Novel interactions of CAPS (Ca2+-dependent activator protein for secretion) with the three neuronal SNARE proteins required for vesicle fusion.

PubMed

Daily, Neil J; Boswell, Kristin L; James, Declan J; Martin, Thomas F J

2010-11-12

CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca(2+)-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis.

Novel Interactions of CAPS (Ca2+-dependent Activator Protein for Secretion) with the Three Neuronal SNARE Proteins Required for Vesicle Fusion*

PubMed Central

Daily, Neil J.; Boswell, Kristin L.; James, Declan J.; Martin, Thomas F. J.

2010-01-01

CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca2+-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis. PMID:20826818

Antigen clasping by two antigen-binding sites of an exceptionally specific antibody for histone methylation

DOE PAGES

Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.; ...

2016-02-09

Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less

Antigen clasping by two antigen-binding sites of an exceptionally specific antibody for histone methylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.

Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less

Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

PubMed

Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

2018-04-10

Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin.

PubMed

Ball, David A; Mehta, Gunjan D; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G; Karpova, Tatiana S

2016-12-01

In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12-0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†

PubMed Central

Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald

2009-01-01

A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129

When core competence is not enough: functional interplay of the DEAD-box helicase core with ancillary domains and auxiliary factors in RNA binding and unwinding.

PubMed

Rudolph, Markus G; Klostermeier, Dagmar

2015-08-01

DEAD-box helicases catalyze RNA duplex unwinding in an ATP-dependent reaction. Members of the DEAD-box helicase family consist of a common helicase core formed by two RecA-like domains. According to the current mechanistic model for DEAD-box mediated RNA unwinding, binding of RNA and ATP triggers a conformational change of the helicase core, and leads to formation of a compact, closed state. In the closed conformation, the two parts of the active site for ATP hydrolysis and of the RNA binding site, residing on the two RecA domains, become aligned. Closing of the helicase core is coupled to a deformation of the RNA backbone and destabilization of the RNA duplex, allowing for dissociation of one of the strands. The second strand remains bound to the helicase core until ATP hydrolysis and product release lead to re-opening of the core. The concomitant disruption of the RNA binding site causes dissociation of the second strand. The activity of the helicase core can be modulated by interaction partners, and by flanking N- and C-terminal domains. A number of C-terminal flanking regions have been implicated in RNA binding: RNA recognition motifs (RRM) typically mediate sequence-specific RNA binding, whereas positively charged, unstructured regions provide binding sites for structured RNA, without sequence-specificity. Interaction partners modulate RNA binding to the core, or bind to RNA regions emanating from the core. The functional interplay of the helicase core and ancillary domains or interaction partners in RNA binding and unwinding is not entirely understood. This review summarizes our current knowledge on RNA binding to the DEAD-box helicase core and the roles of ancillary domains and interaction partners in RNA binding and unwinding by DEAD-box proteins.

Calculation of Relative Binding Free Energy in the Water-Filled Active Site of Oligopeptide-Binding Protein A.

PubMed

Maurer, Manuela; de Beer, Stephanie B A; Oostenbrink, Chris

2016-04-15

The periplasmic oligopeptide binding protein A (OppA) represents a well-known example of water-mediated protein-ligand interactions. Here, we perform free-energy calculations for three different ligands binding to OppA, using a thermodynamic integration approach. The tripeptide ligands share a high structural similarity (all have the sequence KXK), but their experimentally-determined binding free energies differ remarkably. Thermodynamic cycles were constructed for the ligands, and simulations conducted in the bound and (freely solvated) unbound states. In the unbound state, it was observed that the difference in conformational freedom between alanine and glycine leads to a surprisingly slow convergence, despite their chemical similarity. This could be overcome by increasing the softness parameter during alchemical transformations. Discrepancies remained in the bound state however, when comparing independent simulations of the three ligands. These difficulties could be traced to a slow relaxation of the water network within the active site. Fluctuations in the number of water molecules residing in the binding cavity occur mostly on a timescale larger than the simulation time along the alchemical path. After extensive simulations, relative binding free energies that were converged to within thermal noise could be obtained, which agree well with available experimental data.

Calculation of Relative Binding Free Energy in the Water-Filled Active Site of Oligopeptide-Binding Protein A

PubMed Central

Maurer, Manuela; de Beer, Stephanie B. A.; Oostenbrink, Chris

2018-01-01

The periplasmic oligopeptide binding protein A (OppA) represents a well-known example of water-mediated protein-ligand interactions. Here, we perform free-energy calculations for three different ligands binding to OppA, using a thermodynamic integration approach. The tripeptide ligands share a high structural similarity (all have the sequence KXK), but their experimentally-determined binding free energies differ remarkably. Thermodynamic cycles were constructed for the ligands, and simulations conducted in the bound and (freely solvated) unbound states. In the unbound state, it was observed that the difference in conformational freedom between alanine and glycine leads to a surprisingly slow convergence, despite their chemical similarity. This could be overcome by increasing the softness parameter during alchemical transformations. Discrepancies remained in the bound state however, when comparing independent simulations of the three ligands. These difficulties could be traced to a slow relaxation of the water network within the active site. Fluctuations in the number of water molecules residing in the binding cavity occur mostly on a timescale larger than the simulation time along the alchemical path. After extensive simulations, relative binding free energies that were converged to within thermal noise could be obtained, which agree well with available experimental data. PMID:27092480

( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Branchek, T.; Adham, N.; Macchi, M.

1990-11-01

The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

Stochastic dynamics of genetic broadcasting networks

NASA Astrophysics Data System (ADS)

Potoyan, Davit; Wolynes, Peter

The complex genetic programs of eukaryotic cells are often regulated by key transcription factors occupying or clearing out of a large number of genomic locations. Orchestrating the residence times of these factors is therefore important for the well organized functioning of a large network. The classic models of genetic switches sidestep this timing issue by assuming the binding of transcription factors to be governed entirely by thermodynamic protein-DNA affinities. Here we show that relying on passive thermodynamics and random release times can lead to a ''time-scale crisis'' of master genes that broadcast their signals to large number of binding sites. We demonstrate that this ''time-scale crisis'' can be resolved by actively regulating residence times through molecular stripping. We illustrate these ideas by studying the stochastic dynamics of the genetic network of the central eukaryotic master regulator NFκB which broadcasts its signals to many downstream genes that regulate immune response, apoptosis etc.

Functionalizing Microporous Membranes for Protein Purification and Protein Digestion

NASA Astrophysics Data System (ADS)

Dong, Jinlan; Bruening, Merlin L.

2015-07-01

This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO2 nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

Functionalizing Microporous Membranes for Protein Purification and Protein Digestion.

PubMed

Dong, Jinlan; Bruening, Merlin L

2015-01-01

This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO₂ nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

X-ray structures and mechanism of the human serotonin transporter.

PubMed

Coleman, Jonathan A; Green, Evan M; Gouaux, Eric

2016-04-21

The serotonin transporter (SERT) terminates serotonergic signalling through the sodium- and chloride-dependent reuptake of neurotransmitter into presynaptic neurons. SERT is a target for antidepressant and psychostimulant drugs, which block reuptake and prolong neurotransmitter signalling. Here we report X-ray crystallographic structures of human SERT at 3.15 Å resolution bound to the antidepressants (S)-citalopram or paroxetine. Antidepressants lock SERT in an outward-open conformation by lodging in the central binding site, located between transmembrane helices 1, 3, 6, 8 and 10, directly blocking serotonin binding. We further identify the location of an allosteric site in the complex as residing at the periphery of the extracellular vestibule, interposed between extracellular loops 4 and 6 and transmembrane helices 1, 6, 10 and 11. Occupancy of the allosteric site sterically hinders ligand unbinding from the central site, providing an explanation for the action of (S)-citalopram as an allosteric ligand. These structures define the mechanism of antidepressant action in SERT, and provide blueprints for future drug design.

3D local structure around copper site of rabbit prion-related protein: Quantitative determination by XANES spectroscopy combined with multiple-scattering calculations

NASA Astrophysics Data System (ADS)

Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.

2014-02-01

Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.

Reversible binding kinetics of a cytoskeletal protein at the erythrocyte submembrane.

PubMed Central

Stout, A. L.; Axelrod, D.

1994-01-01

Reversible binding among components of the cellular submembrane cytoskeleton and reversible binding of some of these components with the plasma membrane likely play a role in nonelastic morphological changes and mechanoplastic properties of cells. However, relatively few studies have been devoted to investigating directly the kinetic aspects of the interactions of individual components of the membrane skeleton with the membrane. The experiments described here investigated whether one component of the erythrocyte membrane cytoskeleton, protein 4.1, binds to its sites on the membrane reversibly and if so, whether the different 4.1-binding sites display distinct kinetic behavior. Protein 4.1 is known to stabilize the membrane and to mediate the attachment of spectrin filaments to the membrane. Protein 4.1 previously has been shown to bind to integral membrane proteins band 3, glycophorin C, and to negatively charged phospholipids. To examine the kinetic rates of dissociation of carboxymethyl fluorescein-labeled 4.1 (CF-4.1) to the cytofacial surface of erythrocyte membrane, a special preparation of hemolyzed erythrocyte ghosts was used, in which the ghosts became flattened on a glass surface and exposed their cytofacial surfaces to the solution through a membrane rip in a distinctive characteristic pattern. This preparation was examined by the microscopy technique of total internal reflection/fluorescence recovery after photobleaching (TIR/FRAP). Four different treatments were employed to help identify which membrane binding sites gave rise to the multiplicity of observed kinetic rates. The first treatment, the control, stripped off the native spectrin, actin, 4.1, and ankyrin. About 60% of the CF-4.1 bound to this control binded irreversibly (dissociation time > 20 min), but the remaining approximately 40% binded reversibly with a range of residency times averaging approximately 3 s. The second treatment subjected these stripped membranes to trypsin, which presumably removed most of the band 3. CF-4.1 binded significantly less to these trypsinized membranes and most of the decrease was a loss of the irreversibly binding sites. The third treatment simply preserved the native 4.1 and ankyrin. CF-4.1 binded less to this sample too, and the loss involved both the irreversible and reversible sites. The fourth treatment blocked the gycophorin C sites on the native 4.1-stripped membranes with an antibody. CF-4.1 again binded less to this sample than to a nonimmune serum control, and almost all of the decrease is a loss of irreversible sites. These rest suggest that 1) protein 4.1 binds to membrane or submembrane sites at least in part reversibly ; 2) the most reversible sites are probably not proteinaceous and not glycophorin C, but possibly are phospholipids (especially phosphatidylserine); and 3) TIWRFRAP can successfully examine the fast reversible dynamics of cytoskeletal components binding to biological membranes. Images FIGURE 2 FIGURE 3 FIGURE 4 PMID:7811947

PWMScan: a fast tool for scanning entire genomes with a position-specific weight matrix.

PubMed

Ambrosini, Giovanna; Groux, Romain; Bucher, Philipp

2018-03-05

Transcription factors (TFs) regulate gene expression by binding to specific short DNA sequences of 5 to 20-bp to regulate the rate of transcription of genetic information from DNA to messenger RNA. We present PWMScan, a fast web-based tool to scan server-resident genomes for matches to a user-supplied PWM or TF binding site model from a public database. The web server and source code are available at http://ccg.vital-it.ch/pwmscan and https://sourceforge.net/projects/pwmscan, respectively. giovanna.ambrosini@epfl.ch. SUPPLEMENTARY DATA ARE AVAILABLE AT BIOINFORMATICS ONLINE.

DNA residence time is a regulatory factor of transcription repression

PubMed Central

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Characterization of the colorectal cancer-associated enhancer MYC-335 at 8q24: the role of rs67491583.

PubMed

Tuupanen, Sari; Yan, Jian; Turunen, Mikko; Gylfe, Alexandra E; Kaasinen, Eevi; Li, Li; Eng, Charis; Culver, Daniel A; Kalady, Matthew F; Pennison, Michael J; Pasche, Boris; Manne, Upender; de la Chapelle, Albert; Hampel, Heather; Henderson, Brian E; Marchand, Loic Le; Hautaniemi, Sampsa; Askhtorab, Hassan; Smoot, Duane; Sandler, Robert S; Keku, Temitope; Kupfer, Sonia S; Ellis, Nathan A; Haiman, Christopher A; Taipale, Jussi; Aaltonen, Lauri A

2012-01-01

Recent genome-wide association studies have identified multiple regions at 8q24 that confer susceptibility to many cancers. In our previous work, we showed that the colorectal cancer (CRC) risk variant rs6983267 at 8q24 resides within a TCF4 binding site at the MYC-335 enhancer, with the risk allele G having a stronger binding capacity and Wnt responsiveness. Here, we searched for other potential functional variants within MYC-335. Genetic variation within MYC-335 was determined in samples from individuals of European, African, and Asian descent, with emphasis on variants in putative transcription factor binding sites. A 2-bp GA deletion rs67491583 was found to affect a growth factor independent (GFI) binding site and was present only in individuals with African ancestry. Chromatin immunoprecipitation performed in heterozygous cells showed that the GA deletion had an ability to reduce binding of the transcriptional repressors GFI1 and GFI1b. Screening of 1,027 African American colorectal cancer cases and 1,773 healthy controls did not reveal evidence for association (odds ratio: 1.17, 95% confidence interval: 0.97-1.41, P = 0.095). In this study, rs67491583 was identified as another functional variant in the CRC-associated enhancer MYC-335, but further studies are needed to establish the role of rs67491583 in the colorectal cancer predisposition of African Americans. Copyright © 2012 Elsevier Inc. All rights reserved.

PI(4,5)P2-binding effector proteins for vesicle exocytosis

PubMed Central

Martin, Thomas F. J.

2014-01-01

PI(4,5)P2 participates directly in priming and possibly fusion steps of Ca2+-triggered vesicle exocytosis. High concentration nanodomains of PI(4,5)P2 reside on the plasma membrane of neuroendocrine cells. A subset of vesicles that co-localize with PI(4,5)P2 domains appear to undergo preferential exocytosis in stimulated cells. PI(4,5)P2 directly regulates vesicle exocytosis by recruiting and activating PI(4,5)P2-binding proteins that regulate SNARE protein function including CAPS, Munc13-1/2, synaptotagmin-1, and other C2 domain-containing proteins. These PI(4,5)P2 effector proteins are coincidence detectors that engage in multiple interactions at vesicle exocytic sites. The SNARE protein syntaxin-1 also binds to PI(4,5)P2, which promotes clustering, but an activating role for PI(4,5)P2 in syntaxin-1 function remains to be fully characterized. Similar principles underlie polarized constitutive vesicle fusion mediated in part by the PI(4,5)P2-binding subunits of the exocyst complex (Sec3, Exo70). Overall, focal vesicle exocytosis occurs at sites landmarked by PI(4,5)P2, which serves to recruit and/or activate multifunctional PI(4,5)P2-binding proteins. PMID:25280637

Stochastic dynamics of genetic broadcasting networks

NASA Astrophysics Data System (ADS)

Potoyan, Davit A.; Wolynes, Peter G.

2017-11-01

The complex genetic programs of eukaryotic cells are often regulated by key transcription factors occupying or clearing out of a large number of genomic locations. Orchestrating the residence times of these factors is therefore important for the well organized functioning of a large network. The classic models of genetic switches sidestep this timing issue by assuming the binding of transcription factors to be governed entirely by thermodynamic protein-DNA affinities. Here we show that relying on passive thermodynamics and random release times can lead to a "time-scale crisis" for master genes that broadcast their signals to a large number of binding sites. We demonstrate that this time-scale crisis for clearance in a large broadcasting network can be resolved by actively regulating residence times through molecular stripping. We illustrate these ideas by studying a model of the stochastic dynamics of the genetic network of the central eukaryotic master regulator NFκ B which broadcasts its signals to many downstream genes that regulate immune response, apoptosis, etc.

Actions of 2-methylpiperidine (MP) and its interactions with (-)-nicotine (N) in the dog and rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.; Martin, W.R.; Bostwick, M.

1986-03-01

(+/-)-MP is a highly specific drug for enhancing the binding of (+/-)-(/sup 3/H)N in the rat brain P/sub 2/ preparation. Competition studies employing (+/-)-(/sup 3/H)N as the labelled ligand show that this activity resides in the (+) isomer. Saturation studies employing (+/-)-(/sup 3/H)MP indicate that it binds to a very high affinity site which is presumed to be an up-regulatory site. Studies were conducted where (+/-)-MP was injected through an implanted cannula into the 4th ventricle of intact beagle-type dogs. (+/-)-MP, like low doses of (+)-N, another drug which has specificity in enhancing the binding of (+/-)-, and (-)- andmore » (+)-(/sup 3/H)N, produced EEG synchronization and miosis. (-)-N produced analgesia where as (+/-)-MP produced hyperalgesia. In the urethane-pentobarbital anethetized rats, the i.v. infusion of (+)-MP (600 ..mu..g/kg/min for 10 min), had no effect on heart rate, blood pressure or respiration. Pretreatment with (+)-MP delayed and decreased the bradycardia, vasodepression, and enhanced tidal volume produced by (-)-N infusion (60 ..mu..g/kg/min). These data show that the pharmacologic actions of MP are different from (-)-N and hexamethonium and that MP, which enhances the binding of (+/-)- and (-)-(/sup 3/H)N at the high affinity site, appears to exert opposite effects to and antagonistic effects against (-)-N.« less

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE PAGES

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.; ...

2017-08-30

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

Structures of Human Golgi-resident Glutaminyl Cyclase and Its Complexes with Inhibitors Reveal a Large Loop Movement upon Inhibitor Binding*

PubMed Central

Huang, Kai-Fa; Liaw, Su-Sen; Huang, Wei-Lin; Chia, Cho-Yun; Lo, Yan-Chung; Chen, Yi-Ling; Wang, Andrew H.-J.

2011-01-01

Aberrant pyroglutamate formation at the N terminus of certain peptides and proteins, catalyzed by glutaminyl cyclases (QCs), is linked to some pathological conditions, such as Alzheimer disease. Recently, a glutaminyl cyclase (QC) inhibitor, PBD150, was shown to be able to reduce the deposition of pyroglutamate-modified amyloid-β peptides in brain of transgenic mouse models of Alzheimer disease, leading to a significant improvement of learning and memory in those transgenic animals. Here, we report the 1.05–1.40 Å resolution structures, solved by the sulfur single-wavelength anomalous dispersion phasing method, of the Golgi-luminal catalytic domain of the recently identified Golgi-resident QC (gQC) and its complex with PBD150. We also describe the high-resolution structures of secretory QC (sQC)-PBD150 complex and two other gQC-inhibitor complexes. gQC structure has a scaffold similar to that of sQC but with a relatively wider and negatively charged active site, suggesting a distinct substrate specificity from sQC. Upon binding to PBD150, a large loop movement in gQC allows the inhibitor to be tightly held in its active site primarily by hydrophobic interactions. Further comparisons of the inhibitor-bound structures revealed distinct interactions of the inhibitors with gQC and sQC, which are consistent with the results from our inhibitor assays reported here. Because gQC and sQC may play different biological roles in vivo, the different inhibitor binding modes allow the design of specific inhibitors toward gQC and sQC. PMID:21288892

Structures of human Golgi-resident glutaminyl cyclase and its complexes with inhibitors reveal a large loop movement upon inhibitor binding.

PubMed

Huang, Kai-Fa; Liaw, Su-Sen; Huang, Wei-Lin; Chia, Cho-Yun; Lo, Yan-Chung; Chen, Yi-Ling; Wang, Andrew H-J

2011-04-08

Aberrant pyroglutamate formation at the N terminus of certain peptides and proteins, catalyzed by glutaminyl cyclases (QCs), is linked to some pathological conditions, such as Alzheimer disease. Recently, a glutaminyl cyclase (QC) inhibitor, PBD150, was shown to be able to reduce the deposition of pyroglutamate-modified amyloid-β peptides in brain of transgenic mouse models of Alzheimer disease, leading to a significant improvement of learning and memory in those transgenic animals. Here, we report the 1.05-1.40 Å resolution structures, solved by the sulfur single-wavelength anomalous dispersion phasing method, of the Golgi-luminal catalytic domain of the recently identified Golgi-resident QC (gQC) and its complex with PBD150. We also describe the high-resolution structures of secretory QC (sQC)-PBD150 complex and two other gQC-inhibitor complexes. gQC structure has a scaffold similar to that of sQC but with a relatively wider and negatively charged active site, suggesting a distinct substrate specificity from sQC. Upon binding to PBD150, a large loop movement in gQC allows the inhibitor to be tightly held in its active site primarily by hydrophobic interactions. Further comparisons of the inhibitor-bound structures revealed distinct interactions of the inhibitors with gQC and sQC, which are consistent with the results from our inhibitor assays reported here. Because gQC and sQC may play different biological roles in vivo, the different inhibitor binding modes allow the design of specific inhibitors toward gQC and sQC.

Functional implications of Major Histocompatibility (MH) variation using estuarine fish populations.

PubMed

Cohen, Sarah; Tirindelli, Joëlle; Gomez-Chiarri, Marta; Nacci, Diane

2006-12-01

Recently, there has been a dramatic expansion of studies of major histocompatibility complex (MHC) variation aimed at discovering functional differences in immunity across wild populations of diverse vertebrate species. Some species with relatively low genetic diversity or under strong directional selection by pathogens have revealed fascinating cases of MHC allelic disease linkage. More generally in genetically diverse species, however, these linkages may be hard to find. In this paper, we review approaches for assessing functional variation in MHC and discuss their potential use for discovering smaller-scale intraspecific spatial and temporal patterns of MHC variation. Then, we describe and illustrate an approach using the structural model to produce a population composite of variation in antigen-binding regions by mapping population-specific substitutions onto functional regions of the molecule. We are producing models of variation in major histocompatibility (MH) loci for populations of non-migratory fish (killifish, Fundulus heteroclitus) resident at sites that vary dramatically in environmental quality. We discuss the goal of relating MH population variation to functional differences in disease susceptibility such as those inferred by observations of parasitic infection and direct measurement of bacterial challenges in the laboratory. Our study has focused on relatively well-studied killifish populations, including those resident in a highly disturbed, chemically contaminated estuary and nearby less contaminated sites. Population-specific genetic changes at MHC antigen-binding loci are described, and evidence relevant to functional implications of these changes is reviewed. Population-specific patterns of variation in antigen-binding regions in combination with a range of assessments of immune function will provide a powerful new approach to reveal functional changes in MHC.

The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages

PubMed Central

Daniel, Bence; Hah, Nasun; Horvath, Attila; Czimmerer, Zsolt; Poliska, Szilard; Gyuris, Tibor; Keirsse, Jiri; Gysemans, Conny; Van Ginderachter, Jo A.; Balint, Balint L.; Evans, Ronald M.; Barta, Endre; Nagy, Laszlo

2014-01-01

RXR signaling is predicted to have a major impact in macrophages, but neither the biological consequence nor the genomic basis of its ligand activation is known. Comprehensive genome-wide studies were carried out to map liganded RXR-mediated transcriptional changes, active binding sites, and cistromic interactions in the context of the macrophage genome architecture. The macrophage RXR cistrome has 5200 genomic binding sites, which are not impacted by ligand. Active enhancers are characterized by PU.1 binding, an increase of enhancer RNA, and P300 recruitment. Using these features, 387 liganded RXR-bound enhancers were linked to 226 genes, which predominantly reside in CTCF/cohesin-limited functional domains. These findings were molecularly validated using chromosome conformation capture (3C) and 3C combined with sequencing (3C-seq), and we show that selected long-range enhancers communicate with promoters via stable or RXR-induced loops and that some of the enhancers interact with each other, forming an interchromosomal network. A set of angiogenic genes, including Vegfa, has liganded RXR-controlled enhancers and provides the macrophage with a novel inducible program. PMID:25030696

Two-sided block of a dual-topology F- channel.

PubMed

Turman, Daniel L; Nathanson, Jacob T; Stockbridge, Randy B; Street, Timothy O; Miller, Christopher

2015-05-05

The Fluc family is a set of small membrane proteins forming F(-)-specific electrodiffusive ion channels that rescue microorganisms from F(-) toxicity during exposure to weakly acidic environments. The functional channel is built as a dual-topology homodimer with twofold symmetry parallel to the membrane plane. Fluc channels are blocked by nanomolar-affinity fibronectin-domain monobodies originally selected from phage-display libraries. The unusual symmetrical antiparallel dimeric architecture of Flucs demands that the two chemically equivalent monobody-binding epitopes reside on opposite ends of the channel, a double-sided blocking situation that has never before presented itself in ion channel biophysics. However, it is not known if both sites can be simultaneously occupied, and if so, whether monobodies bind independently or cooperatively to their transmembrane epitopes. Here, we use direct monobody-binding assays and single-channel recordings of a Fluc channel homolog to reveal a novel trimolecular blocking behavior that reveals a doubly occupied blocked state. Kinetic analysis of single-channel recordings made with monobody on both sides of the membrane shows substantial negative cooperativity between the two blocking sites.

Transcription factor target site search and gene regulation in a background of unspecific binding sites.

PubMed

Hettich, J; Gebhardt, J C M

2018-06-02

Response time and transcription level are vital parameters of gene regulation. They depend on how fast transcription factors (TFs) find and how efficient they occupy their specific target sites. It is well known that target site search is accelerated by TF binding to and sliding along unspecific DNA and that unspecific associations alter the occupation frequency of a gene. However, whether target site search time and occupation frequency can be optimized simultaneously is mostly unclear. We developed a transparent and intuitively accessible state-based formalism to calculate search times to target sites on and occupation frequencies of promoters of arbitrary state structure. Our formalism is based on dissociation rate constants experimentally accessible in live cell experiments. To demonstrate our approach, we consider promoters activated by a single TF, by two coactivators or in the presence of a competitive inhibitor. We find that target site search time and promoter occupancy differentially vary with the unspecific dissociation rate constant. Both parameters can be harmonized by adjusting the specific dissociation rate constant of the TF. However, while measured DNA residence times of various eukaryotic TFs correspond to a fast search time, the occupation frequencies of target sites are generally low. Cells might tolerate low target site occupancies as they enable timely gene regulation in response to a changing environment. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Dual control by Cdk1 phosphorylation of the budding yeast APC/C ubiquitin ligase activator Cdh1.

PubMed

Höckner, Sebastian; Neumann-Arnold, Lea; Seufert, Wolfgang

2016-07-15

The antagonism between cyclin-dependent kinases (Cdks) and the ubiquitin ligase APC/C-Cdh1 is central to eukaryotic cell cycle control. APC/C-Cdh1 targets cyclin B and other regulatory proteins for degradation, whereas Cdks disable APC/C-Cdh1 through phosphorylation of the Cdh1 activator protein at multiple sites. Budding yeast Cdh1 carries nine Cdk phosphorylation sites in its N-terminal regulatory domain, most or all of which contribute to inhibition. However, the precise role of individual sites has remained unclear. Here, we report that the Cdk phosphorylation sites of yeast Cdh1 are organized into autonomous subgroups and act through separate mechanisms. Cdk sites 1-3 had no direct effect on the APC/C binding of Cdh1 but inactivated a bipartite nuclear localization sequence (NLS) and thereby controlled the partitioning of Cdh1 between cytoplasm and nucleus. In contrast, Cdk sites 4-9 did not influence the cell cycle-regulated localization of Cdh1 but prevented its binding to the APC/C. Cdk sites 4-9 reside near two recently identified APC/C interaction motifs in a pattern conserved with the human Cdh1 orthologue. Thus a Cdk-inhibited NLS goes along with Cdk-inhibited APC/C binding sites in yeast Cdh1 to relay the negative control by Cdk1 phosphorylation of the ubiquitin ligase APC/C-Cdh1. © 2016 Höckner et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

The Phosphatidic Acid Binding Site of the Arabidopsis Trigalactosyldiacylglycerol 4 (TGD4) Protein Required for Lipid Import into Chloroplasts*

PubMed Central

Wang, Zhen; Anderson, Nicholas Scott; Benning, Christoph

2013-01-01

Chloroplast membrane lipid synthesis relies on the import of glycerolipids from the ER. The TGD (TriGalactosylDiacylglycerol) proteins are required for this lipid transfer process. The TGD1, -2, and -3 proteins form a putative ABC (ATP-binding cassette) transporter transporting ER-derived lipids through the inner envelope membrane of the chloroplast, while TGD4 binds phosphatidic acid (PtdOH) and resides in the outer chloroplast envelope. We identified two sequences in TGD4, amino acids 1–80 and 110–145, which are necessary and sufficient for PtdOH binding. Deletion of both sequences abolished PtdOH binding activity. We also found that TGD4 from 18:3 plants bound specifically and with increased affinity PtdOH. TGD4 did not interact with other proteins and formed a homodimer both in vitro and in vivo. Our results suggest that TGD4 is an integral dimeric β-barrel lipid transfer protein that binds PtdOH with its N terminus and contains dimerization domains at its C terminus. PMID:23297418

Structural basis of transport function in major facilitator superfamily protein from Trichoderma harzianum.

PubMed

Chaudhary, Nitika; Sandhu, Padmani; Ahmed, Mushtaq; Akhter, Yusuf

2017-02-01

Trichothecenes are the sesquiterpenes secreted by Trichoderma spp. residing in the rhizosphere. These compounds have been reported to act as plant growth promoters and bio-control agents. The structural knowledge for the transporter proteins of their efflux remained limited. In this study, three-dimensional structure of Thmfs1 protein, a trichothecene transporter from Trichoderma harzianum, was homology modelled and further Molecular Dynamics (MD) simulations were used to decipher its mechanism. Fourteen transmembrane helices of Thmfs1 protein are observed contributing to an inward-open conformation. The transport channel and ligand binding sites in Thmfs1 are identified based on heuristic, iterative algorithm and structural alignment with homologous proteins. MD simulations were performed to reveal the differential structural behaviour occurring in the ligand free and ligand bound forms. We found that two discrete trichothecene binding sites are located on either side of the central transport tunnel running from the cytoplasmic side to the extracellular side across the Thmfs1 protein. Detailed analysis of the MD trajectories showed an alternative access mechanism between N and C-terminal domains contributing to its function. These results also demonstrate that the transport of trichodermin occurs via hopping mechanism in which the substrate molecule jumps from one binding site to another lining the transport tunnel. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

PubMed Central

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity chromosome may be partially transcriptionally autonomous, but there are also extensive transcriptional connections between core and accessory chromosomes. PMID:27855160

Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.

PubMed

Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S

2008-01-01

Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

PubMed

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

Comparative study of flavins binding with human serum albumin: a fluorometric, thermodynamic, and molecular dynamics approach.

PubMed

Sengupta, Abhigyan; Sasikala, Wilbee D; Mukherjee, Arnab; Hazra, Partha

2012-06-04

Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) are derivatives of riboflavin (RF), a water-soluble vitamin, more commonly known as vitamin B(2). Flavins have attracted special attention in the last few years because of the recent discovery of a large number of flavoproteins. In this work, these flavins are used as extrinsic fluorescence markers for probing the microheterogeneous environment of a well-known transport protein, human serum albumin (HSA). Steady-state and time-resolved fluorescence experiments confirm that both FMN and FAD bind to the Sudlow's site-1 (SS1) binding pocket of HSA, where Trp214 resides. In the case of RF, a fraction of RF molecules binds at the SS1, whereas the major fraction of RF molecules remains unbound or surface bound to the protein. Moreover, flavin(s)-HSA interactions are monitored with the help of isothermal titration calorimetry, which provides free energy, enthalpy, and entropy changes of binding along with the binding constants. The molecular picture of binding interaction between flavins and HSA is well explored by docking and molecular dynamics studies. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dynamics of human protein kinase Aurora A linked to drug selectivity

DOE PAGES

Pitsawong, Warintra; Buosi, Vanessa; Otten, Renee; ...

2018-06-14

Protein kinases are major drug targets, but the development of highly-selective inhibitors has been challenging due to the similarity of their active sites. The observation of distinct structural states of the fully-conserved Asp-Phe-Gly (DFG) loop has put the concept of conformational selection for the DFG-state at the center of kinase drug discovery. Recently, it was shown that Gleevec selectivity for the Tyr-kinases Abl was instead rooted in conformational changes after drug binding. Here, we investigate whether protein dynamics after binding is a more general paradigm for drug selectivity by characterizing the binding of several approved drugs to the Ser/Thr-kinase Auroramore » A. Using a combination of biophysical techniques, we propose a universal drug-binding mechanism, that rationalizes selectivity, affinity and long on-target residence time for kinase inhibitors. These new concepts, where protein dynamics in the drug-bound state plays the crucial role, can be applied to inhibitor design of targets outside the kinome.« less

Dynamics of human protein kinase Aurora A linked to drug selectivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitsawong, Warintra; Buosi, Vanessa; Otten, Renee

Protein kinases are major drug targets, but the development of highly-selective inhibitors has been challenging due to the similarity of their active sites. The observation of distinct structural states of the fully-conserved Asp-Phe-Gly (DFG) loop has put the concept of conformational selection for the DFG-state at the center of kinase drug discovery. Recently, it was shown that Gleevec selectivity for the Tyr-kinases Abl was instead rooted in conformational changes after drug binding. Here, we investigate whether protein dynamics after binding is a more general paradigm for drug selectivity by characterizing the binding of several approved drugs to the Ser/Thr-kinase Auroramore » A. Using a combination of biophysical techniques, we propose a universal drug-binding mechanism, that rationalizes selectivity, affinity and long on-target residence time for kinase inhibitors. These new concepts, where protein dynamics in the drug-bound state plays the crucial role, can be applied to inhibitor design of targets outside the kinome.« less

Ion-binding properties of Calnuc, Ca2+ versus Mg2+--Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein.

PubMed

Kanuru, Madhavi; Samuel, Jebakumar J; Balivada, Lavanya M; Aradhyam, Gopala K

2009-05-01

Calnuc is a novel, highly modular, EF-hand containing, Ca(2+)-binding, Golgi resident protein whose functions are not clear. Using amino acid sequences, we demonstrate that Calnuc is a highly conserved protein among various organisms, from Ciona intestinalis to humans. Maximum homology among all sequences is found in the region that binds to G-proteins. In humans, it is known to be expressed in a variety of tissues, and it interacts with several important protein partners. Among other proteins, Calnuc is known to interact with heterotrimeric G-proteins, specifically with the alpha-subunit. Herein, we report the structural implications of Ca(2+) and Mg(2+) binding, and illustrate that Calnuc functions as a downstream effector for G-protein alpha-subunit. Our results show that Ca(2+) binds with an affinity of 7 mum and causes structural changes. Although Mg(2+) binds to Calnuc with very weak affinity, the structural changes that it causes are further enhanced by Ca(2+) binding. Furthermore, isothermal titration calorimetry results show that Calnuc and the G-protein bind with an affinity of 13 nm. We also predict a probable function for Calnuc, that of maintaining Ca(2+) homeostasis in the cell. Using Stains-all and terbium as Ca(2+) mimic probes, we demonstrate that the Ca(2+)-binding ability of Calnuc is governed by the activity-based conformational state of the G-protein. We propose that Calnuc adopts structural sites similar to the ones seen in proteins such as annexins, c2 domains or chromogrannin A, and therefore binds more calcium ions upon binding to Gialpha. With the number of organelle-targeted G-protein-coupled receptors increasing, intracellular communication mediated by G-proteins could become a new paradigm. In this regard, we propose that Calnuc could be involved in the downstream signaling of G-proteins.

CCL2 binding is CCR2 independent in primary adult human astrocytes.

PubMed

Fouillet, A; Mawson, J; Suliman, O; Sharrack, B; Romero, I A; Woodroofe, M N

2012-02-09

Chemokines are low relative molecular mass proteins, which have chemoattractant actions on many cell types. The chemokine, CCL2, has been shown to play a major role in the recruitment of monocytes in central nervous system (CNS) lesions in multiple sclerosis (MS). Since resident astrocytes constitute a major source of chemokine synthesis including CCL2, we were interested to assess the regulation of CCL2 by astrocytes. We showed that CCL2 bound to the cell surface of astrocytes and binding was not modulated by inflammatory conditions. However, CCR2 protein was not detected nor was activation of the classical CCR2 downstream signaling pathways. Recent studies have shown that non-signaling decoy chemokine receptors bind and modulate the expression of chemokines at site of inflammation. Here, we show that the D6 chemokine decoy receptor is constitutively expressed by primary human adult astrocytes at both mRNA and protein level. In addition, CCL3, which binds to D6, but not CCL19, which does not bind to D6, displaced CCL2 binding to astrocytes; indicating that CCL2 may bind to this cell type via the D6 receptor. Our results suggest that CCL2 binding to primary adult human astrocytes is CCR2-independent and is likely to be mediated via the D6 decoy chemokine receptor. Therefore we propose that astrocytes are implicated in both the establishment of chemokine gradients for the migration of leukocytes into and within the CNS and in the regulation of CCL2 levels at inflammatory sites in the CNS. Copyright © 2011 Elsevier B.V. All rights reserved.

Structure of bovine pancreatic ribonuclease complexed with uridine 5'-monophosphate at 1.60 A resolution.

PubMed

Larson, Steven B; Day, John S; Nguyen, Chieugiang; Cudney, Robert; McPherson, Alexander

2010-02-01

Bovine pancreatic ribonuclease A (RNase A) was crystallized from a mixture of small molecules containing basic fuchsin, tobramycin and uridine 5'-monophosphate (U5P). Solution of the crystal structure revealed that the enzyme was selectively bound to U5P, with the pyrimidine ring of U5P residing in the pyrimidine-binding site at Thr45. The structure was refined to an R factor of 0.197 and an R(free) of 0.253.

IL-27 Regulates IL-18 binding protein in skin resident cells.

PubMed

Wittmann, Miriam; Doble, Rosella; Bachmann, Malte; Pfeilschifter, Josef; Werfel, Thomas; Mühl, Heiko

2012-01-01

IL-18 is an important mediator involved in chronic inflammatory conditions such as cutaneous lupus erythematosus, psoriasis and chronic eczema. An imbalance between IL-18 and its endogenous antagonist IL-18 binding protein (BP) may account for increased IL-18 activity. IL-27 is a cytokine with dual function displaying pro- and anti-inflammatory properties. Here we provide evidence for a yet not described anti-inflammatory mode of action on skin resident cells. Human keratinocytes and surprisingly also fibroblasts (which do not produce any IL-18) show a robust, dose-dependent and highly inducible mRNA expression and secretion of IL-18BP upon IL-27 stimulation. Other IL-12 family members failed to induce IL-18BP. The production of IL-18BP peaked between 48-72 h after stimulation and was sustained for up to 96 h. Investigation of the signalling pathway showed that IL-27 activates STAT1 in human keratinocytes and that a proximal GAS site at the IL-18BP promoter is of importance for the functional activity of IL-27. The data are in support of a significant anti-inflammatory effect of IL-27 on skin resident cells. An important novel property of IL-27 in skin pathobiology may be to counter-regulate IL-18 activities by acting on keratinocytes and importantly also on dermal fibroblasts.

Keratinocyte secretion of cyclophilin B via the constitutive pathway is regulated through its cyclosporin-binding site.

PubMed

Fearon, Paula; Lonsdale-Eccles, Ann A; Ross, O Kehinde; Todd, Carole; Sinha, Aparna; Allain, Fabrice; Reynolds, Nick J

2011-05-01

Cyclophilin B (CypB) is an endoplasmic reticulum (ER)-resident member of the cyclophilin family of proteins that bind cyclosporin A (CsA). We report that as in other cell types, CypB trafficked from the ER and was secreted by keratinocytes into the media in response to CsA. Concentrations as low as 1 pM of CsA induced secretion of CypB. Using brefeldin A, we showed that CypB is secreted from keratinocytes via the constitutive secretory pathway. We defined that substitution of tryptophan residue 128 in the CsA-binding site of CypB with alanine resulted in dissociation of CypB(W128A)-green fluorescent protein (GFP) from the ER. Photobleaching studies revealed a significant reduction in the diffusible mobility of CypB(W128A)-GFP compared with CypB(WT)-GFP, consistent with redistribution of CypB(W128A)-GFP into secretory vesicles disconnected from the ER/Golgi network. Furthermore, CsA significantly decreased the mobility of CypB(WT)-GFP but not CypB(W128A)-GFP. These studies demonstrate that therapeutically relevant concentrations of CsA regulate secretion of CypB by keratinocytes, and that a key residue within the CsA-binding site of CypB controls retention of CypB within the ER and regulates entry into the secretory pathway. As keratinocytes express CypB receptors (CD147) and CypB exhibits chemotactic properties, these data have implications for the therapeutic effects of CsA in inflammatory skin disease.

Keratinocyte Secretion of Cyclophilin B via the Constitutive Pathway Is Regulated through Its Cyclosporin-Binding Site

PubMed Central

Fearon, Paula; Lonsdale-Eccles, Ann A; Ross, O Kehinde; Todd, Carole; Sinha, Aparna; Allain, Fabrice; Reynolds, Nick J

2011-01-01

Cyclophilin B (CypB) is an endoplasmic reticulum (ER)-resident member of the cyclophilin family of proteins that bind cyclosporin A (CsA). We report that as in other cell types, CypB trafficked from the ER and was secreted by keratinocytes into the media in response to CsA. Concentrations as low as 1 p of CsA induced secretion of CypB. Using brefeldin A, we showed that CypB is secreted from keratinocytes via the constitutive secretory pathway. We defined that substitution of tryptophan residue 128 in the CsA-binding site of CypB with alanine resulted in dissociation of CypBW128A-green fluorescent protein (GFP) from the ER. Photobleaching studies revealed a significant reduction in the diffusible mobility of CypBW128A-GFP compared with CypBWT-GFP, consistent with redistribution of CypBW128A-GFP into secretory vesicles disconnected from the ER/Golgi network. Furthermore, CsA significantly decreased the mobility of CypBWT-GFP but not CypBW128A-GFP. These studies demonstrate that therapeutically relevant concentrations of CsA regulate secretion of CypB by keratinocytes, and that a key residue within the CsA-binding site of CypB controls retention of CypB within the ER and regulates entry into the secretory pathway. As keratinocytes express CypB receptors (CD147) and CypB exhibits chemotactic properties, these data have implications for the therapeutic effects of CsA in inflammatory skin disease. PMID:21270823

Isotope-labeled aspartate sidechain as a non-perturbing infrared probe: Application to investigate the dynamics of a carboxylate buried inside a protein

NASA Astrophysics Data System (ADS)

Abaskharon, Rachel M.; Brown, Stephen P.; Zhang, Wenkai; Chen, Jianxin; Smith, Amos B.; Gai, Feng

2017-09-01

Because of their negatively charged carboxylates, aspartate and glutamate are frequently found at the active or binding site of proteins. However, studying a specific carboxylate in proteins that contain multiple aspartates and/or glutamates via infrared spectroscopy is difficult due to spectral overlap. We show, herein, that isotopic-labeling of the aspartate sidechain can overcome this limitation as the resultant 13COO- asymmetric stretching vibration resides in a transparent region of the protein IR spectrum. Applicability of this site-specific vibrational probe is demonstrated by using it to assess the dynamics of an aspartate ion buried inside a small protein via two-dimensional infrared spectroscopy.

Classification of small molecule protein kinase inhibitors based upon the structures of their drug-enzyme complexes.

PubMed

Roskoski, Robert

2016-01-01

Because dysregulation and mutations of protein kinases play causal roles in human disease, this family of enzymes has become one of the most important drug targets over the past two decades. The X-ray crystal structures of 21 of the 27 FDA-approved small molecule inhibitors bound to their target protein kinases are depicted in this paper. The structure of the enzyme-bound antagonist complex is used in the classification of these inhibitors. Type I inhibitors bind to the active protein kinase conformation (DFG-Asp in, αC-helix in). Type I½ inhibitors bind to a DFG-Asp in inactive conformation while Type II inhibitors bind to a DFG-Asp out inactive conformation. Type I, I½, and type II inhibitors occupy part of the adenine binding pocket and form hydrogen bonds with the hinge region connecting the small and large lobes of the enzyme. Type III inhibitors bind next to the ATP-binding pocket and type IV inhibitors do not bind to the ATP or peptide substrate binding sites. Type III and IV inhibitors are allosteric in nature. Type V inhibitors bind to two different regions of the protein kinase domain and are therefore bivalent inhibitors. The type I-V inhibitors are reversible. In contrast, type VI inhibitors bind covalently to their target enzyme. Type I, I½, and II inhibitors are divided into A and B subtypes. The type A inhibitors bind in the front cleft, the back cleft, and near the gatekeeper residue, all of which occur within the region separating the small and large lobes of the protein kinase. The type B inhibitors bind in the front cleft and gate area but do not extend into the back cleft. An analysis of the limited available data indicates that type A inhibitors have a long residence time (minutes to hours) while the type B inhibitors have a short residence time (seconds to minutes). The catalytic spine includes residues from the small and large lobes and interacts with the adenine ring of ATP. Nearly all of the approved protein kinase inhibitors occupy the adenine-binding pocket; thus it is not surprising that these inhibitors interact with nearby catalytic spine (CS) residues. Moreover, a significant number of approved drugs also interact with regulatory spine (RS) residues. Copyright © 2015 Elsevier Ltd. All rights reserved.

Lymphatic transport and lymph node targeting of methotrexate-conjugated PEGylated dendrimers are enhanced by reducing the length of the drug linker or masking interactions with the injection site.

PubMed

Ryan, Gemma M; McLeod, Victoria M; Mehta, Dharmini; Kelly, Brian D; Stanislawski, Pauline C; Owen, David J; Kaminskas, Lisa M; Porter, Christopher J H

2017-11-01

Drug conjugation to dendrimer-based delivery systems has been shown to enhance delivery to the lymphatic system after subcutaneous administration. Dendrimer interaction with components of the interstitium at the injection site, however, may prevent drainage from the injection site. The current study sought to vary the length of a linker employed to conjugate methotrexate (MTX) to a PEGylated dendrimer, in an attempt to reduce MTX interaction with interstitial binding sites and enhance lymphatic drainage. Dendrimers with shorter linkers resulted in higher lymphatic drainage, presumably via shielding of interaction sites by the PEG mantle, but were not retained in lymph nodes. Improved drainage of dendrimers with longer linkers was achieved through coadministration with dextran to mask interactions at the injection site while maintaining retention within the node. Enhanced drug exposure to the lymph node has the potential to enhance the treatment of lymph-node resident cancer metastases. Copyright © 2017 Elsevier Inc. All rights reserved.

Location of the synaptosome-binding regions on botulinum neurotoxin B.

PubMed

Dolimbek, Behzod Z; Steward, Lance E; Aoki, K Roger; Atassi, M Zouhair

2012-01-10

The regions of botulinum neurotoxin B (BoNT/B) involved in binding to mouse brain synaptosomes (snps) were localized. Sixty 19-residue overlapping peptides (peptide C31 consisted of 24 residues) encompassing BoNT/B H chain (residues 442-1291) were synthesized and used to inhibit binding of (125)I-labeled BoNT/B to snps. Synaptosome-binding regions were noncompeting and existed on both H(N) and H(C) domains of neurotoxin. At 37 °C, inhibitory activities on H(N) resided, in decreasing order, in peptides 638-656 (26.7%), 596-614 (18.2%), 512-530 (13.9%), 778-796 (13.8%), and 526-544 (11.6%). On H(C), activity resided in decreasing order in peptides 1170-1188 (44.6%), 1128-1146 (21.6%), 1184-1202 (18.6%), 1156-1174 (13.0%), 946-964 (11.8%), 1114-1132 (11.2%), 1100-1118 (6.2%), 876-894 (6.1%), 1268-1291 (4.6%), and 1226-1244 (4.3%). The 45 remaining H(N) and H(C) peptides had no activity. At 4 °C, peptide C24 (1170-1188) remained quite active (inhibiting, 31.2%), while activities of peptides N15, C21, and C25 were little under 10%. The snp-binding regions contained sites that bind synaptotagmin II and gangliosides. Despite the low degree of sequence homology, BoNT/B and BoNT/A display significant structural homology and appeared to bind in part to the same snp-binding regions. Binding of each labeled toxin to snps was inhibited ~50% by the other toxin, 70-72% by its correlate H(C), and by the H(C) of the other toxin [29% (BoNT/A by H(C) of B) or 32% (BoNT/B by H(C) of A)]. In the three-dimensional structure of BoNT/B, the greater part of H(C), one H(N) face, and part of the belt on the same side interact with snps. Thus, BoNT/B binds to snps through the H(C) head and employs regions on one H(N) face and the belt, reserving flexibility for the belt's unbound part to release the light chain. Most snp-binding regions coincide or overlap with blocking antibody (Ab)-binding regions explaining how such Abs prevent BoNT/B toxicity.

Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk

PubMed Central

Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.

2016-01-01

It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407

Individual N-Glycans Added at Intervals along the Stalk of the Nipah Virus G Protein Prevent Fusion but Do Not Block the Interaction with the Homologous F Protein

PubMed Central

Zhu, Qiyun; Biering, Scott B.; Mirza, Anne M.; Grasseschi, Brittany A.; Mahon, Paul J.; Lee, Benhur; Aguilar, Hector C.

2013-01-01

The promotion of membrane fusion by most paramyxoviruses requires an interaction between the viral attachment and fusion (F) proteins to enable receptor binding by the former to trigger the activation of the latter for fusion. Numerous studies demonstrate that the F-interactive sites on the Newcastle disease virus (NDV) hemagglutinin-neuraminidase (HN) and measles virus (MV) hemagglutinin (H) proteins reside entirely within the stalk regions of those proteins. Indeed, stalk residues of NDV HN and MV H that likely mediate the F interaction have been identified. However, despite extensive efforts, the F-interactive site(s) on the Nipah virus (NiV) G attachment glycoprotein has not been identified. In this study, we have introduced individual N-linked glycosylation sites at several positions spaced at intervals along the stalk of the NiV G protein. Five of the seven introduced sites are utilized as established by a retardation of electrophoretic mobility. Despite surface expression, ephrinB2 binding, and oligomerization comparable to those of the wild-type protein, four of the five added N-glycans completely eliminate the ability of the G protein to complement the homologous F protein in the promotion of fusion. The most membrane-proximal added N-glycan reduces fusion by 80%. However, unlike similar NDV HN and MV H mutants, the NiV G glycosylation stalk mutants retain the ability to bind F, indicating that the fusion deficiency of these mutants is not due to prevention of the G-F interaction. These findings suggest that the G-F interaction is not mediated entirely by the stalk domain of G and may be more complex than that of HN/H-F. PMID:23283956

Learning environment: the impact of clerkship location on instructional quality.

PubMed

Prunuske, Jacob P; Deci, David M

2013-03-01

Students provide variable feedback on instructional quality at ambulatory training sites. We hypothesized several strengths and weaknesses of placing students at resident and non-resident training sites, including differences in faculty behaviors, patient characteristics, work environment, learning opportunities, and levels of student engagement. We systematically assessed for differences in learning quality between clerkship sites with and without residents. Students completed the MedED IQ, a validated survey assessing four domains of instructional quality, after completing a required primary care rotation. We calculated descriptive and summary statistics and two sample tests of proportion analyzing student agreement with each MedEd IQ item with respect to the presence or absence of resident learners. Of 149 total, 113 (75.8%) students completed the MedEd IQ site survey. A greater percentage of students at resident training sites (25.8%) than at non-resident sites (7.3%) agreed with the statement "The opportunities were too diverse, preventing me from developing proficiency." A greater percentage of students at resident training sites (19.4%) than at non-resident sites (1.2%) agreed with the statement "The health care team was not supportive of my learning." There were no differences between sites with or without residents on 14 items measuring preceptor actions or seven items measuring student involvement. Ambulatory clerkship sites with and without residents provide comparable quality learning experiences and precepting. Students placed at resident training sites may be overwhelmed with diverse opportunities and have a less supportive learning environment than students placed at non-resident sites. Future research should evaluate the impact of health care team development programs designed to foster a more supportive training environment for medical students. Ways of aligning residency and medical student education goals within the training setting should be explored.

Editing of misaligned 3'-termini by an intrinsic 3'-5' exonuclease activity residing in the PHP domain of a family X DNA polymerase.

PubMed

Baños, Benito; Lázaro, José M; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

2008-10-01

Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolX(Bs)), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolX(Bs) possesses an intrinsic 3'-5' exonuclease activity specialized in resecting unannealed 3'-termini in a gapped DNA substrate. Biochemical analysis of a PolX(Bs) deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3'-5' exonuclease activity of PolX(Bs) resides in its PHP domain. Furthermore, site-directed mutagenesis of PolX(Bs) His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3'-termini resection by the 3'-5' exonuclease activity of PolX(Bs) in the DNA repair context are discussed.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

PtdInsP2 and PtdSer cooperate to trap synaptotagmin-1 to the plasma membrane in the presence of calcium

PubMed Central

Pérez-Lara, Ángel; Thapa, Anusa; Nyenhuis, Sarah B; Nyenhuis, David A; Halder, Partho; Tietzel, Michael; Tittmann, Kai; Cafiso, David S; Jahn, Reinhard

2016-01-01

The Ca2+-sensor synaptotagmin-1 that triggers neuronal exocytosis binds to negatively charged membrane lipids (mainly phosphatidylserine (PtdSer) and phosphoinositides (PtdIns)) but the molecular details of this process are not fully understood. Using quantitative thermodynamic, kinetic and structural methods, we show that synaptotagmin-1 (from Rattus norvegicus and expressed in Escherichia coli) binds to PtdIns(4,5)P2 via a polybasic lysine patch in the C2B domain, which may promote the priming or docking of synaptic vesicles. Ca2+ neutralizes the negative charges of the Ca2+-binding sites, resulting in the penetration of synaptotagmin-1 into the membrane, via binding of PtdSer, and an increase in the affinity of the polybasic lysine patch to phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2). These Ca2+-induced events decrease the dissociation rate of synaptotagmin-1 membrane binding while the association rate remains unchanged. We conclude that both membrane penetration and the increased residence time of synaptotagmin-1 at the plasma membrane are crucial for triggering exocytotic membrane fusion. DOI: http://dx.doi.org/10.7554/eLife.15886.001 PMID:27791979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jun-Hao; Liu, Shun; Zheng, Ling-Ling

Long non-coding RNAs (lncRNAs) are emerging as important regulatory molecules in developmental, physiological, and pathological processes. However, the precise mechanism and functions of most of lncRNAs remain largely unknown. Recent advances in high-throughput sequencing of immunoprecipitated RNAs after cross-linking (CLIP-Seq) provide powerful ways to identify biologically relevant protein–lncRNA interactions. In this study, by analyzing millions of RNA-binding protein (RBP) binding sites from 117 CLIP-Seq datasets generated by 50 independent studies, we identified 22,735 RBP–lncRNA regulatory relationships. We found that one single lncRNA will generally be bound and regulated by one or multiple RBPs, the combination of which may coordinately regulatemore » gene expression. We also revealed the expression correlation of these interaction networks by mining expression profiles of over 6000 normal and tumor samples from 14 cancer types. Our combined analysis of CLIP-Seq data and genome-wide association studies data discovered hundreds of disease-related single nucleotide polymorphisms resided in the RBP binding sites of lncRNAs. Finally, we developed interactive web implementations to provide visualization, analysis, and downloading of the aforementioned large-scale datasets. Our study represented an important step in identification and analysis of RBP–lncRNA interactions and showed that these interactions may play crucial roles in cancer and genetic diseases.« less

Hydrogen storage in engineered carbon nanospaces.

PubMed

Burress, Jacob; Kraus, Michael; Beckner, Matt; Cepel, Raina; Suppes, Galen; Wexler, Carlos; Pfeifer, Peter

2009-05-20

It is shown how appropriately engineered nanoporous carbons provide materials for reversible hydrogen storage, based on physisorption, with exceptional storage capacities (approximately 80 g H2/kg carbon, approximately 50 g H2/liter carbon, at 50 bar and 77 K). Nanopores generate high storage capacities (a) by having high surface area to volume ratios, and (b) by hosting deep potential wells through overlapping substrate potentials from opposite pore walls, giving rise to a binding energy nearly twice the binding energy in wide pores. Experimental case studies are presented with surface areas as high as 3100 m(2) g(-1), in which 40% of all surface sites reside in pores of width approximately 0.7 nm and binding energy approximately 9 kJ mol(-1), and 60% of sites in pores of width>1.0 nm and binding energy approximately 5 kJ mol(-1). The findings, including the prevalence of just two distinct binding energies, are in excellent agreement with results from molecular dynamics simulations. It is also shown, from statistical mechanical models, that one can experimentally distinguish between the situation in which molecules do (mobile adsorption) and do not (localized adsorption) move parallel to the surface, how such lateral dynamics affects the hydrogen storage capacity, and how the two situations are controlled by the vibrational frequencies of adsorbed hydrogen molecules parallel and perpendicular to the surface: in the samples presented, adsorption is mobile at 293 K, and localized at 77 K. These findings make a strong case for it being possible to significantly increase hydrogen storage capacities in nanoporous carbons by suitable engineering of the nanopore space.

Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response

PubMed Central

Goldstein, Ido; Baek, Songjoon; Presman, Diego M.; Paakinaho, Ville; Swinstead, Erin E.; Hager, Gordon L.

2017-01-01

Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. PMID:28031249

Functional defect of variants in the adenosine triphosphate-binding sites of ABCB4 and their rescue by the cystic fibrosis transmembrane conductance regulator potentiator, ivacaftor (VX-770).

PubMed

Delaunay, Jean-Louis; Bruneau, Alix; Hoffmann, Brice; Durand-Schneider, Anne-Marie; Barbu, Véronique; Jacquemin, Emmanuel; Maurice, Michèle; Housset, Chantal; Callebaut, Isabelle; Aït-Slimane, Tounsia

2017-02-01

ABCB4 (MDR3) is an adenosine triphosphate (ATP)-binding cassette (ABC) transporter expressed at the canalicular membrane of hepatocytes, where it mediates phosphatidylcholine (PC) secretion. Variations in the ABCB4 gene are responsible for several biliary diseases, including progressive familial intrahepatic cholestasis type 3 (PFIC3), a rare disease that can be lethal in the absence of liver transplantation. In this study, we investigated the effect and potential rescue of ABCB4 missense variations that reside in the highly conserved motifs of ABC transporters, involved in ATP binding. Five disease-causing variations in these motifs have been identified in ABCB4 (G535D, G536R, S1076C, S1176L, and G1178S), three of which are homologous to the gating mutations of cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7; i.e., G551D, S1251N, and G1349D), that were previously shown to be function defective and corrected by ivacaftor (VX-770; Kalydeco), a clinically approved CFTR potentiator. Three-dimensional structural modeling predicted that all five ABCB4 variants would disrupt critical interactions in the binding of ATP and thereby impair ATP-induced nucleotide-binding domain dimerization and ABCB4 function. This prediction was confirmed by expression in cell models, which showed that the ABCB4 mutants were normally processed and targeted to the plasma membrane, whereas their PC secretion activity was dramatically decreased. As also hypothesized on the basis of molecular modeling, PC secretion activity of the mutants was rescued by the CFTR potentiator, ivacaftor (VX-770). Disease-causing variations in the ATP-binding sites of ABCB4 cause defects in PC secretion, which can be rescued by ivacaftor. These results provide the first experimental evidence that ivacaftor is a potential therapy for selected patients who harbor mutations in the ATP-binding sites of ABCB4. (Hepatology 2017;65:560-570). © 2016 by the American Association for the Study of Liver Diseases.

The catalytic center of ferritin regulates iron storage via Fe(II)-Fe(III) displacement.

PubMed

Honarmand Ebrahimi, Kourosh; Bill, Eckhard; Hagedoorn, Peter-Leon; Hagen, Wilfred R

2012-11-01

A conserved iron-binding site, the ferroxidase center, regulates the vital iron storage role of the ubiquitous protein ferritin in iron metabolism. It is commonly thought that two Fe(II) simultaneously bind the ferroxidase center and that the oxidized Fe(III)-O(H)-Fe(III) product spontaneously enters the cavity of ferritin as a unit. In contrast, in some bacterioferritins and in archaeal ferritins a persistent di-iron prosthetic group in this center is believed to mediate catalysis of core formation. Using a combination of binding experiments and isotopically labeled (57)Fe(II), we studied two systems in comparison: the ferritin from the hyperthermophilic archaeal anaerobe Pyrococcus furiosus (PfFtn) and the eukaryotic human H ferritin (HuHF). The results do not support either of the two paradigmatic models; instead they suggest a unifying mechanism in which the Fe(III)-O-Fe(III) unit resides in the ferroxidase center until it is sequentially displaced by Fe(II).

Single-molecule resolution of protein dynamics on polymeric membrane surfaces: the roles of spatial and population heterogeneity.

PubMed

Langdon, Blake B; Mirhossaini, Roya B; Mabry, Joshua N; Sriram, Indira; Lajmi, Ajay; Zhang, Yanxia; Rojas, Orlando J; Schwartz, Daniel K

2015-02-18

Although polymeric membranes are widely used in the purification of protein pharmaceuticals, interactions between biomolecules and membrane surfaces can lead to reduced membrane performance and damage to the product. In this study, single-molecule fluorescence microscopy provided direct observation of bovine serum albumin (BSA) and human monoclonal antibody (IgG) dynamics at the interface between aqueous buffer and polymeric membrane materials including regenerated cellulose and unmodified poly(ether sulfone) (PES) blended with either polyvinylpyrrolidone (PVP), polyvinyl acetate-co-polyvinylpyrrolidone (PVAc-PVP), or polyethylene glycol methacrylate (PEGM) before casting. These polymer surfaces were compared with model surfaces composed of hydrophilic bare fused silica and hydrophobic trimethylsilane-coated fused silica. At extremely dilute protein concentrations (10(-3)-10(-7) mg/mL), protein surface exchange was highly dynamic with protein monomers desorbing from the surface within ∼1 s after adsorption. Protein oligomers (e.g., nonspecific dimers, trimers, or larger aggregates), although less common, remained on the surface for 5 times longer than monomers. Using newly developed super-resolution methods, we could localize adsorption sites with ∼50 nm resolution and quantify the spatial heterogeneity of the various surfaces. On a small anomalous subset of the adsorption sites, proteins adsorbed preferentially and tended to reside for significantly longer times (i.e., on "strong" sites). Proteins resided for shorter times overall on surfaces that were more homogeneous and exhibited fewer strong sites (e.g., PVAc-PVP/PES). We propose that strong surface sites may nucleate protein aggregation, initiated preferentially by protein oligomers, and accelerate ultrafiltration membrane fouling. At high protein concentrations (0.3-1.0 mg/mL), fewer strong adsorption sites were observed, and surface residence times were reduced. This suggests that at high concentrations, adsorbed proteins block strong sites from further protein adsorption. Importantly, this demonstrates that strong binding sites can be modified by changing solution conditions. Membrane surfaces are intrinsically heterogeneous; by employing single-molecule techniques, we have provided a new framework for understanding protein interactions with such surfaces.

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

Target recognition of beta2-glycoprotein I (beta2GPI)-dependent anticardiolipin antibodies: evidence for involvement of the fourth domain of beta2GPI in antibody binding.

PubMed

George, J; Gilburd, B; Hojnik, M; Levy, Y; Langevitz, P; Matsuura, E; Koike, T; Shoenfeld, Y

1998-04-15

Beta2-glycoprotein I (beta2GPI) is an absolute requirement for the binding of autoimmune anticardiolipin Abs (aCL) to cardiolipin (CL). We evaluated the target recognition of human beta2GPI by IgG derived from two patients with primary and two with secondary antiphospholipid syndrome. The total IgG serum fractions and beta2GPI affinity-purified IgGs were assessed by using various domain-deleted mutants (DM) of human beta2GPI (DMs: I-III, I-IV, II-V, III-V, IV-V, and V) and mouse mAbs against individual beta2GPI domains. The four IgGs bound slightly to CL in the absence of beta2GPI and showed increased binding in the beta2GPI presence. Following affinity purification of the IgGs on a beta2GPI column, reactivity toward CL was absent. DMs containing domain V inhibited the binding of biotinylated beta2GPI to CL. The addition to CL-coated plates of DM V, but not the other DMs, reduced the binding of all four IgGs. The anti-beta2GPI IgGs bound only to complete beta2GPI and DM I-IV coated on the plates. The binding to plate-adsorbed beta2GPI could be inhibited by complete beta2GPI and DM I-IV, the latter being a more efficient inhibitor. Further, the human anti-beta2GPI IgGs could compete with the binding to beta2GPI of Cof-21 mouse mAb (directed at domain IV), but not with the two other mouse mAbs. The results suggest that some "autoimmune:" beta2GPI-dependent anticardiolipin Abs recognize a beta2GPI target that is distinct from the CL-binding site in domain V. The target site for some antiphospholipid syndrome IgGs appear to reside in domain IV of beta2GPI.

Alteration of the Copper-Binding Capacity of Iron-Rich Humic Colloids during Transport from Peatland to Marine Waters.

PubMed

Muller, François L L; Cuscov, Marco

2017-03-21

Blanket bogs contain vast amounts of Sphagnum-derived organic substances which can act as powerful chelators for dissolved iron and thus enhance its export to the coastal ocean. To investigate the variations in quantity and quality of these exports, adsorptive cathodic stripping voltammetry (CSV) was used to characterize the metal binding properties of molecular weight-fractionated dissolved organic matter (MW-fractionated DOM) in the catchment and coastal plume of a small peat-draining river over a seasonal cycle. Within the plume, both iron- and copper-binding organic ligands showed a linear, conservative distribution with increasing salinity, illustrating the high stability of peatland-derived humic substances (HS). Within the catchment, humic colloids lost up to 50% of their copper-binding capacity, expressed as a molar ratio to organic carbon, after residing for 1 week or more in the main reservoir of the catchment. Immediately downstream of the reservoir, the molar ratio [L 2 ]/[C org ], where L 2 was the second strongest copper-binding ligand, was 0.75 × 10 -4 when the reservoir residence time was 5 h but 0.34 × 10 -4 when it was 25 days. Residence time did not affect the carbon specific iron-binding capacity of the humic substances which was [L]/[C org ] = (0.80 ± 0.20) × 10 -2 . Our results suggest that the loss of copper-binding capacity with increasing residence time is caused by intracolloidal interactions between iron and HS during transit from peat soil to river mouth.

Crystal Structure of VC0702 at 2.0 angstrom: A Conserved Hypothetical Protein from Vibrio Cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ni, Shuisong; Forouhar, Farhad; Bussiere, Dirksen E.

2006-06-01

VC0702, a conserved hypothetical protein of unknown function from Vibrio cholerae, resides in a putative three-gene operon containing the MbaA gene, which is involved in regulating formation of the extracellular matrix of biofilms in Vibrio cholerae. The VC0702 crystal structure has been determined at 2.0? and refined to Rwork=22.8% and Rfree=26.3%. VC0702 crystallized in an orthorhombic crystal lattice in the C2221 space group with dimensions of a=66.61 ?, b=88.118 ?, and c=118.35 ? with a homodimer in the asymmetric unit. VC0702 belongs to the Pfam DUF84 and COG1986 family of proteins. Sequence conservation within the DUF84 and COG1986 families wasmore » used to identify a conserved patch of surface residues that define a cleft and potential substrate-binding site in VC0702. The three-dimensional structure of VC0702 is similar to that of Mj0226 from Methanococcus janeshii, which has been identified as a novel NTPase. The NTP-binding site in Mj0226 is similarly located in comparison to the conserved patch of surface residues in VC0702. Furthermore, the NTP binds to MJ0226 in a cleft and deep cavity, features that are present in the VC0702 structure as well, suggesting that VC0702 may have a biochemical function involving NTP binding that is associated with a cellular function of regulating biofilm formation in Vibrio cholerae.« less

Molecular mechanisms involved in gamete interaction: evidence for the participation of cysteine-rich secretory proteins (CRISP) in sperm-egg fusion.

PubMed

Da Ros, V; Busso, D; Cohen, D J; Maldera, J; Goldweic, N; Cuasnicu, P S

2007-01-01

Epididymal protein DE and testicular protein Tpx-1 are two cysteine-rich secretory proteins also known as CRISP-1 and CRISP-2, respectively. DE/ CRISP-1 is localised on the equatorial segment of acrosome-reacted sperm and participates in rat gamete fusion through its binding to egg-complementary sites. Recent results using bacterially-expressed recombinant fragments of DE as well as synthetic peptides revealed that the ability of DE to bind to the egg surface and inhibit gamete fusion resides in a region of 12 amino acids corresponding to an evolutionary conserved motif of the CRISP family (Signature 2). Given the high degree of homology between DE/CRISP-1 and Tpx-1/CRISP-2, we also explored the potential participation of the testicular intra-acrosomal protein in gamete fusion. Results showing the ability of recombinant Tpx-1 to bind to the surface of rat eggs (evaluated by indirect immunofluorescence) and to significantly inhibit zona-free egg penetration, support the participation of this protein in gamete fusion through its interaction with egg-binding sites. Interestingly, rat Tpx-1 exhibits only two substitutions in Signature 2 when compared to this region in DE. Together, these results provide evidence for the involvement of both epididymal DE/CRISP-1 and testicular Tpx-1/CRISP-2 in gamete fusion suggesting the existence of a functional cooperation between homologue molecules as a mechanism to ensure the success of fertilisation.

External Barium Affects the Gating of KCNQ1 Potassium Channels and Produces a Pore Block via Two Discrete Sites

PubMed Central

Gibor, Gilad; Yakubovich, Daniel; Peretz, Asher; Attali, Bernard

2004-01-01

The pore properties and the reciprocal interactions between permeant ions and the gating of KCNQ channels are poorly understood. Here we used external barium to investigate the permeation characteristics of homomeric KCNQ1 channels. We assessed the Ba2+ binding kinetics and the concentration and voltage dependence of Ba2+ steady-state block. Our results indicate that extracellular Ba2+ exerts a series of complex effects, including a voltage-dependent pore blockade as well as unique gating alterations. External barium interacts with the permeation pathway of KCNQ1 at two discrete and nonsequential sites. (a) A slow deep Ba2+ site that occludes the channel pore and could be simulated by a model of voltage-dependent block. (b) A fast superficial Ba2+ site that barely contributes to channel block and mostly affects channel gating by shifting rightward the voltage dependence of activation, slowing activation, speeding up deactivation kinetics, and inhibiting channel inactivation. A model of voltage-dependent block cannot predict the complex impact of Ba2+ on channel gating in low external K+ solutions. Ba2+ binding to this superficial site likely modifies the gating transitions states of KCNQ1. Both sites appear to reside in the permeation pathway as high external K+ attenuates Ba2+ inhibition of channel conductance and abolishes its impact on channel gating. Our data suggest that despite the high degree of homology of the pore region among the various K+ channels, KCNQ1 channels display significant structural and functional uniqueness. PMID:15226366

Kinetic gating mechanism of DNA damage recognition by Rad4/XPC

NASA Astrophysics Data System (ADS)

Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; Park, Beomseok; Shim, Yoonjung; Kim, Youngchang; Liu, Lili; van Houten, Bennett; He, Chuan; Ansari, Anjum; Min, Jung-Hyun

2015-01-01

The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivity arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.

Kinetic gating mechanism of DNA damage recognition by Rad4/XPC

DOE PAGES

Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; ...

2015-01-06

The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivitymore » arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Lastly, kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.« less

Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response.

PubMed

Goldstein, Ido; Baek, Songjoon; Presman, Diego M; Paakinaho, Ville; Swinstead, Erin E; Hager, Gordon L

2017-03-01

Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. Published by Cold Spring Harbor Laboratory Press.

Transcriptome profiling identifies p53 as a key player during calreticulin deficiency: Implications in lipid accumulation.

PubMed

Vig, Saurabh; Talwar, Puneet; Kaur, Kirandeep; Srivastava, Rohit; Srivastava, Arvind K; Datta, Malabika

2015-01-01

Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering identified 34 significant clusters, of which p53 occupied the central hub node in the highest node-rich cluster. Toward validation, we show that CRT knockdown leads to inhibition of p53 protein levels. Both, CRT and p53 siRNA promote hepatic lipid accumulation and this was accompanied by elevated SREBP-1c and FAS levels. p53 was identified to bind at -219 bp on the SREBP-1c promoter and in the presence of CRT siRNA, there was decreased occupancy of p53 on this binding element. This was associated with increased SREBP-1c promoter activity and both, mutation in this binding site or p53 over-expression antagonised the effects of CRT knockdown. We, therefore, identify a negatively regulating p53 binding site on the SREBP-1c promoter that is critical during hepatic lipid accumulation. These results were validated in mouse primary hepatocytes and toward a physiological relevance, we report that while the levels of CRT and p53 are reduced in the fatty livers of diabetic db/db mice, SREBP-1c levels are significantly elevated. Our results suggest that decreased CRT levels might be involved in the development of a fatty liver by preventing p53 occupancy on the SREBP-1c promoter and thereby facilitating SREBP-1c up-regulation and consequently, lipid accumulation.

Molecular modeling of fibronectin adsorption on topographically nanostructured rutile (110) surfaces

NASA Astrophysics Data System (ADS)

Guo, Chuangqiang; Wu, Chunya; Chen, Mingjun; Zheng, Ting; Chen, Ni; Cummings, Peter T.

2016-10-01

To investigate the topographical dependency of protein adsorption, molecular dynamics simulations were employed to describe the adsorption behavior of the tenth type-III module of fibronectin (FN-III10) on nanostructured rutile (110) surfaces. The results indicated that the residence time of adsorbed FN-III10 largely relied on its binding mode (direct or indirect) with the substrate and the region for protein migration on the periphery (protrusion) or in the interior (cavity or groove) of nanostructures. In the direct binding mode, FN-III10 molecules were found to be 'trapped' at the anchoring sites of rutile surface, or even penetrate deep into the interior of nanostructures, regardless of the presented geometrical features. In the indirect binding mode, FN-III10 molecules were indirectly connected to the substrate via a hydrogen-bond network (linking FN-III10 and interfacial hydrations). The facets created by nanostructures, which exerted restraints on protein migration, were suggested to play an important role in the stability of indirect FN-III10-rutile binding. However, a doubly unfavorable situation - indirect FN-III10-rutile connections bridged by a handful of mediating waters and few constraints on movement of protein provided by nanostructures - would result in an early desorption of protein.

Editing of misaligned 3′-termini by an intrinsic 3′–5′ exonuclease activity residing in the PHP domain of a family X DNA polymerase

PubMed Central

Baños, Benito; Lázaro, José M.; Villar, Laurentino; de Vega, Miguel

2008-01-01

Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolXBs), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolXBs possesses an intrinsic 3′–5′ exonuclease activity specialized in resecting unannealed 3′-termini in a gapped DNA substrate. Biochemical analysis of a PolXBs deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3′–5′ exonuclease activity of PolXBs resides in its PHP domain. Furthermore, site-directed mutagenesis of PolXBs His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3′-termini resection by the 3′–5′ exonuclease activity of PolXBs in the DNA repair context are discussed. PMID:18776221

Genome-wide survey by ChIP-seq reveals YY1 regulation of lincRNAs in skeletal myogenesis

PubMed Central

Lu, Leina; Sun, Kun; Chen, Xiaona; Zhao, Yu; Wang, Lijun; Zhou, Liang; Sun, Hao; Wang, Huating

2013-01-01

Skeletal muscle differentiation is orchestrated by a network of transcription factors, epigenetic regulators, and non-coding RNAs. The transcription factor Yin Yang 1 (YY1) silences multiple target genes in myoblasts (MBs) by recruiting Ezh2 (Enhancer of Zeste Homologue2). To elucidate genome-wide YY1 binding in MBs, we performed chromatin immunoprecipitation (ChIP)-seq and found 1820 specific binding sites in MBs with a large portion residing in intergenic regions. Detailed analysis demonstrated that YY1 acts as an activator for many loci in addition to its known repressor function. No significant co-occupancy was found between YY1 and Ezh2, suggesting an additional Ezh2-independent function for YY1 in MBs. Further analysis of intergenic binding sites showed that YY1 potentially regulates dozens of large intergenic non-coding RNAs (lincRNAs), whose function in myogenesis is underexplored. We characterized a novel muscle-associated lincRNA (Yam-1) that is positively regulated by YY1. Yam-1 is downregulated upon differentiation and acts as an inhibitor of myogenesis. We demonstrated that Yam-1 functions through in cis regulation of miR-715, which in turn targets Wnt7b. Our findings not only provide the first genome-wide picture of YY1 association in muscle cells, but also uncover the functional role of lincRNA Yam-1. PMID:23942234

Elucidation of the glucose transport pathway in glucose transporter 4 via steered molecular dynamics simulations.

PubMed

Sheena, Aswathy; Mohan, Suma S; Haridas, Nidhina Pachakkil A; Anilkumar, Gopalakrishnapillai

2011-01-01

GLUT4 is a predominant insulin regulated glucose transporter expressed in major glucose disposal tissues such as adipocytes and muscles. Under the unstimulated state, GLUT4 resides within intracellular vesicles. Various stimuli such as insulin translocate this protein to the plasma membrane for glucose transport. In the absence of a crystal structure for GLUT4, very little is known about the mechanism of glucose transport by this protein. Earlier we proposed a homology model for GLUT4 and performed a conventional molecular dynamics study revealing the conformational rearrangements during glucose and ATP binding. However, this study could not explain the transport of glucose through the permeation tunnel. To elucidate the molecular mechanism of glucose transport and its energetic, a steered molecular dynamics study (SMD) was used. Glucose was pulled from the extracellular end of GLUT4 to the cytoplasm along the pathway using constant velocity pulling method. We identified several key residues within the tunnel that interact directly with either the backbone ring or the hydroxyl groups of glucose. A rotation of glucose molecule was seen near the sugar binding site facilitating the sugar recognition process at the QLS binding site. This study proposes a possible glucose transport pathway and aids the identification of several residues that make direct interactions with glucose during glucose transport. Mutational studies are required to further validate the observation made in this study.

Cysteine-rich secretory proteins (CRISP) and their role in mammalian fertilization.

PubMed

Cohen, Débora J; Maldera, Julieta A; Weigel Muñoz, Mariana; Ernesto, Juan I; Vasen, Gustavo; Cuasnicu, Patricia S

2011-01-01

Epididymal protein CRISPI is a member of the CRISP (Cysteine-RIch Secretory proteins) family and is involved in sperm-egg fusion through its interaction with complementary sites on the egg surface. Results from our laboratory have shown that this binding ability resides in a 12-amino-acid region corresponding to a highly conserved motif of the CRISP family, named Signature 2 (S2). In addition to this, our results revealed that CRISP1 could also be involved in the previous step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. As another approach to elucidate the participation of CRISP1 in fertilization, a mouse line containing a targeted disruption of CRISP1 was generated. Although CRISP1-deficient mice exhibited normal fertility, CRISP1-defficient sperm presented a decreased level of protein tyrosine phosphorylation during capacitation, and an impaired ability to fertilize both zona-intact and zona-free eggs in vitro, confirming the proposed roles for the protein in fertilization. Evidence obtained in our laboratory indicated that testicular CRISP2 would also be involved in sperm-egg fusion. Competition assays between CRISP1 and CRISP2, as well as the comparison of their corresponding S2 regions, suggest that both proteins bind to common complementary sites in the egg. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization.

Identification of a Unique Fe-S Cluster Binding Site in a Glycyl-Radical Type Microcompartment Shell Protein

PubMed Central

Thompson, Michael C.; Wheatley, Nicole M.; Jorda, Julien; Sawaya, Michael R.; Gidaniyan, Soheil D.; Ahmed, Hoda; Yang, Zhongyu; McCarty, Krystal N.; Whitelegge, Julian P.; Yeates, Todd O.

2014-01-01

Recently, progress has been made toward understanding the functional diversity of bacterial microcompartment (MCP) systems, which serve as protein-based metabolic organelles in diverse microbes. New types of MCPs have been identified, including the glycyl-radical propanediol (Grp) MCP. Within these elaborate protein complexes, BMC-domain shell proteins assemble to form a polyhedral barrier that encapsulates the enzymatic contents of the MCP. Interestingly, the Grp MCP contains a number of shell proteins with unusual sequence features. GrpU is one such shell protein, whose amino acid sequence is particularly divergent from other members of the BMC-domain superfamily of proteins that effectively defines all MCPs. Expression, purification, and subsequent characterization of the protein showed, unexpectedly, that it binds an iron-sulfur cluster. We determined X-ray crystal structures of two GrpU orthologs, providing the first structural insight into the homohexameric BMC-domain shell proteins of the Grp system. The X-ray structures of GrpU, both obtained in the apo form, combined with spectroscopic analyses and computational modeling, show that the metal cluster resides in the central pore of the BMC shell protein at a position of broken 6-fold symmetry. The result is a structurally polymorphic iron-sulfur cluster binding site that appears to be unique among metalloproteins studied to date. PMID:25102080

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

An Angular Overlap Model for Cu(II) Ion in the AMOEBA Polarizable Force Field

PubMed Central

Xiang, Jin Yu; Ponder, Jay W.

2014-01-01

An extensible polarizable force field for transition metal ion was developed based on AMOEBA and the angular overlap model (AOM) with consistent treatment of electrostatics for all atoms. Parameters were obtained by fitting molecular mechanics (MM) energies to various ab initio gas-phase calculations. The results of parameterization were presented for copper (II) ion ligated to water and model fragments of amino acid residues involved in the copper binding sites of type 1 copper proteins. Molecular dynamics (MD) simulations were performed on aqueous copper (II) ion at various temperatures, as well as plastocyanin (1AG6) and azurin (1DYZ). Results demonstrated that the AMOEBA-AOM significantly improves the accuracy of classical MM in a number of test cases when compared to ab initio calculations. The Jahn-Teller distortion for hexa-aqua copper (II) complex was handled automatically without specifically designating axial and in-plane ligands. Analyses of MD trajectories resulted in a 6-coordination first solvation shell for aqueous copper (II) ion and a 1.8ns average residence time of water molecules. The ensemble average geometries of 1AG6 and 1DYZ copper binding sites were in general agreement with X-ray and previous computational studies. PMID:25045338

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Pharmacists teaching in family medicine residency programs

PubMed Central

Jorgenson, Derek; Muller, Andries; Whelan, Anne Marie; Buxton, Kelly

2011-01-01

Abstract Objective To determine the percentage of family medicine residency programs that have pharmacists directly involved in teaching residents, the types and extent of teaching provided by pharmacists in family medicine residency programs, and the primary source of funding for the pharmacists. Design Web-based survey. Setting One hundred fifty-eight resident training sites within the 17 family medicine residency programs in Canada. Participants One hundred residency program directors who were responsible for overseeing the training sites within the residency programs were contacted to determine the percentage of training sites in which pharmacists were directly involved in teaching. Pharmacists who were identified by the residency directors were invited to participate in the Web-based survey. Main outcome measures The percentage of training sites for family medicine residency that have pharmacists directly involved in teaching residents. The types and the extent of teaching performed by the pharmacists who teach in the residency programs. The primary source of funding that supports the pharmacists’ salaries. Results More than a quarter (25.3%) of family medicine residency training sites include direct involvement of pharmacist teachers. Pharmacist teachers reported that they spend a substantial amount of their time teaching residents using a range of teaching modalities and topics, but have no formal pharmacotherapy curriculums. Nearly a quarter (22.6%) of the pharmacists reported that their salaries were primarily funded by the residency programs. Conclusion Pharmacists have a role in training family medicine residents. This is a good opportunity for family medicine residents to learn about issues related to pharmacotherapy; however, the role of pharmacists as educators might be optimized if standardized teaching methods, curriculums, and evaluation plans were in place. PMID:21918131

BEND3 is involved in the human-specific repression of calreticulin: Implication for the evolution of higher brain functions in human.

PubMed

Aghajanirefah, A; Nguyen, L N; Ohadi, M

2016-01-15

Recent emerging evidence indicates that changes in gene expression levels are linked to human evolution. We have previously reported a human-specific nucleotide in the promoter sequence of the calreticulin (CALR) gene at position -220C, which is the site of action of valproic acid. Reversion of this nucleotide to the ancestral A-allele has been detected in patients with degrees of deficit in higher brain cognitive functions. This mutation has since been reported in the 1000 genomes database at an approximate frequency of <0.0004 in humans (rs138452745). In the study reported here, we present update on the status of rs138452745 across evolution, based on the Ensembl and NCBI databases. The DNA pulldown assay was also used to identify the proteins binding to the C- and A-alleles, using two cell lines, SK-N-BE and HeLa. Consistent with our previous findings, the C-allele is human-specific, and the A-allele is the rule across all other species (N=38). This nucleotide resides in a block of 12-nucleotides that is strictly conserved across evolution. The DNA pulldown experiments revealed that in both SK-N-BE and HeLa cells, the transcription repressor BEN domain containing 3 (BEND3) binds to the human-specific C-allele, whereas the nuclear factor I (NFI) family members, NF1A, B, C, and X, specifically bind to the ancestral A-allele. This binding pattern is consistent with a previously reported decreased promoter activity of the C-allele vs. the A-allele. We propose that there is a link between binding of BEND3 to the CALR rs138452745 C-allele and removal of NFI binding site from this nucleotide, and the evolution of human-specific higher brain functions. To our knowledge, CALR rs138452745 is the first instance of enormous nucleotide conservation across evolution, except in the human species. Copyright © 2015 Elsevier B.V. All rights reserved.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Value of a regional family practice residency training program site: perceptions of residents, nurses, and physicians.

PubMed

Fletcher, Sarah; Mullett, Jennifer; Beerman, Steve

2014-09-01

To examine the perceptions of residents, nurses, and physicians about the effect of a regional family practice residency site on the delivery of health services in the community, as well as on the community health care providers. Interviews and focus groups were conducted. Nanaimo, BC. A total of 16 residents, 15 nurses, and 20 physicians involved with the family practice residency training program at the Nanaimo site. A series of semistructured interviews and focus groups was conducted. Transcripts of interviews and focus groups were analyzed thematically by the research team. Overall, participants agreed that having a family practice residency training site in the community contributed to community life and to the delivery of health services in the following ways: increased community capacity and social capital; motivated positive relationships and attitudes in the hospital and community settings; improved communication and teamwork, as well as accessibility and understanding of the health care system; increased the standard of care; and facilitated the recruitment and retention of family physicians. This family practice residency training site was beneficial for the community it served. Future planning for distributed medical education sites should take into account the effects of these sites on the health care community and ensure that they continue to be positive influences. Further research in this area could focus on patients' perceptions of how residency programs affect their care, as well as on the effect of residency programs on wait times and workload for physicians and nurses. Copyright© the College of Family Physicians of Canada.

Characterization of 12 GnRH peptide agonists - a kinetic perspective.

PubMed

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H

2016-01-01

Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.

Characterization of 12 GnRH peptide agonists – a kinetic perspective

PubMed Central

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.

2015-01-01

Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856

Site-specific surveillance project at the Koppers Company, Inc. , National Priorities List Site, Texarkana, Texas. Final report, March 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

A site-specific surveillance project was conducted at the Koppers Company, a National Priorities List site. The findings indicated that living in the Koppers area was associated with a higher prevalance of reported rashes than among residents of a similar neighborhood in Texarkana not located near this site. Koppers residents did not appear to have higher rates of either adverse pregnancy outcomes or cancer than comparison residents. They did have many more concerns about their soil, water, and chemical odors in their neighborhood than did residents of the comparison neighborhood.

Synthesis of bis-Phosphate Iminoaltritol Enantiomers and Structural Characterization with Adenine Phosphoribosyltransferase.

PubMed

Harris, Lawrence D; Harijan, Rajesh K; Ducati, Rodrigo G; Evans, Gary B; Hirsch, Brett M; Schramm, Vern L

2018-01-19

Phosphoribosyl transferases (PRTs) are essential in nucleotide synthesis and salvage, amino acid, and vitamin synthesis. Transition state analysis of several PRTs has demonstrated ribocation-like transition states with a partial positive charge residing on the pentose ring. Core chemistry for synthesis of transition state analogues related to the 5-phospho-α-d-ribosyl 1-pyrophosphate (PRPP) reactant of these enzymes could be developed by stereospecific placement of bis-phosphate groups on an iminoaltritol ring. Cationic character is provided by the imino group and the bis-phosphates anchor both the 1- and 5-phosphate binding sites. We provide a facile synthetic path to these molecules. Cyclic-nitrone redox methodology was applied to the stereocontrolled synthesis of three stereoisomers of a selectively monoprotected diol relevant to the synthesis of transition-state analogue inhibitors. These polyhydroxylated pyrrolidine natural product analogues were bis-phosphorylated to generate analogues of the ribocationic form of 5-phosphoribosyl 1-phosphate. A safe, high yielding synthesis of the key intermediate represents a new route to these transition state mimics. An enantiomeric pair of iminoaltritol bis-phosphates (L-DIAB and D-DIAB) was prepared and shown to display inhibition of Plasmodium falciparum orotate phosphoribosyltransferase and Saccharomyces cerevisiae adenine phosphoribosyltransferase (ScAPRT). Crystallographic inhibitor binding analysis of L- and D-DIAB bound to the catalytic sites of ScAPRT demonstrates accommodation of both enantiomers by altered ring geometry and bis-phosphate catalytic site contacts.

Cholesterol transfer at endosomal-organelle membrane contact sites.

PubMed

Ridgway, Neale D; Zhao, Kexin

2018-06-01

Cholesterol is delivered to the limiting membrane of late endosomes by Niemann-Pick Type C1 and C2 proteins. This review summarizes recent evidence that cholesterol transfer from endosomes to the endoplasmic reticulum and other organelles is mediated by lipid-binding proteins that localize to membrane contact sites (MCS). LDL-cholesterol in the late endosomal/lysosomes is exported to the plasma membrane, where most cholesterol resides, and the endoplasmic reticulum, which harbors the regulatory complexes and enzymes that control the synthesis and esterification of cholesterol. A major advance in dissecting these cholesterol transport pathways was identification of frequent and dynamic MCS between endosomes and the endoplasmic reticulum, peroxisomes and plasma membrane. Positioned at these MCS are members of the oxysterol-binding protein (OSBP) and steroidogenic acute regulatory protein-related lipid-transfer family of lipid transfer proteins that bridge the opposing membranes and directly or indirectly mediate cholesterol transfer. OSBP-related protein 1L (ORP1L), ORP5 and ORP6 mediate cholesterol transfer to the endoplasmic reticulum that regulates cholesterol homeostasis. ORP1L and STARD3 also move cholesterol from the endoplasmic reticulum-to-late endosomal/lysosomes under low-cholesterol conditions to facilitate intraluminal vesicle formation. Cholesterol transport also occurs at MCS with peroxisomes and possibly the plasma membrane. Frequent contacts between organelles and the endo-lysosomal vesicles are sites for bidirectional transfer of cholesterol.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Transforming the Primary Care Training Clinic: New York State's Hospital Medical Home Demonstration Pilot.

PubMed

Angelotti, Marietta; Bliss, Kathryn; Schiffman, Dana; Weaver, Erin; Graham, Laura; Lemme, Thomas; Pryor, Veronica; Gesten, Foster C

2015-06-01

Training in patient-centered medical home (PCMH) settings may prepare new physicians to measure quality of care, manage the health of populations, work in teams, and include cost information in decision making. Transforming resident clinics to PCMHs requires funding for additional staff, electronic health records, training, and other resources not typically available to residency programs. Describe how a 1115 Medicaid waiver was used to transform the majority of primary care training sites in New York State to the PCMH model and improve the quality of care provided. The 2013-2014 Hospital Medical Home Program provided awards to 60 hospitals and 118 affiliated residency programs (training more than 5000 residents) to transform outpatient sites into PCMHs and provide high-quality, coordinated care. Site visits, coaching calls, resident surveys, data reporting, and feedback were used to promote and monitor change in resident continuity and quality of care. Descriptive analyses measured improvements in these areas. A total of 156 participating outpatient sites (100%) received PCMH recognition. All sites enhanced resident education using PCMH principles through patient empanelment, development of quality dashboards, and transforming resident scheduling and training. Clinical quality outcomes showed improvement across the demonstration, including better performance on colorectal and breast cancer screening rates (rate increases of 13%, P≤.001, and 11%, P=.011, respectively). A 1115 Medicaid waiver is a viable mechanism for states to transform residency clinics to reflect new primary care models. The PCMH transformation of 156 sites led to improvements in resident continuity and clinical outcomes.

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

PEGylation prolongs the pulmonary retention of an anti-IL-17A Fab' antibody fragment after pulmonary delivery in three different species.

PubMed

Freches, Danielle; Patil, Harshad P; Machado Franco, Maria; Uyttenhove, Catherine; Heywood, Sam; Vanbever, Rita

2017-04-15

The PEGylation of antibody fragments has been shown to greatly prolong their residence time in the lungs in mice. The purpose of this research was to confirm the effect of PEGylation in higher animal species, that is, the rat and the rabbit. An anti-IL-17A Fab' antibody fragment was conjugated to a two-armed 40kDa polyethylene glycol (PEG) via site-selective thiol PEGylation. PEGylation did not significantly alter the binding activity of the Fab' fragment but it largely enhanced its inhibitory potency. PEGylation increased the residence time of the Fab' in the lungs of mice, rats and rabbits. Following intratracheal administration, the unconjugated Fab' was cleared from the lungs within 24h while large quantities of the PEGylated Fab' remained present up to 48h. No significant differences in clearance were noted between the three animal species although there was a tendency of longer residence time in higher species. PEGylation represents a promising approach to sustain the presence of antibody fragments in the lungs and to enhance their therapeutic efficacy in respiratory diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Membrane Topology Mapping of the Na+-Pumping NADH: Quinone Oxidoreductase from Vibrio cholerae by PhoA- Green Fluorescent Protein Fusion Analysis▿

PubMed Central

Duffy, Ellen B.; Barquera, Blanca

2006-01-01

The membrane topologies of the six subunits of Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from Vibrio cholerae were determined by a combination of topology prediction algorithms and the construction of C-terminal fusions. Fusion expression vectors contained either bacterial alkaline phosphatase (phoA) or green fluorescent protein (gfp) genes as reporters of periplasmic and cytoplasmic localization, respectively. A majority of the topology prediction algorithms did not predict any transmembrane helices for NqrA. A lack of PhoA activity when fused to the C terminus of NqrA and the observed fluorescence of the green fluorescent protein C-terminal fusion confirm that this subunit is localized to the cytoplasmic side of the membrane. Analysis of four PhoA fusions for NqrB indicates that this subunit has nine transmembrane helices and that residue T236, the binding site for flavin mononucleotide (FMN), resides in the cytoplasm. Three fusions confirm that the topology of NqrC consists of two transmembrane helices with the FMN binding site at residue T225 on the cytoplasmic side. Fusion analysis of NqrD and NqrE showed almost mirror image topologies, each consisting of six transmembrane helices; the results for NqrD and NqrE are consistent with the topologies of Escherichia coli homologs YdgQ and YdgL, respectively. The NADH, flavin adenine dinucleotide, and Fe-S center binding sites of NqrF were localized to the cytoplasm. The determination of the topologies of the subunits of Na+-NQR provides valuable insights into the location of cofactors and identifies targets for mutagenesis to characterize this enzyme in more detail. The finding that all the redox cofactors are localized to the cytoplasmic side of the membrane is discussed. PMID:17041063

Photoaffinity labelling of the cardiac calcium channel. (-)-[3H]azidopine labels a 165 kDa polypeptide, and evidence against a [3H]-1,4-dihydropyridine-isothiocyanate being a calcium-channel-specific affinity ligand.

PubMed

Ferry, D R; Goll, A; Glossmann, H

1987-04-01

The arylazide 1,4-dihydropyridine (-)-[3H]azidopine binds to a saturable population of sites in guinea-pig heart membranes with a dissociation constant (KD) of 30 +/- 7 pM and a density (Bmax.) of 670 +/- 97 fmol/mg of protein. This high-affinity binding site is assumed to reside on voltage-operated calcium channels because reversible binding is blocked stereoselectively by 1,4-dihydropyridine channel blockers and by the enantiomers of Bay K 8644. A low-affinity (KD 25 +/- 7 nM) high-capacity (Bmax. 21.6 +/- 9 pmol/mg of protein) site does not bind (-)- or (+)-Bay K 8644, but is blocked by high concentrations (greater than 500 nM) of dihydro-2,6-dimethyl-4-(2-isothiocyanatophenyl)-3,5-pyridinedicarboxy lic acid dimethyl ester (1,4-DHP-isothiocyanate) or, e.g., (+/-)-nicardipine. (-)-[3H]Azidopine was photoincorporated covalently into bands of 165 +/- 8, 39 +/- 2 and 35 +/- 3 kDa, as determined by SDS/polyacrylamide-gel electrophoresis. Labelling of the 165 kDa band is protected stereoselectively by 1,4-dihydropyridine enantiomers at low (nM) concentrations and by (-)- and (+)-Bay K 8644, whereas the lower-Mr bands are not. Thus, only the 165 kDa band is the calcium-channel-linked 1,4-dihydropyridine receptor. Photolabelling of the 39 or 35 kDa bands was only blocked by 10 microM-1,4-DHP-isothiocyanate or 50 microM-(+/-)-nicardipine but not by 10 microM-(-)-Bay K 8644. [3H]-1,4-DHP-isothiocyanate binds to guinea-pig heart membranes with a KD of 0.35 nM and dissociates with a k-1 of 0.2 min-1 at 30 degrees C. [3H]-1,4 DHP-isothiocyanate irreversibly labels bands of 39 and 35 kDa which are protected by greater than 10 microM-(+/-)-nicardipine or unlabelled ligand but not by 10 microM-(-)-Bay K 8644. Thus, [3H]-1,4-DHP-isothiocyanate is not an affinity probe for the calcium channel.

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Value of a regional family practice residency training program site

PubMed Central

Fletcher, Sarah; Mullett, Jennifer; Beerman, Steve

2014-01-01

Abstract Objective To examine the perceptions of residents, nurses, and physicians about the effect of a regional family practice residency site on the delivery of health services in the community, as well as on the community health care providers. Design Interviews and focus groups were conducted. Setting Nanaimo, BC. Participants A total of 16 residents, 15 nurses, and 20 physicians involved with the family practice residency training program at the Nanaimo site. Methods A series of semistructured interviews and focus groups was conducted. Transcripts of interviews and focus groups were analyzed thematically by the research team. Main findings Overall, participants agreed that having a family practice residency training site in the community contributed to community life and to the delivery of health services in the following ways: increased community capacity and social capital; motivated positive relationships and attitudes in the hospital and community settings; improved communication and teamwork, as well as accessibility and understanding of the health care system; increased the standard of care; and facilitated the recruitment and retention of family physicians. Conclusion This family practice residency training site was beneficial for the community it served. Future planning for distributed medical education sites should take into account the effects of these sites on the health care community and ensure that they continue to be positive influences. Further research in this area could focus on patients’ perceptions of how residency programs affect their care, as well as on the effect of residency programs on wait times and workload for physicians and nurses. PMID:25217693

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Functional interaction of CCAAT/enhancer-binding-protein-α basic region mutants with E2F transcription factors and DNA.

PubMed

Kowenz-Leutz, Elisabeth; Schuetz, Anja; Liu, Qingbin; Knoblich, Maria; Heinemann, Udo; Leutz, Achim

2016-07-01

The transcription factor CCAAT/enhancer-binding protein α (C/EBPα) regulates cell cycle arrest and terminal differentiation of neutrophils and adipocytes. Mutations in the basic leucine zipper domain (bZip) of C/EBPα are associated with acute myeloid leukemia. A widely used murine transforming C/EBPα basic region mutant (BRM2) entails two bZip point mutations (I294A/R297A). BRM2 has been discordantly described as defective for DNA binding or defective for interaction with E2F. We have separated the two BRM2 mutations to shed light on the intertwined reciprocity between C/EBPα-E2F-DNA interactions. Both, C/EBPα I294A and R297A retain transactivation capacity and interaction with E2F-DP. The C/EBPα R297A mutation destabilized DNA binding, whereas the C/EBPα I294A mutation enhanced binding to DNA. The C/EBPα R297A mutant, like BRM2, displayed enhanced interaction with E2F-DP but failed to repress E2F-dependent transactivation although both mutants were readily suppressed by E2F1 for transcription through C/EBP cis-regulatory sites. In contrast, the DNA binding enhanced C/EBPα I294A mutant displayed increased repression of E2F-DP mediated transactivation and resisted E2F-DP mediated repression. Thus, the efficient repression of E2F dependent S-phase genes and the activation of differentiation genes reside in the balanced DNA binding capacity of C/EBPα. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural Effect of the Asp345a Insertion in Penicillin-Binding Protein 2 from Penicillin-Resistant Strains of Neisseria gonorrhoeae

PubMed Central

2015-01-01

A hallmark of penicillin-binding protein 2 (PBP2) from penicillin-resistant strains of Neisseria gonorrhoeae is insertion of an aspartate after position 345. The insertion resides on a loop near the active site and is immediately adjacent to an existing aspartate (Asp346) that forms a functionally important hydrogen bond with Ser363 of the SxN conserved motif. Insertion of other amino acids, including Glu and Asn, can also lower the rate of acylation by penicillin, but these insertions abolish transpeptidase function. Although the kinetic consequences of the Asp insertion are well-established, how it impacts the structure of PBP2 is unknown. Here, we report the 2.2 Å resolution crystal structure of a truncated construct of PBP2 containing all five mutations present in PBP2 from the penicillin-resistant strain 6140, including the Asp insertion. Commensurate with the strict specificity for the Asp insertion over similar amino acids, the insertion does not cause disordering of the structure, but rather induces localized flexibility in the β2c−β2d loop. The crystal structure resolves the ambiguity of whether the insertion is Asp345a or Asp346a (due to the adjacent Asp) because the hydrogen bond between Asp346 and Ser362 is preserved and the insertion is therefore Asp346a. The side chain of Asp346a projects directly toward the β-lactam-binding site near Asn364 of the SxN motif. The Asp insertion may lower the rate of acylation by sterically impeding binding of the antibiotic or by hindering breakage of the β-lactam ring during acylation because of the negative charge of its side chain. PMID:25403720

Structural effect of the Asp345a insertion in penicillin-binding protein 2 from penicillin-resistant strains of Neisseria gonorrhoeae.

PubMed

Fedarovich, Alena; Cook, Edward; Tomberg, Joshua; Nicholas, Robert A; Davies, Christopher

2014-12-09

A hallmark of penicillin-binding protein 2 (PBP2) from penicillin-resistant strains of Neisseria gonorrhoeae is insertion of an aspartate after position 345. The insertion resides on a loop near the active site and is immediately adjacent to an existing aspartate (Asp346) that forms a functionally important hydrogen bond with Ser363 of the SxN conserved motif. Insertion of other amino acids, including Glu and Asn, can also lower the rate of acylation by penicillin, but these insertions abolish transpeptidase function. Although the kinetic consequences of the Asp insertion are well-established, how it impacts the structure of PBP2 is unknown. Here, we report the 2.2 Å resolution crystal structure of a truncated construct of PBP2 containing all five mutations present in PBP2 from the penicillin-resistant strain 6140, including the Asp insertion. Commensurate with the strict specificity for the Asp insertion over similar amino acids, the insertion does not cause disordering of the structure, but rather induces localized flexibility in the β2c-β2d loop. The crystal structure resolves the ambiguity of whether the insertion is Asp345a or Asp346a (due to the adjacent Asp) because the hydrogen bond between Asp346 and Ser362 is preserved and the insertion is therefore Asp346a. The side chain of Asp346a projects directly toward the β-lactam-binding site near Asn364 of the SxN motif. The Asp insertion may lower the rate of acylation by sterically impeding binding of the antibiotic or by hindering breakage of the β-lactam ring during acylation because of the negative charge of its side chain.

Characterization of a new ARID family transcription factor (Brightlike/ARID3C) that co-activates Bright/ARID3A-mediated immunoglobulin gene transcription

PubMed Central

Tidwell, Josephine A.; Schmidt, Christian; Heaton, Phillip; Wilson, Van; Tucker, Philip W.

2011-01-01

Two members, Bright/ARID3A and Bdp/ARID3B, of the ARID (AT-Rich Interaction Domain) transcription family are distinguished by their ability to specifically bind to DNA and to self-associate via a second domain, REKLES. Bright and Bdp positively regulate immunoglobulin heavy chain gene (IgH) transcription by binding to AT-rich motifs within Matrix Associating Regions (MARs) residing within a subset of VH promoters and the Eµ intronic enhancer. In addition, REKLES provides Bright nuclear export function, and a small pool of Bright is directed to plasma membrane sub-domains/lipid rafts where it associates with and modulates signaling of the B cell antigen receptor (BCR). Here, we characterize a third, highly conserved, physically condensed ARID3 locus, Brightlike/ARID3C. Brightlike encodes two alternatively spliced, SUMO-I-modified isoforms that include or exclude (Δ6) the REKLES-encoding exon 6. Brightlike transcripts and proteins are expressed preferentially within B lineage lymphocytes and coordinate with highest Bright expression--in activated follicular B cells. Brightlike, but not BrightlikeΔ6, undergoes nuclear-cytoplasmic shuttling with a fraction localizing within lipid rafts following BCR stimulation. Brightlike, but not BrightlikeΔ6, associates with Bright in solution, at common DNA binding sites in vitro, and is enriched at Bright binding sites in chromatin. Although possessing little transactivation capacity of its own, Brightlike significantly co-activates Bright-dependent IgH transcription with maximal activity mediated by the unsumoylated form. In sum, this report introduces Brightlike as an additional functional member of the family of ARID proteins, which should be considered in regulatory circuits, previously ascribed to be mediated by Bright. PMID:21955986

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Space use and habitat selection of migrant and resident American Avocets in San Francisco Bay

USGS Publications Warehouse

Demers, Scott A.; Takekawa, John Y.; Ackerman, Joshua T.; Warnock, N.; Athearn, N.D.

2010-01-01

San Francisco Bay is a wintering area for shorebirds, including American Avocets (Recurvirostra americana). Recently, a new resident population of avocets has emerged, presumably because of the development of tidal marshes into salt-evaporation ponds. In habitat restoration now underway, as many as 90% of salt ponds will be restored to tidal marsh. However, it is unknown if wintering and resident avocets coexist and if their requirements for space and habitat differ, necessitating different management for their populations to be maintained during restoration. We captured and radio-marked wintering avocets at a salt pond and a tidal flat to determine their population status (migrant or resident) and examine their space use and habitat selection. Of the radio-marked avocets, 79% were migrants and 21% were residents. At the salt pond, residents' fidelity to their location of capture was higher, and residents moved less than did migrants from the same site. Conversely, on the tidal flat, fidelity of residents to their site of capture was lower, and residents' home ranges were larger than those of migrants from the same site. Habitat selection of migrants and residents differed little; however, capture site influenced habitat selection far more than the birds' status as migrants or residents. Our study suggests that individual avocets have high site fidelity while wintering in San Francisco Bay, although the avocet as a species is plastic in its space use and habitat selection. This plasticity may allow wintering migrant and resident avocets to adapt to habitat change in San Francisco Bay. ?? The Cooper Ornithological Society 2010.

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

Design, Synthesis, and Biological Evaluation of Novel Type I1/2 p38α MAP Kinase Inhibitors with Excellent Selectivity, High Potency, and Prolonged Target Residence Time by Interfering with the R-Spine.

PubMed

Walter, Niklas M; Wentsch, Heike K; Bührmann, Mike; Bauer, Silke M; Döring, Eva; Mayer-Wrangowski, Svenja; Sievers-Engler, Adrian; Willemsen-Seegers, Nicole; Zaman, Guido; Buijsman, Rogier; Lämmerhofer, Michael; Rauh, Daniel; Laufer, Stefan A

2017-10-12

We recently reported 1a (skepinone-L) as a type I p38α MAP kinase inhibitor with high potency and excellent selectivity in vitro and in vivo. However, as a type I inhibitor, it is entirely ATP-competitive and shows just a moderate residence time. Thus, the scope was to develop a new class of advanced compounds maintaining the structural binding features of skepinone-L scaffold like inducing a glycine flip at the hinge region and occupying both hydrophobic regions I and II. Extending this scaffold with suitable residues resulted in an interference with the kinase's R-Spine. By synthesizing 69 compounds, we could significantly prolong the target residence time with one example to 3663 s, along with an excellent selectivity score of 0.006 and an outstanding potency of 1.0 nM. This new binding mode was validated by cocrystallization, showing all binding interactions typifying type I 1 / 2 binding. Moreover, microsomal studies showed convenient metabolic stability of the most potent, herein reported representatives.

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optimized Target Residence Time: Type I1/2 Inhibitors for p38α MAP Kinase with Improved Binding Kinetics through Direct Interaction with the R-Spine.

PubMed

Wentsch, Heike K; Walter, Niklas M; Bührmann, Mike; Mayer-Wrangowski, Svenja; Rauh, Daniel; Zaman, Guido J R; Willemsen-Seegers, Nicole; Buijsman, Rogier C; Henning, Melanie; Dauch, Daniel; Zender, Lars; Laufer, Stefan

2017-05-02

Skepinone-L was recently reported to be a p38α MAP kinase inhibitor with high potency and excellent selectivity in vitro and in vivo. However, this class of compounds still act as fully ATP-competitive Type I binders which, furthermore, suffer from short residence times at the enzyme. We herein describe a further development with the first Type I1/2 binders for p38α MAP kinase. Type I1/2 inhibitors interfere with the R-spine, inducing a glycine flip and occupying both hydrophobic regions I and II. This design approach leads to prolonged target residence time, binding to both the active and inactive states of the kinase, excellent selectivity, excellent potency on the enzyme level, and low nanomolar activity in a human whole blood assay. This promising binding mode is proven by X-ray crystallography. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects on the immune system associated with living near a pesticide dump site.

PubMed Central

Vine, M F; Stein, L; Weigle, K; Schroeder, J; Degnan, D; Tse, C K; Hanchette, C; Backer, L

2000-01-01

In this paper, we report results of the second phase of a larger study designed to evaluate the effects on the immune system of living near a Superfund site containing organochlorine pesticides, volatile organic compounds, and metals. Phase II was conducted to determine whether living near the site, consisting of six locations in Aberdeen, North Carolina, is associated with higher plasma organochlorine levels, immune suppression, or DNA damage. Each of 302 residents of Aberdeen and neighboring communities provided a blood specimen, underwent a skin test, and answered a questionnaire. Blood specimens were analyzed for organochlorine pesticides, immune markers, and micronuclei. Of 20 organochlorines tested, only DDE was detected in the blood of participants (except for one individual). Age-adjusted mean plasma DDE levels were 4.05 ppb for Aberdeen residents and 2.95 ppb (p = 0.01) for residents of neighboring communities. Residents of 40-59 years of age who lived within a mile of any site, but particularly the Farm Chemicals site, had higher plasma DDE levels than residents who lived farther away. Residents who lived near the Farm Chemicals site before versus after 1985 also had higher plasma DDE levels. Overall, there were few differences in immune markers between residents of Aberdeen and the neighboring communities. However, residents who lived closer to the dump sites had statistically significantly lower mitogen-induced lymphoproliferative activity than residents who lived farther away (p < 0.05). Residential location was not consistently associated with frequency of micronuclei or skin test responses. Although some statistically significant differences in immune markers were noted in association with residential location, the magnitude of effects are of uncertain clinical importance. PMID:11133390

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Home Care Services as Teaching Sites for Geriatrics in Family Medicine Residencies.

ERIC Educational Resources Information Center

Laguillo, Edgardo

1988-01-01

A national survey of family medicine programs and residency training in geriatrics found almost half using home care services as teaching sites. In the program design preferred by residents, the resident followed the patient long-term and discussed management with a multidisciplinary team. An alternative combined rotation is discussed. (Author/MSE)

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

View from west to east of PAR site resident engineer's ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

View from west to east of PAR site resident engineer's office building (REOB) - Stanley R. Mickelsen Safeguard Complex, Resident Engineers Office Building, Southeast of intersection of PAR Access Road & Fourth Avenue, Nekoma, Cavalier County, ND

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

1987-11-01

Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Elucidation of Motifs in Ribosomal Protein S9 That Mediate Its Nucleolar Localization and Binding to NPM1/Nucleophosmin

PubMed Central

Lindström, Mikael S.

2012-01-01

Biogenesis of eukaryotic ribosomes occurs mainly in a specific subnuclear compartment, the nucleolus, and involves the coordinated assembly of ribosomal RNA and ribosomal proteins. Identification of amino acid sequences mediating nucleolar localization of ribosomal proteins may provide important clues to understand the early steps in ribosome biogenesis. Human ribosomal protein S9 (RPS9), known in prokaryotes as RPS4, plays a critical role in ribosome biogenesis and directly binds to ribosomal RNA. RPS9 is targeted to the nucleolus but the regions in the protein that determine its localization remains unknown. Cellular expression of RPS9 deletion mutants revealed that it has three regions capable of driving nuclear localization of a fused enhanced green fluorescent protein (EGFP). The first region was mapped to the RPS9 N-terminus while the second one was located in the proteins C-terminus. The central and third region in RPS9 also behaved as a strong nucleolar localization signal and was hence sufficient to cause accumulation of EGFP in the nucleolus. RPS9 was previously shown to interact with the abundant nucleolar chaperone NPM1 (nucleophosmin). Evaluating different RPS9 fragments for their ability to bind NPM1 indicated that there are two binding sites for NPM1 on RPS9. Enforced expression of NPM1 resulted in nucleolar accumulation of a predominantly nucleoplasmic RPS9 mutant. Moreover, it was found that expression of a subset of RPS9 deletion mutants resulted in altered nucleolar morphology as evidenced by changes in the localization patterns of NPM1, fibrillarin and the silver stained nucleolar organizer regions. In conclusion, RPS9 has three regions that each are competent for nuclear localization, but only the central region acted as a potent nucleolar localization signal. Interestingly, the RPS9 nucleolar localization signal is residing in a highly conserved domain corresponding to a ribosomal RNA binding site. PMID:23285058

Molecular principles behind Boceprevir resistance due to mutations in hepatitis C NS3/4A protease.

PubMed

Nagpal, Neha; Goyal, Sukriti; Wahi, Divya; Jain, Ritu; Jamal, Salma; Singh, Aditi; Rana, Preeti; Grover, Abhinav

2015-10-01

The hepatitis C virus (HCV) infection is a primary cause of chronic hepatitis which eventually progresses to cirrhosis and in some instances might advance to hepatocellular carcinoma. According to the WHO report, HCV infects 130-150 million people globally and every year 350,000 to 500,000 people die from hepatitis C virus infection. Great achievement has been made in viral treatment evolution, after the development of HCV NS3/4A protease inhibitor (Boceprevir). However, efficacy of Boceprevir is compromised by the emergence of drug resistant variants. The molecular principle behind drug resistance of the protease mutants such as (V36M, T54S and R155K) is still poorly understood. Therefore in this study, we employed a series of computational strategies to analyze the binding of antiviral drug, Boceprevir to HCV NS3/4A protease mutants. Our results clearly demonstrate that the point mutations (V36M, T54S and R155K) in protease are associated with lowering of its binding affinity with Boceprevir. Exhaustive analysis of the simulated Boceprevir-bound wild and mutant complexes revealed variations in hydrophobic interactions, hydrogen bond occupancy and salt bridge interactions. Also, substrate envelope analysis scrutinized that the studied mutations reside outside the substrate envelope which may affect the Boceprevir affinity towards HCV protease but not the protease enzymatic activity. Furthermore, structural analyses of the binding site volume and flexibility show impairment in flexibility and stability of the binding site residues in mutant structures. In order to combat Boceprevir resistance, renovation of binding interactions between the drug and protease may be valuable. The structural insight from this study reveals the mechanism of the Boceprevir resistance and the results can be valuable for the design of new PIs with improved efficiency. Copyright © 2015 Elsevier B.V. All rights reserved.

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

Functional domains of the poliovirus receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Satoshi; Ise, Iku; Nomoto, Akio

1991-05-15

A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

Ligand Residence Time at G-protein-Coupled Receptors-Why We Should Take Our Time To Study It.

PubMed

Hoffmann, C; Castro, M; Rinken, A; Leurs, R; Hill, S J; Vischer, H F

2015-09-01

Over the past decade the kinetics of ligand binding to a receptor have received increasing interest. The concept of drug-target residence time is becoming an invaluable parameter for drug optimization. It holds great promise for drug development, and its optimization is thought to reduce off-target effects. The success of long-acting drugs like tiotropium support this hypothesis. Nonetheless, we know surprisingly little about the dynamics and the molecular detail of the drug binding process. Because protein dynamics and adaptation during the binding event will change the conformation of the protein, ligand binding will not be the static process that is often described. This can cause problems because simple mathematical models often fail to adequately describe the dynamics of the binding process. In this minireview we will discuss the current situation with an emphasis on G-protein-coupled receptors. These are important membrane protein drug targets that undergo conformational changes upon agonist binding to communicate signaling information across the plasma membrane of cells. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Site fidelity, territory fidelity, and natal philopatry in Willow Flycatchers (Empidonax traillii)

USGS Publications Warehouse

Sedgwick, James A.

2004-01-01

I investigated the causes and consequences of adult breeding-site fidelity, territory fidelity, and natal philopatry in Willow Flycatchers (Empidonax traillii) in southeastern Oregon over a 10-year period, testing the general hypothesis that fidelity and dispersal distances are influenced by previous breeding performance. Willow Flycatchers adhered to the generally observed tendencies of passerine birds for low natal philopatry and high breedingsite fidelity. Site fidelity (return to the study area) of adult males (52.0%) and females (51.3%), and median dispersal distances between seasons (16 m vs. 19 m) were similar. Previous breeding performance and residency (age-experience), but not study-site quality, explained site fidelity in females. Site fidelity of females rearing 4–5 young (64.4%) exceeded that of unsuccessful females (40.0%), breeding dispersal was less (successful: 15 m; unsuccessful: 33 m), and novice residents were more site-faithful than former residents. Probability of site fidelity was higher for previously successful females (odds ratio = 4.76), those with greater seasonal fecundity (odds ratio = 1.58), novice residents (odds ratio = 1.41), and unparasitized females (odds ratio = 2.76). Male site fidelity was not related to residency, site quality, or previous breeding performance. Territory fidelity (return to the previous territory) in females was best explained by previous breeding performance, but not by site quality or residency. Previously successful females were more likely to return to their territory of the previous season than either unsuccessful (odds ratio = 14.35) or parasitized birds (odds ratio = 6.38). Male territory fidelity was not related to residency, site quality, or previous breeding performance. Natal philopatry was low (7.8%) and similar for males and females. Site quality appeared to influence philopatry, given that no birds reared at a low-quality study site returned there to breed, and birds reared there dispersed farther than birds reared at two other study sites. My results partially support the hypothesis that site fidelity is an adaptive response: (1) previously successful females that switched territories underperformed those that did not switch (P = 0.01); and (2) previously unsuccessful females that switched territories outperformed those that did not switch, but not significantly (P = 0.22).

Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

NASA Astrophysics Data System (ADS)

Schwartz, Rochelle D.; Kellar, Kenneth J.

1983-04-01

Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

Substance P binding sites in the nucleus tractus solitarius of the cat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, B.E.; Sasek, C.A.; Seybold, V.S.

1988-11-01

Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

PubMed

Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

2018-06-16

Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

PubMed Central

Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

2008-01-01

Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

[The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

PubMed

Kawasaki, Kazuyoshi; Ogawa, Seturou

2003-01-01

NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

Intrinsic disorder in scaffold proteins: Getting more from less

PubMed Central

Cortese, Marc S.; Uversky, Vladimir N.; Dunker, A. Keith

2008-01-01

Regulation, recognition and cell signaling involve the coordinated actions of many players. Signaling scaffolds, with their ability to bring together proteins belonging to common and/or interlinked pathways, play crucial roles in orchestrating numerous events by coordinating specific interactions among signaling proteins. This review examines the roles of intrinsic disorder (ID) in signaling scaffold protein function. Several well-characterized scaffold proteins with structurally and functionally characterized ID regions are used here to illustrate the importance of ID for scaffolding function. These examples include scaffolds that are mostly disordered, only partially disordered or those in which the ID resides in a scaffold partner. Specific scaffolds discussed include RNase, voltage-activated potassium channels, axin, BRCA1, GSK-3β, p53, Ste5, titin, Fus3, BRCA1, Titin, MAP2, D-AKAP2 and AKAP250. Among the mechanisms discussed are: molecular recognition features, fly-casting, ease of encounter complex formation, structural isolation of partners, modulation of interactions between bound partners, masking of intramolecular interaction sites, maximized interaction surface per residue, toleration of high evolutionary rates, binding site overlap, allosteric modification, palindromic binding, reduced constraints for alternative splicing, efficient regulation via posttranslational modification, efficient regulation via rapid degradation, protection of normally solvent-exposed sites, enhancing the plasticity of interaction and molecular crowding. We conclude that ID can enhance scaffold function by a diverse array of mechanisms. In other words, scaffold proteins utilize several ID-facilitated mechanisms to enhance function, and by doing so, get more functionality from less structure. PMID:18619997

Emergency preparedness among people living near US army chemical weapons sites after September 11, 2001.

PubMed

Williams, Bryan L; Magsumbol, Melina S

2007-09-01

We examined trust in the army and perceptions of emergency preparedness among residents living near the Anniston, Ala, and Richmond, Ky, US Army chemical weapons stockpile sites shortly after September 11, 2001. Residents (n = 655) living near the 2 sites who participated in a cross-sectional population were relatively unprepared in the event of a chemical emergency. The events of September 11 gave rise to concerns regarding the security of stored chemical weapons and the sites' vulnerability to terrorist attacks. Although residents expressed trust in the army to manage chemical weapons safely, only a few expressed a desire to actively participate in site decisions. Compliance with procedures during emergencies could be seriously limited, putting residents in these sites at higher levels of risk of exposure to chemical hazards than nonresidents.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Do medical residents perform patient-centered medical home tasks? A mixed-methods study

PubMed Central

Block, Lauren; LaVine, Nancy; Verbsky, Jennifer; Sagar, Ankita; Smith, Miriam A.; Lane, Susan; Conigliaro, Joseph; Chaudhry, Saima A.

2017-01-01

ABSTRACT Background: Increasingly, residents are being trained in Patient-centered Medical Home (PCMH) settings. A set of PCMH entrustable professional activities (EPAs) for residents has been defined but not evaluated in practice. Objective: To understand whether residents trained at PCMH sites reported higher likelihood of engaging in PCMH tasks than those training in non-PCMH sites. Design: Survey and nominal group data from post-graduate trainees at three residency programs. Results: A total of 179 residents responded (80% response). Over half (52%) cared for patients at PCMH sites. Residents at PCMH sites were more likely to report engaging in tasks in the NCQA domains of enhancing access and continuity (p < 0.01 for 4/11 tasks), planning and managing care (p < 0.01 for 3/4 tasks), providing self-care and community support (p < 0.01 for 3/5 tasks), and identifying and managing patient populations (p < 0.01 for 1/6 tasks), but were not more likely to report tracking and coordinating care or measuring and improving performance. Residents at PCMH sites were more likely to report working with medical assistants (p < 0.01), but not other healthcare professionals. Qualitative data showed staff teamwork and continuity of care as facilitators of patient-centered care, and technological problems and office inefficiencies as barriers to care. Conclusions: Residents trained at PCMH sites were more likely to engage in tasks in several NCQA domains, but not care coordination and quality assessment. Similar facilitators and barriers to trainee provision of patient-centered care were cited regardless of PCMH status. Curricula on PCMH principles and workflows that foster continuity and communication may help to inform residents on PCMH tenets and incorporate residents into team-based care. Abbreviations: EPA: Entrustable professional activity; GIM: General Internal Medicine; NCQA: National Center for Quality Assurance; PCMH: Patient-centered medical home PMID:28758564

Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

PubMed

Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

2015-10-01

Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

Changes at the nuclear lamina alter binding of pioneer factor Foxa2 in aged liver.

PubMed

Whitton, Holly; Singh, Larry N; Patrick, Marissa A; Price, Andrew J; Osorio, Fernando G; López-Otín, Carlos; Bochkis, Irina M

2018-06-01

Increasing evidence suggests that regulation of heterochromatin at the nuclear envelope underlies metabolic disease susceptibility and age-dependent metabolic changes, but the mechanism is unknown. Here, we profile lamina-associated domains (LADs) using lamin B1 ChIP-Seq in young and old hepatocytes and find that, although lamin B1 resides at a large fraction of domains at both ages, a third of lamin B1-associated regions are bound exclusively at each age in vivo. Regions occupied by lamin B1 solely in young livers are enriched for the forkhead motif, bound by Foxa pioneer factors. We also show that Foxa2 binds more sites in Zmpste24 mutant mice, a progeroid laminopathy model, similar to increased Foxa2 occupancy in old livers. Aged and Zmpste24-deficient livers share several features, including nuclear lamina abnormalities, increased Foxa2 binding, de-repression of PPAR- and LXR-dependent gene expression, and fatty liver. In old livers, additional Foxa2 binding is correlated to loss of lamin B1 and heterochromatin (H3K9me3 occupancy) at these loci. Our observations suggest that changes at the nuclear lamina are linked to altered Foxa2 binding, enabling opening of chromatin and de-repression of genes encoding lipid synthesis and storage targets that contribute to etiology of hepatic steatosis. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poat, J.A.; Cripps, H.E.; Iversen, L.L.

1988-05-01

Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCann, D.J.; Su, T.P.

1991-05-01

The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

PubMed

Suzuki, N; Mihashi, K

1991-01-01

The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

ECHO-AGE: an innovative model of geriatric care for long-term care residents with dementia and behavioral issues.

PubMed

Catic, Angela G; Mattison, Melissa L P; Bakaev, Innokentiy; Morgan, Marisa; Monti, Sara M; Lipsitz, Lewis

2014-12-01

To design, implement, and assess the pilot phase of an innovative, remote case-based video-consultation program called ECHO-AGE that links experts in the management of behavior disorders in patients with dementia to nursing home care providers. Pilot study involving surveying of participating long-term care sites regarding utility of recommendations and resident outcomes. Eleven long-term care sites in Massachusetts and Maine. An interprofessional specialty team at a tertiary care center and staff from 11 long-term care sites. Long-term care sites presented challenging cases regarding residents with dementia and/or delirium related behavioral issues to specialists via video-conferencing. Baseline resident characteristics and follow-up data regarding compliance with ECHO-AGE recommendations, resident improvement, hospitalization, and mortality were collected from the long-term care sites. Forty-seven residents, with a mean age of 82 years, were presented during the ECHO-AGE pilot period. Eighty-three percent of residents had a history of dementia and 44% were taking antipsychotic medications. The most common reasons for presentation were agitation, intrusiveness, and paranoia. Behavioral plans were recommended in 72.3% of patients. Suggestions for medication adjustments were also frequent. ECHO-AGE recommendations were completely or partially followed in 88.6% of residents. When recommendations were followed, sites were much more likely to report clinical improvement (74% vs 20%, P < .03). Hospitalization was also less common among residents for whom recommendations were followed. The results suggest that a case-based video-consultation program can be successful in improving the care of elders with dementia and/or delirium related behavioral issues by linking specialists with long-term care providers. Published by Elsevier Inc.

Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luthin, G.R.; Wolfe, B.B.

The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Mechanistic insights into phosphoprotein-binding FHA domains.

PubMed

Liang, Xiangyang; Van Doren, Steven R

2008-08-01

[Structure: see text]. FHA domains are protein modules that switch signals in diverse biological pathways by monitoring the phosphorylation of threonine residues of target proteins. As part of the effort to gain insight into cellular avoidance of cancer, FHA domains involved in the cellular response to DNA damage have been especially well-characterized. The complete protein where the FHA domain resides and the interaction partners determine the nature of the signaling. Thus, a key biochemical question is how do FHA domains pick out their partners from among thousands of alternatives in the cell? This Account discusses the structure, affinity, and specificity of FHA domains and the formation of their functional structure. Although FHA domains share sequence identity at only five loop residues, they all fold into a beta-sandwich of two beta-sheets. The conserved arginine and serine of the recognition loops recognize the phosphorylation of the threonine targeted. Side chains emanating from loops that join beta-strand 4 with 5, 6 with 7, or 10 with 11 make specific contacts with amino acids of the ligand that tailor sequence preferences. Many FHA domains choose a partner in extended conformation, somewhat according to the residue three after the phosphothreonine in sequence (pT + 3 position). One group of FHA domains chooses a short carboxylate-containing side chain at pT + 3. Another group chooses a long, branched aliphatic side chain. A third group prefers other hydrophobic or uncharged polar side chains at pT + 3. However, another FHA domain instead chooses on the basis of pT - 2, pT - 3, and pT + 1 positions. An FHA domain from a marker of human cancer instead chooses a much longer protein fragment that adds a beta-strand to its beta-sheet and that presents hydrophobic residues from a novel helix to the usual recognition surface. This novel recognition site and more remote sites for the binding of other types of protein partners were predicted for the entire family of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Ethylene binding site affinity in ripening apples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, S.M.; Sisler, E.C.

1993-09-01

Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

On the interaction mechanisms of a p53 peptide and nutlin with the MDM2 and MDMX proteins: a Brownian dynamics study.

PubMed

ElSawy, Karim M; Verma, Chandra S; Joseph, Thomas L; Lane, David P; Twarock, Reidun; Caves, Leo S D

2013-02-01

The interaction of p53 with its regulators MDM2 and MDMX plays a major role in regulating the cell cycle. Inhibition of this interaction has become an important therapeutic strategy in oncology. Although MDM2 and MDMX share a very high degree of sequence/structural similarity, the small-molecule inhibitor nutlin appears to be an efficient inhibitor only of the p53-MDM2 interaction. Here, we investigate the mechanism of interaction of nutlin with these two proteins and contrast it with that of p53 using Brownian dynamics simulations. In contrast to earlier attempts to examine the bound states of the partners, here we locate initial reaction events in these interactions by identifying the regions of space around MDM2/MDMX, where p53/nutlin experience associative encounters with prolonged residence times relative to that in bulk solution. We find that the initial interaction of p53 with MDM2 is long-lived relative to nutlin, but, unlike nutlin, it takes place at the N- and C termini of the MDM2 protein, away from the binding site, suggestive of an allosteric mechanism of action. In contrast, nutlin initially interacts with MDM2 directly at the clefts of the binding site. The interaction of nutlin with MDMX, however, is very short-lived compared with MDM2 and does not show such direct initial interactions with the binding site. Comparison of the topology of the electrostatic potentials of MDM2 and MDMX and the locations of the initial encounters with p53/nutlin in tandem with structure-based sequence alignment revealed that the origin of the diminished activity of nutlin toward MDMX relative to MDM2 may stem partly from the differing topologies of the electrostatic potentials of the two proteins. Glu25 and Lys51 residues underpin these topological differences and appear to collectively play a key role in channelling nutlin directly toward the binding site on the MDM2 surface and are absent in MDMX. The results, therefore, provide new insight into the mechanism of p53/nutlin interactions with MDM2 and MDMX and could potentially have a broader impact on anticancer drug optimization strategies.

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

Golgi enzymes do not cycle through the endoplasmic reticulum during protein secretion or mitosis

PubMed Central

Villeneuve, Julien; Duran, Juan; Scarpa, Margherita; Bassaganyas, Laia; Van Galen, Josse; Malhotra, Vivek

2017-01-01

Golgi-specific sialyltransferase (ST) expressed as a chimera with the rapamycin-binding domain of mTOR, FRB, relocates to the endoplasmic reticulum (ER) in cells exposed to rapamycin that also express invariant chain (Ii)-FKBP in the ER. This result has been taken to indicate that Golgi-resident enzymes cycle to the ER constitutively. We show that ST-FRB is trapped in the ER even without Ii-FKBP upon rapamycin addition. This is because ER-Golgi–cycling FKBP proteins contain a C-terminal KDEL-like sequence, bind ST-FRB in the Golgi, and are transported together back to the ER by KDEL receptor–mediated retrograde transport. Moreover, depletion of KDEL receptor prevents trapping of ST-FRB in the ER by rapamycin. Thus ST-FRB cycles artificially by binding to FKBP domain–containing proteins. In addition, Golgi-specific O-linked glycosylation of a resident ER protein occurs only upon artificial fusion of Golgi membranes with ER. Together these findings support the consensus view that there is no appreciable mixing of Golgi-resident enzymes with ER under normal conditions. PMID:27807044

Autoradiographic localization of endothelin-1 binding sites in porcine skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Y.D.; Springall, D.R.; Wharton, J.

Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Global opportunities on 239 general surgery residency Web sites.

PubMed

Wackerbarth, Joel J; Campbell, Timothy D; Wren, Sherry; Price, Raymond R; Maier, Ronald V; Numann, Patricia; Kushner, Adam L

2015-09-01

Many general surgical residency programs lack a formal international component. We hypothesized that most surgery programs do not have international training or do not provide the information to prospective applicants regarding electives or programs in an easily accessible manner via Web-based resources. Individual general surgery program Web sites and the American College of Surgeons residency tool were used to identify 239 residencies. The homepages were examined for specific mention of international or global health programs. Ease of access was also considered. Global surgery specific pages or centers were noted. Programs were assessed for length of rotation, presence of research component, and mention of benefits to residents and respective institution. Of 239 programs, 24 (10%) mentioned international experiences on their home page and 42 (18%) contained information about global surgery. Of those with information available, 69% were easily accessible. Academic programs were more likely than independent programs to have information about international opportunities on their home page (13.7% versus 4.0%, P = 0.006) and more likely to have a dedicated program or pathway Web site (18.8% versus 2.0%, P < 0.0001). Half of the residencies with global surgery information did not have length of rotation available. Research was only mentioned by 29% of the Web sites. Benefits to high-income country residents were discussed more than benefits to low- and middle-income country residents (57% versus 17%). General surgery residency programs do not effectively communicate international opportunities for prospective residents through Web-based resources and should seriously consider integrating international options into their curriculum and better present them on department Web sites. Copyright © 2015 Elsevier Inc. All rights reserved.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

General surgery residency program websites: usefulness and usability for resident applicants.

PubMed

Reilly, Eugene F; Leibrandt, Thomas J; Zonno, Alan J; Simpson, Mary Christina; Morris, Jon B

2004-01-01

To assess the content of general surgery residency program websites, the websites' potential as tools in resident recruitment, and their "usability." The homepages of general surgery residency programs were evaluated for accessibility, ease-of-use, adherence to established principles of website design, and content. Investigators completed a questionnaire on aspects of their online search, including number of mouse-clicks used, number of errors encountered, and number of returns to the residency homepage. The World Wide Web listings on the Fellowship and Residency Electronic Interactive Database (FREIDA) of the American Medical Association (AMA). A total of 251 ACGME-accredited general surgery residency programs. One hundred sixty-seven programs (67%) provided a viable link to the program's website. Evaluators found an average of 5.9 of 16 content items; 2 (1.2%) websites provided as many as 12 content items. Five of the 16 content items (program description, conference schedules, listing of faculty, caseload, and salary) were found on more than half of the sites. An average of 24 mouse-clicks was required to complete the questionnaire for each site. Forty-six sites (28%) generated at least 1 error during our search. The residency homepage was revisited an average of 5 times during each search. On average, programs adhered to 6 of the 10 design principles; only 6 (3.6%) sites adhered to all 10 design principles. Two of the 10 design principles (use of familiar fonts, absence of frames) were adhered to in more than half of the sites. Our overall success rate when searching residency websites was 38%. General surgery residency programs do not use the World Wide Web optimally, particularly for users who are potential residency candidates. The usability of these websites could be increased by providing relevant content, making that content easier to find, and adhering to established web design principles.

Cancer in relation to socioeconomic status: stage at diagnosis in Texas, 2004-2008.

PubMed

Risser, David R; Miller, Eric A

2012-10-01

To determine whether stage of cancer diagnosis was associated with the socioeconomic status (SES) of the census tract where the patient resides, and to assess whether this is modified by race, ethnicity, or urban/rural residence, other factors known to affect cancer diagnosis stage. Using 2004-2008 data from the Texas Cancer Registry, we examined the distribution of stage at diagnosis in Texas residents for 15 cancer sites by the SES of the census tract of residence. Stage at diagnosis was categorized into the summary stage categories of early (in situ [preinvasive disease] and localized) and late stage (regional and distant spread). Age-adjusted odds ratios for late-stage versus early-stage cancer diagnosis in low versus high SES census tracts were evaluated by cancer site, race, ethnicity, and urban versus rural residence. For most cancer sites, late-stage cancer diagnosis increased with decreasing SES. These findings were consistent by cancer site, race, ethnicity, and in urban and rural areas of the state. For most cancer sites, particularly those likely to have patients diagnosed early by screening, late-stage cancer diagnosis is increased in Texas populations residing in lower SES census tracts compared with higher SES census tracts.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

PubMed

Jiang, Peng; Singh, Mona; Coller, Hilary A

2013-01-01

Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

Emergency Preparedness Among People Living Near US Army Chemical Weapons Sites After September 11, 2001

PubMed Central

Williams, Bryan L.; Magsumbol, Melina S.

2007-01-01

We examined trust in the army and perceptions of emergency preparedness among residents living near the Anniston, Ala, and Richmond, Ky, US Army chemical weapons stockpile sites shortly after September 11, 2001. Residents (n = 655) living near the 2 sites who participated in a cross-sectional population were relatively unprepared in the event of a chemical emergency. The events of September 11 gave rise to concerns regarding the security of stored chemical weapons and the sites’ vulnerability to terrorist attacks. Although residents expressed trust in the army to manage chemical weapons safely, only a few expressed a desire to actively participate in site decisions. Compliance with procedures during emergencies could be seriously limited, putting residents in these sites at higher levels of risk of exposure to chemical hazards than nonresidents. PMID:17666684

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Unusual conformation of the SxN motif in the crystal structure of penicillin-binding protein A from Mycobacterium tuberculosis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fedarovich, Alena; Nicholas, Robert A.; Davies, Christopher

PBPA from Mycobacterium tuberculosis is a class B-like penicillin-binding protein (PBP) that is not essential for cell growth in M. tuberculosis, but is important for proper cell division in Mycobacterium smegmatis. We have determined the crystal structure of PBPA at 2.05 {angstrom} resolution, the first published structure of a PBP from this important pathogen. Compared to other PBPs, PBPA has a relatively small N-terminal domain, and conservation of a cluster of charged residues within this domain suggests that PBPA is more related to class B PBPs than previously inferred from sequence analysis. The C-terminal domain is a typical transpeptidase foldmore » and contains the three conserved active-site motifs characterisitic of penicillin-interacting enzymes. While the arrangement of the SxxK and KTG motifs is similar to that observed in other PBPs, the SxN motif is markedly displaced away from the active site, such that its serine (Ser281) is not involved in hydrogen bonding with residues of the other two motifs. A disulfide bridge between Cys282 (the 'x' of the SxN motif) and Cys266, which resides on an adjacent loop, may be responsible for this unusual conformation. Another interesting feature of the structure is a relatively long connection between {beta}5 and {alpha}11, which restricts the space available in the active site of PBPA and suggests that conformational changes would be required to accommodate peptide substrate or {beta}-lactam antibiotics during acylation. Finally, the structure shows that one of the two threonines postulated to be targets for phosphorylation is inaccessible (Thr362), whereas the other (Thr437) is well placed on a surface loop near the active site.« less

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Location of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

Locations of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

Discovering amino acid patterns on binding sites in protein complexes

PubMed Central

Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

2011-01-01

Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegon, A.; Rainbow, T.C.

1983-05-01

The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Quantitative determination of cesium binding to ferric hexacyanoferrate: Prussian blue.

PubMed

Faustino, Patrick J; Yang, Yongsheng; Progar, Joseph J; Brownell, Charles R; Sadrieh, Nakissa; May, Joan C; Leutzinger, Eldon; Place, David A; Duffy, Eric P; Houn, Florence; Loewke, Sally A; Mecozzi, Vincent J; Ellison, Christopher D; Khan, Mansoor A; Hussain, Ajaz S; Lyon, Robbe C

2008-05-12

Ferric hexacyanoferrate (Fe4III[FeII(CN)6]3), also known as insoluble Prussian blue (PB) is the active pharmaceutical ingredient (API) of the drug product, Radiogardase. Radiogardase is the first FDA approved medical countermeasure for the treatment of internal contamination with radioactive cesium (Cs) or thallium in the event of a major radiological incident such as a "dirty bomb". A number of pre-clinical and clinical studies have evaluated the use of PB as an investigational decorporation agent to enhance the excretion of metal cations. There are few sources of published in vitro data that detail the binding capacity of cesium to insoluble PB under various chemical and physical conditions. The study objective was to determine the in vitro binding capacity of PB APIs and drug products by evaluating certain chemical and physical factors such as medium pH, particle size, and storage conditions (temperature). In vitro experimental conditions ranged from pH 1 to 9, to cover the range of pH levels that PB may encounter in the gastrointestinal (GI) tract in humans. Measurements of cesium binding were made between 1 and 24h, to cover gastric and intestinal tract residence time using a validated atomic emission spectroscopy (AES) method. The results indicated that pH, exposure time, storage temperature (affecting moisture content) and particle size play significant roles in the cesium binding to both the PB API and the drug product. The lowest cesium binding was observed at gastric pH of 1 and 2, whereas the highest cesium binding was observed at physiological pH of 7.5. It was observed that dry storage conditions resulted in a loss of moisture from PB, which had a significant negative effect on the PB cesium binding capacity at time intervals consistent with gastric residence. Differences were also observed in the binding capacity of PB with different particle sizes. Significant batch to batch differences were also observed in the binding capacity of some PB API and drug products. Our results suggest that certain physiochemical properties affect the initial binding capacity and the overall binding capacity of PB APIs and drug products during conditions that simulated gastric and GI residence time. These physiochemical properties can be utilized as quality attributes to monitor and predict drug product quality under certain manufacturing and storage conditions and may be utilized to enhance the clinical efficacy of PB.

Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palacios, J.M.; Chinaglia, G.; Rigo, M.

1991-02-01

Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

PubMed

Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

2014-01-01

We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

PubMed

Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

1996-10-11

In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

PubMed Central

2011-01-01

Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

PubMed

Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

2016-11-01

Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

PubMed

Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

1986-08-15

The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

PubMed

Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

2017-04-01

BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

Target engagement and drug residence time can be observed in living cells with BRET

PubMed Central

Robers, Matthew B.; Dart, Melanie L.; Woodroofe, Carolyn C.; Zimprich, Chad A.; Kirkland, Thomas A.; Machleidt, Thomas; Kupcho, Kevin R.; Levin, Sergiy; Hartnett, James R.; Zimmerman, Kristopher; Niles, Andrew L.; Ohana, Rachel Friedman; Daniels, Danette L.; Slater, Michael; Wood, Monika G.; Cong, Mei; Cheng, Yi-Qiang; Wood, Keith V.

2015-01-01

The therapeutic action of drugs is predicated on their physical engagement with cellular targets. Here we describe a broadly applicable method using bioluminescence resonance energy transfer (BRET) to reveal the binding characteristics of a drug with selected targets within intact cells. Cell-permeable fluorescent tracers are used in a competitive binding format to quantify drug engagement with the target proteins fused to Nanoluc luciferase. The approach enabled us to profile isozyme-specific engagement and binding kinetics for a panel of histone deacetylase (HDAC) inhibitors. Our analysis was directed particularly to the clinically approved prodrug FK228 (Istodax/Romidepsin) because of its unique and largely unexplained mechanism of sustained intracellular action. Analysis of the binding kinetics by BRET revealed remarkably long intracellular residence times for FK228 at HDAC1, explaining the protracted intracellular behaviour of this prodrug. Our results demonstrate a novel application of BRET for assessing target engagement within the complex milieu of the intracellular environment. PMID:26631872

Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

PubMed

Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

1996-01-04

In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Overwintering strategies of migratory birds: a novel approach for estimating seasonal movement patterns of residents and transients

USGS Publications Warehouse

Ruiz-Gutierrez, Viviana; Kendall, William L.; Saracco, James F.; White, Gary C.

2016-01-01

Our understanding of movement patterns in wildlife populations has played an important role in current ecological knowledge and can inform landscape conservation decisions. Direct measures of movement can be obtained using marked individuals, but this requires tracking individuals across a landscape or multiple sites.We demonstrate how movements can be estimated indirectly using single-site, capture–mark–recapture (CMR) data with a multi-state open robust design with state uncertainty model (MSORD-SU). We treat residence and transience as two phenotypic states of overwintering migrants and use time- and state-dependent probabilities of site entry and persistence as indirect measures of movement. We applied the MSORD-SU to data on eight species of overwintering Neotropical birds collected in 14 countries between 2002 and 2011. In addition to entry and persistence probabilities, we estimated the proportions of residents at a study site and mean residence times.We identified overwintering movement patterns and residence times that contrasted with prior categorizations of territoriality. Most species showed an evidence of residents entering sites at multiple time intervals, with transients tending to enter between peak resident movement times. Persistence and the proportion of residents varied by latitude, but were not always positively correlated for a given species.Synthesis and applications. Our results suggest that migratory songbirds commonly move among habitats during the overwintering period. Substantial proportions of populations appear to be comprised of transient individuals, and residents tend to persist at specific sites for relatively short periods of time. This information on persistence and movement patterns should be explored for specific habitats to guide landscape management on the wintering grounds, such as determining which habitats are conserved or restored as part of certification programmes of tropical agroforestry crops. We suggest that research and conservation efforts on Neotropical migrant songbirds focus on identifying landscape configurations and regional habitat networks that support these diverse overwintering strategies to secure full life cycle conservation.

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, K.A.; LaBarbera, A.R.

1988-11-01

The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

PubMed Central

Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

2013-01-01

Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Computational Optimization and Characterization of Molecularly Imprinted Polymers

NASA Astrophysics Data System (ADS)

Terracina, Jacob J.

Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids.

PubMed

Dittrich, Timothy Mark; Boukhalfa, Hakim; Ware, Stuart Douglas; Reimus, Paul William

2015-10-01

Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater-bentonite-fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L(-1)) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10(-10) M (241)Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (k(f)) of 0.01-0.02 h(-1). Am recoveries in each column were 55-60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h(-1) in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance scales because of the ability of the fracture materials to rapidly strip Am from the bentonite colloids and the apparent lack of a strong binding site that would keep a fraction of the Am strongly-associated with the colloids. Published by Elsevier Ltd.

Estimation of ultrafine particle concentrations at near-highway residences using data from local and central monitors

PubMed Central

Fuller, Christina H.; Brugge, Doug; Williams, Paige; Mittleman, Murray; Durant, John L.; Spengler, John D.

2012-01-01

Ultrafine particles (UFP; aerodynamic diameter < 0.1 micrometers) are a ubiquitous exposure in the urban environment and are elevated near highways. Most epidemiological studies of UFP health effects use central site monitoring data, which may misclassify exposure. Our aims were to: (1) examine the relationship between distant and proximate monitoring sites and their ability to predict hourly UFP concentration measured at residences in an urban community with a major interstate highway and; (2) determine if meteorology and proximity to traffic improve explanatory power. Short-term (1 – 3 weeks) residential monitoring of UFP concentration was conducted at 18 homes. Long-term monitoring was conducted at two near-highway monitoring sites and a central site. We created models of outdoor residential UFP concentration based on concentrations at the near-highway site, at the central site, at both sites together and without fixed sites. UFP concentration at residential sites was more highly correlated with those at a near-highway site than a central site. In regression models of each site alone, a 10% increase in UFP concentration at a near-highway site was associated with a 6% (95% CI: 6%, 7%) increase at residences while a 10% increase in UFP concentration at the central site was associated with a 3% (95% CI: 2%, 3%) increase at residences. A model including both sites showed minimal change in the magnitude of the association between the near-highway site and the residences, but the estimated association with UFP concentration at the central site was substantially attenuated. These associations remained after adjustment for other significant predictors of residential UFP concentration, including distance from highway, wind speed, wind direction, highway traffic volume and precipitation. The use of a central site as an estimate of personal exposure for populations near local emissions of traffic-related air pollutants may result in exposure misclassification. PMID:23645993

Estimation of ultrafine particle concentrations at near-highway residences using data from local and central monitors.

PubMed

Fuller, Christina H; Brugge, Doug; Williams, Paige; Mittleman, Murray; Durant, John L; Spengler, John D

2012-09-01

Ultrafine particles (UFP; aerodynamic diameter < 0.1 micrometers) are a ubiquitous exposure in the urban environment and are elevated near highways. Most epidemiological studies of UFP health effects use central site monitoring data, which may misclassify exposure. Our aims were to: (1) examine the relationship between distant and proximate monitoring sites and their ability to predict hourly UFP concentration measured at residences in an urban community with a major interstate highway and; (2) determine if meteorology and proximity to traffic improve explanatory power. Short-term (1 - 3 weeks) residential monitoring of UFP concentration was conducted at 18 homes. Long-term monitoring was conducted at two near-highway monitoring sites and a central site. We created models of outdoor residential UFP concentration based on concentrations at the near-highway site, at the central site, at both sites together and without fixed sites. UFP concentration at residential sites was more highly correlated with those at a near-highway site than a central site. In regression models of each site alone, a 10% increase in UFP concentration at a near-highway site was associated with a 6% (95% CI: 6%, 7%) increase at residences while a 10% increase in UFP concentration at the central site was associated with a 3% (95% CI: 2%, 3%) increase at residences. A model including both sites showed minimal change in the magnitude of the association between the near-highway site and the residences, but the estimated association with UFP concentration at the central site was substantially attenuated. These associations remained after adjustment for other significant predictors of residential UFP concentration, including distance from highway, wind speed, wind direction, highway traffic volume and precipitation. The use of a central site as an estimate of personal exposure for populations near local emissions of traffic-related air pollutants may result in exposure misclassification.

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

PubMed

Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

2011-05-01

The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Acceleration of Binding Site Comparisons by Graph Partitioning.

PubMed

Krotzky, Timo; Klebe, Gerhard

2015-08-01

The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

CTCF and cohesin regulate chromatin loop stability with distinct dynamics

PubMed Central

Hansen, Anders S; Pustova, Iryna; Cattoglio, Claudia; Tjian, Robert; Darzacq, Xavier

2017-01-01

Folding of mammalian genomes into spatial domains is critical for gene regulation. The insulator protein CTCF and cohesin control domain location by folding domains into loop structures, which are widely thought to be stable. Combining genomic and biochemical approaches we show that CTCF and cohesin co-occupy the same sites and physically interact as a biochemically stable complex. However, using single-molecule imaging we find that CTCF binds chromatin much more dynamically than cohesin (~1–2 min vs. ~22 min residence time). Moreover, after unbinding, CTCF quickly rebinds another cognate site unlike cohesin for which the search process is long (~1 min vs. ~33 min). Thus, CTCF and cohesin form a rapidly exchanging 'dynamic complex' rather than a typical stable complex. Since CTCF and cohesin are required for loop domain formation, our results suggest that chromatin loops are dynamic and frequently break and reform throughout the cell cycle. DOI: http://dx.doi.org/10.7554/eLife.25776.001 PMID:28467304

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

sc-PDB: a 3D-database of ligandable binding sites--10 years on.

PubMed

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

PubMed

Ahmed, Ahmed H; Oswald, Robert E

2010-03-11

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

PubMed Central

Ahmed, Ahmed H.; Oswald, Robert E.

2010-01-01

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

Differing susceptibility to autophagic degradation of two LC3-binding proteins: SQSTM1/p62 and TBC1D25/OATL1.

PubMed

Hirano, Satoshi; Uemura, Takefumi; Annoh, Hiromichi; Fujita, Naonobu; Waguri, Satoshi; Itoh, Takashi; Fukuda, Mitsunori

2016-01-01

MAP1LC3/LC3 (a mammalian ortholog family of yeast Atg8) is a ubiquitin-like protein that is essential for autophagosome formation. LC3 is conjugated to phosphatidylethanolamine on phagophores and ends up distributed both inside and outside the autophagosome membrane. One of the well-known functions of LC3 is as a binding partner for receptor proteins, which target polyubiquitinated organelles and proteins to the phagophore through direct interaction with LC3 in selective autophagy, and their LC3-binding ability is essential for degradation of the polyubiquitinated substances. Although a number of LC3-binding proteins have been identified, it is unknown whether they are substrates of autophagy or how their interaction with LC3 is regulated. We previously showed that one LC3-binding protein, TBC1D25/OATL1, plays an inhibitory role in the maturation step of autophagosomes and that this function depends on its binding to LC3. Interestingly, TBC1D25 seems not to be a substrate of autophagy, despite being present on the phagophore. In this study we investigated the molecular basis for the escape of TBC1D25 from autophagic degradation by performing a chimeric analysis between TBC1D25 and SQSTM1/p62 (sequestosome 1), and the results showed that mutant TBC1D25 with an intact LC3-binding site can become an autophagic substrate when TBC1D25 is forcibly oligomerized. In addition, an ultrastructural analysis showed that TBC1D25 is mainly localized outside autophagosomes, whereas an oligomerized TBC1D25 mutant rather uniformly resides both inside and outside the autophagosomes. Our findings indicate that oligomerization is a key factor in the degradation of LC3-binding proteins and suggest that lack of oligomerization ability of TBC1D25 results in its asymmetric localization at the outer autophagosome membrane.

Identification of the WW domain-interaction sites in the unstructured N-terminal domain of EBV LMP 2A.

PubMed

Seo, Min-Duk; Park, Sung Jean; Kim, Hyun-Jung; Lee, Bong Jin

2007-01-09

Epstein-Barr virus latency is maintained by the latent membrane protein (LMP) 2A, which mimics the B-cell receptor (BCR) and perturbs BCR signaling. The cytoplasmic N-terminal domain of LMP2A is composed of 119 amino acids. The N-terminal domain of LMP2A (LMP2A NTD) contains two PY motifs (PPPPY) that interact with the WW domains of Nedd4 family ubiquitin-protein ligases. Based on our analysis of NMR data, we found that the LMP2A NTD adopts an overall random-coil structure in its native state. However, the region between residues 60 and 90 was relatively ordered, and seemed to form the hydrophobic core of the LMP2A NTD. This region resides between two PY motifs and is important for WW domain binding. Mapping of the residues involved in the interaction between the LMP2A NTD and WW domains was achieved by chemical shift perturbation, by the addition of WW2 and WW3 peptides. Interestingly, the binding of the WW domains mainly occurred in the hydrophobic core of the LMP2A NTD. In addition, we detected a difference in the binding modes of the two PY motifs against the two WW peptides. The binding of the WW3 peptide caused the resonances of five residues (Tyr(60), Glu(61), Asp(62), Trp(65), and Gly(66)) just behind the N-terminal PY motif of the LMP2A NTD to disappear. A similar result was obtained with WW2 binding. However, near the C-terminal PY motif, the chemical shift perturbation caused by WW2 binding was different from that due to WW3 binding, indicating that the residues near the PY motifs are involved in selective binding of WW domains. The present work represents the first structural study of the LMP2A NTD and provides fundamental structural information about its interaction with ubiquitin-protein ligase.

The secondary cell wall polysaccharide of Bacillus anthracis provides the specific binding ligand for the C-terminal cell wall-binding domain of two phage endolysins, PlyL and PlyG

PubMed Central

Ganguly, Jhuma; Low, Lieh Y; Kamal, Nazia; Saile, Elke; Forsberg, L Scott; Gutierrez-Sanchez, Gerardo; Hoffmaster, Alex R; Liddington, Robert; Quinn, Conrad P; Carlson, Russell W; Kannenberg, Elmar L

2013-01-01

Endolysins are bacteriophage enzymes that lyse their bacterial host for phage progeny release. They commonly contain an N-terminal catalytic domain that hydrolyzes bacterial peptidoglycan (PG) and a C-terminal cell wall-binding domain (CBD) that confers enzyme localization to the PG substrate. Two endolysins, phage lysin L (PlyL) and phage lysin G (PlyG), are specific for Bacillus anthracis. To date, the cell wall ligands for their C-terminal CBD have not been identified. We recently described structures for a number of secondary cell wall polysaccharides (SCWPs) from B. anthracis and B. cereus strains. They are covalently bound to the PG and are comprised of a -ManNAc-GlcNAc-HexNAc- backbone with various galactosyl or glucosyl substitutions. Surface plasmon resonance (SPR) showed that the endolysins PlyL and PlyG bind to the SCWP from B. anthracis (SCWPBa) with high affinity (i.e. in the μM range with dissociation constants ranging from 0.81 × 10−6 to 7.51 × 10−6 M). In addition, the PlyL and PlyG SCWPBa binding sites reside with their C-terminal domains. The dissociation constants for the interactions of these endolysins and their derived C-terminal domains with the SCWPBa were in the range reported for other protein–carbohydrate interactions. Our findings show that the SCWPBa is the ligand that confers PlyL and PlyG lysin binding and localization to the PG. PlyL and PlyG also bound the SCWP from B. cereus G9241 with comparable affinities to SCWPBa. No detectable binding was found to the SCWPs from B. cereus ATCC (American Type Culture Collection) 10987 and ATCC 14579, thus demonstrating specificity of lysin binding to SCWPs. PMID:23493680

Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

PubMed

Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

2013-07-01

Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

Evaluation of serum immunoglobulins among individuals living near six Superfund sites.

PubMed

Williamson, Dhelia M; White, Mary C; Poole, Charles; Kleinbaum, David; Vogt, Robert; North, Kari

2006-07-01

Residents living in communities near Superfund sites have expressed concern that releases from these facilities affect their health, including adverse effects on their immune systems. We used data from six cross-sectional studies to evaluate whether people who live near several Superfund sites are more likely to have individual immunoglobulin test results (IgA, IgG, and IgM) below or above the reference range than those who live in comparison areas with no Superfund site. Study participants consisted of target-area residents who lived close to a Superfund site and comparison-area residents who were not located near any Superfund or hazardous waste sites. A consistent modeling strategy was used across studies to assess the magnitude of the relationship between area of residence and immunoglobulin test results, adjusting for potential confounders and effect modifiers. In all study areas, the results suggest that people who live near a Superfund site may have been more likely to have IgA test results above the reference range than comparison areas residents regardless of modeling strategy employed. The effect measures were larger for residents who lived in communities near military bases with groundwater contamination. For all analyses the wide confidence intervals reflect uncertainty in the magnitude of these effects. To adequately address the question of whether the immune system is affected by low-level exposures to hazardous substances, we recommend that more functional immunotoxicity tests be conducted in human populations where individual exposure information is available or when it can be reasonably estimated from environmental exposure measurements.

Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

PubMed

Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

2017-09-14

U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauch, Eva-Maria; Bernard, Steffen M.; La, David

Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

PubMed

Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

2015-11-01

Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

Secretory cargo sorting by Ca2+-dependent Cab45 oligomerization at the trans-Golgi network

PubMed Central

Blank, Birgit; Maiser, Andreas; Emin, Derya; Prescher, Jens; Beck, Gisela; Kienzle, Christine; Bartnik, Kira; Habermann, Bianca; Pakdel, Mehrshad; Leonhardt, Heinrich; Lamb, Don C.

2016-01-01

Sorting and export of transmembrane cargoes and lysosomal hydrolases at the trans-Golgi network (TGN) are well understood. However, elucidation of the mechanism by which secretory cargoes are segregated for their release into the extracellular space remains a challenge. We have previously demonstrated that, in a reaction that requires Ca2+, the soluble TGN-resident protein Cab45 is necessary for the sorting of secretory cargoes at the TGN. Here, we report that Cab45 reversibly assembles into oligomers in the presence of Ca2+. These Cab45 oligomers specifically bind secretory proteins, such as COMP and LyzC, in a Ca2+-dependent manner in vitro. In intact cells, mutation of the Ca2+-binding sites in Cab45 impairs oligomerization, as well as COMP and LyzC sorting. Superresolution microscopy revealed that Cab45 colocalizes with secretory proteins and the TGN Ca2+ pump (SPCA1) in specific TGN microdomains. These findings reveal that Ca2+-dependent changes in Cab45 mediate sorting of specific cargo molecules at the TGN. PMID:27138253

Structural assembly of the signaling competent ERK2–RSK1 heterodimeric protein kinase complex

PubMed Central

Alexa, Anita; Gógl, Gergő; Glatz, Gábor; Garai, Ágnes; Zeke, András; Varga, János; Dudás, Erika; Jeszenői, Norbert; Bodor, Andrea; Hetényi, Csaba; Reményi, Attila

2015-01-01

Mitogen-activated protein kinases (MAPKs) bind and activate their downstream kinase substrates, MAPK-activated protein kinases (MAPKAPKs). Notably, extracellular signal regulated kinase 2 (ERK2) phosphorylates ribosomal S6 kinase 1 (RSK1), which promotes cellular growth. Here, we determined the crystal structure of an RSK1 construct in complex with its activator kinase. The structure captures the kinase–kinase complex in a precatalytic state where the activation loop of the downstream kinase (RSK1) faces the enzyme's (ERK2) catalytic site. Molecular dynamics simulation was used to show how this heterodimer could shift into a signaling-competent state. This structural analysis combined with biochemical and cellular studies on MAPK→MAPKAPK signaling showed that the interaction between the MAPK binding linear motif (residing in a disordered kinase domain extension) and the ERK2 “docking” groove plays the major role in making an encounter complex. This interaction holds kinase domains proximal as they “readjust,” whereas generic kinase domain surface contacts bring them into a catalytically competent state. PMID:25730857

Oligomycin frames a common drug-binding site in the ATP synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

PubMed

Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

2013-01-01

Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

[3H]MK-801 binding sites in post-mortem human frontal cortex.

PubMed

Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

1989-03-29

The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

Discovering transcription factor binding sites in highly repetitive regions of genomes with multi-read analysis of ChIP-Seq data.

PubMed

Chung, Dongjun; Kuan, Pei Fen; Li, Bo; Sanalkumar, Rajendran; Liang, Kun; Bresnick, Emery H; Dewey, Colin; Keleş, Sündüz

2011-07-01

Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip) as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads). This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads). Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

Structure–function analyses of a pertussis-like toxin from pathogenic Escherichia coli reveal a distinct mechanism of inhibition of trimeric G-proteins

PubMed Central

Littler, Dene R.; Ang, Sheng Y.; Moriel, Danilo G.; Kocan, Martina; Kleifeld, Oded; Johnson, Matthew D.; Tran, Mai T.; Paton, Adrienne W.; Paton, James C.; Summers, Roger J.; Schembri, Mark A.; Rossjohn, Jamie; Beddoe, Travis

2017-01-01

Pertussis-like toxins are secreted by several bacterial pathogens during infection. They belong to the AB5 virulence factors, which bind to glycans on host cell membranes for internalization. Host cell recognition and internalization are mediated by toxin B subunits sharing a unique pentameric ring-like assembly. Although the role of pertussis toxin in whooping cough is well-established, pertussis-like toxins produced by other bacteria are less studied, and their mechanisms of action are unclear. Here, we report that some extra-intestinal Escherichia coli pathogens (i.e. those that reside in the gut but can spread to other bodily locations) encode a pertussis-like toxin that inhibits mammalian cell growth in vitro. We found that this protein, EcPlt, is related to toxins produced by both nontyphoidal and typhoidal Salmonella serovars. Pertussis-like toxins are secreted as disulfide-bonded heterohexamers in which the catalytic ADP-ribosyltransferase subunit is activated when exposed to the reducing environment in mammalian cells. We found here that the reduced EcPlt exhibits large structural rearrangements associated with its activation. We noted that inhibitory residues tethered within the NAD+-binding site by an intramolecular disulfide in the oxidized state dissociate upon the reduction and enable loop restructuring to form the nucleotide-binding site. Surprisingly, although pertussis toxin targets a cysteine residue within the α subunit of inhibitory trimeric G-proteins, we observed that activated EcPlt toxin modifies a proximal lysine/asparagine residue instead. In conclusion, our results reveal the molecular mechanism underpinning activation of pertussis-like toxins, and we also identified differences in host target specificity. PMID:28663369

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Electronic collaboration in dermatology resident training through social networking.

PubMed

Meeks, Natalie M; McGuire, April L; Carroll, Bryan T

2017-04-01

The use of online educational resources and professional social networking sites is increasing. The field of dermatology is currently under-utilizing online social networking as a means of professional collaboration and sharing of training materials. In this study, we sought to assess the current structure of and satisfaction with dermatology resident education and gauge interest for a professional social networking site for educational collaboration. Two surveys-one for residents and one for faculty-were electronically distributed via the American Society for Dermatologic Surgery and Association of Professors of Dermatology (APD) listserves. The surveys confirmed that there is interest among dermatology residents and faculty in a dermatology professional networking site with the goal to enhance educational collaboration.

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

Role of Specificity Protein-1 and Activating Protein-2 Transcription Factors in the Regulation of the Gap Junction Protein Beta-2 Gene in the Epididymis of the Rat.

PubMed

Adam, Cécile; Cyr, Daniel G

2016-06-01

In prepubertal rats, connexin 26 (GJB2) is expressed between adjacent columnar cells of the epididymis. At 28 days of age, when columnar cells differentiate into adult epithelial cell types, Gjb2 mRNA levels decrease to barely detectable levels. There is no information on the regulation of GJB2 in the epididymis. The present study characterized regulation of the Gjb2 gene promoter in the epididymis. A single transcription start site at position -3829 bp relative to the ATG was identified. Computational analysis revealed several TFAP2A, SP1, and KLF4 putative binding sites. A 1.5-kb fragment of the Gjb2 promoter was cloned into a vector containing a luciferase reporter gene. Transfection of the construct into immortalized rat caput epididymal (RCE-1) cells indicated that the promoter contained sufficient information to drive expression of the reporter gene. Deletion constructs showed that the basal activity of the promoter resides in the first -230 bp of the transcriptional start site. Two response elements necessary for GJB2 expression were identified: an overlapping TFAP2A/SP1 site (-136 to -126 bp) and an SP1 site (-50 bp). Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assays confirmed that SP1 and TFAP2A were bound to the promoter. ChIP analysis of chromatin from young and pubertal rats indicated that TFAP2A and SP1 binding decreased with age. SP1 and TFAP2A knockdown indicated that SP1 is necessary for Gjb2 expression. DNA methylation did not appear to be involved in the regulation of Gjb2 expression. Results indicate that SP1 and TFAP2A regulate Gjb2 promoter activity during epididymal differentiation in rat. © 2016 by the Society for the Study of Reproduction, Inc.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-03-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed Central

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-01-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

Availability of pediatric rheumatology training in United States pediatric residencies.

PubMed

Mayer, Michelle L; Brogan, Laura; Sandborg, Christy I

2006-12-15

To characterize the availability of pediatric rheumatology training in general pediatric residencies. We surveyed 195 pediatric residency program directors in the US using a combined Web-based and paper-based survey format. The survey asked directors about the availability of an on-site pediatric rheumatologist in their institution, the availability of formal pediatric rheumatology rotations, and the types of physicians involved in teaching curriculum components related to pediatric rheumatology. Survey responses were analyzed using descriptive and bivariate statistics. Of the 195 program directors surveyed, 127 (65%) responded. More than 40% of responding programs did not have a pediatric rheumatologist on site. Programs with on-site pediatric rheumatologists were significantly more likely than those without on-site pediatric rheumatologists to have an on-site pediatric rheumatology rotation available (94% versus 9%; P < 0.001). Although pediatric rheumatologists' involvement in 4 curriculum areas relevant to pediatric rheumatology is nearly universal in programs with on-site pediatric rheumatologists, nearly two-thirds of programs without on-site pediatric rheumatologists rely on internist rheumatologists, general pediatricians, or other physicians to cover these areas. Programs without pediatric rheumatologists on site are less likely to have pediatric rheumatology rotations and are more likely to rely on internist rheumatologists and nonrheumatologists to address rheumatology-related curriculum components. Lack of exposure to pediatric rheumatology during residency may impede general pediatricians' ability to identify and treat children with rheumatic diseases, undermine resident interest in this field, and perpetuate low levels of supply.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

sc-PDB: a 3D-database of ligandable binding sites—10 years on

PubMed Central

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

PubMed

Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

2018-05-29

Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

PubMed Central

Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

2012-01-01

Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

PubMed

Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

2014-01-01

We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

PubMed

Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

2018-03-23

The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

Monitoring SO2emission trends and residents' perceived health risks from PGM smelting at Selous Metallurgical Complex in Zimbabwe.

PubMed

Gwimbi, Patrick

2017-11-16

Persistently high sulphur dioxide (SO 2 ) emissions from platinum group metal (PGM) smelting pose a major threat to communities located around smelters. This paper examined SO 2 emission trends, emission regulations and residents' perceived health risks from exposures to such emissions at Selous Metallurgical Complex (SMC) PGM smelting facility in Zimbabwe. SO 2 data from roof monitoring sites at the smelter furnace were aggregated into annual, quarterly and monthly emission trends from 2008 to 2015. The regulatory regime's ability to protect human health from SO 2 pollution in communities located around the smelter was examined. Questionnaire responses to perceived health risks from SO 2 exposure from 40 purposively sampled residents were assessed. The relationships between SO 2 emission trends and residents' self-reported health risks from exposure to SO 2 emissions were explored using STATA version 11. Descriptive statistics were used to illustrate SO 2 emission trends and residents' self-reported health risks from exposure to SO 2 . Between 2008 and 2015, annual SO 2 emissions increased from 7951 to 2500 tonnes. Emissions exceeded the recommended standard limit of 50 mg/Nm 3 , presenting considerable adverse health risks to local residents. Concerns relating to inefficient environmental impact assessment (EIA) licensing system, poor monitoring and auditing by the environmental management agency, as well as non-deterring SO 2 emission exceedance penalties were identified as major drivers of emission increase. Thirty-two (80%) of the forty respondents perceived exposure to SO 2 emissions as adverse and the cause of their illnesses, with coughing, nasal congestion and shortness of breath the most frequently self-reported symptoms. A set of legally-binding SO 2 emission standards supported by stringent EIA licensing arrangements for smelting industries are suggested for development and enforcement to reduce the SO 2 emission problem. Community participation in SO 2 emissions monitoring is also proposed as a core part of sustainable environmental management in communities located around smelters.

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

PubMed

Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

2006-07-01

High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

How maltose influences structural changes to bind to maltose-binding protein: results from umbrella sampling simulation.

PubMed

Mascarenhas, Nahren Manuel; Kästner, Johannes

2013-02-01

A well-studied periplasmic-binding protein involved in the abstraction of maltose is maltose-binding protein (MBP), which undergoes a ligand-induced conformational transition from an open (ligand-free) to a closed (ligand-bound) state. Umbrella sampling simulations have been us to estimate the free energy of binding of maltose to MBP and to trace the potential of mean force of the unbinding event using the center-of-mass distance between the protein and ligand as the reaction coordinate. The free energy thus obtained compares nicely with the experimentally measured value justifying our theoretical basis. Measurement of the domain angle (N-terminal-domain - hinge - C-terminal-domain) along the unbinding pathway established the existence of three different states. Starting from a closed state, the protein shifts to an open conformation during the initial unbinding event of the ligand then resides in a semi-open conformation and later resides predominantly in an open-state. These transitions along the ligand unbinding pathway have been captured in greater depth using principal component analysis. It is proposed that in mixed-model, both conformational selection and an induced-fit mechanism combine to the ligand recognition process in MBP. Copyright © 2012 Wiley Periodicals, Inc.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannopoulos, G.; Jackson, K.; Kredentser, J.

The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

Structure–kinetic relationship study of CDK8/CycC specific compounds

PubMed Central

Schneider, Elisabeth V.; Böttcher, Jark; Huber, Robert; Maskos, Klaus; Neumann, Lars

2013-01-01

In contrast with the very well explored concept of structure–activity relationship, similar studies are missing for the dependency between binding kinetics and compound structure of a protein ligand complex, the structure–kinetic relationship. Here, we present a structure–kinetic relationship study of the cyclin-dependent kinase 8 (CDK8)/cyclin C (CycC) complex. The scaffold moiety of the compounds is anchored in the kinase deep pocket and extended with diverse functional groups toward the hinge region and the front pocket. These variations can cause the compounds to change from fast to slow binding kinetics, resulting in an improved residence time. The flip of the DFG motif (“DMG” in CDK8) to the inactive DFG-out conformation appears to have relatively little influence on the velocity of binding. Hydrogen bonding with the kinase hinge region contributes to the residence time but has less impact than hydrophobic complementarities within the kinase front pocket. PMID:23630251

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

An assessment of unprofessional behavior among surgical residents on Facebook: a warning of the dangers of social media.

PubMed

Langenfeld, Sean J; Cook, Gates; Sudbeck, Craig; Luers, Thomas; Schenarts, Paul J

2014-01-01

Dismissal from residency is most commonly because of unprofessional conduct rather than cognitive failure. Disciplinary action by medical boards has also been associated with prior unprofessional behavior during medical school. Facebook is a social media network that has become ubiquitous in recent years and has the potential to offer an unvarnished view into the lives of residents using a public forum that is open to the public and program directors alike. The aim of this study was to evaluate the publically available Facebook profiles of surgical residents to determine the incidence and degree of unprofessional conduct. The American College of Surgeons Web site was used to identify general surgery residencies located in the Midwest. Resident rosters were then obtained using departmental Web sites. Facebook was then searched to determine which residents had profiles available for viewing by the public. The Accreditation Council for Graduate Medical Education's components of professionalism and the American Medical Association's report on professionalism in the use of social media were used to develop the following 3 categories: professional, potentially unprofessional, or clearly unprofessional. The chi-square test was used to determine significance. A total of 57 residency programs were identified on the American College of Surgeons Web site, of which 40 (70.2%) provided an institutional Web site with a current resident roster. A total of 996 surgical residents were identified, of which 319 (32%) had identifiable Facebook profiles. Overall, 235 residents (73.7%) had no unprofessional content, 45 (14.1%) had potentially unprofessional content, and 39 (12.2%) had clearly unprofessional content. Binge drinking, sexually suggestive photos, and Health Insurance Portability and Accountability Act violations were the most commonly found variables in the clearly unprofessional group. There were no statistical differences in professionalism based on sex (p = 0.93) or postgraduate year status (p = 0.88). Unprofessional behavior is prevalent among surgical residents who use Facebook, and this behavior does not appear to decrease as residents progress through training. This represents a risk to the reputations of hospitals and residency programs, and residents should be educated on the dangers of social media. Although it may be perceived as an invasion of privacy, this information is publically available, and program directors may benefit from monitoring these sites to identify gaps in professionalism that require correction. Copyright © 2014 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

Introducing practice-based learning and improvement ACGME core competencies into a family medicine residency curriculum.

PubMed

Coleman, Mary Thoesen; Nasraty, Soraya; Ostapchuk, Michael; Wheeler, Stephen; Looney, Stephen; Rhodes, Sandra

2003-05-01

The Accreditation Council for Graduate Medical Education (ACGME) recommends integrating improvement activities into residency training. A curricular change was designed at the Department of Family and Community Medicine, University of Louisville, to address selected ACGME competencies by incorporating practice-based improvement activities into the routine clinical work of family medicine residents. Teams of residents, faculty, and office staff completed clinical improvement projects at three ambulatory care training sites. Residents were given academic credit for participation in team meetings. After 6 months, residents presented results to faculty, medical students, other residents, and staff from all three training sites. Residents, staff, and faculty were recognized for their participation. Resident teams demonstrated ACGME competencies in practice-based improvement: Chart audits indicated improvement in clinical projects; quality improvement tools demonstrated analysis of root causes and understanding of the process; plan-do-study-act cycle worksheets demonstrated the change process. Improvement activities that affect patient care and demonstrate selected ACGME competencies can be successfully incorporated into the daily work of family medicine residents.

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

PubMed

Konc, Janez; Janežič, Dušanka

2014-07-01

The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

2005-08-22

Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

PubMed

Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

1994-10-27

Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

NASA Astrophysics Data System (ADS)

Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

PubMed Central

Jalak, Jürgen; Väljamäe, Priit

2014-01-01

Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

PubMed Central

Gibbons, R. J.; Moreno, E. C.; Etherden, I.

1983-01-01

The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

1990-01-01

Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

The Structural Basis of ATP as an Allosteric Modulator

PubMed Central

Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

2014-01-01

Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

PubMed Central

Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

2014-01-01

A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

PubMed Central

Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

1999-01-01

Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romm, E.; Marks, M.J.; Collins, A.C.

1990-01-01

Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

Independent control of matrix adhesiveness and stiffness within a 3D self-assembling peptide hydrogel.

PubMed

Hogrebe, Nathaniel J; Reinhardt, James W; Tram, Nguyen K; Debski, Anna C; Agarwal, Gunjan; Reilly, Matthew A; Gooch, Keith J

2018-04-01

A cell's insoluble microenvironment has increasingly been shown to exert influence on its function. In particular, matrix stiffness and adhesiveness strongly impact behaviors such as cell spreading and differentiation, but materials that allow for independent control of these parameters within a fibrous, stromal-like microenvironment are very limited. In the current work, we devise a self-assembling peptide (SAP) system that facilitates user-friendly control of matrix stiffness and RGD (Arg-Gly-Asp) concentration within a hydrogel possessing a microarchitecture similar to stromal extracellular matrix. In this system, the RGD-modified SAP sequence KFE-RGD and the scrambled sequence KFE-RDG can be directly swapped for one another to change RGD concentration at a given matrix stiffness and total peptide concentration. Stiffness is controlled by altering total peptide concentration, and the unmodified base peptide KFE-8 can be included to further increase this stiffness range due to its higher modulus. With this tunable system, we demonstrate that human mesenchymal stem cell morphology and differentiation are influenced by both gel stiffness and the presence of functional cell binding sites in 3D culture. Specifically, cells 24 hours after encapsulation were only able to spread out in stiffer matrices containing KFE-RGD. Upon addition of soluble adipogenic factors, soft gels facilitated the greatest adipogenesis as determined by the presence of lipid vacuoles and PPARγ-2 expression, while increasing KFE-RGD concentration at a given stiffness had a negative effect on adipogenesis. This three-component hydrogel system thus allows for systematic investigation of matrix stiffness and RGD concentration on cell behavior within a fibrous, three-dimensional matrix. Physical cues from a cell's surrounding environment-such as the density of cell binding sites and the stiffness of the surrounding material-are increasingly being recognized as key regulators of cell function. Currently, most synthetic biomaterials used to independently tune these parameters lack the fibrous structure characteristic of stromal extracellular matrix, which can be important to cells naturally residing within stromal tissues. In this manuscript, we describe a 3D hydrogel encapsulation system that provides user-friendly control over matrix stiffness and binding site concentration within the context of a stromal-like microarchitecture. Binding site concentration and gel stiffness both influenced cell spreading and differentiation, highlighting the utility of this system to study the independent effects of these material properties on cell function. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Molecular basis for zinc potentiation at strychnine-sensitive glycine receptors.

PubMed

Miller, Paul S; Da Silva, Helena M A; Smart, Trevor G

2005-11-11

The divalent cation Zn(2+) is a potent potentiator at the strychnine-sensitive glycine receptor (GlyR). This occurs at nanomolar concentrations, which are the predicted endogenous levels of extracellular neuronal Zn(2+). Using structural modeling and functional mutagenesis, we have identified the molecular basis for the elusive Zn(2+) potentiation site on GlyRs and account for the differential sensitivity of GlyR alpha(1) and GlyR alpha(2) to Zn(2+) potentiation. In addition, juxtaposed to this Zn(2+) site, which is located externally on the N-terminal domain of the alpha subunit, another residue was identified in the nearby Cys loop, a region that is critical for receptor gating in all Cys loop ligand-gated ion channels. This residue acted as a key control element in the allosteric transduction pathway for Zn(2+) potentiation, enabling either potentiation or overt inhibition of receptor activation depending upon the moiety resident at this location. Overall, we propose that Zn(2+) binds to a site on the extracellular outer face of the GlyR alpha subunit and exerts its positive allosteric effect via an interaction with the Cys loop to increase the efficacy of glycine receptor gating.

Comprehensive Structural Characterization of the Bacterial Homospermidine Synthase–an Essential Enzyme of the Polyamine Metabolism

PubMed Central

Krossa, Sebastian; Faust, Annette; Ober, Dietrich; Scheidig, Axel J.

2016-01-01

The highly conserved bacterial homospermidine synthase (HSS) is a key enzyme of the polyamine metabolism of many proteobacteria including pathogenic strains such as Legionella pneumophila and Pseudomonas aeruginosa; The unique usage of NAD(H) as a prosthetic group is a common feature of bacterial HSS, eukaryotic HSS and deoxyhypusine synthase (DHS). The structure of the bacterial enzyme does not possess a lysine residue in the active center and thus does not form an enzyme-substrate Schiff base intermediate as observed for the DHS. In contrast to the DHS the active site is not formed by the interface of two subunits but resides within one subunit of the bacterial HSS. Crystal structures of Blastochloris viridis HSS (BvHSS) reveal two distinct substrate binding sites, one of which is highly specific for putrescine. BvHSS features a side pocket in the direct vicinity of the active site formed by conserved amino acids and a potential substrate discrimination, guiding, and sensing mechanism. The proposed reaction steps for the catalysis of BvHSS emphasize cation-π interaction through a conserved Trp residue as a key stabilizer of high energetic transition states. PMID:26776105

DNA Supercoiling and the Lrp Protein Determine the Directionality of fim Switch DNA Inversion in Escherichia coli K-12

PubMed Central

Kelly, Arlene; Conway, Colin; Ó Cróinín, Tadhg; Smith, Stephen G. J.; Dorman, Charles J.

2006-01-01

Site-specific recombinases of the integrase family usually require cofactors to impart directionality in the recombination reactions that they catalyze. The FimB integrase inverts the Escherichia coli fim switch (fimS) in the on-to-off and off-to-on directions with approximately equal efficiency. Inhibiting DNA gyrase with novobiocin caused inversion to become biased in the off-to-on direction. This directionality was not due to differential DNA topological distortion of fimS in the on and off phases by the activity of its resident PfimA promoter. Instead, the leucine-responsive regulatory (Lrp) protein was found to determine switching outcomes. Knocking out the lrp gene or abolishing Lrp binding sites 1 and 2 within fimS completely reversed the response of the switch to DNA relaxation. Inactivation of either Lrp site alone resulted in mild on-to-off bias, showing that they act together to influence the response of the switch to changes in DNA supercoiling. Thus, Lrp is not merely an architectural element organizing the fim invertasome, it collaborates with DNA supercoiling to determine the directionality of the DNA inversion event. PMID:16855224

Nucleotide-dependent bisANS binding to tubulin.

PubMed

Chakraborty, S; Sarkar, N; Bhattacharyya, B

1999-07-13

Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

1988-01-01

(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

DTIC Science & Technology

positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

PubMed

Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

2017-03-16

Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

1986-06-01

(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

Can hunting of translocated nuisance Canada geese reduce local conflicts?

USGS Publications Warehouse

Holevinski, R.A.; Malecki, R.A.; Curtis, P.D.

2006-01-01

Resident Canada geese (Branta canadensis) nest or reside in the temperate latitudes of North America. In past years, translocation-the capture and subsequent release of geese at distant locations-has been used to establish resident goose populations and to reduce nuisance problems. However, with new special hunting seasons designed to target resident Canada geese, we can now evaluate translocation as a management tool when hunting is allowed at release sites. We selected 2 study sites, representative of urban and suburban locations with nuisance resident geese, in central and western New York, USA. In June 2003, we translocated 80 neck-banded adult geese, 14 radiomarked adult females, and 83 juveniles 150 km east and southwest from urban and suburban problem sites in western New York to state-owned Wildlife Management Areas. At these same capture sites, we used 151 neck-banded adult geese, 12 radiomarked females, and 100 juveniles as controls to compare dispersal movements and harvest vulnerability to translocated geese. All observations (n = 45) of translocated radiomarked geese were <20 km from release sites, in areas where hunting was permitted. Only 25 of 538 observations (4.6%) of radiomarked geese at control sites were in areas open to hunting. The remainder of observations occurred at nonhunting locations within 10 km of control sites. More translocated adult geese (23.8%) were harvested than control geese (6.6%; ??2 = 72.98, P = 0.0009). More translocated juvenile geese were harvested (22.9%) than juvenile controls (5.0%; ??2 = 72.30, P = 0.0005). Only 7 (8.8%) translocated adult geese returned to the original capture sites during Canada goose hunting seasons. Translocation of adult and juvenile geese in family groups may alleviate nuisance problems at conflict sites through increased harvest, reducing the number of birds returning in subsequent years.

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

PubMed Central

Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

1998-01-01

The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

PubMed

Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

2015-12-01

CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Quantifying transient binding of ISWI chromatin remodelers in living cells by pixel-wise photobleaching profile evolution analysis.

PubMed

Erdel, Fabian; Rippe, Karsten

2012-11-20

Interactions between nuclear proteins and chromatin frequently occur on the time scale of seconds and below. These transient binding events are important for the fast identification of target sites as concluded from our previous analysis of the human chromatin remodelers Snf2H and Snf2L from the imitation switch (ISWI) family. Both ATP-driven molecular motor proteins are able to translocate nucleosomes along the DNA and appear to exert this activity only on a small number of nucleosomes to which they bind more tightly. For mechanistic studies, one needs to distinguish such translocation reactions or other long-lived interactions associated with conformational changes and/or ATP hydrolysis from nonproductive chromatin sampling during target search. These processes can be separated by measuring the duration of nucleosome binding with subsecond time resolution. To reach this goal, we have developed a fluorescence bleaching technique termed pixel-wise photobleaching profile evolution analysis (3PEA). It exploits the inherent time structure of confocal microscopy images and yields millisecond resolution. 3PEA represents a generally applicable approach to quantitate transient chromatin interactions in the 2- to 500-ms time regime within only ∼1 s needed for a measurement. The green autofluorescent protein (GFP)-tagged Snf2H and Snf2L and the inactive Snf2L+13 splice variant were studied by 3PEA in comparison to the isolated GFP or red autofluorescent protein and a GFP pentamer. Our results reveal that the residence time for transient chromatin binding of Snf2H and Snf2L is <2 ms, and strongly support the view that ISWI-type remodelers are only rarely active in unperturbed cells during G1 phase.

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Resident away rotations allow adaptive neurosurgical training.

PubMed

Gephart, Melanie Hayden; Derstine, Pamela; Oyesiku, Nelson M; Grady, M Sean; Burchiel, Kim; Batjer, H Hunt; Popp, A John; Barbaro, Nicholas M

2015-04-01

Subspecialization of physicians and regional centers concentrate the volume of certain rare cases into fewer hospitals. Consequently, the primary institution of a neurological surgery training program may not have sufficient case volume to meet the current Residency Review Committee case minimum requirements in some areas. To ensure the competency of graduating residents through a comprehensive neurosurgical education, programs may need for residents to travel to outside institutions for exposure to cases that are either less common or more regionally focused. We sought to evaluate off-site rotations to better understand the changing demographics and needs of resident education. This would also allow prospective monitoring of modifications to the neurosurgery training landscape. We completed a survey of neurosurgery program directors and query of data from the Accreditation Council of Graduate Medical Education to characterize the current use of away rotations in neurosurgical education of residents. We found that 20% of programs have mandatory away rotations, most commonly for exposure to pediatric, functional, peripheral nerve, or trauma cases. Most of these rotations are done during postgraduate year 3 to 6, lasting 1 to 15 months. Twenty-six programs have 2 to 3 participating sites and 41 have 4 to 6 sites distinct from the host program. Programs frequently offset potential financial harm to residents rotating at a distant site by support of housing and transportation costs. As medical systems experience fluctuating treatment paradigms and demographics, over time, more residency programs may adapt to meet the Accreditation Council of Graduate Medical Education case minimum requirements through the implementation of away rotations.

Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

NASA Astrophysics Data System (ADS)

Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2018-03-01

To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

PubMed Central

Keck, P C; Huston, J S

1996-01-01

Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Emergence and Kinetics of Simian Immunodeficiency Virus-Specific CD8+ T Cells in the Intestines of Macaques during Primary Infection

PubMed Central

Veazey, Ronald S.; Gauduin, Marie-Claire; Mansfield, Keith G.; Tham, Irene C.; Altman, John D.; Lifson, Jeffrey D.; Lackner, Andrew A.; Johnson, R. Paul

2001-01-01

In this report, three Mamu-A*01+ rhesus macaques were examined to compare the emergence of simian immunodeficiency virus (SIV)-specific CD8+ T cells in the intestines and blood in early SIV infection using a major histocompatibility complex class I tetramer complexed with the Gag181–189 peptide. Fourteen days after intravenous inoculation with SIVmac251, large numbers of SIV Gag181–189-specific CD8+ T cells were detected in the intestinal mucosa (3.1 to 11.5% of CD3+ CD8+ lymphocytes) as well as in the blood (3.1 to 13.4%) of all three macaques. By 21 days postinoculation, levels of tetramer-binding cells had dropped in both the intestines and blood. At day 63, however, levels of SIV Gag181–189-specific CD8+ T cells in the intestines had rebounded in all three macaques to levels that were higher (8.6 to 18.7%) than those at day 21. In contrast, percentages of tetramer-binding cells in the peripheral blood remained comparatively stable (2.5 to 4.5%) at this time point. In summary, SIV Gag181–189-specific CD8+ T cells appeared in both the intestinal mucosa and peripheral blood at a comparable rate and magnitude in primary SIV infection. Given that the intestine is a major site of early viral replication as well as the site where most of the total body lymphocyte pool resides, these data indicate that it is also an early and important site of development of antiviral immune responses. PMID:11581423

Catalytic site interactions in yeast OMP synthase.

PubMed

Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

2014-01-15

The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

PubMed

Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

2006-01-01

Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muccioli, G.; Guardabassi, A.; Pattono, P.

1990-03-01

The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

Study of DNA binding sites using the Rényi parametric entropy measure.

PubMed

Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

2004-04-07

Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

Pine Ridge Indian Health Service Primary Care Resident Rotation: a summary.

PubMed

Jerde, O M; Vogt, H B

1996-10-01

The Pine Ridge Indian Health Service Primary Care Resident Rotation was officially established in January 1992 and operated through May 1996. Sponsored by an Indian Health Service grant, the rotation was conceived in an effort to help address the problem of recruitment and retention of physicians at Pin Ridge in the long term, while offering a unique educational experience for residents. Fifty-eight residents from 40 Family Practice, General Internal Medicine and General Pediatric Residency Programs in 18 states completed the rotation. Four of the rotation "graduates" are currently employed by the IHS at Pine Ridge and two other sites. A fifth physician provided short term service to a fourth site.

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Binding site and affinity prediction of general anesthetics to protein targets using docking.

PubMed

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

2012-05-01

The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

PubMed Central

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

2012-01-01

Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

PubMed Central

Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

2008-01-01

Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

PubMed

Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

2006-04-15

We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

PubMed Central

Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

2015-01-01

Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

PubMed

Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

2013-02-21

Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

The relative importance of water temperature and residence time in predicting cyanobacteria abundance in regulated rivers.

PubMed

Cha, YoonKyung; Cho, Kyung Hwa; Lee, Hyuk; Kang, Taegu; Kim, Joon Ha

2017-11-01

Despite a growing awareness of the problems associated with cyanobacterial blooms in rivers, and particularly in regulated rivers, the drivers of bloom formation and abundance in rivers are not well understood. We developed a Bayesian hierarchical model to assess the relative importance of predictors of summer cyanobacteria abundance, and to test whether the relative importance of each predictor varies by site, using monitoring data from 16 sites in the four major rivers of South Korea. The results suggested that temperature and residence time, but not nutrient levels, are important predictors of summer cyanobacteria abundance in rivers. Although the two predictors were of similar significance across the sites, the residence time was marginally better in accounting for the variation in cyanobacteria abundance. The model with spatial hierarchy demonstrated that temperature played a consistently significant role at all sites, and showed no effect from site-specific factors. In contrast, the importance of residence time varied significantly from site to site. This variation was shown to depend on the trophic state, indicated by the chlorophyll-a and total phosphorus levels. Our results also suggested that the magnitude of weir inflow is a key factor determining the cyanobacteria abundance under baseline conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Souza, E.B.; Kuyatt, B.L.

1987-01-01

Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

USGS Publications Warehouse

Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

2002-01-01

The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors

PubMed Central

Corbo, Joseph C.; Lawrence, Karen A.; Karlstetter, Marcus; Myers, Connie A.; Abdelaziz, Musa; Dirkes, William; Weigelt, Karin; Seifert, Martin; Benes, Vladimir; Fritsche, Lars G.; Weber, Bernhard H.F.; Langmann, Thomas

2010-01-01

Approximately 98% of mammalian DNA is noncoding, yet we understand relatively little about the function of this enigmatic portion of the genome. The cis-regulatory elements that control gene expression reside in noncoding regions and can be identified by mapping the binding sites of tissue-specific transcription factors. Cone-rod homeobox (CRX) is a key transcription factor in photoreceptor differentiation and survival, but its in vivo targets are largely unknown. Here, we used chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) on CRX to identify thousands of cis-regulatory regions around photoreceptor genes in adult mouse retina. CRX directly regulates downstream photoreceptor transcription factors and their target genes via a network of spatially distributed regulatory elements around each locus. CRX-bound regions act in a synergistic fashion to activate transcription and contain multiple CRX binding sites which interact in a spacing- and orientation-dependent manner to fine-tune transcript levels. CRX ChIP-seq was also performed on Nrl−/− retinas, which represent an enriched source of cone photoreceptors. Comparison with the wild-type ChIP-seq data set identified numerous rod- and cone-specific CRX-bound regions as well as many shared elements. Thus, CRX combinatorially orchestrates the transcriptional networks of both rods and cones by coordinating the expression of photoreceptor genes including most retinal disease genes. In addition, this study pinpoints thousands of noncoding regions of relevance to both Mendelian and complex retinal disease. PMID:20693478

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Selection of the simplest RNA that binds isoleucine

PubMed Central

LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

2003-01-01

We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shima, K.; Kitayama, S.; Nakano, R.

Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

NASA Astrophysics Data System (ADS)

Aalberts, Daniel P.; Garland, Jeffrey A.

2004-03-01

When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Reid, A.; Mahboubi, A.

1991-02-01

Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

PubMed

Brierley, I; Hoggett, J G

1992-07-01

The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

NASA Astrophysics Data System (ADS)

Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

2010-01-01

The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

The Utah rural residency study: a blueprint for evaluating potential sites for development of a 4-4-4 family practice residency program in a rural community.

PubMed

Catinella, A Peter; Magill, Michael K; Thiese, Steven M; Turner, Deborah; Elison, Gar T; Baden, Daniel J

2003-01-01

Most graduates of rural residencies enter rural practice. Rural residencies therefore have emerged over the past 2 decades to increase the supply of rural physicians. However, researchers have published few descriptions of strategies to evaluate and select communities in which to locate rural residencies. This report describes the development and application of such a strategy to assess 7 rural communities in Utah as potential sites for family practice residency training. Criteria were developed on the basis of an examination of the literature, residency accreditation requirements, and characteristics of existing rural residency programs. Ten rural or frontier communities with hospitals were selected as study candidates, and 7 agreed to participate. Data were collected through hospital surveys, state hospital discharge records, and community site visits. Specific evaluation criteria that were developed included the presence of a medical practice of the appropriate specialty and size, a sufficient number of medical subspecialty physicians, an adequate number and mix of hospitalized patients, an adequate number of ambulatory patients, adequate outpatient facility space to accommodate learners, and a commitment by the practicing physician and hospital to lead the program and teach residents. Two communities were found to be potentially capable of supporting a residency if physicians and hospital leaders in the communities were to become motivated to lead program development. These criteria may be useful in other states, but they have not been tested for validity or reliability and are subject to limitations such as exclusion of alternate rural residency models. Future research should address data needs and the relationship of the evaluation criteria to the quality of resident learning.

Cooperative interplay of let-7 mimic and HuR with MYC RNA

PubMed Central

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

Two classes of binding sites for [3H]substance P in rat cerebral cortex.

PubMed

Geraghty, D P; Burcher, E

1993-01-22

The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

A web server for analysis, comparison and prediction of protein ligand binding sites.

PubMed

Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

2016-03-25

One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

Interactions and phosphorylation of postsynaptic density 93 (PSD-93) by extracellular signal-regulated kinase (ERK).

PubMed

Guo, Ming-Lei; Xue, Bing; Jin, Dao-Zhong; Mao, Li-Min; Wang, John Q

2012-07-17

Postsynaptic density 93 (PSD-93) is a protein enriched at postsynaptic sites. As a key scaffolding protein, PSD-93 forms complexes with the clustering of various synaptic proteins to construct postsynaptic signaling networks and control synaptic transmission. Extracellular signal-regulated kinase (ERK) is a prototypic member of a serine/threonine protein kinase family known as mitogen-activated protein kinase (MAPK). This kinase, especially ERK2 isoform, noticeably resides in peripheral structures of neurons, such as dendritic spines and postsynaptic density areas, in addition to its distribution in the cytoplasm and nucleus, although little is known about specific substrates of ERK at synaptic sites. In this study, we found that synaptic PSD-93 is a direct target of ERK. This was demonstrated by direct protein-protein interactions between purified ERK2 and PSD-93 in vitro. The accurate ERK2-binding region seems to locate at an N-terminal region of PSD-93. In adult rat striatal neurons in vivo, native ERK from synaptosomal fractions also associated with PSD-93. In phosphorylation assays, active ERK2 phosphorylated PSD-93. An accurate phosphorylation site was identified at a serine site (S323). In striatal neurons, immunoprecipitated PSD-93 showed basal phosphorylation at an ERK-sensitive site. Our data provide evidence supporting PSD-93 as a new substrate of the synaptic species of ERK. ERK2 possesses the ability to interact with PSD-93 and phosphorylate PSD-93 at a specific site. Published by Elsevier B.V.

Superfund Record of Decision (EPA Region 4): Sodyeco Site, Charlotte, North Carolina (first remedial action), September 1987. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1987-09-24

The Southern Dyestuff Company (Sodyeco) site, located in Mecklenburg County, North Carolina, consists of approximately 1,300 acres. Approximately 20-30 residents reside within a one-quarter mile radius of the site, while many of the areas 9,137 residents commute daily to the site for employment. The site contains an operating manufacturing facility consisting of production units, a waste-water-treatment area and materials storage areas. Approximately 1040 acres are underdeveloped. Sodyeco began operations at the site in 1936. In 1958, American Marietta (which became Martin Marietta in 1961) purchased the site and expanded the company's liquid sulfur dye production to include the manufacture ofmore » vat and disperse dyes and specialty products for agrochemical, electronic, explosive, lithographic, pigment, plastic, rubber and general chemical industries. The Sandoz Chemical Company purchased the plant in 1983. Five CERCLA facilities, identified as A, B, C, D and E, were identified as probable sources of the ground water and soil contamination.« less

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

PubMed Central

Meng, Xiangzhi; Leman, Michael; Xiang, Yan

2007-01-01

Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

PubMed

Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

2018-05-16

Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

NASA Astrophysics Data System (ADS)

Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

1986-07-01

The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

PubMed

Marsh, Lorraine

2015-01-01

Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

PubMed

Fehr, Marcus; Wolf, Antje; Stammler, Gerd

2016-03-01

Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

NASA Astrophysics Data System (ADS)

Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

1985-05-01

The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

5 CFR 550.703 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-01-01

...)(1), except the government of the District of Columbia. Commuting area means the geographic area... expectations of the local community. When an employee's residence is within the standard commuting area for a work site, the work site is within the employee's commuting area. When an employee's residence is...

5 CFR 550.703 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-01-01

...)(1), except the government of the District of Columbia. Commuting area means the geographic area... expectations of the local community. When an employee's residence is within the standard commuting area for a work site, the work site is within the employee's commuting area. When an employee's residence is...

5 CFR 550.703 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-01-01

...)(1), except the government of the District of Columbia. Commuting area means the geographic area... expectations of the local community. When an employee's residence is within the standard commuting area for a work site, the work site is within the employee's commuting area. When an employee's residence is...

5 CFR 550.703 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

...)(1), except the government of the District of Columbia. Commuting area means the geographic area... expectations of the local community. When an employee's residence is within the standard commuting area for a work site, the work site is within the employee's commuting area. When an employee's residence is...

5 CFR 550.703 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

...)(1), except the government of the District of Columbia. Commuting area means the geographic area... expectations of the local community. When an employee's residence is within the standard commuting area for a work site, the work site is within the employee's commuting area. When an employee's residence is...

Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

PubMed

DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

2003-07-08

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

PubMed

Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

1997-10-28

Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

PubMed Central

Jayasena, S D; Johnston, B H

1992-01-01

tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648