. Whole-cell in vitro recordings in the rat basolateral amygdala (BLA) showed that RDX reduces the frequency and amplitude of spontaneous GABAA receptor–mediated inhibitory postsynaptic currents and the amplitude of GABA-evoked postsynaptic currents. In extracellular field recordings from the BLA, RDX induced prolonged, seizure-like neuronal discharges. Conclusions These results suggest that binding to the GABAA receptor convulsant site is the primary mechanism of seizure induction by RDX and that reduction of GABAergic inhibitory transmission in the amygdala is involved in the generation of RDX-induced seizures. Knowledge of the molecular site and the mechanism of RDX action with respect to seizure induction can guide therapeutic strategies, allow more accurate development of safe thresholds for exposures, and help prevent the development of new explosives or other munitions that could pose similar health risks. PMID:21362589

  8. Pharmacologic characterization of the oxytocin receptor in human uterine smooth muscle cells

    PubMed Central

    Tahara, Atsuo; Tsukada, Junko; Tomura, Yuichi; Wada, Koh-ichi; Kusayama, Toshiyuki; Ishii, Noe; Yatsu, Takeyuki; Uchida, Wataru; Tanaka, Akihiro

    2000-01-01

    [3H]-oxytocin was used to characterize the oxytocin receptor found in human uterine smooth muscle cells (USMC). Specific binding of [3H]-oxytocin to USMC plasma membranes was dependent upon time, temperature and membrane protein concentration. Scatchard plot analysis of equilibrium binding data revealed the existence of a single class of high-affinity binding sites with an apparent equilibrium dissociation constant (Kd) of 0.76 nM and a maximum receptor density (Bmax) of 153 fmol mg−1 protein. The Hill coefficient (nH) did not differ significantly from unity, suggesting binding to homogenous, non-interacting receptor populations. Competitive inhibition of [3H]-oxytocin binding showed that oxytocin and vasopressin (AVP) receptor agonists and antagonists displaced [3H]-oxytocin in a concentration-dependent manner. The order of potencies for peptide agonists and antagonists was: oxytocin>[Asu1,6]-oxytocin>AVP= atosiban>d(CH2)5Tyr(Me)AVP>[Thr4,Gly7]-oxytocin>dDAVP, and for nonpeptide antagonists was: L-371257>YM087>SR 49059>OPC-21268>SR 121463A>OPC-31260. Oxytocin significantly induced concentration-dependent increase in intracellular Ca2+ concentration ([Ca2+]i) and hyperplasia in USMC. The oxytocin receptor antagonists, atosiban and L-371257, potently and concentration-dependently inhibited oxytocin-induced [Ca2+]i increase and hyperplasia. In contrast, the V1A receptor selective antagonist, SR 49059, and the V2 receptor selective antagonist, SR 121463A, did not potently inhibit oxytocin-induced [Ca2+]i increase and hyperplasia. The potency order of antagonists in inhibiting oxytocin-induced [Ca2+]i increase and hyperplasia was similar to that observed in radioligand binding assays. In conclusion, these data provide evidence that the high-affinity [3H]-oxytocin binding site found in human USMC is a functional oxytocin receptor coupled to [Ca2+]i increase and cell growth. Thus human USMC may prove to be a valuable tool in further investigation of the physiologic and pathophysiologic roles of oxytocin in the uterus. PMID:10694212

  9. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

  10. Dual Role of OhrR as a Repressor and an Activator in Response to Organic Hydroperoxides in Streptomyces coelicolor▿

    PubMed Central

    Oh, So-Young; Shin, Jung-Ho; Roe, Jung-Hye

    2007-01-01

    Organic hydroperoxide resistance in bacteria is achieved primarily through reducing oxidized membrane lipids. The soil-inhabiting aerobic bacterium Streptomyces coelicolor contains three paralogous genes for organic hydroperoxide resistance: ohrA, ohrB, and ohrC. The ohrA gene is transcribed divergently from ohrR, which encodes a putative regulator of MarR family. Both the ohrA and ohrR genes were induced highly by various organic hydroperoxides. The ohrA gene was induced through removal of repression by OhrR, whereas the ohrR gene was induced through activation by OhrR. Reduced OhrR bound to the ohrA-ohrR intergenic region, which contains a central (primary) and two adjacent (secondary) inverted-repeat motifs that overlap with promoter elements. Organic peroxide decreased the binding affinity of OhrR for the primary site, with a concomitant decrease in cooperative binding to the adjacent secondary sites. The single cysteine C28 in OhrR was involved in sensing oxidants, as determined by substitution mutagenesis. The C28S mutant of OhrR bound to the intergenic region without any change in binding affinity in response to organic peroxides. These results lead us to propose a model for the dual action of OhrR as a repressor and an activator in S. coelicolor. Under reduced conditions, OhrR binds cooperatively to the intergenic region, repressing transcription from both genes. Upon oxidation, the binding affinity of OhrR decreases, with a concomitant loss of cooperative binding, which allows RNA polymerase to bind to both the ohrA and ohrR promoters. The loosely bound oxidized OhrR can further activate transcription from the ohrR promoter. PMID:17586628

  11. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  12. Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus

    PubMed Central

    Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

    2015-01-01

    The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function. PMID:25333630

  13. Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus.

    PubMed

    Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

    2015-09-01

    The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function.

  14. Investigating MUC1/ICAM-1 Binding Induced Signaling in Breast Cancer Metastasis

    DTIC Science & Technology

    2011-05-01

    expected that covalently linked species would remain intact. Reducing (R, + !-mercaptoethanol) and non-reducing (NR, no !-mercaptoethanol) samples were...binding site, containing both proline and arginine residues. We mutated the SH2 and/or putative SH3 binding domains on the MUC1-CFP-Fv plasmid...Structure and regulation of Src family kinases. Oncogene 2004, 23:7918- 7927. 31. Li SSC: Specificity and versatility of SH3 and other proline -recognition

  15. Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism

    PubMed Central

    Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K.; Lehtonen, Jukka Y.A.

    2016-01-01

    As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3′-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. PMID:26681690

  16. hnRNP L controls HPV16 RNA polyadenylation and splicing in an Akt kinase-dependent manner

    PubMed Central

    Kajitani, Naoko; Glahder, Jacob; Wu, Chengjun; Yu, Haoran; Nilsson, Kersti

    2017-01-01

    Abstract Inhibition of the Akt kinase activates HPV16 late gene expression by reducing HPV16 early polyadenylation and by activating HPV16 late L1 mRNA splicing. We identified ‘hot spots’ for RNA binding proteins at the early polyA signal and at splice sites on HPV16 late mRNAs. We observed that hnRNP L was associated with sequences at all HPV16 late splice sites and at the early polyA signal. Akt kinase inhibition resulted in hnRNP L dephosphorylation and reduced association of hnRNP L with HPV16 mRNAs. This was accompanied by an increased binding of U2AF65 and Sam68 to HPV16 mRNAs. Furthermore, siRNA knock-down of hnRNP L or Akt induced HPV16 gene expression. Treatment of HPV16 immortalized keratinocytes with Akt kinase inhibitor reduced hnRNP L binding to HPV16 mRNAs and induced HPV16 L1 mRNA production. Finally, deletion of the hnRNP L binding sites in HPV16 subgenomic expression plasmids resulted in activation of HPV16 late gene expression. In conclusion, the Akt kinase inhibits HPV16 late gene expression at the level of RNA processing by controlling the RNA-binding protein hnRNP L. We speculate that Akt kinase activity upholds an intracellular milieu that favours HPV16 early gene expression and suppresses HPV16 late gene expression. PMID:28934469

  17. The organic solute transporters alpha and beta are induced by hypoxia in human hepatocytes

    PubMed Central

    Schaffner, Carlos A; Mwinyi, Jessica; Gai, Zhibo; Thasler, Wolfgang E; Eloranta, Jyrki J; Kullak-Ublick, Gerd A

    2015-01-01

    Background & Aims The organic solute transporters alpha and beta (OSTα-OSTβ) form a heterodimeric transporter located at the basolateral membrane of intestinal epithelial cells and hepatocytes. Liver injury caused by ischaemia-reperfusion, cancer, inflammation or cholestasis can induce a state of hypoxia in hepatocytes. Here, we studied the effect of hypoxia on the expression of OSTα-OSTβ. Methods OSTα-OSTβ expression was measured in Huh7 cells and primary human hepatocytes (PHH) exposed to chenodeoxycholic acid (CDCA), hypoxia or both. OSTα-OSTβ promoter activity was analysed in luciferase reporter gene assays. Binding of hypoxia-inducible factor-1 alpha (HIF-1α) to the OSTα-OSTβ gene promoters was studied in electrophoretic mobility shift assays (EMSA). Results Expression of OSTα and OSTβ increased in PHH under conditions of hypoxia. Exposure of Huh7 cells or PHH to CDCA (50 μM) enhanced the effect of hypoxia on OSTα mRNA levels. In luciferase assays and EMSA, the inducing effect of low oxygen could be assigned to HIF-1α, which binds to hypoxia responsive elements (HRE) in the OSTα and OSTβ gene promoters. Site-directed mutagenesis of either the predicted HRE or the bile acid responsive FXR binding site abolished inducibility of the OSTα promoter, indicating that both elements need to be intact for induction by hypoxia and CDCA. In a rat model of chronic renal failure, the known increase in hepatic OSTα expression was associated with an increase in HIF-1α protein levels. Conclusion OSTα-OSTβ expression is induced by hypoxia. FXR and HIF-1α bind in close proximity to the OSTα gene promoter and produce synergistic effects on OSTα expression. PMID:24703425

  18. Hormone-induced 14-3-3γ Adaptor Protein Regulates Steroidogenic Acute Regulatory Protein Activity and Steroid Biosynthesis in MA-10 Leydig Cells*

    PubMed Central

    Aghazadeh, Yasaman; Rone, Malena B.; Blonder, Josip; Ye, Xiaoying; Veenstra, Timothy D.; Hales, D. Buck; Culty, Martine; Papadopoulos, Vassilios

    2012-01-01

    Cholesterol is the sole precursor of steroid hormones in the body. The import of cholesterol to the inner mitochondrial membrane, the rate-limiting step in steroid biosynthesis, relies on the formation of a protein complex that assembles at the outer mitochondrial membrane called the transduceosome. The transduceosome contains several mitochondrial and cytosolic components, including the steroidogenic acute regulatory protein (STAR). Human chorionic gonadotropin (hCG) induces de novo synthesis of STAR, a process shown to parallel maximal steroid production. In the hCG-dependent steroidogenic MA-10 mouse Leydig cell line, the 14-3-3γ protein was identified in native mitochondrial complexes by mass spectrometry and immunoblotting, and its levels increased in response to hCG treatment. The 14-3-3 proteins bind and regulate the activity of many proteins, acting via target protein activation, modification and localization. In MA-10 cells, cAMP induces 14-3-3γ expression parallel to STAR expression. Silencing of 14-3-3γ expression potentiates hormone-induced steroidogenesis. Binding motifs of 14-3-3γ were identified in components of the transduceosome, including STAR. Immunoprecipitation studies demonstrate a hormone-dependent interaction between 14-3-3γ and STAR that coincides with reduced 14-3-3γ homodimerization. The binding site of 14-3-3γ on STAR was identified to be Ser-194 in the STAR-related sterol binding lipid transfer (START) domain, the site phosphorylated in response to hCG. Taken together, these results demonstrate that 14-3-3γ negatively regulates steroidogenesis by binding to Ser-194 of STAR, thus keeping STAR in an unfolded state, unable to induce maximal steroidogenesis. Over time 14-3-3γ homodimerizes and dissociates from STAR, allowing this protein to induce maximal mitochondrial steroid formation. PMID:22427666

  19. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  20. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  1. B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

    PubMed

    Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

    2008-10-03

    The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

  2. Molecular analysis of the differential hepatic expression of rat kininogen family genes.

    PubMed Central

    Chen, H M; Liao, W S

    1993-01-01

    Serum concentration of rat T1 kininogen increases 20- to 30-fold in response to acute inflammation, an induced hepatic synthesis regulated primarily at the transcriptional level. We have demonstrated by transient transfection analyses that rat T1 kininogen gene/chloramphenicol acetyltransferase (T1K/CAT) constructs are highly responsive to interleukin-6 and dexamethasone. In these studies we examined the regulation of a highly homologous K kininogen gene promoter and showed that it is minimally induced under identical conditions. The basal expression of the KK/CAT construct was, however, five- to sevenfold higher than that of the analogous T1K/CAT construct. Promoter-swapping experiments to examine the molecular basis of this differentially regulated basal expression showed that at least two K kininogen promoter regions are important for conferring its high basal expression: a distal 19-bp region (C box) constituted a binding site for C/EBP family proteins, and a proximal 66-bp region contained two adjacent binding sites for hepatocyte nuclear factor 3 (HNF-3). While the C box in the K kininogen promoter was able to interact with C/EBP transcription factors, the T1 kininogen promoter C box could not. In addition, HNF-3 binding sites of the K kininogen promoter demonstrated stronger affinities than those of the T1 kininogen promoter. Since C/EBP and HNF-3 are highly enriched in the liver and are known to enhance transcription of liver-specific genes, these differences in their binding activities thus accounted for the K kininogen gene's higher basal expression. Our studies demonstrated that evolutionary divergence of a few critical nucleotides may lead to subtle changes in the binding affinities of a transcription factor to its recognition site, profoundly altering expression of the downstream gene. Images PMID:8413271

  3. The second Cu(II)-binding site in a proton-rich environment interferes with the aggregation of amyloid-beta(1-40) into amyloid fibrils.

    PubMed

    Jun, Sangmi; Gillespie, Joel R; Shin, Byong-kyu; Saxena, Sunil

    2009-11-17

    The overall morphology and Cu(II) ion coordination for the aggregated amyloid-beta(1-40) [Abeta(1-40)] in N-ethylmorpholine (NEM) buffer are affected by Cu(II) ion concentration. This effect is investigated by transmission electron microscopy (TEM), atomic force microscopy (AFM), and electron spin echo envelope modulation (ESEEM) spectroscopy. At lower than equimolar concentrations of Cu(II) ions, fibrillar aggregates of Abeta(1-40) are observed. At these concentrations of Cu(II), the monomeric and fibrillar Abeta(1-40) ESEEM data indicate that the Cu(II) ion is coordinated by histidine residues. For aggregated Abeta(1-40) at a Cu(II):Abeta molar ratio of 2:1, TEM and AFM images show both linear fibrils and granular amorphous aggregates. The ESEEM spectra show that the multi-histidine coordination for Cu(II) ion partially breaks up and becomes exposed to water or exchangeable protons of the peptide at a higher Cu(II) concentration. Since the continuous-wave electron spin resonance results also suggest two copper-binding sites in Abeta(1-40), the proton ESEEM peak may arise from the second copper-binding site, which may be significantly involved in the formation of granular amorphous aggregates. Thioflavin T fluorescence and circular dichroism experiments also show that Cu(II) inhibits the formation of fibrils and induces a nonfibrillar beta-sheet conformation. Therefore, we propose that Abeta(1-40) has a second copper-binding site in a proton-rich environment and the second binding Cu(II) ion interferes with a conformational transition into amyloid fibrils, inducing the formation of granular amorphous aggregates.

  4. WZB117 (2-Fluoro-6-(m-hydroxybenzoyloxy) Phenyl m-Hydroxybenzoate) Inhibits GLUT1-mediated Sugar Transport by Binding Reversibly at the Exofacial Sugar Binding Site.

    PubMed

    Ojelabi, Ogooluwa A; Lloyd, Kenneth P; Simon, Andrew H; De Zutter, Julie K; Carruthers, Anthony

    2016-12-23

    WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with K i (app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with K i (app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. WZB117 (2-Fluoro-6-(m-hydroxybenzoyloxy) Phenyl m-Hydroxybenzoate) Inhibits GLUT1-mediated Sugar Transport by Binding Reversibly at the Exofacial Sugar Binding Site*

    PubMed Central

    Ojelabi, Ogooluwa A.; Lloyd, Kenneth P.; Simon, Andrew H.; De Zutter, Julie K.; Carruthers, Anthony

    2016-01-01

    WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with Ki(app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with Ki(app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. PMID:27836974

  6. Glucostatic regulation of (+)-(/sup 3/H)amphetamine binding in the hypothalamus: correlation with Na/sup +/, K/sup +/-ATPase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Angel, I.; Hauger, R.L.; Luu, M.D.

    1985-09-01

    Preincubation of rat hypothalamic slices in glucose-free Krebs-Ringer buffer (37/sup 0/C) resulted in a time-dependent decrease in specific (+)-(/sup 3/H)amphetamine binding in the crude synaptosomal fraction prepared from these slices. The addition of D-glucose resulted in a dose- and time-dependent stimulation of (+)-(/sup 3/H)amphetamine binding, whereas incubations with L-glucose, 2-deoxy-D-glucose, or 3-O-methyl-D-glucose failed to increase the number of (+)-(/sup 3/H)amphetamine binding sites. Ouabain potently inhibited the glucose-induced stimulation of (+)-(/sup 3/H)amphetamine binding, suggesting the involvement of Na/sup +/, K/sup +/-ATPase. Preincubation of hypothalamic slices with glucose also resulted in an increase in Na/sup +/,K/sup +/-ATPase activity and the number ofmore » specific high-affinity binding sites for (/sup 3/H)ouabain, and a good correlation was observed between the glucose-stimulated increase in (+)-(/sup 3/H)amphetamine and (/sup 3/H)ouabain binding. These data suggest that the (+)-(/sup 3/H)amphetamine binding site in hypothalamus, previously linked to the anorectic actions of various phenylethylamines, is regulated both in vitro and in vivo by physiological concentrations of glucose. Glucose and amphetamine appear to interact at common sites in the hypothalamus to stimulate Na/sup +/,K/sup +/-ATPase activity, and the latter may be involved in the glucostatic regulation of appetite.« less

  7. Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

    PubMed Central

    Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

    1996-01-01

    Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

  8. Preparation of (125)I-ricin suitable as a probe for the autoradiographic localization of toxin binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doebler, J.A.; Mayer, T.W.; Traub, R.K.

    1993-05-13

    The long term objectives of this research are to identify cellular binding sites for ricin and examine its organ distribution in mice following aerosol inhalation exposure. Preliminary studies relating to the synthesis and evaluation of (125 I)-ricin as an autoradiographic probe have been conducted. Non-radioactive (I)-ricin prepared using the Iodogen method was found to be non-toxic both in vivo and in vitro. Lactose was then added to the Iodogen reaction medium to block galactose-binding site associated tyrosines in an attempt to retain toxicity. However, this did not prevent iodination-induced loss of biological potency. We then switched to the lactoperoxidase methodmore » of iodination, which yielded an (I)-ricin preparation with toxicity comparable to that of native toxin.« less

  9. Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

    PubMed Central

    Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

    2014-01-01

    Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

  10. Locked and proteolysis-based transcription activator-like effector (TALE) regulation.

    PubMed

    Lonzarić, Jan; Lebar, Tina; Majerle, Andreja; Manček-Keber, Mateja; Jerala, Roman

    2016-02-18

    Development of orthogonal, designable and adjustable transcriptional regulators is an important goal of synthetic biology. Their activity has been typically modulated through stimulus-induced oligomerization or interaction between the DNA-binding and activation/repression domain. We exploited a feature of the designable Transcription activator-like effector (TALE) DNA-binding domain that it winds around the DNA which allows to topologically prevent it from binding by intramolecular cyclization. This new approach was investigated through noncovalent ligand-induced cyclization or through a covalent split intein cyclization strategy, where the topological inhibition of DNA binding by cyclization and its restoration by a proteolytic release of the topologic constraint was expected. We show that locked TALEs indeed have diminished DNA binding and regain full transcriptional activity by stimulation with the rapamycin ligand or site-specific proteolysis of the peptide linker, with much higher level of activation than rapamycin-induced heterodimerization. Additionally, we demonstrated reversibility, activation of genomic targets and implemented logic gates based on combinations of protein cyclization, proteolytic cleavage and ligand-induced dimerization, where the strongest fold induction was achieved by the proteolytic cleavage of a repression domain from a linear TALE. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Post-Transcriptional Regulation of the Human Mu-Opioid Receptor (MOR) by Morphine-Induced RNA Binding Proteins hnRNP K and PCBP1

    PubMed Central

    Song, Kyu Young; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

    2016-01-01

    Expression of the mu-opioid receptor (MOR) protein is controlled by extensive transcriptional and post-transcriptional processing. MOR gene expression has previously been shown to be altered by a post-transcriptional mechanism involving the MOR mRNA untranslated region (UTR). Here, we demonstrate for the first time the role of heterogeneous nuclear ribonucleic acids (hnRNA)-binding protein (hnRNP) K and poly(C)-binding protein 1 (PCBP1) as post-transcriptional inducers in MOR gene regulation. In the absence of morphine, a significant level of MOR mRNA is sustained in its resting state and partitions in the translationally inactive polysomal fraction. Morphine stimulation activates the downstream targets hnRNP K and PCPB1 and induces partitioning of the MOR mRNA to the translationally active fraction. Using reporter and ligand binding assays, as well as RNA EMSA, we reveal potential RNP binding sites located in the 5′-untranslated region of human MOR mRNA. In addition, we also found that morphine-induced RNPs could regulate MOR expression. Our results establish the role of hnRNP K and PCPB1 in the translational control of morphine-induced MOR expression in human neuroblastoma (NMB) cells as well as cells stably expressing MOR (NMB1). PMID:27292014

  12. The two Na+ sites in the human serotonin transporter play distinct roles in the ion coupling and electrogenicity of transport.

    PubMed

    Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H; Henry, L Keith

    2014-01-17

    Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na(+), Cl(-), and K(+) gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na(+)-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca(2+) (but not other cations) to functionally replace Na(+) for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca(2+) and Na(+) illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca(2+) promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na(+)-binding sites.

  13. The Two Na+ Sites in the Human Serotonin Transporter Play Distinct Roles in the Ion Coupling and Electrogenicity of Transport*

    PubMed Central

    Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H.; Henry, L. Keith

    2014-01-01

    Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na+, Cl−, and K+ gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na+-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca2+ (but not other cations) to functionally replace Na+ for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca2+ and Na+ illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca2+ promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na+-binding sites. PMID:24293367

  14. [Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels].

    PubMed

    Benoit, E

    1998-01-01

    This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site 2), (ii) a decrease of cellular excitability due to an important increase in the action potential duration (site 3) and (iii) an increase in cellular excitability which results in spontaneous and repetitive firing of action potentials (sites 5 and 6). The biochemical and electrophysiological studies performed with these toxins, as well as the determination of their molecular structure, have given basic information on the function and structure of the Na channel protein. Therefore, various models representing the different states of Na channels have been proposed to account for the neurotoxin-induced modifications of Na inactivation. Moreover, the localization of receptor binding sites 2, 3, 5 et 6 for these toxins on the neuronal Na channel has been deduced and the molecular identification of the recognition site(s) for some of them has been established on the alpha sub-unit forming the Na channel protein.

  15. Alteration of methotrexate binding to human serum albumin induced by oxidative stress. Spectroscopic comparative study

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Równicka-Zubik, J.

    2016-01-01

    Changes of oxidative modified albumin conformation by comparison of non-modified (HSA) and modified (oHSA) human serum albumin absorption spectra, Red Edge Excitation Shift (REES) effect and fluorescence synchronous spectra were investigated. Studies of absorption spectra indicated that changes in the value of absorbance associated with spectral changes in the region from 200 to 250 nm involve structural alterations related to variations in peptide backbone conformation. Analysis of the REES effect allowed for the observation of changes caused by oxidation in the region of the hydrophobic pocket containing the tryptophanyl residue. Synchronous fluorescence spectroscopy confirmed changes of the position of the tryptophanyl and tyrosil residues fluorescent band. Effect of oxidative stress on binding of methotrexate (MTX) was investigated by spectrofluorescence, UV-VIS and 1HNMR spectroscopy. MTX caused the fluorescence quenching of non-modified (HSA) and modified (oHSA) human serum albumin molecule. The values of binding constants, Hill's coefficients and a number of binding sites in the protein molecule in the high affinity binding site were calculated for the binary MTX-HSA and MTX-oHSA systems. For these systems, qualitative analysis in the low affinity binding sites was performed with the use of the 1HNMR technique.

  16. NRIP enhances HPV gene expression via interaction with either GR or E2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Szu-Wei; Lu, Pei-Yu; Guo, Jih-Huong

    We previously identified a gene, nuclear receptor-interaction protein (NRIP), which functions as a transcription cofactor in glucocorticoid receptor (GR) and human papillomavirus E2 (HPV E2)-driven gene expression. Here, we comprehensively evaluated the role of NRIP in HPV-16 gene expression. NRIP acts as a transcription cofactor to enhance GR-regulated HPV-16 gene expression in the presence of hormone. NRIP also can form complex with E2 that caused NRIP-induced HPV gene expression via E2-binding sites in a hormone-independent manner. Furthermore, NRIP can associate with GR and E2 to form tri-protein complex to activate HPV gene expression via GRE, not the E2-binding site, inmore » a hormone-dependent manner. These results indicate that NRIP and GR are viral E2-binding proteins and that NRIP regulates HPV gene expression via GRE and/or E2 binding site in the HPV promoter in a hormone-dependent or independent manner, respectively.« less

  17. Parkin-phosphoubiquitin complex reveals a cryptic ubiquitin binding site required for RBR ligase activity

    PubMed Central

    Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen

    2017-01-01

    RING-BETWEENRING-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR is Parkin, mutations in which lead to early onset hereditary Parkinsonism. Parkin and other RBRs share a catalytic RBR module, but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during activation of Parkin. However, current data on active RBRs are in the absence of regulatory domains. Therefore, how individual RBRs are activated, and whether they share a common mechanism remains unclear. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces a movement in the IBR domain to reveal a cryptic ubiquitin binding site. Mutation of this site negatively impacts on Parkin’s activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, suggesting a role for interdomain association in RBR ligase mechanism. PMID:28414322

  18. Parkin-phosphoubiquitin complex reveals cryptic ubiquitin-binding site required for RBR ligase activity.

    PubMed

    Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen

    2017-05-01

    RING-between-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR ligase is Parkin, mutations in which lead to early-onset hereditary Parkinsonism. Parkin and other RBR ligases share a catalytic RBR module but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during Parkin activation. However, current data on active RBR ligases reflect the absence of regulatory domains. Therefore, it remains unclear how individual RBR ligases are activated, and whether they share a common mechanism. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces movement in the 'in-between RING' (IBR) domain to reveal a cryptic ubiquitin-binding site. Mutation of this site negatively affects Parkin's activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, which suggests a role for interdomain association in the RBR ligase mechanism.

  19. Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

    2017-09-11

    Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

  20. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  1. The PUF binding landscape in metazoan germ cells

    PubMed Central

    Prasad, Aman; Porter, Douglas F.; Kroll-Conner, Peggy L.; Mohanty, Ipsita; Ryan, Anne R.; Crittenden, Sarah L.; Wickens, Marvin; Kimble, Judith

    2016-01-01

    PUF (Pumilio/FBF) proteins are RNA-binding proteins and conserved stem cell regulators. The Caenorhabditis elegans PUF proteins FBF-1 and FBF-2 (collectively FBF) regulate mRNAs in germ cells. Without FBF, adult germlines lose all stem cells. A major gap in our understanding of PUF proteins, including FBF, is a global view of their binding sites in their native context (i.e., their “binding landscape”). To understand the interactions underlying FBF function, we used iCLIP (individual-nucleotide resolution UV crosslinking and immunoprecipitation) to determine binding landscapes of C. elegans FBF-1 and FBF-2 in the germline tissue of intact animals. Multiple iCLIP peak-calling methods were compared to maximize identification of both established FBF binding sites and positive control target mRNAs in our iCLIP data. We discovered that FBF-1 and FBF-2 bind to RNAs through canonical as well as alternate motifs. We also analyzed crosslinking-induced mutations to map binding sites precisely and to identify key nucleotides that may be critical for FBF–RNA interactions. FBF-1 and FBF-2 can bind sites in the 5′UTR, coding region, or 3′UTR, but have a strong bias for the 3′ end of transcripts. FBF-1 and FBF-2 have strongly overlapping target profiles, including mRNAs and noncoding RNAs. From a statistically robust list of 1404 common FBF targets, 847 were previously unknown, 154 were related to cell cycle regulation, three were lincRNAs, and 335 were shared with the human PUF protein PUM2. PMID:27165521

  2. The Transcription Factor AlsR Binds and Regulates the Promoter of the alsSD Operon Responsible for Acetoin Formation in Bacillus subtilis

    PubMed Central

    Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter

    2012-01-01

    Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965

  3. Improved neovascularization and wound repair by targeting human basic fibroblast growth factor (bFGF) to fibrin.

    PubMed

    Zhao, Wenxue; Han, Qianqian; Lin, Hang; Gao, Yuan; Sun, Wenjie; Zhao, Yannan; Wang, Bin; Chen, Bing; Xiao, Zhifeng; Dai, Jianwu

    2008-10-01

    Targeted therapy is a new generation of therapeutics, where two critical factors are involved. One is the particular molecular target, and the other is the specific target-binding drug. In this work, the fibrin, a main component of plasma clot at wound sites, was used as the target for human bFGF, aiming to improve therapeutic neovascularization and wound repair. To endow bFGF with fibrin-targeting ability, a fibrin-binding peptide Kringle1 (K1), derived from human plasminogen, was fused to human bFGF. The recombinant K1bFGF showed high fibrin and plasma-clot-binding ability. When applied to the wound sites with plasma clots, K1bFGF induced robust neovascularization and improved wound healing. To extend the application of K1bFGF to other cases where no plasma clots exist, we developed a fibrin-scaffold/K1bFGF system. This system could induce localized neovascularization by delivery of K1bFGF in a sustained and site-targeting manner, and provide a microenvironment promoting cell growth and tissue regeneration. In summary, we successfully used the pathologic environment fibrin clot as the target for bFGF, and based on which bFGF was designed into a targeting agent by introduction of a fibrin-binding peptide. This provides a potential approach to improve therapeutic neovascularization and wound repair.

  4. Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

    PubMed

    Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

    2016-06-28

    Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

  5. Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

    PubMed

    Pessler, F; Pendergrast, P S; Hernandez, N

    1997-07-01

    The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes.

  6. A gratuitous β-Lactamase inducer uncovers hidden active site dynamics of the Staphylococcus aureus BlaR1 sensor domain.

    PubMed

    Frederick, Thomas E; Peng, Jeffrey W

    2018-01-01

    Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.

  7. Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.

    PubMed

    Elinder, Fredrik; Liin, Sara I

    2017-01-01

    Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.

  8. Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels

    PubMed Central

    Elinder, Fredrik; Liin, Sara I.

    2017-01-01

    Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076

  9. Escitalopram, an antidepressant with an allosteric effect at the serotonin transporter--a review of current understanding of its mechanism of action.

    PubMed

    Zhong, Huailing; Haddjeri, Nasser; Sánchez, Connie

    2012-01-01

    Escitalopram is a widely used antidepressant for the treatment of patients with major depression. It is the pure S-enantiomer of racemic citalopram. Several clinical trials and meta-analyses indicate that escitalopram is quantitatively more efficacious than many other antidepressants with a faster onset of action. This paper reviews current knowledge about the mechanism of action of escitalopram. The primary target for escitalopram is the serotonin transporter (SERT), which is responsible for serotonin (or 5-hydroxytryptamine [5-HT]) reuptake at the terminals and cell bodies of serotonergic neurons. Escitalopram and selective serotonin reuptake inhibitors bind with high affinity to the 5-HT binding site (orthosteric site) on the transporter. This leads to antidepressant effects by increasing extracellular 5-HT levels which enhance 5-HT neurotransmission. SERT also has one or more allosteric sites, binding to which modulates activity at the orthosteric binding site but does not directly affect 5-HT reuptake by the transporter. In vitro studies have shown that through allosteric binding, escitalopram decreases its own dissociation rate from the orthosteric site on the SERT. R-citalopram, the nontherapeutic enantiomer in citalopram, is also an allosteric modulator of SERT but can inhibit the actions of escitalopram by interfering negatively with its binding. Both nonclinical studies and some clinical investigations have demonstrated the cellular, neurochemical, neuroadaptive, and neuroplastic changes induced by escitalopram with acute and chronic administration. The findings from binding, neurochemical, and neurophysiological studies may provide a mechanistic rationale for the clinical difference observed with escitalopram compared to other antidepressant therapies.

  10. The heat shock protein 90 antagonist novobiocin interacts with a previously unrecognized ATP-binding domain in the carboxyl terminus of the chaperone.

    PubMed

    Marcu, M G; Chadli, A; Bouhouche, I; Catelli, M; Neckers, L M

    2000-11-24

    Heat shock protein 90 (Hsp90), one of the most abundant chaperones in eukaryotes, participates in folding and stabilization of signal-transducing molecules including steroid hormone receptors and protein kinases. The amino terminus of Hsp90 contains a non-conventional nucleotide-binding site, related to the ATP-binding motif of bacterial DNA gyrase. The anti-tumor agents geldanamycin and radicicol bind specifically at this site and induce destabilization of Hsp90-dependent client proteins. We recently demonstrated that the gyrase inhibitor novobiocin also interacts with Hsp90, altering the affinity of the chaperone for geldanamycin and radicicol and causing in vitro and in vivo depletion of key regulatory Hsp90-dependent kinases including v-Src, Raf-1, and p185(ErbB2). In the present study we used deletion/mutation analysis to identify the site of interaction of novobiocin with Hsp90, and we demonstrate that the novobiocin-binding site resides in the carboxyl terminus of the chaperone. Surprisingly, this motif also recognizes ATP, and ATP and novobiocin efficiently compete with each other for binding to this region of Hsp90. Novobiocin interferes with association of the co-chaperones Hsc70 and p23 with Hsp90. These results identify a second site on Hsp90 where the binding of small molecule inhibitors can significantly impact the function of this chaperone, and they support the hypothesis that both amino- and carboxyl-terminal domains of Hsp90 interact to modulate chaperone activity.

  11. A PARP1-ERK2 synergism is required for the induction of LTP

    PubMed Central

    Visochek, L.; Grigoryan, G.; Kalal, A.; Milshtein-Parush, H.; Gazit, N.; Slutsky, I.; Yeheskel, A.; Shainberg, A.; Castiel, A.; Seger, R.; Langelier, M. F.; Dantzer, F.; Pascal, J. M.; Segal, M.; Cohen-Armon, M.

    2016-01-01

    Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence. PMID:27121568

  12. A PARP1-ERK2 synergism is required for the induction of LTP.

    PubMed

    Visochek, L; Grigoryan, G; Kalal, A; Milshtein-Parush, H; Gazit, N; Slutsky, I; Yeheskel, A; Shainberg, A; Castiel, A; Seger, R; Langelier, M F; Dantzer, F; Pascal, J M; Segal, M; Cohen-Armon, M

    2016-04-28

    Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence.

  13. Binding of sulphonated indigo derivatives to RepA-WH1 inhibits DNA-induced protein amyloidogenesis

    PubMed Central

    Gasset-Rosa, Fátima; Maté, María Jesús; Dávila-Fajardo, Cristina; Bravo, Jerónimo; Giraldo, Rafael

    2008-01-01

    The quest for inducers and inhibitors of protein amyloidogenesis is of utmost interest, since they are key tools to understand the molecular bases of proteinopathies such as Alzheimer, Parkinson, Huntington and Creutzfeldt–Jakob diseases. It is also expected that such molecules could lead to valid therapeutic agents. In common with the mammalian prion protein (PrP), the N-terminal Winged-Helix (WH1) domain of the pPS10 plasmid replication protein (RepA) assembles in vitro into a variety of amyloid nanostructures upon binding to different specific dsDNA sequences. Here we show that di- (S2) and tetra-sulphonated (S4) derivatives of indigo stain dock at the DNA recognition interface in the RepA-WH1 dimer. They compete binding of RepA to its natural target dsDNA repeats, found at the repA operator and at the origin of replication of the plasmid. Calorimetry points to the existence of a major site, with micromolar affinity, for S4-indigo in RepA-WH1 dimers. As revealed by electron microscopy, in the presence of inducer dsDNA, both S2/S4 stains inhibit the assembly of RepA-WH1 into fibres. These results validate the concept that DNA can promote protein assembly into amyloids and reveal that the binding sites of effector molecules can be targeted to inhibit amyloidogenesis. PMID:18285361

  14. Integrity of N- and C-termini is important for E. coli Hsp31 chaperone activity

    PubMed Central

    Sastry, M S R; Zhou, Weibin; Baneyx, François

    2009-01-01

    Hsp31 is a stress-inducible molecular chaperone involved in the management of protein misfolding at high temperatures and in the development of acid resistance in starved E. coli. Each subunit of the Hsp31 homodimer consists of two structural domains connected by a flexible linker that sits atop a continuous tract of nonpolar residues adjacent to a hydrophobic bowl defined by the dimerization interface. Previously, we proposed that while the bowl serves as a binding site for partially folded species at physiological temperatures, chaperone function under heat shock conditions requires that folding intermediates further anneal to high-affinity binding sites that become uncovered upon thermally induced motion of the linker. In support of a mechanism requiring that client proteins first bind to the bowl, we show here that fusion of a 20-residue-long hexahistidine tag to the N-termini of Hsp31 abolishes chaperone activity at all temperatures by inducing reversible structural changes that interfere with substrate binding. We further demonstrate that extending the C-termini of Hsp31 with short His tags selectively suppresses chaperone function at high temperatures by interfering with linker movement. The structural and functional sensitivity of Hsp31 to lengthening is consistent with the high degree of conservation of class I Hsp31 orthologs and will serve as a cautionary tale on the implications of affinity tagging. PMID:19517531

  15. Snake Cytotoxins Bind to Membranes via Interactions with Phosphatidylserine Head Groups of Lipids

    PubMed Central

    Konshina, Anastasia G.; Boldyrev, Ivan A.; Utkin, Yuri N.; Omel'kov, Anton V.; Efremov, Roman G.

    2011-01-01

    The major representatives of Elapidae snake venom, cytotoxins (CTs), share similar three-fingered fold and exert diverse range of biological activities against various cell types. CT-induced cell death starts from the membrane recognition process, whose molecular details remain unclear. It is known, however, that the presence of anionic lipids in cell membranes is one of the important factors determining CT-membrane binding. In this work, we therefore investigated specific interactions between one of the most abundant of such lipids, phosphatidylserine (PS), and CT 4 of Naja kaouthia using a combined, experimental and modeling, approach. It was shown that incorporation of PS into zwitterionic liposomes greatly increased the membrane-damaging activity of CT 4 measured by the release of the liposome-entrapped calcein fluorescent dye. The CT-induced leakage rate depends on the PS concentration with a maximum at approximately 20% PS. Interestingly, the effects observed for PS were much more pronounced than those measured for another anionic lipid, sulfatide. To delineate the potential PS binding sites on CT 4 and estimate their relative affinities, a series of computer simulations was performed for the systems containing the head group of PS and different spatial models of CT 4 in aqueous solution and in an implicit membrane. This was done using an original hybrid computational protocol implementing docking, Monte Carlo and molecular dynamics simulations. As a result, at least three putative PS-binding sites with different affinities to PS molecule were delineated. Being located in different parts of the CT molecule, these anion-binding sites can potentially facilitate and modulate the multi-step process of the toxin insertion into lipid bilayers. This feature together with the diverse binding affinities of the sites to a wide variety of anionic targets on the membrane surface appears to be functionally meaningful and may adjust CT action against different types of cells. PMID:21559494

  16. Substrate-induced fit of the ATP binding site of cytidine monophosphate kinase from Escherichia coli: time-resolved fluorescence of 3'-anthraniloyl-2'-deoxy-ADP and molecular modeling.

    PubMed

    Li de La Sierra, I M; Gallay, J; Vincent, M; Bertrand, T; Briozzo, P; Bârzu, O; Gilles, A M

    2000-12-26

    The conformation and dynamics of the ATP binding site of cytidine monophosphate kinase from Escherichia coli (CMPK(coli)), which catalyzes specifically the phosphate exchange between ATP and CMP, was studied using the fluorescence properties of 3'-anthraniloyl-2'-deoxy-ADP, a specific ligand of the enzyme. The spectroscopic properties of the bound fluorescent nucleotide change strongly with respect to those in aqueous solution. These changes (red shift of the absorption and excitation spectra, large increase of the excited state lifetime) are compared to those observed in different solvents. These data, as well as acrylamide quenching experiments, suggest that the anthraniloyl moiety is protected from the aqueous solvent upon binding to the ATP binding site, irrespective of the presence of CMP or CDP. The protein-bound ADP analogue exhibits a restricted fast subnanosecond rotational motion, completely blocked by CMP binding. The energy-minimized models of CMPK(coli) complexed with 3'-anthraniloyl-2'-deoxy-ADP using the crystal structures of the ligand-free protein and of its complex with CDP (PDB codes and, respectively) were compared to the crystal structure of UMP/CMP kinase from Dictyostelium discoideum complexed with substrates (PDB code ). The key residues for ATP/ADP binding to CMPK(coli) were identified as R157 and I209, their side chains sandwiching the adenine ring. Moreover, the residues involved in the fixation of the phosphate groups are conserved in both proteins. In the model, the accessibility of the fluorescent ring to the solvent should be substantial if the LID conformation remained unchanged, by contrast to the fluorescence data. These results provide the first experimental arguments about an ATP-mediated induced-fit of the LID in CMPK(coli) modulated by CMP, leading to a closed conformation of the active site, protected from water.

  17. Prediction of consensus binding mode geometries for related chemical series of positive allosteric modulators of adenosine and muscarinic acetylcholine receptors.

    PubMed

    Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S

    2017-06-05

    Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  18. Zinc can increase the activity of protein kinase C and contributes to its binding to plasma membranes in T lymphocytes.

    PubMed

    Csermely, P; Szamel, M; Resch, K; Somogyi, J

    1988-05-15

    In the primary structure of protein kinase C, the presence of a putative metal-binding site has been suggested (Parker, P.J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen, E., Stabel, S., Waterfield, M.D., and Ullrich, A. (1986) Science 233, 853-859). In the present report, we demonstrate that the most abundant intracellular heavy metal, zinc, can increase the activity of cytosolic protein kinase C. Zinc reversibly binds the enzyme to plasma membranes, and it may contribute to the calcium-induced binding as well. The intracellular heavy metal chelator N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine prevents the phorbol ester- and antigen-induced translocation of protein kinase C. This effect can be totally reversed by the concomitant addition of Zn2+, while Fe2+ and Mn2+ are only partially counteractive. Our results suggest that zinc can activate protein kinase C and contributes to its binding to plasma membranes in T lymphocytes induced by Ca2+, phorbol ester, or antigen.

  19. Sulfated Metabolites of Polychlorinated Biphenyls Are High-Affinity Ligands for the Thyroid Hormone Transport Protein Transthyretin

    PubMed Central

    Grimm, Fabian A.; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W.

    2013-01-01

    Background: The displacement of l-thyroxine (T4) from binding sites on transthyretin (TTR) is considered a significant contributing mechanism in polychlorinated biphenyl (PCB)-induced thyroid disruption. Previous research has discovered hydroxylated PCB metabolites (OH-PCBs) as high-affinity ligands for TTR, but the binding potential of conjugated PCB metabolites such as PCB sulfates has not been explored. Objectives: We evaluated the binding of five lower-chlorinated PCB sulfates to human TTR and compared their binding characteristics to those determined for their OH-PCB precursors and for T4. Methods: We used fluorescence probe displacement studies and molecular docking simulations to characterize the binding of PCB sulfates to TTR. The stability of PCB sulfates and the reversibility of these interactions were characterized by HPLC analysis of PCB sulfates after their binding to TTR. The ability of OH-PCBs to serve as substrates for human cytosolic sulfotransferase 1A1 (hSULT1A1) was assessed by OH-PCB–dependent formation of adenosine-3´,5´-diphosphate, an end product of the sulfation reaction. Results: All five PCB sulfates were able to bind to the high-affinity binding site of TTR with equilibrium dissociation constants (Kd values) in the low nanomolar range (4.8–16.8 nM), similar to that observed for T4 (4.7 nM). Docking simulations provided corroborating evidence for these binding interactions and indicated multiple high-affinity modes of binding. All OH-PCB precursors for these sulfates were found to be substrates for hSULT1A1. Conclusions: Our findings show that PCB sulfates are high-affinity ligands for human TTR and therefore indicate, for the first time, a potential relevance for these metabolites in PCB-induced thyroid disruption. PMID:23584369

  20. Mefloquine inhibits voltage dependent Nav1.4 channel by overlapping the local anaesthetic binding site.

    PubMed

    Paiz-Candia, Bertin; Islas, Angel A; Sánchez-Solano, Alfredo; Mancilla-Simbro, Claudia; Scior, Thomas; Millan-PerezPeña, Lourdes; Salinas-Stefanon, Eduardo M

    2017-02-05

    Mefloquine constitutes a multitarget antimalaric that inhibits cation currents. However, the effect and the binding site of this compound on Na + channels is unknown. To address the mechanism of action of mefloquine, we employed two-electrode voltage clamp recordings on Xenopus laevis oocytes, site-directed mutagenesis of the rat Na + channel, and a combined in silico approach using Molecular Dynamics and docking protocols. We found that mefloquine: i) inhibited Na v 1.4 currents (IC 50 =60μM), ii) significantly delayed fast inactivation but did not affect recovery from inactivation, iii) markedly the shifted steady-state inactivation curve to more hyperpolarized potentials. The presence of the β1 subunit significantly reduced mefloquine potency, but the drug induced a significant frequency-independent rundown upon repetitive depolarisations. Computational and experimental results indicate that mefloquine overlaps the local anaesthetic binding site by docking at a hydrophobic cavity between domains DIII and DIV that communicates the local anaesthetic binding site with the selectivity filter. This is supported by the fact that mefloquine potency significantly decreased on mutant Na v 1.4 channel F1579A and significantly increased on K1237S channels. In silico this compound docked above F1579 forming stable π-π interactions with this residue. We provide structure-activity insights into how cationic amphiphilic compounds may exert inhibitory effects by docking between the local anaesthetic binding site and the selectivity filter of a mammalian Na + channel. Our proposed synergistic cycle of experimental and computational studies may be useful for elucidating binding sites of other drugs, thereby saving in vitro and in silico resources. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

    PubMed Central

    Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-01-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

  2. Activity-Based Probes for Isoenzyme- and Site-Specific Functional Characterization of Glutathione S -Transferases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoddard, Ethan G.; Killinger, Bryan J.; Nair, Reji N.

    Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “Hmore » site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.« less

  3. Forskolin- and dihydroalprenolol (DHA) binding sites and adenylate cyclase activity in heart of rats fed diets containing different oils

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, S.Q.; Ren, Y.F.; Alam, B.S.

    1987-05-01

    The purpose of the present investigation was to determine if dietary lipids can induce changes in the adenylate cyclase system in rat heart. Three groups of male young Sprague-Dawley rats were fed for 6 weeks diets containing 10% corn oil (I), 8% coconut oil + 2% corn oil (II) or 10% menhaden oil (III). Adenylate cyclase activity (basal, fluoride-, isoproterenol-, and forskolin-stimulated) was higher in heart homogenates of rats in group III than in the other two groups. Concentration of the (/sup 3/H)-forskolin binding sites in the cardiac membranes were significantly higher in rats fed menhaden oil. The values (pmol/mgmore » protein) were 4.8 +/- 0.2 (I), 4.5 +/- 0.7 (II) and 8.4 +/- 0.5 (III). There was no significant difference in the affinity of the forskolin binding sites among the 3 dietary groups. When measured at different concentrations of forskolin, the adenylate cyclase activity in cardiac membranes of rats fed menhaden oil was higher than in the other 2 groups. Concentrations of the (/sup 3/H)DHA binding sites were slightly higher but their affinity was lower in cardiac membranes of rats fed menhaden oil. The results suggest that diets containing fish oil increase the concentration of the forskolin binding sites and may also affect the characteristics of the ..beta..-adrenergic receptor in rat heart.« less

  4. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

    PubMed Central

    Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

    1995-01-01

    Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

  5. Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

    NASA Astrophysics Data System (ADS)

    Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

    2016-04-01

    The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

  6. Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

    PubMed Central

    Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

    2016-01-01

    2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

  7. Structural and Biochemical Studies on ATP Binding and Hydrolysis by the Escherichia coli RNA Chaperone Hfq

    PubMed Central

    Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)15 and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq65) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions. PMID:23226421

  8. Effect of Scoparia dulcis extract on insulin receptors in streptozotocin induced diabetic rats: studies on insulin binding to erythrocytes.

    PubMed

    Pari, Leelavinothan; Latha, Muniappan; Rao, Chippada Appa

    2004-01-01

    We investigated the insulin-receptor-binding effect of Scoparia dulcis plant extract in streptozotocin (STZ)-induced male Wistar rats, using circulating erythrocytes (ER) as a model system. An aqueous extract of S dulcis plant (SPEt) (200 mg/kg body weight) was administered orally. We measured blood levels of glucose and plasma insulin and the binding of insulin to cell-membrane ER receptors. Glibenclamide was used as standard reference drug. The mean specific binding of insulin to ER was significantly lower in diabetic control rats (DC) (55.0 +/- 2.8%) than in SPEt-treated (70.0 +/- 3.5%)- and glibenclamide-treated (65.0 +/- 3.3%) diabetic rats, resulting in a significant decrease in plasma insulin. Scatchard plot analysis demonstrated that the decrease in insulin binding was accounted for by a lower number of insulin receptor sites per cell in DC rats when compared with SPEt- and glibenclamide-treated rats. High-affinity (Kd1), low-affinity (Kd2), and kinetic analysis revealed an increase in the average receptor affinity in ER from SPEt and glibenclamide treated diabetic rats having 2.5 +/- 0.15 x 10(10) M(-1) (Kd1); 17.0 +/- 1.0 x 10(-8) M(-1) (Kd2), and 2.0 +/- 0.1 x 10(-10) M(-1) (Kd1); 12.3 +/- 0.9 x 10(-8) M(-1) (Kd2) compared with 1.0 +/- 0.08 x 10(-10) M(-1) (Kd1); 2.7 +/- 0.25 x 10(-8) M(-1) (Kd2) in DC rats. The results suggest an acute alteration in the number of insulin receptors on ER membranes in STZ-induced diabetic rats. Treatment with SPEt and glibenclamide significantly improved specific insulin binding, with receptor number and affinity binding (p < 0.001) reaching almost normal non-diabetic levels. The data presented here show that SPEt and glibenclamide increase total ER membrane insulin binding sites with a concomitant significant increase in plasma insulin.

  9. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    PubMed Central

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  10. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  11. Computational Tools for Allosteric Drug Discovery: Site Identification and Focus Library Design.

    PubMed

    Huang, Wenkang; Nussinov, Ruth; Zhang, Jian

    2017-01-01

    Allostery is an intrinsic phenomenon of biological macromolecules involving regulation and/or signal transduction induced by a ligand binding to an allosteric site distinct from a molecule's active site. Allosteric drugs are currently receiving increased attention in drug discovery because drugs that target allosteric sites can provide important advantages over the corresponding orthosteric drugs including specific subtype selectivity within receptor families. Consequently, targeting allosteric sites, instead of orthosteric sites, can reduce drug-related side effects and toxicity. On the down side, allosteric drug discovery can be more challenging than traditional orthosteric drug discovery due to difficulties associated with determining the locations of allosteric sites and designing drugs based on these sites and the need for the allosteric effects to propagate through the structure, reach the ligand binding site and elicit a conformational change. In this study, we present computational tools ranging from the identification of potential allosteric sites to the design of "allosteric-like" modulator libraries. These tools may be particularly useful for allosteric drug discovery.

  12. Prefusion F-specific antibodies determine the magnitude of RSV neutralizing activity in human sera.

    PubMed

    Ngwuta, Joan O; Chen, Man; Modjarrad, Kayvon; Joyce, M Gordon; Kanekiyo, Masaru; Kumar, Azad; Yassine, Hadi M; Moin, Syed M; Killikelly, April M; Chuang, Gwo-Yu; Druz, Aliaksandr; Georgiev, Ivelin S; Rundlet, Emily J; Sastry, Mallika; Stewart-Jones, Guillaume B E; Yang, Yongping; Zhang, Baoshan; Nason, Martha C; Capella, Cristina; Peeples, Mark E; Ledgerwood, Julie E; McLellan, Jason S; Kwong, Peter D; Graham, Barney S

    2015-10-14

    Respiratory syncytial virus (RSV) is estimated to claim more lives among infants <1 year old than any other single pathogen, except malaria, and poses a substantial global health burden. Viral entry is mediated by a type I fusion glycoprotein (F) that transitions from a metastable prefusion (pre-F) to a stable postfusion (post-F) trimer. A highly neutralization-sensitive epitope, antigenic site Ø, is found only on pre-F. We determined what fraction of neutralizing (NT) activity in human sera is dependent on antibodies specific for antigenic site Ø or other antigenic sites on F in healthy subjects from ages 7 to 93 years. Adsorption of individual sera with stabilized pre-F protein removed >90% of NT activity and depleted binding antibodies to both F conformations. In contrast, adsorption with post-F removed ~30% of NT activity, and binding antibodies to pre-F were retained. These findings were consistent across all age groups. Protein competition neutralization assays with pre-F mutants in which sites Ø or II were altered to knock out binding of antibodies to the corresponding sites showed that these sites accounted for ~35 and <10% of NT activity, respectively. Binding competition assays with monoclonal antibodies (mAbs) indicated that the amount of site Ø-specific antibodies correlated with NT activity, whereas the magnitude of binding competed by site II mAbs did not correlate with neutralization. Our results indicate that RSV NT activity in human sera is primarily derived from pre-F-specific antibodies, and therefore, inducing or boosting NT activity by vaccination will be facilitated by using pre-F antigens that preserve site Ø. Copyright © 2015, American Association for the Advancement of Science.

  13. Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.

    PubMed

    Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui

    2018-04-01

    Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.

  14. Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.

    PubMed

    Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A

    2016-04-20

    As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Cooperative Dynamics of AR and ER Activity in Breast Cancer

    PubMed Central

    D’Amato, Nicholas C.; Gordon, Michael A.; Babbs, Beatrice L.; Spoelstra, Nicole S.; Carson Butterfield, Kiel T.; Torkko, Kathleen C.; Phan, Vernon T.; Barton, Valerie N.; Rogers, Thomas J.; Sartorius, Carol A; Elias, Anthony D.; Gertz, Jason; Jacobsen, Britta M.; Richer, Jennifer K.

    2016-01-01

    Androgen receptor (AR) is expressed in 90% of estrogen receptor alpha positive (ER+) breast tumors, but its role in tumor growth and progression remains controversial. Use of two anti-androgens that inhibit AR nuclear localization, enzalutamide and MJC13, revealed that AR is required for maximum ER genomic binding. Here, a novel global examination of AR chromatin binding found that estradiol induced AR binding at unique sites compared to dihydrotestosterone (DHT). Estradiol-induced AR binding sites were enriched for estrogen response elements and had significant overlap with ER binding sites. Furthermore, AR inhibition reduced baseline and estradiol-mediated proliferation in multiple ER+/AR+ breast cancer cell lines, and synergized with tamoxifen and fulvestrant. In vivo, enzalutamide significantly reduced viability of tamoxifen-resistant MCF7 xenograft tumors and an ER+/AR+ patient-derived model. Enzalutamide also reduced metastatic burden following cardiac injection. Lastly, in a comparison of ER+/AR+ primary tumors versus patient-matched local recurrences or distant metastases, AR expression was often maintained even when ER was reduced or absent. These data provide pre-clinical evidence that anti-androgens that inhibit AR nuclear localization affect both AR and ER, and are effective in combination with current breast cancer therapies. In addition, single agent efficacy may be possible in tumors resistant to traditional endocrine therapy, since clinical specimens of recurrent disease demonstrate AR expression in tumors with absent or refractory ER. Implications This study suggests that AR plays a previously-unrecognized role in supporting E2-mediated ER activity in ER+/AR+ breast cancer cells, and that enzalutamide may be an effective therapeutic in ER+/AR+ breast cancers. PMID:27565181

  16. Upregulation of RhoB via c-Jun N-terminal kinase signaling induces apoptosis of the human gastric carcinoma NUGC-3 cells treated with NSC12618.

    PubMed

    Kim, Bo-Kyung; Kim, Hwan Mook; Chung, Kyung-Sook; Kim, Dong-Myung; Park, Song-Kyu; Song, Alexander; Won, Kyoung-Jae; Lee, Kiho; Oh, Yu-Kyoung; Lee, Kyeong; Song, Kyung-Bin; Simon, Julian A; Han, Gyoonhee; Won, Misun

    2011-03-01

    RhoB expression is reduced in most invasive tumors, with loss of RhoB expression correlating significantly with tumor stage. Here, we demonstrate that upregulation of RhoB by the potent anticancer agent NSC126188 induces apoptosis of NUGC-3 human gastric carcinoma cells. The crucial role of RhoB in NSC126188-induced apoptosis is indicated by the rescue of NUGC-3 cells from apoptosis by knockdown of RhoB. In the presence of NSC126188, c-Jun N-terminal kinase (JNK) signaling was activated, and the JNK inhibitor SP600125 reduced RhoB expression and suppressed the apoptosis of NUGC-3 cells. Knockdowns of mitogen-activated protein kinase kinase (MKK) 4/7, JNK1/2 and c-Jun downregulated RhoB expression and rescued cells from apoptotic death in the presence of NSC126188. The JNK inhibitor SP600125 suppressed transcriptional activation of RhoB in the presence of NSC126188, as indicated by a reporter assay that used luciferase under the RhoB promoter. The ability of NSC126188 to increase luciferase activity through both the p300-binding site and the inverted CCAAT sequence (iCCAAT box) suggests that JNK signaling to upregulate RhoB expression is mediated through both the p300-binding site and the iCCAAT box. However, the JNK inhibitor SP600125 did not inhibit the upregulation of RhoB by farnesyltransferase inhibitor (FTI)-277. The p300-binding site did not affect activation of the RhoB promoter by FTI-277 in NUGC-3 cells, suggesting that the transcriptional activation of RhoB by NSC126188 occurs by a different mechanism than that reported for FTIs. Our data indicate that NSC126188 increases RhoB expression via JNK-mediated signaling through a p300-binding site and iCCAAT box resulting in apoptosis of NUGC-3 cells.

  17. Toxic shock syndrome toxin 1 binds to major histocompatibility complex class II molecules.

    PubMed Central

    Scholl, P; Diez, A; Mourad, W; Parsonnet, J; Geha, R S; Chatila, T

    1989-01-01

    Toxic shock syndrome toxin 1 (TSST-1) is a 22-kDa exotoxin produced by strains of Staphylococcus aureus and implicated in the pathogenesis of toxic shock syndrome. In common with other staphylococcal exotoxins, TSST-1 has diverse immunological effects. These include the induction of interleukin 2 receptor expression, interleukin 2 synthesis, proliferation of human T lymphocytes, and stimulation of interleukin 1 synthesis by human monocytes. In the present study, we demonstrate that TSST-1 binds with saturation kinetics and with a dissociation constant of 17-43 nM to a single class of binding sites on human mononuclear cells. There was a strong correlation between the number of TSST-1 binding sites and the expression of major histocompatibility complex class II molecules, and interferon-gamma induced the expression of class II molecules as well as TSST-1 binding sites on human skin-derived fibroblasts. Monoclonal antibodies to HLA-DR, but not to HLA-DP or HLA-DQ, strongly inhibited TSST-1 binding. Affinity chromatography of 125I-labeled cell membranes over TSST-1-agarose resulted in the recovery of two bands of 35 kDa and 31 kDa that comigrated, respectively, with the alpha and beta chains of HLA-DR and that could be immunoprecipitated with anti-HLA-DR monoclonal antibodies. Binding of TSST-1 was demonstrated to HLA-DR and HLA-DQ L-cell transfectants. These results indicate that major histocompatibility complex class II molecules represent the major binding site for TSST-1 on human cells. Images PMID:2542966

  18. Binding of the Zn2+ ion to ferric uptake regulation protein from E. coli and the competition with Fe2+ binding: a molecular modeling study of the effect on DNA binding and conformational changes of Fur

    NASA Astrophysics Data System (ADS)

    Jabour, Salih; Hamed, Mazen Y.

    2009-04-01

    The three dimensional structure of Ferric uptake regulation protein dimer from E. coli, determined by molecular modeling, was docked on a DNA fragment (iron box) and Zn2+ ions were added in two steps. The first step involved the binding of one Zn2+ ion to what is known as the zinc site which consists of the residues Cys 92, Cys 95, Asp 137, Asp141, Arg139, Glu 140, His 145 and His 143 with an average metal-Nitrogen distance of 2.5 Å and metal-oxygen distance of 3.1-3.2 Å. The second Zn2+ ion is bound to the iron activating site formed from the residues Ile 50, His 71, Asn 72, Gly 97, Asp 105 and Ala 109. The binding of the second Zn2+ ion strengthened the binding of the first ion as indicated by the shortening of the zinc-residue distances. Fe2+, when added to the complex consisting of 2Zn2+/Fur dimer/DNA, replaced the Zn2+ ion in the zinc site and when a second Fe2+ was added, it replaced the second zinc ion in the iron activating site. The binding of both zinc and iron ions induced a similar change in Fur conformations, but shifted residues closer to DNA in a different manner. This is discussed along with a possible role for the Zn2+ ion in the Fur dimer binding of DNA in its repressor activity.

  19. Human α1β3γ2L gamma-aminobutyric acid type A receptors: High-level production and purification in a functional state.

    PubMed

    Dostalova, Zuzana; Zhou, Xiaojuan; Liu, Aiping; Zhang, Xi; Zhang, Yinghui; Desai, Rooma; Forman, Stuart A; Miller, Keith W

    2014-02-01

    Gamma-aminobutyric acid type A receptors (GABA(A)Rs) are the most important inhibitory chloride ion channels in the central nervous system and are major targets for a wide variety of drugs. The subunit compositions of GABA(A)Rs determine their function and pharmacological profile. GABAA Rs are heteropentamers of subunits, and (α1)2 (β3)2 (γ2L)1 is a common subtype. Biochemical and biophysical studies of GABA(A)Rs require larger quantities of receptors of defined subunit composition than are currently available. We previously reported high-level production of active human α1β3 GABA(A)R using tetracycline-inducible stable HEK293 cells. Here we extend the strategy to receptors containing three different subunits. We constructed a stable tetracycline-inducible HEK293-TetR cell line expressing human (N)-FLAG-α1β3γ2L-(C)-(GGS)3 GK-1D4 GABA(A)R. These cells achieved expression levels of 70-90 pmol [(3)H]muscimol binding sites/15-cm plate at a specific activity of 15-30 pmol/mg of membrane protein. Incorporation of the γ2 subunit was confirmed by the ratio of [(3)H]flunitrazepam to [(3)H]muscimol binding sites and sensitivity of GABA-induced currents to benzodiazepines and zinc. The α1β3γ2L GABA(A)Rs were solubilized in dodecyl-D-maltoside, purified by anti-FLAG affinity chromatography and reconstituted in CHAPS/asolectin at an overall yield of ∼ 30%. Typical purifications yielded 1.0-1.5 nmoles of [(3)H]muscimol binding sites/60 plates. Receptors with similar properties could be purified by 1D4 affinity chromatography with lower overall yield. The composition of the purified, reconstituted receptors was confirmed by ligand binding, Western blot, and proteomics. Allosteric interactions between etomidate and [(3)H]muscimol binding were maintained in the purified state. © 2013 The Protein Society.

  20. The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji

    2014-01-17

    Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains amore » highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.« less

  1. Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria

    2016-08-15

    Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP 2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL -) with a distinct second site is required for high PIP 2sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP 2sensitivity, even in the absence of PL -. Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP 2(2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domainmore » (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL -binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP 2site and explaining the positive allostery between PL -binding and PIP 2sensitivity.« less

  2. Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids.

    PubMed

    Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria; Heyman, Sarah; Stary-Weinzinger, Anna; Yuan, Peng; Nichols, Colin G

    2016-09-01

    Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL(-)) with a distinct second site is required for high PIP2 sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP2 sensitivity, even in the absence of PL(-) Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP2 (2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domain (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL(-) binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP2 site and explaining the positive allostery between PL(-) binding and PIP2 sensitivity. © 2016 Lee et al.

  3. Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

    PubMed

    Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

    2014-08-01

    Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

  4. Evidence that Ribulose 1,5-Bisphosphate (RuBP) Binds to Inactive Sites of RuBP Carboxylase in Vivo and an Estimate of the Rate Constant for Dissociation 1

    PubMed Central

    Cardon, Zoe G.; Mott, Keith A.

    1989-01-01

    The binding of ribulose 1,5-bisphosphate (RuBP) to inactive (noncarbamylated) sites of the enzyme RuBP carboxylase in vivo was investigated in Spinacia oleracea and Helianthus annuus. The concentrations of RuBP and inactive sites were determined in leaf tissue as a function of time after a change to darkness. RuBP concentrations fell rapidly after the change to darkness and were approximately equal to the concentration of inactive sites after 60 s. Variations in the concentration of inactive sites, which were induced by differences in the light intensity before the light-dark transition, correlated with the concentration of RuBP between 60 and 120 s after the change to darkness. These data are discussed as evidence that RuBP binds to inactive sites of RuBP carboxylase in vivo. After the concentration of RuBP fell below that of inactive sites (at times longer than 60 s of darkness), the decline in RuBP was logarithmic with time. This would be expected if the dissociation of RuBP from inactive sites controlled the decline in RuBP concentration. These data were used to estimate the rate constant for dissociation of RuBP from inactive sites in vivo. PMID:16666692

  5. Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method

    NASA Astrophysics Data System (ADS)

    Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

    2014-08-01

    Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

  6. A novel substance P binding site in rat brain regions modulates TRH receptor binding.

    PubMed

    Sharif, N A

    1990-10-01

    Binding sites for thyrotropin-releasing hormone (TRH) were labelled with [3H](2-Me-His3)TRH ([3H]MeTRH) on membranes from rat brain regions at 0 degrees C for 5 h. Amygdaloid membranes bound [3H]MeTRH with high-affinity (Kd = 3.1 +/- 0.5 nM (n = 4)). Five TRH analogs competed for this binding with the same rank order and with affinities that matched the pharmacological specificity of pituitary TRH receptors. Substance P (SP) and its C-terminal fragments reduced amygdaloid TRH receptor binding in a concentration dependent manner (IC50 for SP = 65 microM). The rank order of potency of SP analogs at inhibiting TRH receptor binding was: SP greater than nonapeptide (3-11) greater than hexapeptide (6-11) greater than heptapeptide (5-11) greater than pentapeptide (7-11). However, other tachykinins were inactive in this system. SP was a potent inhibitor of [3H]MeTRH binding in hippocampus greater than spinal cord greater than retina greater than n. accumbens greater than hypothalamus greater than amygdaloid greater than olfactory bulb greater than or equal to pituitary greater than pons/medulla in parallel assays. In amygdaloid membranes SP (50 microM) reduced the apparent maximum receptor density by 39% (p less than 0.01) without altering the binding affinity, and 100 microM SP induced a biphasic dissociation of [3H]MeTRH with kinetics faster than those induced by both TRH (10 microM) and serotonin (100 microM). In contrast, other neuropeptides such as neurotensin, proctolin, angiotensin II, bombesin and luteinizing hormone releasing hormone did not significantly inhibit [3H]MeTRH binding to amygdaloid membranes.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    PubMed Central

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  8. /sup 3/H)pirenzepine and (-)-(/sup 3/H)quinuclidinyl benzilate binding to rat cerebral cortical and cardiac muscarinic cholinergic sites. I. Characterization and regulation of agonist binding to putative muscarinic subtypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watson, M.; Yamamura, H.I.; Roeske, W.R.

    The binding and regulation of selected muscarinic agonists to putative subtypes in rat cerebral cortex and heart were studied. Parallel inhibition studies of (/sup 3/H)pirenzepine ((/sup 3/H)PZ) and (-)-(/sup 3/H)quinuclidinylbenzilate ((-)-(/sup 3/H)QNB)-labeled membranes were done with and without 30 microM guanyl-5'-yl imidodiphosphate (Gpp(NH)p) at 25 degrees C in 10 mM Na-K-phosphate buffer which enhances PZ binding affinity and in modified Krebs-phosphate buffer, which mimics physiological conditions. Classical agonists such as carbachol, oxotremorine and acetylcholine inhibited (-)-(/sup 3/H)QNB binding to membranes with shallow Hill values (nH less than 1), were better fit to a 2-state model, were Gpp(NH)p-regulated and showed lowermore » affinity in modified Krebs-phosphate buffer than in 10 mM Na-K-phosphate buffer. Some agonists were not significantly better fit to a 2-state model in (/sup 3/H)PZ-labeled cortical membranes, especially in 10 mM Na-K-phosphate buffer. Whereas putative M1 and M2 binding sites distinguished by PZ possessed multiple agonist affinity states, as judged by carbachol, and agonist binding to (/sup 3/H)PZ-labeled sites were Gpp(NH)p modulated, the partial agonist pilocarpine and nonclassical agonist McN-A-343 (3-(m-chlorophenylcarbamoyloxy)-2-butynyl trimethylammonium chloride) showed little Gpp(NH)p-induced shift in (/sup 3/H)PZ-labeled cortical membranes in physiological conditions. Agonist binding to (-)-(/sup 3/H)QNB-labeled putative M2 cardiac sites was more sensitive to Gpp(NH)p than (-)-(/sup 3/H)QNB-labeled cortical sites. Carbachol and acetylcholine showed significant selectivity for putative M2 sites.« less

  9. Glutathione regulation of redox-sensitive signals in tumor necrosis factor-{alpha}-induced vascular endothelial dysfunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsou, T.-C.; Yeh, S.C.; Tsai, F.-Y.

    2007-06-01

    We investigated the regulatory role of glutathione in tumor necrosis factor-alpha (TNF-{alpha})-induced vascular endothelial dysfunction as evaluated by using vascular endothelial adhesion molecule expression and monocyte-endothelial monolayer binding. Since TNF-{alpha} induces various biological effects on vascular cells, TNF-{alpha} dosage could be a determinant factor directing vascular cells into different biological fates. Based on the adhesion molecule expression patterns responding to different TNF-{alpha} concentrations, we adopted the lower TNF-{alpha} (0.2 ng/ml) to rule out the possible involvement of other TNF-{alpha}-induced biological effects. Inhibition of glutathione synthesis by L-buthionine-(S,R)-sulfoximine (BSO) resulted in down-regulations of the TNF-{alpha}-induced adhesion molecule expression and monocyte-endothelial monolayermore » binding. BSO attenuated the TNF-{alpha}-induced nuclear factor-kappaB (NF-{kappa}B) activation, however, with no detectable effect on AP-1 and its related mitogen-activated protein kinases (MAPKs). Deletion of an AP-1 binding site in intercellular adhesion molecule-1 (ICAM-1) promoter totally abolished its constitutive promoter activity and its responsiveness to TNF-{alpha}. Inhibition of ERK, JNK, or NF-{kappa}B attenuates TNF-{alpha}-induced ICAM-1 promoter activation and monocyte-endothelial monolayer binding. Our study indicates that TNF-{alpha} induces adhesion molecule expression and monocyte-endothelial monolayer binding mainly via activation of NF-{kappa}B in a glutathione-sensitive manner. We also demonstrated that intracellular glutathione does not modulate the activation of MAPKs and/or their downstream AP-1 induced by lower TNF-{alpha}. Although AP-1 activation by the lower TNF-{alpha} was not detected in our systems, we could not rule out the possible involvement of transiently activated MAPKs/AP-1 in the regulation of TNF-{alpha}-induced adhesion molecule expression.« less

  10. O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals.

    PubMed

    Sawaguchi, Shogo; Varshney, Shweta; Ogawa, Mitsutaka; Sakaidani, Yuta; Yagi, Hirokazu; Takeshita, Kyosuke; Murohara, Toyoaki; Kato, Koichi; Sundaram, Subha; Stanley, Pamela; Okajima, Tetsuya

    2017-04-11

    The glycosyltransferase EOGT transfers O-GlcNAc to a consensus site in epidermal growth factor-like (EGF) repeats of a limited number of secreted and membrane proteins, including Notch receptors. In EOGT-deficient cells, the binding of DLL1 and DLL4, but not JAG1, canonical Notch ligands was reduced, and ligand-induced Notch signaling was impaired. Mutagenesis of O-GlcNAc sites on NOTCH1 also resulted in decreased binding of DLL4. EOGT functions were investigated in retinal angiogenesis that depends on Notch signaling. Global or endothelial cell-specific deletion of Eogt resulted in defective retinal angiogenesis, with a mild phenotype similar to that caused by reduced Notch signaling in retina. Combined deficiency of different Notch1 mutant alleles exacerbated the abnormalities in Eogt -/- retina, and Notch target gene expression was decreased in Eogt -/- endothelial cells. Thus, O-GlcNAc on EGF repeats of Notch receptors mediates ligand-induced Notch signaling required in endothelial cells for optimal vascular development.

  11. Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

    2006-03-01

    Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

  12. Deciphering the complexation process of a fluoroquinolone antibiotic, levofloxacin, with bovine serum albumin in the presence of additives

    NASA Astrophysics Data System (ADS)

    Kaur, Amandeep; Khan, Imran Ahmd; Banipal, Parampaul Kaur; Banipal, Tarlok Singh

    2018-02-01

    The current work aims to explore the thermodynamic and conformational aspects for the binding of fluoroquinolone antibacterial drug, levofloxacin (LFC), with bovine serum albumin (BSA) using calorimetric, spectroscopic (UV-visible, fluorescence, circular dichroism, and 1H NMR), dynamic light scattering (DLS) and computational methods (molecular docking). The binding of LFC with BSA at two sequential sites with higher affinity ( 103 M- 1) at the first site has been explored by calorimetry whereas the binding at a single site with affinity of the order of 104 M- 1 has been observed from fluorescence spectroscopy. The calorimetric study in the presence of additives along with docking analysis reveals the significant role of electrostatic, hydrogen bonding, and hydrophobic interactions in the association process. The slight conformational changes in protein as well as the changes in the water network structure around the binding cavity of protein have been observed from spectroscopic and DLS measurements. The LFC induced quenching of BSA fluorescence was observed to be initiated mainly through the static quenching process and this suggests the formation of ground state LFC-BSA association complex. The stronger interactions of LFC in the cavity of Sudlow site I (subdomain IIA) of protein have been explored from site marker calorimetric and molecular docking study.

  13. Enhancement of GABAergic transmission by zolpidem, an imidazopyridine with preferential affinity for type I benzodiazepine receptors.

    PubMed

    Biggio, G; Concas, A; Corda, M G; Serra, M

    1989-02-28

    The effect of zolpidem, an imidazopyridine derivative with high affinity at the type I benzodiazepine recognition site, on the function of the GABAA/ionophore receptor complex was studied in vitro. Zolpidem, mimicking the action of diazepam, increased [3H]GABA binding, enhanced muscimol-stimulated 36Cl- uptake and reduced [35S]TBPS binding in rat cortical membrane preparations. Zolpidem was less effective than diazepam on the above parameters. Zolpidem induced a lower increase of [3H]GABA binding (23 vs. 35%) and muscimol-stimulated 36Cl- uptake (22 vs. 40%) and a smaller decrease of [35S]TBPS binding (47 vs. 77%) than diazepam. The finding that zolpidem enhanced the function of GABAergic synapses with an efficacy qualitatively and quantitatively different from that of diazepam suggests that this compound is a partial agonist at the benzodiazepine recognition site. Thus, our results are consistent with the view that the biochemical and pharmacological profile of a benzodiazepine recognition site ligand reflects its efficacy to enhance GABAergic transmission. Whether the preferential affinity of zolpidem at the type I site is involved in its atypical biochemical and pharmacological profile remains to be clarified.

  14. Azadirachtin interacts with the tumor necrosis factor (TNF) binding domain of its receptors and inhibits TNF-induced biological responses.

    PubMed

    Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K

    2010-02-19

    The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.

  15. Azadirachtin Interacts with the Tumor Necrosis Factor (TNF) Binding Domain of Its Receptors and Inhibits TNF-induced Biological Responses*

    PubMed Central

    Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A.; Manna, Sunil K.

    2010-01-01

    The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor κB (NF-κB) and also expression of NF-κB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-κB (IκBα) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IκBα kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-κB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy. PMID:20018848

  16. An N-terminal fragment of substance P, substance P(1-7), down-regulates neurokinin-1 binding in the mouse spinal cord.

    PubMed

    Yukhananov RYu; Larson, A A

    1994-08-29

    Injected intrathecally, substance P (SP) down-regulates neurokinin-1 (NK-1) binding in the spinal cord and desensitizes rats to the behavioral effect of SP. N-terminal fragments of SP, such as SP(1-7), induce antinociception and play a role in desensitization to SP in mice. The goal of this study was to assess the abilities of N- and C-terminal fragments of SP to down-regulate NK-1 binding. Binding of [3H]SP to mouse spinal cord membranes was inhibited by SP, CP-96,345, and to a lesser extent by SP(5-11), but not SP(1-7), consistent with these binding sites being NK-1 receptors. Injection of SP(5-11) intrathecally did not affect the affinity (Kd) or concentration (Bmax) of [3H]SP binding. However, injection of 1 nmol of SP(1-7) decreased the Bmax of [3H]SP binding in the spinal cord at 6 h after its injection just as this dose of SP decreased the Bmax at 24 h. These data suggest that the N-terminus of SP is responsible for down-regulation of NK-1 binding. As SP(5-11) did not down-regulate NK-1 binding, activation of NK-1 sites does not appear necessary or sufficient for down-regulation of SP binding. In contrast, SP(1-7), in spite of its inability to interact with NK-1 sites, did down-regulate SP binding, suggesting an indirect mechanism dissociated from NK-1 receptors.

  17. Reshaping Human Antibodies: Grafting an Antilysozyme Activity

    NASA Astrophysics Data System (ADS)

    Verhoeyen, Martine; Milstein, Cesar; Winter, Greg

    1988-03-01

    The production of therapeutic human monoclonal antibodies by hybridoma technology has proved difficult, and this has prompted the ``humanizing'' of mouse monoclonal antibodies by recombinant DNA techniques. It was shown previously that the binding site for a small hapten could be grafted from the heavy-chain variable domain of a mouse antibody to that of a human myeloma protein by transplanting the hypervariable loops. It is now shown that a large binding site for a protein antigen (lysozyme) can also be transplanted from mouse to human heavy chain. The success of such constructions may be facilitated by an induced-fit mechanism.

  18. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  19. Stigmatellin Probes the Electrostatic Potential in the QB Site of the Photosynthetic Reaction Center

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerencsér, László; Boros, Bogáta; Derrien, Valerie

    2015-01-01

    The electrostatic potential in the secondary quinone (QB) binding site of the reaction center (RC) of the photosynthetic bacterium Rhodobacter sphaeroides determines the rate and free energy change (driving force) of electron transfer to QB. It is controlled by the ionization states of residues in a strongly interacting cluster around the QB site. Reduction of the QB induces change of the ionization states of residues and binding of protons from the bulk. Stigmatellin, an inhibitor of the mitochondrial and photosynthetic respiratory chain, has been proven to be a unique voltage probe of the QB binding pocket. It binds to themore » QB site with high affinity, and the pK value of its phenolic group monitors the local electrostatic potential with high sensitivity. Investigations with different types of detergent as a model system of isolated RC revealed that the pK of stigmatellin was controlled overwhelmingly by electrostatic and slightly by hydrophobic interactions. Measurements showed a high pK value (>11) of stigmatellin in the QB pocket of the dark-state wild-type RC, indicating substantial negative potential. When the local electrostatics of the QB site was modulated by a single mutation, L213Asp/Ala, or double mutations, L213Asp-L212Glu/Ala-Ala (AA), the pK of stigmatellin dropped to 7.5 and 7.4, respectively, which corresponds to a >210 mV increase in the electrostatic potential relative to the wild-type RC. This significant pK drop (DpK > 3.5) decreased dramatically to (DpK > 0.75) in the RC of the compensatory mutant (AAþM44Asn/AAþM44Asp). Our results indicate that the L213Asp is the most important actor in the control of the electrostatic potential in the QB site of the dark-state wild-type RC, in good accordance with conclusions of former studies using theoretical calculations or light-induced charge recombination assay.« less

  20. Dux4 induces cell cycle arrest at G1 phase through upregulation of p21 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Hongliang; Wang, Zhaoxia; Jin, Suqin

    2014-03-28

    Highlights: • Dux4 induced TE671 cell proliferation defect and G1 phase arrest. • Dux4 upregulated p21 expression without activating p53. • Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. • Sp1 binding site was required for Dux4-induced p21 promoter activation. - Abstract: It has been implicated that Dux4 plays crucial roles in development of facioscapulohumeral dystrophy. But the underlying myopathic mechanisms and related down-stream events of this retrogene were far from clear. Here, we reported that overexpression of Dux4 in a cell model TE671 reduced cell proliferation rate, and increased G1 phase accumulation. We also determined themore » impact of Dux4 on p53/p21 signal pathway, which controls the checkpoint in cell cycle progression. Overexpression of Dux4 increased p21 mRNA and protein level, while expression of p53, phospho-p53 remained unchanged. Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. Furthermore, we demonstrated that enhanced Dux4 expression increased p21 promoter activity and elevated expression of Sp1 transcription factor. Mutation of Sp1 binding site decreased dux4 induced p21 promoter activation. Chromatin immunoprecipitation (ChIP) assays confirmed the Dux4-induced binding of Sp1 to p21 promoter in vivo. These results suggest that Dux4 might induce proliferation inhibition and G1 phase arrest through upregulation of p21.« less

  1. Pharmacologic characterization of the oxytocin receptor in human uterine smooth muscle cells.

    PubMed

    Tahara, A; Tsukada, J; Tomura, Y; Wada, K i; Kusayama, T; Ishii, N; Yatsu, T; Uchida, W; Tanaka, A

    2000-01-01

    [(3)H]-oxytocin was used to characterize the oxytocin receptor found in human uterine smooth muscle cells (USMC). Specific binding of [(3)H]-oxytocin to USMC plasma membranes was dependent upon time, temperature and membrane protein concentration. Scatchard plot analysis of equilibrium binding data revealed the existence of a single class of high-affinity binding sites with an apparent equilibrium dissociation constant (K(d)) of 0.76 nM and a maximum receptor density (B(max)) of 153 fmol mg(-1) protein. The Hill coefficient (n(H)) did not differ significantly from unity, suggesting binding to homogenous, non-interacting receptor populations. Competitive inhibition of [(3)H]-oxytocin binding showed that oxytocin and vasopressin (AVP) receptor agonists and antagonists displaced [(3)H]-oxytocin in a concentration-dependent manner. The order of potencies for peptide agonists and antagonists was: oxytocin>[Asu(1,6)]-oxytocin>AVP= atosiban>d(CH(2))(5)Tyr(Me)AVP>[Thr(4),Gly(7)]-oxytocin>dDAVP, and for nonpeptide antagonists was: L-371257>YM087>SR 49059>OPC-21268>SR 121463A>OPC-31260. Oxytocin significantly induced concentration-dependent increase in intracellular Ca(2+) concentration ([Ca(2+)](i)) and hyperplasia in USMC. The oxytocin receptor antagonists, atosiban and L-371257, potently and concentration-dependently inhibited oxytocin-induced [Ca(2+)](i) increase and hyperplasia. In contrast, the V(1A) receptor selective antagonist, SR 49059, and the V(2) receptor selective antagonist, SR 121463A, did not potently inhibit oxytocin-induced [Ca(2+)](i) increase and hyperplasia. The potency order of antagonists in inhibiting oxytocin-induced [Ca(2+)](i) increase and hyperplasia was similar to that observed in radioligand binding assays. In conclusion, these data provide evidence that the high-affinity [(3)H]-oxytocin binding site found in human USMC is a functional oxytocin receptor coupled to [Ca(2+)](i) increase and cell growth. Thus human USMC may prove to be a valuable tool in further investigation of the physiologic and pathophysiologic roles of oxytocin in the uterus. British Journal of Pharmacology (2000) 129, 131 - 139

  2. Fragment-Based Screen against HIV Protease

    PubMed Central

    Perryman, A. L.; Zhang, Q.; Soutter, H. H.; Rosenfeld, R.; McRee, D. E.; Olson, A. J.; Elder, J. E.; Stout, C. D.

    2009-01-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 Å resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the ‘exo site’ adjacent to the Gly16Gly17Gln18 loop where the amide of Gly17 is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys14 and Leu63. Another fragment, indole-6-carboxylic acid, binds on the ‘outside/top of the flap’ via hydrophobic contacts with Trp42, Pro44, Met46, and Lys55, a hydrogen bond with Val56, and a salt-bridge with Arg57. 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target. PMID:20659109

  3. Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

    PubMed

    DasGupta, G; White, J; Cheung, P; Reisler, E

    1990-09-11

    The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

  4. Assessment of ligand binding at a site relevant to SOD1 oxidation and aggregation.

    PubMed

    Manjula, Ramu; Wright, Gareth S A; Strange, Richard W; Padmanabhan, Balasundaram

    2018-05-01

    Cu/Zn superoxide dismutase-1 (SOD1) mutations are causative for a subset of amyotrophic lateral sclerosis (ALS) cases. These mutations lead to structural instability, aggregation and ultimately motor neuron death. We have determined crystal structures of SOD1 in complex with a naphthalene-catechol-linked compound which binds with low micro-molar affinity to a site important for oxidative damage-induced aggregation. SOD1 Trp32 oxidation is indeed significantly inhibited by ligand binding. Our work shows how compound linking can be applied successfully to ligand interactions on the SOD1 surface to generate relatively good binding strength. The ligand, positioned in a region important for SOD1 fibrillation, offers the possibility that it, or a similar compound, could prevent the abnormal self-association that drives SOD1 toxicity in ALS. © 2018 Federation of European Biochemical Societies.

  5. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  6. Gab1 Is Required for Cell Cycle Transition, Cell Proliferation, and Transformation Induced by an Oncogenic Met Receptor

    PubMed Central

    Mood, Kathleen; Saucier, Caroline; Bong, Yong-Sik; Lee, Hyun-Shik; Park, Morag

    2006-01-01

    We have shown previously that either Grb2- or Shc-mediated signaling from the oncogenic Met receptor Tpr-Met is sufficient to trigger cell cycle progression in Xenopus oocytes. However, direct binding of these adaptors to Tpr-Met is dispensable, implying that another Met binding partner mediates these responses. In this study, we show that overexpression of Grb2-associated binder 1 (Gab1) promotes cell cycle progression when Tpr-Met is expressed at suboptimal levels. This response requires that Gab1 possess an intact Met-binding motif, the pleckstrin homology domain, and the binding sites for phosphatidylinositol 3-kinase and tyrosine phosphatase SHP-2, but not the Grb2 and CrkII/phospholipase Cγ binding sites. Importantly, we establish that Gab1-mediated signals are critical for cell cycle transition promoted by the oncogenic Met and fibroblast growth factor receptors, but not by progesterone, the natural inducer of cell cycle transition in Xenopus oocytes. Moreover, Gab1 is essential for Tpr-Met–mediated morphological transformation and proliferation of fibroblasts. This study provides the first evidence that Gab1 is a key binding partner of the Met receptor for induction of cell cycle progression, proliferation, and oncogenic morphological transformation. This study identifies Gab1 and its associated signaling partners as potential therapeutic targets to impair proliferation or transformation of cancer cells in human malignancies harboring a deregulated Met receptor. PMID:16775003

  7. Rational design and validation of a vanilloid-sensitive TRPV2 ion channel

    PubMed Central

    Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

    2016-01-01

    Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359

  8. Mechanistic and conformational studies on the interaction of food dye amaranth with human serum albumin by multispectroscopic methods.

    PubMed

    Zhang, Guowen; Ma, Yadi

    2013-01-15

    The mechanism of interaction between food dye amaranth and human serum albumin (HSA) in physiological buffer (pH 7.4) was investigated by fluorescence, UV-vis absorption, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy. Results obtained from analysis of fluorescence spectra indicated that amaranth had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching procedure. The negative value of enthalpy change and positive value of entropy change elucidated that the binding of amaranth to HSA was driven mainly by hydrophobic and hydrogen bonding interactions. The surface hydrophobicity of HSA increased after binding with amaranth. The binding distance between HSA and amaranth was estimated to be 3.03 nm and subdomain IIA (Sudlow site I) was the primary binding site for amaranth on HSA. The results of CD and FT-IR spectra showed that binding of amaranth to HSA induced conformational changes of HSA. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Reduction of the Ganglioside Binding Activity of the Tetanus Toxin HC Fragment Destroys Immunogenicity: Implications for Development of Novel Tetanus Vaccines

    PubMed Central

    Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil

    2006-01-01

    In this study, the immunogenicities of the nontoxic HC fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type HC (HCWT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and HC antigens and provided complete protection against toxin challenge. Mutants of HC containing deletions essential for ganglioside binding elicited lower responses than HCWT. HCM115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with HCWT, consistent with lower anti-HC and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in HCM115. We conclude that the presence of the ganglioside binding site within HC may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection. PMID:16861677

  10. Study on the interaction of the epilepsy drug, zonisamide with human serum albumin (HSA) by spectroscopic and molecular docking techniques

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Khorshidi, Aref; Moghadam, Neda Hossinpour

    2013-10-01

    In the present investigation, an attempt has been made to study the interaction of zonisamide (ZNS) with the transport protein, human serum albumin (HSA) employing UV-Vis, fluorometric, circular dichroism (CD) and molecular docking techniques. The results indicated that binding of ZNS to HSA caused strong fluorescence quenching of HSA through static quenching mechanism, hydrogen bonds and van der Waals contacts are the major forces in the stability of protein ZNS complex and the process of the binding of ZNS with HSA was driven by enthalpy (ΔH = -193.442 kJ mol-1). The results of CD and UV-Vis spectroscopy showed that the binding of this drug to HSA induced conformational changes in HSA. Furthermore, the study of molecular docking also indicated that zonisamide could strongly bind to the site I (subdomain IIA) of HSA mainly by hydrophobic interaction and there were hydrogen bond interactions between this drug and HSA, also known as the warfarin binding site.

  11. Opposing effects of estradiol- and testosterone-membrane binding sites on T47D breast cancer cell apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kampa, Marilena; Nifli, Artemissia-Phoebe; Charalampopoulos, Ioannis

    Classical steroid mode of action involves binding to intracellular receptors, the later acting as ligand-activated nuclear transcription factors. Recently, membrane sites for different steroids have been also identified, mediating rapid, non-genomic, steroid actions. Membrane sites for estrogen and androgen have been found in a number of different cell types, bearing or not classical intracellular receptors. In the present study, with the use of radioligand binding, flow cytometry and confocal laser microscopy, we report that T47D human breast cancer cells express specific and saturable membrane receptors for both estrogen (K {sub D} 4.06 {+-} 3.31 nM) and androgen (K {sub D}more » 7.64 {+-} 3.15 nM). Upon activation with BSA-conjugated, non-permeable ligands (E{sub 2}-BSA and testosterone-BSA), membrane estrogen receptors protect cells from serum-deprivation-induced apoptosis, while androgen receptors induce apoptosis in serum-supplemented T47D cells. In addition, co-incubation of cells with a fixed concentration of one steroid and varying concentrations of the other reversed the abovementioned effect (apoptosis for androgen, and anti-apoptosis for E{sub 2}), suggesting that the fate of the cell depends on the relative concentration of either steroid in the culture medium. We also report the identification of membrane receptors for E{sub 2} and androgen in biopsy slides from breast cancer patients. Both sites are expressed, with the staining for membrane E{sub 2} being strongly present in ER-negative, less differentiated, more aggressive tumors. These findings suggest that aromatase inhibitors may exert their beneficial effects on breast cancer by also propagating the metabolism of local steroids towards androgen, inducing thus cell apoptosis through membrane androgen receptor activation.« less

  12. IR signature of the photoionization-induced hydrophobic-->hydrophilic site switching in phenol-Arn clusters

    NASA Astrophysics Data System (ADS)

    Ishiuchi, Shun-ichi; Sakai, Makoto; Tsuchida, Yuji; Takeda, Akihiro; Kawashima, Yasutake; Dopfer, Otto; Müller-Dethlefs, Klaus; Fujii, Masaaki

    2007-09-01

    IR spectra of phenol-Arn (PhOH-Arn) clusters with n =1 and 2 were measured in the neutral and cationic electronic ground states in order to determine the preferential intermolecular ligand binding motifs, hydrogen bonding (hydrophilic interaction) versus π bonding (hydrophobic interaction). Analysis of the vibrational frequencies of the OH stretching motion, νOH, observed in nanosecond IR spectra demonstrates that neutral PhOH-Ar and PhOH -Ar2 as well as cationic PhOH +-Ar have a π-bound structure, in which the Ar atoms bind to the aromatic ring. In contrast, the PhOH +-Ar2 cluster cation is concluded to have a H-bound structure, in which one Ar atom is hydrogen-bonded to the OH group. This π →H binding site switching induced by ionization was directly monitored in real time by picosecond time-resolved IR spectroscopy. The π-bound νOH band is observed just after the ionization and disappears simultaneously with the appearance of the H-bound νOH band. The analysis of the picosecond IR spectra demonstrates that (i) the π →H site switching is an elementary reaction with a time constant of ˜7ps, which is roughly independent of the available internal vibrational energy, (ii) the barrier for the isomerization reaction is rather low(<100cm-1), (iii) both the position and the width of the H-bound νOH band change with the delay time, and the time evolution of these spectral changes can be rationalized by intracluster vibrational energy redistribution occurring after the site switching. The observation of the ionization-induced switch from π bonding to H bonding in the PhOH +-Ar2 cation corresponds to the first manifestation of an intermolecular isomerization reaction in a charged aggregate.

  13. Exploring the selectivity of auto-inducer complex with LuxR using molecular docking, mutational studies and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Rajamanikandan, Sundaraj; Srinivasan, Pappu

    2017-03-01

    Bacteria communicate with one another using extracellular signaling molecules called auto-inducers (AHLs), a process termed as quorum sensing. The quorum sensing process allows bacteria to regulate various physiological activities. In this regard, quorum sensing master regulator LuxR from Vibrio harveyi represents an attractive therapeutic target for the development of novel anti-quorum sensing agents. Eventhough the binding of AHL complex with LuxR is evidenced in earlier reports, but their mode of binding is not clearly determined. Therefore, in the present work, molecular docking, in silico mutational studies, molecular dynamics simulations and free energy calculations were performed to understand the selectivity of AHL into the binding site of LuxR. The results revealed that Asn133 and Gln137 residues play a crucial role in recognizing AHL more effectively into the binding site of LuxR with good binding free energy. In addition to that, the carbonyl group presents in the lactone ring and amide group of AHL plays a vital role in the formation of hydrogen bond interactions with the protein. Further, structure based virtual screening was performed using ChemBridge database to screen potent lead molecules against LuxR. 4-benzyl-2-pyrrolidinone and N-[2(1-cyclohexen-1-yl) enthyl]-N'(2-ethoxyphenyl) were selected based on dock score, binding affinity and mode of interactions with the receptor. Furthermore, binding free energy, density functional theory and ADME prediction were performed to rank the lead molecules. Thus, the identified lead molecules can be used for the development of anti-quorum sensing drugs.

  14. Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

    PubMed

    Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

    2015-11-10

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

  15. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  16. Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

    PubMed Central

    Pessler, F; Pendergrast, P S; Hernandez, N

    1997-01-01

    The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes. PMID:9199312

  17. The increased binding affinity of curcumin with human serum albumin in the presence of rutin and baicalin: A potential for drug delivery system

    NASA Astrophysics Data System (ADS)

    Liu, Bing-Mi; Zhang, Jun; Hao, Ai-Jun; Xu, Liang; Wang, Dan; Ji, Hui; Sun, Shi-Jie; Chen, Bo-Qi; Liu, Bin

    2016-02-01

    The impacts of rutin and baicalin on the interaction of curcumin (CU) with human serum albumin (HSA) were investigated by fluorescence and circular dichroism (CD) spectroscopies under imitated physiological conditions. The results showed that the fluorescence quenching of HSA by CU was a simultaneous static and dynamic quenching process, irrespective of the presence or absence of flavonoids. The binding constants between CU and HSA in the absence and presence of rutin and baicalin were 2.268 × 105 M- 1, 3.062 × 105 M- 1, and 3.271 × 105 M- 1, indicating that the binding affinity was increased in the case of two flavonoids. Furthermore, the binding distance determined according to Förster's theory was decreased in the presence of flavonoids. Combined with the fact that flavonoids and CU have the same binding site (site I), it can be concluded that they may simultaneously bind in different regions in site I, and formed a ternary complex of flavonoid-HSA-CU. Meanwhile, the results of fluorescence quenching, CD and three-dimensional fluorescence spectra revealed that flavonoids further strengthened the microenvironmental and conformational changes of HSA induced by CU binding. Therefore, it is possible to develop a novel complex involving CU, flavonoid and HSA for CU delivery. The work may provide some valuable information in terms of improving the poor bioavailabiliy of CU.

  18. Binding of vitamin A with milk α- and β-caseins.

    PubMed

    Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

    2013-05-01

    The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NFκB binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bonin, Camila P., E-mail: mila_bonin@yahoo.com.br; Baccarin, Raquel Y.A., E-mail: baccarin@usp.br; Nostell, Katarina, E-mail: katarina.nostell@slu.se

    2013-03-08

    Highlights: ► Chimpanzees, horses and humans have regions of similarity on TLR4 and MD2 promoters. ► Rodents have few regions of similarity on TLR4 promoter when compared to primates. ► Conserved NFkB binding sites were found in the promoters of TLR4 and MD2. ► LPS-induced inhibition of TLR4 transcription is reversed by dexamethasone. ► LPS-induced transcription of MD2 is inhibited by dexamethasone. -- Abstract: Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explainingmore » these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NFκB) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2.« less

  20. The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages

    PubMed Central

    Daniel, Bence; Hah, Nasun; Horvath, Attila; Czimmerer, Zsolt; Poliska, Szilard; Gyuris, Tibor; Keirsse, Jiri; Gysemans, Conny; Van Ginderachter, Jo A.; Balint, Balint L.; Evans, Ronald M.; Barta, Endre; Nagy, Laszlo

    2014-01-01

    RXR signaling is predicted to have a major impact in macrophages, but neither the biological consequence nor the genomic basis of its ligand activation is known. Comprehensive genome-wide studies were carried out to map liganded RXR-mediated transcriptional changes, active binding sites, and cistromic interactions in the context of the macrophage genome architecture. The macrophage RXR cistrome has 5200 genomic binding sites, which are not impacted by ligand. Active enhancers are characterized by PU.1 binding, an increase of enhancer RNA, and P300 recruitment. Using these features, 387 liganded RXR-bound enhancers were linked to 226 genes, which predominantly reside in CTCF/cohesin-limited functional domains. These findings were molecularly validated using chromosome conformation capture (3C) and 3C combined with sequencing (3C-seq), and we show that selected long-range enhancers communicate with promoters via stable or RXR-induced loops and that some of the enhancers interact with each other, forming an interchromosomal network. A set of angiogenic genes, including Vegfa, has liganded RXR-controlled enhancers and provides the macrophage with a novel inducible program. PMID:25030696

  1. Use of terbium as a probe of tRNA tertiary structure and folding.

    PubMed Central

    Hargittai, M R; Musier-Forsyth, K

    2000-01-01

    Lanthanide metals such as terbium have previously been shown to be useful for mapping metal-binding sites in RNA. Terbium binds to the same sites on RNA as magnesium, however, with a much higher affinity. Thus, low concentrations of terbium ions can easily displace magnesium and promote phosphodiester backbone scission. At higher concentrations, terbium cleaves RNA in a sequence-independent manner, with a preference for single-stranded, non-Watson-Crick base-paired regions. Here, we show that terbium is a sensitive probe of human tRNALys,3 tertiary structure and folding. When 1 microM tRNA is used, the optimal terbium ion concentration for detecting Mg2+-induced tertiary structural changes is 50-60 microM. Using these concentrations of RNA and terbium, a magnesium-dependent folding transition with a midpoint (KMg) of 2.6 mM is observed for unmodified human tRNALys,3. At lower Tb3+ concentrations, cleavage is restricted to nucleotides that constitute specific metal-binding pockets. This small chemical probe should also be useful for detecting protein induced structural changes in RNA. PMID:11105765

  2. Structural integration in hypoxia-inducible factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Potluri, Nalini; Lu, Jingping

    The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

  3. Phospho-selective mechanisms of arrestin conformations and functions revealed by unnatural amino acid incorporation and 19F-NMR

    PubMed Central

    Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng

    2015-01-01

    Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956

  4. Widespread long noncoding RNAs as endogenous target mimics for microRNAs in plants.

    PubMed

    Wu, Hua-Jun; Wang, Zhi-Min; Wang, Meng; Wang, Xiu-Jie

    2013-04-01

    Target mimicry is a recently identified regulatory mechanism for microRNA (miRNA) functions in plants in which the decoy RNAs bind to miRNAs via complementary sequences and therefore block the interaction between miRNAs and their authentic targets. Both endogenous decoy RNAs (miRNA target mimics) and engineered artificial RNAs can induce target mimicry effects. Yet until now, only the Induced by Phosphate Starvation1 RNA has been proven to be a functional endogenous microRNA target mimic (eTM). In this work, we developed a computational method and systematically identified intergenic or noncoding gene-originated eTMs for 20 conserved miRNAs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). The predicted miRNA binding sites were well conserved among eTMs of the same miRNA, whereas sequences outside of the binding sites varied a lot. We proved that the eTMs of miR160 and miR166 are functional target mimics and identified their roles in the regulation of plant development. The effectiveness of eTMs for three other miRNAs was also confirmed by transient agroinfiltration assay.

  5. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  6. DNA-Binding Kinetics Determines the Mechanism of Noise-Induced Switching in Gene Networks

    PubMed Central

    Tse, Margaret J.; Chu, Brian K.; Roy, Mahua; Read, Elizabeth L.

    2015-01-01

    Gene regulatory networks are multistable dynamical systems in which attractor states represent cell phenotypes. Spontaneous, noise-induced transitions between these states are thought to underlie critical cellular processes, including cell developmental fate decisions, phenotypic plasticity in fluctuating environments, and carcinogenesis. As such, there is increasing interest in the development of theoretical and computational approaches that can shed light on the dynamics of these stochastic state transitions in multistable gene networks. We applied a numerical rare-event sampling algorithm to study transition paths of spontaneous noise-induced switching for a ubiquitous gene regulatory network motif, the bistable toggle switch, in which two mutually repressive genes compete for dominant expression. We find that the method can efficiently uncover detailed switching mechanisms that involve fluctuations both in occupancies of DNA regulatory sites and copy numbers of protein products. In addition, we show that the rate parameters governing binding and unbinding of regulatory proteins to DNA strongly influence the switching mechanism. In a regime of slow DNA-binding/unbinding kinetics, spontaneous switching occurs relatively frequently and is driven primarily by fluctuations in DNA-site occupancies. In contrast, in a regime of fast DNA-binding/unbinding kinetics, switching occurs rarely and is driven by fluctuations in levels of expressed protein. Our results demonstrate how spontaneous cell phenotype transitions involve collective behavior of both regulatory proteins and DNA. Computational approaches capable of simulating dynamics over many system variables are thus well suited to exploring dynamic mechanisms in gene networks. PMID:26488666

  7. A natural xanthone increases catalase activity but decreases NF-kappa B and lipid peroxidation in U-937 and HepG2 cell lines.

    PubMed

    Sahoo, Binay K; Zaidi, Adeel H; Gupta, Pankaj; Mokhamatam, Raveendra B; Raviprakash, Nune; Mahali, Sidhartha K; Manna, Sunil K

    2015-10-05

    Mangiferin, a C-glycosyl xanthone, has shown anti-inflammatory, antioxidant, and anti-tumorigenic activities. In the present study, we investigated the molecular mechanism for the antioxidant property of mangiferin. Considering the role of nuclear transcription factor kappa B (NF-κB) in inflammation and tumorigenesis, we hypothesized that modulating its activity will be a viable therapeutic target in regulating the redox-sensitive ailments. Our results show that mangiferin blocks several inducers, such as tumor necrosis factor (TNF), lypopolysaccharide (LPS), phorbol-12-myristate-13-acetate (PMA) or hydrogen peroxide (H2O2) mediated NF-κB activation via inhibition of reactive oxygen species generation. In silico docking studies predicted strong binding energy of mangiferin to the active site of catalase (-9.13 kcal/mol), but not with other oxidases such as myeloperoxidase, glutathione peroxidase, or inducible nitric oxide synthase. Mangiferin increased activity of catalase by 44%, but had no effect on myeloperoxidase activity in vitro. Fluorescence spectroscopy further revealed the binding of mangiferin to catalase at the single site with binding constant and binding affinity of 3.1×10(-7) M(-1) and 1.046 respectively. Mangiferin also inhibits TNF-induced lipid peroxidation and thereby protects apoptosis. Hence, mangiferin with its ability to inhibit NF-κB and increase the catalase activity may prove to be a potent therapeutic. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Microsecond molecular dynamics simulations provide insight into the ATP-competitive inhibitor-induced allosteric protection of Akt kinase phosphorylation.

    PubMed

    Mou, Linkai; Cui, Tongwei; Liu, Weiguang; Zhang, Hong; Cai, Zhanxiu; Lu, Shaoyong; Gao, Guojun

    2017-05-01

    Akt is a serine/threonine protein kinase, a critical mediator of growth factor-induced survival in key cellular pathways. Allosteric signaling between protein intramolecular domains requires long-range communication mediated by hotspot residues, often triggered by ligand binding. Here, based on extensive 3 μs explicit solvent molecular dynamics (MD) simulations of Akt1 kinase domain in the unbound (apo) and ATP-competitive inhibitor, GDC-0068-bound states, we propose a molecular mechanism for allosteric regulation of Akt1 kinase phosphorylation by GDC-0068 binding to the ATP-binding site. MD simulations revealed that the apo Akt1 is flexible with two disengaged N- and C-lobes, equilibrated between the open and closed conformations. GDC-0068 occupancy of the ATP-binding site shifts the conformational equilibrium of Akt1 from the open conformation toward the closed conformation and stabilizes the closed state. This effect enables allosteric signal propagation from the GDC-0068 to the phosphorylated T308 (pT308) in the activation loop and restrains phosphatase access to pT308, thereby protecting the pT308 in the GDC-0068-bound Akt1. Importantly, functional hotspots involved in the allosteric communication from the GDC-0068 to the pT308 are identified. Our analysis of GDC-0068-induced allosteric protection of Akt kinase phosphorylation yields important new insights into the molecular mechanism of allosteric regulation of Akt kinase activity. © 2016 John Wiley & Sons A/S.

  9. Benzodiazepines: rat pinealocyte binding sites and augmentation of norepinephrine-stimulated N-acetyltransferase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthew, E.; Parfitt, A.G.; Sugden, D.

    1984-02-01

    Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects ofmore » diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.« less

  10. Novel bis-(−)-nor-meptazinol derivatives act as dual binding site AChE inhibitors with metal-complexing property

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Wei; NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032; Li, Juan

    The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC{sub 50} values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC{sub 50} values of 49.1 μM (for ZLA) and 55.3more » μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.« less

  11. Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

    PubMed

    Hagemann, H; Marcillat, O; Buchet, R; Vial, C

    2000-08-08

    Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

  12. Internalization of the chemokine receptor CCR4 can be evoked by orthosteric and allosteric receptor antagonists

    PubMed Central

    Ajram, Laura; Begg, Malcolm; Slack, Robert; Cryan, Jenni; Hall, David; Hodgson, Simon; Ford, Alison; Barnes, Ashley; Swieboda, Dawid; Mousnier, Aurelie; Solari, Roberto

    2014-01-01

    The chemokine receptor CCR4 has at least two natural agonist ligands, MDC (CCL22) and TARC (CCL17) which bind to the same orthosteric site with a similar affinity. Both ligands are known to evoke chemotaxis of CCR4-bearing T cells and also elicit CCR4 receptor internalization. A series of small molecule allosteric antagonists have been described which displace the agonist ligand, and inhibit chemotaxis. The aim of this study was to determine which cellular coupling pathways are involved in internalization, and if antagonists binding to the CCR4 receptor could themselves evoke receptor internalization. CCL22 binding coupled CCR4 efficiently to β-arrestin and stimulated GTPγS binding however CCL17 did not couple to β-arrestin and only partially stimulated GTPγS binding. CCL22 potently induced internalization of almost all cell surface CCR4, while CCL17 showed only weak effects. We describe four small molecule antagonists that were demonstrated to bind to two distinct allosteric sites on the CCR4 receptor, and while both classes inhibited agonist ligand binding and chemotaxis, one of the allosteric sites also evoked receptor internalization. Furthermore, we also characterize an N-terminally truncated version of CCL22 which acts as a competitive antagonist at the orthosteric site, and surprisingly also evokes receptor internalization without demonstrating any agonist activity. Collectively this study demonstrates that orthosteric and allosteric antagonists of the CCR4 receptor are capable of evoking receptor internalization, providing a novel strategy for drug discovery against this class of target. PMID:24534492

  13. GW domains of the Listeria monocytogenes invasion protein InlB are SH3-like and mediate binding to host ligands

    PubMed Central

    Marino, Michael; Banerjee, Manidipa; Jonquières, Renaud; Cossart, Pascale; Ghosh, Partho

    2002-01-01

    InlB, a surface-localized protein of Listeria monocytogenes, induces phagocytosis in non-phagocytic mammalian cells by activating Met, a receptor tyrosine kinase. InlB also binds glycosaminoglycans and the protein gC1q-R, two additional host ligands implicated in invasion. We present the structure of InlB, revealing a highly elongated molecule with leucine-rich repeats that bind Met at one end, and GW domains that dissociably bind the bacterial surface at the other. Surprisingly, the GW domains are seen to resemble SH3 domains. Despite this, GW domains are unlikely to act as functional mimics of SH3 domains since their potential proline-binding sites are blocked or destroyed. However, we do show that the GW domains, in addition to binding glycosaminoglycans, bind gC1q-R specifically, and that this binding requires release of InlB from the bacterial surface. Dissociable attachment to the bacterial surface via the GW domains may be responsible for restricting Met activation to a small, localized area of the host cell and for coupling InlB-induced host membrane dynamics with bacterial proximity during invasion. PMID:12411480

  14. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    PubMed Central

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  15. The Interaction of N-Glycans in Fcγ Receptor I α-Chain with Escherichia coli K1 Outer Membrane Protein A for Entry into Macrophages

    PubMed Central

    Krishnan, Subramanian; Liu, Fan; Abrol, Ravinder; Hodges, Jacqueline; Goddard, William A.; Prasadarao, Nemani V.

    2014-01-01

    Neonatal meningitis, caused by Escherichia coli K1, is a serious central nervous system disease. We have established that macrophages serve as permissive niches for E. coli K1 to multiply in the host and for attaining a threshold level of bacterial load, which is a prerequisite for the onset of the disease. Here, we demonstrate experimentally that three N-glycans in FcγRIa interact with OmpA of E. coli K1 for binding to and entering the macrophages. Adoptive transfer of FcγRIa−/− bone marrow-derived macrophages transfected with FcγRIa into FcγRIa−/− newborn mice renders them susceptible to E. coli K1-induced meningitis. In contrast, mice that received bone marrow-derived macrophages transfected with FcγRIa in which N-glycosylation sites 1, 4, and 5 are mutated to alanines exhibit resistance to E. coli K1 infection. Our molecular dynamics and simulation studies predict that N-glycan 5 exhibits strong binding at the barrel site of OmpA formed by loops 3 and 4, whereas N-glycans 1 and 4 interact with loops 1, 3, and 4 of OmpA at tip regions. Molecular modeling data also suggest no role for the IgG binding site in the invasion process. In agreement, experimental mutations in IgG binding site had no effect on the E. coli K1 entry into macrophages in vitro or on the onset of meningitis in newborn mice. Together, this integration of experimental and computational studies reveals how the N-glycans in FcγRIa interact with the OmpA of E. coli K1 for inducing the disease pathogenesis. PMID:25231998

  16. Insights into the complex association of bovine factor Va with acidic-lipid-containing synthetic membranes.

    PubMed Central

    Cutsforth, G A; Koppaka, V; Krishnaswamy, S; Wu, J R; Mann, K G; Lentz, B R

    1996-01-01

    The mechanism of binding of blood coagulation cofactor factor Va to acidic-lipid-containing membranes has been addressed. Binding isotherms were generated at room temperature using the change in fluorescence anisotropy of pyrene-labeled bovine factor Va to detect binding to sonicated membrane vesicles containing either bovine brain phosphatidylserine (PS) or 1,2-dioleoyl-3-sn-phosphatidylglycerol (DOPG) in combination with 1-palmitoyl-2-oleoyl-3-sn-phosphatidylcholine (POPC). The composition of the membranes was varied from 0 to 40 mol% for PS/POPC and from 0 to 65 mol % for DOPG/POPC membranes. Fitting the data to a classical Langmuir adsorption model yielded estimates of the dissociation constant (Kd) and the stoichiometry of binding. The values of Kd defined in this way displayed a maximum at low acidic lipid content but were nearly constant at intermediate to high fractions of acidic lipid. Fitting the binding isotherms to a two-process binding model (nonspecific adsorption in addition to binding of acidic lipids to sites on the protein) suggested a significant acidic-lipid-independent binding affinity in addition to occupancy of three protein sites that bind PS in preference to DOPG. Both analyses indicated that interaction of factor Va with an acidic-lipid-containing membrane is much more complex than those of factor Xa or prothrombin. Furthermore, a change in the conformation of bound pyrene-labeled factor Va with surface concentration of acidic lipid was implied by variation of both the saturating fluorescence anisotropy and the binding parameters with the acidic lipid content of the membrane. Finally, the results cannot support the contention that binding occurs through nonspecific adsorption to a patch or domain of acidic lipids in the membrane. Factor Va is suggested to associate with membranes by a complex process that includes both acidic-lipid-specific and acidic-lipid-independent sites and a protein structure change induced by occupancy of acidic-lipid-specific sites on the factor Va molecule. Images FIGURE 5 PMID:8744332

  17. Structure of Simian Immunodeficiency Virus Envelope Spikes Bound with CD4 and Monoclonal Antibody 36D5.

    PubMed

    Hu, Guiqing; Liu, Jun; Roux, Kenneth H; Taylor, Kenneth A

    2017-08-15

    The human immunodeficiency virus type 1 (HIV-1)/simian immunodeficiency virus (SIV) envelope spike (Env) mediates viral entry into host cells. The V3 loop of the gp120 component of the Env trimer contributes to the coreceptor binding site and is a target for neutralizing antibodies. We used cryo-electron tomography to visualize the binding of CD4 and the V3 loop monoclonal antibody (MAb) 36D5 to gp120 of the SIV Env trimer. Our results show that 36D5 binds gp120 at the base of the V3 loop and suggest that the antibody exerts its neutralization effect by blocking the coreceptor binding site. The antibody does this without altering the dynamics of the spike motion between closed and open states when CD4 is bound. The interaction between 36D5 and SIV gp120 is similar to the interaction between some broadly neutralizing anti-V3 loop antibodies and HIV-1 gp120. Two conformations of gp120 bound with CD4 are revealed, suggesting an intrinsic dynamic nature of the liganded Env trimer. CD4 binding substantially increases the binding of 36D5 to gp120 in the intact Env trimer, consistent with CD4-induced changes in the conformation of gp120 and the antibody binding site. Binding by MAb 36D5 does not substantially alter the proportions of the two CD4-bound conformations. The position of MAb 36D5 at the V3 base changes little between conformations, indicating that the V3 base serves as a pivot point during the transition between these two states. IMPORTANCE Glycoprotein spikes on the surfaces of SIV and HIV are the sole targets available to the immune system for antibody neutralization. Spikes evade the immune system by a combination of a thick layer of polysaccharide on the surface (the glycan shield) and movement between spike domains that masks the epitope conformation. Using SIV virions whose spikes were "decorated" with the primary cellular receptor (CD4) and an antibody (36D5) at part of the coreceptor binding site, we visualized multiple conformations trapped by the rapid freezing step, which were separated using statistical analysis. Our results show that the CD4-induced conformational dynamics of the spike enhances binding of the antibody. Copyright © 2017 American Society for Microbiology.

  18. Localization and characterization of an alpha-thrombin-binding site on platelet glycoprotein Ib alpha.

    PubMed

    De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M

    1994-03-04

    Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.

  19. Mercury(II) binds to both of chymotrypsin's histidines, causing inhibition followed by irreversible denaturation/aggregation.

    PubMed

    Stratton, Amanda; Ericksen, Matthew; Harris, Travis V; Symmonds, Nick; Silverstein, Todd P

    2017-02-01

    The toxicity of mercury is often attributed to its tight binding to cysteine thiolate anions in vital enzymes. To test our hypothesis that Hg(II) binding to histidine could be a significant factor in mercury's toxic effects, we studied the enzyme chymotrypsin, which lacks free cysteine thiols; we found that chymotrypsin is not only inhibited, but also denatured by Hg(II). We followed the aggregation of denatured enzyme by the increase in visible absorbance due to light scattering. Hg(II)-induced chymotrypsin precipitation increased dramatically above pH 6.5, and free imidazole inhibited this precipitation, implicating histidine-Hg(II) binding in the process of chymotrypsin denaturation/aggregation. Diethylpyrocarbonate (DEPC) blocked chymotrypsin's two histidines (his 40 and his 57 ) quickly and completely, with an IC 50 of 35 ± 6 µM. DEPC at 350 µM reduced the hydrolytic activity of chymotrypsin by 90%, suggesting that low concentrations of DEPC react with his 57 at the active site catalytic triad; furthermore, DEPC below 400 µM enhanced the Hg(II)-induced precipitation of chymotrypsin. We conclude that his 57 reacts readily with DEPC, causing enzyme inhibition and enhancement of Hg(II)-induced aggregation. Above 500 µM, DEPC inhibited Hg(II)-induced precipitation, and [DEPC] >2.5 mM completely protected chymotrypsin against precipitation. This suggests that his 40 reacts less readily with DEPC, and that chymotrypsin denaturation is caused by Hg(II) binding specifically to the his 40 residue. Finally, we show that Hg(II)-histidine binding may trigger hemoglobin aggregation as well. Because of results with these two enzymes, we suggest that metal-histidine binding may be key to understanding all heavy metal-induced protein aggregation. © 2017 The Protein Society.

  20. Dual-mode fluorophore-doped nickel nitrilotriacetic acid-modified silica nanoparticles combine histidine-tagged protein purification with site-specific fluorophore labeling.

    PubMed

    Kim, Sung Hoon; Jeyakumar, M; Katzenellenbogen, John A

    2007-10-31

    We present the first example of a fluorophore-doped nickel chelate surface-modified silica nanoparticle that functions in a dual mode, combining histidine-tagged protein purification with site-specific fluorophore labeling. Tetramethylrhodamine (TMR)-doped silica nanoparticles, estimated to contain 700-900 TMRs per ca. 23 nm particle, were surface modified with nitrilotriacetic acid (NTA), producing TMR-SiO2-NTA-Ni2+. Silica-embedded TMR retains very high quantum yield, is resistant to quenching by buffer components, and is modestly quenched and only to a certain depth (ca. 2 nm) by surface-attached Ni2+. When exposed to a bacterial lysate containing estrogen receptor alpha ligand binding domain (ERalpha) as a minor component, these beads showed very high specificity binding, enabling protein purification in one step. The capacity and specificity of these beads for binding a his-tagged protein were characterized by electrophoresis, radiometric counting, and MALDI-TOF MS. ERalpha, bound to TMR-SiO2-NTA-Ni++ beads in a site-specific manner, exhibited good activity for ligand binding and for ligand-induced binding to coactivators in solution FRET experiments and protein microarray fluorometric and FRET assays. This dual-mode type TMR-SiO2-NTA-Ni2+ system represents a powerful combination of one-step histidine-tagged protein purification and site-specific labeling with multiple fluorophore species.

  1. Biophysical insights into the interaction of clofazimine with human alpha 1-acid glycoprotein: a multitechnique approach.

    PubMed

    Ajmal, Mohammad Rehan; Almutairi, Fahad; Zaidi, Nida; Alam, Parvez; Siddiqi, Mohammad Khursheed; Khan, Mohsin Vahid; Zaman, Masihuz; Ishtikhar, Mohd; Khan, Rizwan Hasan

    2018-04-25

    Alpha1-acid glycoprotein (AAG) is a major acute phase protein of human plasma. Binding of clofazimine to AAG is investigated using optical spectroscopy and molecular docking tools. We found significant quenching of intrinsic fluorescence of AAG upon the binding of clofazimine, binding mode is static with binding constant of 3.52 × 10 4 at 298 K. The Gibbs free energy change is found to be negative for the interaction of clofazimine with AAG indicating spontaneity of the binding process. Binding of clofazimine induced ordered structure in protein and lead to molecular compaction. Molecular docking results indicate the binding site is located in the central beta barrel, hydrogen bonding and hydrophobic interactions are main bonding forces between AAG-clofazimine.

  2. Binding mechanism and dynamic conformational change of C subunit of PKA with different pathways

    PubMed Central

    Chu, Wen-Ting; Chu, Xiakun; Wang, Jin

    2017-01-01

    The catalytic subunit of PKA (PKAc) exhibits three major conformational states (open, intermediate, and closed) during the biocatalysis process. Both ATP and substrate/inhibitor can effectively induce the conformational changes of PKAc from open to closed states. Aiming to explore the mechanism of this allosteric regulation, we developed a coarse-grained model and analyzed the dynamics of conformational changes of PKAc during binding by performing molecular dynamics simulations for apo PKAc, binary PKAc (PKAc with ATP, PKAc with PKI), and ternary PKAc (PKAc with ATP and PKI). Our results suggest a mixed binding mechanism of induced fit and conformational selection, with the induced fit dominant. The ligands can drive the movements of Gly-rich loop as well as some regions distal to the active site in PKAc and stabilize them at complex state. In addition, there are two parallel pathways (pathway with PKAc-ATP as an intermediate and pathway PKAc-PKI as an intermediate) during the transition from open to closed states. By molecular dynamics simulations and rate constant analyses, we find that the pathway through PKAc-ATP intermediate is the main binding route from open to closed state because of the fact that the bound PKI will hamper ATP from successful binding and significantly increase the barrier for the second binding subprocess. These findings will provide fundamental insights of the mechanisms of PKAc conformational change upon binding. PMID:28855336

  3. Binding mechanism and dynamic conformational change of C subunit of PKA with different pathways.

    PubMed

    Chu, Wen-Ting; Chu, Xiakun; Wang, Jin

    2017-09-19

    The catalytic subunit of PKA (PKAc) exhibits three major conformational states (open, intermediate, and closed) during the biocatalysis process. Both ATP and substrate/inhibitor can effectively induce the conformational changes of PKAc from open to closed states. Aiming to explore the mechanism of this allosteric regulation, we developed a coarse-grained model and analyzed the dynamics of conformational changes of PKAc during binding by performing molecular dynamics simulations for apo PKAc, binary PKAc (PKAc with ATP, PKAc with PKI), and ternary PKAc (PKAc with ATP and PKI). Our results suggest a mixed binding mechanism of induced fit and conformational selection, with the induced fit dominant. The ligands can drive the movements of Gly-rich loop as well as some regions distal to the active site in PKAc and stabilize them at complex state. In addition, there are two parallel pathways (pathway with PKAc-ATP as an intermediate and pathway PKAc-PKI as an intermediate) during the transition from open to closed states. By molecular dynamics simulations and rate constant analyses, we find that the pathway through PKAc-ATP intermediate is the main binding route from open to closed state because of the fact that the bound PKI will hamper ATP from successful binding and significantly increase the barrier for the second binding subprocess. These findings will provide fundamental insights of the mechanisms of PKAc conformational change upon binding.

  4. Atrazine Molecular Imprinted Polymers: Comparative Analysis by Far-Infrared and Ultraviolet Induced Polymerization

    PubMed Central

    Chen, Jun; Bai, Lian-Yang; Liu, Kun-Feng; Liu, Run-Qiang; Zhang, Yu-Ping

    2014-01-01

    Atrazine molecular imprinted polymers (MIPs) were comparatively synthesized using identical polymer formulation by far-infrared (FIR) radiation and ultraviolet (UV)-induced polymerization, respectively. Equilibrium binding experiments were carried out with the prepared MIPs; the results showed that MIPuv possessed specific binding to atrazine compared with their MIPFIR radiation counterparts. Scatchard plot’s of both MIPs indicated that the affinities of the binding sites in MIPs are heterogeneous and can be approximated by two dissociation-constants corresponding to the high-and low-affinity binding sites. Moreover, several common pesticides including atrazine, cyromazine, metamitron, simazine, ametryn, terbutryn were tested to determine their specificity, similar imprinting factor (IF) and different selectivity index (SI) for both MIPs. Physical characterization of the polymers revealed that the different polymerization methods led to slight differences in polymer structures and performance by scanning electron microscope (SEM), Fourier transform infrared absorption (FT-IR), and mercury analyzer (MA). Finally, both MIPs were used as selective sorbents for solid phase extraction (SPE) of atrazine from lake water, followed by high performance liquid chromatography (HPLC) analysis. Compared with commercial C18 SPE sorbent (86.4%–94.8%), higher recoveries of atrazine in spiked lake water were obtained in the range of 90.1%–97.1% and 94.4%–101.9%, for both MIPs, respectively. PMID:24398982

  5. The Fn14 cytoplasmic tail binds tumour-necrosis-factor-receptor-associated factors 1, 2, 3 and 5 and mediates nuclear factor-kappaB activation.

    PubMed Central

    Brown, Sharron A N; Richards, Christine M; Hanscom, Heather N; Feng, Sheau-Line Y; Winkles, Jeffrey A

    2003-01-01

    Fn14 is a growth-factor-inducible immediate-early-response gene encoding a 102-amino-acid type I transmembrane protein. The human Fn14 protein was recently identified as a cell-surface receptor for the tumour necrosis factor (TNF) superfamily member named TWEAK (TNF-like weak inducer of apoptosis). In the present paper, we report that the human TWEAK extracellular domain can also bind the murine Fn14 protein. Furthermore, site-specific mutagenesis and directed yeast two-hybrid interaction assays revealed that the TNFR-associated factor (TRAF) 1, 2, 3 and 5 adaptor molecules bind the murine Fn14 cytoplasmic tail at an overlapping, but non-identical, amino acid sequence motif. We also found that TWEAK treatment of quiescent NIH 3T3 cells stimulates inhibitory kappaBalpha phosphorylation and transcriptional activation of a nuclear factor-kappaB (NF-kappaB) enhancer/luciferase reporter construct. Fn14 overexpression in transiently transfected NIH 3T3 cells also promotes NF-kappaB activation, and this cellular response requires an intact TRAF binding site. These results indicate that Fn14 is a functional TWEAK receptor that can associate with four distinct TRAF family members and stimulate the NF-kappaB transcription factor signalling pathway. PMID:12529173

  6. Calcium binding to calmodulin mutants monitored by domain-specific intrinsic phenylalanine and tyrosine fluorescence.

    PubMed Central

    VanScyoc, Wendy S; Sorensen, Brenda R; Rusinova, Elena; Laws, William R; Ross, J B Alexander; Shea, Madeline A

    2002-01-01

    Cooperative calcium binding to the two homologous domains of calmodulin (CaM) induces conformational changes that regulate its association with and activation of numerous cellular target proteins. Calcium binding to the pair of high-affinity sites (III and IV in the C-domain) can be monitored by observing calcium-dependent changes in intrinsic tyrosine fluorescence intensity (lambda(ex)/lambda(em) of 277/320 nm). However, calcium binding to the low-affinity sites (I and II in the N-domain) is more difficult to measure with optical spectroscopy because that domain of CaM does not contain tryptophan or tyrosine. We recently demonstrated that calcium-dependent changes in intrinsic phenylalanine fluorescence (lambda(ex)/lambda(em) of 250/280 nm) of an N-domain fragment of CaM reflect occupancy of sites I and II (VanScyoc, W. S., and M. A. Shea, 2001, Protein Sci. 10:1758-1768). Using steady-state and time-resolved fluorescence methods, we now show that these excitation and emission wavelength pairs for phenylalanine and tyrosine fluorescence can be used to monitor equilibrium calcium titrations of the individual domains in full-length CaM. Calcium-dependent changes in phenylalanine fluorescence specifically indicate ion occupancy of sites I and II in the N-domain because phenylalanine residues in the C-domain are nonemissive. Tyrosine emission from the C-domain does not interfere with phenylalanine fluorescence signals from the N-domain. This is the first demonstration that intrinsic fluorescence may be used to monitor calcium binding to each domain of CaM. In this way, we also evaluated how mutations of two residues (Arg74 and Arg90) located between sites II and III can alter the calcium-binding properties of each of the domains. The mutation R74A caused an increase in the calcium affinity of sites I and II in the N-domain. The mutation R90A caused an increase in calcium affinity of sites III and IV in the C-domain whereas R90G caused an increase in calcium affinity of sites in both domains. This approach holds promise for exploring the linked energetics of calcium binding and target recognition. PMID:12414709

  7. Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less

  8. Structural studies of the natriuretic peptide receptor: a novel hormone-induced rotation mechanism for transmembrane signal transduction.

    PubMed

    Misono, Kunio S; Ogawa, Haruo; Qiu, Yue; Ogata, Craig M

    2005-06-01

    The atrial natriuretic peptide (ANP) receptor is a single-span transmembrane receptor that is coupled to its intrinsic intracellular guanylate cyclase (GCase) catalytic activity. To investigate the mechanisms of hormone binding and signal transduction, we have expressed the extracellular hormone-binding domain of the ANP receptor (ANPR) and characterized its structure and function. The disulfide-bond structure, state of glycosylation, binding-site residues, chloride-dependence of ANP binding, dimerization, and binding stoichiometry have been determined. More recently, the crystal structures of both the apoANPR dimer and ANP-bound complex have been determined. The structural comparison between the two has shown that, upon ANP binding, two ANPR molecules in the dimer undergo an inter-molecular twist with little intra-molecular conformational change. This motion produces a Ferris wheel-like translocation of two juxtamembrane domains with essentially no change in the inter-domain distance. This movement alters the relative orientation of the two domains equivalent to counter-clockwise rotation of each by 24 degrees . These results suggest that transmembrane signaling by the ANP receptor is mediated by a novel hormone-induced rotation mechanism.

  9. In silico Analysis of Conformational Changes Induced by Mutation of Aromatic Binding Residues: Consequences for Drug Binding in the hERG K+ Channel

    PubMed Central

    Knape, Kirsten; Linder, Tobias; Wolschann, Peter; Beyer, Anton; Stary-Weinzinger, Anna

    2011-01-01

    Pharmacological inhibition of cardiac hERG K+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652) substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences. PMID:22194911

  10. Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

    PubMed Central

    Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

    2017-01-01

    Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

  11. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents.

    PubMed

    Olazaran, Fabián E; Rivera, Gildardo; Pérez-Vázquez, Alondra M; Morales-Reyes, Cynthia M; Segura-Cabrera, Aldo; Balderas-Rentería, Isaías

    2017-01-12

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [ N -( p -methoxy-phenyl)-2-( p -methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site.

  12. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents

    PubMed Central

    2016-01-01

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [N-(p-methoxy-phenyl)-2-(p-methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site. PMID:28105271

  13. The Role of TIR-NBS and TIR-X Proteins in Plant Basal Defense Responses1[W][OA

    PubMed Central

    Nandety, Raja Sekhar; Caplan, Jeffery L.; Cavanaugh, Keri; Perroud, Bertrand; Wroblewski, Tadeusz; Michelmore, Richard W.; Meyers, Blake C.

    2013-01-01

    Toll/interleukin receptor (TIR) domain-containing proteins encoded in the Arabidopsis (Arabidopsis thaliana) genome include the TIR-nucleotide binding site (TN) and TIR-unknown site/domain (TX) families. We investigated the function of these proteins. Transient overexpression of five TX and TN genes in tobacco (Nicotiana benthamiana) induced chlorosis. This induced chlorosis was dependent on ENHANCED DISEASE RESISTANCE1, a dependency conserved in both tobacco and Arabidopsis. Stable overexpression transgenic lines of TX and TN genes in Arabidopsis produced a variety of phenotypes associated with basal innate immune responses; these were correlated with elevated levels of salicylic acid. The TN protein AtTN10 interacted with the chloroplastic protein phosphoglycerate dehydrogenase in a yeast (Saccharomyces cerevisiae) two-hybrid screen; other TX and TN proteins interacted with nucleotide binding-leucine-rich repeat proteins and effector proteins, suggesting that TN proteins might act in guard complexes monitoring pathogen effectors. PMID:23735504

  14. The role of TIR-NBS and TIR-X proteins in plant basal defense responses.

    PubMed

    Nandety, Raja Sekhar; Caplan, Jeffery L; Cavanaugh, Keri; Perroud, Bertrand; Wroblewski, Tadeusz; Michelmore, Richard W; Meyers, Blake C

    2013-07-01

    Toll/interleukin receptor (TIR) domain-containing proteins encoded in the Arabidopsis (Arabidopsis thaliana) genome include the TIR-nucleotide binding site (TN) and TIR-unknown site/domain (TX) families. We investigated the function of these proteins. Transient overexpression of five TX and TN genes in tobacco (Nicotiana benthamiana) induced chlorosis. This induced chlorosis was dependent on ENHANCED DISEASE RESISTANCE1, a dependency conserved in both tobacco and Arabidopsis. Stable overexpression transgenic lines of TX and TN genes in Arabidopsis produced a variety of phenotypes associated with basal innate immune responses; these were correlated with elevated levels of salicylic acid. The TN protein AtTN10 interacted with the chloroplastic protein phosphoglycerate dehydrogenase in a yeast (Saccharomyces cerevisiae) two-hybrid screen; other TX and TN proteins interacted with nucleotide binding-leucine-rich repeat proteins and effector proteins, suggesting that TN proteins might act in guard complexes monitoring pathogen effectors.

  15. PARP-1 dependent recruitment of the amyotrophic lateral sclerosis-associated protein FUS/TLS to sites of oxidative DNA damage

    PubMed Central

    Rulten, Stuart L.; Rotheray, Amy; Green, Ryan L.; Grundy, Gabrielle J.; Moore, Duncan A. Q.; Gómez-Herreros, Fernando; Hafezparast, Majid; Caldecott, Keith W

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is associated with progressive degeneration of motor neurons. Several of the genes associated with this disease encode proteins involved in RNA processing, including fused-in-sarcoma/translocated-in-sarcoma (FUS/TLS). FUS is a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) family of proteins that bind thousands of pre-mRNAs and can regulate their splicing. Here, we have examined the possibility that FUS is also a component of the cellular response to DNA damage. We show that both GFP-tagged and endogenous FUS re-localize to sites of oxidative DNA damage induced by UVA laser, and that FUS recruitment is greatly reduced or ablated by an inhibitor of poly (ADP-ribose) polymerase activity. Consistent with this, we show that recombinant FUS binds directly to poly (ADP-ribose) in vitro, and that both GFP-tagged and endogenous FUS fail to accumulate at sites of UVA laser induced damage in cells lacking poly (ADP-ribose) polymerase-1. Finally, we show that GFP-FUSR521G, harbouring a mutation that is associated with ALS, exhibits reduced ability to accumulate at sites of UVA laser-induced DNA damage. Together, these data suggest that FUS is a component of the cellular response to DNA damage, and that defects in this response may contribute to ALS. PMID:24049082

  16. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent 99mTc-Duramycin

    PubMed Central

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G.; Zhao, Ming

    2013-01-01

    Introduction 99mTc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between 99mTc-Duramycin and the target tissue. Methods High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague Dawley rats. Target binding and biodistribution of 99mTc-duramycin was captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of 99mTc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of 99mTc-Duramycin in normal and ischemic myocardial tissue. Results 99mTc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to 99mTc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for 99mTc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9 fold reduction in binding affinity. Conclusion 99mTc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of 99mTc-Duramycin as a novel PE-binding agent. PMID:22534031

  17. The transformed glucocorticoid receptor has a lower steroid-binding affinity than the nontransformed receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemoto, Takayuki; Ohara-Nemoto, Yuko; Denis, M.

    1990-02-20

    High-salt treatment of cytosolic glucocorticoid receptor (GR) preparations reduces the steroid-binding ability of the receptor and induces the conversion of the receptor from a nontransformed (non-DNA-binding) 9S form to a transformed (DNA-binding) 4S entity. Therefore, the authors decided to investigate the possible relationship between these two phenomena. The binding of ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) to the 9S form was almost saturated at a concentration of 20 nM, whereas ({sup 3}H)TA was hardly bound to the 4S form at this concentration. The 4S form was efficiently labeled at 200 nM. Scatchard analysis of the GR showed the presence of twomore » types of binding sites. In the absence of molybdate, the ratio of the lower affinity site was increased, but the total number of binding sites was not modified. The GR with the low ({sup 3}H)TA-binding affinity bound to DNA-cellulose even in its unliganded state, whereas the form with the high affinity did not. These results indicate that the transformed GR has a reduced ({sup 3}H)TA-binding affinity as compared to the nontransformed GR. The steroid-binding domain (amino acids 477-777) and the DNA- and steroid-binding domains (amino acids 415-777) of the human GR were expressed in Escherichia coli as protein A fused proteins. Taken together, these results suggest that the component(s) associating with the nontransformed GR, possibly the heat shock protein hsp 90, play(s) an important role in stabilizing the GR in a high-affinity state for steroids.« less

  18. Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

    PubMed Central

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-01-01

    Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

  19. Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

    PubMed

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-08-09

    The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

  20. The N253F mutant structure of trehalose synthase from Deinococcus radiodurans reveals an open active-site topology.

    PubMed

    Chow, Sih Yao; Wang, Yung Lin; Hsieh, Yu Chiao; Lee, Guan Chiun; Liaw, Shwu Huey

    2017-11-01

    Trehalose synthase (TS) catalyzes the reversible conversion of maltose to trehalose and belongs to glycoside hydrolase family 13 (GH13). Previous mechanistic analysis suggested a rate-limiting protein conformational change, which is probably the opening and closing of the active site. Consistently, crystal structures of Deinococcus radiodurans TS (DrTS) in complex with the inhibitor Tris displayed an enclosed active site for catalysis of the intramoleular isomerization. In this study, the apo structure of the DrTS N253F mutant displays a new open conformation with an empty active site. Analysis of these structures suggests that substrate binding induces a domain rotation to close the active site. Such a substrate-induced domain rotation has also been observed in some other GH13 enzymes.

  1. The fast release of sticky protons: Kinetics of substrate binding and proton release in a multidrug transporter

    PubMed Central

    Adam, Yoav; Tayer, Naama; Rotem, Dvir; Schreiber, Gideon; Schuldiner, Shimon

    2007-01-01

    EmrE is an Escherichia coli H+-coupled multidrug transporter that provides a unique experimental paradigm because of its small size and stability, and because its activity can be studied in detergent solution. In this work, we report a study of the transient kinetics of substrate binding and substrate-induced proton release in EmrE. For this purpose, we measured transient changes in the tryptophan fluorescence upon substrate binding and the rates of substrate-induced proton release. The fluorescence of the essential and fully conserved Trp residue at position 63 is sensitive to the occupancy of the binding site with either protons or substrate. The maximal rate of binding to detergent-solubilized EmrE of TPP+, a high-affinity substrate, is 2 × 107 M−1·s−1, a rate typical of diffusion-limited reactions. Rate measurements with medium- and low-affinity substrates imply that the affinity is determined mainly by the koff of the substrate. The rates of substrate binding and substrate-induced release of protons are faster at basic pHs and slower at lower pHs. These findings imply that the substrate-binding rates are determined by the generation of the species capable of binding; this is controlled by the high affinity to protons of the glutamate at position 14, because an Asp replacement with a lower pK is faster at the same pHs. PMID:17984053

  2. Glomerular anionic site distribution in nonproteinuric rats. A computer-assisted morphometric analysis.

    PubMed

    Pilia, P A; Swain, R P; Williams, A V; Loadholt, C B; Ainsworth, S K

    1985-12-01

    The cationic ultrastructural tracer polyethyleneimine (PEI: pI approximately equal to 11.0), binds electrophysically to uniformly spaced discrete electron-dense anionic sites present in the laminae rarae of the rat glomerular basement membrane (GBM), mesangial reflections of the GBM, Bowman's capsule, and tubular basement membranes when administered intravenously. Computer-assisted morphometric analysis of glomerular anionic sites reveals that the maximum concentration of stainable lamina rara externa (lre) sites (21/10,000 A GBM) occurs 60 minutes after PEI injection with a site-site interspacing of 460 A. Lamina rara interna (lri) sites similarly demonstrate a maximum concentration (20/10,000 A GBM) at 60 minutes with a periodicity of 497 A. The concentration and distribution of anionic sites within the lri was irregular in pattern and markedly decreased in number, while the lre possesses an electrical field that is highly regular at all time intervals analyzed (15, 30, 60, 120, 180, 240, and 300 minutes). Immersion and perfusion of renal tissue with PEI reveals additional heavy staining of the epithelial and endothelial cell sialoprotein coatings. PEI appears to bind to glomerular anionic sites reversibly: ie, between 60 and 180 minutes the concentration of stained sites decreases. At 300 minutes, the interspacing once again approaches the 60-minute concentration. This suggests a dynamic turnover or dissociation followed by a reassociation of glomerular negatively charged PEI binding sites. In contrast, morphometric analysis of anionic sites stained with lysozyme and protamine sulfate reveals interspacings of 642 A and 585 A, respectively; in addition, these tracers produce major glomerular ultrastructural alterations and induce transient proteinuria. PEI does not induce proteinuria in rats, nor does it produce glomerular morphologic alterations when ten times the tracer dosage is administered intravenously. These findings indicate that the choice of ultrastructural charge tracer, the method of administering the tracer, and the time selected for analysis of tissue after administration of tracer significantly influences results. Morphometric analysis of the distribution of glomerular anionic sites in nonproteinuric rats provides a method of evaluating quantitative alterations of the glomerular charge barrier in renal disease models.

  3. The Lumenal Loop Met672–Pro707 of Copper-transporting ATPase ATP7A Binds Metals and Facilitates Copper Release from the Intramembrane Sites*

    PubMed Central

    Barry, Amanda N.; Otoikhian, Adenike; Bhatt, Sujata; Shinde, Ujwal; Tsivkovskii, Ruslan; Blackburn, Ninian J.; Lutsenko, Svetlana

    2011-01-01

    The copper-transporting ATPase ATP7A has an essential role in human physiology. ATP7A transfers the copper cofactor to metalloenzymes within the secretory pathway; inactivation of ATP7A results in an untreatable neurodegenerative disorder, Menkes disease. Presently, the mechanism of ATP7A-mediated copper release into the secretory pathway is not understood. We demonstrate that the characteristic His/Met-rich segment Met672–Pro707 (HM-loop) that connects the first two transmembrane segments of ATP7A is important for copper release. Mutations within this loop do not prevent the ability of ATP7A to form a phosphorylated intermediate during ATP hydrolysis but inhibit subsequent dephosphorylation, a step associated with copper release. The HM-loop inserted into a scaffold protein forms two structurally distinct binding sites and coordinates copper in a mixed His-Met environment with an ∼2:1 stoichiometry. Binding of either copper or silver, a Cu(I) analog, induces structural changes in the loop. Mutations of 4 Met residues to Ile or two His-His pairs to Ala-Gly decrease affinity for copper. Altogether, the data suggest a two-step process, where copper released from the transport sites binds to the first His(Met)2 site, triggering a structural change and binding to a second 2-coordinate His-His or His-Met site. We also show that copper binding within the HM-loop stabilizes Cu(I) and protects it from oxidation, which may further aid the transfer of copper from ATP7A to acceptor proteins. The mechanism of copper entry into the secretory pathway is discussed. PMID:21646353

  4. Crystal structure of Urtica dioica agglutinin, a superantigen presented by MHC molecules of class I and class II.

    PubMed

    Saul, F A; Rovira, P; Boulot, G; Damme, E J; Peumans, W J; Truffa-Bachi, P; Bentley, G A

    2000-06-15

    Urtica dioica agglutinin (UDA), a monomeric lectin extracted from stinging nettle rhizomes, is specific for saccharides containing N-acetylglucosamine (GlcNAc). The lectin behaves as a superantigen for murine T cells, inducing the exclusive proliferation of Vbeta8.3(+) lymphocytes. UDA is unique among known T cell superantigens because it can be presented by major histocompatibility complex (MHC) molecules of both class I and II. The crystal structure of UDA has been determined in the ligand-free state, and in complex with tri-acetylchitotriose and tetra-acetylchitotetraose at 1.66 A, 1.90 A and 1.40 A resolution, respectively. UDA comprises two hevein-like domains, each with a saccharide-binding site. A serine and three aromatic residues at each site form the principal contacts with the ligand. The N-terminal domain binding site can centre on any residue of a chito-oligosaccharide, whereas that of the C-terminal domain is specific for residues at the nonreducing terminus of the ligand. We have shown previously that oligomers of GlcNAc inhibit the superantigenic activity of UDA and that the lectin binds to glycans on the MHC molecule. We show that UDA also binds to glycans on the T cell receptor (TCR). The presence of two saccharide-binding sites observed in the structure of UDA suggests that its superantigenic properties arise from the simultaneous fixation of glycans on the TCR and MHC molecules of the T cell and antigen-presenting cell, respectively. The well defined spacing between the two binding sites of UDA is probably a key factor in determining the specificity for Vbeta8.3(+) lymphocytes.

  5. Occupancy of the Zinc-binding Site by Transition Metals Decreases the Substrate Affinity of the Human Dopamine Transporter by an Allosteric Mechanism*

    PubMed Central

    Li, Yang; Mayer, Felix P.; Hasenhuetl, Peter S.; Burtscher, Verena; Schicker, Klaus; Sitte, Harald H.; Freissmuth, Michael; Sandtner, Walter

    2017-01-01

    The human dopamine transporter (DAT) has a tetrahedral Zn2+-binding site. Zn2+-binding sites are also recognized by other first-row transition metals. Excessive accumulation of manganese or of copper can lead to parkinsonism because of dopamine deficiency. Accordingly, we examined the effect of Mn2+, Co2+, Ni2+, and Cu2+ on transport-associated currents through DAT and DAT-H193K, a mutant with a disrupted Zn2+-binding site. All transition metals except Mn2+ modulated the transport cycle of wild-type DAT with affinities in the low micromolar range. In this concentration range, they were devoid of any action on DAT-H193K. The active transition metals reduced the affinity of DAT for dopamine. The affinity shift was most pronounced for Cu2+, followed by Ni2+ and Zn2+ (= Co2+). The extent of the affinity shift and the reciprocal effect of substrate on metal affinity accounted for the different modes of action: Ni2+ and Cu2+ uniformly stimulated and inhibited, respectively, the substrate-induced steady-state currents through DAT. In contrast, Zn2+ elicited biphasic effects on transport, i.e. stimulation at 1 μm and inhibition at 10 μm. A kinetic model that posited preferential binding of transition metal ions to the outward-facing apo state of DAT and a reciprocal interaction of dopamine and transition metals recapitulated all experimental findings. Allosteric activation of DAT via the Zn2+-binding site may be of interest to restore transport in loss-of-function mutants. PMID:28096460

  6. Two reaction pathways for transformation of high potential cytochrome b559 of PS II into the intermediate potential form.

    PubMed

    Kaminskaya, Olga; Shuvalov, Vladimir A; Renger, Gernot

    2007-06-01

    This study describes an analysis of different treatments that influence the relative content and the midpoint potential of HP Cyt b559 in PS II membrane fragments from higher plants. Two basically different types of irreversible modification effects are distinguished: the HP form of Cyt b559 is either predominantly affected when the heme group is oxidized ("O-type" effects) or when it is reduced ("R-type" effects). Transformation of HP Cyt b559 to lower potential redox forms (IP and LP forms) by the "O-type" mechanism is induced by high pH and detergent treatments. In this case the effects consist of a gradual decrease in the relative content of HP Cyt b559 while its midpoint potential remains unaffected. Transformation of HP Cyt b559 via an "R-type" mechanism is caused by a number of exogenous compounds denoted L: herbicides, ADRY reagents and tetraphenylboron. These compounds are postulated to bind to the PS II complex at a quinone binding site designated as Q(C) which interacts with Cyt b559 and is clearly not the Q(B) site. Binding of compounds L to the Q(C) site when HP Cyt b559 is oxidized gives rise to a gradual decrease in the E(m) of HP Cyt b559 with increasing concentration of L (up to 10 K(ox)(L) values) while the relative content of HP Cyt b559 is unaffected. Higher concentrations of compounds L required for their binding to Q(C) site when HP Cyt b559 is reduced (described by K(red)(L)) induce a conversion of HP Cyt b559 to lower potential redox forms ("R-type" transformation). Two reaction pathways for transitions of Cyt b559 between the different protein conformations that are responsible for the HP and IP/LP redox forms are proposed and new insights into the functional regulation of Cyt b559 via the Q(C) site are discussed.

  7. Binding and effects of KATP channel openers in the vascular smooth muscle cell line, A10

    PubMed Central

    Russ, Ulrich; Metzger, Friedrich; Kickenweiz, Elisabeth; Hambrock, Annette; Krippeit-Drews, Peter; Quast, Ulrich

    1997-01-01

    The ATP-sensitive K+ channel (KATP channel) in A10 cells, a cell line derived from rat thoracic aorta, was characterized by binding studies with the tritiated KATP channel opener, [3H]-P1075, and by electrophysiological techniques. Saturation binding experiments gave a KD value of 9.2±5.2 nM and a binding capacity (BMax) of 140±40 fmol mg−1 protein for [3H]-P1075 binding to A10 cells; from the BMax value a density of binding sites of 5–10 per μm2 plasmalemma was estimated. KATP channel modulators such as the openers P1075, pinacidil, levcromakalim and minoxidil sulphate and the blocker glibenclamide inhibited [3H]-P1075 binding. The extent of inhibition at saturation depended on the compound, levcromakalim inhibiting specific [3H]-P1075 binding by 85%, minoxidil sulphate and glibenclamide by 70%. The inhibition constants were similar to those determined in strips of rat aorta. Resting membrane potential, recorded with microelectrodes, was −51±1 mV. P1075 and levcromakalim produced a concentration-dependent hyperpolarization by up to −25 mV with EC50 values of 170±40 nM and 870±190 nM, respectively. The hyperpolarization induced by levcromakalim (3 μM) was completely reversed by glibenclamide with an IC50 value of 86±17 nM. Voltage clamp experiments were performed in the whole cell configuration under a physiological K+ gradient. Levcromakalim (10 μM) induced a current which reversed around −80 mV; the current-voltage relationship showed considerable outward rectification. Glibenclamide (3 μM) abolished the effect of levcromakalim. Analysis of the noise of the levcromakalim (10 μM)-induced current at −40 and −20 mV yielded estimates of the channel density, the single channel conductance and the probability of the channel to be open of 0.14 μm−2, 8.8 pS and 0.39, respectively. The experiments showed that A10 cells are endowed with functional KATP channels which resemble those in vascular tissue; hence, these cells provide an easily accessible source of channels for biochemical and pharmacological studies. The density of binding sites for [3H]-P1075 was estimated to be one order of magnitude higher than the density of functional KATP channels; assuming a plasmalemmal localization of the binding sites this suggests a large receptor reserve for the openers in A10 cells. PMID:9401776

  8. Aluminum as an inducer of the mitochondrial permeability transition.

    PubMed

    Toninello, A; Clari, G; Mancon, M; Tognon, G; Zatta, P

    2000-10-01

    Treatment of rat liver mitochondria with aluminum in the presence of Ca2+ results in large amplitude swelling accompanied by loss of endogenous Mg2+ and K+ and oxidation of endogenous pyridine nucleotides. The presence of cyclosporin A, ADP, bongkrekic acid, N-ethylmaleimide and dithioerythritol prevent these effects, indicating that binding of aluminum to the inner mitochondrial membrane, most likely at the level of adenine nucleotide translocase, correlates with the induction of the membrane permeability transition (MPT). Indeed, aluminum binding promotes such a perturbation at the level of ubiquinol-cytochrome c reductase, which favors the production of reactive oxygen species. These metabolites generate an oxidative stress involving two previously defined sites in equilibrium with the glutathione and pyridine nucleotides pools, the levels of which correlate with the increase in MPT induction. Although the above-described phenomena are typical of MPT, they are not paralleled by other events normally observed in response to treatment with inducers of MPT (e.g., phosphate), such as the collapse of the electrochemical gradient and the release of accumulated Ca2+ and oxidized pyridine nucleotides. Biochemical and ultrastructural observations demonstrate that aluminum induces a pore opening having a conformation intermediate between fully open and closed in a subpopulation of mitochondria. While inorganic phosphate enhances the MPT induced by ruthenium red plus a deenergizing agent, aluminum instead inhibits this phenomenon. This finding suggests the presence of a distinct binding site for aluminum differing from that involved in MPT induction.

  9. The neuronal nitric oxide synthase inhibitor, 7-nitroindazole, protects against methamphetamine-induced neurotoxicity in vivo.

    PubMed

    Itzhak, Y; Ali, S F

    1996-10-01

    The present study was undertaken to investigate whether the relatively selective neuronal nitric oxide synthase (NOS) inhibitor, 7-nitroindazole (7-NI), protects against methamphetamine (METH)-induced neurotoxicity. Male Swiss Webster mice received the following treatments (i.p.; q 3 h x 3): (a) vehicle/saline, (b) 7-NI (25 mg/kg)/saline, (c) vehicle/METH (5 mg/kg), and (d) 7-NI (25 mg/kg)/METH (5 mg/kg). On the second day, groups (a) and (b) received two vehicle injections, and groups (c) and (d) received two 7-NI injections (25 mg/kg, each). Administration of vehicle/METH resulted in 68, 44, and 55% decreases in the concentration of dopamine, 3,4-dihydroxyphenylacetic acid, and homovanillic acid, respectively, and a 48% decrease in the number of [3H]mazindol binding sites in the striatum compared with control values. Treatment with 7-NI (group d) provided full protection against the depletion of dopamine and its metabolites and the loss of dopamine transporter binding sites. Administration of 7-NI/saline (group b) affected neither the tissue concentration of dopamine and its metabolites nor the binding parameters of [3H] mazindol compared with control values. 7-NI had no significant effect on animals' body temperature, and it did not affect METH-induced hyperthermia. These findings indicate a role for nitric oxide in methamphetamine-induced neurotoxicity and also suggest that blockade of NOS may be beneficial for the management of Parkinson's disease.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang

    Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of themore » bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.« less

  11. Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.

    PubMed

    Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R

    1982-02-01

    Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (<0.4 pmol/10(7) cells per min) and NBMPR binding (<3,000 sites/cell) for the treated group. In summary, myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10-fold between leukemic blasts and normal leukocytes, but transport capacity related directly to the number of nucleoside transport sites on the cell. Finally, low araC transport rates or few NBMPR binding sites on blasts were observed in a subset of patients with acute leukemia who failed to achieve remission with drug combinations containing araC.

  12. Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit

    PubMed Central

    Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G

    1999-01-01

    Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the apex of a β sheet in the N-terminal extracellular domain. PMID:10517800

  13. Cholinergic nicotinic and muscarinic receptors in dementia of Alzheimer, Parkinson and Lewy body types.

    PubMed

    Perry, E K; Smith, C J; Court, J A; Perry, R H

    1990-01-01

    Cholinergic nicotinic and muscarinic receptor binding were measured in post mortem human brain tissue, using low (nM) concentrations of (3H)-nicotine to detect predominately the high affinity nicotinic site and (3H)-N-methylscopolamine in the presence and absence of 3 x 10(-4) M carbachol to measure both the low and high affinity agonist subtypes of the muscarinic receptor group. Consistent with most previous reports, the nicotinic but not muscarinic binding was reduced in the different forms of dementia associated with cortical cholinergic deficits, including Alzheimer's and Parkinson's disease, senile dementia of Lewy body type (SDLT) and Down's syndrome (over 50 years). Analysis of (3H)-nicotine binding displaced by a range of carbachol concentrations (10(-9)-10(-3) M) indicated 2 binding sites for nicotine and that the high affinity rather than low affinity site was reduced in Alzheimer's disease. In all 3 cortical areas investigated (temporal, parietal and occipital) there were increases in the low affinity muscarinic site in Parkinson's disease and SDLT but not Alzheimer's disease or middle-aged Down's syndrome. This observation raised the question of whether the presence of neurofibrillary tangles (evident in the latter but not former 2 disorders) is incompatible with denervation-induced muscarinic supersensitivity in cholinoceptive neurons which include cortical pyramids generally affeted by tangle formation.

  14. Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

    PubMed Central

    Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

    2015-01-01

    Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

  15. Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

    PubMed Central

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

    2014-01-01

    Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

  16. A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

    PubMed Central

    Weidmann, Alyson G.; Barton, Jacqueline K.

    2015-01-01

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

  17. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    PubMed

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  18. Effect of N-benzoyl-D-phenylalanine and metformin on insulin receptors in neonatal streptozotocin-induced diabetic rats: studies on insulin binding to erythrocytes.

    PubMed

    Ashokkumar, N; Pari, L; Rao, Ch Appa

    2006-07-01

    In the present study, we focused on the insulin-receptor binding in circulating erythrocytes of N-benzoyl-D-phenylalanine (NBDP) and metformin in neonatal streptozotocin (nSTZ)-induced male Wistar rats. We measured blood levels of glucose and plasma insulin and the binding of insulin to cell-membrane ER receptors in NBDP and metformin-treated diabetic rats. The mean specific binding of insulin to ER was significantly lower in diabetic control rats (DC) (53.0 +/- 3.1%) than in NBDP (62.0 +/- 3.1%), metformin (66.0 +/- 3.3%) and NBDP and metformin combination-treated (72.0 +/- 4.2%) diabetic rats, resulting in a significant decrease in plasma insulin. Scatchard plot analysis demonstrated that the decrease in insulin binding was accounted for by a lower number of insulin receptor sites per cell in DC rats when compared with NBDP and metformin-treated rats. High-affinity (Kd1), low-affinity (Kd2), and kinetic analysis revealed an increase in the average receptor affinity in ER from NBDP and metformin-treated diabetic rats having NBDP 2.0 +/- 0.10 x 10(-10) M(-1) (Kd1); 12.0 +/- 0.85 x 10(-8) M(-1) (Kd2), Metformin 2.1 +/- 0.15 x 10(-10) M(-1) (Kd1); 15.0 +/- 0.80 x 10(-8) M(-1) (Kd2), NBDP and metformin 2.7 +/- 0.10 x 10(-10) M(-1) (Kd1); 20.0 +/- 1.2 x 10(-8) M(-1) (Kd2) compared with 0.9 +/- 0.06 x 10(-10) M(-1) (Kd1); 6.0 +/- 0.30 x 10(-8) M(-1) (Kd2) in DC rats. The results suggest an acute alteration in the number of insulin receptors on ER membranes in nSTZ induced diabetic control rats. Treatment with NBDP along with metformin significantly improved specific insulin binding, with receptor number and affinity binding reaching almost normal non-diabetic levels. The data presented here show that NBDP along with metformin increase total ER membrane insulin binding sites with a concomitant significant increase in plasma insulin.

  19. Both internalization and AIP1 association are required for tumor necrosis factor receptor 2-mediated JNK signaling.

    PubMed

    Ji, Weidong; Li, Yonghao; Wan, Ting; Wang, Jing; Zhang, Haifeng; Chen, Hong; Min, Wang

    2012-09-01

    The proinflammtory cytokine tumor necrosis factor (TNF), primarily via TNF receptor 1 (TNFR1), induces nuclear factor-κB (NF-κB)-dependent cell survival, and c-Jun N-terminal kinase (JNK) and caspase-dependent cell death, regulating vascular endothelial cell (EC) activation and apoptosis. However, signaling by the second receptor, TNFR2, is poorly understood. The goal of this study was to dissect how TNFR2 mediates NF-κB and JNK signaling in vascular EC, and its relevance to in vivo EC function. We show that TNFR2 contributes to TNF-induced NF-κB and JNK signaling in EC as TNFR2 deletion or knockdown reduces the TNF responses. To dissect the critical domains of TNFR2 that mediate the TNF responses, we examine the activity of TNFR2 mutant with a specific deletion of the TNFR2 intracellular region, which contains conserved domain I, domain II, domain III, and 2 TNFR-associated factor-2-binding sites. Deletion analyses indicate that different sequences on TNFR2 have distinct roles in NF-κB and JNK activation. Specifically, deletion of the TNFR-associated factor-2-binding sites (TNFR2-59) diminishes the TNFR2-mediated NF-κB, but not JNK activation; whereas, deletion of domain II or domain III blunts TNFR2-mediated JNK but not NF-κB activation. Interestingly, we find that the TNFR-associated factor-2-binding sites ensure TNFR2 on the plasma membrane, but the di-leucine LL motif within the domain II and aa338-355 within the domain III are required for TNFR2 internalization as well as TNFR2-dependent JNK signaling. Moreover, domain III of TNFR2 is responsible for association with ASK1-interacting protein-1, a signaling adaptor critical for TNF-induced JNK signaling. While TNFR2 containing the TNFR-associated factor-2-binding sites prevents EC cell death, a specific activation of JNK without NF-κB activation by TNFR2-59 strongly induces caspase activation and EC apoptosis. Our data reveal that both internalization and ASK1-interacting protein-1 association are required for TNFR2-dependent JNK and apoptotic signaling. Controlling TNFR2-mediated JNK and apoptotic signaling in EC may provide a novel strategy for the treatment of vascular diseases.

  20. Resistance of neuronal nitric oxide synthase-deficient mice to methamphetamine-induced dopaminergic neurotoxicity.

    PubMed

    Itzhak, Y; Gandia, C; Huang, P L; Ali, S F

    1998-03-01

    Methamphetamine (METH) is a powerful psychostimulant that produces dopaminergic neurotoxicity manifested by a decrease in the levels of dopamine, tyrosine hydroxylase activity and dopamine transporter (DAT) binding sites in the nigrostriatal system. We have recently reported that blockade of the neuronal nitric oxide synthase (nNOS) isoform by 7-nitroindazole provides protection against METH-induced neurotoxicity in Swiss Webster mice. The present study was undertaken to investigate the effect of a neurotoxic dose of METH on mutant mice lacking the nNOS gene [nNOS(-/-)] and wild-type controls. In addition, we sought to investigate the behavioral outcome of exposure to a neurotoxic dose of METH. Homozygote nNOS(-/-), heterozygote nNOS(+/-) and wild-type animals were administered either saline or METH (5 mg/kg x 3). Dopamine, DOPAC and HVA levels, as well as DAT binding site levels, were determined in striatal tissue derived 72 h after the last METH injection. This regimen of METH given to nNOS(-/-) mice affected neither the tissue content of dopamine and its metabolites nor the number of DAT binding sites. Although a moderate reduction in the levels of dopamine (35%) and DAT binding sites (32%) occurred in striatum of heterozygote nNOS(+/-) mice, a more profound depletion of the dopaminergic markers (up to 68%) was observed in the wild-type animals. METH-induced hyperthermia was observed in all animal strains examined except the nNOS(-/-) mice. Investigation of the animals' spontaneous locomotor activity before and after administration of the neurotoxic dose of METH (5 mg/kg x 3) revealed no differences. A low dose of METH (1.0 mg/kg) administered to naive animals (nNOS(-/-) and wild-type) resulted in a similar intensity of locomotor stimulation. However, 68 to 72 h after exposure to the high-dose METH regimen, a marked sensitized responses to a challenge METH injection was observed in the wild-type mice but not in the nNOS(-/-) mice. Taken together, these results indicate that nNOS(-/-) mice are protected against METH-induced dopaminergic neurotoxicity and locomotor sensitization. It also appears that a partial deficit of dopaminergic transmission in wild-type animals does not prevent the development of sensitization to METH, whereas a deficit in nNOS may attenuate this process.

  1. Small Molecule-Induced Allosteric Activation of the Vibrio Cholerae RTX Cysteine Protease Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lupardus, P.J.; Shen, A.; Bogyo, M.

    2009-05-19

    Vibrio cholerae RTX (repeats in toxin) is an actin-disrupting toxin that is autoprocessed by an internal cysteine protease domain (CPD). The RTX CPD is efficiently activated by the eukaryote-specific small molecule inositol hexakisphosphate (InsP{sub 6}), and we present the 2.1 angstrom structure of the RTX CPD in complex with InsP{sub 6}. InsP{sub 6} binds to a conserved basic cleft that is distant from the protease active site. Biochemical and kinetic analyses of CPD mutants indicate that InsP{sub 6} binding induces an allosteric switch that leads to the autoprocessing and intracellular release of toxin-effector domains.

  2. New insights into the molecular characteristics behind the function of Renilla luciferase.

    PubMed

    Fanaei-Kahrani, Zahra; Ganjalikhany, Mohamad Reza; Rasa, Seyed Mohammad Mahdi; Emamzadeh, Rahman

    2018-02-01

    Renilla Luciferase (RLuc) is a blue light emitter protein which can be applied as a valuable tool in medical diagnosis. But due to lack of the crystal structure of RLuc-ligand complex, the functional motions and catalytic mechanism of this enzyme remain largely unknown. In the present study, the active site properties and the ligand-receptor interactions of the native RLuc and its red-shifted light emitting variant (Super RLuc 8) were investigated using molecular docking approach, molecular dynamics (MD) analysis, and MM-PBSA method. The detailed analysis of the main clusters led to identifying a lid-like structure and its functional motions. Furthermore, an induced-fit mechanism is proposed where ligand-binding induces conformational changes of the active site. Our findings give an insight into the deeper understanding of RLuc conformational changes during binding steps and ligand-receptor pattern. Moreover, our work broaden our understanding of how active site geometry is adjusted to support the catalytic activity and red-shifted light emission in Super RLuc 8. © 2017 Wiley Periodicals, Inc.

  3. Alpha-tocopheryl succinate induces apoptosis by targeting ubiquinone-binding sites in mitochondrial respiratory complex II.

    PubMed

    Dong, L-F; Low, P; Dyason, J C; Wang, X-F; Prochazka, L; Witting, P K; Freeman, R; Swettenham, E; Valis, K; Liu, J; Zobalova, R; Turanek, J; Spitz, D R; Domann, F E; Scheffler, I E; Ralph, S J; Neuzil, J

    2008-07-17

    Alpha-tocopheryl succinate (alpha-TOS) is a selective inducer of apoptosis in cancer cells, which involves the accumulation of reactive oxygen species (ROS). The molecular target of alpha-TOS has not been identified. Here, we show that alpha-TOS inhibits succinate dehydrogenase (SDH) activity of complex II (CII) by interacting with the proximal and distal ubiquinone (UbQ)-binding site (Q(P) and Q(D), respectively). This is based on biochemical analyses and molecular modelling, revealing similar or stronger interaction energy of alpha-TOS compared to that of UbQ for the Q(P) and Q(D) sites, respectively. CybL-mutant cells with dysfunctional CII failed to accumulate ROS and underwent apoptosis in the presence of alpha-TOS. Similar resistance was observed when CybL was knocked down with siRNA. Reconstitution of functional CII rendered CybL-mutant cells susceptible to alpha-TOS. We propose that alpha-TOS displaces UbQ in CII causing electrons generated by SDH to recombine with molecular oxygen to yield ROS. Our data highlight CII, a known tumour suppressor, as a novel target for cancer therapy.

  4. α-Tocopheryl succinate induces apoptosis by targeting ubiquinone-binding sites in mitochondrial respiratory complex II

    PubMed Central

    Dong, Lan-Feng; Low, Pauline; Dyason, Jeffrey C.; Wang, Xiu-Fang; Prochazka, Lubomir; Witting, Paul K.; Freeman, Ruth; Swettenham, Emma; Valis, Karel; Liu, Ji; Zobalova, Renata; Turanek, Jaroslav; Spitz, Doug R.; Domann, Frederick E.; Scheffler, Immo E.; Ralph, Stephen J.; Neuzil, Jiri

    2009-01-01

    α-Tocopheryl succinate (α-TOS) is a selective inducer of apoptosis in cancer cells, which involves the accumulation of reactive oxygen species (ROS). The molecular target of α-TOS has not been identified. Here we show that α-TOS inhibits succinate dehydrogenase (SDH) activity of complex II (CII) by interacting with the proximal and distal ubiquinone (UbQ) binding site (QP and QD, respectively). This is based on biochemical analyses and molecular modelling, revealing similar or stronger interaction energy of α-TOS compared to that of UbQ for the QP and QD sites, respectively. CybL-mutant cells with dysfunctional CII failed to accumulate ROS and undergo apoptosis in the presence of α-TOS. Similar resistance was observed when CybL was knocked down with siRNA. Reconstitution of functional CII rendered CybL-mutant cells susceptible to α-TOS. We propose that α-TOS displaces UbQ in CII causing electrons generated by SDH to recombine with molecular oxygen to yield ROS. Our data highlight CII, a known tumour suppressor, as a novel target for cancer therapy. PMID:18372923

  5. The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

    PubMed Central

    Kosturko, L D; Daub, E; Murialdo, H

    1989-01-01

    The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

  6. Structural dynamics and energetics underlying allosteric inactivation of the cannabinoid receptor CB1

    PubMed Central

    Fay, Jonathan F.; Farrens, David L.

    2015-01-01

    G protein-coupled receptors (GPCRs) are surprisingly flexible molecules that can do much more than simply turn on G proteins. Some even exhibit biased signaling, wherein the same receptor preferentially activates different G-protein or arrestin signaling pathways depending on the type of ligand bound. Why this behavior occurs is still unclear, but it can happen with both traditional ligands and ligands that bind allosterically outside the orthosteric receptor binding pocket. Here, we looked for structural mechanisms underlying these phenomena in the marijuana receptor CB1. Our work focused on the allosteric ligand Org 27569, which has an unusual effect on CB1—it simultaneously increases agonist binding, decreases G-protein activation, and induces biased signaling. Using classical pharmacological binding studies, we find that Org 27569 binds to a unique allosteric site on CB1 and show that it can act alone (without need for agonist cobinding). Through mutagenesis studies, we find that the ability of Org 27569 to bind is related to how much receptor is in an active conformation that can couple with G protein. Using these data, we estimated the energy differences between the inactive and active states. Finally, site-directed fluorescence labeling studies show the CB1 structure stabilized by Org 27569 is different and unique from that stabilized by antagonist or agonist. Specifically, transmembrane helix 6 (TM6) movements associated with G-protein activation are blocked, but at the same time, helix 8/TM7 movements are enhanced, suggesting a possible mechanism for the ability of Org 27569 to induce biased signaling. PMID:26100912

  7. Experimentally biased model structure of the Hsc70/auxilin complex: Substrate transfer and interdomain structural change

    PubMed Central

    Gruschus, James M.; Greene, Lois E.; Eisenberg, Evan; Ferretti, James A.

    2004-01-01

    A model structure of the Hsc70/auxilin complex has been constructed to gain insight into interprotein substrate transfer and ATP hydrolysis induced conformational changes in the multidomain Hsc70 structure. The Hsc70/auxilin system, which is a member of the Hsp70/Hsp40 chaperone system family, uncoats clathrin-coated vesicles in an ATP hydrolysis-driven process. Incorporating previous results from NMR and mutant binding studies, the auxilin J-domain was docked into the Hsc70 ATPase domain lower cleft using rigid backbone/flexible side chain molecular dynamics, and the Hsc70 substrate binding domain was docked by a similar procedure. For comparison, J-domain and substrate binding domain docking sites were obtained by the rigid-body docking programs DOT and ZDOCK, filtered and ranked by the program ClusPro, and relaxed using the same rigid backbone/flexible side chain dynamics. The substrate binding domain sites were assessed in terms of conserved surface complementarity and feasibility in the context of substrate transfer, both for auxilin and another Hsp40 protein, Hsc20. This assessment favors placement of the substrate binding domain near D152 on the ATPase domain surface adjacent to the J-domain invariant HPD segment, with the Hsc70 interdomain linker in the lower cleft. Examining Hsc70 interdomain energetics, we propose that long-range electrostatic interactions, perhaps due to a difference in the pKa values of bound ATP and ADP, could play a major role in the structural change induced by ATP hydrolysis. Interdomain electrostatic interactions also appear to play a role in stimulation of ATPase activity due to J-domain binding and substrate binding by Hsc70. PMID:15273304

  8. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

  9. Structural dynamics of F-actin: I. Changes in the C terminus.

    PubMed

    Orlova, A; Egelman, E H

    1995-02-03

    The biochemical properties of G-actin, and the kinetics of polymerization of G-actin into F-actin, are dependent upon whether Mg2+ or Ca2+ is bound at the high-affinity metal-binding site in actin. Three-dimensional reconstructions from electron micrographs show that a bridge of density, that we interpret as arising from a major shift of the C terminus, exists between the two strands of the filament in Ca(2+)-actin that is absent in Mg(2+)-actin. This bridge is also absent in models of F-actin built from an atomic structure of G-Ca(2+)-actin. The cleavage of the DNase I-binding loop in actin between residues 42 and 43, with the non-covalent association of the 42 cleaved residues with the remainder of the actin, induces an even larger bridge of density between the two strands. When the bridge is absent, the two C-terminal residues in F-actin are easily cleaved by trypsin, while these residues become increasingly resistant to tryptic cleavage as the bridge becomes more prominent. Conversely, cleavage of the two C-terminal residues leads to a conformational change in the DNase I-binding loop. Since both the DNase I-binding loop and the metal-binding site are quite distant from the C terminus, large allosteric effects must exist in F-actin. The conformational change in F-actin that results from the creation of this bridge may be induced by myosin binding, since this movement generates changes in actin's diffraction that are very similar to the changes in the muscle X-ray pattern during activation that are associated with the binding of myosin to the thin filament.

  10. Catalytic zinc site and mechanism of the metalloenzyme PR-AMP cyclohydrolase.

    PubMed

    D'Ordine, Robert L; Linger, Rebecca S; Thai, Carolyn J; Davisson, V Jo

    2012-07-24

    The enzyme N(1)-(5'-phosphoribosyl) adenosine-5'-monophosphate cyclohydrolase (PR-AMP cyclohydrolase) is a Zn(2+) metalloprotein encoded by the hisI gene. It catalyzes the third step of histidine biosynthesis, an uncommon ring-opening of a purine heterocycle for use in primary metabolism. A three-dimensional structure of the enzyme from Methanobacterium thermoautotrophicum has revealed that three conserved cysteine residues occur at the dimer interface and likely form the catalytic site. To investigate the functions of these cysteines in the enzyme from Methanococcus vannielii, a series of biochemical studies were pursued to test the basic hypothesis regarding their roles in catalysis. Inactivation of the enzyme activity by methyl methane thiosulfonate (MMTS) or 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) also compromised the Zn(2+) binding properties of the protein inducing loss of up to 90% of the metal. Overall reaction stoichiometry and the potassium cyanide (KCN) induced cleavage of the protein suggested that all three cysteines were modified in the process. The enzyme was protected from DTNB-induced inactivation by inclusion of the substrate N(1)-(5'-phosphoribosyl)adenosine 5'-monophosphate; (PR-AMP), while Mg(2+), a metal required for catalytic activity, enhanced the rate of inactivation. Site-directed mutations of the conserved C93, C109, C116 and the double mutant C109/C116 were prepared and analyzed for catalytic activity, Zn(2+) content, and reactivity with DTNB. Substitution of alanine for each of the conserved cysteines showed no measurable catalytic activity, and only the C116A was still capable of binding Zn(2+). Reactions of DTNB with the C109A/C116A double mutant showed that C93 is completely modified within 0.5 s. A model consistent with these data involves a DTNB-induced mixed disulfide linkage between C93 and C109 or C116, followed by ejection of the active site Zn(2+) and provides further evidence that the Zn(2+) coordination site involves the three conserved cysteine residues. The C93 reactivity is modulated by the presence of the Zn(2+) and Mg(2+) and substantiates the role of this residue as a metal ligand. In addition, Mg(2+) ligand binding site(s) indicated by the structural analysis were probed by site-directed mutagenesis of three key aspartate residues flanking the conserved C93 which were shown to have a functional impact on catalysis, cysteine activation, and metal (zinc) binding capacity. The unique amino acid sequence, the dynamic properties of the cysteine ligands involved in Zn(2+) coordination, and the requirement for a second metal (Mg(2+)) are discussed in the context of their roles in catalysis. The results are consistent with a Zn(2+)-mediated activation of H(2)O mechanism involving histidine as a general base that has features similar to but distinct from those of previously characterized purine and pyrimidine deaminases.

  11. Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

    PubMed Central

    Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2016-01-01

    In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

  12. Dynamic and thermodynamic response of the Ras protein Cdc42Hs upon association with the effector domain of PAK3

    PubMed Central

    Moorman, Veronica R.; Valentine, Kathleen G.; Bédard, Sabrina; Kasinath, Vignesh; Dogan, Jakob; Love, Fiona M.; Wand, A. Joshua

    2014-01-01

    Human cell division cycle protein 42 (Cdc42Hs) is a small, Rho-type GTPase involved in multiple cellular processes through its interactions with downstream effectors. The binding domain of one such effector, the actin cytoskeleton-regulating p21 activated kinase 3 (PAK3) is known as PBD46. Nitrogen-15 backbone and carbon-13 methyl NMR relaxation were measured to investigate the dynamical changes in activated GMPPCP•Cdc42Hs upon PBD46 binding. Changes in internal motion of the Cdc42Hs, as revealed by methyl axis order parameters, were observed not only near the Cdc42Hs–PBD46 interface but also in remote sites on the Cdc42Hs molecule. The binding-induced changes in side chain dynamics propagate along the long axis of Cdc42Hs away from the site of PBD46 binding with a sharp distance dependence. Overall, the binding of the PBD46 effector domain on the dynamics of methyl bearing side chains of Cdc42Hs results in a modest rigidification, which is estimated to correspond to an unfavorable change in conformational entropy of approximately −10 kcal mol−1 at 298 K. A cluster of methyl probes closest to the nucleotide-binding pocket of Cdc42Hs become more rigid upon binding of PBD46 and is proposed to slow the catalytic hydrolysis of the γ phosphate moiety. An additional cluster of methyl probes surrounding the guanine ring become more flexible on binding of PBD46, presumably facilitating nucleotide exchange mediated by a guanosine exchange factor. In addition, the Rho insert helix, which is located at a site remote from the PBD46 binding interface, shows a significant dynamic response to PBD46 binding. PMID:25109462

  13. Neural precursor cell-expressed developmentally down-regulated protein 4-2 (Nedd4-2) regulation by 14-3-3 protein binding at canonical serum and glucocorticoid kinase 1 (SGK1) phosphorylation sites.

    PubMed

    Chandran, Sindhu; Li, Hui; Dong, Wuxing; Krasinska, Karolina; Adams, Chris; Alexandrova, Ludmila; Chien, Allis; Hallows, Kenneth R; Bhalla, Vivek

    2011-10-28

    Regulation of epithelial Na(+) channel (ENaC)-mediated transport in the distal nephron is a critical determinant of blood pressure in humans. Aldosterone via serum and glucocorticoid kinase 1 (SGK1) stimulates ENaC by phosphorylation of the E3 ubiquitin ligase Nedd4-2, which induces interaction with 14-3-3 proteins. However, the mechanisms of SGK1- and 14-3-3-mediated regulation of Nedd4-2 are unclear. There are three canonical SGK1 target sites on Nedd4-2 that overlap phosphorylation-dependent 14-3-3 interaction motifs. Two of these are termed "minor," and one is termed "major," based on weak or strong binding to 14-3-3 proteins, respectively. By mass spectrometry, we found that aldosterone significantly stimulates phosphorylation of a minor, relative to the major, 14-3-3 binding site on Nedd4-2. Phosphorylation-deficient minor site Nedd4-2 mutants bound less 14-3-3 than did wild-type (WT) Nedd4-2, and minor site Nedd4-2 mutations were sufficient to inhibit SGK1 stimulation of ENaC cell surface expression. As measured by pulse-chase and cycloheximide chase assays, a major binding site Nedd4-2 mutant had a shorter cellular half-life than WT Nedd4-2, but this property was not dependent on binding to 14-3-3. Additionally, a dimerization-deficient 14-3-3ε mutant failed to bind Nedd4-2. We conclude that whereas phosphorylation at the Nedd4-2 major site is important for interaction with 14-3-3 dimers, minor site phosphorylation by SGK1 may be the relevant molecular switch that stabilizes Nedd4-2 interaction with 14-3-3 and thus promotes ENaC cell surface expression. We also propose that major site phosphorylation promotes cellular Nedd4-2 protein stability, which potentially represents a novel form of regulation for turnover of E3 ubiquitin ligases.

  14. Inhibitory Effects of Lysine Analogues on t-PA Induced Whole Blood Clot Lysis

    DTIC Science & Technology

    1994-01-01

    aminocaproic acid (EACA) and trans-4-amino- methyl cyclohexane carboxylic acid (AMCA) are used to prevent excessive bleeding in patients with... aminocaproic acid (EACA) and the others have lower affinity binding sites (K&=5 mM) (5). The lysine analogues EACA and trans-4-aniinomethyl...JL, Wissler FC. Quantitative determination of the binding of epsilon- aminocaproic acid to native plasminogen. J Biol Chem 253, 727-732, 1978. 6

  15. Crystal Structure of the Neutralizing Llama VHH D7 and Its Mode of HIV-1 gp120 Interaction

    PubMed Central

    Hinz, Andreas; Lutje Hulsik, David; Forsman, Anna; Koh, Willie Wee-Lee; Belrhali, Hassan; Gorlani, Andrea; de Haard, Hans; Weiss, Robin A.; Verrips, Theo; Weissenhorn, Winfried

    2010-01-01

    HIV-1 entry into host cells is mediated by the sequential binding of the envelope glycoprotein gp120 to CD4 and a chemokine receptor. Antibodies binding to epitopes overlapping the CD4-binding site on gp120 are potent inhibitors of HIV entry, such as the llama heavy chain antibody fragment VHH D7, which has cross-clade neutralizing properties and competes with CD4 and mAb b12 for high affinity binding to gp120. We report the crystal structure of the D7 VHH at 1.5 Å resolution, which reveals the molecular details of the complementarity determining regions (CDR) and substantial flexibility of CDR3 that could facilitate an induced fit interaction with gp120. Structural comparison of CDRs from other CD4 binding site antibodies suggests diverse modes of interaction. Mutational analysis identified CDR3 as a key component of gp120 interaction as determined by surface plasmon resonance. A decrease in affinity is directly coupled to the neutralization efficiency since mutations that decrease gp120 interaction increase the IC50 required for HIV-1 IIIB neutralization. Thus the structural study identifies the long CDR3 of D7 as the key determinant of interaction and HIV-1 neutralization. Furthermore, our data confirm that the structural plasticity of gp120 can accommodate multiple modes of antibody binding within the CD4 binding site. PMID:20463957

  16. Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families.

    PubMed

    Garcia, Mario D; Nouwens, Amanda; Lonhienne, Thierry G; Guddat, Luke W

    2017-02-14

    Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted "S"-shaped conformation when bound to A. thaliana AHAS ( At AHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors.

  17. Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families

    PubMed Central

    Nouwens, Amanda; Lonhienne, Thierry G.; Guddat, Luke W.

    2017-01-01

    Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted “S”-shaped conformation when bound to A. thaliana AHAS (AtAHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors. PMID:28137884

  18. Characterization of CcSTOP1; a C2H2-type transcription factor regulates Al tolerance gene in pigeonpea.

    PubMed

    Daspute, Abhijit Arun; Kobayashi, Yuriko; Panda, Sanjib Kumar; Fakrudin, Bashasab; Kobayashi, Yasufumi; Tokizawa, Mutsutomo; Iuchi, Satoshi; Choudhary, Arbind Kumar; Yamamoto, Yoshiharu Y; Koyama, Hiroyuki

    2018-01-01

    Al-responsive citrate-transporting CcMATE1 function and its regulation by CcSTOP1 were analyzed using NtSTOP1 -KD tobacco- and pigeonpea hairy roots, respectively, CcSTOP1 binding sequence of CcMATE1 showed similarity with AtALMT1 promoter. The molecular mechanisms of Aluminum (Al) tolerance in pigeonpea (Cajanus cajan) were characterized to provide information for molecular breeding. Al-inducible citrate excretion was associated with the expression of MULTIDRUGS AND TOXIC COMPOUNDS EXCLUSION (CcMATE1), which encodes a citrate transporter. Ectopic expression of CcMATE1-conferred Al tolerance to hairy roots of transgenic tobacco with the STOP1 regulation system knocked down. This gain-of-function approach clearly showed CcMATE1 was involved in Al detoxification. The expression of CcMATE1 and another Al-tolerance gene, ALUMINUM SENSITIVE 3 (CcALS3), was regulated by SENSITIVE TO PROTON RHIZOTOXICITY1 (CcSTOP1) according to loss-of-function analysis of pigeonpea hairy roots in which CcSTOP1 was suppressed. An in vitro binding assay showed that the Al-responsive CcMATE1 promoter contained the GGNVS consensus bound by CcSTOP1. Mutation of GGNVS inactivated the Al-inducible expression of CcMATE1 in pigeonpea hairy roots. This indicated that CcSTOP1 binding to the promoter is critical for CcMATE1 expression. The STOP1 binding sites of both the CcMATE1 and AtALMT1 promoters contained GGNVS and a flanking 3' sequence. The GGNVS region was identical in both CcMATE1 and AtALMT1. By contrast, the 3' flanking sequence with binding affinity to STOP1 did not show similarity. Putative STOP1 binding sites with similar structures were also found in Al-inducible MATE and ALMT1 promoters in other plant species. The characterized Al-responsive CcSTOP1 and CcMATE1 genes will help in pigeonpea breeding in acid soil tolerance.

  19. Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

    PubMed

    López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

    2004-07-09

    The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

  20. Sort-Seq Approach to Engineering a Formaldehyde-Inducible Promoter for Dynamically Regulated Escherichia coli Growth on Methanol

    PubMed Central

    2017-01-01

    Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494

  1. Structures of Saccharomyces cerevisiae D-arabinose dehydrogenase Ara1 and its complex with NADPH: implications for cofactor-assisted substrate recognition.

    PubMed

    Hu, Xiao-Qian; Guo, Peng-Chao; Ma, Jin-Di; Li, Wei-Fang

    2013-11-01

    The primary role of yeast Ara1, previously mis-annotated as a D-arabinose dehydrogenase, is to catalyze the reduction of a variety of toxic α,β-dicarbonyl compounds using NADPH as a cofactor at physiological pH levels. Here, crystal structures of Ara1 in apo and NADPH-complexed forms are presented at 2.10 and 2.00 Å resolution, respectively. Ara1 exists as a homodimer, each subunit of which adopts an (α/β)8-barrel structure and has a highly conserved cofactor-binding pocket. Structural comparison revealed that induced fit upon NADPH binding yielded an intact active-site pocket that recognizes the substrate. Moreover, the crystal structures combined with computational simulation defined an open substrate-binding site to accommodate various substrates that possess a dicarbonyl group.

  2. Targeting the Allosteric Site of Oncoprotein BCR-ABL as an Alternative Strategy for Effective Target Protein Degradation.

    PubMed

    Shimokawa, Kenichiro; Shibata, Norihito; Sameshima, Tomoya; Miyamoto, Naoki; Ujikawa, Osamu; Nara, Hiroshi; Ohoka, Nobumichi; Hattori, Takayuki; Cho, Nobuo; Naito, Mikihiko

    2017-10-12

    Protein degradation technology based on hybrid small molecules is an emerging drug modality that has significant potential in drug discovery and as a unique method of post-translational protein knockdown in the field of chemical biology. Here, we report the first example of a novel and potent protein degradation inducer that binds to an allosteric site of the oncogenic BCR-ABL protein. BCR-ABL allosteric ligands were incorporated into the SNIPER (Specific and Nongenetic inhibitor of apoptosis protein [IAP]-dependent Protein Erasers) platform, and a series of in vitro biological assays of binding affinity, target protein modulation, signal transduction, and growth inhibition were carried out. One of the designed compounds, 6 (SNIPER(ABL)-062), showed desirable binding affinities against ABL1, cIAP1/2, and XIAP and consequently caused potent BCR-ABL degradation.

  3. Structure-Based Network Analysis of Activation Mechanisms in the ErbB Family of Receptor Tyrosine Kinases: The Regulatory Spine Residues Are Global Mediators of Structural Stability and Allosteric Interactions

    PubMed Central

    James, Kevin A.; Verkhivker, Gennady M.

    2014-01-01

    The ErbB protein tyrosine kinases are among the most important cell signaling families and mutation-induced modulation of their activity is associated with diverse functions in biological networks and human disease. We have combined molecular dynamics simulations of the ErbB kinases with the protein structure network modeling to characterize the reorganization of the residue interaction networks during conformational equilibrium changes in the normal and oncogenic forms. Structural stability and network analyses have identified local communities integrated around high centrality sites that correspond to the regulatory spine residues. This analysis has provided a quantitative insight to the mechanism of mutation-induced “superacceptor” activity in oncogenic EGFR dimers. We have found that kinase activation may be determined by allosteric interactions between modules of structurally stable residues that synchronize the dynamics in the nucleotide binding site and the αC-helix with the collective motions of the integrating αF-helix and the substrate binding site. The results of this study have pointed to a central role of the conserved His-Arg-Asp (HRD) motif in the catalytic loop and the Asp-Phe-Gly (DFG) motif as key mediators of structural stability and allosteric communications in the ErbB kinases. We have determined that residues that are indispensable for kinase regulation and catalysis often corresponded to the high centrality nodes within the protein structure network and could be distinguished by their unique network signatures. The optimal communication pathways are also controlled by these nodes and may ensure efficient allosteric signaling in the functional kinase state. Structure-based network analysis has quantified subtle effects of ATP binding on conformational dynamics and stability of the EGFR structures. Consistent with the NMR studies, we have found that nucleotide-induced modulation of the residue interaction networks is not limited to the ATP site, and may enhance allosteric cooperativity with the substrate binding region by increasing communication capabilities of mediating residues. PMID:25427151

  4. Interaction of 18-methoxycoronaridine with nicotinic acetylcholine receptors in different conformational states

    PubMed Central

    Arias, Hugo R.; Rosenberg, Avraham; Feuerbach, Dominik; Targowska-Duda, Katarzyna M.; Maciejewski, Ryszard; Jozwiak, Krzysztof; Moaddel, Ruin; Glick, Stanley D.; Wainer, Irving W.

    2013-01-01

    The interaction of 18-methoxycoronaridine (18-MC) with nicotinic acetylcholine receptors (AChRs) was compared with that for ibogaine and phencyclidine (PCP). The results established that 18-MC: (a) is more potent than ibogaine and PCP inhibiting (±)-epibatidine-induced AChR Ca2+ influx. The potency of 18-MC is increased after longer pre-incubation periods, which is in agreement with the enhancement of [3H]cytisine binding to resting but activatable Torpedo AChRs, (b) binds to a single site in the Torpedo AChR with high affinity and inhibits [3H]TCP binding to desensitized AChRs in a steric fashion, suggesting the existence of overlapping sites. This is supported by our docking results indicating that 18-MC interacts with a domain located between the serine (position 6′) and valine (position 13′) rings, and (c) inhibits [3H]TCP, [3H] ibogaine, and [3H]18-MC binding to desensitized AChRs with higher affinity compared to resting AChRs. This can be partially attributed to a slower dissociation rate from the desensitized AChR compared to that from the resting AChR. The enthalpic contribution is more important than the entropic contribution when 18-MC binds to the desensitized AChR compared to that for the resting AChR, and vice versa. Ibogaine analogs inhibit the AChR by interacting with a luminal domain that is shared with PCP, and by inducing desensitization. PMID:20303928

  5. AP-1 mediated transcriptional repression of matrix metalloproteinase-9 by recruitment of histone deacetylase 1 in response to interferon β.

    PubMed

    Mittelstadt, Megan L; Patel, Rekha C

    2012-01-01

    Matrix metalloproteinase-9 (MMP-9) is a 92 kDa zinc-dependant endopeptidase that degrades components of the extracellular matrix. Increased expression of MMP-9 is implicated in many pathological conditions including metastatic cancer, multiple sclerosis, and atherosclerosis. Although it has been widely noted that interferon-β (IFNβ) downregulates both the basal and phorbol 12-myristate 13-acetate (PMA)-induced MMP-9 expression at the transcriptional level, the molecular mechanism of this repression is poorly understood. In the present study we identify a novel mechanism for repression of MMP-9 transcription by IFNβ in HT1080 fibrosarcoma cells. Using reporter assays with promoter deletion constructs we show that IFNβ's inhibitory effects require a region of the promoter between -154 and -72, which contains an AP-1 binding site. Chromatin immunoprecipitation (ChIP) studies indicate that IFNβ increases histone deacetylase (HDAC)-1 recruitment to the MMP-9 promoter and reduces histone H3 acetylation, in addition to reduced NF-κB recruitment. ChIP analysis shows that IFNβ induced HDAC1 recruitment to the MMP-9 promoter and IFNβ mediated transcriptional repression is lost when the AP-1 binding site is inactivated by a point mutation. Altogether, our results establish that the repression of MMP-9 transcription in response to IFNβ occurs by the recruitment of HDAC1 via the proximal AP-1 binding site.

  6. Conformational epitopes at cadherin calcium-binding sites and p120-catenin phosphorylation regulate cell adhesion

    PubMed Central

    Petrova, Yuliya I.; Spano, MarthaJoy M.; Gumbiner, Barry M.

    2012-01-01

    We investigated changes in cadherin structure at the cell surface that regulate its adhesive activity. Colo 205 cells are nonadhesive cells with a full but inactive complement of E-cadherin–catenin complexes at the cell surface, but they can be triggered to adhere and form monolayers. We were able to distinguish the inactive and active states of E-cadherin at the cell surface by using a special set of monoclonal antibodies (mAbs). Another set of mAbs binds E-cadherin and strongly activates adhesion. In other epithelial cell types these activating mAbs inhibit growth factor–induced down-regulation of adhesion and epithelial morphogenesis, indicating that these phenomena are also controlled by E-cadherin activity at the cell surface. Both types of mAbs recognize conformational epitopes at different interfaces between extracellular cadherin repeat domains (ECs), especially near calcium-binding sites. Activation also induces p120-catenin dephosphorylation, as well as changes in the cadherin cytoplasmic domain. Moreover, phospho-site mutations indicate that dephosphorylation of specific Ser/Thr residues in the N-terminal domain of p120-catenin mediate adhesion activation. Thus physiological regulation of the adhesive state of E-cadherin involves physical and/or conformational changes in the EC interface regions of the ectodomain at the cell surface that are mediated by catenin-associated changes across the membrane. PMID:22513089

  7. Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

    PubMed

    Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

    2011-01-30

    During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

  8. Paracetamol and cytarabine binding competition in high affinity binding sites of transporting protein

    NASA Astrophysics Data System (ADS)

    Sułkowska, A.; Bojko, B.; Równicka, J.; Sułkowski, W. W.

    2006-07-01

    Paracetamol (acetaminophen, AA) the most popular analgesic drug is commonly used in the treatment of pain in patients suffering from cancer. In our studies, we evaluated the competition in binding with serum albumin between paracetamol (AA) and cytarabine, antyleukemic drug (araC). The presence of one drug can alter the binding affinity of albumin towards the second one. Such interaction can result in changing of the free fraction of the one of these drugs in blood. Two spectroscopic methods were used to determine high affinity binding sites and the competition of the drugs. Basing on the change of the serum albumin fluorescence in the presence of either of the drugs the quenching ( KQ) constants for the araC-BSA and AA-BSA systems were calculated. Analysis of UV difference spectra allowed us to describe the changes in drug-protein complexes (araC-albumin and AA-albumin) induced by the presence of the second drug (AA and araC, respectively). The mechanism of competition between araC and AA has been proposed.

  9. Reduction of the ganglioside binding activity of the tetanus toxin HC fragment destroys immunogenicity: implications for development of novel tetanus vaccines.

    PubMed

    Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil

    2006-08-01

    In this study, the immunogenicities of the nontoxic H(C) fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type H(C) (H(C)WT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and H(C) antigens and provided complete protection against toxin challenge. Mutants of H(C) containing deletions essential for ganglioside binding elicited lower responses than H(C)WT. H(C)M115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with H(C)WT, consistent with lower anti-H(C) and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in H(C)M115. We conclude that the presence of the ganglioside binding site within H(C) may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection.

  10. Binding interaction of atorvastatin with bovine serum albumin: Spectroscopic methods and molecular docking

    NASA Astrophysics Data System (ADS)

    Wang, Qi; Huang, Chuan-ren; Jiang, Min; Zhu, Ying-yao; Wang, Jing; Chen, Jun; Shi, Jie-hua

    2016-03-01

    The interaction of atorvastatin with bovine serum albumin (BSA) was investigated using multi-spectroscopic methods and molecular docking technique for providing important insight into further elucidating the store and transport process of atorvastatin in the body and the mechanism of action and pharmacokinetics. The experimental results revealed that the fluorescence quenching mechanism of BSA induced atorvastatin was a combined dynamic and static quenching. The binding constant and number of binding site of atorvastatin with BSA under simulated physiological conditions (pH = 7.4) were 1.41 × 105 M- 1 and about 1 at 310 K, respectively. The values of the enthalpic change (ΔH0), entropic change (ΔS0) and Gibbs free energy (ΔG0) in the binding process of atorvastatin with BSA at 310 K were negative, suggesting that the binding process of atorvastatin and BSA was spontaneous and the main interaction forces were van der Waals force and hydrogen bonding interaction. Moreover, atorvastatin was bound into the subdomain IIA (site I) of BSA, resulting in a slight change of the conformation of BSA.

  11. Identification of Critical Elements for Regulation of Inorganic Pyrophosphatase (PPA1) in MCF7 Breast Cancer Cells.

    PubMed

    Mishra, Dipti Ranjan; Chaudhary, Sanjib; Krishna, B Madhu; Mishra, Sandip K

    2015-01-01

    Cytosolic inorganic pyrophosphatase plays an important role in the cellular metabolism by hydrolyzing inorganic pyrophosphate (PPi) formed as a by-product of various metabolic reactions. Inorganic pyrophosphatases are known to be associated with important functions related to the growth and development of various organisms. In humans, the expression of inorganic pyrophosphatase (PPA1) is deregulated in different types of cancer and is involved in the migration and invasion of gastric cancer cells and proliferation of ovarian cancer cells. However, the transcriptional regulation of the gene encoding PPA1 is poorly understood. To gain insights into PPA1 gene regulation, a 1217 bp of its 5'-flanking region was cloned and analyzed. The 5'-deletion analysis of the promoter revealed a 266 bp proximal promoter region exhibit most of the transcriptional activity and upon sequence analysis, three putative Sp1 binding sites were found to be present in this region. Binding of Sp1 to the PPA1 promoter was confirmed by Electrophoretic mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay. Importance of these binding sites was verified by site-directed mutagenesis and overexpression of Sp1 transactivates PPA1 promoter activity, upregulates protein expression and increases chromatin accessibility. p300 binds to the PPA1 promoter and stimulates Sp1 induced promoter activity. Trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor induces PPA1 promoter activity and protein expression and HAT activity of p300 was important in regulation of PPA1 expression. These results demonstrated that PPA1 is positively regulated by Sp1 and p300 coactivates Sp1 induced PPA1 promoter activity and histone acetylation/deacetylation may contribute to a local chromatin remodeling across the PPA1 promoter. Further, knockdown of PPA1 decreased colony formation and viability of MCF7 cells.

  12. The effects of the phyllolitorin analogue [desTrp3,Leu8]phyllolitorin on scratching induced by bombesin and related peptides in rats

    PubMed Central

    Johnson, Mark D.; Ko, Mei-Chuan; Choo, Kevin S.; Traynor, John R.; Mosberg, Henry I.; Naughton, Norah N.; Woods, James H.

    2010-01-01

    Bombesin along with several closely related neuropeptides elicit scratching behavior when administered centrally. The first part of the study was designed to determine the antagonistic effects of a novel phyllolitorin analogue wdesTrp3,Leu8]phyllolitorin (DTP) on scratching induced by three peptides (bombesin, neuromedin-C, and [Leu8]phyllolitorin). In addition, the binding affinity of each peptide for the bombesin receptor site was determined. DTP (30 μg) inhibited scratching induced by these peptides, but unlike the peptides, DTP had no affinity for the bombesin site, thereby suggesting that DTP is displaying physiological antagonism through an unknown mechanism. PMID:10482814

  13. Comparison of crystal structures of human type 3 3α-hydroxysteroid dehydrogenase reveals an “induced-fit” mechanism and a conserved basic motif involved in the binding of androgen

    PubMed Central

    Couture, Jean-François; Pereira De Jésus-Tran, Karine; Roy, Anne-Marie; Cantin, Line; Côté, Pierre-Luc; Legrand, Pierre; Luu-The, Van; Labrie, Fernand; Breton, Rock

    2005-01-01

    The aldo-keto reductase (AKR) human type 3 3α-hydroxysteroid dehydrogenase (h3α–HSD3, AKR1C2) plays a crucial role in the regulation of the intracellular concentrations of testosterone and 5α-dihydrotestosterone (5α-DHT), two steroids directly linked to the etiology and the progression of many prostate diseases and cancer. This enzyme also binds many structurally different molecules such as 4-hydroxynonenal, polycyclic aromatic hydrocarbons, and indanone. To understand the mechanism underlying the plasticity of its substrate-binding site, we solved the binary complex structure of h3α–HSD3-NADP(H) at 1.9 Å resolution. During the refinement process, we found acetate and citrate molecules deeply engulfed in the steroid-binding cavity. Superimposition of this structure with the h3α–HSD3-NADP(H)-testosterone/acetate ternary complex structure reveals that one of themobile loops forming the binding cavity operates a slight contraction movement against the citrate molecule while the side chains of many residues undergo numerous conformational changes, probably to create an optimal binding site for the citrate. These structural changes, which altogether cause a reduction of the substrate-binding cavity volume (from 776 Å3 in the presence of testosterone/acetate to 704 Å3 in the acetate/citratecomplex), are reminiscent of the “induced-fit” mechanism previously proposed for the aldose reductase, another member of the AKR superfamily. We also found that the replacement of residues Arg301 and Arg304, localized near the steroid-binding cavity, significantly affects the 3α–HSD activity of this enzyme toward 5α-DHT and completely abolishes its 17β–HSD activity on 4-dione. All these results have thus been used to reevaluate the binding mode of this enzyme for androgens. PMID:15929998

  14. Influence of E. coli endotoxin on ACTH induced adrenal cell steroidogenesis.

    PubMed

    Garcia, R; Viloria, M D; Municio, A M

    1985-03-01

    The effect of endotoxin (lipopolysaccharide from E. coli) on isolated adrenocortical cells was examined. Lipopolysaccharide decreased the ACTH-induced steroidogenesis. This effect was shown by all corticotropin concentrations studied, and the longer the incubation time, the higher the effect produced. The rate of decrease of ACTH-induced steroidogenesis was dependent on the concentration of lipopolysaccharide in the medium. Binding of [125I]ACTH to adrenocortical cells was modified by lipopolysaccharide; this modification was related to a decrease of the ACTH-induced steroidogenesis. This effect supports the hypothesis of a direct interaction between lipopolysaccharide and the cell membrane with a concomitant distortion of the cell surface affecting the ACTH receptor sites of their environment. [14C]Lipopolysaccharide binds to isolated adrenocortical cells. Binding specificity was investigated by competitive experiments in the presence of various types of endotoxins, polypeptide hormones and proteins. Unlabelled lipopolysaccharide from the same bacterial strain and isolated under identical conditions than the labelled lipopolysaccharide exerted the strongest inhibitory activity. Unlabelled lipopolysaccharide of various strains different from that originating the labelled lipopolysaccharide exerted the less displacement. It would imply a certain kind of specificity but the decrease in the binding of lipopolysaccharide produced by ACTH and glucagon suggests the existence of non-specific interactions between lipopolysaccharide and cell membrane.

  15. Relationship of calcium and membrane guanylate cyclase in adrenocorticotropin-induced steroidogenesis.

    PubMed

    Nambi, P; Aiyar, N V; Roberts, A N; Sharma, R K

    1982-07-01

    Chlorpromazine, when incubated with isolated adrenal cells, inhibited the ACTH-stimulated formation of cGMP and corticosterone production. It also inhibited the ACTH-stimulated membrane guanylate cyclase, but did not affect the binding of ACTH to the membrane receptors. cGMP-induced steroidogenesis was not affected by the drug. These data indicate that chlorpromazine interferes with adrenal steroid metabolism at a site between the hormone receptor and guanylate cyclase and also show that guanylate cyclase is composed of separate receptor and catalytic components. Furthermore, based on the premise that chlorpromazine exerts its inhibitory action by blocking the binding of a calcium receptor protein, such as calmodulin, to the receptor-coupled guanylate cyclase, it is proposed that the interaction of calcium, presumably through a calcium-binding protein, is essential for ACTH-dependent guanylate cyclase.

  16. A key agonist-induced conformational change in the cannabinoid receptor CB1 is blocked by the allosteric ligand Org 27569.

    PubMed

    Fay, Jonathan F; Farrens, David L

    2012-09-28

    Allosteric ligands that modulate how G protein-coupled receptors respond to traditional orthosteric drugs are an exciting and rapidly expanding field of pharmacology. An allosteric ligand for the cannabinoid receptor CB1, Org 27569, exhibits an intriguing effect; it increases agonist binding, yet blocks agonist-induced CB1 signaling. Here we explored the mechanism behind this behavior, using a site-directed fluorescence labeling approach. Our results show that Org 27569 blocks conformational changes in CB1 that accompany G protein binding and/or activation, and thus inhibit formation of a fully active CB1 structure. The underlying mechanism behind this behavior is that simultaneous binding of Org 27569 produces a unique agonist-bound conformation, one that may resemble an intermediate structure formed on the pathway to full receptor activation.

  17. Asymmetric ring structure of Vps4 required for ESCRT-III disassembly

    NASA Astrophysics Data System (ADS)

    Caillat, Christophe; Macheboeuf, Pauline; Wu, Yuanfei; McCarthy, Andrew A.; Boeri-Erba, Elisabetta; Effantin, Gregory; Göttlinger, Heinrich G.; Weissenhorn, Winfried; Renesto, Patricia

    2015-12-01

    The vacuolar protein sorting 4 AAA-ATPase (Vps4) recycles endosomal sorting complexes required for transport (ESCRT-III) polymers from cellular membranes. Here we present a 3.6-Å X-ray structure of ring-shaped Vps4 from Metallosphera sedula (MsVps4), seen as an asymmetric pseudohexamer. Conserved key interface residues are shown to be important for MsVps4 assembly, ATPase activity in vitro, ESCRT-III disassembly in vitro and HIV-1 budding. ADP binding leads to conformational changes within the protomer, which might propagate within the ring structure. All ATP-binding sites are accessible and the pseudohexamer binds six ATP with micromolar affinity in vitro. In contrast, ADP occupies one high-affinity and five low-affinity binding sites in vitro, consistent with conformational asymmetry induced on ATP hydrolysis. The structure represents a snapshot of an assembled Vps4 conformation and provides insight into the molecular motions the ring structure undergoes in a concerted action to couple ATP hydrolysis to ESCRT-III substrate disassembly.

  18. Specificity of O-glycosylation in enhancing the stability and cellulose binding affinity of Family 1 carbohydrate-binding modules

    PubMed Central

    Chen, Liqun; Drake, Matthew R.; Resch, Michael G.; Greene, Eric R.; Himmel, Michael E.; Chaffey, Patrick K.; Beckham, Gregg T.; Tan, Zhongping

    2014-01-01

    The majority of biological turnover of lignocellulosic biomass in nature is conducted by fungi, which commonly use Family 1 carbohydrate-binding modules (CBMs) for targeting enzymes to cellulose. Family 1 CBMs are glycosylated, but the effects of glycosylation on CBM function remain unknown. Here, the effects of O-mannosylation are examined on the Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase at three glycosylation sites. To enable this work, a procedure to synthesize glycosylated Family 1 CBMs was developed. Subsequently, a library of 20 CBMs was synthesized with mono-, di-, or trisaccharides at each site for comparison of binding affinity, proteolytic stability, and thermostability. The results show that, although CBM mannosylation does not induce major conformational changes, it can increase the thermolysin cleavage resistance up to 50-fold depending on the number of mannose units on the CBM and the attachment site. O-Mannosylation also increases the thermostability of CBM glycoforms up to 16 °C, and a mannose disaccharide at Ser3 seems to have the largest themostabilizing effect. Interestingly, the glycoforms with small glycans at each site displayed higher binding affinities for crystalline cellulose, and the glycoform with a single mannose at each of three positions conferred the highest affinity enhancement of 7.4-fold. Overall, by combining chemical glycoprotein synthesis and functional studies, we show that specific glycosylation events confer multiple beneficial properties on Family 1 CBMs. PMID:24821760

  19. A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites.

    PubMed Central

    Sellers, W R; Rodgers, J W; Kaelin, W G

    1995-01-01

    An intact T/E1A-binding domain (the pocket) is necessary, but not sufficient, for the retinoblastoma protein (RB) to bind to DNA-protein complexes containing E2F and for RB to induce a G1/S block. Indirect evidence suggests that the binding of RB to E2F may, in addition to inhibiting E2F transactivation function, generate a complex capable of functioning as a transrepressor. Here we show that a chimera in which the E2F1 transactivation domain was replaced with the RB pocket could, in a DNA-binding and pocket-dependent manner, mimic the ability of RB to repress transcription and induce a cell cycle arrest. In contrast, a transdominant negative E2F1 mutant that is capable of blocking E2F-dependent transactivation did not. Fusion of the RB pocket to a heterologous DNA-binding domain unrelated to E2F likewise generated a transrepressor protein when scored against a suitable reporter. These results suggest that growth suppression by RB is due, at least in part, to transrepression mediated by the pocket domain bound to certain promoters via E2F. Images Fig. 4 Fig. 5 PMID:8524800

  20. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  1. Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.

    PubMed

    Du, W; Aloyo, V J; Harvey, J A

    1997-10-03

    Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.

  2. A crustacean Ca2+-binding protein with a glutamate-rich sequence promotes CaCO3 crystallization.

    PubMed

    Endo, Hirotoshi; Takagi, Yasuaki; Ozaki, Noriaki; Kogure, Toshihiro; Watanabe, Toshiki

    2004-11-15

    The DD4 mRNA of the penaeid prawn Penaeus japonicus was shown previously to be expressed in the epidermis adjacent to the exoskeleton specifically during the post-moult period, when calcification of the exoskeleton took place. The encoded protein possessed a Ca2+-binding site, suggesting its involvement in the calcification of the exoskeleton. In the present study, an additional ORF (open reading frame) of 289 amino acids was identified at the 5' end of the previous ORF. The newly identified part of the encoded protein included a region of approx. 120 amino acids that was highly rich in glutamate residues, and contained one or more Ca2+-binding sites. In an immunohistochemical study, signals were detected within calcified regions in the endocuticular layer of the exoskeleton. Bacterially expressed partial segments of the protein induced CaCO3 crystallization in vitro. Finally, a reverse transcription-PCR study showed that the expression was limited to an early part of the post-moult period, preceding significant calcification of the exoskeleton. These observations argue for the possibility that the encoded protein, renamed crustocalcin (CCN), promotes formation of CaCO3 crystals in the exoskeleton by inducing nucleation.

  3. NMR of α-synuclein–polyamine complexes elucidates the mechanism and kinetics of induced aggregation

    PubMed Central

    Fernández, Claudio O; Hoyer, Wolfgang; Zweckstetter, Markus; Jares-Erijman, Elizabeth A; Subramaniam, Vinod; Griesinger, Christian; Jovin, Thomas M

    2004-01-01

    The aggregation of α-synuclein is characteristic of Parkinson's disease (PD) and other neurodegenerative synucleinopathies. The 140-aa protein is natively unstructured; thus, ligands binding to the monomeric form are of therapeutic interest. Biogenic polyamines promote the aggregation of α-synuclein and may constitute endogenous agents modulating the pathogenesis of PD. We characterized the complexes of natural and synthetic polyamines with α-synuclein by NMR and assigned the binding site to C-terminal residues 109–140. Dissociation constants were derived from chemical shift perturbations. Greater polyamine charge (+2 → +5) correlated with increased affinity and enhancement of fibrillation, for which we propose a simple kinetic mechanism involving a dimeric nucleation center. According to the analysis, polyamines increase the extent of nucleation by ∼104 and the rate of monomer addition ∼40-fold. Significant secondary structure is not induced in monomeric α-synuclein by polyamines at 15°C. Instead, NMR reveals changes in a region (aa 22–93) far removed from the polyamine binding site and presumed to adopt the β-sheet conformation characteristic of fibrillar α-synuclein. We conclude that the C-terminal domain acts as a regulator of α-synuclein aggregation. PMID:15103328

  4. Consensus Induced Fit Docking (cIFD): methodology, validation, and application to the discovery of novel Crm1 inhibitors

    NASA Astrophysics Data System (ADS)

    Kalid, Ori; Toledo Warshaviak, Dora; Shechter, Sharon; Sherman, Woody; Shacham, Sharon

    2012-11-01

    We present the Consensus Induced Fit Docking (cIFD) approach for adapting a protein binding site to accommodate multiple diverse ligands for virtual screening. This novel approach results in a single binding site structure that can bind diverse chemotypes and is thus highly useful for efficient structure-based virtual screening. We first describe the cIFD method and its validation on three targets that were previously shown to be challenging for docking programs (COX-2, estrogen receptor, and HIV reverse transcriptase). We then demonstrate the application of cIFD to the challenging discovery of irreversible Crm1 inhibitors. We report the identification of 33 novel Crm1 inhibitors, which resulted from the testing of 402 purchased compounds selected from a screening set containing 261,680 compounds. This corresponds to a hit rate of 8.2 %. The novel Crm1 inhibitors reveal diverse chemical structures, validating the utility of the cIFD method in a real-world drug discovery project. This approach offers a pragmatic way to implicitly account for protein flexibility without the additional computational costs of ensemble docking or including full protein flexibility during virtual screening.

  5. Widespread Long Noncoding RNAs as Endogenous Target Mimics for MicroRNAs in Plants1[W

    PubMed Central

    Wu, Hua-Jun; Wang, Zhi-Min; Wang, Meng; Wang, Xiu-Jie

    2013-01-01

    Target mimicry is a recently identified regulatory mechanism for microRNA (miRNA) functions in plants in which the decoy RNAs bind to miRNAs via complementary sequences and therefore block the interaction between miRNAs and their authentic targets. Both endogenous decoy RNAs (miRNA target mimics) and engineered artificial RNAs can induce target mimicry effects. Yet until now, only the Induced by Phosphate Starvation1 RNA has been proven to be a functional endogenous microRNA target mimic (eTM). In this work, we developed a computational method and systematically identified intergenic or noncoding gene-originated eTMs for 20 conserved miRNAs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). The predicted miRNA binding sites were well conserved among eTMs of the same miRNA, whereas sequences outside of the binding sites varied a lot. We proved that the eTMs of miR160 and miR166 are functional target mimics and identified their roles in the regulation of plant development. The effectiveness of eTMs for three other miRNAs was also confirmed by transient agroinfiltration assay. PMID:23429259

  6. Cofilin is a pH sensor for actin free barbed end formation: role of phosphoinositide binding.

    PubMed

    Frantz, Christian; Barreiro, Gabriela; Dominguez, Laura; Chen, Xiaoming; Eddy, Robert; Condeelis, John; Kelly, Mark J S; Jacobson, Matthew P; Barber, Diane L

    2008-12-01

    Newly generated actin free barbed ends at the front of motile cells provide sites for actin filament assembly driving membrane protrusion. Growth factors induce a rapid biphasic increase in actin free barbed ends, and we found both phases absent in fibroblasts lacking H(+) efflux by the Na-H exchanger NHE1. The first phase is restored by expression of mutant cofilin-H133A but not unphosphorylated cofilin-S3A. Constant pH molecular dynamics simulations and nuclear magnetic resonance (NMR) reveal pH-sensitive structural changes in the cofilin C-terminal filamentous actin binding site dependent on His133. However, cofilin-H133A retains pH-sensitive changes in NMR spectra and severing activity in vitro, which suggests that it has a more complex behavior in cells. Cofilin activity is inhibited by phosphoinositide binding, and we found that phosphoinositide binding is pH-dependent for wild-type cofilin, with decreased binding at a higher pH. In contrast, phosphoinositide binding by cofilin-H133A is attenuated and pH insensitive. These data suggest a molecular mechanism whereby cofilin acts as a pH sensor to mediate a pH-dependent actin filament dynamics.

  7. Organization, development, and effects of infraorbital nerve transection on galanin binding sites in the trigeminal brainstem complex.

    PubMed

    Bodie, D; Bennett-Clarke, C A; Davis, K; Postelwaite, J P; Chiaia, N L; Rhoades, R W

    1997-01-01

    Previous experiments from this laboratory have indicated that transection of the infraorbital nerve (ION, the trigeminal [V] branch that supplies the mystacial vibrissae follicles) at birth and in adulthood has markedly different effects on galanin immunoreactivity in the V brainstem complex. Adult nerve transection increases galanin immunoreactivity in the superficial layers of V subnucleus caudalis (SpC) only, while neonatal nerve transection results in increased galanin expression in vibrissae-related primary afferents throughout the V brainstem complex. The present study describes the distribution of binding sites for this peptide in the mature and developing V ganglion and brainstem complex and determines the effects of neonatal and adult ION damage and the associated changes in galanin levels upon their distribution and density. Galanin binding sites are densely distributed in all V brainstem subnuclei and are particularly dense in V subnucleus interpolaris and the superficial layers of SpC. They are present at birth (P-0) and their distribution is similar to that in adult animals. Transection of the ION in adulthood and examination of brainstem 7 days later indicated marked reductions in the density of galanin binding sites in the V brainstem complex. With the exception of the superficial laminae of SpC, the same reduction in density remained apparent in rats that survived > 45 days after nerve cuts. Transection of the ION on P-0 resulted in no change in the density of galanin binding sites in the brainstem after either 7 or > 60 days survival. These results indicate that densely distributed galanin binding sites are present in the V brainstem complex of both neonatal and adult rats, that they are located in regions not innervated by galanin-positive axons, and that their density is not significantly influenced by large lesion-induced changes in the primary afferent content of their natural ligand.

  8. A stochastic context free grammar based framework for analysis of protein sequences

    PubMed Central

    Dyrka, Witold; Nebel, Jean-Christophe

    2009-01-01

    Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800

  9. GABA/benzodiazepine receptor complex in long-sleep and short-sleep mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marley, R.J.

    LS mice are more sensitive to benzodiazepine-induced anesthesia; however, the two lines do not differ in their hypothermic response to flurazepam. SS mice are more resistant to 3-mercaptopropionic acid-induced seizures and more sensitive to the anticonvulsant effects of benzodiazepines. The various correlates of GABA and benzodiazepine actions probably are the results of different mechanisms of action and/or differential regional control. Bicuculline competition for /sup 3/H-GABA binding sites is greater in SS cerebellar tissue and /sup 3/H-flunitrazepam binding is greater in the mid-brain region of LS mice. GABA enhancement of /sup 3/H-flunitrazepma binding is greater in SS mice. Ethanol also enhancesmore » /sup 3/H-flunitrazepam binding and increases the levels of /sup 3/H-flunitrazepam binding above those observed for GABA. Using correlational techniques on data from LS and SS mice and several inbred mouse strains, it was demonstrated that a positive relationship exists between the degree of receptor coupling within the GABA receptor complex and the degree of resistance to seizures.« less

  10. AKAP13 Rho-GEF and PKD-Binding Domain Deficient Mice Develop Normally but Have an Abnormal Response to β-Adrenergic-Induced Cardiac Hypertrophy

    PubMed Central

    Spindler, Matthew J.; Burmeister, Brian T.; Huang, Yu; Hsiao, Edward C.; Salomonis, Nathan; Scott, Mark J.; Srivastava, Deepak; Carnegie, Graeme K.; Conklin, Bruce R.

    2013-01-01

    Background A-kinase anchoring proteins (AKAPs) are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA) and D (PKD) and an active Rho-guanine nucleotide exchange factor (Rho-GEF) domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown. Methodology/Principal Findings To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction. Conclusions These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy. PMID:23658642

  11. Analysis and prediction of calcium-binding pockets from apo-protein structures exhibiting calcium-induced localized conformational changes

    PubMed Central

    Wang, Xue; Zhao, Kun; Kirberger, Michael; Wong, Hing; Chen, Guantao; Yang, Jenny J

    2010-01-01

    Calcium binding in proteins exhibits a wide range of polygonal geometries that relate directly to an equally diverse set of biological functions. The binding process stabilizes protein structures and typically results in local conformational change and/or global restructuring of the backbone. Previously, we established the MUG program, which utilized multiple geometries in the Ca2+-binding pockets of holoproteins to identify such pockets, ignoring possible Ca2+-induced conformational change. In this article, we first report our progress in the analysis of Ca2+-induced conformational changes followed by improved prediction of Ca2+-binding sites in the large group of Ca2+-binding proteins that exhibit only localized conformational changes. The MUGSR algorithm was devised to incorporate side chain torsional rotation as a predictor. The output from MUGSR presents groups of residues where each group, typically containing two to five residues, is a potential binding pocket. MUGSR was applied to both X-ray apo structures and NMR holo structures, which did not use calcium distance constraints in structure calculations. Predicted pockets were validated by comparison with homologous holo structures. Defining a “correct hit” as a group of residues containing at least two true ligand residues, the sensitivity was at least 90%; whereas for a “correct hit” defined as a group of residues containing at least three true ligand residues, the sensitivity was at least 78%. These data suggest that Ca2+-binding pockets are at least partially prepositioned to chelate the ion in the apo form of the protein. PMID:20512971

  12. Ligand Binding Induces Conformational Changes in Human Cellular Retinol-binding Protein 1 (CRBP1) Revealed by Atomic Resolution Crystal Structures.

    PubMed

    Silvaroli, Josie A; Arne, Jason M; Chelstowska, Sylwia; Kiser, Philip D; Banerjee, Surajit; Golczak, Marcin

    2016-04-15

    Important in regulating the uptake, storage, and metabolism of retinoids, cellular retinol-binding protein 1 (CRBP1) is essential for trafficking vitamin A through the cytoplasm. However, the molecular details of ligand uptake and targeted release by CRBP1 remain unclear. Here we report the first structure of CRBP1 in a ligand-free form as well as ultra-high resolution structures of this protein bound to either all-trans-retinol or retinylamine, the latter a therapeutic retinoid that prevents light-induced retinal degeneration. Superpositioning of human apo- and holo-CRBP1 revealed major differences within segments surrounding the entrance to the retinoid-binding site. These included α-helix II and hairpin turns between β-strands βC-βD and βE-βF as well as several side chains, such as Phe-57, Tyr-60, and Ile-77, that change their orientations to accommodate the ligand. Additionally, we mapped hydrogen bond networks inside the retinoid-binding cavity and demonstrated their significance for the ligand affinity. Analyses of the crystallographic B-factors indicated several regions with higher backbone mobility in the apoprotein that became more rigid upon retinoid binding. This conformational flexibility of human apo-CRBP1 facilitates interaction with the ligands, whereas the more rigid holoprotein structure protects the labile retinoid moiety during vitamin A transport. These findings suggest a mechanism of induced fit upon ligand binding by mammalian cellular retinol-binding proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Deciphering structure-activity relationships in a series of Tat/TAR inhibitors.

    PubMed

    Pascale, Lise; González, Alejandro López; Di Giorgio, Audrey; Gaysinski, Marc; Teixido Closa, Jordi; Tejedor, Roger Estrada; Azoulay, Stéphane; Patino, Nadia

    2016-11-01

    A series of pentameric "Polyamide Amino Acids" (PAAs) compounds derived from the same trimeric precursor have been synthesized and investigated as HIV TAR RNA ligands, in the absence and in the presence of a Tat fragment. All PAAs bind TAR with similar sub-micromolar affinities but their ability to compete efficiently with the Tat fragment strongly differs, IC50 ranging from 35 nM to >2 μM. While NMR and CD studies reveal that all PAA interact with TAR at the same site and induce globally the same RNA conformational change upon binding, a comparative thermodynamic study of PAA/TAR equilibria highlights distinct TAR binding modes for Tat competitor and non-competitor PAAs. This led us to suggest two distinct interaction modes that have been further validated by molecular modeling studies. While the binding of Tat competitor PAAs induces a contraction at the TAR bulge region, the binding of non-competitor ones widens it. This could account for the distinct PAA ability to compete with Tat fragment. Our work illustrates how comparative thermodynamic studies of a series of RNA ligands of same chemical family are of value for understanding their binding modes and for rationalizing structure-activity relationships.

  14. Pin1 promotes transforming growth factor-beta-induced migration and invasion.

    PubMed

    Matsuura, Isao; Chiang, Keng-Nan; Lai, Chen-Yu; He, Dongming; Wang, Guannan; Ramkumar, Romila; Uchida, Takafumi; Ryo, Akihide; Lu, Kunping; Liu, Fang

    2010-01-15

    Transforming growth factor-beta (TGF-beta) regulates a wide variety of biological activities. It induces potent growth-inhibitory responses in normal cells but promotes migration and invasion of cancer cells. Smads mediate the TGF-beta responses. TGF-beta binding to the cell surface receptors leads to the phosphorylation of Smad2/3 in their C terminus as well as in the proline-rich linker region. The serine/threonine phosphorylation sites in the linker region are followed by the proline residue. Pin1, a peptidyl-prolyl cis/trans isomerase, recognizes phosphorylated serine/threonine-proline motifs. Here we show that Smad2/3 interacts with Pin1 in a TGF-beta-dependent manner. We further show that the phosphorylated threonine 179-proline motif in the Smad3 linker region is the major binding site for Pin1. Although epidermal growth factor also induces phosphorylation of threonine 179 and other residues in the Smad3 linker region the same as TGF-beta, Pin1 is unable to bind to the epidermal growth factor-stimulated Smad3. Further analysis suggests that phosphorylation of Smad3 in the C terminus is necessary for the interaction with Pin1. Depletion of Pin1 by small hairpin RNA does not significantly affect TGF-beta-induced growth-inhibitory responses and a number of TGF-beta/Smad target genes analyzed. In contrast, knockdown of Pin1 in human PC3 prostate cancer cells strongly inhibited TGF-beta-mediated migration and invasion. Accordingly, TGF-beta induction of N-cadherin, which plays an important role in migration and invasion, is markedly reduced when Pin1 is depleted in PC3 cells. Because Pin1 is overexpressed in many cancers, our findings highlight the importance of Pin1 in TGF-beta-induced migration and invasion of cancer cells.

  15. Regulation of IL-8 promoter activity by verrucarin A in human monocytic THP-1 cells.

    PubMed

    Liu, Jun; Simmons, Steve O; Pei, Ruoting

    2014-01-01

    Macrocyclic trichothecenes have been frequently detected in fungi in water-damaged buildings and exhibited higher toxicity than the well-studied trichothecenes; however, the mechanism underlying their toxicity has been poorly understood. In this study, transcriptional regulation of the cytokine interleukin (IL)-8 by a macrocyclic trichothecene, verrucarin A (VA), in human monocytic THP-1 cells is reported. Consistent with previous findings, VA was 100-fold more cytotoxic than deoxynivalenol (DON), while ochratoxin A (OA) was not cytotoxic. In cells transduced with the wild-type IL-8 promoter luciferase construct, VA induced a biphasic dose response composed of an upregulation of luciferase expression at low concentrations of 0.01-1 ng/ml and a downregulation at high levels of 10 ng/ml and higher. In contrast, DON induced a sigmoid-shaped dose response with the EC50 of 11.6 ng/ml, while OA did not markedly affect the IL-8 expression. When cells were transduced with IL-8 promoter with a mutation of transcription factor nuclear factor-κB (NF-κB)-binding site, VA (1 ng/ml), DON (1000 ng/ml), and tumor necrosis factor (TNF) α (20 ng/ml)-induced luciferase expression were impaired. In addition, the NF-κB inhibitor caffeic acid phenethyl ester inhibited VA-, DON-, and TNFα-induced luciferase expression. Mutation of the CCAAT/enhancer-binding protein (CEBP) β binding site of the IL-8 promoter affected only DON-, but not VA- and TNFα-induced luciferase expression. Taken together, these results suggested that VA activated IL-8 promoter via an NF-κB-dependent, but not CEBPβ-dependent, pathway in human monocytes.

  16. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  17. Methoxyflurane acts at the substrate binding site of cytochrome P450 LM2 to induce a dependence on cytochrome b5.

    PubMed

    Lipka, J J; Waskell, L A

    1989-01-01

    Rabbit cytochrome P450 isozyme 2 requires cytochrome b5 to metabolize the volatile anesthetic methoxyflurane but not the substrate benzphetamine [E. Canova-Davis and L. Waskell (1984) J. Biol. Chem. 259, 2541-2546]. To determine whether the requirement for cytochrome b5 for methoxyflurane oxidation is mediated by an allosteric effect on cytochrome P450 LM2 or cytochrome P450 reductase, we have investigated whether this anesthetic can induce a role for cytochrome b5 in benzphetamine metabolism. Using rabbit liver microsomes and antibodies raised in guinea pigs against rabbit cytochrome b5, we found that methoxyflurane did not create a cytochrome b5 requirement for benzphetamine metabolism. Methoxyflurane also failed to induce a role for cytochrome b5 in benzphetamine metabolism in the purified, reconstituted mixed function oxidase system. Studies of the reaction kinetics established that in the absence of cytochrome b5, methoxyflurane and benzphetamine are competitive inhibitors, and that in the presence of cytochrome b5, benzphetamine and methoxyflurane are two alternate substrates in competition for a single site on the same enzyme. These results all indicate that the methoxyflurane-induced cytochrome b5 dependence of the mixed function oxidase cytochrome P450 LM2 system is a direct result of the interaction between methoxyflurane and the substrate binding site of cytochrome P450 LM2 and suggest the focus of future studies of this question.

  18. Novobiocin and additional inhibitors of the Hsp90 C-terminal nucleotide-binding pocket.

    PubMed

    Donnelly, Alison; Blagg, Brian S J

    2008-01-01

    The 90 kDa heat shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site ( approximately 700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea. EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimics the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones, Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity.

  19. Novobiocin and Additional Inhibitors of the Hsp90 C-Terminal Nucleotide-binding Pocket

    PubMed Central

    Donnelly, Alison; Blagg, Brian S. J.

    2009-01-01

    The 90 kDa heal shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site (~700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimies the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones. Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity. PMID:18991631

  20. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  1. Phosphorylation of α3 Glycine Receptors Induces a Conformational Change in the Glycine-Binding Site

    PubMed Central

    2013-01-01

    Inflammatory pain sensitization is initiated by prostaglandin-induced phosphorylation of α3 glycine receptors (GlyRs) that are specifically located in inhibitory synapses on spinal pain sensory neurons. Phosphorylation reduces the magnitude of glycinergic synaptic currents, thereby disinhibiting nociceptive neurons. Although α1 and α3 subunits are both expressed on spinal nociceptive neurons, α3 is a more promising therapeutic target as its sparse expression elsewhere implies a reduced risk of side-effects. Here we compared glycine-mediated conformational changes in α1 and α3 GlyRs to identify structural differences that might be exploited in designing α3-specific analgesics. Using voltage-clamp fluorometry, we show that glycine-mediated conformational changes in the extracellular M2-M3 domain were significantly different between the two GlyR isoforms. Using a chimeric approach, we found that structural variations in the intracellular M3-M4 domain were responsible for this difference. This prompted us to test the hypothesis that phosphorylation of S346 in α3 GlyR might also induce extracellular conformation changes. We show using both voltage-clamp fluorometry and pharmacology that Ser346 phosphorylation elicits structural changes in the α3 glycine-binding site. These results provide the first direct evidence for phosphorylation-mediated extracellular conformational changes in pentameric ligand-gated ion channels, and thus suggest new loci for investigating how phosphorylation modulates structure and function in this receptor family. More importantly, by demonstrating that phosphorylation alters α3 GlyR glycine-binding site structure, they raise the possibility of developing analgesics that selectively target inflammation-modulated GlyRs. PMID:23834509

  2. cAMP Response Element-binding Protein (CREB) and Nuclear Factor κB Mediate the Tamoxifen-induced Up-regulation of Glutamate Transporter 1 (GLT-1) in Rat Astrocytes*

    PubMed Central

    Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook

    2013-01-01

    Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341

  3. Crystal structures reveal an induced-fit binding of a substrate-like Aza-peptide epoxide to SARS coronavirus main peptidase.

    PubMed

    Lee, Ting-Wai; Cherney, Maia M; Liu, Jie; James, Karen Ellis; Powers, James C; Eltis, Lindsay D; James, Michael N G

    2007-02-23

    The SARS coronavirus main peptidase (SARS-CoV M(pro)) plays an essential role in the life-cycle of the virus and is a primary target for the development of anti-SARS agents. Here, we report the crystal structure of M(pro) at a resolution of 1.82 Angstroms, in space group P2(1) at pH 6.0. In contrast to the previously reported structure of M(pro) in the same space group at the same pH, the active sites and the S1 specificity pockets of both protomers in the structure of M(pro) reported here are in the catalytically competent conformation, suggesting their conformational flexibility. We report two crystal structures of M(pro) having an additional Ala at the N terminus of each protomer (M(+A(-1))(pro)), both at a resolution of 2.00 Angstroms, in space group P4(3)2(1)2: one unbound and one bound by a substrate-like aza-peptide epoxide (APE). In the unbound form, the active sites and the S1 specificity pockets of both protomers of M(+A(-1))(pro) are observed in a collapsed (catalytically incompetent) conformation; whereas they are in an open (catalytically competent) conformation in the APE-bound form. The observed conformational flexibility of the active sites and the S1 specificity pockets suggests that these parts of M(pro) exist in dynamic equilibrium. The structural data further suggest that the binding of APE to M(pro) follows an induced-fit model. The substrate likely also binds in an induced-fit manner in a process that may help drive the catalytic cycle.

  4. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  5. Carbon repression of cellobiose dehydrogenase production in the white rot fungus Trametes versicolor is mediated at the level of gene transcription.

    PubMed

    Stapleton, P C; Dobson, A D W

    2003-04-25

    Cellobiose dehydrogenase (CDH) production in Trametes versicolor is induced in the presence of cellulose, but decreases when additional carbon sources such as glucose and maltose are added to the fungal cultures. Using T. versicolor-specific cdh primers in a reverse transcription-polymerase chain reaction-based approach, it appears that this repression in CDH production is being mediated at the level of gene transcription. When a 1.6-kb upstream region of the T. versicolor cdh gene was cloned and sequenced, a number of putative CreA-like binding sites were observed. We propose that these sites may be involved in mediating this repressive effect, based on their similarity to the consensus [5'-SYGGRGG-3'] site for binding of the CreA and Cre1 repressor proteins.

  6. Increased mitochondrial matrix directed superoxide production by fatty acid hydroperoxides in skeletal muscle mitochondria

    PubMed Central

    Bhattacharya, Arunabh; Lustgarten, Michael; Shi, Yun; Liu, Yuhong; Jang, Youngmok C; Pulliam, Daniel; Jernigan, Amanda L; Van Remmen, Holly

    2013-01-01

    Previous studies have shown that muscle atrophy is associated with mitochondrial dysfunction and an increased rate of mitochondrial reactive oxygen species production. We recently demonstrated that fatty acid hydroperoxides (FA-OOH) are significantly elevated in mitochondria isolated from atrophied muscles. The purpose of the current study is to determine whether FA-OOH can alter skeletal muscle mitochondrial function. We found that FA-OOH (at low micromolar concentrations) induces mitochondrial dysfunction assessed by decrease in the rate of ATP production, oxygen consumption and activity of respiratory chain complexes I and III. Using methods to distinguish superoxide release towards the matrix and inter-membrane space, we demonstrate that FA-OOH significantly elevates oxidative stress in the mitochondrial matrix (and not the inter-membrane space) with complex I as the major site of superoxide production (most likely from a site upstream of the ubiquinone binding site but downstream from the flavin binding site-the iron sulfur clusters). Our results are the first to indicate that FA-OOH’s are important modulators of mitochondrial function and oxidative stress in skeletal muscle mitochondria and may play an important role in muscle atrophies that are associated with increased generation of FA-OOH’s, e.g., denervation-induced muscle atrophy. PMID:21172427

  7. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate.

    PubMed

    Vanpouille, Christophe; Denys, Agnès; Carpentier, Mathieu; Pakula, Rachel; Mazurier, Joël; Allain, Fabrice

    2004-09-01

    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPB(KKK-) [where KKK- refers to the substitutions K3A(Lys3-->Ala)/K4A/K5A] and CyPB(DeltaYFD) (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses.

  8. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate

    PubMed Central

    2004-01-01

    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPBKKK− [where KKK− refers to the substitutions K3A(Lys3→Ala)/K4A/K5A] and CyPBΔYFD (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses. PMID:15109301

  9. Structural and Biochemical Characterization of Organotin and Organolead Compounds Binding to the Organomercurial Lyase MerB Provide New Insights into Its Mechanism of Carbon–Metal Bond Cleavage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wahba, Haytham M.; Stevenson, Michael J.; Mansour, Ahmed

    2017-01-03

    The organomercurial lyase MerB has the unique ability to cleave carbon–Hg bonds, and structural studies indicate that three residues in the active site (C96, D99, and C159 in E. coli MerB) play important roles in the carbon–Hg bond cleavage. However, the role of each residue in carbon–metal bond cleavage has not been well-defined. To do so, we have structurally and biophysically characterized the interaction of MerB with a series of organotin and organolead compounds. Studies with two known inhibitors of MerB, dimethyltin (DMT) and triethyltin (TET), reveal that they inhibit by different mechanisms. In both cases the initial binding ismore » to D99, but DMT subsequently binds to C96, which induces a conformation change in the active site. In contrast, diethyltin (DET) is a substrate for MerB and the SnIV product remains bound in the active site in a coordination similar to that of HgII following cleavage of organomercurial compounds. The results with analogous organolead compounds are similar in that trimethyllead (TML) is not cleaved and binds only to D99, whereas diethyllead (DEL) is a substrate and the PbIV product remains bound in the active site. Binding and cleavage is an exothermic reaction, while binding to D99 has negligible net heat flow. These results show that initial binding of organometallic compounds to MerB occurs at D99 followed, in some cases, by cleavage and loss of the organic moieties and binding of the metal ion product to C96, D99, and C159. The N-terminus of MerA is able to extract the bound PbVI but not the bound SnIV. These results suggest that MerB could be utilized for bioremediation applications, but certain organolead and organotin compounds may present an obstacle by inhibiting the enzyme.« less

  10. CD and MCD studies of the effects of component B variant binding on the biferrous active site of methane monooxygenase.

    PubMed

    Mitić, Natasa; Schwartz, Jennifer K; Brazeau, Brian J; Lipscomb, John D; Solomon, Edward I

    2008-08-12

    The multicomponent soluble form of methane monooxygenase (sMMO) catalyzes the oxidation of methane through the activation of O 2 at a nonheme biferrous center in the hydroxylase component, MMOH. Reactivity is limited without binding of the sMMO effector protein, MMOB. Past studies show that mutations of specific MMOB surface residues cause large changes in the rates of individual steps in the MMOH reaction cycle. To define the structural and mechanistic bases for these observations, CD, MCD, and VTVH MCD spectroscopies coupled with ligand-field (LF) calculations are used to elucidate changes occurring near and at the MMOH biferrous cluster upon binding of MMOB and the MMOB variants. Perturbations to both the CD and MCD are observed upon binding wild-type MMOB and the MMOB variant that similarly increases O 2 reactivity. MMOB variants that do not greatly increase O 2 reactivity fail to cause one or both of these changes. LF calculations indicate that reorientation of the terminal glutamate on Fe2 reproduces the spectral perturbations in MCD. Although this structural change allows O 2 to bridge the diiron site and shifts the redox active orbitals for good overlap, it is not sufficient for enhanced O 2 reactivity of the enzyme. Binding of the T111Y-MMOB variant to MMOH induces the MCD, but not CD changes, and causes only a small increase in reactivity. Thus, both the geometric rearrangement at Fe2 (observed in MCD) coupled with a more global conformational change that may control O 2 access (probed by CD), induced by MMOB binding, are critical factors in the reactivity of sMMO.

  11. Complicated function of dopamine in Aβ-related neurotoxicity: Dual interactions with Tyr10 and SNK(26-28) of Aβ.

    PubMed

    Liu, Mengmeng; Kou, Lu; Bin, Yannan; Wan, Liping; Xiang, Juan

    2016-11-01

    With the capability to inhibit the formation of amyloid β peptides (Aβ) fibril, dopamine (DA) and other catechol derivatives have been considered for the potential treatment of Alzheimer's disease (AD). Such treatment, however, remains debatable because of the diverse functions of Aβ and DA in AD pathology. Moreover, the complicated oxidation accompanying DA has caused the majority of the previous research to focus on the binding of DA oxides onto Aβ. The molecular mechanism by which Aβ interacts with the reduction state of DA, which is correlative with the brain function, should be urgently explored. By controlling rigorous anaerobic experimental conditions, this work investigated the molecular mechanism of the Aβ/DA interaction, and two binding sites were revealed. For the binding of DA, Tyrosine (Tyr 10 ) was identified as the strong binding site, and serine-asparagine-lysing (SNK(26-28)) segment was the weak binding segment. Furthermore, the Thioflavin T (THT) fluorescence confirmed DA's positive function of inhibiting Aβ aggregation through its weakly binding with SNK(26-28) segment. Meanwhile, 7-OHCCA fluorescence exhibited DA's negative function of enhancing OH generation through inhibiting the Aβ/Cu 2+ coordination. The viability tests of the neuroblastoma SH-SY5Y cells displayed that the coexistence of DA, Cu 2+ , and Aβ induced lower cell viability than free Cu 2+ , indicating the significant negative effect of excessive DA on AD progression. This research revealed the potential DA-induced damage in AD brain, which is significant for understanding the function of DA in AD neuropathology and for designing a DA-related therapeutic strategy for AD. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Structural Basis of Resistance to Anti-Cytochrome bc1 Complex Inhibitors: Implication for Drug Improvement

    PubMed Central

    Esser, Lothar; Yu, Chang-An; Xia, Di

    2016-01-01

    The emergence of drug resistance has devastating economic and social consequences, a testimonial of which is the rise and fall of inhibitors against the respiratory component cytochrome bc1 complex, a time tested and highly effective target for disease control. Unfortunately, the mechanism of resistance is a multivariate problem, including primarily mutations in the gene of the cytochrome b subunit but also activation of alternative pathways of ubiquinol oxidation and pharmacokinetic effects. There is a considerable interest in designing new bc1 inhibitors with novel modes of binding and lower propensity to induce the development of resistance. The accumulation of crystallographic data of bc1 complexes with and without inhibitors bound provides the structural basis for rational drug design. In particular, the cytochrome b subunit offers two distinct active sites that can be targeted for inhibition - the quinol oxidation site and the quinone reduction site. This review brings together available structural information of inhibited bc1 by various quinol oxidation- and reduction-site inhibitors, the inhibitor binding modes, conformational changes upon inhibitor binding of side chains in the active site and large scale domain movements of the iron-sulfur protein subunit. Structural data analysis provides a clear understanding of where and why existing inhibitors fail and points towards promising alternatives. PMID:23688079

  13. Dynamic Conformational Changes in MUNC18 Prevent Syntaxin Binding

    PubMed Central

    Bar-On, Dana; Nachliel, Esther; Gutman, Menachem; Ashery, Uri

    2011-01-01

    The Sec1/munc18 protein family is essential for vesicle fusion in eukaryotic cells via binding to SNARE proteins. Protein kinase C modulates these interactions by phosphorylating munc18a thereby reducing its affinity to one of the central SNARE members, syntaxin-1a. The established hypothesis is that the reduced affinity of the phosphorylated munc18a to syntaxin-1a is a result of local electrostatic repulsion between the two proteins, which interferes with their compatibility. The current study challenges this paradigm and offers a novel mechanistic explanation by revealing a syntaxin-non-binding conformation of munc18a that is induced by the phosphomimetic mutations. In the present study, using molecular dynamics simulations, we explored the dynamics of the wild-type munc18a versus phosphomimetic mutant munc18a. We focused on the structural changes that occur in the cavity between domains 3a and 1, which serves as the main syntaxin-binding site. The results of the simulations suggest that the free wild-type munc18a exhibits a dynamic equilibrium between several conformations differing in the size of its cavity (the main syntaxin-binding site). The flexibility of the cavity's size might facilitate the binding or unbinding of syntaxin. In silico insertion of phosphomimetic mutations into the munc18a structure induces the formation of a conformation where the syntaxin-binding area is rigid and blocked as a result of interactions between residues located on both sides of the cavity. Therefore, we suggest that the reduced affinity of the phosphomimetic mutant/phosphorylated munc18a is a result of the closed-cavity conformation, which makes syntaxin binding energetically and sterically unfavorable. The current study demonstrates the potential of phosphoryalation, an essential biological process, to serve as a driving force for dramatic conformational changes of proteins modulating their affinity to target proteins. PMID:21390273

  14. A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

    NASA Technical Reports Server (NTRS)

    Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

    2001-01-01

    The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

  15. Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

    PubMed

    Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

    2016-11-02

    Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.

  16. Cobra CRISP functions as an inflammatory modulator via a novel Zn2+- and heparan sulfate-dependent transcriptional regulation of endothelial cell adhesion molecules.

    PubMed

    Wang, Yu-Ling; Kuo, Je-Hung; Lee, Shao-Chen; Liu, Jai-Shin; Hsieh, Yin-Cheng; Shih, Yu-Tsung; Chen, Chun-Jung; Chiu, Jeng-Jiann; Wu, Wen-Guey

    2010-11-26

    Cysteine-rich secretory proteins (CRISPs) have been identified as a toxin family in most animal venoms with biological functions mainly associated with the ion channel activity of cysteine-rich domain (CRD). CRISPs also bind to Zn(2+) at their N-terminal pathogenesis-related (PR-1) domain, but their function remains unknown. Interestingly, similar the Zn(2+)-binding site exists in all CRISP family, including those identified in a wide range of organisms. Here, we report that the CRISP from Naja atra (natrin) could induce expression of vascular endothelial cell adhesion molecules, i.e. intercellular adhesion molecule-1, vascular adhesion molecule-1, and E-selectin, to promote monocytic cell adhesion in a heparan sulfate (HS)- and Zn(2+)-dependent manner. Using specific inhibitors and small interfering RNAs, the activation mechanisms are shown to involve both mitogen-activated protein kinases and nuclear factor-κB. Biophysical characterization of natrin by using fluorescence, circular dichroism, and x-ray crystallographic methods further reveals the presence of two Zn(2+)-binding sites for natrin. The strong binding site is located near the putative Ser-His-Glu catalytic triad of the N-terminal domain. The weak binding site remains to be characterized, but it may modulate HS binding by enhancing its interaction with long chain HS. Our results strongly suggest that natrin may serve as an inflammatory modulator that could perturb the wound-healing process of the bitten victim by regulating adhesion molecule expression in endothelial cells. Our finding uncovers a new aspect of the biological role of CRISP family in immune response and is expected to facilitate future development of new therapeutic strategy for the envenomed victims.

  17. Modulation of ouabain binding and potassium pump fluxes by cellular sodium and potassium in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. Erythrocytes were treated with nystatin to alter internal Na (Nai) and K (Ki) composition. Although the rates of K pumping and [3H]ouabain binding were altered dramatically, the relationship between glycoside binding and K pump inhibition was unaffected. 2. Human cells with high Nai and low Ki exhibited an increased rate of ouabain binding as compared to high Ki, low Nai cells; this paralleled the stimulated K pump activity of high Nai cells. 3. At constant Ki, increasing internal Na stimulated K pump and ouabain binding rates concomitantly. 4. At low Nai, increasing Ki inhibited both K pumping and ouabain binding. However, at high Nai, increasing Ki from 4 to 44 mM stimulated the rate of glycoside binding, parallel to its effect of increasing the rate of active K influx. 5. Anti-L, an isoantibody to low K (LK) sheep red cells, increased the rate of ouabain binding via its stimulation of K pump turnover. Since the latter effect is the result of affinity changes at the internal cation activation site(s) of the pump (Lauf, Rasmusen, Hoffman, Dunham, Cook, Parmelee & Tosteson, 1970), the antibody's effect on ouabain binding reflected the positive correlation between the rates of K pump turnover and glycoside binding. 6. These data provide the first evidence in intact cells for the occurrence of a Nai-induced conformational change in the Na/K pump during its normal operational cycle. PMID:722574

  18. N- and C-terminal substance P fragments: differential effects on striatal [3H]substance P binding and NK1 receptor internalization.

    PubMed

    Michael-Titus, A T; Blackburn, D; Connolly, Y; Priestley, J V; Whelpton, R

    1999-07-13

    N- and C-terminal substance P (SP) fragments increase striatal dopamine outflow at nanomolar concentrations. This contrasts with their low affinity for NK1 receptors. To explore this discrepancy, we investigated the interaction of SP and SP fragments with NK1 sites in fresh striatal slices, the same model used in the functional studies on dopamine outflow. [3H]SP bound specifically to one site (Kd = 6.6 +/- 0.9 nM; Bmax = 12.6 +/- 0.7 fmol/mg protein). [3H]SP binding was displaced by SP (IC50 = 11.8 nM), but not by SP(1-7) or SP(5-11), up to 10 microM. In contrast, 10 nM SP(1-7) or SP(5-11) induced significant internalization of the NK1 receptor, similar to that induced by SP. We suggest that SP fragments have high affinity for an NK1 receptor conformer which is different from that labelled by [3H]SP.

  19. Interplay of histidine residues of the Alzheimer’s disease Aβ peptide governs its Zn-induced oligomerization

    NASA Astrophysics Data System (ADS)

    Istrate, Andrey N.; Kozin, Sergey A.; Zhokhov, Sergey S.; Mantsyzov, Alexey B.; Kechko, Olga I.; Pastore, Annalisa; Makarov, Alexander A.; Polshakov, Vladimir I.

    2016-02-01

    Conformational changes of Aβ peptide result in its transformation from native monomeric state to the toxic soluble dimers, oligomers and insoluble aggregates that are hallmarks of Alzheimer’s disease (AD). Interactions of zinc ions with Aβ are mediated by the N-terminal Aβ1-16 domain and appear to play a key role in AD progression. There is a range of results indicating that these interactions trigger the Aβ plaque formation. We have determined structure and functional characteristics of the metal binding domains derived from several Aβ variants and found that their zinc-induced oligomerization is governed by conformational changes in the minimal zinc binding site 6HDSGYEVHH14. The residue H6 and segment 11EVHH14, which are part of this site are crucial for formation of the two zinc-mediated interaction interfaces in Aβ. These structural determinants can be considered as promising targets for rational design of the AD-modifying drugs aimed at blocking pathological Aβ aggregation.

  20. Identification of the hydrophobic strand in the A–B loop of leptin as major binding site III: implications for large-scale preparation of potent recombinant human and ovine leptin antagonists

    PubMed Central

    Niv-Spector, Leonora; Gonen-Berger, Dana; Gourdou, Isabelle; Biener, Eva; Gussakovsky, Eugene E.; Benomar, Yackir; Ramanujan, Krishnan V.; Taouis, Mohammed; Herman, Brian; Callebaut, Isabelle; Djiane, Jean; Gertler, Arieh

    2005-01-01

    Interaction of leptin with its receptors resembles that of interleukin-6 and granulocyte colony-stimulating factor, which interact with their receptors through binding sites I–III. Site III plays a pivotal role in receptors' dimerization or tetramerization and subsequent activation. Leptin's site III also mediates the formation of an active multimeric complex through its interaction with the IGD (immunoglobulin-like domain) of LEPRs (leptin receptors). Using a sensitive hydrophobic cluster analysis of leptin's and LEPR's sequences, we identified hydrophobic stretches in leptin's A–B loop (amino acids 39–42) and in the N-terminal end of LEPR's IGD (amino acids 325–328) that are predicted to participate in site III and to interact with each other in a β-sheet-like configuration. To verify this hypothesis, we prepared and purified to homogeneity (as verified by SDS/PAGE, gel filtration and reverse-phase chromatography) several alanine muteins of amino acids 39–42 in human and ovine leptins. CD analyses revealed that those mutations hardly affect the secondary structure. All muteins acted as true antagonists, i.e. they bound LEPR with an affinity similar to the wild-type hormone, had no agonistic activity and specifically inhibited leptin action in several leptin-responsive in vitro bioassays. Alanine mutagenesis of LEPR's IGD (amino acids 325–328) drastically reduced its biological but not binding activity, indicating the importance of this region for interaction with leptin's site III. FRET (fluorescence resonance energy transfer) microscopy experiments have documented that the transient FRET signalling occurring upon exposure to leptin results not from binding of the ligand, but from ligand-induced oligomerization of LEPRs mediated by leptin's site III. PMID:15952938

  1. Site-Specific Phosphorylation of VEGFR2 Is Mediated by Receptor Trafficking: Insights from a Computational Model

    PubMed Central

    Clegg, Lindsay Wendel; Mac Gabhann, Feilim

    2015-01-01

    Matrix-binding isoforms and non-matrix-binding isoforms of vascular endothelial growth factor (VEGF) are both capable of stimulating vascular remodeling, but the resulting blood vessel networks are structurally and functionally different. Here, we develop and validate a computational model of the binding of soluble and immobilized ligands to VEGF receptor 2 (VEGFR2), the endosomal trafficking of VEGFR2, and site-specific VEGFR2 tyrosine phosphorylation to study differences in induced signaling between these VEGF isoforms. In capturing essential features of VEGFR2 signaling and trafficking, our model suggests that VEGFR2 trafficking parameters are largely consistent across multiple endothelial cell lines. Simulations demonstrate distinct localization of VEGFR2 phosphorylated on Y1175 and Y1214. This is the first model to clearly show that differences in site-specific VEGFR2 activation when stimulated with immobilized VEGF compared to soluble VEGF can be accounted for by altered trafficking of VEGFR2 without an intrinsic difference in receptor activation. The model predicts that Neuropilin-1 can induce differences in the surface-to-internal distribution of VEGFR2. Simulations also show that ligated VEGFR2 and phosphorylated VEGFR2 levels diverge over time following stimulation. Using this model, we identify multiple key levers that alter how VEGF binding to VEGFR2 results in different coordinated patterns of multiple downstream signaling pathways. Specifically, simulations predict that VEGF immobilization, interactions with Neuropilin-1, perturbations of VEGFR2 trafficking, and changes in expression or activity of phosphatases acting on VEGFR2 all affect the magnitude, duration, and relative strength of VEGFR2 phosphorylation on tyrosines 1175 and 1214, and they do so predictably within our single consistent model framework. PMID:26067165

  2. Modulation by bicuculline and penicillin of the block by t-butyl-bicyclo-phosphorothionate (TBPS) of GABAA-receptor mediated Cl−-current responses in rat striatal neurones

    PubMed Central

    Behrends, Jan C

    2000-01-01

    T-butyl-bicyclo-phosphorothionate (TBPS) is a prototypical representative of the cage-convulsants which act through a use-dependent block of the GABAA-receptor-ionophore complex. Using current recordings from cultured neurones of rat striatum the manner was investigated in which two antagonists, bicuculline and penicillin, presumably acting at the agonist binding site and in the ionic channel, respectively, modify the rate of block by TBPS. Penicillin (5 or 10 mM) did not slow the rate of block by TBPS, but produced a significant enhancement of block rate, which, however, was inversely related to the degree of antagonism by penicillin of the GABA-induced current. Bicuculline (10 μM) reduced the rate of block by TBPS. However, this effect was 3 fold weaker than its GABA-antagonistic action. The slowing of block rate and the current antagonism exhibited a biphasic, positive-negative relationship. Co-application of bicuculline (100 μM) in a concentration that produced nearly complete antagonism and TBPS (10 μM) resulted in a marked (∼40%) reduction of subsequent GABA response amplitudes compatible with a direct, bicuculline-induced conformational change in the receptor required for the binding of and block by TBPS. The lack of protection afforded by the channel blocker penicillin as well as the lack of correlation between bicuculline antagonism of the Cl−-current and its efficiency in protecting against TBPS block is evidence against an open channel blocking mechanism for TBPS. TBPS does, therefore, not appear to gain access to its binding site via the open pore but through alternative routes regulated from the agonist binding site. PMID:10694249

  3. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy.

    PubMed

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J M; Benoist, Hervé; Rougé, Pierre

    2017-06-09

    Aberrant O -glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O -glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola , and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O -glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors.

  4. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy

    PubMed Central

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J. M.; Benoist, Hervé; Rougé, Pierre

    2017-01-01

    Aberrant O-glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O-glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola, and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O-glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors. PMID:28598369

  5. Interaction of lafutidine in binding to human serum albumin in gastric ulcer therapy: STD-NMR, WaterLOGSY-NMR, NMR relaxation times, Tr-NOESY, molecule docking, and spectroscopic studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; He, Jiawei; Li, Shanshan; Tang, Bin; Li, Hui

    2016-09-15

    In this study, lafutidine (LAF) was used as a model compound to investigate the binding mechanism between antiulcer drugs and human serum albumin (HSA) through various techniques, including STD-NMR, WaterLOGSY-NMR, (1)H NMR relaxation times, tr-NOESY, molecule docking calculation, FT-IR spectroscopy, and CD spectroscopy. The analyses of STD-NMR, which derived relative STD (%) intensities, and WaterLOGSY-NMR, determined that LAF bound to HSA. In particular, the pyridyl group of LAF was in close contact with HSA binding pocket, whereas furyl group had a secondary binding. Competitive STD-NMR and WaterLOGSY-NMR experiments, with warifarin and ibuprofen as site-selective probes, indicated that LAF preferentially bound to site II in the hydrophobic subdomains IIIA of HSA. The bound conformation of LAF at the HSA binding site was further elucidated by transferred NOE effect (tr-NOESY) experiment. Relaxation experiments provided quantitative information about the relationship between the affinity and structure of LAF. The molecule docking simulations conducted with AutoDock and the restraints derived from STD results led to three-dimensional models that were consistent with the NMR spectroscopic data. The presence of hydrophobic forces and hydrogen interactions was also determined. Additionally, FT-IR and CD spectroscopies showed that LAF induced secondary structure changes of HSA. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2

    PubMed Central

    Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.

    2008-01-01

    Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384

  7. Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.

    PubMed

    Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S

    2008-09-23

    Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishino, Tomonori G.; Department of Biotechnology, University of Tokyo, Bunkyo-ku, Tokyo 113-8657; Miyazaki, Masaya

    Class IIa histone deacetylases (HDACs) form complexes with a class of transcriptional repressors in the nucleus. While screening for compounds that could block the association of HDAC4 with the BTB domain-containing transcriptional repressor Bach2, we discovered that phorbol 12-myristate 13-acetate (PMA) induced the cytoplasmic retention of HDAC4 mutants lacking a nuclear export signal (NES). Although PMA treatment and PKD overexpression has been proposed to facilitate the nuclear export of class IIa HDACs by creating 14-3-3 binding sites containing phosphoserines, our experiments using HDAC mutants demonstrated that PMA greatly reduces nuclear import. PMA treatment repressed the NLS activity in a mannermore » dependent on 14-3-3 binding. These results suggest that nuclear HDAC4 is not tethered in the nucleus, but instead shuttles between the nucleus and the cytoplasm. Phosphorylation-induced 14-3-3 binding biases the balance of nucleo-cytoplasmic shuttling toward the cytoplasm by inhibiting nuclear import.« less

  9. The interaction of N-glycans in Fcγ receptor I α-chain with Escherichia coli K1 outer membrane protein A for entry into macrophages: experimental and computational analysis.

    PubMed

    Krishnan, Subramanian; Liu, Fan; Abrol, Ravinder; Hodges, Jacqueline; Goddard, William A; Prasadarao, Nemani V

    2014-11-07

    Neonatal meningitis, caused by Escherichia coli K1, is a serious central nervous system disease. We have established that macrophages serve as permissive niches for E. coli K1 to multiply in the host and for attaining a threshold level of bacterial load, which is a prerequisite for the onset of the disease. Here, we demonstrate experimentally that three N-glycans in FcγRIa interact with OmpA of E. coli K1 for binding to and entering the macrophages. Adoptive transfer of FcγRIa(-/-) bone marrow-derived macrophages transfected with FcγRIa into FcγRIa(-/-) newborn mice renders them susceptible to E. coli K1-induced meningitis. In contrast, mice that received bone marrow-derived macrophages transfected with FcγRIa in which N-glycosylation sites 1, 4, and 5 are mutated to alanines exhibit resistance to E. coli K1 infection. Our molecular dynamics and simulation studies predict that N-glycan 5 exhibits strong binding at the barrel site of OmpA formed by loops 3 and 4, whereas N-glycans 1 and 4 interact with loops 1, 3, and 4 of OmpA at tip regions. Molecular modeling data also suggest no role for the IgG binding site in the invasion process. In agreement, experimental mutations in IgG binding site had no effect on the E. coli K1 entry into macrophages in vitro or on the onset of meningitis in newborn mice. Together, this integration of experimental and computational studies reveals how the N-glycans in FcγRIa interact with the OmpA of E. coli K1 for inducing the disease pathogenesis. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors.

    PubMed

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I; Lanciego, José L; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB 2 receptors (CB 2 Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB 2 R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB 2 R. Using membrane preparations from CB 2 R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB 2 R where the synthetic cannabinoid, [ 3 H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB 2 R-selective compound, CM-157. The effect on binding to CB 2 R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the K D . CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB 2 R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities.

  11. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors

    PubMed Central

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I.; Lanciego, José L.; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB2 receptors (CB2Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB2R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB2R. Using membrane preparations from CB2R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB2R where the synthetic cannabinoid, [3H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB2R-selective compound, CM-157. The effect on binding to CB2R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the KD. CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB2R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities. PMID:29109685

  12. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent (99m)Tc-Duramycin.

    PubMed

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G; Zhao, Ming

    2012-08-01

    (99m)Tc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between (99m)Tc-Duramycin and the target tissue. High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague-Dawley rats. Target binding and biodistribution of (99m)Tc-duramycin were captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of (99m)Tc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of (99m)Tc-Duramycin in normal and ischemic myocardial tissue. (99m)Tc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to (99m)Tc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for (99m)Tc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9-fold reduction in binding affinity. (99m)Tc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of (99m)Tc-Duramycin as a novel PE-binding agent. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Genome-Wide Progesterone Receptor Binding: Cell Type-Specific and Shared Mechanisms in T47D Breast Cancer Cells and Primary Leiomyoma Cells

    PubMed Central

    Huang, Lei; Owen, Jonas K.; Xie, Anna; Navarro, Antonia; Monsivais, Diana; Coon V, John S.; Kim, J. Julie; Dai, Yang; Bulun, Serdar E.

    2012-01-01

    Background Progesterone, via its nuclear receptor (PR), exerts an overall tumorigenic effect on both uterine fibroid (leiomyoma) and breast cancer tissues, whereas the antiprogestin RU486 inhibits growth of these tissues through an unknown mechanism. Here, we determined the interaction between common or cell-specific genome-wide binding sites of PR and mRNA expression in RU486-treated uterine leiomyoma and breast cancer cells. Principal Findings ChIP-sequencing revealed 31,457 and 7,034 PR-binding sites in breast cancer and uterine leiomyoma cells, respectively; 1,035 sites overlapped in both cell types. Based on the chromatin-PR interaction in both cell types, we statistically refined the consensus progesterone response element to G•ACA• • •TGT•C. We identified two striking differences between uterine leiomyoma and breast cancer cells. First, the cis-regulatory elements for HSF, TEF-1, and C/EBPα and β were statistically enriched at genomic RU486/PR-targets in uterine leiomyoma, whereas E2F, FOXO1, FOXA1, and FOXF sites were preferentially enriched in breast cancer cells. Second, 51.5% of RU486-regulated genes in breast cancer cells but only 6.6% of RU486-regulated genes in uterine leiomyoma cells contained a PR-binding site within 5 kb from their transcription start sites (TSSs), whereas 75.4% of RU486-regulated genes contained a PR-binding site farther than 50 kb from their TSSs in uterine leiomyoma cells. RU486 regulated only seven mRNAs in both cell types. Among these, adipophilin (PLIN2), a pro-differentiation gene, was induced via RU486 and PR via the same regulatory region in both cell types. Conclusions Our studies have identified molecular components in a RU486/PR-controlled gene network involved in the regulation of cell growth, cell migration, and extracellular matrix function. Tissue-specific and common patterns of genome-wide PR binding and gene regulation may determine the therapeutic effects of antiprogestins in uterine fibroids and breast cancer. PMID:22272226

  14. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade

    NASA Astrophysics Data System (ADS)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-01

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  15. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade.

    PubMed

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-28

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  16. A conserved apomixis-specific polymorphism is correlated with exclusive exonuclease expression in premeiotic ovules of apomictic boechera species.

    PubMed

    Corral, José M; Vogel, Heiko; Aliyu, Olawale M; Hensel, Götz; Thiel, Thomas; Kumlehn, Jochen; Sharbel, Timothy F

    2013-12-01

    Apomixis (asexual seed production) is characterized by meiotically unreduced egg cell production (apomeiosis) followed by its parthenogenetic development into offspring that are genetic clones of the mother plant. Fertilization (i.e. pseudogamy) of the central cell is important for the production of a functional endosperm with a balanced 2:1 maternal:paternal genome ratio. Here, we present the APOLLO (for apomixis-linked locus) gene, an Aspartate Glutamate Aspartate Aspartate histidine exonuclease whose transcripts are down-regulated in sexual ovules entering meiosis while being up-regulated in apomeiotic ovules at the same stage of development in plants of the genus Boechera. APOLLO has both "apoalleles," which are characterized by a set of linked apomixis-specific polymorphisms, and "sexalleles." All apomictic Boechera spp. accessions proved to be heterozygous for the APOLLO gene (having at least one apoallele and one sexallele), while all sexual genotypes were homozygous for sexalleles. Apoalleles contained a 20-nucleotide polymorphism present in the 5' untranslated region that contains specific transcription factor-binding sites for ARABIDOPSIS THALIANA HOMEOBOX PROTEIN5, LIM1 (for LINEAGE ABNORMAL11, INSULIN1, MECHANOSENSORY PROTEIN3), SORLIP1AT (for SEQUENCES OVERREPRESENTED IN LIGHT-INDUCED PROMOTERS IN ARABIDOPSIS THALIANA1), SORLIP2AT, and POLYA SIGNAL1. In the same region, sexalleles contain transcription factor-binding sites for DNA BINDING WITH ONE FINGER2, DNA BINDING WITH ONE FINGER3, and PROLAMIN BOX-BINDING FACTOR. Our results suggest that the expression of a single deregulated allele could induce the cascade of events leading to asexual female gamete formation in an apomictic plant.

  17. Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response

    PubMed Central

    Goldstein, Ido; Baek, Songjoon; Presman, Diego M.; Paakinaho, Ville; Swinstead, Erin E.; Hager, Gordon L.

    2017-01-01

    Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. PMID:28031249

  18. Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

    PubMed

    Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

    2017-07-18

    Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

  19. Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition

    PubMed Central

    Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576

  20. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    PubMed

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Top