Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Helicobacter pylori purine nucleoside phosphorylase shows new distribution patterns of open and closed active site conformations and unusual biochemical features.

PubMed

Narczyk, Marta; Bertoša, Branimir; Papa, Lucija; Vuković, Vedran; Leščić Ašler, Ivana; Wielgus-Kutrowska, Beata; Bzowska, Agnieszka; Luić, Marija; Štefanić, Zoran

2018-04-01

Even with decades of research, purine nucleoside phosphorylases (PNPs) are enzymes whose mechanism is yet to be fully understood. This is especially true in the case of hexameric PNPs, and is probably, in part, due to their complex oligomeric nature and a whole spectrum of active site conformations related to interactions with different ligands. Here we report an extensive structural characterization of the apo forms of hexameric PNP from Helicobacter pylori (HpPNP), as well as its complexes with phosphate (P i ) and an inhibitor, formycin A (FA), together with kinetic, binding, docking and molecular dynamics studies. X-ray structures show previously unseen distributions of open and closed active sites. Microscale thermophoresis results indicate that a two-site model describes P i binding, while a three-site model is needed to characterize FA binding, irrespective of P i presence. The latter may be related to the newly found nonstandard mode of FA binding. The ternary complex of the enzyme with P i and FA shows, however, that P i binding stabilizes the standard mode of FA binding. Surprisingly, HpPNP has low affinity towards the natural substrate adenosine. Molecular dynamics simulations show that P i moves out of most active sites, in accordance with its weak binding. Conformational changes between nonstandard and standard binding modes of nucleoside are observed during the simulations. Altogether, these findings show some unique features of HpPNP and provide new insights into the functioning of the active sites, with implications for understanding the complex mechanism of catalysis of this enzyme. The atomic coordinates and structure factors have been deposited in the Protein Data Bank: with accession codes 6F52 (HpPNPapo_1), 6F5A (HpPNPapo_2), 6F5I (HpPNPapo_3), 5LU0 (HpPNP_PO4), 6F4W (HpPNP_FA) and 6F4X (HpPNP_PO4_FA). Purine nucleoside orthophosphate ribosyl transferase, EC2.4.2.1, UniProtID: P56463. © 2018 Federation of European Biochemical Societies.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Evaluation of a novel virtual screening strategy using receptor decoy binding sites.

PubMed

Patel, Hershna; Kukol, Andreas

2016-08-23

Virtual screening is used in biomedical research to predict the binding affinity of a large set of small organic molecules to protein receptor targets. This report shows the development and evaluation of a novel yet straightforward attempt to improve this ranking in receptor-based molecular docking using a receptor-decoy strategy. This strategy includes defining a decoy binding site on the receptor and adjusting the ranking of the true binding-site virtual screen based on the decoy-site screen. The results show that by docking against a receptor-decoy site with Autodock Vina, improved Receiver Operator Characteristic Enrichment (ROCE) was achieved for 5 out of fifteen receptor targets investigated, when up to 15 % of a decoy site rank list was considered. No improved enrichment was seen for 7 targets, while for 3 targets the ROCE was reduced. The extent to which this strategy can effectively improve ligand prediction is dependent on the target receptor investigated.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

2016-10-01

The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

Interaction of flavonols with human serum albumin: a biophysical study showing structure-activity relationship and enhancement when coated on silver nanoparticles.

PubMed

Das, Pratyusa; Chaudhari, Sunil Kumar; Das, Asmita; Kundu, Somashree; Saha, Chabita

2018-04-24

Binding affinities of flavonols namely quercetin, myricetin, and kaempferol to human serum albumin (HSA) were determined fluorimetrically and the order was observed to be myricetin > quercetin > kaempferol demonstrating structure-activity relationship. Quercetin-coated silver nanoparticles (AgNPs) show higher binding affinity to HSA compared to free quercetin with binding constants 6.04 × 10 7  M -1 and 4.2 × 10 6  M -1 , respectively. Using site-specific markers it is concluded that free quercetin and that coated on AgNPs bind at different sites. Significant structural changes in circular dichroism (CD) spectra of HSA were recorded with quercetin-coated AgNPs compared to free quercetin. These results were further substantiated by time-resolved fluorescence spectroscopy where fluorescence life time of the tryptophan residue in HSA-quercetin-coated AgNPs complex decreased to 3.63 ns from 4.22 ns in HSA-quercetin complex. Isothermal calorimetric studies reveal two binding modes for quercetin-coated AgNPs and also higher binding constants compared to free quercetin. These higher binding affinities are attributed to altered properties of quercetin when coated on AgNPs enabling it to reach the binding sites other than site II where free quercetin mainly binds.

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Activation of the edema factor of Bacillus anthracis by calmodulin: evidence of an interplay between the EF-calmodulin interaction and calcium binding.

PubMed

Laine, Elodie; Martínez, Leandro; Blondel, Arnaud; Malliavin, Thérèse E

2010-10-06

Calmodulin (CaM) is a remarkably flexible protein which can bind multiple targets in response to changes in intracellular calcium concentration. It contains four calcium-binding sites, arranged in two globular domains. The calcium affinity of CaM N-terminal domain (N-CaM) is dramatically reduced when the complex with the edema factor (EF) of Bacillus anthracis is formed. Here, an atomic explanation for this reduced affinity is proposed through molecular dynamics simulations and free energy perturbation calculations of the EF-CaM complex starting from different crystallographic models. The simulations show that electrostatic interactions between CaM and EF disfavor the opening of N-CaM domains usually induced by calcium binding. Relative calcium affinities of the N-CaM binding sites are probed by free energy perturbation, and dissociation probabilities are evaluated with locally enhanced sampling simulations. We show that EF impairs calcium binding on N-CaM through a direct conformational restraint on Site 1, by an indirect destabilization of Site 2, and by reducing the cooperativity between the two sites. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Lipid-regulated sterol transfer between closely apposed membranes by oxysterol-binding protein homologues.

PubMed

Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A

2009-12-14

Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

A molecular dynamics simulation study of the association of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate enantiomers with a chiral molecular micelle

NASA Astrophysics Data System (ADS)

Morris, Kevin F.; Billiot, Eugene J.; Billiot, Fereshteh H.; Gladis, Ashley A.; Lipkowitz, Kenny B.; Southerland, William M.; Fang, Yayin

2014-08-01

Molecular dynamics (MD) simulations were used to investigate the binding of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate (BNP) enantiomers to the molecular micelle poly-(sodium undecyl-(L,L)-leucine-valine) (poly(SULV)). Poly(SULV) is used as a chiral selector in capillary electrophoresis separations. Four poly(SULV) binding pockets were identified and either (R)-BNP or (S)-BNP were docked into each pocket. MD simulations were then used to identify the preferred BNP binding site. Within the preferred site, both enantiomers formed hydrogen bonds with poly(SULV) and penetrated into the poly(SULV) core. Comparisons of BNP enantiomer binding to the preferred poly(SULV) pocket showed that (S)-BNP formed stronger hydrogen bonds, moved deeper into the binding site, and had a lower poly(SULV) binding free energy than the (R) enantiomer. Finally, MD simulation results were in agreement with capillary electrophoresis and NMR experiments. Each technique showed (S)-BNP interacted more strongly with poly(SULV) than (R)-BNP and that the site of chiral recognition was near the poly(SULV) leucine chiral center.

Physical constraints determine the logic of bacterial promoter architectures

PubMed Central

Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

2014-01-01

Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

New Synthesis and Tritium Labeling of a Selective Ligand for Studying High-affinity γ-Hydroxybutyrate (GHB) Binding Sites

PubMed Central

Vogensen, Stine B.; Marek, Aleš; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frølund, Bente; Pedersen, Martin H.F.; Clausen, Rasmus P.

2013-01-01

3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screening of 1 against different CNS targets establishes a high selectivity and we demonstrate in vivo brain penetration. In vitro characterization of [3H]-1 binding shows high specificity to the high-affinity GHB binding sites. PMID:24053696

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Polar bear hemoglobin and human Hb A0: same 2,3-diphosphoglycerate binding site but asymmetry of the binding?

PubMed

Pomponi, Massimo; Bertonati, Claudia; Patamia, Maria; Marta, Maurizio; Derocher, Andrew E; Lydersen, Christian; Kovacs, Kit M; Wiig, Oystein; Bårdgard, Astrid J

2002-11-01

Polar bear (Ursus maritimus) hemoglobin (Hb) shows a low response to 2,3-diphosphoglycerate (2,3-DPG), compared to human Hb A0, even though these proteins have the same 2,3-DPG-binding site. In addition, polar bear Hb shows a high response to chloride and an alkaline Bohr effect (deltalog P50/deltapH) that is significantly greater than that of human Hb A0. The difference in sequence Pro (Hb A0)-->Gly (polar bear Hb) at position A2 in the A helix seems to be critical for reduced binding of 2,3-DPG. Our results also show that the A2 position may influence not only the flexibility of the A helix, but that differences in flexibility of the first turn of the A helix may affect the unloading of oxygen for the intrinsic ligand affinities of the alpha and beta chains. However, preferential binding to either chain can only take place if there is appreciable asymmetric binding of the phosphoric effector. Regarding this point, 31P NMR data suggest a loss of symmetry of the 2,3-DPG-binding site in the deoxyHb-2,3-DPG complex.

Studies on the cellular localization of spinal cord substance P receptors.

PubMed

Helke, C J; Charlton, C G; Wiley, R G

1986-10-01

Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

A gratuitous β-Lactamase inducer uncovers hidden active site dynamics of the Staphylococcus aureus BlaR1 sensor domain.

PubMed

Frederick, Thomas E; Peng, Jeffrey W

2018-01-01

Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.

Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.

1991-03-11

The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less

Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

PubMed Central

Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

2011-01-01

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

PubMed

Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

2011-01-14

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

PubMed

Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

2017-05-05

The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

2011-07-29

Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

Crystal structure of glucose isomerase in complex with xylitol inhibitor in one metal binding mode.

PubMed

Bae, Ji-Eun; Kim, In Jung; Nam, Ki Hyun

2017-11-04

Glucose isomerase (GI) is an intramolecular oxidoreductase that interconverts aldoses and ketoses. These characteristics are widely used in the food, detergent, and pharmaceutical industries. In order to obtain an efficient GI, identification of novel GI genes and substrate binding/inhibition have been studied. Xylitol is a well-known inhibitor of GI. In Streptomyces rubiginosus, two crystal structures have been reported for GI in complex with xylitol inhibitor. However, a structural comparison showed that xylitol can have variable conformation at the substrate binding site, e.g., a nonspecific binding mode. In this study, we report the crystal structure of S. rubiginosus GI in a complex with xylitol and glycerol. Our crystal structure showed one metal binding mode in GI, which we presumed to represent the inactive form of the GI. The metal ion was found only at the M1 site, which was involved in substrate binding, and was not present at the M2 site, which was involved in catalytic function. The O 2 and O 4 atoms of xylitol molecules contributed to the stable octahedral coordination of the metal in M1. Although there was no metal at the M2 site, no large conformational change was observed for the conserved residues coordinating M2. Our structural analysis showed that the metal at the M2 site was not important when a xylitol inhibitor was bound to the M1 site in GI. Thus, these findings provided important information for elucidation or engineering of GI functions. Copyright © 2017 Elsevier Inc. All rights reserved.

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Unbinding Pathways of an Agonist and an Antagonist from the 5-HT3 Receptor

PubMed Central

Thompson, A. J.; Chau, P.-L.; Chan, S. L.; Lummis, S. C. R.

2006-01-01

The binding sites of 5-HT3 and other Cys-loop receptors have been extensively studied, but there are no data on the entry and exit routes of ligands for these sites. Here we have used molecular dynamics simulations to predict the pathway for agonists and antagonists exiting from the 5-HT3 receptor binding site. The data suggest that the unbinding pathway follows a tunnel at the interface of two subunits, which is ∼8 Å long and terminates ∼20 Å above the membrane. The exit routes for an agonist (5-HT) and an antagonist (granisetron) were similar, with trajectories toward the membrane and outward from the ligand binding site. 5-HT appears to form many hydrogen bonds with residues in the unbinding pathway, and experiments show that mutating these residues significantly affects function. The location of the pathway is also supported by docking studies of granisetron, which show a potential binding site for granisetron on the unbinding route. We propose that leaving the binding pocket along this tunnel places the ligands close to the membrane and prevents their immediate reentry into the binding pocket. We anticipate similar exit pathways for other members of the Cys-loop receptor family. PMID:16387779

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

PubMed Central

Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

1992-01-01

By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343

Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

NASA Astrophysics Data System (ADS)

Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

1992-09-01

Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Botulinum neurotoxin serotype C associates with dual ganglioside receptors to facilitate cell entry.

PubMed

Karalewitz, Andrew P-A; Fu, Zhuji; Baldwin, Michael R; Kim, Jung-Ja P; Barbieri, Joseph T

2012-11-23

How botulinum neurotoxin serotype C (BoNT/C) enters neurons is unclear. BoNT/C utilizes dual gangliosides as host cell receptors. BoNT/C accesses gangliosides on the plasma membrane. Plasma membrane accessibility of the dual ganglioside receptors suggests synaptic vesicle exocytosis may not be necessary to expose BoNT/C receptors. Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A-G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission.

Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

PubMed

Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

2015-05-19

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

/sup 3/H)pirenzepine and (-)-(/sup 3/H)quinuclidinyl benzilate binding to rat cerebral cortical and cardiac muscarinic cholinergic sites. I. Characterization and regulation of agonist binding to putative muscarinic subtypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watson, M.; Yamamura, H.I.; Roeske, W.R.

The binding and regulation of selected muscarinic agonists to putative subtypes in rat cerebral cortex and heart were studied. Parallel inhibition studies of (/sup 3/H)pirenzepine ((/sup 3/H)PZ) and (-)-(/sup 3/H)quinuclidinylbenzilate ((-)-(/sup 3/H)QNB)-labeled membranes were done with and without 30 microM guanyl-5'-yl imidodiphosphate (Gpp(NH)p) at 25 degrees C in 10 mM Na-K-phosphate buffer which enhances PZ binding affinity and in modified Krebs-phosphate buffer, which mimics physiological conditions. Classical agonists such as carbachol, oxotremorine and acetylcholine inhibited (-)-(/sup 3/H)QNB binding to membranes with shallow Hill values (nH less than 1), were better fit to a 2-state model, were Gpp(NH)p-regulated and showed lowermore » affinity in modified Krebs-phosphate buffer than in 10 mM Na-K-phosphate buffer. Some agonists were not significantly better fit to a 2-state model in (/sup 3/H)PZ-labeled cortical membranes, especially in 10 mM Na-K-phosphate buffer. Whereas putative M1 and M2 binding sites distinguished by PZ possessed multiple agonist affinity states, as judged by carbachol, and agonist binding to (/sup 3/H)PZ-labeled sites were Gpp(NH)p modulated, the partial agonist pilocarpine and nonclassical agonist McN-A-343 (3-(m-chlorophenylcarbamoyloxy)-2-butynyl trimethylammonium chloride) showed little Gpp(NH)p-induced shift in (/sup 3/H)PZ-labeled cortical membranes in physiological conditions. Agonist binding to (-)-(/sup 3/H)QNB-labeled putative M2 cardiac sites was more sensitive to Gpp(NH)p than (-)-(/sup 3/H)QNB-labeled cortical sites. Carbachol and acetylcholine showed significant selectivity for putative M2 sites.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

PubMed

Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

2014-04-15

The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

Identification and characterization of Hoxa9 binding sites in hematopoietic cells

PubMed Central

Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven

2012-01-01

The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553

Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

PubMed Central

Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

2012-01-01

Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

CheckMyMetal: a macromolecular metal-binding validation tool

PubMed Central

Porebski, Przemyslaw J.

2017-01-01

Metals are essential in many biological processes, and metal ions are modeled in roughly 40% of the macromolecular structures in the Protein Data Bank (PDB). However, a significant fraction of these structures contain poorly modeled metal-binding sites. CheckMyMetal (CMM) is an easy-to-use metal-binding site validation server for macromolecules that is freely available at http://csgid.org/csgid/metal_sites. The CMM server can detect incorrect metal assignments as well as geometrical and other irregularities in the metal-binding sites. Guidelines for metal-site modeling and validation in macromolecules are illustrated by several practical examples grouped by the type of metal. These examples show CMM users (and crystallographers in general) problems they may encounter during the modeling of a specific metal ion. PMID:28291757

Reversibly bound chloride in the atrial natriuretic peptide receptor hormone-binding domain: possible allosteric regulation and a conserved structural motif for the chloride-binding site.

PubMed

Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S

2010-03-01

The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.

Reversibly Bound Chloride in the Atrial Natriuretic Peptide Receptor Hormone Binding Domain: Possible Allosteric Regulation and a Conserved Structural Motif for the Chloride-binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogawa, H.; Qiu, Y; Philo, J

2010-01-01

The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. Amore » new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.« less

Reversibly bound chloride in the atrial natriuretic peptide receptor hormone-binding domain: Possible allosteric regulation and a conserved structural motif for the chloride-binding site

PubMed Central

Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S

2010-01-01

The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(−)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(−) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(−) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis. PMID:20066666

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Searching for transcription factor binding sites in vector spaces

PubMed Central

2012-01-01

Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

PubMed

Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

2017-09-11

Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Energetic Coupling between Ligand Binding and Dimerization in E. coli Phosphoglycerate Mutase

PubMed Central

Gardner, Nathan W.; Monroe, Lyman K.; Kihara, Daisuke; Park, Chiwook

2016-01-01

Energetic coupling of two molecular events in a protein molecule is ubiquitous in biochemical reactions mediated by proteins, such as catalysis and signal transduction. Here, we investigate energetic coupling between ligand binding and folding of a dimer using a model system that shows three-state equilibrium unfolding in an exceptional quality. The homodimeric E. coli cofactor-dependent phosphoglycerate mutase (dPGM) was found to be stabilized by ATP in a proteome-wide screen, although dPGM does not require or utilize ATP for enzymatic function. We investigated the effect of ATP on the thermodynamic stability of dPGM using equilibrium unfolding. In the absence of ATP, dPGM populates a partially unfolded, monomeric intermediate during equilibrium unfolding. However, addition of 1.0 mM ATP drastically reduces the population of the intermediate by selectively stabilizing the native dimer. Using a computational ligand docking method, we predicted ATP binds to the active site of the enzyme using the triphosphate group. By performing equilibrium unfolding and isothermal titration calorimetry with active-site variants of dPGM, we confirmed that active-site residues are involved in ATP binding. Our findings show that ATP promotes dimerization of the protein by binding to the active site, which is distal from the dimer interface. This cooperativity suggests an energetic coupling between the active-site and the dimer interface. We also propose a structural link to explain how ligand binding to the active site is energetically coupled with dimerization. PMID:26919584

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

A two-metal ion mechanism operates in the hammerhead ribozyme-mediated cleavage of an RNA substrate

PubMed Central

Lott, William B.; Pontius, Brian W.; von Hippel, Peter H.

1998-01-01

Evidence for a two-metal ion mechanism for cleavage of the HH16 hammerhead ribozyme is provided by monitoring the rate of cleavage of the RNA substrate as a function of La3+ concentration in the presence of a constant concentration of Mg2+. We show that a bell-shaped curve of cleavage activation is obtained as La3+ is added in micromolar concentrations in the presence of 8 mM Mg2+, with a maximal rate of cleavage being attained in the presence of 3 μM La3+. These results show that two-metal ion binding sites on the ribozyme regulate the rate of the cleavage reaction and, on the basis of earlier estimates of the Kd values for Mg2+ of 3.5 mM and >50 mM, that these sites bind La3+ with estimated Kd values of 0.9 and >37.5 μM, respectively. Furthermore, given the very different effects of these metal ions at the two binding sites, with displacement of Mg2+ by La3+ at the stronger (relative to Mg2+) binding site activating catalysis and displacement of Mg2+ by La3+ at the weaker (relative to Mg2+) (relative to Mg2+) binding site inhibiting catalysis, we show that the metal ions at these two sites play very different roles. We argue that the metal ion at binding site 1 coordinates the attacking 2′-oxygen species in the reaction and lowers the pKa of the attached proton, thereby increasing the concentration of the attacking alkoxide nucleophile in an equilibrium process. In contrast, the role of the metal ion at binding site 2 is to catalyze the reaction by absorbing the negative charge that accumulates at the leaving 5′-oxygen in the transition state. We suggest structural reasons why the Mg2+–La3+ ion combination is particularly suited to demonstrating these different roles of the two-metal ions in the ribozyme cleavage reaction. PMID:9435228

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

Ligand deconstruction: Why some fragment binding positions are conserved and others are not

PubMed Central

Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

2015-01-01

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

Characterization of rodent liver and kidney AVP receptors: pharmacologic evidence for species differences.

PubMed

Tahara, A; Tsukada, J; Ishii, N; Tomura, Y; Wada, K; Kusayama, T; Yatsu, T; Uchida, W; Tanaka, A

1999-10-22

Radioligand binding studies with [3H]vasopressin (AVP) were used to determine the affinities of AVP receptor agonists and antagonists for mouse liver and kidney plasma membrane preparations. Both membrane preparations exhibited one class of high-affinity binding site. AVP ligand binding inhibition studies confirmed that mouse liver binding sites belong to the V1A subtype while kidney binding sites belong to the V2 receptor subtype. The affinity of each ligand for mouse V1A receptors was very similar to that for rat V1A receptors, showing differences in Ki values of less than 3-fold. In contrast, several peptide (d(CH2)5Tyr(Me)AVP) and nonpeptide (OPC-21268 and SR 49059) ligands had different affinities for mouse and rat kidney V2 receptors, with differences in Ki values ranging from 14- to 17-fold. These results indicate that mouse and rat kidney V2 receptors show significant pharmacologic differences.

Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

PubMed

Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

2013-01-01

Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

PubMed Central

Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

2012-01-01

Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

PubMed

Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

2012-08-21

Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

PubMed

Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

2011-02-01

RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex*

PubMed Central

Douglas, Max E.

2016-01-01

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

Pyrene maleimide as a probe of microenvironmental and dynamics properties of protein binding sites

NASA Astrophysics Data System (ADS)

Benci, S.; Vaccari, S.; Schianchi, G.; Locatelli, Donata; Vaghi, P.; Bottiroli, Giovanni F.

1995-01-01

N-(1-Pyrene)maleimide is highly fluorescent upon covalent binding with sulfhydryl and amino groups of the proteins. Multiexponential fluorescence decays were observed for the dye bound to different proteins even when a single binding site is involved. The lack of information about the fluorescence decay of free dye does not allow to define the variations of fluorescence parameter following the conjugation and their correlation with the binding properties of the fluorophore. In this work, a study of the fluorescence of the probe, free in solution, bound to different antibodies and to the antigen-antibody complex both in solution and in cell, has been performed. The experimental results showed that chemico-physical properties of the medium influence the fluorescence decay of the probe in both the free and bound forms, although to a different extent. The variations of fluorescence decay and anisotropy of the bound probe are related to the electronic characteristics of microenvironment and show an increased stabilization of the probe binding site with the increasing complexity of the substrate. The sensitivity of the fluorescence properties of the probe to the binding site environment opens interesting perspectives concerning the application of Py- maleimide fluorochromization to assess the degree of specificity of immunocytochemical labelling.

The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

PubMed

Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

2017-07-01

FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Mediation of CTCF transcriptional insulation by DEAD-box RNA-binding protein p68 and steroid receptor RNA activator SRA

PubMed Central

Yao, Hongjie; Brick, Kevin; Evrard, Yvonne; Xiao, Tiaojiang; Camerini-Otero, R. Daniel; Felsenfeld, Gary

2010-01-01

CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, although the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we showed that the DEAD-box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF by binding to both, and is required for proper insulator function. PMID:20966046

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

PubMed

Fehr, Marcus; Wolf, Antje; Stammler, Gerd

2016-03-01

Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

Distinguishing multiple chemotaxis Y protein conformations with laser-polarized 129Xe NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowery, Thomas J.; Doucleff, Michealeen; Ruiz, E. Janette

2005-02-01

The chemical shift of the {sup 129}Xe NMR signal has been shown to be extremely sensitive to the local environment around the atom and has been used to follow processes such as ligand binding by bacterial periplasmic binding proteins (Rubin et al. 2000; Lowery et al. 2004). Here we show that the {sup 129}Xe shift can sense more subtle changes: magnesium binding, BeF{sub 3}{sup -} activation, and peptide binding by the E. coli chemotaxis Y protein. {sup 1}H-{sup 15}N correlation spectroscopy and x-ray crystallography were used to identify two xenon-binding cavities in CheY that are primarily responsible for the shiftmore » changes. One site is near the active site, and the other is near the peptide binding site.« less

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities Are Predicted for C-2 Analogues in the Colchicine Site

PubMed Central

2011-01-01

3,5-Dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogues were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structure–activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design. PMID:22611477

Hemoglobin Rahere, a human hemoglobin variant with amino acid substitution at the 2,3-diphosphoglycerate binding site. Functional consequences of the alteration and effects of bezafibrate on the oxygen bindings.

PubMed

Sugihara, J; Imamura, T; Nagafuchi, S; Bonaventura, J; Bonaventura, C; Cashon, R

1985-09-01

We encountered an abnormal hemoglobin (Rahere), with a threonine residue replacing the beta 82 (EF6) lysine residue at the binding site of 2,3-diphosphoglycerate, which was responsible for overt erythrocytosis in two individuals of a Japanese family. Hemoglobin Rahere shows a lower oxygen affinity on the binding of 2,3-diphosphoglycerate or chloride ions than hemoglobin A. Although a decrease in the positive charge density at the binding sites of 2,3-diphosphoglycerate in hemoglobin Rahere apparently shifts the allosteric equilibrium toward the low affinity state, it greatly diminishes the cofactor effects by anions. The oxygen affinity of the patient's erythrocytes is substantially lowered by the presence of bezafibrate, which combines with sites different from those of 2,3-diphosphoglycerate in either hemoglobin Rahere or hemoglobin A.

Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities are Predicted for C-2 Analogs in the Colchicine Site.

PubMed

Da, Chenxiao; Telang, Nakul; Barelli, Peter; Jia, Xin; Gupton, John T; Mooberry, Susan L; Kellogg, Glen E

2012-01-12

3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogs were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structural-activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design.

Hemoglobin Rahere, a human hemoglobin variant with amino acid substitution at the 2,3-diphosphoglycerate binding site. Functional consequences of the alteration and effects of bezafibrate on the oxygen bindings.

PubMed Central

Sugihara, J; Imamura, T; Nagafuchi, S; Bonaventura, J; Bonaventura, C; Cashon, R

1985-01-01

We encountered an abnormal hemoglobin (Rahere), with a threonine residue replacing the beta 82 (EF6) lysine residue at the binding site of 2,3-diphosphoglycerate, which was responsible for overt erythrocytosis in two individuals of a Japanese family. Hemoglobin Rahere shows a lower oxygen affinity on the binding of 2,3-diphosphoglycerate or chloride ions than hemoglobin A. Although a decrease in the positive charge density at the binding sites of 2,3-diphosphoglycerate in hemoglobin Rahere apparently shifts the allosteric equilibrium toward the low affinity state, it greatly diminishes the cofactor effects by anions. The oxygen affinity of the patient's erythrocytes is substantially lowered by the presence of bezafibrate, which combines with sites different from those of 2,3-diphosphoglycerate in either hemoglobin Rahere or hemoglobin A. PMID:3930571

Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

PubMed Central

Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

2007-01-01

The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

Locating the binding sites of folic acid with milk α- and β-caseins.

PubMed

Bourassa, P; Tajmir-Riahi, H A

2012-01-12

We located the binding sites of folic acid with milk α- and β-caseins at physiological conditions, using constant protein concentration and various folic acid contents. FTIR, UV-visible, and fluorescence spectroscopic methods as well as molecular modeling were used to analyze folic acid binding sites, the binding constant, and the effect of folic acid interaction on the stability and conformation of caseins. Structural analysis showed that folic acid binds caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(folic acid-α-caseins) = 4.8 (±0.6) × 10(4) M(-1) and K(folic acid-β-caseins) = 7.0 (±0.9) × 10(4) M(-1). The number of bound acid molecules per protein was 1.5 (±0.4) for α-casein and 1.4 (±0.3) for β-casein complexes. Molecular modeling showed different binding sites for folic acid on α- and β-caseins. The participation of several amino acids in folic acid-protein complexes was observed, which was stabilized by hydrogen bonding network and the free binding energy of -7.7 kcal/mol (acid-α-casein) and -8.1 kcal/mol (acid-β-casein). Folic acid complexation altered protein secondary structure by the reduction of α-helix from 35% (free α-casein) to 33% (acid-complex) and 32% (free β-casein) to 26% (acid-complex) indicating a partial protein destabilization. Caseins might act as carriers for transportation of folic acid to target molecules.

PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

PubMed Central

Wu, Hao; Ji, Hongkai

2014-01-01

ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

Warfarin and Flavonoids Do Not Share the Same Binding Region in Binding to the IIA Subdomain of Human Serum Albumin.

PubMed

Rimac, Hrvoje; Dufour, Claire; Debeljak, Željko; Zorc, Branka; Bojić, Mirza

2017-07-11

Human serum albumin (HSA) binds a variety of xenobiotics, including flavonoids and warfarin. The binding of another ligand to the IIA binding site on HSA can cause warfarin displacement and potentially the elevation of its free concentration in blood. Studies dealing with flavonoid-induced warfarin displacement from HSA provided controversial results: estimated risk of displacement ranged from none to serious. To resolve these controversies, in vitro study of simultaneous binding of warfarin and eight different flavonoid aglycons and glycosides to HSA was carried out by fluorescence spectroscopy as well as molecular docking. Results show that warfarin and flavonoids do not share the same binding region in binding to HSA. Interactions were only observed at high warfarin concentrations not attainable under recommended dosing regimes. Docking experiments show that flavonoid aglycons and glycosides do not bind at warfarin high affinity sites, but rather to different regions within the IIA HSA subdomain. Thus, the risk of clinically significant warfarin-flavonoid interaction in binding to HSA should be regarded as negligible.

Characterization of Protein Tyrosine Phosphatase 1B Inhibition by Chlorogenic Acid and Cichoric Acid.

PubMed

Lipchock, James M; Hendrickson, Heidi P; Douglas, Bonnie B; Bird, Kelly E; Ginther, Patrick S; Rivalta, Ivan; Ten, Nicholas S; Batista, Victor S; Loria, J Patrick

2017-01-10

Protein tyrosine phosphatase 1B (PTP1B) is a known regulator of the insulin and leptin signaling pathways and is an active target for the design of inhibitors for the treatment of type II diabetes and obesity. Recently, cichoric acid (CHA) and chlorogenic acid (CGA) were predicted by docking methods to be allosteric inhibitors that bind distal to the active site. However, using a combination of steady-state inhibition kinetics, solution nuclear magnetic resonance experiments, and molecular dynamics simulations, we show that CHA is a competitive inhibitor that binds in the active site of PTP1B. CGA, while a noncompetitive inhibitor, binds in the second aryl phosphate binding site, rather than the predicted benzfuran binding pocket. The molecular dynamics simulations of the apo enzyme and cysteine-phosphoryl intermediate states with and without bound CGA suggest CGA binding inhibits PTP1B by altering hydrogen bonding patterns at the active site. This study provides a mechanistic understanding of the allosteric inhibition of PTP1B.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Comparison and correlation of binding mode of ATP in the kinase domains of Hexokinase family

PubMed Central

Kumar, Yellapu Nanda; Kumar, Pasupuleti Santhosh; Sowjenya, Gopal; Rao, Valasani Koteswara; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Pradeepkiran, Jangampalli Adi; Sarma, PVGK; Bhaskar, Matcha

2012-01-01

Hexokinases (HKs) are the enzymes that catalyses the ATP dependent phosphorylation of Hexose sugars to Hexose-6-Phosphate (Hex-6-P). There exist four different forms of HKs namely HK-I, HK-II, HK-III and HK-IV and all of them share a common ATP binding site core surrounded by more variable sequence that determine substrate affinities. Although they share a common binding site but they differ in their kinetic functions, hence the present study is aimed to analyze the binding mode of ATP. The analysis revealed that the four ATP binding domains are showing 13 identical, 7 similar and 6 dissimilar residues with similar structural conformation. Molecular docking of ATP into the kinase domains using Molecular Operating Environment (MOE) soft ware tool clearly showed the variation in the binding mode of ATP with variable docking scores. This probably explains the variable phosphorylation rates among hexokinases family. PMID:22829728

Development of a sugar-binding residue prediction system from protein sequences using support vector machine.

PubMed

Banno, Masaki; Komiyama, Yusuke; Cao, Wei; Oku, Yuya; Ueki, Kokoro; Sumikoshi, Kazuya; Nakamura, Shugo; Terada, Tohru; Shimizu, Kentaro

2017-02-01

Several methods have been proposed for protein-sugar binding site prediction using machine learning algorithms. However, they are not effective to learn various properties of binding site residues caused by various interactions between proteins and sugars. In this study, we classified sugars into acidic and nonacidic sugars and showed that their binding sites have different amino acid occurrence frequencies. By using this result, we developed sugar-binding residue predictors dedicated to the two classes of sugars: an acid sugar binding predictor and a nonacidic sugar binding predictor. We also developed a combination predictor which combines the results of the two predictors. We showed that when a sugar is known to be an acidic sugar, the acidic sugar binding predictor achieves the best performance, and showed that when a sugar is known to be a nonacidic sugar or is not known to be either of the two classes, the combination predictor achieves the best performance. Our method uses only amino acid sequences for prediction. Support vector machine was used as a machine learning algorithm and the position-specific scoring matrix created by the position-specific iterative basic local alignment search tool was used as the feature vector. We evaluated the performance of the predictors using five-fold cross-validation. We have launched our system, as an open source freeware tool on the GitHub repository (https://doi.org/10.5281/zenodo.61513). Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

2014-02-01

The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

Crystal structures of botulinum neurotoxin DC in complex with its protein receptors synaptotagmin I and II.

PubMed

Berntsson, Ronnie Per-Arne; Peng, Lisheng; Svensson, Linda Marie; Dong, Min; Stenmark, Pål

2013-09-03

Botulinum neurotoxins (BoNTs) can cause paralysis at exceptionally low concentrations and include seven serotypes (BoNT/A-G). The chimeric BoNT/DC toxin has a receptor binding domain similar to the same region in BoNT/C. However, BoNT/DC does not share protein receptor with BoNT/C. Instead, it shares synaptotagmin (Syt) I and II as receptors with BoNT/B, despite their low sequence similarity. Here, we present the crystal structures of the binding domain of BoNT/DC in complex with the recognition domains of its protein receptors, Syt-I and Syt-II. The structures reveal that BoNT/DC possesses a Syt binding site, distinct from the established Syt-II binding site in BoNT/B. Structure-based mutagenesis further shows that hydrophobic interactions play a key role in Syt binding. The structures suggest that the BoNT/DC ganglioside binding sites are independent of the protein receptor binding site. Our results reveal the remarkable versatility in the receptor recognition of the BoNTs. Copyright © 2013 Elsevier Ltd. All rights reserved.

Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

PubMed Central

Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

2012-01-01

Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

PubMed

Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

2017-06-15

RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Protein docking prediction using predicted protein-protein interface.

PubMed

Li, Bin; Kihara, Daisuke

2012-01-10

Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

Bone morphogenetic protein 2 activates Smad6 gene transcription through bone-specific transcription factor Runx2.

PubMed

Wang, Qing; Wei, Xiaochao; Zhu, Tianhui; Zhang, Ming; Shen, Run; Xing, Lianping; O'Keefe, Regis J; Chen, Di

2007-04-06

BMP-2 plays an essential role in osteoblast and chondrocyte differentiation, but its signaling mechanism has not been fully defined. In the present studies, we investigated the mechanism through which BMP-2 activates the Smad6 gene. A -2006/+45 Smad6 promoter-luciferase construct was generated along with deletions and Runx2 binding site mutations to examine the role of Smad1 and Runx2 signaling following BMP-2 stimulation in osteoblasts. Transfection of Runx2 or treatment with BMP-2-stimulated promoter activity of the -2006/+45 and -1191/+45 reporters but not the -829/+45 and -374/+45 reporters. No Smad1/5 binding site is present in the -1191/-829 region of the Smad6 promoter. Mutation of the OSE2-a site (-1036/-1031) completely abolished the stimulatory effect of Runx2 as well as BMP-2 on the -2006/+45 and -1191/+45 Smad6 reporters. Gel shift and chromatin immunoprecipitation (ChIP) assays showed that Runx2 binds the OSE2-a element. ChIP assays demonstrated that Smad1 also interacts with the OSE2-a site at the Smad6 promoter through Runx2. The protein degradation of Runx2 is mediated by the E3 ubiquitin ligase Smurf1. In the present studies, we found that Smurf1 binds the OSE2-a site through Runx2 and inhibits Smad6 gene transcription. Treatment with BMP-2 and transfection of Smad1 abolished Smurf1 binding to the OSE2 site. These results show that Smad1 binding excludes Smurf1 interaction with the OSE2 site and promotes Smad6 gene transcription.

An efficient method to transcription factor binding sites imputation via simultaneous completion of multiple matrices with positional consistency.

PubMed

Guo, Wei-Li; Huang, De-Shuang

2017-08-22

Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.

Characterization of the [125I]-neurokinin A binding site in the circular muscle of human colon

PubMed Central

Warner, Fiona J; Comis, Alfio; Miller, Robert C; Burcher, Elizabeth

1999-01-01

Neurokinin A (NKA) is a potent contractile agonist of human colon circular muscle. These responses are mediated predominantly through tachykinin NK2 receptors. In the present study, the NK2 receptor radioligand [125I]-NKA has been used to characterize binding sites in this tissue, using tachykinin agonists and antagonists. 125INKA labelled a single, high affinity binding site. Specific binding (95% of total binding) of [125I]-NKA was saturable (KD 0.47±0.05 nM), of high capacity (Bmax 2.1±0.1 fmol mg−1 wet weight tissue) and reversible (kinetically derived KD 0.36±0.07 nM). The rank order of agonists competing for the [125I]-NKA binding site was neuropeptide γ (NPγ)≥NKA≥[Lys5,MeLeu9,Nle10]NKA (4–10) (NK2 agonist)>>substance P (SP)>neurokinin B (NKB)≥[Pro9]SP (NK1 agonist)>>senktide (NK3 agonist), indicating binding to an NK2 site. The nonpeptide selective NK2 antagonist SR48968 showed higher affinity for the [125I]-NKA site than selective peptide NK2 antagonists. The rank order of potency for NK2 antagonists was SR48968≥MEN11420>GR94800≥MEN10627>MEN10376≥R396. The NK1 antagonist SR140333 was a weak competitor. The competition curve for SP could be resolved into two sites. When experiments were repeated in the presence of SR140333 (0.1 μM), the curve for SP became monophasic and showed a significant shift to the right, whereas curves to NKA and NKB were unaffected. In conclusion, binding of the radioligand [125I]-NKA to membranes from circular muscle is predominantly to the NK2 receptor. There may be a small component of binding to the NK1 receptor. The NK2 receptor mediates circular muscle contraction, whereas the role of the NK1 receptor in circular muscle is unclear. PMID:10455255

Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

PubMed Central

Meng, Xiangzhi; Leman, Michael; Xiang, Yan

2007-01-01

Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Biphasic association of T7 RNA polymerase and a nucleotide analogue, cibacron blue as a model to understand the role of initiating nucleotide in the mechanism of enzyme action.

PubMed

Pai, Sudipta; Das, Mili; Banerjee, Rahul; Dasgupta, Dipak

2011-08-01

T7 RNA polymerase (T7 RNAP) is an enzyme that utilizes ribonucleotides to synthesize the nascent RNA chain in a template-dependent manner. Here we have studied the interaction of T7 RNAP with cibacron blue, an anthraquinone monochlorotriazine dye, its effect on the function of the enzyme and the probable mode of binding of the dye. We have used difference absorption spectroscopy and isothermal titration calorimetry to show that the dye binds T7 RNAP in a biphasic manner. The first phase of the binding is characterized by inactivation of the enzyme. The second binding site overlaps with the common substrate-binding site of the enzyme. We have carried out docking experiment to map the binding site of the dye in the promoter bound protein. Competitive displacement of the dye from the high affinity site by labeled GTP and isothermal titration calorimetry of high affinity GTP bound enzyme with the dye suggests a strong correlation between the high affinity dye binding and the high affinity GTP binding in T7 RNAP reported earlier from our laboratory.

Investigation of the binding sites and orientation of caffeine on human serum albumin by surface-enhanced Raman scattering and molecular docking

NASA Astrophysics Data System (ADS)

Wang, Weinan; Zhang, Wei; Duan, Yaokai; Jiang, Yong; Zhang, Liangren; Zhao, Bing; Tu, Pengfei

2013-11-01

Fluorescence, normal Raman and surface-enhanced Raman scattering (SERS) were introduced to explore the absorptive geometry of caffeine on Human Serum Albumin (HSA) at physiological condition. The molecular docking was also employed to make a better understanding of the interaction between caffeine and HSA as well as to elucidate the detailed information of the major binding site. The results showed that caffeine could bind to HSA via the hydrophobic force of aromatic stacking and the main binding group on caffeine could be the pyrimidine ring. In addition, a consecutive set of changes in the orientation of caffeine molecule had been demonstrated during the process of caffeine binding to HSA, and the primary binding site was considered to be a hydrophobic cavity formed by Leu198, Lys199, Ser202, Phe211, Trp214, Val344, Ser454 and Leu481 in domain II.

Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connelly, P.R.; Gill, S.J.; Miller, K.I.

1989-02-21

Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

Molecular interaction of 2,4-diacetylphloroglucinol (DAPG) with human serum albumin (HSA): The spectroscopic, calorimetric and computational investigation

NASA Astrophysics Data System (ADS)

Pragna Lakshmi, T.; Mondal, Moumita; Ramadas, Krishna; Natarajan, Sakthivel

2017-08-01

Drug molecule interaction with human serum albumin (HSA) affects the distribution and elimination of the drug. The compound, 2,4-diacetylphloroglucinol (DAPG) has been known for its antimicrobial, antiviral, antihelminthic and anticancer properties. However, its interaction with HSA is not yet reported. In this study, the interaction between HSA and DAPG was investigated through steady-state fluorescence, time-resolved fluorescence (TRF), circular dichroism (CD), Fourier transform infrared (FT-IR) spectroscopy, isothermal titration calorimetry (ITC), molecular docking and molecular dynamics simulation (MDS). Fluorescence spectroscopy results showed the strong quenching of intrinsic fluorescence of HSA due to interaction with DAPG, through dynamic quenching mechanism. The compound bound to HSA with reversible and moderate affinity which explained its easy diffusion from circulatory system to target tissue. The thermodynamic parameters from fluorescence spectroscopic data clearly revealed the contribution of hydrophobic forces but, the role of hydrogen bonds was not negligible according to the ITC studies. The interaction was exothermic and spontaneous in nature. Binding with DAPG reduced the helical content of protein suggesting the unfolding of HSA. Site marker fluorescence experiments revealed the change in binding constant of DAPG in the presence of site I (warfarin) but not site II marker (ibuprofen) which confirmed that the DAPG bound to site I. ITC experiments also supported this as site I marker could not bind to HSA-DAPG complex while site II marker was accommodated in the complex. In silico studies further showed the lowest binding affinity and more stability of DAPG in site I than in site II. Thus the data presented in this study confirms the binding of DAPG to the site I of HSA which may help in further understanding of pharmacokinetic properties of DAPG.

Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

PubMed Central

Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

2013-01-01

β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

PubMed

Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

2006-01-01

Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data

PubMed Central

O'Connor, Timothy; Bodén, Mikael

2017-01-01

Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

PubMed Central

Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

2017-01-01

PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

Detecting cis-regulatory binding sites for cooperatively binding proteins

PubMed Central

van Oeffelen, Liesbeth; Cornelis, Pierre; Van Delm, Wouter; De Ridder, Fedor; De Moor, Bart; Moreau, Yves

2008-01-01

Several methods are available to predict cis-regulatory modules in DNA based on position weight matrices. However, the performance of these methods generally depends on a number of additional parameters that cannot be derived from sequences and are difficult to estimate because they have no physical meaning. As the best way to detect cis-regulatory modules is the way in which the proteins recognize them, we developed a new scoring method that utilizes the underlying physical binding model. This method requires no additional parameter to account for multiple binding sites; and the only necessary parameters to model homotypic cooperative interactions are the distances between adjacent protein binding sites in basepairs, and the corresponding cooperative binding constants. The heterotypic cooperative binding model requires one more parameter per cooperatively binding protein, which is the concentration multiplied by the partition function of this protein. In a case study on the bacterial ferric uptake regulator, we show that our scoring method for homotypic cooperatively binding proteins significantly outperforms other PWM-based methods where biophysical cooperativity is not taken into account. PMID:18400778

Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12

PubMed Central

Lithgow, James K; Haider, Fouzia; Roberts, Ian S; Green, Jeffrey

2007-01-01

Haemolysin E is a cytolytic pore-forming toxin found in several Escherichia coli and Salmonella enterica strains. Expression of hlyE is repressed by the global regulator H-NS (histone-like nucleoid structuring protein), but can be activated by the regulator SlyA. Expression of a chromosomal hlyE–lacZ fusion in an E. coli slyA mutant was reduced to 60% of the wild-type level confirming a positive role for SlyA. DNase I footprint analysis revealed the presence of two separate SlyA binding sites, one located upstream, the other downstream of the hlyE transcriptional start site. These sites overlap AT-rich H-NS binding sites. Footprint and gel shift data showed that whereas H-NS prevented binding of RNA polymerase (RNAP) at the hlyE promoter (PhlyE), SlyA allowed binding of RNAP, but inhibited binding of H-NS. Accordingly, in vitro transcription analyses showed that addition of SlyA protein relieved H-NS-mediated repression of hlyE. Based on these observations a model for SlyA/H-NS regulation of hlyE expression is proposed in which the relative concentrations of SlyA and H-NS govern the nature of the nucleoprotein complexes formed at PhlyE. When H-NS is dominant RNAP binding is inhibited and hlyE expression is silenced; when SlyA is dominant H-NS binding is inhibited allowing RNAP access to the promoter facilitating hlyE transcription. PMID:17892462

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex.

PubMed

Douglas, Max E; Diffley, John F X

2016-03-11

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Structural evolution of luciferase activity in Zophobas mealworm AMP/CoA-ligase (protoluciferase) through site-directed mutagenesis of the luciferin binding site.

PubMed

Prado, R A; Barbosa, J A; Ohmiya, Y; Viviani, V R

2011-07-01

The structural origin and evolution of bioluminescent activity of beetle luciferases from AMP/CoA ligases remains a mystery. Previously we cloned the luciferase-like enzyme from Zophobas morio mealworm, a reasonable protoluciferase model that could shine light on this mystery. Kinetic characterization and studies with D- and L-luciferin and their adenylates showed that stereoselectivity constitutes a critical feature for the origin of luciferase activity in AMP/CoA ligases. Comparison of the primary structures and modeling studies of this protoluciferase and the three main families of beetle luciferases showed that the carboxylic acid substrate binding site of this enzyme is smaller and more hydrophobic than the luciferin binding site of beetle luciferases, showing several substitutions of otherwise conserved residues. Thus, here we performed a site-directed mutagenesis survey of the carboxylic binding site motifs of the protoluciferase by replacing their residues by the respective conserved ones found in beetle luciferases in order to identify the structural determinants of luciferase/oxygenase activity. Although most of the substitutions had negative impact on the luminescence activity of the protoluciferase, only the substitution I327T improved the luminescence activity, resulting in a broad and 15 nm blue-shifted luminescence spectrum. Such substitution indicates the importance of the loop motif 322YGMSEI327 (341YGLTETT347 in Photinus pyralis luciferase) for luciferase activity, and indicates a possible route for the evolution of bioluminescence function of beetle luciferases.

Nickel binding to NikA: an additional binding site reconciles spectroscopy, calorimetry and crystallography.

PubMed

Addy, Christine; Ohara, Masato; Kawai, Fumihiro; Kidera, Akinori; Ikeguchi, Mitsunori; Fuchigami, Sotaro; Osawa, Masanori; Shimada, Ichio; Park, Sam-Yong; Tame, Jeremy R H; Heddle, Jonathan G

2007-02-01

Intracellular nickel is required by Escherichia coli as a cofactor for a number of enzymes and is necessary for anaerobic respiration. However, high concentrations of nickel are toxic, so both import and export systems have evolved to control the cellular level of the metal. The nik operon in E. coli encodes a nickel-uptake system that includes the periplasmic nickel-binding protein NikA. The crystal structures of wild-type NikA both bound to nickel and in the apo form have been solved previously. The liganded structure appeared to show an unusual interaction between the nickel and the protein in which no direct bonds are formed. The highly unusual nickel coordination suggested by the crystal structure contrasted strongly with earlier X-ray spectroscopic studies. The known nickel-binding site has been probed by extensive mutagenesis and isothermal titration calorimetry and it has been found that even large numbers of disruptive mutations appear to have little effect on the nickel affinity. The crystal structure of a binding-site mutant with nickel bound has been solved and it is found that nickel is bound to two histidine residues at a position distant from the previously characterized binding site. This novel site immediately resolves the conflict between the crystal structures and other biophysical analyses. The physiological relevance of the two binding sites is discussed.

Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

PubMed Central

Cherepanov, A V; de Vries, S

2001-01-01

The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting

NASA Astrophysics Data System (ADS)

Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

2016-07-01

Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency.

Binding site feature description of 2-substituted benzothiazoles as potential AcrAB-TolC efflux pump inhibitors in E. coli.

PubMed

Yilmaz, S; Altinkanat-Gelmez, G; Bolelli, K; Guneser-Merdan, D; Ufuk Over-Hasdemir, M; Aki-Yalcin, E; Yalcin, I

2015-01-01

The resistance-nodulation-division (RND) family efflux pumps are important in the antibiotic resistance of Gram-negative bacteria. However, although a number of bacterial RND efflux pump inhibitors have been developed, there has been no clinically available RND efflux pump inhibitor to date. A set of BSN-coded 2-substituted benzothiazoles were tested alone and in combinations with ciprofloxacin (CIP) against the AcrAB-TolC overexpressor Escherichia coli AG102 clinical strain. The results indicated that the BSN compounds did not show intrinsic antimicrobial activity when tested alone. However, when used in combinations with CIP, a reversal in the antibacterial activity of CIP with up to 10-fold better MIC values was observed. In order to describe the binding site features of these BSN compounds with AcrB, docking studies were performed using the CDocker method. The performed docking poses and the calculated binding energy scores revealed that the tested compounds BSN-006, BSN-023, and BSN-004 showed significant binding interactions with the phenylalanine-rich region in the distal binding site of the AcrB binding monomer. Moreover, the tested compounds BSN-006 and BSN-023 possessed stronger binding energies than CIP, verifying that BSN compounds are acting as the putative substrates of AcrB.

Large-scale turnover of functional transcription factor bindingsites in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Pollard, Daniel A.; Nix, David A.

2006-07-14

The gain and loss of functional transcription-factor bindingsites has been proposed as a major source of evolutionary change incis-regulatory DNA and gene expression. We have developed an evolutionarymodel to study binding site turnover that uses multiple sequencealignments to assess the evolutionary constraint on individual bindingsites, and to map gain and loss events along a phylogenetic tree. Weapply this model to study the evolutionary dynamics of binding sites ofthe Drosophila melanogaster transcription factor Zeste, using genome-widein vivo (ChIP-chip) binding data to identify functional Zeste bindingsites, and the genome sequences of D. melanogaster, D. simulans, D.erecta and D. yakuba to study theirmore » evolution. We estimate that more than5 percent of functional Zeste binding sites in D. melanogaster weregained along the D. melanogaster lineage or lost along one of the otherlineages. We find that Zeste bound regions have a reduced rate of bindingsite loss and an increased rate of binding site gain relative to flankingsequences. Finally, we show that binding site gains and losses areasymmetrically distributed with respect to D. melanogaster, consistentwith lineage-specific acquisition and loss of Zeste-responsive regulatoryelements.« less

Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1

PubMed Central

Malina, Jaroslav; Scott, Peter; Brabec, Viktor

2015-01-01

Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617

Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

DOE PAGES

Celik, Fuat E.; Mavrikakis, Manos

2015-01-12

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

Stability of Surface and Subsurface Hydrogen on and in Au/Ni Near-Surface Alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Celik, Fuat E.; Mavrikakis, Manos

2015-10-01

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While themore » metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.« less

Stability of surface and subsurface hydrogen on and in Au/Ni near-surface alloys

NASA Astrophysics Data System (ADS)

Celik, Fuat E.; Mavrikakis, Manos

2015-10-01

Periodic, self-consistent DFT-GGA (PW91) calculations were used to study the interaction of hydrogen atoms with the (111) surfaces of substitutional near-surface alloys (NSAs) of Au and Ni with different surface layer compositions and different arrangements of Au atoms in the surface layer. The effect of hydrogen adsorption on the surface and in the first and second subsurface layers of the NSAs was studied. Increasing the Au content in the surface layer weakens hydrogen binding on the surface, but strengthens subsurface binding, suggesting that the distribution of surface and subsurface hydrogen will be different than that on pure Ni(111). While the metal composition of the surface layer has an effect on the binding energy of hydrogen on NSA surfaces, the local composition of the binding site has a stronger effect. For example, fcc hollow sites consisting of three Ni atoms bind H nearly as strongly as on Ni(111), and fcc sites consisting of three Au atoms bind H nearly as weakly as on Au(111). Sites with one or two Au atoms show intermediate binding energies. The preference of hydrogen for three-fold Ni hollow sites alters the relative stabilities of different surface metal atom arrangements, and may provide a driving force for adsorbate-induced surface rearrangement.

Hoxa2 Selectively Enhances Meis Binding to Change a Branchial Arch Ground State

PubMed Central

Amin, Shilu; Donaldson, Ian J.; Zannino, Denise A.; Hensman, James; Rattray, Magnus; Losa, Marta; Spitz, François; Ladam, Franck; Sagerström, Charles; Bobola, Nicoletta

2015-01-01

Summary Hox transcription factors (TFs) are essential for vertebrate development, but how these evolutionary conserved proteins function in vivo remains unclear. Because Hox proteins have notoriously low binding specificity, they are believed to bind with cofactors, mainly homeodomain TFs Pbx and Meis, to select their specific targets. We mapped binding of Meis, Pbx, and Hoxa2 in the branchial arches, a series of segments in the developing vertebrate head. Meis occupancy is largely similar in Hox-positive and -negative arches. Hoxa2, which specifies second arch (IIBA) identity, recognizes a subset of Meis prebound sites that contain Hox motifs. Importantly, at these sites Meis binding is strongly increased. This enhanced Meis binding coincides with active enhancers, which are linked to genes highly expressed in the IIBA and regulated by Hoxa2. These findings show that Hoxa2 operates as a tissue-specific cofactor, enhancing Meis binding to specific sites that provide the IIBA with its anatomical identity. PMID:25640223

Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.

Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less

Apigenin shows synergistic anticancer activity with curcumin by binding at different sites of tubulin.

PubMed

Choudhury, Diptiman; Ganguli, Arnab; Dastidar, Debabrata Ghosh; Acharya, Bipul R; Das, Amlan; Chakrabarti, Gopal

2013-06-01

Apigenin, a natural flavone, present in many plants sources, induced apoptosis and cell death in lung epithelium cancer (A549) cells with an IC50 value of 93.7 ± 3.7 μM for 48 h treatment. Target identification investigations using A549 cells and also in cell-free system demonstrated that apigenin depolymerized microtubules and inhibited reassembly of cold depolymerized microtubules of A549 cells. Again apigenin inhibited polymerization of purified tubulin with an IC50 value of 79.8 ± 2.4 μM. It bounds to tubulin in cell-free system and quenched the intrinsic fluorescence of tubulin in a concentration- and time-dependent manner. The interaction was temperature-dependent and kinetics of binding was biphasic in nature with binding rate constants of 11.5 × 10(-7) M(-1) s(-1) and 4.0 × 10(-9) M(-1) s(-1) for fast and slow phases at 37 °C, respectively. The stoichiometry of tubulin-apigenin binding was 1:1 and binding the binding constant (Kd) was 6.08 ± 0.096 μM. Interestingly, apigenin showed synergistic anti-cancer effect with another natural anti-tubulin agent curcumin. Apigenin and curcumin synergistically induced cell death and apoptosis and also blocked cell cycle progression at G2/M phase of A549 cells. The synergistic activity of apigenin and curcumin was also apparent from their strong depolymerizing effects on interphase microtubules and inhibitory effect of reassembly of cold depolymerized microtubules when used in combinations, indicating that these ligands bind to tubulin at different sites. In silico modeling suggested apigenin bounds at the interphase of α-β-subunit of tubulin. The binding site is 19 Å in distance from the previously predicted curcumin binding site. Binding studies with purified protein also showed both apigenin and curcumin can simultaneously bind to purified tubulin. Understanding the mechanism of synergistic effect of apigenin and curcumin could be helped to develop anti-cancer combination drugs from cheap and readily available nutraceuticals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

USGS Publications Warehouse

Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

2002-01-01

The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Structural studies of bovine, equine, and leporine serum albumin complexes with naproxen.

PubMed

Bujacz, Anna; Zielinski, Kamil; Sekula, Bartosz

2014-09-01

Serum albumin, a protein naturally abundant in blood plasma, shows remarkable ligand binding properties of numerous endogenous and exogenous compounds. Most of serum albumin binding sites are able to interact with more than one class of ligands. Determining the protein-ligand interactions among mammalian serum albumins is essential for understanding the complexity of this transporter. We present three crystal structures of serum albumins in complexes with naproxen (NPS): bovine (BSA-NPS), equine (ESA-NPS), and leporine (LSA-NPS) determined to 2.58 Å (C2), 2.42 Å (P61), and 2.73 Å (P2₁2₁2₁) resolutions, respectively. A comparison of the structurally investigated complexes with the analogous complex of human serum albumin (HSA-NPS) revealed surprising differences in the number and distribution of naproxen binding sites. Bovine and leporine serum albumins possess three NPS binding sites, but ESA has only two. All three complexes of albumins studied here have two common naproxen locations, but BSA and LSA differ in the third NPS binding site. None of these binding sites coincides with the naproxen location in the HSA-NPS complex, which was obtained in the presence of other ligands besides naproxen. Even small differences in sequences of serum albumins from various species, especially in the area of the binding pockets, influence the affinity and the binding mode of naproxen to this transport protein. © 2014 Wiley Periodicals, Inc.

Unusual sugar specificity of banana lectin from Musa paradisiaca and its probable evolutionary origin. Crystallographic and modelling studies.

PubMed

Singh, D D; Saikrishnan, K; Kumar, Prashant; Surolia, A; Sekar, K; Vijayan, M

2005-10-01

The crystal structure of a complex of methyl-alpha-D-mannoside with banana lectin from Musa paradisiaca reveals two primary binding sites in the lectin, unlike in other lectins with beta-prism I fold which essentially consists of three Greek key motifs. It has been suggested that the fold evolved through successive gene duplication and fusion of an ancestral Greek key motif. In other lectins, all from dicots, the primary binding site exists on one of the three motifs in the three-fold symmetric molecule. Banana is a monocot, and the three motifs have not diverged enough to obliterate sequence similarity among them. Two Greek key motifs in it carry one primary binding site each. A common secondary binding site exists on the third Greek key. Modelling shows that both the primary sites can support 1-2, 1-3, and 1-6 linked mannosides with the second residue interacting in each case primarily with the secondary binding site. Modelling also readily leads to a bound branched mannopentose with the nonreducing ends of the two branches anchored at the two primary binding sites, providing a structural explanation for the lectin's specificity for branched alpha-mannans. A comparison of the dimeric banana lectin with other beta-prism I fold lectins, provides interesting insights into the variability in their quaternary structure.

Discovery of Novel Nonactive Site Inhibitors of the Prothrombinase Enzyme Complex.

PubMed

Kapoor, Karan; McGill, Nicole; Peterson, Cynthia B; Meyers, Harold V; Blackburn, Michael N; Baudry, Jerome

2016-03-28

The risk of serious bleeding is a major liability of anticoagulant drugs that are active-site competitive inhibitors targeting the Factor Xa (FXa) prothrombin (PT) binding site. The present work identifies several new classes of small molecule anticoagulants that can act as nonactive site inhibitors of the prothrombinase (PTase) complex composed of FXa and Factor Va (FVa). These new classes of anticoagulants were identified, using a novel agnostic computational approach to identify previously unrecognized binding pockets at the FXa-FVa interface. From about three million docking calculations of 281,128 compounds in a conformational ensemble of FXa heavy chains identified by molecular dynamics (MD) simulations, 97 compounds and their structural analogues were selected for experimental validation, through a series of inhibition assays. The compound selection was based on their predicted binding affinities to FXa and their ability to successfully bind to multiple protein conformations while showing selectivity for particular binding sites at the FXa/FVa interface. From these, thirty-one (31) compounds were experimentally identified as nonactive site inhibitors. Concentration-based assays further identified 10 compounds represented by four small-molecule families of inhibitors that achieve dose-independent partial inhibition of PTase activity in a nonactive site-dependent and self-limiting mechanism. Several compounds were identified for their ability to bind to protein conformations only seen during MD, highlighting the importance of accounting for protein flexibility in structure-based drug discovery approaches.

Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Aimee; Higgins, Darren E.; Panne, Daniel

2009-07-22

The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

PubMed Central

Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

2014-01-01

SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

Equivalence of two approaches for modeling ion permeation through a transmembrane channel with an internal binding site

NASA Astrophysics Data System (ADS)

Zhou, Huan-Xiang

2011-04-01

Ion permeation through transmembrane channels has traditionally been modeled using two different approaches. In one approach, the translocation of the permeant ion through the channel pore is modeled as continuous diffusion and the rate of ion transport is obtained from solving the steady-state diffusion equation. In the other approach, the translocation of the permeant ion through the pore is modeled as hopping along a discrete set of internal binding sites and the rate of ion transport is obtained from solving a set of steady-state rate equations. In a recent work [Zhou, J. Phys. Chem. Lett. 1, 1973 (2010)], the rate constants for binding to an internal site were further calculated by modeling binding as diffusion-influenced reactions. That work provided the foundation for bridging the two approaches. Here we show that, by representing a binding site as an energy well, the two approaches indeed give the same result for the rate of ion transport.

Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vognsen, Tina, E-mail: tv@farma.ku.dk; Kristensen, Ole, E-mail: ok@farma.ku.dk

2012-03-30

Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites formore » RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.« less

Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong

2015-11-30

Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only themore » channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.« less

Structural basis for the binding of tryptophan-based motifs by δ-COP

PubMed Central

Suckling, Richard J.; Poon, Pak Phi; Travis, Sophie M.; Majoul, Irina V.; Hughson, Frederick M.; Evans, Philip R.; Duden, Rainer; Owen, David J.

2015-01-01

Coatomer consists of two subcomplexes: the membrane-targeting, ADP ribosylation factor 1 (Arf1):GTP-binding βγδζ-COP F-subcomplex, which is related to the adaptor protein (AP) clathrin adaptors, and the cargo-binding αβ’ε-COP B-subcomplex. We present the structure of the C-terminal μ-homology domain of the yeast δ-COP subunit in complex with the WxW motif from its binding partner, the endoplasmic reticulum-localized Dsl1 tether. The motif binds at a site distinct from that used by the homologous AP μ subunits to bind YxxΦ cargo motifs with its two tryptophan residues sitting in compatible pockets. We also show that the Saccharomyces cerevisiae Arf GTPase-activating protein (GAP) homolog Gcs1p uses a related WxxF motif at its extreme C terminus to bind to δ-COP at the same site in the same way. Mutations designed on the basis of the structure in conjunction with isothermal titration calorimetry confirm the mode of binding and show that mammalian δ-COP binds related tryptophan-based motifs such as that from ArfGAP1 in a similar manner. We conclude that δ-COP subunits bind Wxn(1–6)[WF] motifs within unstructured regions of proteins that influence the lifecycle of COPI-coated vesicles; this conclusion is supported by the observation that, in the context of a sensitizing domain deletion in Dsl1p, mutating the tryptophan-based motif-binding site in yeast causes defects in both growth and carboxypeptidase Y trafficking/processing. PMID:26578768

Kinetics of Cation and Oxyanion Adsorption and Desorption on Ferrihydrite: Roles of Ferrihydrite Binding Sites and a Unified Model.

PubMed

Tian, Lei; Shi, Zhenqing; Lu, Yang; Dohnalkova, Alice C; Lin, Zhang; Dang, Zhi

2017-09-19

Quantitative understanding the kinetics of toxic ion reactions with various heterogeneous ferrihydrite binding sites is crucial for accurately predicting the dynamic behavior of contaminants in environment. In this study, kinetics of As(V), Cr(VI), Cu(II), and Pb(II) adsorption and desorption on ferrihydrite was studied using a stirred-flow method, which showed that metal adsorption/desorption kinetics was highly dependent on the reaction conditions and varied significantly among four metals. High resolution scanning transmission electron microscopy coupled with energy-dispersive X-ray spectroscopy showed that all four metals were distributed within the ferrihydrite aggregates homogeneously after adsorption reactions. Based on the equilibrium model CD-MUSIC, we developed a novel unified kinetics model applicable for both cation and oxyanion adsorption and desorption on ferrihydrite, which is able to account for the heterogeneity of ferrihydrite binding sites, different binding properties of cations and oxyanions, and variations of solution chemistry. The model described the kinetic results well. We quantitatively elucidated how the equilibrium properties of the cation and oxyanion binding to various ferrihydrite sites and the formation of various surface complexes controlled the adsorption and desorption kinetics at different reaction conditions and time scales. Our study provided a unified modeling method for the kinetics of ion adsorption/desorption on ferrihydrite.

Comparison of (/sup 3/H)nicotine and (/sup 3/H)acetylcholine binding in mouse brain: regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sershen, H.; Reith, M.E.; Hashim, A.

1985-06-01

In a continuing study of nicotine binding sites, the authors determined the relative amount of nicotine binding and acetylcholine binding in various brain regions of C57/BL and of DBA mice. Although midbrain showed the highest and cerebellum the lowest binding for both (/sup 3/H)nicotine and (/sup 3/H)acetylcholine, the ratio of nicotine to acetylcholine binding showed a three-fold regional variation. Acetylcholine inhibition of (/sup 3/H)nicotine binding indicated that a portion of nicotine binding was not inhibited by acetylcholine. These results indicate important differences between the binding of (+/-)-(/sup 3/H)nicotine and that of (/sup 3/H)acetylcholine.

Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

PubMed Central

2015-01-01

ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

Binding-Site Assessment by Virtual Fragment Screening

PubMed Central

Huang, Niu; Jacobson, Matthew P.

2010-01-01

The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules) would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock ∼11000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors. PMID:20404926

The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

PubMed

Wang, Jinling; de Montellano, Paul R Ortiz

2003-05-30

Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

Recognition of Mannosylated Ligands and Influenza A Virus by Human Surfactant Protein D: Contributions of an Extended Site and Residue 343

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crouch, E.; Hartshorn, K; Horlacher, T

2009-01-01

Surfactant protein D (SP-D) plays important roles in antiviral host defense. Although SP-D shows a preference for glucose/maltose, the protein also recognizes d-mannose and a variety of mannose-rich microbial ligands. This latter preference prompted an examination of the mechanisms of mannose recognition, particularly as they relate to high-mannose viral glycans. Trimeric neck plus carbohydrate recognition domains from human SP-D (hNCRD) preferred ?1-2-linked dimannose (DM) over the branched trimannose (TM) core, ?1-3 or ?1-6 DM, or d-mannose. Previous studies have shown residues flanking the carbohydrate binding site can fine-tune ligand recognition. A mutant with valine at 343 (R343V) showed enhanced bindingmore » to mannan relative to wild type and R343A. No alteration in affinity was observed for d-mannose or for ?1-3- or ?1-6-linked DM; however, substantially increased affinity was observed for ?1-2 DM. Both proteins showed efficient recognition of linear and branched subdomains of high-mannose glycans on carbohydrate microarrays, and R343V showed increased binding to a subset of the oligosaccharides. Crystallographic analysis of an R343V complex with 1,2-DM showed a novel mode of binding. The disaccharide is bound to calcium by the reducing sugar ring, and a stabilizing H-bond is formed between the 2-OH of the nonreducing sugar ring and Arg349. Although hNCRDs show negligible binding to influenza A virus (IAV), R343V showed markedly enhanced viral neutralizing activity. Hydrophobic substitutions for Arg343 selectively blocked binding of a monoclonal antibody (Hyb 246-05) that inhibits IAV binding activity. Our findings demonstrate an extended ligand binding site for mannosylated ligands and the significant contribution of the 343 side chain to specific recognition of multivalent microbial ligands, including high-mannose viral glycans.« less

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

CD/MCD/VTVH-MCD Studies of Escherichia coli Bacterioferritin Support a Binuclear Iron Cofactor Site.

PubMed

Kwak, Yeonju; Schwartz, Jennifer K; Huang, Victor W; Boice, Emily; Kurtz, Donald M; Solomon, Edward I

2015-12-01

Ferritins and bacterioferritins (Bfrs) utilize a binuclear non-heme iron binding site to catalyze oxidation of Fe(II), leading to formation of an iron mineral core within a protein shell. Unlike ferritins, in which the diiron site binds Fe(II) as a substrate, which then autoxidizes and migrates to the mineral core, the diiron site in Bfr has a 2-His/4-carboxylate ligand set that is commonly found in diiron cofactor enzymes. Bfrs could, therefore, utilize the diiron site as a cofactor rather than for substrate iron binding. In this study, we applied circular dichroism (CD), magnetic CD (MCD), and variable-temperature, variable-field MCD (VTVH-MCD) spectroscopies to define the geometric and electronic structures of the biferrous active site in Escherichia coli Bfr. For these studies, we used an engineered M52L variant, which is known to eliminate binding of a heme cofactor but to have very minor effects on either iron oxidation or mineral core formation. We also examined an H46A/D50A/M52L Bfr variant, which additionally disrupts a previously observed mononuclear non-heme iron binding site inside the protein shell. The spectral analyses define a binuclear and an additional mononuclear ferrous site. The biferrous site shows two different five-coordinate centers. After O2 oxidation and re-reduction, only the mononuclear ferrous signal is eliminated. The retention of the biferrous but not the mononuclear ferrous site upon O2 cycling supports a mechanism in which the binuclear site acts as a cofactor for the O2 reaction, while the mononuclear site binds the substrate Fe(II) that, after its oxidation to Fe(III), migrates to the mineral core.

[Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].

PubMed

Gong, Y; Deng, C; Li, S; Li, L; Guan, J

1995-03-01

Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.

Interaction of D-LSD with binding sites in brain: a study in vivo and in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebersole, B.L.J.

The localization of (/sup 3/H)-d-lysergic acid diethylamide ((/sup 3/H)LSD) binding sites in the mouse brain was compared in vivo and in vitro. Radioautography of brain sections incubated with (/sup 3/H)LSD in vitro revealed substantial specific (/sup 3/H)LSD binding in cortical layers III-IV and areas CA1 and dentate gyrus in hippocampus. In contrast, in brain sections from animals that received (/sup 3/H)LSD in vivo, binding in hippocampus was scant and diffuse, although the pattern of labeling in cortex was similar to that seen in vitro. The low specific binding in hippocampus relative to cortex was confirmed by homogenate filtration studies ofmore » brain areas from mice that received injections of (/sup 3/H)LSD. Time-course studies established that peak specific binding at ten minutes was the same in cortex and hippocampus. At all times, binding in hippocampus was about one-third of that in cortex; in contrast, the concentration of free (/sup 3/H)LSD did not vary between regions. This finding was unexpected, because binding studies in vitro in membrane preparations indicated that the density and affinity of (/sup 3/H)LSD binding sites were similar in both brain regions. Saturation binding studies in vivo showed that the lower amount of (/sup 3/H)LSD binding in hippocampus was attributable to a lower density of sites labeled by (/sup 3/H)LSD. The pharmacological identify of (/sub 3/H)LSD binding sites in vivo may be relevant to the hallucinogenic properties of LSD and of other related hallucinogens.« less

Translational autocontrol of the Escherichia coli hfq RNA chaperone gene.

PubMed

Vecerek, Branislav; Moll, Isabella; Bläsi, Udo

2005-06-01

The conserved bacterial RNA chaperone Hfq has been shown to play an important role in post-transcriptional regulation. Here, we demonstrate that Hfq synthesis is autoregulated at the translational level. We have mapped two Hfq binding sites in the 5'-untranslated region of hfq mRNA and show that Hfq binding inhibits formation of the translation initiation complex. In vitro translation and in vivo studies further revealed that Hfq binding to both sites is required for efficient translational repression of hfq mRNA.

microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

PubMed

Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

2017-02-01

We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

Analysis of an artificial zinc finger epigenetic modulator: widespread binding but limited regulation

PubMed Central

Grimmer, Matthew R.; Stolzenburg, Sabine; Ford, Ethan; Lister, Ryan; Blancafort, Pilar; Farnham, Peggy J.

2014-01-01

Artificial transcription factors (ATFs) and genomic nucleases based on a DNA binding platform consisting of multiple zinc finger domains are currently being developed for clinical applications. However, no genome-wide investigations into their binding specificity have been performed. We have created six-finger ATFs to target two different 18 nt regions of the human SOX2 promoter; each ATF is constructed such that it contains or lacks a super KRAB domain (SKD) that interacts with a complex containing repressive histone methyltransferases. ChIP-seq analysis of the effector-free ATFs in MCF7 breast cancer cells identified thousands of binding sites, mostly in promoter regions; the addition of an SKD domain increased the number of binding sites ∼5-fold, with a majority of the new sites located outside of promoters. De novo motif analyses suggest that the lack of binding specificity is due to subsets of the finger domains being used for genomic interactions. Although the ATFs display widespread binding, few genes showed expression differences; genes repressed by the ATF-SKD have stronger binding sites and are more enriched for a 12 nt motif. Interestingly, epigenetic analyses indicate that the transcriptional repression caused by the ATF-SKD is not due to changes in active histone modifications. PMID:25122745

aPPRove: An HMM-Based Method for Accurate Prediction of RNA-Pentatricopeptide Repeat Protein Binding Events

PubMed Central

Harrison, Thomas; Ruiz, Jaime; Sloan, Daniel B.; Ben-Hur, Asa; Boucher, Christina

2016-01-01

Pentatricopeptide repeat containing proteins (PPRs) bind to RNA transcripts originating from mitochondria and plastids. There are two classes of PPR proteins. The P class contains tandem P-type motif sequences, and the PLS class contains alternating P, L and S type sequences. In this paper, we describe a novel tool that predicts PPR-RNA interaction; specifically, our method, which we call aPPRove, determines where and how a PLS-class PPR protein will bind to RNA when given a PPR and one or more RNA transcripts by using a combinatorial binding code for site specificity proposed by Barkan et al. Our results demonstrate that aPPRove successfully locates how and where a PPR protein belonging to the PLS class can bind to RNA. For each binding event it outputs the binding site, the amino-acid-nucleotide interaction, and its statistical significance. Furthermore, we show that our method can be used to predict binding events for PLS-class proteins using a known edit site and the statistical significance of aligning the PPR protein to that site. In particular, we use our method to make a conjecture regarding an interaction between CLB19 and the second intronic region of ycf3. The aPPRove web server can be found at www.cs.colostate.edu/~approve. PMID:27560805

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Control of Ion Selectivity in LeuT: Two Na+ Binding Sites with two different mechanisms

PubMed Central

Noskov, Sergei Y.; Roux, Benoît

2016-01-01

The x-ray structure of LeuT, a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporter, provides a great opportunity to better understand the molecular basis of monovalent cation selectivity in ion-coupled transporters. LeuT possesses two ion-binding sites, NA1 and NA2, which are highly selective for Na+. Extensive all-atom free energy molecular dynamics simulations of LeuT embedded in an explicit membrane are performed at different temperatures and various occupancy states of the binding sites to dissect the molecular mechanism of ion selectivity. The results show that the two binding sites display robust selectivity for Na+ over K+ or Li+, the competing ions of most similar radii. Of particular interest, the mechanism primarily responsible for selectivity for each of the two binding sites appears to be different. In site NA1, selectivity for Na+ over K+ arises predominantly from the strong electrostatic field arising from the negatively charged carboxylate group of the leucine substrate coordinating the ion directly. In site NA2, which comprises only neutral ligands, selectivity for Na+ is enforced by the local structural restraints arising from the hydrogen-bonding network and the covalent connectivity of the poly-peptide chain surrounding the ion according to a snug-fit mechanism. PMID:18280500

Heterogeneity of binding of muscarinic receptor antagonists in rat brain homogenates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, J.H.; el-Fakahany, E.E.

1985-06-01

The binding properties of (-)-(/sup 3/H)quinuclidinyl benzilate and (/sup 3/H) N-methylscopolamine to muscarinic acetylcholine receptors have been investigated in rat brain homogenates. The binding of both antagonists demonstrated high affinity and saturability. Analysis of the binding data resulted in linear Scatchard plots. However, (-)-(/sup 3/H)quinuclidinyl benzilate showed a significantly higher maximal binding capacity than that of (/sup 3/H)N-methylscopolamine. Displacement of both ligands with several muscarinic receptor antagonists resulted in competition curves in accordance with the law of mass-action for quinuclidinyl benzilate, atropine and scopolamine. A similar profile was found for the quaternary ammonium analogs of atropine and scopolamine when (/supmore » 3/H)N-methylscopolamine was used to label the receptors. However, when these hydrophilic antagonists were used to displace (-)-(/sup 3/H) quinuclidinyl benzilate binding, they showed interaction with high- and low-affinity binding sites. On the other hand, the nonclassical muscarinic receptor antagonist, pirenzepine, was able to displace both ligands from two binding sites. The present data are discussed in terms of the relationship of this anomalous heterogenity of binding of these hydrophilic muscarinic receptor antagonists and the proposed M1 and M2 receptor subtypes.« less

Human La binds mRNAs through contacts to the poly(A) tail.

PubMed

Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

2018-05-04

In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3'OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3'OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail.

Crystallographic Analysis Reveals a Novel Second Binding Site for Trimethoprim in Active Site Double Mutants of Human Dihydrofolate Reductase†,‡

PubMed Central

Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.

2011-01-01

In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339

Comparative studies on the human serum albumin binding of the clinically approved EGFR inhibitors gefitinib, erlotinib, afatinib, osimertinib and the investigational inhibitor KP2187.

PubMed

Dömötör, Orsolya; Pelivan, Karla; Borics, Attila; Keppler, Bernhard K; Kowol, Christian R; Enyedy, Éva A

2018-05-30

Binding interactions between human serum albumin (HSA) and four approved epidermal growth factor receptor (EGFR) inhibitors gefitinib (GEF), erlotinib (ERL), afatinib (AFA), osimertinib (OSI), as well as the experimental drug KP2187, were investigated by means of spectrofluorometric and molecular modelling methods. Steady-state and time resolved spectrofluorometric techniques were carried out, including direct quenching of protein fluorescence and site marker displacement measurements. Proton dissociation processes and solvent dependent fluorescence properties were investigated as well. The EGFR inhibitors were predominantly presented in their single protonated form (HL + ) at physiological pH except ERL, which is charge-neutral. Significant solvent dependent fluorescence properties were found for GEF, ERL and KP2187, namely their emission spectra show strong dependence on the polarity and the hydrogen bonding ability of the solvents. The inhibitors proved to be bound at site I of HSA (in subdomain IIA) in a weak-to-moderate fashion (logK' 3.9-4.9) using spectrofluorometry. OSI (logK' 4.3) and KP2187 can additionally bind in site II (in subdomain IIIA), while GEF, ERL and AFA clearly show no interaction here. Docking methods qualitatively confirmed binding site preferences of compounds GEF and KP2187, and indicated that they probably bind to HSA in their neutral forms. Binding constants calculated on the basis of the various experimental data indicate a weak-to-moderate binding on HSA, only OSI exhibits somewhat higher affinity towards this protein. However, model calculations performed at physiological blood concentrations of HSA resulted in high (ca. 90%) bound fractions for the inhibitors, highlighting the importance of plasma protein binding. Copyright © 2018 Elsevier B.V. All rights reserved.

Structure of the Mycobacterium tuberculosis D-Alanine:D-Alanine Ligase, a Target of the Antituberculosis Drug D-Cycloserine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruning, John B.; Murillo, Ana C.; Chacon, Ofelia

D-Alanine:D-alanine ligase (EC 6.3.2.4; Ddl) catalyzes the ATP-driven ligation of two D-alanine (D-Ala) molecules to form the D-alanyl:D-alanine dipeptide. This molecule is a key building block in peptidoglycan biosynthesis, making Ddl an attractive target for drug development. D-Cycloserine (DCS), an analog of D-Ala and a prototype Ddl inhibitor, has shown promise for the treatment of tuberculosis. Here, we report the crystal structure of Mycobacterium tuberculosis Ddl at a resolution of 2.1 {angstrom}. This structure indicates that Ddl is a dimer and consists of three discrete domains; the ligand binding cavity is at the intersection of all three domains and conjoinedmore » by several loop regions. The M. tuberculosis apo Ddl structure shows a novel conformation that has not yet been observed in Ddl enzymes from other species. The nucleotide and D-alanine binding pockets are flexible, requiring significant structural rearrangement of the bordering regions for entry and binding of both ATP and D-Ala molecules. Solution affinity and kinetic studies showed that DCS interacts with Ddl in a manner similar to that observed for D-Ala. Each ligand binds to two binding sites that have significant differences in affinity, with the first binding site exhibiting high affinity. DCS inhibits the enzyme, with a 50% inhibitory concentration (IC{sub 50}) of 0.37 mM under standard assay conditions, implicating a preferential and weak inhibition at the second, lower-affinity binding site. Moreover, DCS binding is tighter at higher ATP concentrations. The crystal structure illustrates potential drugable sites that may result in the development of more-effective Ddl inhibitors.« less

Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor.

PubMed

Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J

1993-11-01

Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth factors stimulate the phosphorylation of Nck and its association with autophosphorylated growth factor receptors. A panel of platelet-derived growth factor (PDGF) receptor mutations at tyrosine residues has been used to identify the Nck binding site. Here we show that mutation at Tyr-751 of the PDGF beta-receptor eliminates Nck binding both in vitro and in living cells. Moreover, the Y751F PDGF receptor mutant failed to mediate PDGF-stimulated phosphorylation of Nck in intact cells. A phosphorylated Tyr-751 is also required for binding of phosphatidylinositol-3 kinase to the PDGF receptor. Hence, the SH2 domains of p85 and Nck share a binding site in the PDGF receptor. Competition experiments with different phosphopeptides derived from the PDGF receptor suggest that binding of Nck and p85 is influenced by different residues around Tyr-751. Thus, a single tyrosine autophosphorylation site is able to link the PDGF receptor to two distinct SH2 domain-containing signaling molecules.

FINDSITE-metal: Integrating evolutionary information and machine learning for structure-based metal binding site prediction at the proteome level

PubMed Central

Brylinski, Michal; Skolnick, Jeffrey

2010-01-01

The rapid accumulation of gene sequences, many of which are hypothetical proteins with unknown function, has stimulated the development of accurate computational tools for protein function prediction with evolution/structure-based approaches showing considerable promise. In this paper, we present FINDSITE-metal, a new threading-based method designed specifically to detect metal binding sites in modeled protein structures. Comprehensive benchmarks using different quality protein structures show that weakly homologous protein models provide sufficient structural information for quite accurate annotation by FINDSITE-metal. Combining structure/evolutionary information with machine learning results in highly accurate metal binding annotations; for protein models constructed by TASSER, whose average Cα RMSD from the native structure is 8.9 Å, 59.5% (71.9%) of the best of top five predicted metal locations are within 4 Å (8 Å) from a bound metal in the crystal structure. For most of the targets, multiple metal binding sites are detected with the best predicted binding site at rank 1 and within the top 2 ranks in 65.6% and 83.1% of the cases, respectively. Furthermore, for iron, copper, zinc, calcium and magnesium ions, the binding metal can be predicted with high, typically 70-90%, accuracy. FINDSITE-metal also provides a set of confidence indexes that help assess the reliability of predictions. Finally, we describe the proteome-wide application of FINDSITE-metal that quantifies the metal binding complement of the human proteome. FINDSITE-metal is freely available to the academic community at http://cssb.biology.gatech.edu/findsite-metal/. PMID:21287609

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubocovich, M.L.; Takahashi, J.S.

2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

PubMed Central

Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

2010-01-01

The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

A spectroscopic study of phenylbutazone and aspirin bound to serum albumin in rheumatoid diseases

NASA Astrophysics Data System (ADS)

Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka-Zubik, J.; Sułkowski, W. W.

2011-11-01

Interaction of phenylbutazone (PBZ) and aspirin (ASA), two drugs recommended in rheumatoid diseases (RDs), when binding to human (HSA) and bovine (BSA) serum albumins, has been studied by quenching of fluorescence and proton nuclear magnetic resonance ( 1HNMR) techniques. On the basis of spectrofluorescence measurements high affinity binding sites of PBZ and ASA on albumin as well as their interaction within the binding sites were described. A low affinity binding site has been studied by proton nuclear magnetic resonance spectroscopy. Using fluorescence spectroscopy the location of binding site in serum albumin (SA) for PBZ and ASA was found. Association constants Ka were determined for binary (i.e. PBZ-SA and ASA-SA) and ternary complexes (i.e. PBZ-[ASA]-SA and ASA-[PBZ]-SA). PBZ and ASA change the affinity of each other to the binding site in serum albumin (SA). The presence of ASA causes the increase of association constants KaI of PBZ-SA complex. Similarly, PBZ influences KaI of ASA-SA complex. This phenomenon shows that the strength of binding and the stability of the complexes increase in the presence of the second drug. The decrease of KaII values suggests that the competition between PBZ and ASA in binding to serum albumin in the second class of binding sites occurs. The analysis of 1HNMR spectral parameters i.e. changes of chemical shifts and relaxation times of the drug indicate that the presence of ASA weakens the interaction of PBZ with albumin. Similarly PBZ weakens the interaction of ASA with albumin. This conclusion points to the necessity of using a monitoring therapy owning to the possible increase of uncontrolled toxic effects.

Influence of myristic acid on furosemide binding to bovine serum albumin. Comparison with furosemide-human serum albumin complex

NASA Astrophysics Data System (ADS)

Bojko, B.; Sułkowska, A.; Maciążek-Jurczyk, M.; Równicka, J.; Sułkowski, W. W.

2010-06-01

Fluorescence studies on furosemide (FUR) binding to bovine serum albumin (BSA) showed the existence of three or four binding sites in the tertiary structure of the protein. Two of them are located in subdomain IIA, while the others in subdomains IB and/or IIIA. Furosemide binding in subdomain IB is postulated on the basis of run of Stern-Volmer plot indicating the existence of two populations of tryptophans involved in the interaction with FUR. In turn, the significant participation of tyrosil residues in complex formation leads to the consideration of the subdomain IIIA as furosemide low-affinity binding site. The effect of increasing concentration of fatty acid on FUR binding in all studied binding sites was also investigated and compared with the previous results obtained for human serum albumin (HSA). For BSA the lesser impact of fatty acid on affinity between drug and albumin was observed. This is probably a result of more significant role of tyrosines in the complex formation and different polarity of microenvironment of the fluorophores when compared HSA and BSA. The most distinct differences between FUR-BSA and FUR-HSA binding parameters are observed when third fatty acid molecule is bound with the protein and rotation of domains I and II occurs. However these structural changes mostly affect FUR low affinity binding sites.

Structural basis for collagen recognition by the immune receptor OSCAR.

PubMed

Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

2016-02-04

The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

Locations of Halide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Adimurthy, Ganapathi; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions play an important role in the crystallization of lysozyme, and are known to bind to the crystalline protein. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. Studies using other approaches have reported more chloride ion binding sites, but their locations were not known. Knowing the precise location of these anions is also useful in determining the correct electrostatic fields surrounding the protein. In the first part of this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from the lysozyme crystals grown in bromide and chloride solutions under identical conditions. The anion locations were then obtained from standard crystallographic methods and five possible anion binding sites were found in this manner. The sole chloride ion binding site found in previous studies was confirmed. The remaining four sites were new ones for tetragonal lysozyme crystals. However, three of these new sites and the previously found one corresponded to the four unique binding sites found for nitrate ions in monoclinic crystals. This suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed. It is unlikely that there are many more anions in the tetragonal lysozyme crystal structure. Assuming osmotic equilibrium it can be shown that there are at most three more anions in the crystal channels. Some of the new anion binding sites found in this study were, as expected, in pockets containing basic residues. However, some of them were near neutral, but polar, residues. Thus, the study also showed the importance of uncharged, but polar groups, on the protein surface in determining its electrostatic field. This was important for the second part of this study where the electrostatic field surrounding the protein was accurately determined. This was achieved by solving the linearized version of the Poisson-Boltzmann equation for the protein in solution. The solution was computed employing the commercial code Delphi which uses a finite difference technique. This has recently become available as a module in the general protein visualization code Insight II. Partial charges were assigned to the polar groups of lysozyme for the calculations done here. The calculations showed the complexity of the electrostatic field surrounding the protein. Although most of the region near the protein surface had a positive field strength, the active site cleft was negatively charged and this was projected a considerable distance. This might explain the occurrence of "head-to-side" interactions in the formation of lysozyme aggregates in solution. Pockets of high positive field strength were also found in the vicinity of the anion locations obtained from the crystallographic part of this study, confirming the validity of these calculations. This study clearly shows not only the importance of determining the counterion locations in protein crystals and the electrostatic fields surrounding the protein, but also the advantage of performing them together.

Characterization of the interaction between furosemide and bovine serum albumin

NASA Astrophysics Data System (ADS)

Zhou, Neng; Liang, Yi-Zeng; Wang, Ping

2008-01-01

The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.

Copper Coordination in the Full-Length, Recombinant Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Legname, Giuseppe; Prusiner, Stanley B.; Antholine, William E.; Gerfen, Gary J.; Peisach, Jack; Millhauser, Glenn L.

2010-01-01

The prion protein (PrP) binds divalent copper at physiologically relevant conditions and is believed to participate in copper regulation or act as a copper-dependent enzyme. Ongoing studies aim at determining the molecular features of the copper binding sites. The emerging consensus is that most copper binds in the octarepeat domain, which is composed of four or more copies of the fundamental sequence PHGGGWGQ. Previous work from our laboratory using PrP-derived peptides, in conjunction with EPR and X-ray crystallography, demonstrated that the HGGGW segment constitutes the fundamental binding unit in the octarepeat domain [Burns et al. (2002) Biochemistry 41, 3991–4001; Aronoff-Spencer et al. (2000) Biochemistry 39, 13760–13771]. Copper coordination arises from the His imidazole and sequential deprotonated glycine amides. In this present work, recombinant, full-length Syrian hamster PrP is investigated using EPR methodologies. Four copper ions are taken up in the octarepeat domain, which supports previous findings. However, quantification studies reveal a fifth binding site in the flexible region between the octarepeats and the PrP globular C-terminal domain. A series of PrP peptide constructs show that this site involves His96 in the PrP(92–96) segment GGGTH. Further examination by X-band EPR, S-band EPR, and electron spin–echo envelope spectroscopy, demonstrates coordination by the His96 imidazole and the glycine preceding the threonine. The copper affinity for this type of binding site is highly pH dependent, and EPR studies here show that recombinant PrP loses its affinity for copper below pH 6.0. These studies seem to provide a complete profile of the copper binding sites in PrP and support the hypothesis that PrP function is related to its ability to bind copper in a pH-dependent fashion. PMID:12779334

Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

PubMed

Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

2003-08-01

Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

Calmodulin binds to inv protein: implication for the regulation of inv function.

PubMed

Yasuhiko, Y; Imai, F; Ookubo, K; Takakuwa, Y; Shiokawa, K; Yokoyama, T

2001-12-01

Establishment of the left-right asymmetry of internal organs is essential for the normal development of vertebrates. The inv mutant in mice shows a constant reversal of left-right asymmetry and although the inv gene has been cloned, its biochemical and cell biological functions have not been defined. Here, we show that calmodulin binds to mouse inv protein at two sites (IQ1 and IQ2). The binding of calmodulin to the IQ2 site occurs in the absence of Ca(2+) and is not observed in the presence of Ca(2+). Injection of mouse inv mRNA into the right blastomere of Xenopus embryos at the two-cell stage randomized the left-right asymmetry of the embryo and altered the patterns of Xnr-1 and Pitx2 expression. Importantly, inv mRNA that lacked the region encoding the IQ2 site was unable to randomize left-right asymmetry in Xenopus embryos, implying that the IQ2 site is essential for inv to randomize left-right asymmetry in Xenopus. These results suggest that calmodulin binding may regulate inv function. Based on our findings, we propose a model for the regulation of inv function by calcium-calmodulin and discuss its implications.

Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1.

PubMed

Malina, Jaroslav; Scott, Peter; Brabec, Viktor

2015-06-23

Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

A role for heterochromatin protein 1γ at human telomeres

PubMed Central

Canudas, Silvia; Houghtaling, Benjamin R.; Bhanot, Monica; Sasa, Ghadir; Savage, Sharon A.; Bertuch, Alison A.; Smith, Susan

2011-01-01

Human telomere function is mediated by shelterin, a six-subunit complex that is required for telomere replication, protection, and cohesion. TIN2, the central component of shelterin, has binding sites to three subunits: TRF1, TRF2, and TPP1. Here we identify a fourth partner, heterochromatin protein 1γ (HP1γ), that binds to a conserved canonical HP1-binding motif, PXVXL, in the C-terminal domain of TIN2. We show that HP1γ localizes to telomeres in S phase, where it is required to establish/maintain cohesion. We further demonstrate that the HP1-binding site in TIN2 is required for sister telomere cohesion and can impact telomere length maintenance by telomerase. Remarkably, the PTVML HP1-binding site is embedded in the recently identified cluster of mutations in TIN2 that gives rise to dyskeratosis congenita (DC), an inherited bone marrow failure syndrome caused by defects in telomere maintenance. We show that DC-associated mutations in TIN2 abrogate binding to HP1γ and that DC patient cells are defective in sister telomere cohesion. Our data indicate a novel requirement for HP1γ in the establishment/maintenance of cohesion at human telomeres and, furthermore, may provide insight into the mechanism of pathogenesis in TIN2-mediated DC. PMID:21865325

The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

PubMed Central

Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

2014-01-01

Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

Prediction of Ordered Water Molecules in Protein Binding Sites from Molecular Dynamics Simulations: The Impact of Ligand Binding on Hydration Networks.

PubMed

Rudling, Axel; Orro, Adolfo; Carlsson, Jens

2018-02-26

Water plays a major role in ligand binding and is attracting increasing attention in structure-based drug design. Water molecules can make large contributions to binding affinity by bridging protein-ligand interactions or by being displaced upon complex formation, but these phenomena are challenging to model at the molecular level. Herein, networks of ordered water molecules in protein binding sites were analyzed by clustering of molecular dynamics (MD) simulation trajectories. Locations of ordered waters (hydration sites) were first identified from simulations of high resolution crystal structures of 13 protein-ligand complexes. The MD-derived hydration sites reproduced 73% of the binding site water molecules observed in the crystal structures. If the simulations were repeated without the cocrystallized ligands, a majority (58%) of the crystal waters in the binding sites were still predicted. In addition, comparison of the hydration sites obtained from simulations carried out in the absence of ligands to those identified for the complexes revealed that the networks of ordered water molecules were preserved to a large extent, suggesting that the locations of waters in a protein-ligand interface are mainly dictated by the protein. Analysis of >1000 crystal structures showed that hydration sites bridged protein-ligand interactions in complexes with different ligands, and those with high MD-derived occupancies were more likely to correspond to experimentally observed ordered water molecules. The results demonstrate that ordered water molecules relevant for modeling of protein-ligand complexes can be identified from MD simulations. Our findings could contribute to development of improved methods for structure-based virtual screening and lead optimization.

Experimental determination and modeling of arsenic complexation with humic and fulvic acids.

PubMed

Fakour, Hoda; Lin, Tsair-Fuh

2014-08-30

The complexation of humic acid (HA) and fulvic acid (FA) with arsenic (As) in water was studied. Experimental results indicate that arsenic may form complexes with HA and FA with a higher affinity for arsenate than for arsenite. With the presence of iron oxide based adsorbents, binding of arsenic to HA/FA in water was significantly suppressed, probably due to adsorption of As and HA/FA. A two-site ligand binding model, considering only strong and weak site types of binding affinity, was successfully developed to describe the complexation of arsenic on the two natural organic fractions. The model showed that the numbers of weak sites were more than 10 times those of strong sites on both HA and FA for both arsenic species studied. The numbers of both types of binding sites were found to be proportional to the HA concentrations, while the apparent stability constants, defined for describing binding affinity between arsenic and the sites, are independent of the HA concentrations. To the best of our knowledge, this is the first study to characterize the impact of HA concentrations on the applicability of the ligand binding model, and to extrapolate the model to FA. The obtained results may give insights on the complexation of arsenic in HA/FA laden groundwater and on the selection of more effective adsorption-based treatment methods for natural waters. Copyright © 2014 Elsevier B.V. All rights reserved.

Probing binding hot spots at protein-RNA recognition sites.

PubMed

Barik, Amita; Nithin, Chandran; Karampudi, Naga Bhushana Rao; Mukherjee, Sunandan; Bahadur, Ranjit Prasad

2016-01-29

We use evolutionary conservation derived from structure alignment of polypeptide sequences along with structural and physicochemical attributes of protein-RNA interfaces to probe the binding hot spots at protein-RNA recognition sites. We find that the degree of conservation varies across the RNA binding proteins; some evolve rapidly compared to others. Additionally, irrespective of the structural class of the complexes, residues at the RNA binding sites are evolutionary better conserved than those at the solvent exposed surfaces. For recognitions involving duplex RNA, residues interacting with the major groove are better conserved than those interacting with the minor groove. We identify multi-interface residues participating simultaneously in protein-protein and protein-RNA interfaces in complexes where more than one polypeptide is involved in RNA recognition, and show that they are better conserved compared to any other RNA binding residues. We find that the residues at water preservation site are better conserved than those at hydrated or at dehydrated sites. Finally, we develop a Random Forests model using structural and physicochemical attributes for predicting binding hot spots. The model accurately predicts 80% of the instances of experimental ΔΔG values in a particular class, and provides a stepping-stone towards the engineering of protein-RNA recognition sites with desired affinity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Active sites prediction and binding analysis E1-E2 protein human papillomavirus with biphenylsulfonacetic acid

NASA Astrophysics Data System (ADS)

Iryani, I.; Amelia, F.; Iswendi, I.

2018-04-01

Cervix cancer triggered by Human papillomavirus infection is the second cause to woman death in worldwide. The binding site of E1-E2 protein of HPV 16 is not known from a 3-D structure yet, so in this study we address this issue to study the structure of E1-E2 protein from Human papillomavirus type 16 and to find its potential binding sites using biphenylsulfonacetic acid as inhibitor. Swiss model was used for 3D structure prediction and PDB: 2V9P (E1 protein) and 2NNU (E2 protein) having 52.32% and 100% identity respectively was selected as a template. The 3D model structure developed of E1 and E2 in the core and allowed regions were 99.2% and 99.5%. The ligand binding sites were predicted using online server meta pocket 2.0 and MOE 2009.10 was used for docking. E1-and E2 protein of HPV-16 has three potential binding site that can interact with the inhibitors. The Docking biphenylsulfonacetic acid using these binding sites shows that ligand interact with the protein through hydrogen bonds on Lys 403, Arg 410, His 551 in the first pocket, on Tyr 32, Leu 99 in the second pocket, and Lys 558m Lys 517 in the third pocket.

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

Binding of vitamin A with milk α- and β-caseins.

PubMed

Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

2013-05-01

The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

PubMed Central

Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

2012-01-01

DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

Understanding the mechanisms of protein-DNA interactions

NASA Astrophysics Data System (ADS)

Lavery, Richard

2004-03-01

Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

iCLIP Predicts the Dual Splicing Effects of TIA-RNA Interactions

PubMed Central

Briese, Michael; Zarnack, Kathi; Luscombe, Nicholas M.; Rot, Gregor; Zupan, Blaž; Curk, Tomaž; Ule, Jernej

2010-01-01

The regulation of alternative splicing involves interactions between RNA-binding proteins and pre-mRNA positions close to the splice sites. T-cell intracellular antigen 1 (TIA1) and TIA1-like 1 (TIAL1) locally enhance exon inclusion by recruiting U1 snRNP to 5′ splice sites. However, effects of TIA proteins on splicing of distal exons have not yet been explored. We used UV-crosslinking and immunoprecipitation (iCLIP) to find that TIA1 and TIAL1 bind at the same positions on human RNAs. Binding downstream of 5′ splice sites was used to predict the effects of TIA proteins in enhancing inclusion of proximal exons and silencing inclusion of distal exons. The predictions were validated in an unbiased manner using splice-junction microarrays, RT-PCR, and minigene constructs, which showed that TIA proteins maintain splicing fidelity and regulate alternative splicing by binding exclusively downstream of 5′ splice sites. Surprisingly, TIA binding at 5′ splice sites silenced distal cassette and variable-length exons without binding in proximity to the regulated alternative 3′ splice sites. Using transcriptome-wide high-resolution mapping of TIA-RNA interactions we evaluated the distal splicing effects of TIA proteins. These data are consistent with a model where TIA proteins shorten the time available for definition of an alternative exon by enhancing recognition of the preceding 5′ splice site. Thus, our findings indicate that changes in splicing kinetics could mediate the distal regulation of alternative splicing. PMID:21048981

Characterization of Conserved Tandem Donor Sites and Intronic Motifs Required for Alternative Splicing in Corticosteroid Receptor Genes

PubMed Central

Qian, Xiaoxiao; Matthews, Laura; Lightman, Stafford; Ray, David; Norman, Michael

2015-01-01

Alternative splicing events from tandem donor sites result in mRNA variants coding for additional amino acids in the DNA binding domain of both the glucocorticoid (GR) and mineralocorticoid (MR) receptors. We now show that expression of both splice variants is extensively conserved in mammalian species, providing strong evidence for their functional significance. An exception to the conservation of the MR tandem splice site (an A at position +5 of the MR+12 donor site in the mouse) was predicted to decrease U1 small nuclear RNA binding. In accord with this prediction, we were unable to detect the MR+12 variant in this species. The one exception to the conservation of the GR tandem splice site, an A at position +3 of the platypus GRγ donor site that was predicted to enhance binding of U1 snRNA, was unexpectedly associated with decreased expression of the variant from the endogenous gene as well as a minigene. An intronic pyrimidine motif present in both GR and MR genes was found to be critical for usage of the downstream donor site, and overexpression of TIA1/TIAL1 RNA binding proteins, which are known to bind such motifs, led to a marked increase in the proportion of GRγ and MR+12. These results provide striking evidence for conservation of a complex splicing mechanism that involves processes other than stochastic spliceosome binding and identify a mechanism that would allow regulation of variant expression. PMID:19819975

HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

PubMed Central

Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

1996-01-01

HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

Binding Isotope Effects for para-Aminobenzoic Acid with Dihydropteroate Synthase from Staphylococcus aureus and Plasmodium falciparum.

PubMed

Stratton, Christopher F; Namanja-Magliano, Hilda A; Cameron, Scott A; Schramm, Vern L

2015-10-16

Dihydropteroate synthase is a key enzyme in folate biosynthesis and is the target of the sulfonamide class of antimicrobials. Equilibrium binding isotope effects and density functional theory calculations indicate that the substrate binding sites for para-aminobenzoic acid on the dihydropteroate synthase enzymes from Staphylococcus aureus and Plasmodium falciparum present distinct chemical environments. Specifically, we show that para-aminobenzoic acid occupies a more sterically constrained vibrational environment when bound to dihydropteroate synthase from P. falciparum relative to that of S. aureus. Deletion of a nonhomologous, parasite-specific insert from the plasmodial dihydropteroate synthase abrogated the binding of para-aminobenzoic acid. The loop specific to P. falciparum is important for effective substrate binding and therefore plays a role in modulating the chemical environment at the substrate binding site.

Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Y.; Li, H.; Li, Hua

2009-04-28

Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings,more » we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.« less

Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

PubMed Central

Harada, Yoichiro; Li, Hua; Li, Huilin; Lennarz, William J.

2009-01-01

Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of ≈1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes. PMID:19365066

Electrostatically Biased Binding of Kinesin to Microtubules

PubMed Central

Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

2011-01-01

The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

Human Blue Cone Opsin Regeneration Involves Secondary Retinal Binding with Analog Specificity.

PubMed

Srinivasan, Sundaramoorthy; Fernández-Sampedro, Miguel A; Morillo, Margarita; Ramon, Eva; Jiménez-Rosés, Mireia; Cordomí, Arnau; Garriga, Pere

2018-03-27

Human color vision is mediated by the red, green, and blue cone visual pigments. Cone opsins are G-protein-coupled receptors consisting of an opsin apoprotein covalently linked to the 11-cis-retinal chromophore. All visual pigments share a common evolutionary origin, and red and green cone opsins exhibit a higher homology, whereas blue cone opsin shows more resemblance to the dim light receptor rhodopsin. Here we show that chromophore regeneration in photoactivated blue cone opsin exhibits intermediate transient conformations and a secondary retinoid binding event with slower binding kinetics. We also detected a fine-tuning of the conformational change in the photoactivated blue cone opsin binding site that alters the retinal isomer binding specificity. Furthermore, the molecular models of active and inactive blue cone opsins show specific molecular interactions in the retinal binding site that are not present in other opsins. These findings highlight the differential conformational versatility of human cone opsin pigments in the chromophore regeneration process, particularly compared to rhodopsin, and point to relevant functional, unexpected roles other than spectral tuning for the cone visual pigments. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12.

PubMed

Zúñiga-Navarrete, Fernando; Gómez, Isabel; Peña, Guadalupe; Amaro, Itzel; Ortíz, Ernesto; Becerril, Baltazar; Ibarra, Jorge E; Bravo, Alejandra; Soberón, Mario

2015-04-01

Bacillus thuringiensis Cry toxins exert their toxic effect by specific recognition of larval midgut proteins leading to oligomerization of the toxin, membrane insertion and pore formation. The exposed domain II loop regions of Cry toxins have been shown to be involved in receptor binding. Insect cadherins have shown to be functionally involved in toxin binding facilitating toxin oligomerization. Here, we isolated a VHH (VHHA5) antibody by phage display that binds Cry3Aa loop 1 and competed with the binding of Cry3Aa to Tenebrio molitor brush border membranes. VHHA5 also competed with the binding of Cry3Aa to a cadherin fragment (CR12) that was previously shown to be involved in binding and toxicity of Cry3Aa, indicating that Cry3Aa binds CR12 through domain II loop 1. Moreover, we show that a loop 1 mutant, previously characterized to have increased toxicity to T. molitor, displayed a correlative enhanced binding affinity to T. molitor CR12 and to VHHA5. These results show that Cry3Aa domain II loop 1 is a binding site of CR12 T. molitor cadherin. Copyright © 2015 Elsevier Ltd. All rights reserved.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

From small sweeteners to sweet proteins: anatomy of the binding sites of the human T1R2_T1R3 receptor.

PubMed

Morini, Gabriella; Bassoli, Angela; Temussi, Piero A

2005-08-25

The sweet taste receptor, a heterodimeric G protein coupled receptor (GPCR) protein, formed by the T1R2 and T1R3 subunits, recognizes several sweet compounds including carbohydrates, amino acids, peptides, proteins, and synthetic sweeteners. Its similarity with the metabotropic glutamate mGluR1 receptor allowed us to build homology models. All possible dimers formed by combinations of the human T1R2 and T1R3 subunits, modeled on the A (closed) or B (open) chains of the extracellular ligand binding domain of the mGluR1 template, yield four ligand binding sites for low-molecular-weight sweeteners. These sites were probed by docking a set of molecules representative of all classes of sweet compounds and calculating the free energy of ligand binding. These sites are not easily accessible to sweet proteins, but docking experiments in silico showed that sweet proteins can bind to a secondary site without entering the deep cleft. Our models account for many experimental observations on the tastes of sweeteners, including sweetness synergy, and can help to design new sweeteners.

Three-dimensional structure of thymidine phosphorylase from E. coli in complex with 3'-azido-2'-fluoro-2',3'-dideoxyuridine

NASA Astrophysics Data System (ADS)

Timofeev, V. I.; Abramchik, Yu. A.; Fateev, I. V.; Zhukhlistova, N. E.; Murav'eva, T. I.; Kuranova, I. P.; Esipov, R. S.

2013-11-01

The three-dimensional structures of thymidine phosphorylase from E. coli containing the bound sulfate ion in the phosphate-binding site and of the complex of thymidine phosphorylase with sulfate in the phosphate-binding site and the inhibitor 3'-azido-2'-fluoro-2',3'-dideoxyuridine (N3F-ddU) in the nucleoside-binding site were determined at 1.55 and 1.50 Å resolution, respectively. The amino-acid residues involved in the ligand binding and the hydrogen-bond network in the active site occupied by a large number of bound water molecules are described. A comparison of the structure of thymidine phosphorylase in complex with N3F-ddU with the structure of pyrimidine nucleoside phosphorylase from St. Aureus in complex with the natural substrate thymidine (PDB_ID: 3H5Q) shows that the substrate and the inhibitor in the nucleoside-binding pocket have different orientations. It is suggested that the position of N3F-ddU can be influenced by the presence of the azido group, which prefers a hydrophobic environment. In both structures, the active sites of the subunits are in the open conformation.

Structural and functional characterization of cargo-binding sites on the μ4-subunit of adaptor protein complex 4.

PubMed

Ross, Breyan H; Lin, Yimo; Corales, Esteban A; Burgos, Patricia V; Mardones, Gonzalo A

2014-01-01

Adaptor protein (AP) complexes facilitate protein trafficking by playing key roles in the selection of cargo molecules to be sorted in post-Golgi compartments. Four AP complexes (AP-1 to AP-4) contain a medium-sized subunit (μ1-μ4) that recognizes YXXØ-sequences (Ø is a bulky hydrophobic residue), which are sorting signals in transmembrane proteins. A conserved, canonical region in μ subunits mediates recognition of YXXØ-signals by means of a critical aspartic acid. Recently we found that a non-canonical YXXØ-signal on the cytosolic tail of the Alzheimer's disease amyloid precursor protein (APP) binds to a distinct region of the μ4 subunit of the AP-4 complex. In this study we aimed to determine the functionality of both binding sites of μ4 on the recognition of the non-canonical YXXØ-signal of APP. We found that substitutions in either binding site abrogated the interaction with the APP-tail in yeast-two hybrid experiments. Further characterization by isothermal titration calorimetry showed instead loss of binding to the APP signal with only the substitution R283D at the non-canonical site, in contrast to a decrease in binding affinity with the substitution D190A at the canonical site. We solved the crystal structure of the C-terminal domain of the D190A mutant bound to this non-canonical YXXØ-signal. This structure showed no significant difference compared to that of wild-type μ4. Both differential scanning fluorimetry and limited proteolysis analyses demonstrated that the D190A substitution rendered μ4 less stable, suggesting an explanation for its lower binding affinity to the APP signal. Finally, in contrast to overexpression of the D190A mutant, and acting in a dominant-negative manner, overexpression of μ4 with either a F255A or a R283D substitution at the non-canonical site halted APP transport at the Golgi apparatus. Together, our analyses support that the functional recognition of the non-canonical YXXØ-signal of APP is limited to the non-canonical site of μ4.

Structural and Functional Characterization of Cargo-Binding Sites on the μ4-Subunit of Adaptor Protein Complex 4

PubMed Central

Ross, Breyan H.; Lin, Yimo; Corales, Esteban A.; Burgos, Patricia V.; Mardones, Gonzalo A.

2014-01-01

Adaptor protein (AP) complexes facilitate protein trafficking by playing key roles in the selection of cargo molecules to be sorted in post-Golgi compartments. Four AP complexes (AP-1 to AP-4) contain a medium-sized subunit (μ1-μ4) that recognizes YXXØ-sequences (Ø is a bulky hydrophobic residue), which are sorting signals in transmembrane proteins. A conserved, canonical region in μ subunits mediates recognition of YXXØ-signals by means of a critical aspartic acid. Recently we found that a non-canonical YXXØ-signal on the cytosolic tail of the Alzheimer's disease amyloid precursor protein (APP) binds to a distinct region of the μ4 subunit of the AP-4 complex. In this study we aimed to determine the functionality of both binding sites of μ4 on the recognition of the non-canonical YXXØ-signal of APP. We found that substitutions in either binding site abrogated the interaction with the APP-tail in yeast-two hybrid experiments. Further characterization by isothermal titration calorimetry showed instead loss of binding to the APP signal with only the substitution R283D at the non-canonical site, in contrast to a decrease in binding affinity with the substitution D190A at the canonical site. We solved the crystal structure of the C-terminal domain of the D190A mutant bound to this non-canonical YXXØ-signal. This structure showed no significant difference compared to that of wild-type μ4. Both differential scanning fluorimetry and limited proteolysis analyses demonstrated that the D190A substitution rendered μ4 less stable, suggesting an explanation for its lower binding affinity to the APP signal. Finally, in contrast to overexpression of the D190A mutant, and acting in a dominant-negative manner, overexpression of μ4 with either a F255A or a R283D substitution at the non-canonical site halted APP transport at the Golgi apparatus. Together, our analyses support that the functional recognition of the non-canonical YXXØ-signal of APP is limited to the non-canonical site of μ4. PMID:24498434

Fluorescence Spectroscopic Studies on the Complexation of Antidiabetic Drugs with Glycosylated Serum Albumin

NASA Astrophysics Data System (ADS)

Seedher, N.; Kanojia, M.

2013-11-01

Glycosylation decreases the association constant values and hence the binding affinity of human serum albumin (HSA) for the antidiabetic drugs under study. The percentage of HAS-bound drug at physiological temperature was only about 21-38 % as compared to 46-74 % for non-glycosylated HSA. Thus the percentage of free drug available for an antihyperglycemic effect was about double (62-79 %) compared to the values for non-glycosylated HSA. Much higher free drug concentrations available for pharmacological effect can lead to the risk of hypoglycemia. Hydrophobic interactions were predominantly involved in the binding. In the binding of gliclazide, hydrogen bonding and electrostatic interactions were involved. Site specificity for glycosylated HSA was the same as that for non-glycosylated HSA; gliclazide and repaglinide bind only at site II whereas glimepiride and glipizide bind at both sites I and II. Glycosylation, however, caused conformational changes in albumin, and the binding region within site II was different for glycosylated and non-glycosylated albumin. Stern-Volmer analysis also indicated the conformational changes in albumin as a result of glycosylation and showed that the dynamic quenching mechanism was valid for fluorescence of both glycosylated and non-glycosylated HSA.

Understanding the molecular mechanism of aryl acylamidase activity of acetylcholinesterase - An in silico study.

PubMed

Chinnadurai, Raj Kumar; Saravanaraman, Ponne; Boopathy, Rathanam

2015-08-15

Acetylcholinesterase (AChE) exhibits two different activities, namely esterase and aryl acylamidase (AAA). Unlike esterase, AAA activity of AChE is inhibited by the active site inhibitors while remaining unaffected by the peripheral anionic site inhibitors. This differential inhibitory pattern of active and peripheral anionic site inhibitors on the AAA activity remains unanswered. To answer this, we investigated the mechanism of binding and trafficking of AAA substrates using in silico tools. Molecular docking of serotonin and AAA substrates (o-nitroacetanilide, and o-nitrotrifluoroacetanilide,) onto AChE shows that these compounds bind at the side door of AChE. Thus, we conceived that the AAA substrates prefer the side door to reach the active site for their catalysis. Further, steered molecular dynamics simulations show that the force required for binding and trafficking of the AAA substrate through the side door is comparatively lesser than their dissociation (900kJ/mol/nm). Among the two substrates, o-nitrotrifluoroacetanilide required lesser force (380kJ/mol/nm) than o-nitroacetanilide the (550kJ/mol/nm) for its binding, thus validating o-nitrotrifluoroacetanilide as a better substrate. With these observations, we resolve that the AAA activity of AChE is mediated through its side door. Therefore, binding of PAS inhibitors at the main door of AChE remain ineffective against AAA activity. Copyright © 2015 Elsevier Inc. All rights reserved.

Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor*

PubMed Central

Lawrence, Callum F.; Margetts, Mai B.; Menting, John G.; Smith, Nicholas A.; Smith, Brian J.; Ward, Colin W.; Lawrence, Michael C.

2016-01-01

Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe701 and Phe705. The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

Carbohydrate binding sites in a pancreatic alpha-amylase-substrate complex, derived from X-ray structure analysis at 2.1 A resolution.

PubMed Central

Qian, M.; Haser, R.; Payan, F.

1995-01-01

The X-ray structure analysis of a crystal of pig pancreatic alpha-amylase (PPA, EC 3.2.1.1.) that was soaked with the substrate maltopentaose showed electron density corresponding to two independent carbohydrate recognition sites on the surface of the molecule. Both binding sites are distinct from the active site described in detail in our previous high-resolution study of a complex between PPA and a carbohydrate inhibitor (Qian M, Buisson G, Duée E, Haser H, Payan F, 1994, Biochemistry 33:6284-6294). One of the binding sites previously identified in a 5-A-resolution electron density map, lies at a distance of 20 A from the active site cleft and can accommodate two glucose units. The second affinity site for sugar units is located close to the calcium binding site. The crystal structure of the maltopentaose complex was refined at 2.1 A resolution, to an R-factor of 17.5%, with an RMS deviation in bond distances of 0.007 A. The model includes all 496 residues of the enzyme, 1 calcium ion, 1 chloride ion, 425 water molecules, and 3 bound sugar rings. The binding sites are characterized and described in detail. The present complex structure provides the evidence of an increased stability of the structure upon interaction with the substrate and allows identification of an N-terminal pyrrolidonecarboxylic acid in PPA. PMID:7613472

Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

PubMed

Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

2016-06-17

Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

PubMed

Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

2018-05-22

Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

The N-Terminal Domain of the Flo1 Flocculation Protein from Saccharomyces cerevisiae Binds Specifically to Mannose Carbohydrates ▿

PubMed Central

Goossens, Katty V. Y.; Stassen, Catherine; Stals, Ingeborg; Donohue, Dagmara S.; Devreese, Bart; De Greve, Henri; Willaert, Ronnie G.

2011-01-01

Saccharomyces cerevisiae cells possess a remarkable capacity to adhere to other yeast cells, which is called flocculation. Flocculation is defined as the phenomenon wherein yeast cells adhere in clumps and sediment rapidly from the medium in which they are suspended. These cell-cell interactions are mediated by a class of specific cell wall proteins, called flocculins, that stick out of the cell walls of flocculent cells. The N-terminal part of the three-domain protein is responsible for carbohydrate binding. We studied the N-terminal domain of the Flo1 protein (N-Flo1p), which is the most important flocculin responsible for flocculation of yeast cells. It was shown that this domain is both O and N glycosylated and is structurally composed mainly of β-sheets. The binding of N-Flo1p to d-mannose, α-methyl-d-mannoside, various dimannoses, and mannan confirmed that the N-terminal domain of Flo1p is indeed responsible for the sugar-binding activity of the protein. Moreover, fluorescence spectroscopy data suggest that N-Flo1p contains two mannose carbohydrate binding sites with different affinities. The carbohydrate dissociation constants show that the affinity of N-Flo1p for mono- and dimannoses is in the millimolar range for the binding site with low affinity and in the micromolar range for the binding site with high affinity. The high-affinity binding site has a higher affinity for low-molecular-weight (low-MW) mannose carbohydrates and no affinity for mannan. However, mannan as well as low-MW mannose carbohydrates can bind to the low-affinity binding site. These results extend the cellular flocculation model on the molecular level. PMID:21076009

Characterization and localization of /sup 3/H-arginine8-vasopressin binding to rat kidney and brain tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorsa, D.M.; Majumdar, L.A.; Petracca, F.M.

Anatomic, behavioral and pharmacologic evidence suggests that arginine8-vasopressin (AVP) serves as a CNS neurotransmitter or neuromodulator. AVP binding to membrane and tissue slice preparations from brain and kidney was characterized, and the anatomical distribution of these binding sites was examined. Conditions for the binding assay were optimized using kidney medullary tissue. Binding of /sup 3/H-AVP (S.A. . 30-51 Ci/mmol, NEN) to brain and kidney membranes and tissue slices was saturable, temperature dependent, linearly related to protein concentration (or number of tissue slices), reversible, and specific since the ability of cold AVP to displace /sup 3/H-AVP from binding was greater thanmore » oxytocin and other related peptide fragments. Autoradiographic localization of /sup 3/H-AVP binding was restricted to kidney medullary tissue. In brain tissue, /sup 3/H-AVP binding was found to occur in concentrated foci. Brainstem areas such as the nucleus tractus solitarius (NTS) showed a high density of AVP binding sites. Since local injections of AVP into the NTS have been shown to influence blood pressure, the present study presents the first anatomical evidence for the presence of AVP specific binding sites which might mediate this effect.« less

Interaction between Saikosaponin D, Paeoniflorin, and Human Serum Albumin.

PubMed

Liang, Guo-Wu; Chen, Yi-Cun; Wang, Yi; Wang, Hong-Mei; Pan, Xiang-Yu; Chen, Pei-Hong; Niu, Qing-Xia

2018-01-27

Saikosaponin D (SSD) and paeoniflorin (PF) are the major active constituents of Bupleuri Radix and Paeonia lactiflora Pall , respectively, and have been widely used in China to treat liver and other diseases for many centuries. We explored the binding of SSD/PF to human serum albumin (HSA) by using fluorospectrophotometry, circular dichroism (CD) and molecular docking. Both SSD and PF produced a conformational change in HSA. Fluorescence quenching was accompanied by a blue shift in the fluorescence spectra. Co-binding of PF and SSD also induced quenching and a conformational change in HSA. The Stern-Volmer equation showed that quenching was dominated by static quenching. The binding constant for ternary interaction was below that for binary interaction. Site-competitive experiments demonstrated that SSD/PF bound to site I (subdomain IIA) and site II (subdomain IIIA) in HSA. Analysis of thermodynamic parameters indicated that hydrogen bonding and van der Waals forces were mostly responsible for the binary association. Also, there was energy transfer upon binary interaction. Molecular docking supported the experimental findings in conformation, binding sites and binding forces.

Phosphorylated nitrate reductase and 14-3-3 proteins. Site of interaction, effects of ions, and evidence for an amp-binding site on 14-3-3 proteins.

PubMed

Athwal, G S; Huber, J L; Huber, S C

1998-11-01

The inactivation of phosphorylated nitrate reductase (NR) by the binding of 14-3-3 proteins is one of a very few unambiguous biological functions for 14-3-3 proteins. We report here that serine and threonine residues at the +6 to +8 positions, relative to the known regulatory binding site involving serine-543, are important in the interaction with GF14omega, a recombinant plant 14-3-3. Also shown is that an increase in ionic strength with KCl or inorganic phosphate, known physical effectors of NR activity, directly disrupts the binding of protein and peptide ligands to 14-3-3 proteins. Increased ionic strength attributable to KCl caused a change in conformation of GF14omega, resulting in reduced surface hydrophobicity, as visualized with a fluorescent probe. Similarly, it is shown that the 5' isomer of AMP was specifically able to disrupt the inactive phosphorylated NR:14-3-3 complex. Using the 5'-AMP fluorescent analog trinitrophenyl-AMP, we show that there is a probable AMP-binding site on GF14omega.

Translational autocontrol of the Escherichia coli hfq RNA chaperone gene

PubMed Central

VEČEREK, BRANISLAV; MOLL, ISABELLA; BLÄSI, UDO

2005-01-01

The conserved bacterial RNA chaperone Hfq has been shown to play an important role in post-transcriptional regulation. Here, we demonstrate that Hfq synthesis is autoregulated at the translational level. We have mapped two Hfq binding sites in the 5′-untranslated region of hfq mRNA and show that Hfq binding inhibits formation of the translation initiation complex. In vitro translation and in vivo studies further revealed that Hfq binding to both sites is required for efficient translational repression of hfq mRNA. PMID:15872186

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

PubMed Central

Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

1996-01-01

Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

STD-NMR experiments identify a structural motif with novel second-site activity against West Nile virus NS2B-NS3 protease.

PubMed

Schöne, Tobias; Grimm, Lena Lisbeth; Sakai, Naoki; Zhang, Linlin; Hilgenfeld, Rolf; Peters, Thomas

2017-10-01

West Nile virus (WNV) belongs to the genus Flavivirus of the family Flaviviridae. This mosquito-borne virus that is highly pathogenic to humans has been evolving into a global threat during the past two decades. Despite many efforts, neither antiviral drugs nor vaccines are available. The viral protease NS2B-NS3 pro is essential for viral replication, and therefore it is considered a prime drug target. However, success in the development of specific NS2B-NS3 pro inhibitors had been moderate so far. In the search for new structural motifs with binding affinity for NS2B-NS3 pro , we have screened a fragment library, the Maybridge Ro5 library, employing saturation transfer difference (STD) NMR experiments as readout. About 30% of 429 fragments showed binding to NS2B-NS3 pro . Subsequent STD-NMR competition experiments using the known active site fragment A as reporter ligand yielded 14 competitively binding fragments, and 22 fragments not competing with A. In a fluorophore-based protease assay, all of these fragments showed inhibition in the micromolar range. Interestingly, 10 of these 22 fragments showed a notable increase of STD intensities in the presence of compound A suggesting cooperative binding. The most promising non-competitive inhibitors 1 and 2 (IC 50 ∼ 500 μM) share a structural motif that may guide the development of novel second-site (potentially allosteric) inhibitors of NS2B-NS3 pro . To identify the matching protein binding site, chemical shift perturbation studies employing 1 H, 15 N-TROSY-HSQC experiments with uniformly 2 H, 15 N-labeled protease were performed in the presence of 1, and in the concomitant absence or presence of A. The data suggest that 1 interacts with Met 52* of NS2B, identifying a secondary site adjacent to the binding site of A. Therefore, our study paves the way for the synthesis of novel bidentate NS2B-NS3 pro inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

PubMed Central

Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

2013-01-01

NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

ATP binding at noncatalytic sites of soluble chloroplast F1-ATPase is required for expression of the enzyme activity.

PubMed

Milgrom, Y M; Ehler, L L; Boyer, P D

1990-11-05

The F1-ATPase from chloroplasts (CF1) lacks catalytic capacity for ATP hydrolysis if ATP is not bound at noncatalytic sites. CF1 heat activated in the presence of ADP, with less than one ADP and no ATP at non-catalytic sites, shows a pronounced lag in the onset of ATP hydrolysis after exposure to 5-20 microM ATP. The onset of activity correlates well with the binding of ATP at the last two of the three noncatalytic sites. The dependence of activity on the presence of ATP at non-catalytic sites is shown at relatively low or high free Mg2+ concentrations, with or without bicarbonate as an activating anion, and when the binding of ATP at noncatalytic sites is slowed 3-4-fold by sulfate. The latent CF1 activated by dithiothreitol also requires ATP at noncatalytic sites for ATPase activity. A similar requirement by other F1-ATPases and by ATP synthases seems plausible.

Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

PubMed Central

Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

2011-01-01

RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

PubMed

Jacobs, Y; Schnabel, C A; Cleary, M L

1999-07-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

Biosorption of heavy metal ions on Rhodobacter sphaeroides and Alcaligenes eutrophus H16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seki, Hideshi; Suzuki, Akira; Mitsueda, Shinichiro

1998-01-15

A fundamental study of the application of bacteria to the recovery of toxic heavy metals from aqueous environments was carried out. The biosorption characteristics of cadmium and lead ions were determined with purple nonsulfur bacteria, Rhodobacter sphaeroides and hydrogen bacteria, Alcaligenes eutrophus H16 that were inactivated by steam sterilization. A simplified version of the metal binding model proposed by Plette et al. was used for the description of meal binding data. The results showed that the biosorption of bivalent metal ions to whole cell bodies of the bacteria was due to monodentate binding to two different types of acidic sites:more » carboxilic and phosphatic-type sites. The number of metal binding sites of A. eutrophus was 2.4-fold larger than that of R. sphaeroides.« less

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

PubMed

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

PubMed

Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

2010-04-01

The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

PubMed Central

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site.

PubMed

Kadamur, Ganesh; Ross, Elliott M

2016-05-20

Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site*

PubMed Central

Kadamur, Ganesh

2016-01-01

Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. PMID:27002154

Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms

PubMed Central

Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.

1999-01-01

Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR

PubMed Central

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2012-01-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the 2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury, et. al. 2011). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. PMID:23000369

NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR.

PubMed

Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

2013-02-01

The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the β2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury et al., [32]). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. Copyright © 2012 Elsevier B.V. All rights reserved.

Engineering Ascorbate Peroxidase Activity Into Cytochrome C Peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meharenna, Y.T.; Oertel, P.; Bhaskar, B.

2009-05-26

Cytochrome c peroxidase (CCP) and ascorbate peroxidase (APX) have very similar structures, and yet neither CCP nor APX exhibits each others activities with respect to reducing substrates. APX has a unique substrate binding site near the heme propionates where ascorbate H-bonds with a surface Arg and one heme propionate (Sharp et al. (2003) Nat. Struct. Biol. 10, 303--307). The corresponding region in CCP has a much longer surface loop, and the critical Arg residue that is required for ascorbate binding in APX is Asn in CCP. In order to convert CCP into an APX, the ascorbate-binding loop and critical argininemore » were engineered into CCP to give the CCP2APX mutant. The mutant crystal structure shows that the engineered site is nearly identical to that found in APX. While wild-type CCP shows no APX activity, CCP2APX catalyzes the peroxidation of ascorbate at a rate of {approx}12 min{sup -1}, indicating that the engineered ascorbate-binding loop can bind ascorbate.« less

The interaction of substituted benzamides with brain benzodiazepine binding sites in vitro.

PubMed

Horton, R W; Lowther, S; Chivers, J; Jenner, P; Marsden, C D; Testa, B

1988-08-01

1. The interaction of substituted benzamides with brain benzodiazepine (BDZ) binding sites was examined by their ability to displace [3H]-flunitrazepam ([3H]-FNM) from specific binding sites in bovine cortical membranes in vitro. 2. Clebopride, Delagrange 2674, Delagrange 2335 and BRL 20627 displayed concentration-dependent displacement of [3H]-FNM with IC50 values of 73 nM, 132 nM, 7.7 microM and 5.9 microM, respectively. Other substituted benzamides including metoclopramide, sulpiride, tiapride, sultopride and cisapride were inactive at 10(-5) M. 3. Inhibition by clebopride and Delagrange 2674 of [3H]-FNM binding was apparently competitive and readily reversible. 4. In the presence of gamma-aminobutyric acid (GABA), the ability of diazepam and Delagrange 2674 to displace [3H]-Ro 15-1788 binding was increased 3.6 and 1.6 fold respectively, compared to the absence of GABA, while ethyl beta-carboline-3-carboxylate (beta CCE) and clebopride were less potent in the presence of GABA. 5. Diazepam was 30 fold less potent at displacing [3H]-Ro 15-1788 in membranes that had been photoaffinity labelled with FNM than in control membranes, whereas the potency of beta CCE did not differ. Clebopride and Delagrange 2674 showed a less than two fold loss of potency in photoaffinity labelled membranes. 6. The pattern of binding of clebopride and Delagrange 2674 in these in vitro tests is similar to that found previously with partial agonists or antagonists at BDZ binding sites. 7. Clebopride and Delagrange 2674 inhibited [3H]-FNM binding with similar potency in rat cerebellar and hippocampal membranes, suggesting they have no selectivity for BDZ1 and BDZ2 binding sites. 8. Clebopride and Delagrange 2674 are structurally dissimilar to other BDZ ligands and represent another chemical structure to probe brain BDZ binding sites.

Binding sites of resveratrol, genistein, and curcumin with milk α- and β-caseins.

PubMed

Bourassa, P; Bariyanga, J; Tajmir-Riahi, H A

2013-02-07

The binding sites of antioxidant polyphenols resveratrol, genistein, and curcumin are located with milk α- and β-caseins in aqueous solution. FTIR, CD, and fluorescence spectroscopic methods and molecular modeling were used to analyze polyphenol binding sites, the binding constant, and the effects of complexation on casein stability and conformation. Structural analysis showed that polyphenols bind casein via hydrophilic and hydrophobic interactions with the number of bound polyphenol molecules (n) 1.20 for resveratrol, 1.42 for genistein, and 1.43 for curcumin with α-casein and 1.14 for resveratrol, 1.27 for genistein, and 1.27 for curcumin with β-casein. The overall binding constants of the complexes formed are K(res-α-casein) = 1.9 (±0.6) × 10(4) M(-1), K(gen-α-casein) = 1.8 (±0.4) × 10(4) M(-1), and K(cur-α-casein) = 2.8 (±0.8) × 10(4) M(-1) with α-casein and K(res-β-casein) = 2.3 (±0.3) × 10(4) M(-1), K(gen-β-casein) = 3.0 (±0.5) × 10(4) M(-1), and K(cur-β-casein) = 3.1 (±0.5) × 10(4) M(-1) for β-casein. Molecular modeling showed the participation of several amino acids in polyphenol-protein complexes, which were stabilized by the hydrogen bonding network with the free binding energy of -11.56 (resveratrol-α-casein), -12.35 (resveratrol-β-casein), -9.68 (genistein-α-casein), -9.97 (genistein-β-casein), -8.89 (curcumin-α-casein), and -10.70 kcal/mol (curcumin-β-casein). The binding sites of polyphenols are different with α- and β-caseins. Polyphenol binding altered casein conformation with reduction of α-helix, indicating a partial protein destabilization. Caseins might act as carriers to transport polyphenol in vitro.

Insights into the interaction of methotrexate and human serum albumin: A spectroscopic and molecular modeling approach.

PubMed

Cheng, Li-Yang; Fang, Min; Bai, Ai-Min; Ouyang, Yu; Hu, Yan-Jun

2017-08-01

In this study, fluorescence spectroscopy and molecular modeling approaches were employed to investigate the binding of methotrexate to human serum albumin (HSA) under physiological conditions. From the mechanism, it was demonstrated that fluorescence quenching of HSA by methotrexate results from the formation of a methotrexate/HSA complex. Binding parameters calculated using the Stern-Volmer method and the Scatchard method showed that methotrexate binds to HSA with binding affinities in the order 10 4  L·mol -1 . Thermodynamic parameter studies revealed that the binding reaction is spontaneous, and that hydrogen bonds and van der Waals interactions play a major role in the reaction. Site marker competitive displacement experiments and a molecular modeling approach demonstrated that methotrexate binds with appropriate affinity to site I (subdomain IIA) of HSA. Furthermore, we discuss some factors that influence methotrexate binding to HSA. Copyright © 2017 John Wiley & Sons, Ltd.

Human La binds mRNAs through contacts to the poly(A) tail

PubMed Central

Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

2018-01-01

Abstract In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3’OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3’OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail. PMID:29447394

Frataxin Directly Stimulates Mitochondrial Cysteine Desulfurase by Exposing Substrate-binding Sites, and a Mutant Fe-S Cluster Scaffold Protein with Frataxin-bypassing Ability Acts Similarly*♦

PubMed Central

Pandey, Alok; Gordon, Donna M.; Pain, Jayashree; Stemmler, Timothy L.; Dancis, Andrew; Pain, Debkumar

2013-01-01

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the “buried” substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation. PMID:24217246

Frataxin directly stimulates mitochondrial cysteine desulfurase by exposing substrate-binding sites, and a mutant Fe-S cluster scaffold protein with frataxin-bypassing ability acts similarly.

PubMed

Pandey, Alok; Gordon, Donna M; Pain, Jayashree; Stemmler, Timothy L; Dancis, Andrew; Pain, Debkumar

2013-12-27

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the "buried" substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation.

Binding of mitomycin C to blood proteins: A spectroscopic analysis and molecular docking

NASA Astrophysics Data System (ADS)

Jang, Jongchol; Liu, Hui; Chen, Wei; Zou, Guolin

2009-06-01

Mitomycin C (MMC) was the first recognized bioreductive alkylating agent, and has been widely used clinically for antitumor therapy. The binding of MMC to two human blood proteins, human serum albumin (HSA) and human hemoglobin (HHb), have been investigated by fluorescence quenching, synchronous fluorescence, circular dichroism (CD) spectroscopy and molecular docking methods. The fluorescence data showed that binding of MMC to proteins caused strong fluorescence quenching of proteins through a static quenching way, and each protein had only one binding site for the drug. The binding constants of MMC to HSA and HHb at 298 K were 2.71 × 10 4 and 2.56 × 10 4 L mol -1, respectively. Thermodynamic analysis suggested that both hydrophobic interaction and hydrogen bonding played major roles in the binding of MMC to HSA or HHb. The CD spectroscopy indicated that the secondary structures of the two proteins were not changed in the presence of MMC. The study of molecular docking showed that MMC was located in the entrance of site I of HSA, and in the central cavity of HHb.

Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

PubMed Central

Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

2009-01-01

Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

Yeast hexokinase: substrate-induced association--dissociation reactions in the binding of glucose to hexokinase P-II.

PubMed

Hoggett, J G; Kellett, G L

1976-06-15

A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.

Active-site copper reduction promotes substrate binding of fungal lytic polysaccharide monooxygenase and reduces stability.

PubMed

Kracher, Daniel; Andlar, Martina; Furtmüller, Paul G; Ludwig, Roland

2018-02-02

Lytic polysaccharide monooxygenases (LPMOs) are a class of copper-containing enzymes that oxidatively degrade insoluble plant polysaccharides and soluble oligosaccharides. Upon reductive activation, they cleave the substrate and promote biomass degradation by hydrolytic enzymes. In this study, we employed LPMO9C from Neurospora crassa , which is active toward cellulose and soluble β-glucans, to study the enzyme-substrate interaction and thermal stability. Binding studies showed that the reduction of the mononuclear active-site copper by ascorbic acid increased the affinity and the maximum binding capacity of LPMO for cellulose. The reduced redox state of the active-site copper and not the subsequent formation of the activated oxygen species increased the affinity toward cellulose. The lower affinity of oxidized LPMO could support its desorption after catalysis and allow hydrolases to access the cleavage site. It also suggests that the copper reduction is not necessarily performed in the substrate-bound state of LPMO. Differential scanning fluorimetry showed a stabilizing effect of the substrates cellulose and xyloglucan on the apparent transition midpoint temperature of the reduced, catalytically active enzyme. Oxidative auto-inactivation and destabilization were observed in the absence of a suitable substrate. Our data reveal the determinants of LPMO stability under turnover and non-turnover conditions and indicate that the reduction of the active-site copper initiates substrate binding. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.

PubMed

Subramanian, Nandhitha; Scopelitti, Amanda J; Carland, Jane E; Ryan, Renae M; O'Mara, Megan L; Vandenberg, Robert J

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2

PubMed Central

Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045

Recognizing metal and acid radical ion-binding sites by integrating ab initio modeling with template-based transferals.

PubMed

Hu, Xiuzhen; Dong, Qiwen; Yang, Jianyi; Zhang, Yang

2016-11-01

More than half of proteins require binding of metal and acid radical ions for their structure and function. Identification of the ion-binding locations is important for understanding the biological functions of proteins. Due to the small size and high versatility of the metal and acid radical ions, however, computational prediction of their binding sites remains difficult. We proposed a new ligand-specific approach devoted to the binding site prediction of 13 metal ions (Zn 2+ , Cu 2+ , Fe 2+ , Fe 3+ , Ca 2+ , Mg 2+ , Mn 2+ , Na + , K + ) and acid radical ion ligands (CO3 2- , NO2 - , SO4 2- , PO4 3- ) that are most frequently seen in protein databases. A sequence-based ab initio model is first trained on sequence profiles, where a modified AdaBoost algorithm is extended to balance binding and non-binding residue samples. A composite method IonCom is then developed to combine the ab initio model with multiple threading alignments for further improving the robustness of the binding site predictions. The pipeline was tested using 5-fold cross validations on a comprehensive set of 2,100 non-redundant proteins bound with 3,075 small ion ligands. Significant advantage was demonstrated compared with the state of the art ligand-binding methods including COACH and TargetS for high-accuracy ion-binding site identification. Detailed data analyses show that the major advantage of IonCom lies at the integration of complementary ab initio and template-based components. Ion-specific feature design and binding library selection also contribute to the improvement of small ion ligand binding predictions. http://zhanglab.ccmb.med.umich.edu/IonCom CONTACT: hxz@imut.edu.cn or zhng@umich.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

DNA-bending properties of TF1.

PubMed

Schneider, G J; Sayre, M H; Geiduschek, E P

1991-10-05

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

NF-kappaB binds to a polymorphic repressor element in the MMP-3 promoter.

PubMed

Borghaei, Ruth C; Rawlings, P Lyle; Javadi, Masoud; Woloshin, Joanna

2004-03-26

A 5T/6T polymorphic site in the matrix metalloproteinase-3 (MMP-3) promoter has been identified as a repressor element involved in inhibiting induction of MMP-3 transcription by interleukin 1; and the 6T allele has been associated with decreased expression of MMP-3 as compared to the 5T allele. Zinc-binding protein-89 (ZBP-89) was cloned from a yeast one-hybrid assay via its ability to interact with this site, but when the protein was over-expressed, it resulted in activation of the MMP-3 promoter rather than repression. Here we show that in nuclear extracts isolated from human gingival fibroblasts stimulated with IL-1, this site is bound by p50 and p65 components of NF-kappaB in addition to ZBP-89, and that recombinant p50 binds preferentially to the 6T binding site. These results are consistent with a role for NF-kappaB in limiting the cytokine induced expression of MMP-3.

Structural basis for the interaction of antibiotics with peptidyl transferase center in eubacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlunzen, Frank; Zarivach, Raz; Harms, Jörg

2009-10-07

Ribosomes, the site of protein synthesis, are a major target for natural and synthetic antibiotics. Detailed knowledge of antibiotic binding sites is central to understanding the mechanisms of drug action. Conversely, drugs are excellent tools for studying the ribosome function. To elucidate the structural basis of ribosome-antibiotic interactions, we determined the high-resolution X-ray structures of the 50S ribosomal subunit of the eubacterium Deinococcus radiodurans, complexed with the clinically relevant antibiotics chloramphenicol, clindamycin and the three macrolides erythromycin, clarithromycin and roxithromycin. We found that antibiotic binding sites are composed exclusively of segments of 23S ribosomal RNA at the peptidyl transferase cavitymore » and do not involve any interaction of the drugs with ribosomal proteins. Here we report the details of antibiotic interactions with the components of their binding sites. Our results also show the importance of putative Mg{sup +2} ions for the binding of some drugs. This structural analysis should facilitate rational drug design.« less

Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

PubMed Central

Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.

2015-01-01

Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server (http://csgid.org/csgid/metal_sites/) is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

The Influence of Spatial Variation in Chromatin Density Determined by X-Ray Tomograms on the Time to Find DNA Binding Sites

PubMed Central

Larabell, Carolyn A.; Le Gros, Mark A.; McQueen, David M.; Peskin, Charles S.

2014-01-01

In this work, we examine how volume exclusion caused by regions of high chromatin density might influence the time required for proteins to find specific DNA binding sites. The spatial variation of chromatin density within mouse olfactory sensory neurons is determined from soft X-ray tomography reconstructions of five nuclei. We show that there is a division of the nuclear space into regions of low-density euchromatin and high-density heterochromatin. Volume exclusion experienced by a diffusing protein caused by this varying density of chromatin is modeled by a repulsive potential. The value of the potential at a given point in space is chosen to be proportional to the density of chromatin at that location. The constant of proportionality, called the volume exclusivity, provides a model parameter that determines the strength of volume exclusion. Numerical simulations demonstrate that the mean time for a protein to locate a binding site localized in euchromatin is minimized for a finite, nonzero volume exclusivity. For binding sites in heterochromatin, the mean time is minimized when the volume exclusivity is zero (the protein experiences no volume exclusion). An analytical theory is developed to explain these results. The theory suggests that for binding sites in euchromatin there is an optimal level of volume exclusivity that balances a reduction in the volume searched in finding the binding site, with the height of effective potential barriers the protein must cross during the search process. PMID:23955281

Structural Insights into the Assembly of the Adeno-associated Virus Type 2 Rep68 Protein on the Integration Site AAVS1*

PubMed Central

Musayev, Faik N.; Zarate-Perez, Francisco; Bishop, Clayton; Burgner, John W.; Escalante, Carlos R.

2015-01-01

Adeno-associated virus (AAV) is the only eukaryotic virus with the property of establishing latency by integrating site-specifically into the human genome. The integration site known as AAVS1 is located in chromosome 19 and contains multiple GCTC repeats that are recognized by the AAV non-structural Rep proteins. These proteins are multifunctional, with an N-terminal origin-binding domain (OBD) and a helicase domain joined together by a short linker. As a first step to understand the process of site-specific integration, we proceeded to characterize the recognition and assembly of Rep68 onto the AAVS1 site. We first determined the x-ray structure of AAV-2 Rep68 OBD in complex with the AAVS1 DNA site. Specificity is achieved through the interaction of a glycine-rich loop that binds the major groove and an α-helix that interacts with a downstream minor groove on the same face of the DNA. Although the structure shows a complex with three OBD molecules bound to the AAVS1 site, we show by using analytical centrifugation and electron microscopy that the full-length Rep68 forms a heptameric complex. Moreover, we determined that a minimum of two direct repeats is required to form a stable complex and to melt DNA. Finally, we show that although the individual domains bind DNA poorly, complex assembly requires oligomerization and cooperation between its OBD, helicase, and the linker domains. PMID:26370092

Gibberellin Receptor GID1: Gibberellin Recognition and Molecular Evolution

NASA Astrophysics Data System (ADS)

Kato, Hiroaki; Sato, Tomomi; Ueguchi-Tanaka, Miyako

Gibberellins (GAs) are phytohormones essential for many developmental processes in plants. We analyzed the crystal structure of a nuclear GA receptor, GIBBERELLIN INSENSITIVE DWARF 1 (GID1) from Oryza sativa. As it was proposed from the sequence similarity, the overall structure of GID1 shows an α/β-hydrolase fold similar to that of the hormone-sensitive lipases (HSLs) except for an amino-terminal lid. The GA-binding site corresponds to the substrate-binding site of HSLs. Almost residues assigned for GA binding showed very little or no activity when they were replaced with Ala. The substitution of the residues corresponding to those of the lycophyte GID1s caused an increase in the binding affinity for GA34, a 2β-hydroxylated GA4. These findings indicate that GID1 originated from HSL and was tinkered to have the specificity for bioactive GAs in the course of plant evolution.

Detection of Specific Solvent Rearrangement Regions of an Enzyme: NMR and ITC Studies with Aminoglycoside Phosphotransferase(3??)-IIIa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozen, C.; Norris, Adrianne; Land, Miriam L

2008-01-01

This work describes differential effects of solvent in complexes of the aminoglycoside phosphotransferase(3¢)-IIIa (APH) with different aminoglycosides and the detection of change in solvent structure at specific sites away from substrates. Binding of kanamycins to APH occurs with a larger negative ¢H in H2O relative to D2O (¢¢H(H2O-D2O) < 0), while the reverse is true for neomycins. Unusually large negative ¢Cp values were observed for binding of aminoglycosides to APH. ¢Cp for the APHneomycin complex was -1.6 kcalâmol-1âdeg-1. A break at 30 C was observed in the APH-kanamycin complex yielding ¢Cp values of -0.7 kcalâmol-1âdeg-1 and -3.8 kcalâmol-1âdeg-1 below andmore » above 30 C, respectively. Neither the change in accessible surface area (¢ASA) nor contributions from heats of ionization were sufficient to explain the large negative ¢Cp values. Most significantly, 15N-1H HSQC experiments showed that temperature-dependent shifts of the backbone amide protons of Leu 88, Ser 91, Cys 98, and Leu143 revealed a break at 30 C only in the APH-kanamycin complex in spectra collected between 21 C and 38 C. These amino acids represent solVent reorganization sites that experience a change in solvent structure in their immediate environment as structurally different ligands bind to the enzyme. These residues were away from the substrate binding site and distributed in three hydrophobic patches in APH. Overall, our results show that a large number of factors affect ¢Cp and binding of structurally different ligand groups cause different solvent structure in the active site as well as differentially affecting specific sites away from the ligand binding site.« less

Insights on Na(+) binding and conformational dynamics in multidrug and toxic compound extrusion transporter NorM.

PubMed

Song, Jianing; Ji, Changge; Zhang, John Z H

2014-02-01

MATE (multidrug and toxic compound extrusion) transporter proteins mediate metabolite transport in plants and multidrug resistance in bacteria and mammals. MATE transporter NorM from Vibrio cholerae is an antiporter that is driven by Na+ gradient to extrude the substrates. To understand the molecular mechanism of Na+-substrate exchange, molecular dynamics simulation was performed to study conformational changes of both wild-type and mutant NorM with and without cation bindings. Our results show that NorM is able to bind two Na(+) ions simultaneously, one to each of the carboxylic groups of E255 and D371 in the binding pocket. Furthermore, this di-Na(+) binding state is likely more efficient for conformational changes of NorM_VC toward the inward-facing conformation than single-Na(+) binding state. The observation of two Na(+) binding sites of NorM_VC is consistent with the previous study that two sites for ion binding (denoted as Na1/Na2 sites) are found in the transporter LeuT and BetP, another two secondary transporters. Taken together, our findings shed light on the structure rearrangements of NorM on Na(+) binding and enrich our knowledge of the transport mechanism of secondary transporters. Copyright © 2013 Wiley Periodicals, Inc.

Understanding the Structural Ensembles of a Highly Extended Disordered Protein†

PubMed Central

Daughdrill, Gary W.; Kashtanov, Stepan; Stancik, Amber; Hill, Shannon E.; Helms, Gregory; Muschol, Martin

2013-01-01

Developing a comprehensive description of the equilibrium structural ensembles for intrinsically disordered proteins (IDPs) is essential to understanding their function. The p53 transactivation domain (p53TAD) is an IDP that interacts with multiple protein partners and contains numerous phosphorylation sites. Multiple techniques were used to investigate the equilibrium structural ensemble of p53TAD in its native and chemically unfolded states. The results from these experiments show that the native state of p53TAD has dimensions similar to a classical random coil while the chemically unfolded state is more extended. To investigate the molecular properties responsible for this behavior, a novel algorithm that generates diverse and unbiased structural ensembles of IDPs was developed. This algorithm was used to generate a large pool of plausible p53TAD structures that were reweighted to identify a subset of structures with the best fit to small angle X-ray scattering data. High weight structures in the native state ensemble show features that are localized to protein binding sites and regions with high proline content. The features localized to the protein binding sites are mostly eliminated in the chemically unfolded ensemble; while, the regions with high proline content remain relatively unaffected. Data from NMR experiments support these results, showing that residues from the protein binding sites experience larger environmental changes upon unfolding by urea than regions with high proline content. This behavior is consistent with the urea-induced exposure of nonpolar and aromatic side-chains in the protein binding sites that are partially excluded from solvent in the native state ensemble. PMID:21979461

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

PubMed Central

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-01-01

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families.

PubMed

Garcia, Mario D; Nouwens, Amanda; Lonhienne, Thierry G; Guddat, Luke W

2017-02-14

Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted "S"-shaped conformation when bound to A. thaliana AHAS ( At AHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors.

Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families

PubMed Central

Nouwens, Amanda; Lonhienne, Thierry G.; Guddat, Luke W.

2017-01-01

Five commercial herbicide families inhibit acetohydroxyacid synthase (AHAS, E.C. 2.2.1.6), which is the first enzyme in the branched-chain amino acid biosynthesis pathway. The popularity of these herbicides is due to their low application rates, high crop vs. weed selectivity, and low toxicity in animals. Here, we have determined the crystal structures of Arabidopsis thaliana AHAS in complex with two members of the pyrimidinyl-benzoate (PYB) and two members of the sulfonylamino-carbonyl-triazolinone (SCT) herbicide families, revealing the structural basis for their inhibitory activity. Bispyribac, a member of the PYBs, possesses three aromatic rings and these adopt a twisted “S”-shaped conformation when bound to A. thaliana AHAS (AtAHAS) with the pyrimidinyl group inserted deepest into the herbicide binding site. The SCTs bind such that the triazolinone ring is inserted deepest into the herbicide binding site. Both compound classes fill the channel that leads to the active site, thus preventing substrate binding. The crystal structures and mass spectrometry also show that when these herbicides bind, thiamine diphosphate (ThDP) is modified. When the PYBs bind, the thiazolium ring is cleaved, but when the SCTs bind, ThDP is modified to thiamine 2-thiazolone diphosphate. Kinetic studies show that these compounds not only trigger reversible accumulative inhibition of AHAS, but also can induce inhibition linked with ThDP degradation. Here, we describe the features that contribute to the extraordinarily powerful herbicidal activity exhibited by four classes of AHAS inhibitors. PMID:28137884

The interaction of substituted benzamides with brain benzodiazepine binding sites in vitro.

PubMed Central

Horton, R. W.; Lowther, S.; Chivers, J.; Jenner, P.; Marsden, C. D.; Testa, B.

1988-01-01

1. The interaction of substituted benzamides with brain benzodiazepine (BDZ) binding sites was examined by their ability to displace [3H]-flunitrazepam ([3H]-FNM) from specific binding sites in bovine cortical membranes in vitro. 2. Clebopride, Delagrange 2674, Delagrange 2335 and BRL 20627 displayed concentration-dependent displacement of [3H]-FNM with IC50 values of 73 nM, 132 nM, 7.7 microM and 5.9 microM, respectively. Other substituted benzamides including metoclopramide, sulpiride, tiapride, sultopride and cisapride were inactive at 10(-5) M. 3. Inhibition by clebopride and Delagrange 2674 of [3H]-FNM binding was apparently competitive and readily reversible. 4. In the presence of gamma-aminobutyric acid (GABA), the ability of diazepam and Delagrange 2674 to displace [3H]-Ro 15-1788 binding was increased 3.6 and 1.6 fold respectively, compared to the absence of GABA, while ethyl beta-carboline-3-carboxylate (beta CCE) and clebopride were less potent in the presence of GABA. 5. Diazepam was 30 fold less potent at displacing [3H]-Ro 15-1788 in membranes that had been photoaffinity labelled with FNM than in control membranes, whereas the potency of beta CCE did not differ. Clebopride and Delagrange 2674 showed a less than two fold loss of potency in photoaffinity labelled membranes. 6. The pattern of binding of clebopride and Delagrange 2674 in these in vitro tests is similar to that found previously with partial agonists or antagonists at BDZ binding sites. 7. Clebopride and Delagrange 2674 inhibited [3H]-FNM binding with similar potency in rat cerebellar and hippocampal membranes, suggesting they have no selectivity for BDZ1 and BDZ2 binding sites.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2850059

Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

PubMed

Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

2010-01-01

The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

Analysis of expression and chitin-binding activity of the wing disc cuticle protein BmWCP4 in the silkworm, Bombyx mori.

PubMed

Deng, Hui-Min; Li, Yong; Zhang, Jia-Ling; Liu, Lin; Feng, Qi-Li

2016-12-01

The insect exoskeleton is mainly composed of chitin filaments linked by cuticle proteins. When insects molt, the cuticle of the exoskeleton is renewed by degrading the old chitin and cuticle proteins and synthesizing new ones. In this study, chitin-binding activity of the wing disc cuticle protein BmWCP4 in Bombyx mori was studied. Sequence analysis showed that the protein had a conservative hydrophilic "R&R" chitin-binding domain (CBD). Western blotting showed that BmWCP4 was predominately expressed in the wing disc-containing epidermis during the late wandering and early pupal stages. The immunohistochemistry result showed that the BmWCP4 was mainly present in the wing disc tissues containing wing bud and trachea blast during day 2 of wandering stage. Recombinant full-length BmWCP4 protein, "R&R" CBD peptide (CBD), non-CBD peptide (BmWCP4-CBD - ), four single site-directed mutated peptides (M 1 , M 2 , M 3 and M 4 ) and four-sites-mutated peptide (M F ) were generated and purified, respectively, for in vitro chitin-binding assay. The results indicated that both the full-length protein and the "R&R" CBD peptide could bind with chitin, whereas the BmWCP4-CBD - could not bind with chitin. The single residue mutants M 1 , M 2 , M 3 and M 4 reduced but did not completely abolish the chitin-binding activity, while four-sites-mutated protein M F completely lost the chitin-binding activity. These data indicate that BmWCP4 protein plays a critical role by binding to the chitin filaments in the wing during larva-to-pupa transformation. The conserved aromatic amino acids are critical in the interaction between chitin and the cuticle protein. © 2015 Institute of Zoology, Chinese Academy of Sciences.

Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

PubMed Central

Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

2012-01-01

The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

Silver(I) complexes with DNA and RNA studied by Fourier transform infrared spectroscopy and capillary electrophoresis.

PubMed Central

Arakawa, H; Neault, J F; Tajmir-Riahi, H A

2001-01-01

Ag(I) is a strong nucleic acids binder and forms several complexes with DNA such as types I, II, and III. However, the details of the binding mode of silver(I) in the Ag-polynucleotides remains unknown. Therefore, it was of interest to examine the binding of Ag(I) with calf-thymus DNA and bakers yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentration of DNA or RNA and various concentrations of Ag(I). Fourier transform infrared spectroscopy and capillary electrophoresis were used to analyze the Ag(I) binding mode, the binding constant, and the polynucleotides' structural changes in the Ag-DNA and Ag-RNA complexes. The spectroscopic results showed that in the type I complex formed with DNA, Ag(I) binds to guanine N7 at low cation concentration (r = 1/80) and adenine N7 site at higher concentrations (r = 1/20 to 1/10), but not to the backbone phosphate group. At r = 1/2, type II complexes formed with DNA in which Ag(I) binds to the G-C and A-T base pairs. On the other hand, Ag(I) binds to the guanine N7 atom but not to the adenine and the backbone phosphate group in the Ag-RNA complexes. Although a minor alteration of the sugar-phosphate geometry was observed, DNA remained in the B-family structure, whereas RNA retained its A conformation. Scatchard analysis following capillary electrophoresis showed two binding sites for the Ag-DNA complexes with K(1) = 8.3 x 10(4) M(-1) for the guanine and K(2) = 1.5 x 10(4) M(-1) for the adenine bases. On the other hand, Ag-RNA adducts showed one binding site with K = 1.5 x 10(5) M(-1) for the guanine bases. PMID:11509371

Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

PubMed

Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

2017-09-09

The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

PubMed

Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

2017-01-24

Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

Interactions of divalent cations with calcium binding sites of BK channels reveal independent motions within the gating ring.

PubMed

Miranda, Pablo; Giraldez, Teresa; Holmgren, Miguel

2016-12-06

Large-conductance voltage- and calcium-activated K + (BK) channels are key physiological players in muscle, nerve, and endocrine function by integrating intracellular Ca 2+ and membrane voltage signals. The open probability of BK channels is regulated by the intracellular concentration of divalent cations sensed by a large structure in the BK channel called the "gating ring," which is formed by four tandems of regulator of conductance for K + (RCK1 and RCK2) domains. In contrast to Ca 2+ that binds to both RCK domains, Mg 2+ , Cd 2+ , or Ba 2+ interact preferentially with either one or the other. Interaction of cations with their binding sites causes molecular rearrangements of the gating ring, but how these motions occur remains elusive. We have assessed the separate contributions of each RCK domain to the cation-induced gating-ring structural rearrangements, using patch-clamp fluorometry. Here we show that Mg 2+ and Ba 2+ selectively induce structural movement of the RCK2 domain, whereas Cd 2+ causes motions of RCK1, in all cases substantially smaller than those elicited by Ca 2+ By combining divalent species interacting with unique sites, we demonstrate that RCK1 and RCK2 domains move independently when their specific binding sites are occupied. Moreover, binding of chemically distinct cations to both RCK domains is additive, emulating the effect of fully occupied Ca 2+ binding sites.

Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

PubMed Central

Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

2015-01-01

Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

PubMed Central

Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

2006-01-01

As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

Biological evaluation, docking and molecular dynamic simulation of some novel diaryl urea derivatives bearing quinoxalindione moiety

PubMed Central

Sadeghian-Rizi, Sedighe; Khodarahmi, Ghadamali Ali; Sakhteman, Amirhossein; Jahanian-Najafabadi, Ali; Rostami, Mahboubeh; Mirzaei, Mahmoud; Hassanzadeh, Farshid

2017-01-01

In this study a series of diarylurea derivatives containing quinoxalindione group were biologically evaluated for their cytotoxic activities using MTT assay against MCF-7 and HepG2 cell lines. Antibacterial activities of these compounds were also evaluated by Microplate Alamar Blue Assay (MABA) against three Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi), three Gram-positive (Staphylococcus aureus, Bacillus subtilis and Listeria monocitogenes) and one yeast-like fungus (Candida albicans) strain. Furthermore, molecular docking was carried out to study the binding pattern of the compounds to the active site of B-RAF kinase (PDB code: 1UWH). Molecular dynamics simulation was performed on the best ligand (16e) to investigate the ligand binding dynamics in the physiological environment. Cytotoxic evaluation revealed the most prominent cytotoxicity for 6 compounds with IC50 values of 10-18 μM against two mentioned cell lines. None of the synthesized compounds showed significant antimicrobial activity. The obtained results of the molecular docking study showed that all compounds fitted in the binding site of enzyme with binding energy range of -11.22 to -12.69 kcal/mol vs sorafenib binding energy -11.74 kcal/mol as the lead compound. Molecular dynamic simulation indicated that the binding of ligand (16e) was stable in the active site of B-RAF during the simulation. PMID:29204178

Redox process is crucial for inhibitory properties of aurintricarboxylic acid against activity of YopH: virulence factor of Yersinia pestis

PubMed Central

Kuban-Jankowska, Alicja; Gorska, Magdalena; Tuszynski, Jack A; Ossowski, Tadeusz; Wozniak, Michal

2015-01-01

YopH is a bacterial protein tyrosine phosphatase, which is essential for the viability and pathogenic virulence of the plague-causing Yersinia sp. bacteria. Inactivation of YopH activity would lead to the loss of bacterial pathogenicity. We have studied the inhibitory properties of aurintricarboxylic acid (ATA) against YopH phosphatase and found that at nanomolar concentrations ATA reversibly decreases the activity of YopH. Computational docking studies indicated that in all binding poses ATA binds in the YopH active site. Molecular dynamics simulations showed that in the predicted binding pose, ATA binds to the essential Cys403 and Arg409 residues in the active site and has a stronger binding affinity than the natural substrate (pTyr). The cyclic voltammetry experiments suggest that ATA reacts remarkably strongly with molecular oxygen. Additionally, the electrochemical reduction of ATA in the presence of a negative potential from −2.0 to 2.5 V generates a current signal, which is observed for hydrogen peroxide. Here we showed that ATA indicates a unique mechanism of YopH inactivation due to a redox process. We proposed that the potent inhibitory properties of ATA are a result of its strong binding in the YopH active site and in situ generation of hydrogen peroxide near catalytic cysteine residue. PMID:26286963

Synaptosomal binding of 125I-labelled daboiatoxin, a new PLA2 neurotoxin from the venom of Daboia russelli siamensis.

PubMed

Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H

1996-02-01

Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steiner, B.; Cousot, D.; Trzeciak, A.

The platelet glycoprotein IIb-IIIa complex (GP IIb-IIIa) is a member of the integrin receptor family that recognizes adhesive proteins containing the Arg-Gly-Asp (RGD) sequence. In the present study the binding characteristics of the synthetic hexapeptide Tyr-Asn-Arg-Gly-Asp-Ser (YNRGDS, a sequence present in the fibrinogen alpha-chain at position 570-575) to purified GP IIb-IIIa were determined by equilibrium dialysis. The binding of 125I-YNRGDS to GP IIb-IIIa was specific, saturable, and reversible. The apparent dissociation constant was 1.0 +/- 0.2 microM, and the maximal binding capacity was 0.92 +/- 0.02 mol of 125I-YNRGDS/mol of GP IIb-IIIa, indicating that GP IIb-IIIa contains a single bindingmore » site for RGD peptides. The binding of 125I-YNRGDS to purified GP IIb-IIIa showed many of the characteristics of fibrinogen binding to activated platelets: the binding was inhibited by fibrinogen, by the monoclonal antibody A2A9, and by the dodecapeptide from the C terminus of the fibrinogen gamma-chain. In addition, the binding of 125I-YNRGDS to GP IIb-IIIa was divalent cation-dependent. Our data suggest that two divalent cation binding sites must be occupied for YNRGDS to bind: one site is specific for calcium and is saturated at 1 microM free Ca2+, whereas the other site is less specific and reaches saturation at millimolar concentrations of either Ca2+ or Mg2+. The results of the present study support the hypothesis that the RGD domains within the adhesive proteins are responsible for their binding to GP IIb-IIIa.« less

Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

PubMed Central

2015-01-01

The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

PubMed Central

Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

2016-01-01

DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

CTCF Binding Sites in the Herpes Simplex Virus 1 Genome Display Site-Specific CTCF Occupation, Protein Recruitment, and Insulator Function.

PubMed

Washington, Shannan D; Musarrat, Farhana; Ertel, Monica K; Backes, Gregory L; Neumann, Donna M

2018-04-15

There are seven conserved CTCF binding domains in the herpes simplex virus 1 (HSV-1) genome. These binding sites individually flank the latency-associated transcript (LAT) and the immediate early (IE) gene regions, suggesting that CTCF insulators differentially control transcriptional domains in HSV-1 latency. In this work, we show that two CTCF binding motifs in HSV-1 display enhancer blocking in a cell-type-specific manner. We found that CTCF binding to the latent HSV-1 genome was LAT dependent and that the quantity of bound CTCF was site specific. Following reactivation, CTCF eviction was dynamic, suggesting that each CTCF site was independently regulated. We explored whether CTCF sites recruit the polycomb-repressive complex 2 (PRC2) to establish repressive domains through a CTCF-Suz12 interaction and found that Suz12 colocalized to the CTCF insulators flanking the ICP0 and ICP4 regions and, conversely, was removed at early times postreactivation. Collectively, these data support the idea that CTCF sites in HSV-1 are independently regulated and may contribute to lytic-latent HSV-1 control in a site-specific manner. IMPORTANCE The role of chromatin insulators in DNA viruses is an area of interest. It has been shown in several beta- and gammaherpesviruses that insulators likely control the lytic transcriptional profile through protein recruitment and through the formation of three-dimensional (3D) chromatin loops. The ability of insulators to regulate alphaherpesviruses has been understudied to date. The alphaherpesvirus HSV-1 has seven conserved insulator binding motifs that flank regions of the genome known to contribute to the establishment of latency. Our work presented here contributes to the understanding of how insulators control transcription of HSV-1. Copyright © 2018 American Society for Microbiology.

B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

PubMed

Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

2008-10-03

The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

PubMed

De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

2017-07-01

Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

PubMed

Cave, John W; Xia, Li; Caudy, Michael

2011-01-01

In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

CD, MCD and VTVH MCD Studies of Biferrous and Mixed-Valent myo-Inositol Oxygenase: Insights into Substrate Activation of O2 Reactivity

PubMed Central

Snyder, Rae Ana; Bell, Caleb B.; Diao, Yinghui; Krebs, Carsten; Bollinger, J. Martin; Solomon, Edward I.

2013-01-01

Myo-inositol oxygenase (MIOX) catalyzes the 4e− oxidation of myo-inositol (MI) to D-glucuronate using a substrate activated Fe(II)Fe(III) site. The biferrous and Fe(II)Fe(III) forms of MIOX were studied with circular dichroism (CD), magnetic circular dichroism (MCD), and variable temperature variable field (VTVH) MCD spectroscopies. The MCD spectrum of biferrous MIOX shows two ligand field (LF) transitions near 10,000 cm−1, split by ~2,000 cm−1, characteristic of 6 coordinate (6C) Fe(II) sites, indicating that the modest reactivity of the biferrous form toward O2 can be attributed to the saturated coordination of both irons. Upon oxidation to the Fe(II)Fe(III) state, MIOX shows two LF transitions in the ~10,000 cm−1 region, again implying a coordinatively saturated Fe(II) site. Upon MI binding, these split in energy to 5,200 cm−1 and 11,200 cm−1, showing that MI binding causes the Fe(II) to become coordinately unsaturated. VTVH MCD magnetization curves of unbound and MI-bound Fe(II)Fe(III) forms show that upon substrate binding, the isotherms become more nested, requiring that the exchange coupling and ferrous zero field splitting (ZFS) both decrease in magnitude. These results imply that MI binds to the ferric site, weakening the Fe(III)-μ-OH bond and strengthening the Fe(II)-μ-OH bond. This perturbation results in the release of a coordinated water from the Fe(II) that enables its O2 activation. PMID:24066857

Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

PubMed

Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

2001-11-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

Combining solvent thermodynamic profiles with functionality maps of the Hsp90 binding site to predict the displacement of water molecules.

PubMed

Haider, Kamran; Huggins, David J

2013-10-28

Intermolecular interactions in the aqueous phase must compete with the interactions between the two binding partners and their solvating water molecules. In biological systems, water molecules in protein binding sites cluster at well-defined hydration sites and can form strong hydrogen-bonding interactions with backbone and side-chain atoms. Displacement of such water molecules is only favorable when the ligand can form strong compensating hydrogen bonds. Conversely, water molecules in hydrophobic regions of protein binding sites make only weak interactions, and the requirements for favorable displacement are less stringent. The propensity of water molecules for displacement can be identified using inhomogeneous fluid solvation theory (IFST), a statistical mechanical method that decomposes the solvation free energy of a solute into the contributions from different spatial regions and identifies potential binding hotspots. In this study, we employed IFST to study the displacement of water molecules from the ATP binding site of Hsp90, using a test set of 103 ligands. The predicted contribution of a hydration site to the hydration free energy was found to correlate well with the observed displacement. Additionally, we investigated if this correlation could be improved by using the energetic scores of favorable probe groups binding at the location of hydration sites, derived from a multiple copy simultaneous search (MCSS) method. The probe binding scores were not highly predictive of the observed displacement and did not improve the predictivity when used in combination with IFST-based hydration free energies. The results show that IFST alone can be used to reliably predict the observed displacement of water molecules in Hsp90. However, MCSS can augment IFST calculations by suggesting which functional groups should be used to replace highly displaceable water molecules. Such an approach could be very useful in improving the hit-to-lead process for new drug targets.

Analysis of flavin oxidation and electron-transfer inhibition in Plasmodium falciparum dihydroorotate dehydrogenase.

PubMed

Malmquist, Nicholas A; Gujjar, Ramesh; Rathod, Pradipsinh K; Phillips, Margaret A

2008-02-26

Plasmodium falciparum dihydroorotate dehydrogenase (pfDHODH) is a flavin-dependent mitochondrial enzyme that provides the only route to pyrimidine biosynthesis in the parasite. Clinically significant inhibitors of human DHODH (e.g., A77 1726) bind to a pocket on the opposite face of the flavin cofactor from dihydroorotate (DHO). This pocket demonstrates considerable sequence variability, which has allowed species-specific inhibitors of the malarial enzyme to be identified. Ubiquinone (CoQ), the physiological oxidant in the reaction, has been postulated to bind this site despite a lack of structural evidence. To more clearly define the residues involved in CoQ binding and catalysis, we undertook site-directed mutagenesis of seven residues in the structurally defined A77 1726 binding site, which we term the species-selective inhibitor site. Mutation of several of these residues (H185, F188, and F227) to Ala substantially decreased the affinity of pfDHODH-specific inhibitors (40-240-fold). In contrast, only a modest increase in the Kmapp for CoQ was observed, although mutation of Y528 in particular caused a substantial reduction in kcat (40-100-fold decrease). Pre-steady-state kinetic analysis by single wavelength stopped-flow spectroscopy showed that the mutations had no effect on the rate of the DHO-dependent reductive half-reaction, but most reduced the rate of the CoQ-dependent flavin oxidation step (3-20-fold decrease), while not significantly altering the Kdox for CoQ. As with the mutants, inhibitors that bind this site block the CoQ-dependent oxidative half-reaction without affecting the DHO-dependent step. These results identify residues involved in inhibitor binding and electron transfer to CoQ. Importantly, the data provide compelling evidence that the binding sites for CoQ and species-selective site inhibitors do not overlap, and they suggest instead that inhibitors act either by blocking the electron path between flavin and CoQ or by stabilizing a conformation that excludes CoQ binding.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Long-range electrostatic complementarity governs substrate recognition by human chymotrypsin C, a key regulator of digestive enzyme activation.

PubMed

Batra, Jyotica; Szabó, András; Caulfield, Thomas R; Soares, Alexei S; Sahin-Tóth, Miklós; Radisky, Evette S

2013-04-05

Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5' subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2' positions of CTRC, although acidic P2' residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels.

A Graph Approach to Mining Biological Patterns in the Binding Interfaces.

PubMed

Cheng, Wen; Yan, Changhui

2017-01-01

Protein-RNA interactions play important roles in the biological systems. Searching for regular patterns in the Protein-RNA binding interfaces is important for understanding how protein and RNA recognize each other and bind to form a complex. Herein, we present a graph-mining method for discovering biological patterns in the protein-RNA interfaces. We represented known protein-RNA interfaces using graphs and then discovered graph patterns enriched in the interfaces. Comparison of the discovered graph patterns with UniProt annotations showed that the graph patterns had a significant overlap with residue sites that had been proven crucial for the RNA binding by experimental methods. Using 200 patterns as input features, a support vector machine method was able to classify protein surface patches into RNA-binding sites and non-RNA-binding sites with 84.0% accuracy and 88.9% precision. We built a simple scoring function that calculated the total number of the graph patterns that occurred in a protein-RNA interface. That scoring function was able to discriminate near-native protein-RNA complexes from docking decoys with a performance comparable with that of a state-of-the-art complex scoring function. Our work also revealed possible patterns that might be important for binding affinity.

Exploring the site-selective binding of jatrorrhizine to human serum albumin: spectroscopic and molecular modeling approaches.

PubMed

Mi, Ran; Hu, Yan-Jun; Fan, Xiao-Yang; Ouyang, Yu; Bai, Ai-Min

2014-01-03

This paper exploring the site-selective binding of jatrorrhizine to human serum albumin (HSA) under physiological conditions (pH=7.4). The investigation was carried out using fluorescence spectroscopy, UV-vis spectroscopy, and molecular modeling. The results of fluorescence quenching and UV-vis absorption spectra experiments indicated the formation of the complex of HSA-jatrorrhizine. Binding parameters calculating from Stern-Volmer method and Scatchard method were calculated at 298, 304 and 310 K, with the corresponding thermodynamic parameters ΔG, ΔH and ΔS as well. Binding parameters calculating from Stern-Volmer method and Scatchard method showed that jatrorrhizine bind to HSA with the binding affinities of the order 10(4) L mol(-1). The thermodynamic parameters studies revealed that the binding was characterized by negative enthalpy and positive entropy changes and the electrostatic interactions play a major role for jatrorrhizine-HSA association. Site marker competitive displacement experiments and molecular modeling calculation demonstrating that jatrorrhizine is mainly located within the hydrophobic pocket of the subdomain IIIA of HSA. Furthermore, the synchronous fluorescence spectra suggested that the association between jatrorrhizine and HSA changed molecular conformation of HSA. Copyright © 2013. Published by Elsevier B.V.

CorA Is a Copper Repressible Surface-Associated Copper(I)-Binding Protein Produced in Methylomicrobium album BG8

PubMed Central

Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.

2014-01-01

CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370

SP-A binding sites on bovine alveolar macrophages.

PubMed

Plaga, S; Plattner, H; Schlepper-Schaefer, J

1998-11-25

Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Thermochemistry of the specific binding of C12 surfactants to bovine serum albumin.

PubMed

Nielsen, A D; Borch, K; Westh, P

2000-06-15

The specific binding to bovine serum albumin (BSA) of anionic and non-ionic surfactants with C12 acyl chains has been studied by high sensitivity isothermal titration calorimetry. This method proved particularly effective in resolving the binding of anionic surfactants into separate classes of sites with different affinity. For sodium dodecylsulfate (SDS) the measured binding curves could be rationalized as association to two classes (high affinity/low affinity) of sites comprising, respectively, three and six similar (i.e. thermodynamically equivalent), independent sites. Changes in the thermodynamic functions enthalpy, standard free energy, standard entropy and heat capacity could be discerned for each class of binding site, as well as for micelle formation. These data suggest that binding to low affinity sites (in analogy with micelle formation) exhibits energetic parameters; in particular, a large negative change in heat capacity, which is characteristic of hydrophobic interactions. The thermodynamics of high affinity binding, on the other hand, is indicative of other dominant forces; most likely electrostatic interactions. Other anionic ligands investigated (laurate and dodecyl benzylsulfonate) showed a behavior similar to SDS, the most significant difference being the high affinity binding of the alkylbenzyl sulfonate. For this ligand, the thermodynamic data is indicative of a more loosely associated complex than for SDS and laurate. BSA was found to bind one or two of the non-ionic surfactants (NIS) hepta- or penta(ethylene glycol) monododecyl ether (C12EO7 and C12EO5) with binding constants about three orders of magnitude lower than for SDS. Hence, the free energy of the surfactant in the weakly bound BSA-NIS complex is only slightly favored over the micellar state. The binding process is characterized by very large exothermic enthalpy changes (larger than for the charged surfactants) and a large, positive increment in heat capacity. These observations cannot be reconciled with a molecular picture based on simple hydrophobic condensation onto non-polar patches on the protein surface.

Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers.

PubMed

Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B

2004-04-01

The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. Copyright 2004 Wiley-Liss, Inc.

Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

PubMed

Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

2015-01-01

Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

A global optimization algorithm for protein surface alignment

PubMed Central

2010-01-01

Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

PubMed

Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

2018-05-27

Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

PubMed Central

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-01-01

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells

PubMed Central

Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele

2014-01-01

Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

Molecular mechanism of the allosteric regulation of the αγ heterodimer of human NAD-dependent isocitrate dehydrogenase

PubMed Central

Ma, Tengfei; Peng, Yingjie; Huang, Wei; Ding, Jianping

2017-01-01

Human NAD-dependent isocitrate dehydrogenase catalyzes the decarboxylation of isocitrate (ICT) into α-ketoglutarate in the Krebs cycle. It exists as the α2βγ heterotetramer composed of the αβ and αγ heterodimers. Previously, we have demonstrated biochemically that the α2βγ heterotetramer and αγ heterodimer can be allosterically activated by citrate (CIT) and ADP. In this work, we report the crystal structures of the αγ heterodimer with the γ subunit bound without or with different activators. Structural analyses show that CIT, ADP and Mg2+ bind adjacent to each other at the allosteric site. The CIT binding induces conformational changes at the allosteric site, which are transmitted to the active site through the heterodimer interface, leading to stabilization of the ICT binding at the active site and thus activation of the enzyme. The ADP binding induces no further conformational changes but enhances the CIT binding through Mg2+-mediated interactions, yielding a synergistic activation effect. ICT can also bind to the CIT-binding subsite, which induces similar conformational changes but exhibits a weaker activation effect. The functional roles of the key residues are verified by mutagenesis, kinetic and structural studies. Our structural and functional data together reveal the molecular mechanism of the allosteric regulation of the αγ heterodimer. PMID:28098230

Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

The effect of Berberine on the secondary structure of human serum albumin

NASA Astrophysics Data System (ADS)

Li, Ying; He, WenYing; Tian, Jianniao; Tang, Jianghong; Hu, Zhide; Chen, Xingguo

2005-05-01

The presence of several high affinity binding sites on human serum albumin (HSA) makes it a possible target for many drugs. This study is designed to examine the effect of Berberine (an ancient Chinese drug used for antimicrobial, antiplasmodial, antidiarrheal and cardiovascular) on the solution structure of HSA using fluorescence, Fourier transform infrared (FT-IR), circular dichroism (CD) spectroscopic methods. The fluorescence spectroscopic results show that the fluorescence intensity of HSA was significantly decreased in the presence of Berberine. The Scatchard's plots indicated that the binding of Berberine to HSA at 296, 303, 318 K is characterized by one binding site with the binding constant is 4.071(±0.128)×10 4, 3.741(±0.089)×10 4, 3.454(±0.110)×10 4 M -1, respectively. The protein conformation is altered (FT-IR and CD data) with reductions of α-helices from 54 to 47% for free HSA to 45-32% and with increases of turn structure5% for free HSA to 18% in the presence of Berberine. The binding process was exothermic, enthalpy driven and spontaneous, as indicated by the thermodynamic analyses, Berberine bound to HSA was mainly based on hydrophobic interaction and electrostatic interaction cannot be excluded from the binding. Furthermore, the displace experiments indicate that Berberine can bind to the subdomain IIA, that is, high affinity site (site II).

Specificity of O-glycosylation in enhancing the stability and cellulose binding affinity of Family 1 carbohydrate-binding modules

PubMed Central

Chen, Liqun; Drake, Matthew R.; Resch, Michael G.; Greene, Eric R.; Himmel, Michael E.; Chaffey, Patrick K.; Beckham, Gregg T.; Tan, Zhongping

2014-01-01

The majority of biological turnover of lignocellulosic biomass in nature is conducted by fungi, which commonly use Family 1 carbohydrate-binding modules (CBMs) for targeting enzymes to cellulose. Family 1 CBMs are glycosylated, but the effects of glycosylation on CBM function remain unknown. Here, the effects of O-mannosylation are examined on the Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase at three glycosylation sites. To enable this work, a procedure to synthesize glycosylated Family 1 CBMs was developed. Subsequently, a library of 20 CBMs was synthesized with mono-, di-, or trisaccharides at each site for comparison of binding affinity, proteolytic stability, and thermostability. The results show that, although CBM mannosylation does not induce major conformational changes, it can increase the thermolysin cleavage resistance up to 50-fold depending on the number of mannose units on the CBM and the attachment site. O-Mannosylation also increases the thermostability of CBM glycoforms up to 16 °C, and a mannose disaccharide at Ser3 seems to have the largest themostabilizing effect. Interestingly, the glycoforms with small glycans at each site displayed higher binding affinities for crystalline cellulose, and the glycoform with a single mannose at each of three positions conferred the highest affinity enhancement of 7.4-fold. Overall, by combining chemical glycoprotein synthesis and functional studies, we show that specific glycosylation events confer multiple beneficial properties on Family 1 CBMs. PMID:24821760

Structural basis of carbohydrate recognition by lectin II from Ulex europaeus, a protein with a promiscuous carbohydrate-binding site.

PubMed

Loris, R; De Greve, H; Dao-Thi, M H; Messens, J; Imberty, A; Wyns, L

2000-08-25

Protein-carbohydrate interactions are the language of choice for inter- cellular communication. The legume lectins form a large family of homologous proteins that exhibit a wide variety of carbohydrate specificities. The legume lectin family is therefore highly suitable as a model system to study the structural principles of protein-carbohydrate recognition. Until now, structural data are only available for two specificity families: Man/Glc and Gal/GalNAc. No structural data are available for any of the fucose or chitobiose specific lectins. The crystal structure of Ulex europaeus (UEA-II) is the first of a legume lectin belonging to the chitobiose specificity group. The complexes with N-acetylglucosamine, galactose and fucosylgalactose show a promiscuous primary binding site capable of accommodating both N-acetylglucos amine or galactose in the primary binding site. The hydrogen bonding network in these complexes can be considered suboptimal, in agreement with the low affinities of these sugars. In the complexes with chitobiose, lactose and fucosyllactose this suboptimal hydrogen bonding network is compensated by extensive hydrophobic interactions in a Glc/GlcNAc binding subsite. UEA-II thus forms the first example of a legume lectin with a promiscuous binding site and illustrates the importance of hydrophobic interactions in protein-carbohydrate complexes. Together with other known legume lectin crystal structures, it shows how different specificities can be grafted upon a conserved structural framework. Copyright 2000 Academic Press.

Structural and biochemical studies on ATP binding and hydrolysis by the Escherichia coli RNA chaperone Hfq.

PubMed

Hämmerle, Hermann; Beich-Frandsen, Mads; Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

2012-01-01

In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)(15) and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq(65)) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions.

The influence of repressor DNA binding site architecture on transcriptional control.

PubMed

Park, Dan M; Kiley, Patricia J

2014-08-26

How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

Crystal Structure of the Pseudomonas aeruginosa Virulence Factor Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordes, Timothy J.; Worzalla, Gregory A.; Ginster, Aaron M.

2012-09-07

Virulence factor regulator (Vfr) enhances Pseudomonas aeruginosa pathogenicity through its role as a global transcriptional regulator. The crystal structure of Vfr shows that it is a winged-helix DNA-binding protein like its homologue cyclic AMP receptor protein (CRP). In addition to an expected primary cyclic AMP-binding site, a second ligand-binding site is nestled between the N-terminal domain and the C-terminal helix-turn-helix domain. Unlike CRP, Vfr is a symmetric dimer in the absence of DNA. Removal of seven disordered N-terminal residues of Vfr prvents the growth of P. aeruginosa.

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The second Cu(II)-binding site in a proton-rich environment interferes with the aggregation of amyloid-beta(1-40) into amyloid fibrils.

PubMed

Jun, Sangmi; Gillespie, Joel R; Shin, Byong-kyu; Saxena, Sunil

2009-11-17

The overall morphology and Cu(II) ion coordination for the aggregated amyloid-beta(1-40) [Abeta(1-40)] in N-ethylmorpholine (NEM) buffer are affected by Cu(II) ion concentration. This effect is investigated by transmission electron microscopy (TEM), atomic force microscopy (AFM), and electron spin echo envelope modulation (ESEEM) spectroscopy. At lower than equimolar concentrations of Cu(II) ions, fibrillar aggregates of Abeta(1-40) are observed. At these concentrations of Cu(II), the monomeric and fibrillar Abeta(1-40) ESEEM data indicate that the Cu(II) ion is coordinated by histidine residues. For aggregated Abeta(1-40) at a Cu(II):Abeta molar ratio of 2:1, TEM and AFM images show both linear fibrils and granular amorphous aggregates. The ESEEM spectra show that the multi-histidine coordination for Cu(II) ion partially breaks up and becomes exposed to water or exchangeable protons of the peptide at a higher Cu(II) concentration. Since the continuous-wave electron spin resonance results also suggest two copper-binding sites in Abeta(1-40), the proton ESEEM peak may arise from the second copper-binding site, which may be significantly involved in the formation of granular amorphous aggregates. Thioflavin T fluorescence and circular dichroism experiments also show that Cu(II) inhibits the formation of fibrils and induces a nonfibrillar beta-sheet conformation. Therefore, we propose that Abeta(1-40) has a second copper-binding site in a proton-rich environment and the second binding Cu(II) ion interferes with a conformational transition into amyloid fibrils, inducing the formation of granular amorphous aggregates.

Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum

PubMed Central

2013-01-01

Background METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. Methods We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Results Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Conclusion Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites. PMID:23937714

Genome-wide profiling identifies a subset of methamphetamine (METH)-induced genes associated with METH-induced increased H4K5Ac binding in the rat striatum.

PubMed

Cadet, Jean Lud; Jayanthi, Subramaniam; McCoy, Michael T; Ladenheim, Bruce; Saint-Preux, Fabienne; Lehrmann, Elin; De, Supriyo; Becker, Kevin G; Brannock, Christie

2013-08-12

METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites.

Crystallographic studies with xenon and nitrous oxide provide evidence for protein-dependent processes in the mechanisms of general anesthesia.

PubMed

Abraini, Jacques H; Marassio, Guillaume; David, Helene N; Vallone, Beatrice; Prangé, Thierry; Colloc'h, Nathalie

2014-11-01

The mechanisms by which general anesthetics, including xenon and nitrous oxide, act are only beginning to be discovered. However, structural approaches revealed weak but specific protein-gas interactions. To improve knowledge, we performed x-ray crystallography studies under xenon and nitrous oxide pressure in a series of 10 binding sites within four proteins. Whatever the pressure, we show (1) hydrophobicity of the gas binding sites has a screening effect on xenon and nitrous oxide binding, with a threshold value of 83% beyond which and below which xenon and nitrous oxide, respectively, binds to their sites preferentially compared to each other; (2) xenon and nitrous oxide occupancies are significantly correlated respectively to the product and the ratio of hydrophobicity by volume, indicating that hydrophobicity and volume are binding parameters that complement and oppose each other's effects; and (3) the ratio of occupancy of xenon to nitrous oxide is significantly correlated to hydrophobicity of their binding sites. These data demonstrate that xenon and nitrous oxide obey different binding mechanisms, a finding that argues against all unitary hypotheses of narcosis and anesthesia, and indicate that the Meyer-Overton rule of a high correlation between anesthetic potency and solubility in lipids of general anesthetics is often overinterpreted. This study provides evidence that the mechanisms of gas binding to proteins and therefore of general anesthesia should be considered as the result of a fully reversible interaction between a drug ligand and a receptor as this occurs in classical pharmacology.

Affinity to bovine serum albumin and anticancer activity of some new water-soluble metal Schiff base complexes

NASA Astrophysics Data System (ADS)

Asadi, Mozaffar; Asadi, Zahra; Zarei, Leila; Sadi, Somaye Barzegar; Amirghofran, Zahra

2014-12-01

Metal Schiff-base complexes show biological activity but they are usually insoluble in water so four new water-soluble metal Schiff base complexes of Na2[M(5-SO3-1,2-salben]; (5-SO3-1,2-salben denoted N,N";-bis(5-sulphosalicyliden)-1,2-diaminobenzylamine and M = Mg, Mn, Cu, Zn) were synthesized and characterized. The formation constants of the metal complexes were determined by UV-Vis absorption spectroscopy. The interaction of these complexes with bovine serum albumin (BSA) was studied by fluorescence spectroscopy. Type of quenching, binding constants, number of binding sites and binding stoichiometries were determined by fluorescence quenching method. The results showed that the mentioned complexes strongly bound to BSA. Thermodynamic parameters indicated that hydrophobic association was the major binding force and that the interaction was entropy driven and enthalpically disfavoured. The displacement experiment showed that these complexes could bind to the subdomain IIA (site I) of albumin. Furthermore the synchronous fluorescence spectra showed that the microenvironment of the tryptophan residues was not apparently changed. Based on the Förster theory of non-radiation energy transfer, the distance between the donor (Trp residues) and the acceptor metal complexes was obtained. The growth inhibitory effect of complexes toward the K562 cancer cell line was measured.

Tetrazepam: a benzodiazepine which dissociates sedation from other benzodiazepine activities. II. In vitro and in vivo interactions with benzodiazepine binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keane, P.E.; Bachy, A.; Morre, M.

1988-05-01

Tetrazepam is a 1,4-benzodiazepine (BZD) derivative which, in rodents, appears to have very little sedative and ataxic effects. In an attempt to identify the molecular mechanisms underlying this particular pharmacological profile we examined the interaction of tetrazepam with BZD binding sites. Tetrazepam interacted competitively with central and peripheral BZD binding sites and exhibited comparable affinities for both sites. Tetrazepam was approximately one-seventh as potent as diazepam at the central receptor and as potent as diazepam at the peripheral binding site. Tetrazepam did not distinguish type I from type II central BZD receptors, as evidenced by comparable affinities for the cerebellarmore » and hippocampal receptors. In vitro autoradiographic studies showed that tetrazepam displaced (3H)flunitrazepam from rat brain membranes without any clear regional specificity. Like all BZD receptor agonists, tetrazepam exhibited a gamma-aminobutyric acid shift, a photoaffinity shift and potentiated the binding of 35S-t-butyl-bicyclophosphorothionate to rat brain membranes. However, the latter effect was observed at relatively high concentrations of tetrazepam. In vivo, tetrazepam displaced specifically bound (3H)flunitrazepam from mouse brain (ID50, 37 mg/kg p.o. vs 3.5 mg/kg p.o. for diazepam) and from mouse kidney (ID50, 38 mg/kg p.o. vs. 21 mg/kg p.o. for diazepam). It is concluded that tetrazepam is a BZD receptor agonist; the molecular mechanisms which underly the low sedative potential of the drug cannot at present be explained by a particular interaction with either central or peripheral BZD binding sites, but may be related to the drug's relatively weak effect on 35S-t-butyl-bicyclophosphorothionate binding.« less

Predicting protein-binding RNA nucleotides with consideration of binding partners.

PubMed

Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

2015-06-01

In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in most performance measures. To the best of our knowledge, this is the first sequence-based prediction of protein-binding nucleotides in RNA which considers the binding partner of RNA. The new model will provide valuable information for designing biochemical experiments to find putative protein-binding sites in RNA with unknown structure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

PubMed

Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

1996-07-12

TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

Characterization of interaction between doxycycline and human serum albumin by capillary electrophoresis-frontal analysis.

PubMed

Sun, Hanwen; He, Pan

2009-06-01

The binding of doxycycline to HSA under simulated physiological conditions (pH 7.4, 67 mM phosphate, I=0.17, drug concentration 100 microM, HSA concentration up to 475 microM, 36.5 degrees C) was studied by CE-frontal analysis. The number of primary binding sites, binding constant and physiological protein-binding percentage were 1.9, 1.51 x 10(3) M(-1) and 59.80%, respectively. In addition, the thermodynamic parameters including enthalpy change (DeltaH), entropy change (DeltaS) and free energy change (DeltaG) of the reaction were obtained in order to characterize the acting forces between doxycycline and HSA. Furthermore, to better understand the nature of doxycycline-HSA binding and to get information about potential interaction with other drugs, displacement experiments were performed. The results showed that doxycycline binds at site II of HSA.

Mutant protein of recombinant human granulocyte colony-stimulating factor for receptor binding assay.

PubMed

Watanabe, M; Fukamachi, H; Uzumaki, H; Kabaya, K; Tsumura, H; Ishikawa, M; Matsuki, S; Kusaka, M

1991-05-15

A new mutant protein of recombinant human granulocyte colony-stimulating factor (rhG-CSF) was produced for the studies on receptors for human G-CSF. The mutant protein [(Tyr1, Tyr3]rhG-CSF), the biological activity of which was almost equal to that of rhG-CSF, was prepared by the replacement of threonine-1 and leucine-3 of rhG-CSF with tyrosine. The radioiodinated preparation of the mutant protein showed high specific radioactivity and retained full biological activity for at least 3 weeks. The binding capacity of the radioiodinated ligand was compared with that of [35S]rhG-CSF. Both radiolabeled ligands showed specific binding to murine bone marrow cells. Unlabeled rhG-CSF and human G-CSF purified from the culture supernatant of the human bladder carcinoma cell line 5637 equally competed for the binding of labeled rhG-CSFs in a dose-dependent manner, demonstrating that the sugar moiety of human G-CSF made no contribution to the binding of human G-CSF to target cells. In contrast, all other colony-stimulating factors and lymphokines examined did not affect the binding. Scatchard analysis of the specific binding of both labeled ligands revealed a single class of binding site with an apparent dissociation constant (Kd) of 20-30 pM and 100-200 maximal binding sites per cell. These data indicate that the radioiodinated preparation of the mutant protein binds the same specific receptor with the same affinity as [35S]rhG-CSF. The labeled mutant protein also showed specific binding to human circulating neutrophils.(ABSTRACT TRUNCATED AT 250 WORDS)

Barbiturates Bind in the GLIC Ion Channel Pore and Cause Inhibition by Stabilizing a Closed State*♦

PubMed Central

Fourati, Zaineb; Ruza, Reinis Reinholds; Laverty, Duncan; Drège, Emmanuelle; Delarue-Cochin, Sandrine; Joseph, Delphine; Koehl, Patrice; Smart, Trevor; Delarue, Marc

2017-01-01

Barbiturates induce anesthesia by modulating the activity of anionic and cationic pentameric ligand-gated ion channels (pLGICs). Despite more than a century of use in clinical practice, the prototypic binding site for this class of drugs within pLGICs is yet to be described. In this study, we present the first X-ray structures of barbiturates bound to GLIC, a cationic prokaryotic pLGIC with excellent structural homology to other relevant channels sensitive to general anesthetics and, as shown here, to barbiturates, at clinically relevant concentrations. Several derivatives of barbiturates containing anomalous scatterers were synthesized, and these derivatives helped us unambiguously identify a unique barbiturate binding site within the central ion channel pore in a closed conformation. In addition, docking calculations around the observed binding site for all three states of the receptor, including a model of the desensitized state, showed that barbiturates preferentially stabilize the closed state. The identification of this pore binding site sheds light on the mechanism of barbiturate inhibition of cationic pLGICs and allows the rationalization of several structural and functional features previously observed for barbiturates. PMID:27986812

Identification of metal ion binding sites based on amino acid sequences

PubMed Central

Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

2017-01-01

The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

Interaction of a vasopressin antagonist with vasopressin receptors in the septum of the rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorsa, D.M.; Brot, M.D.; Shewey, L.M.

1988-01-01

The ability of d(CH2)5-Tyr(Me)-arginine-8-vasopressin, an antagonist of peripheral pressoric (V1-type) vasopressin receptors, to label vasopressin binding sites in the septum of the rat brain was evaluated. Using crude membrane preparations from the septum, /sup 3/H-arginine-8-vasopressin (AVP) specifically labels a single class of binding sites with a Kd of 2.9 nM and maximum binding site concentration of 19.8 fmole/mg protein. /sup 3/H-Antag also labels a single class of membrane sites but with higher affinity (Kd = 0.47 nM) and lower capacity (10.1 fmole/mg protein) than /sup 3/H-AVP. The rank order of potency of various competitor peptides for /sup 3/H-AVP and /supmore » 3/H-Antag binding was similar. Oxytocin was 100-1,000 fold less potent than AVP in competing for binding with both ligands. /sup 3/H-AVP and /sup 3/H-Antag showed similar labeling patterns when incubated with septal tissue slices. Unlabeled Antag also effectively antagonized vasopressin-stimulated phosphatidylinositol hydrolysis in septal tissue slices.« less

Identification of metal ion binding sites based on amino acid sequences.

PubMed

Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

2017-01-01

The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

[3H]aniracetam binds to specific recognition sites in brain membranes.

PubMed

Fallarino, F; Genazzani, A A; Silla, S; L'Episcopo, M R; Camici, O; Corazzi, L; Nicoletti, F; Fioretti, M C

1995-08-01

[3H]Aniracetam bound to specific and saturable recognition sites in membranes prepared from discrete regions of rat brain. In crude membrane preparation from rat cerebral cortex, specific binding was Na+ independent, was still largely detectable at low temperature (4 degrees C), and underwent rapid dissociation. Scatchard analysis of [3H]aniracetam binding revealed a single population of sites with an apparent KD value of approximately 70 nM and a maximal density of 3.5 pmol/mg of protein. Specifically bound [3H]aniracetam was not displaced by various metabolites of aniracetam, nor by other pyrrolidinone-containing nootropic drugs such as piracetam or oxiracetam. Subcellular distribution studies showed that a high percentage of specific [3H]aniracetam binding was present in purified synaptosomes or mitochondria, whereas specific binding was low in the myelin fraction. The possibility that at least some [3H]aniracetam binding sites are associated with glutamate receptors is supported by the evidence that specific binding was abolished when membranes were preincubated at 37 degrees C under fast shaking (a procedure that substantially reduced the amount of glutamate trapped in the membranes) and could be restored after addition of either glutamate or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) but not kainate. The action of AMPA was antagonized by DNQX, which also reduced specific [3H]aniracetam binding in unwashed membranes. High levels of [3H]aniracetam binding were detected in hippocampal, cortical, or cerebellar membranes, which contain a high density of excitatory amino acid receptors.(ABSTRACT TRUNCATED AT 250 WORDS)

Specific binding of nicergoline on an alpha1-like adrenoreceptor in the rat retina.

PubMed

Lograno, M D; Tricarico, D; Masciopinto, V; Scuderl, A C

2000-02-01

Systemic treatment with nicergoline, an ergoline derivative showing alpha1-antagonist properties, causes vasodilatation in the eye without apparent untoward cardiovascular effects. In the present work we investigated the ability of nicergoline to inhibit the binding of radiolabelled prazosin in the rat retina and cortex. We found that nicergoline inhibited [3H]prazosin binding in both tissues, being more potent than unlabelled prazosin in the retinal tissue. The competition curves of the ergoline derivative were well fitted by a one-site model in the cortical tissue, with an IC50 (concentration of the drugs needed to inhibit the binding of labelled prazosin by 50%) of 2.54 x 10(-8) M, and by a two-site model in the retinal tissue, with IC50 values of 7.08 x 10(-12) M and 1.82 x 10(-5) M. 2-(2,6 dimetoxyphenoxyethyl) aminomethyl-1,4-benzodioxane hydrochloride (WB4101) and phentolamine, selective ligands for the high-affinity binding site for prazosin, in particular the alpha1A-site, fully inhibited prazosin binding in the cortex but only partially inhibited prazosin binding in the retina, being less potent in this tissue than either nicergoline or prazosin. Our results suggest that a binding component of alpha1-adrenoreceptors is expressed to a lesser extent in the retina than the cortex, leading to a reduced response of the retinal tissue to prazosin, and more particularly to WB4101 and phentolamine. The selective binding of the nicergoline on this retinal adrenoreceptor may explain the peculiar efficacy of the drug in ocular pathophysiology.

Utilizing time-lapse micro-CT-correlated bisphosphonate binding kinetics and soft tissue-derived input functions to differentiate site-specific changes in bone metabolism in vivo.

PubMed

Tower, R J; Campbell, G M; Müller, M; Glüer, C C; Tiwari, S

2015-05-01

The turnover of bone is a tightly regulated process between bone formation and resorption to ensure skeletal homeostasis. This process differs between bone types, with trabecular bone often associated with higher turnover than cortical bone. Analyses of bone by micro-computed tomography (micro-CT) reveal changes in structure and mineral content, but are limited in the study of metabolic activity at a single time point, while analyses of serum markers can reveal changes in bone metabolism, but cannot delineate the origin of any aberrant findings. To obtain a site-specific assessment of bone metabolic status, bisphosphonate binding kinetics were utilized. Using a fluorescently-labeled bisphosphonate, we show that early binding kinetics monitored in vivo using fluorescent molecular tomography (FMT) can monitor changes in bone metabolism in response to bone loss, stimulated by ovariectomy (OVX), or bone gain, resulting from treatment with the anabolic bone agent parathyroid hormone (PTH), and is capable of distinguishing different, metabolically distinct skeletal sites. Using time-lapse micro-CT, longitudinal bone turnover was quantified. The spine showed a significantly greater percent resorbing volume and surface in response to OVX, while mice treated with PTH showed significantly greater resorbing volume per bone surface in the spine and significantly greater forming surfaces in the knee. Correlation studies between binding kinetics and micro-CT suggest that forming surfaces, as assessed by time-lapse micro-CT, are preferentially reflected in the rate constant values while forming and resorbing bone volumes primarily affect plateau values. Additionally, we developed a blood pool correction method which now allows for quantitative multi-compartment analyses to be conducted using FMT. These results further expand our understanding of bisphosphonate binding and the use of bisphosphonate binding kinetics as a tool to monitor site-specific changes in bone metabolism in vivo. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Facilitated dissociation of transcription factors from single DNA binding sites

PubMed Central

Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

2017-01-01

The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

Alcohol binding in the C1 (C1A + C1B) domain of protein kinase C epsilon

PubMed Central

Pany, Satyabrata; Das, Joydip

2015-01-01

Background Alcohol regulates the expression and function of protein kinase C epsilon (PKCε). In a previous study we identified an alcohol binding site in the C1B, one of the twin C1 subdomains of PKCε. Methods In this study, we investigated alcohol binding in the entire C1 domain (combined C1A and C1B) of PKCε. Fluorescent phorbol ester, SAPD and fluorescent diacylglycerol (DAG) analog, dansyl-DAG were used to study the effect of ethanol, butanol, and octanol on the ligand binding using fluorescence resonance energy transfer (FRET). To identify alcohol binding site(s), PKCεC1 was photolabeled with 3-azibutanol and 3-azioctanol, and analyzed by mass spectrometry. The effects of alcohols and the azialcohols on PKCε were studied in NG108-15 cells. Results In the presence of alcohol, SAPD and dansyl-DAG showed different extent of FRET, indicating differential effects of alcohol on the C1A and C1B subdomains. Effects of alcohols and azialcohols on PKCε in NG108-15 cells were comparable. Azialcohols labeled Tyr-176 of C1A and Tyr-250 of C1B. Inspection of the model structure of PKCεC1 reveals that these residues are 40 Å apart from each other indicating that these residues form two different alcohol binding sites. Conclusions The present results provide evidence for the presence of multiple alcohol-binding sites on PKCε and underscore the importance of targeting this PKC isoform in developing alcohol antagonists. PMID:26210390

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

Igs expressed by chronic lymphocytic leukemia B cells show limited binding-site structure variability.

PubMed

Marcatili, Paolo; Ghiotto, Fabio; Tenca, Claudya; Chailyan, Anna; Mazzarello, Andrea N; Yan, Xiao-Jie; Colombo, Monica; Albesiano, Emilia; Bagnara, Davide; Cutrona, Giovanna; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Chiorazzi, Nicholas; Tramontano, Anna; Fais, Franco

2013-06-01

Ag selection has been suggested to play a role in chronic lymphocytic leukemia (CLL) pathogenesis, but no large-scale analysis has been performed so far on the structure of the Ag-binding sites (ABSs) of leukemic cell Igs. We sequenced both H and L chain V(D)J rearrangements from 366 CLL patients and modeled their three-dimensional structures. The resulting ABS structures were clustered into a small number of discrete sets, each containing ABSs with similar shapes and physicochemical properties. This structural classification correlates well with other known prognostic factors such as Ig mutation status and recurrent (stereotyped) receptors, but it shows a better prognostic value, at least in the case of one structural cluster for which clinical data were available. These findings suggest, for the first time, to our knowledge, on the basis of a structural analysis of the Ab-binding sites, that selection by a finite quota of antigenic structures operates on most CLL cases, whether mutated or unmutated.

ADP Regulates SNF1, the Saccharomyces cerevisiae Homolog of AMP-Activated Protein Kinase

PubMed Central

Mayer, Faith V.; Heath, Richard; Underwood, Elizabeth; Sanders, Matthew J.; Carmena, David; McCartney, Rhonda R.; Leiper, Fiona C.; Xiao, Bing; Jing, Chun; Walker, Philip A.; Haire, Lesley F.; Ogrodowicz, Roksana; Martin, Stephen R.; Schmidt, Martin C.; Gamblin, Steven J.; Carling, David

2011-01-01

Summary The SNF1 protein kinase complex plays an essential role in regulating gene expression in response to the level of extracellular glucose in budding yeast. SNF1 shares structural and functional similarities with mammalian AMP-activated protein kinase. Both kinases are activated by phosphorylation on a threonine residue within the activation loop segment of the catalytic subunit. Here we show that ADP is the long-sought metabolite that activates SNF1 in response to glucose limitation by protecting the enzyme against dephosphorylation by Glc7, its physiologically relevant protein phosphatase. We also show that the regulatory subunit of SNF1 has two ADP binding sites. The tighter site binds AMP, ADP, and ATP competitively with NADH, whereas the weaker site does not bind NADH, but is responsible for mediating the protective effect of ADP on dephosphorylation. Mutagenesis experiments suggest that the general mechanism by which ADP protects against dephosphorylation is strongly conserved between SNF1 and AMPK. PMID:22019086

Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.

PubMed

Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S

2017-08-01

Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.

Specific phospholipid binding to Na,K-ATPase at two distinct sites.

PubMed

Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

2017-03-14

Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

Coordination of two sequential ester-transfer reactions: exogenous guanosine binding promotes the subsequent ωG binding to a group I intron

PubMed Central

Bao, Penghui; Wu, Qi-Jia; Yin, Ping; Jiang, Yanfei; Wang, Xu; Xie, Mao-Hua; Sun, Tao; Huang, Lin; Mo, Ding-Ding; Zhang, Yi

2008-01-01

Self-splicing of group I introns is accomplished by two sequential ester-transfer reactions mediated by sequential binding of two different guanosine ligands, but it is yet unclear how the binding is coordinated at a single G-binding site. Using a three-piece trans-splicing system derived from the Candida intron, we studied the effect of the prior GTP binding on the later ωG binding by assaying the ribozyme activity in the second reaction. We showed that adding GTP simultaneously with and prior to the esterified ωG in a substrate strongly accelerated the second reaction, suggesting that the early binding of GTP facilitates the subsequent binding of ωG. GTP-mediated facilitation requires C2 amino and C6 carbonyl groups on the Watson–Crick edge of the base but not the phosphate or sugar groups, suggesting that the base triple interactions between GTP and the binding site are important for the subsequent ωG binding. Strikingly, GTP binding loosens a few local structures of the ribozyme including that adjacent to the base triple, providing structural basis for a rapid exchange of ωG for bound GTP. PMID:18978026

The biological activity of botulinum neurotoxin type C is dependent upon novel types of ganglioside binding sites.

PubMed

Strotmeier, Jasmin; Gu, Shenyan; Jutzi, Stephan; Mahrhold, Stefan; Zhou, Jie; Pich, Andreas; Eichner, Timo; Bigalke, Hans; Rummel, Andreas; Jin, Rongsheng; Binz, Thomas

2011-07-01

The seven botulinum neurotoxins (BoNT) cause muscle paralysis by selectively cleaving core components of the vesicular fusion machinery. Their extraordinary activity primarily relies on highly specific entry into neurons. Data on BoNT/A, B, E, F and G suggest that entry follows a dual receptor interaction with complex gangliosides via an established ganglioside binding region and a synaptic vesicle protein. Here, we report high resolution crystal structures of the BoNT/C cell binding fragment alone and in complex with sialic acid. The WY-motif characteristic of the established ganglioside binding region was located on an exposed loop. Sialic acid was co-ordinated at a novel position neighbouring the binding pocket for synaptotagmin in BoNT/B and G and the sialic acid binding site in BoNT/D and TeNT respectively. Employing synaptosomes and immobilized gangliosides binding studies with BoNT/C mutants showed that the ganglioside binding WY-loop, the newly identified sialic acid-co-ordinating pocket and the area corresponding to the established ganglioside binding region of other BoNTs are involved in ganglioside interaction. Phrenic nerve hemidiaphragm activity tests employing ganglioside deficient mice furthermore evidenced that the biological activity of BoNT/C depends on ganglioside interaction with at least two binding sites. These data suggest a unique cell binding and entry mechanism for BoNT/C among clostridial neurotoxins. © 2011 Blackwell Publishing Ltd.

Analysis of zinc binding sites in protein crystal structures.

PubMed

Alberts, I L; Nadassy, K; Wodak, S J

1998-08-01

The geometrical properties of zinc binding sites in a dataset of high quality protein crystal structures deposited in the Protein Data Bank have been examined to identify important differences between zinc sites that are directly involved in catalysis and those that play a structural role. Coordination angles in the zinc primary coordination sphere are compared with ideal values for each coordination geometry, and zinc coordination distances are compared with those in small zinc complexes from the Cambridge Structural Database as a guide of expected trends. We find that distances and angles in the primary coordination sphere are in general close to the expected (or ideal) values. Deviations occur primarily for oxygen coordinating atoms and are found to be mainly due to H-bonding of the oxygen coordinating ligand to protein residues, bidentate binding arrangements, and multi-zinc sites. We find that H-bonding of oxygen containing residues (or water) to zinc bound histidines is almost universal in our dataset and defines the elec-His-Zn motif. Analysis of the stereochemistry shows that carboxyl elec-His-Zn motifs are geometrically rigid, while water elec-His-Zn motifs show the most geometrical variation. As catalytic motifs have a higher proportion of carboxyl elec atoms than structural motifs, they provide a more rigid framework for zinc binding. This is understood biologically, as a small distortion in the zinc position in an enzyme can have serious consequences on the enzymatic reaction. We also analyze the sequence pattern of the zinc ligands and residues that provide elecs, and identify conserved hydrophobic residues in the endopeptidases that also appear to contribute to stabilizing the catalytic zinc site. A zinc binding template in protein crystal structures is derived from these observations.

Rpn1 provides adjacent receptor sites for substrate binding and deubiquitination by the proteasome

PubMed Central

Shi, Yuan; Chen, Xiang; Elsasser, Suzanne; Stocks, Bradley B.; Tian, Geng; Lee, Byung-Hoon; Shi, Yanhong; Zhang, Naixia; de Poot, Stefanie A. H.; Tuebing, Fabian; Sun, Shuangwu; Vannoy, Jacob; Tarasov, Sergey G.; Engen, John R.; Finley, Daniel; Walters, Kylie J.

2016-01-01

Structured Abstract INTRODUCTION The ubiquitin-proteasome system comprises hundreds of distinct pathways of degradation, which converge at the step of ubiquitin recognition by the proteasome. Five proteasomal ubiquitin receptors have been identified, two that are intrinsic to the proteasome (Rpn10 and Rpn13) and three reversibly associated proteasomal ubiquitin receptors (Rad23, Dsk2, and Ddi1). RATIONALE We found that the five known proteasomal ubiquitin receptors of yeast are collectively nonessential for ubiquitin recognition by the proteasome. We therefore screened for additional ubiquitin receptors in the proteasome and identified subunit Rpn1 as a candidate. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the structure of the binding site within Rpn1, which we term the T1 site. Mutational analysis of this site showed its functional importance within the context of intact proteasomes. T1 binds both ubiquitin and ubiquitin-like (UBL) proteins, in particular the substrate-delivering shuttle factor Rad23. A second site within the Rpn1 toroid, T2, recognizes the UBL domain of deubiquitinating enzyme Ubp6, as determined by hydrogen-deuterium exchange mass spectrometry analysis and validated by amino acid substitution and functional assays. The Rpn1 toroid thus serves a critical scaffolding role within the proteasome, helping to assemble multiple proteasome cofactors as well as substrates. RESULTS Our results indicate that proteasome subunit Rpn1 can recognize both ubiquitin and UBL domains of substrate shuttling factors that themselves bind ubiquitin and function as reversibly-associated proteasomal ubiquitin receptors. Recognition is mediated by the T1 site within the Rpn1 toroid, which supports proteasome function in vivo. We found that the capacity of T1 to recognize both ubiquitin and UBL proteins was shared with Rpn10 and Rpn13. The surprising multiplicity of ubiquitin-recognition domains within the proteasome may promote enhanced, multipoint binding of ubiquitin chains. The structures of the T1 site in its free state and complexed with monoubiquitin or K48-linked diubiquitin were solved, revealing that three neighboring outer helices from the T1 toroid engage two ubiquitins. This binding mode leads to a preference for certain ubiquitin chain types, especially K6- and K48-linked chains, in a distinct configuration that can position substrates close to the entry port of the proteasome. The fate of proteasome-docked ubiquitin conjugates is determined by a competition between deubiquitination and substrate degradation. We find that proximal to the T1 site within the Rpn1 toroid is a second UBL-binding site, T2, that does not assist in ubiquitin chain recognition, but rather in chain disassembly, by binding to the UBL domain of deubiquitinating enzyme Ubp6. Importantly, the UBL interactors at T1 and T2 are distinct, assigning substrate localization to T1 and substrate deubiquitination to T2. CONCLUSION A ligand-binding hotspot was identified in the Rpn1 toroid, consisting of two adjacent receptor sites, T1 and T2. The Rpn1 toroid represents a novel class of binding domains for ubiquitin and UBL proteins. This study thus defines a novel two-site recognition domain intrinsic to the proteasome that uses homologous ubiquitin/UBL-class ligands to assemble substrates, substrate shuttling factors, and a deubiquitinating enzyme in close proximity. A ligand-binding hotspot in the proteasome for assembling substrates and cofactors Schematic (top) and model structure (bottom, left) mapping the UBL-binding Rpn1 T1 (indigo) and T2 (orange) sites. (Bottom, right) Enlarged region of the proteasome to illustrate the Rpn1 T1 and T2 sites bound to a ubiquitin chain (yellow) and deubiquitinating enzyme Ubp6 (green), respectively. PDB 4CR2 and 2B9R were used for this figure. Hundreds of pathways for degradation converge at ubiquitin recognition by proteasome. Here we found that the five known proteasomal ubiquitin receptors are collectively nonessential for ubiquitin recognition, and identified a sixth receptor, Rpn1. A site (T1) in the Rpn1 toroid recognized ubiquitin and ubiquitin-like (UBL) domains of substrate shuttling factors. T1 structures with monoubiquitin or K48 diubiquitin show three neighboring outer helices engaging two ubiquitins. T1 contributes a distinct substrate-binding pathway with preference for K48-linked chains. Proximal to T1 within the Rpn1 toroid is a second UBL-binding site (T2) that assists in ubiquitin chain disassembly, by binding the UBL of deubiquitinating enzyme Ubp6. Thus a two-site recognition domain intrinsic to the proteasome uses homologous ubiquitin/UBL-class ligands to assemble substrates, shuttling factors, and a deubiquitinating enzyme. PMID:26912900

Association of lipids with milk α- and β-caseins.

PubMed

Bourassa, P; Bekale, L; Tajmir-Riahi, H A

2014-09-01

We report the molecular interaction and the binding sites of cholesterol (CHOL), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), dioctadecyldimethyl-ammoniumbromide (DDAB), and dioleoylphosphatidylethanolamine (DOPE) with milk α- and β-caseins in aquous solution at physiological conditions. Fourier transform infrared (FTIR), fluorescence spectroscopic methods and molecular modeling were used to determine the binding sites of lipid-protein complexes and the effect of lipid interaction on the stability and conformation of α- and β-caseins. Structural analysis showed that lipids bind casein via mainly hydrophobic contact with association constants of KCHOL-α-casein=1.0 (±0.1)×10(4) M(-1), KDOPE-α-casein=5.0 (±0.07)×10(3) M(-1), KDDAB-α-casein=2.0 (±0.06)×10(4) M(-1), KDOTAP-α-casein=1.5 (±0.6)×10(4) M(-1), KCHOL-β-casein=1.0 (±0.3)×10(4) M(-1), KDOPE-β-casein=1.5 (±0.06)×10(3) M(-1), KDDAB-β-casein=1.7 (±0.3)×10(4) M(-1) and KDOTAP-β-casein=2.1 (±0.5)×10(4) M(-1). The average number of binding sites occupied by lipid molecules on protein (n) were from 0.7 to 1.1. Docking showed different binding sites for α- and β-caseins toward lipid complexation with the free binding energies from -10 to -13 kcal/mol. Casein conformation was altered by lipid interaction with a reduction of α-helix and β-sheet and an increase of random coil and turn structure suggesting a partial protein unfolding. Cascasein; CHOLcholesterol; DOTAP1,2-dioleoyl-3-trimethylammonium-propane; DDABdioctadecyldimethylammonium bromide; DOPEdioleoylphosphatidylethanolamine; FTIRFourier transform infrared spectroscopy; CDcircular dichroism. Copyright © 2014 Elsevier B.V. All rights reserved.

NF-κB is required for dengue virus NS5-induced RANTES expression.

PubMed

Khunchai, Sasiprapa; Junking, Mutita; Suttitheptumrong, Aroonroong; Kooptiwut, Suwattanee; Haegeman, Guy; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai

2015-02-02

Dengue virus (DENV) infection associates with renal disorders. Patients with dengue hemorrhagic fever and acute kidney injury have a high mortality rate. Increased levels of cytokines may contribute to the pathogenesis of DENV-induced kidney injury. Currently, molecular mechanisms how DENV induces kidney cell injury has not been thoroughly investigated. Excessive cytokine production may be involved in this process. Using human cytokine RT(2) Profiler PCR array, 14 genes including IP-10, RANTES, IL-8, CXCL-9 and MIP-1β were up-regulated more than 2 folds in DENV-infected HEK 293 cells compared to that of mock-infected HEK 293 cells. In the present study, RANTES was suppressed by the NF-κB inhibitor, compound A (CpdA), in DENV-infected HEK 293 cells implying the role of NF-κB in RANTES expression. Chromatin immunoprecipitation (ChIP) assay showed that NF-κB binds more efficiently to its binding sites on the RANTES promoter in NS5-transfected HEK 293 cells than in HEK 293 cells expressing the vector lacking NS5 gene. To further examine whether the NS5-activated RANTES promoter is mediated through NF-κB, the two NF-κB binding sites on the RANTES promoter were mutated and this promoter was coupled to the luciferase cDNA. The result showed that when both binding sites of NF-κB in the RANTES promoter were mutated, the ability of NS5 to induce the luciferase activity was significantly decreased. Therefore, DENV NS5 activates RANTES production by increasing NF-κB binding to its binding sites on the RANTES promoter. Copyright © 2014 Elsevier B.V. All rights reserved.

Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

PubMed Central

2016-01-01

Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

PubMed Central

Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

2009-01-01

Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

PubMed

Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

2002-09-01

Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

PubMed

Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E

1995-06-01

The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.

Tauroursodeoxycholic acid binds to the G-protein site on light activated rhodopsin.

PubMed

Lobysheva, E; Taylor, C M; Marshall, G R; Kisselev, O G

2018-05-01

The heterotrimeric G-protein binding site on G-protein coupled receptors remains relatively unexplored regarding its potential as a new target of therapeutic intervention or as a secondary site of action by the existing drugs. Tauroursodeoxycholic acid bears structural resemblance to several compounds that were previously identified to specifically bind to the light-activated form of the visual receptor rhodopsin and to inhibit its activation of transducin. We show that TUDCA stabilizes the active form of rhodopsin, metarhodopsin II, and does not display the detergent-like effects of common amphiphilic compounds that share the cholesterol scaffold structure, such as deoxycholic acid. Computer docking of TUDCA to the model of light-activated rhodopsin revealed that it interacts using similar mode of binding to the C-terminal domain of transducin alpha subunit. The ring regions of TUDCA made hydrophobic contacts with loop 3 region of rhodopsin, while the tail of TUDCA is exposed to solvent. The results show that TUDCA interacts specifically with rhodopsin, which may contribute to its wide-ranging effects on retina physiology and as a potential therapeutic compound for retina degenerative diseases. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

SSMART: Sequence-structure motif identification for RNA-binding proteins.

PubMed

Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

2018-06-11

RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

PubMed

Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

2006-12-01

The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.

Novel pppGpp binding site at the C-terminal region of the Rel enzyme from Mycobacterium smegmatis.

PubMed

Syal, Kirtimaan; Joshi, Himanshu; Chatterji, Dipankar; Jain, Vikas

2015-10-01

Mycobacterium tuberculosis elicits the stringent response under unfavorable growth conditions, such as those encountered by the pathogen inside the host. The hallmark of this response is production of guanosine tetra- and pentaphosphates, collectively termed (p)ppGpp, which have pleiotropic effects on the bacterial physiology. As the stringent response is connected to survival under stress, it is now being targeted for developing inhibitors against bacterial persistence. The Rel enzyme in mycobacteria has two catalytic domains at its N-terminus that are involved in the synthesis and hydrolysis of (p)ppGpp, respectively. However, the function of the C-terminal region of the protein remained unknown. Here, we have identified a binding site for pppGpp in the C-terminal region of Rel. The binding affinity of pppGpp was quantified by isothermal titration calorimetry. The binding site was determined by crosslinking using the nucleotide analog azido-pppGpp, and examining the crosslink product by mass spectrometry. Additionally, mutations in the Rel protein were created to confirm the site of pppGpp binding by isothermal titration calorimetry. These mutants showed increased pppGpp synthesis and reduced hydrolytic activity. We believe that binding of pppGpp to Rel provides a feedback mechanism that allows the protein to detect and adjust the (p)ppGpp level in the cell. Our work suggests that such sites should also be considered while designing inhibitors to target the stringent response. © 2015 FEBS.

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

PubMed Central

Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

2016-01-01

Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

PubMed

Ando, Tadashi; Skolnick, Jeffrey

2014-12-01

DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain.

PubMed Central

Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M

2000-01-01

Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding. PMID:10727405

The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain.

PubMed

Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M

2000-04-01

Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Prefusion F-specific antibodies determine the magnitude of RSV neutralizing activity in human sera.

PubMed

Ngwuta, Joan O; Chen, Man; Modjarrad, Kayvon; Joyce, M Gordon; Kanekiyo, Masaru; Kumar, Azad; Yassine, Hadi M; Moin, Syed M; Killikelly, April M; Chuang, Gwo-Yu; Druz, Aliaksandr; Georgiev, Ivelin S; Rundlet, Emily J; Sastry, Mallika; Stewart-Jones, Guillaume B E; Yang, Yongping; Zhang, Baoshan; Nason, Martha C; Capella, Cristina; Peeples, Mark E; Ledgerwood, Julie E; McLellan, Jason S; Kwong, Peter D; Graham, Barney S

2015-10-14

Respiratory syncytial virus (RSV) is estimated to claim more lives among infants <1 year old than any other single pathogen, except malaria, and poses a substantial global health burden. Viral entry is mediated by a type I fusion glycoprotein (F) that transitions from a metastable prefusion (pre-F) to a stable postfusion (post-F) trimer. A highly neutralization-sensitive epitope, antigenic site Ø, is found only on pre-F. We determined what fraction of neutralizing (NT) activity in human sera is dependent on antibodies specific for antigenic site Ø or other antigenic sites on F in healthy subjects from ages 7 to 93 years. Adsorption of individual sera with stabilized pre-F protein removed >90% of NT activity and depleted binding antibodies to both F conformations. In contrast, adsorption with post-F removed ~30% of NT activity, and binding antibodies to pre-F were retained. These findings were consistent across all age groups. Protein competition neutralization assays with pre-F mutants in which sites Ø or II were altered to knock out binding of antibodies to the corresponding sites showed that these sites accounted for ~35 and <10% of NT activity, respectively. Binding competition assays with monoclonal antibodies (mAbs) indicated that the amount of site Ø-specific antibodies correlated with NT activity, whereas the magnitude of binding competed by site II mAbs did not correlate with neutralization. Our results indicate that RSV NT activity in human sera is primarily derived from pre-F-specific antibodies, and therefore, inducing or boosting NT activity by vaccination will be facilitated by using pre-F antigens that preserve site Ø. Copyright © 2015, American Association for the Advancement of Science.

A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

PubMed Central

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

2015-01-01

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

Structural Basis of the Lactate-dependent Allosteric Regulation of Oxygen Binding in Arthropod Hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirota, S.; Tanaka, N; Micetic, I

2010-01-01

Hemocyanin (Hc) is an oxygen carrier protein in which oxygen binding is regulated by allosteric effectors such as H{sup +} and L-lactate. Isothermal titration calorimetric measurements showed that L-lactate binds to dodecameric and heterohexameric Hc and to the CaeSS3 homohexamer but not to the CaeSS2 monomer. The binding of lactate caused no change in the optical absorption and x-ray absorption spectra of either oxy- or deoxy-Hc, suggesting that no structural rearrangement of the active site occurred. At pH 6.5, the oxygen binding rate constant k{sub obs} obtained by flash photolysis showed a significant increase upon addition of L-lactate, whereas L-lactatemore » addition had little effect at pH 8.3. Lactate binding caused a concentration-dependent shift in the interhexameric distances at pH 6.5 based on small angle x-ray scattering measurements. These results show that L-lactate affects oxygen affinity at pH 6.5 by modulating the global structure of Hc without affecting its binuclear copper center (the active site). In contrast to this, the active site structure of deoxy-Hc is affected by changes in pH (Hirota, S., Kawahara, T., Beltramini, M., Di Muro, P., Magliozzo, R. S., Peisach, J., Powers, L. S., Tanaka, N., Nagao, S., and Bubacco, L. (2008) J. Biol. Chem. 283, 31941-31948). Upon addiction of lactate, the kinetic behavior of oxygen rebinding for Hc was heterogeneous under low oxygen concentrations at pH 6.5 due to changes in the T and R state populations, and the equilibrium was found to shift from the T toward the R state with addition of lactate.« less

Mechanism of substrate specificity in 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidases

PubMed Central

Siu, Karen K.W.; Asmus, Kyle; Zhang, Allison N.; Horvatin, Cathy; Li, Sheng; Liu, Tong; Moffatt, Barbara; Woods, Virgil L.; Howell, P. Lynne

2010-01-01

5′-Methylthioadenosine/S-adenosylhomocysteine (MTA/SAH) nucleosidase (MTAN) plays a key role in the methionine-recycling pathway of bacteria and plants. Despite extensive structural and biochemical studies, the molecular mechanism of substrate specificity for MTAN remains an outstanding question. Bacterial MTANs show comparable efficiency in hydrolyzing MTA and SAH, while the plant enzymes select preferentially for MTA, with either no or significantly reduced activity towards SAH. Bacterial and plant MTANs show significant conservation in the overall structure, and the adenine- and ribose-binding sites. The observation of a more constricted 5′-alkylthio binding site in Arabidopsis thaliana AtM-TAN1 and AtMTAN2, two plant MTAN homologues, led to the hypothesis that steric hindrance may play a role in substrate selection in plant MTANs. We show using isothermal titration calorimetry that SAH binds to both Escherichia coli MTAN (EcMTAN) and AtMTAN1 with comparable micromolar affinity. To understand why AtMTAN1 can bind but not hydrolyze SAH, we determined the structure of the protein–SAH complex at 2.2 Å resolution. The lack of catalytic activity appears to be related to the enzyme’s inability to bind the substrate in a catalytically competent manner. The role of dynamics in substrate selection was also examined by probing the amide proton exchange rates of EcMTAN and AtMTAN1 via deuterium–hydrogen exchange coupled mass spectrometry. These results correlate with the B factors of available structures and the thermodynamic parameters associated with substrate binding, and suggest a higher level of conformational flexibility in the active site of EcMTAN. Our results implicate dynamics as an important factor in substrate selection in MTAN. PMID:20554051

Characterization of a ( sub 3 H)-5-hydroxtyryptamine binding site in rabbit caudate nucleus that differs from the 5-HT sub 1A , 5-HT sub 1B , 5-HT sub 1C and 5-HT sub 1D subtypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Wencheng; Nelson, D.L.

1989-01-01

({sup 3}H)5-HT binding sites were analyzed in membranes prepared from the rabbit caudate nucleus (CN). ({sup 3}H)5-HT labeled both 5-HT{sub 1A} and 5-HT{sub 1C} recognition sites, defined by nanomolar affinity for 8-OH-DPAT and mesulergine respectively; however, these represented only a fraction of total specific ({sup 3}H)5-HT binding. Saturation experiments of ({sup 3}H)5-HT binding in the presence of 100 nM 8-OH-DPAT and 100 nM mesulergine to block 5-HT{sub 1A} and 5-HT{sub 1C} sites revealed that non-5-HT{sub 1A}/non-5-HT{sub 1C} sites represented about 60% of the total 5-HT{sub 1} sites and that they exhibited saturable, high affinity, and homogeneous binding. The pharmacological profilemore » of the non-5-HT{sub 1A}/non-5-HT{sub 1C} sites (designated 5-HT{sub 1R}) also differed from that of 5-HT{sub 1B} and 5-HT{sub 2} sites, but was similar to that of the 5-HT{sub 1D} site. However, significant differences existed between the 5-HT{sub 1D} and 5-HT{sub 1B} sites for their K{sub i} values for spiperone, spirilene, metergoline, and methiothepin. The study of modulatory agents also showed differences between the 5-HT{sub 1R} and 5-HT{sub 1D} sites. In addition, calcium enhanced the effects of GTP on the 5-HT{sub 1R} sites, whereas calcium inhibited the GTP effect on the 5-HT{sub 1D} sites.« less

α-Actinin Anchors PSD-95 at Postsynaptic Sites.

PubMed

Matt, Lucas; Kim, Karam; Hergarden, Anne C; Patriarchi, Tommaso; Malik, Zulfiqar A; Park, Deborah K; Chowdhury, Dhrubajyoti; Buonarati, Olivia R; Henderson, Peter B; Gökçek Saraç, Çiğdem; Zhang, Yonghong; Mohapatra, Durga; Horne, Mary C; Ames, James B; Hell, Johannes W

2018-03-07

Despite the central role PSD-95 plays in anchoring postsynaptic AMPARs, how PSD-95 itself is tethered to postsynaptic sites is not well understood. Here we show that the F-actin binding protein α-actinin binds to the very N terminus of PSD-95. Knockdown (KD) of α-actinin phenocopies KD of PSD-95. Mutating lysine at position 10 or lysine at position 11 of PSD-95 to glutamate, or glutamate at position 53 or glutamate and aspartate at positions 213 and 217 of α-actinin, respectively, to lysine impairs, in parallel, PSD-95 binding to α-actinin and postsynaptic localization of PSD-95 and AMPARs. These experiments identify α-actinin as a critical PSD-95 anchor tethering the AMPAR-PSD-95 complex to postsynaptic sites. Copyright © 2018 Elsevier Inc. All rights reserved.

High Resolution Features from Low Affinity Interactions: Photoactive Analogs of the Haloether Anesthetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xi,J.; Liu, R.; Rossi, M.

2006-01-01

The difficulty in obtaining binding target and site information for low-affinity drugs, like the inhaled anesthetics, has limited identification of their molecular effectors. Because such information can be provided by photoactive analogues, we designed, synthesized, and characterized a novel diazirnyl haloether that closely mimics isoflurane, the most widely used clinical general anesthetic. This compound, H-diaziflurane, is a nontoxic, potent anesthetic that potentiates GABA-gated ion channels in primary cultures of hippocampal neurons. Calorimetric and structural characterizations show that H-diaziflurane binds a model anesthetic host protein with similar energetics as isoflurane and forms photoadducts with residues lining the isoflurane binding site. H-diazifluranemore » will be immediately useful for identifying targets and sites important for the molecular pharmacology of the inhaled haloether anesthetics.« less

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

PubMed Central

Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

1999-01-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

PubMed Central

Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

2013-01-01

A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

PubMed Central

Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

2012-01-01

KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent

NASA Astrophysics Data System (ADS)

Dudev, Todor; Grauffel, Cédric; Lim, Carmay

2017-02-01

Adenosine triphosphate (ATP), the major energy currency of the cell, exists in solution mostly as ATP-Mg. Recent experiments suggest that Mg2+ interacts with the highly charged ATP triphosphate group and Li+ can co-bind with the native Mg2+ to form ATP-Mg-Li and modulate the neuronal purine receptor response. However, it is unclear how the negatively charged ATP triphosphate group binds Mg2+ and Li+ (i.e. which phosphate group(s) bind Mg2+/Li+) and how the ATP solution conformation depends on the type of metal cation and the metal-binding mode. Here, we reveal the preferred ATP-binding mode of Mg2+/Li+ alone and combined: Mg2+ prefers to bind ATP tridentately to each of the three phosphate groups, but Li+ prefers to bind bidentately to the terminal two phosphates. We show that the solution ATP conformation depends on the cation and its binding site/mode, but it does not change significantly when Li+ binds to Mg2+-loaded ATP. Hence, ATP-Mg-Li, like Mg2+-ATP, can fit in the ATP-binding site of the host enzyme/receptor, activating specific signaling pathways.

Evidence of paired M2 muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potter, L.T.; Ballesteros, L.A.; Bichajian, L.H.

Binding assays involving various antagonists, including N-(3H) methylscopolamine, (3H)quinuclidinyl benzilate, AFDX-116, pirenzepine, and propylbenzilylcholine mustard, disclosed only a single population of M2 muscarinic receptors in membranes from the rat brainstem (medulla, pons, and colliculi). However, competition curves between N-(3H)methylscopolamine and various agonists, including oxotremorine, cis-dioxolane, and acetylethylcholine mustard, showed approximately equal numbers of guanine nucleotide-sensitive high affinity (H) sites and guanine nucleotide-insensitive low affinity (L) sites. This 50% H phenomenon persisted in different buffers, at different temperatures, after the number of receptors was halved (and, thus, the remaining receptor to guanine nucleotide-binding protein ratio was doubled), after membrane solubilization withmore » digitonin, and when rabbit cardiac membranes were used instead of rat brainstem membranes. Preferential occupation of H sites with acetylethylcholine mustard, and of L sites with quinuclidinyl benzilate or either mustard, yielded residual free receptor populations showing predominantly L and H sites, respectively. Low concentrations of (3H)-oxotremorine-M labeled only H sites, and the Bmax for these sites was 49% of the Bmax found with (3H)quinuclidinyl benzilate plus guanine nucleotide. These and other results are most consistent with the idea that H and L receptor sites exist on separate but dimeric receptor molecules and with the hypothesis that only the H receptors cycle between high and low affinity, depending upon interactions between this receptor molecule and a guanine nucleotide-binding protein.« less

The conserved potassium channel filter can have distinct ion binding profiles: Structural analysis of rubidium, cesium, and barium binding in NaK2K

PubMed Central

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant

2014-01-01

Potassium channels are highly selective for K+ over the smaller Na+. Intriguingly, they are permeable to larger monovalent cations such as Rb+ and Cs+ but are specifically blocked by the similarly sized Ba2+. In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K+ channels KcsA and MthK. Rb+ bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs+, however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba2+ binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba2+ block. In the presence of K+, Ba2+ bound to the NaK2K channel at site 3 in conjunction with a K+ at site 1; this led to a prolonged block of the channel (the external K+-dependent Ba2+ lock-in state). In the absence of K+, however, Ba2+ acts as a permeating blocker. We found that, under these conditions, Ba2+ bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba2+ binding profile in the presence and absence of K+ thus provides a structural explanation for the short and prolonged Ba2+ block observed in NaK2K. PMID:25024267

The conserved potassium channel filter can have distinct ion binding profiles: structural analysis of rubidium, cesium, and barium binding in NaK2K.

PubMed

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant; Jiang, Youxing

2014-08-01

Potassium channels are highly selective for K(+) over the smaller Na(+). Intriguingly, they are permeable to larger monovalent cations such as Rb(+) and Cs(+) but are specifically blocked by the similarly sized Ba(2+). In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K(+) channels KcsA and MthK. Rb(+) bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs(+), however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba(2+) binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba(2+) block. In the presence of K(+), Ba(2+) bound to the NaK2K channel at site 3 in conjunction with a K(+) at site 1; this led to a prolonged block of the channel (the external K(+)-dependent Ba(2+) lock-in state). In the absence of K(+), however, Ba(2+) acts as a permeating blocker. We found that, under these conditions, Ba(2+) bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba(2+) binding profile in the presence and absence of K(+) thus provides a structural explanation for the short and prolonged Ba(2+) block observed in NaK2K. © 2014 Lam et al.

Single-molecule Imaging Analysis of Binding, Processive Movement, and Dissociation of Cellobiohydrolase Trichoderma reesei Cel6A and Its Domains on Crystalline Cellulose*

PubMed Central

Nakamura, Akihiko; Tasaki, Tomoyuki; Ishiwata, Daiki; Yamamoto, Mayuko; Okuni, Yasuko; Visootsat, Akasit; Maximilien, Morice; Noji, Hiroyuki; Uchiyama, Taku; Samejima, Masahiro; Igarashi, Kiyohiko; Iino, Ryota

2016-01-01

Trichoderma reesei Cel6A (TrCel6A) is a cellobiohydrolase that hydrolyzes crystalline cellulose into cellobiose. Here we directly observed the reaction cycle (binding, surface movement, and dissociation) of single-molecule intact TrCel6A, isolated catalytic domain (CD), cellulose-binding module (CBM), and CBM and linker (CBM-linker) on crystalline cellulose Iα. The CBM-linker showed a binding rate constant almost half that of intact TrCel6A, whereas those of the CD and CBM were only one-tenth of intact TrCel6A. These results indicate that the glycosylated linker region largely contributes to initial binding on crystalline cellulose. After binding, all samples showed slow and fast dissociations, likely caused by the two different bound states due to the heterogeneity of cellulose surface. The CBM showed much higher specificity to the high affinity site than to the low affinity site, whereas the CD did not, suggesting that the CBM leads the CD to the hydrophobic surface of crystalline cellulose. On the cellulose surface, intact molecules showed slow processive movements (8.8 ± 5.5 nm/s) and fast diffusional movements (30–40 nm/s), whereas the CBM-Linker, CD, and a catalytically inactive full-length mutant showed only fast diffusional movements. These results suggest that both direct binding and surface diffusion contribute to searching of the hydrolysable point of cellulose chains. The duration time constant for the processive movement was 7.7 s, and processivity was estimated as 68 ± 42. Our results reveal the role of each domain in the elementary steps of the reaction cycle and provide the first direct evidence of the processive movement of TrCel6A on crystalline cellulose. PMID:27609516

Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation.

PubMed

Chan, Siew Wee; Lim, Chun Jye; Guo, Fusheng; Tan, Ivan; Leung, Thomas; Hong, Wanjin

2013-12-27

Whether the Hippo pathway has downstream targets other than YAP and TAZ is unknown. In this report, we have identified angiomotin (Amot) family members as novel substrates of Hippo core kinases. The N-terminal regions of Amot proteins contain a conserved HXRXXS consensus site for LATS1/2-mediated phosphorylation. Phospho-specific antibodies showed that Hippo core kinases could mediate phosphorylation of endogenous as well as exogenous Amot family members. Knockdown of LATS1 and LATS2 endogenously reduced the phosphorylation of Amots detected by the phospho-specific antibodies. Mutation of the serine to alanine within this HXRXXS site in Amot and AmotL2 established that this site was essential for Hippo core kinase-mediated phosphorylation. Wild-type and non-phosphorylated Amot (Amot-S175A) were targeted to actin filaments, whereas phospho-mimic Amot (Amot-S175D) failed to be localized with actin. Overexpression of LATS2 caused dissociation of Amot from actin but not Amot-S175A. Mapping of the actin-binding site of Amot showed that serine 175 of Amot was important for the actin-binding activity. Amot-S175A promoted, whereas Amot and Amot-S175D inhibited, cell proliferation. These results collectively suggest that the Hippo pathway negatively regulates the actin-binding activity of Amot family members through direct phosphorylation.

The Role of the β5-α11 Loop in the Active-Site Dynamics of Acylated Penicillin-Binding Protein A from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fedarovich, Alena; Nicholas, Robert A.; Davies, Christopher

Penicillin-binding protein A (PBPA) is a class B penicillin-binding protein that is important for cell division in Mycobacterium tuberculosis. We have determined a second crystal structure of PBPA in apo form and compared it with an earlier structure of apoenzyme. Significant structural differences in the active site region are apparent, including increased ordering of a β-hairpin loop and a shift of the SxN active site motif such that it now occupies a position that appears catalytically competent. Using two assays, including one that uses the intrinsic fluorescence of a tryptophan residue, we have also measured the second-order acylation rate constantsmore » for the antibiotics imipenem, penicillin G, and ceftriaxone. Of these, imipenem, which has demonstrable anti-tubercular activity, shows the highest acylation efficiency. Crystal structures of PBPA in complex with the same antibiotics were also determined, and all show conformational differences in the β5–α11 loop near the active site, but these differ for each β-lactam and also for each of the two molecules in the crystallographic asymmetric unit. Overall, these data reveal the β5–α11 loop of PBPA as a flexible region that appears important for acylation and provide further evidence that penicillin-binding proteins in apo form can occupy different conformational states.« less

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

PubMed Central

Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

2013-01-01

Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

Identification and functional characterization of an Src homology domain 3 domain-binding site on Cbl.

PubMed

Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland

2006-12-01

Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.

Regulation by divalent cations of /sup 3/H-baclofen binding to GABA/sub B/ sites in rat cerebellar membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kato, K.; Goto, M.; Fukuda, H.

1983-02-21

When investigating the effects of divalent cations (Mg/sup 2 +/, Ca/sup 2 +/, Sr/sup 2 +/, Ba/sup 2 +/, Mn/sup 2 +/ and Ni/sup 2 +/) on /sup 3/H-baclofen binding to rat cerebellar synaptic membranes, we found that the specific binding of /sup 3/H-baclofen was not only dependent on divalent cations, but was increased dose-dependently in the presence of these cations. The effects were in the following order of potency: Mn/sup 2 +/ approx. = Ni/sup 2 +/ > Mg/sup 2 +/ > Ca/sup 2 +/ > Sr/sup 2 +/ > Ba/sup 2 +/. Scatchard analysis of the binding datamore » revealed a single component of the binding sites in the presence of 2.5 mM MgCl/sub 2/, 2.5 mM CaCl/sub 2/ or 0.3 mM MnCl/sub 2/ whereas two components appeared in the presence of 2.5 mM MnCl/sub 2/ or 1 mM NiCl/sub 2/. In the former, divalent cations altered the apparent affinity (K/sub d/) without affecting density of the binding sites (B/sub max/). In the latter, the high-affinity sites showed a higher affinity and lower density of the binding sites than did the single component of the former. As the maximal effects of four cations (Mg/sup 2 +/, Ca/sup 2 +/, Mn/sup 2 +/, and Ni/sup 2 +/) were not additive, there are probably common sites of action of these divalent cations. Among the ligands for GABA/sub B/ sites, the affinity for (-), (+) and (+/-)baclofen, GABA and ..beta..-phenyl GABA increased 2 - 6 fold in the presence of 2.5 mM MnCl/sub 2/, in comparison with that in HEPES-buffered Krebs solution (containing 2.5 mM CaCl/sub 2/ and 1.2 mM MgSO/sub 4/), whereas that for muscimol was decreased to one-fifth. Thus, the affinity of GABA/sub B/ sites for its ligands is probably regulated by divalent cations, through common sites of action.« less

Characterization of R5020 and RU486 binding to progesterone receptor from calf uterus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurd, C.; Moudgil, V.K.

1988-05-17

The authors have examined and compared the binding characteristics of the progesterone agonist R5020 (promegestrone, 17,21-dimethylpregna-4,9(10)-diene-3,20-dione) and the progesterone antagonist RU486 (mifepristone, 17..beta..-hydroxy-11..beta..-(4-(dimethylamino)phenyl)-17..cap alpha..-(prop-1-ynyl)-estra-4,9-dien-3-one) in calf uterine cytosol. Both steroids bound cytosol macromolecule(s) with high affinity, exhibiting K/sub d/ values of 5.6 and 3.6 nM for R5020 and RU486 binding, respectively. The binding of the steroids to the macromolecule(s) was rapid at 4/sup 0/C, showing saturation of binding sites at 1-2 h for (/sup 3/H)progesterone and 2-4 h for both (/sup 3/H)R5020 and (/sup 3/H)RU486. Addition of molybdate and glycerol to cytosol increased the extent of (/sup 3/H)R5020 binding. Themore » extent of (/sup 3/H)RU486 binding remained unchanged in the presence of molybdate, whereas glycerol had an inhibitory effect. Molybdate alone or in combination with glycerol stabilized the (/sup 3/H)R5020- and (/sup 3/H)RU486-receptor complexes at 37/sup 0/C. Competitive steroid binding analysis revealed that (/sup 3/H)progesterone, (/sup 3/H)R5020, and (/sup 3/H)RU486 compete for the same site(s) in the uterine cytosol, suggesting that all three bind to the progesterone receptor (PR). Sedimentation rate analysis showed that both steroids were bound to a molecule that sediments in the 8S region. The 8S (/sup 3/H)R5020 and (/sup 3/H)RU486 peaks were abolished by excess radioinert progesterone, RU486, or R5020. The results of this study suggest that, although there are some differences in the nature of their interaction with the PR, both R5020 and RU486 bind to the same 8S receptor in calf uterine cytosol.« less

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

PubMed

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-11-02

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Functional importance of evolutionally conserved Tbx6 binding sites in the presomitic mesoderm-specific enhancer of Mesp2.

PubMed

Yasuhiko, Yukuto; Kitajima, Satoshi; Takahashi, Yu; Oginuma, Masayuki; Kagiwada, Harumi; Kanno, Jun; Saga, Yumiko

2008-11-01

The T-box transcription factor Tbx6 controls the expression of Mesp2, which encodes a basic helix-loop-helix transcription factor that has crucial roles in somitogenesis. In cultured cells, Tbx6 binding to the Mesp2 enhancer region is essential for the activation of Mesp2 by Notch signaling. However, it is not known whether this binding is required in vivo. Here we report that an Mesp2 enhancer knockout mouse bearing mutations in two crucial Tbx6 binding sites does not express Mesp2 in the presomitic mesoderm. This absence leads to impaired skeletal segmentation identical to that reported for Mesp2-null mice, indicating that these Tbx6 binding sites are indispensable for Mesp2 expression. T-box binding to the consensus sequences in the Mesp2 upstream region was confirmed by chromatin immunoprecipitation assays. Further enhancer analyses indicated that the number and spatial organization of the T-box binding sites are critical for initiating Mesp2 transcription via Notch signaling. We also generated a knock-in mouse in which the endogenous Mesp2 enhancer was replaced by the core enhancer of medaka mespb, an ortholog of mouse Mesp2. The homozygous enhancer knock-in mouse was viable and showed normal skeletal segmentation, indicating that the medaka mespb enhancer functionally replaced the mouse Mesp2 enhancer. These results demonstrate that there is significant evolutionary conservation of Mesp regulatory mechanisms between fish and mice.

Marked reduction in the number of platelet-tritiated imipramine binding sites in geriatric depression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemeroff, C.B.; Knight, D.L.; Krishnan, R.R.

The number (Bmax) and affinity (Kd) of platelet-tritiated imipramine binding sites was determined in young and middle-aged controls 50 years of age and younger (n = 25), elderly normal controls over 60 years of age (n = 18), patients who fulfilled DSM-III criteria for major depression who were under 50 years of age (n = 29), patients who fulfilled DSM-III criteria for major depression who were 60 years of age and older (n = 19), and patients who fulfilled both DSM-III criteria for primary degenerative dementia and National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disordersmore » Association criteria for probable Alzheimer's disease (n = 13). Both groups of depressed patients (under 50 and over 60 years of age) exhibited significant reductions (decreases 42%) in the number of platelet-tritiated imipramine binding sites with no change in affinity, when compared with their age-matched controls. There was little overlap in Bmax values between the elderly depressed patients and their controls. The patients with probable Alzheimer's disease showed no alteration in platelet-tritiated imipramine binding. There was no statistically significant relationship between postdexamethasone plasma cortisol concentrations and tritiated imipramine binding. These results indicate that platelet-tritiated imipramine binding may have potential utility as a diagnostic adjunct in geriatric depression, and moreover that the reduction in the number of platelet-tritiated imipramine binding sites is not due to hypercortisolemia.« less

A novel method for the study of molecular interaction by using microscale thermophoresis.

PubMed

Mao, Yexuan; Yu, Lanlan; Yang, Ran; Qu, Ling-bo; Harrington, Perter de B

2015-01-01

The fundamental studies for the binding events of protein and its partner are crucial in drug development. In this study, a novel technology named microscale thermophoresis (MST) was applied in the investigation of molecular interaction between an organic dye fluorescein isothiocyanate (FITC) and bovine serum albumin (BSA), and the results were compared with those obtained from conventional fluorescence spectroscopy. The MST data demonstrated that with a short interaction time, FITC showed a high binding affinity for BSA by weak interaction instead of labeling the protein. By using competitive strategies in which warfarin and ibuprofen acted as the site markers of BSA, FITC was proven to mainly bind to the hydrophobic pocket of site II of BSA compared to site I of BSA. Except for the binding affinity, MST also provided additional information with respect to the aggregation of BSA and the binding of FITC to BSA aggregates, which is unobtainable by fluorescence spectroscopy. This work proves that MST as a new approach is powerful and reliable for investigation of protein-small molecule interaction. Copyright © 2014 Elsevier B.V. All rights reserved.

The selectivity of the Na+/K+-pump is controlled by binding site protonation and self-correcting occlusion

PubMed Central

Rui, Huan; Artigas, Pablo; Roux, Benoît

2016-01-01

The Na+/K+-pump maintains the physiological K+ and Na+ electrochemical gradients across the cell membrane. It operates via an 'alternating-access' mechanism, making iterative transitions between inward-facing (E1) and outward-facing (E2) conformations. Although the general features of the transport cycle are known, the detailed physicochemical factors governing the binding site selectivity remain mysterious. Free energy molecular dynamics simulations show that the ion binding sites switch their binding specificity in E1 and E2. This is accompanied by small structural arrangements and changes in protonation states of the coordinating residues. Additional computations on structural models of the intermediate states along the conformational transition pathway reveal that the free energy barrier toward the occlusion step is considerably increased when the wrong type of ion is loaded into the binding pocket, prohibiting the pump cycle from proceeding forward. This self-correcting mechanism strengthens the overall transport selectivity and protects the stoichiometry of the pump cycle. DOI: http://dx.doi.org/10.7554/eLife.16616.001 PMID:27490484

Heterochromatin assembly by interrupted Sir3 bridges across neighboring nucleosomes

PubMed Central

Behrouzi, Reza; Lu, Chenning; Currie, Mark A; Jih, Gloria; Iglesias, Nahid; Moazed, Danesh

2016-01-01

Heterochromatin is a conserved feature of eukaryotic chromosomes with central roles in regulation of gene expression and maintenance of genome stability. Heterochromatin formation involves spreading of chromatin-modifying factors away from initiation points over large DNA domains by poorly understood mechanisms. In Saccharomyces cerevisiae, heterochromatin formation requires the SIR complex, which contains subunits with histone-modifying, histone-binding, and self-association activities. Here, we analyze binding of the Sir proteins to reconstituted mono-, di-, tri-, and tetra-nucleosomal chromatin templates and show that key Sir-Sir interactions bridge only sites on different nucleosomes but not sites on the same nucleosome, and are therefore 'interrupted' with respect to sites on the same nucleosome. We observe maximal binding affinity and cooperativity to unmodified di-nucleosomes and propose that nucleosome pairs bearing unmodified histone H4-lysine16 and H3-lysine79 form the fundamental units of Sir chromatin binding and that cooperative binding requiring two appropriately modified nucleosomes mediates selective Sir recruitment and spreading. DOI: http://dx.doi.org/10.7554/eLife.17556.001 PMID:27835568

Nature and function of insulator protein binding sites in the Drosophila genome

PubMed Central

Schwartz, Yuri B.; Linder-Basso, Daniela; Kharchenko, Peter V.; Tolstorukov, Michael Y.; Kim, Maria; Li, Hua-Bing; Gorchakov, Andrey A.; Minoda, Aki; Shanower, Gregory; Alekseyenko, Artyom A.; Riddle, Nicole C.; Jung, Youngsook L.; Gu, Tingting; Plachetka, Annette; Elgin, Sarah C.R.; Kuroda, Mitzi I.; Park, Peter J.; Savitsky, Mikhail; Karpen, Gary H.; Pirrotta, Vincenzo

2012-01-01

Chromatin insulator elements and associated proteins have been proposed to partition eukaryotic genomes into sets of independently regulated domains. Here we test this hypothesis by quantitative genome-wide analysis of insulator protein binding to Drosophila chromatin. We find distinct combinatorial binding of insulator proteins to different classes of sites and uncover a novel type of insulator element that binds CP190 but not any other known insulator proteins. Functional characterization of different classes of binding sites indicates that only a small fraction act as robust insulators in standard enhancer-blocking assays. We show that insulators restrict the spreading of the H3K27me3 mark but only at a small number of Polycomb target regions and only to prevent repressive histone methylation within adjacent genes that are already transcriptionally inactive. RNAi knockdown of insulator proteins in cultured cells does not lead to major alterations in genome expression. Taken together, these observations argue against the concept of a genome partitioned by specialized boundary elements and suggest that insulators are reserved for specific regulation of selected genes. PMID:22767387

Tension-induced binding of semiflexible biopolymers

NASA Astrophysics Data System (ADS)

Benetatos, Panayotis; von der Heydt, Alice; Zippelius, Annette

2015-03-01

We investigate theoretically the effect of polymer tension on the collective behaviour of reversible cross-links. We use a model of two parallel-aligned, weakly-bending wormlike chains with a regularly spaced sequence of binding sites subjected to a tensile force. Reversible cross-links attach and detach at the binding sites with an affinity controlled by a chemical potential. In a mean-field approach, we calculate the free energy of the system and we show the emergence of a free energy barrier which controls the reversible (un)binding. The tension affects the conformational entropy of the chains which competes with the binding energy of the cross-links. This competition gives rise to a sudden increase in the fraction of bound sites as the polymer tension increases. The force-induced first-order transition in the number of cross-links implies a sudden force-induced stiffening of the effective stretching modulus of the polymers. This mechanism may be relevant to the formation and stress-induced strengthening of stress fibers in the cytoskeleton. We acknowledge support by the Deutsche Forschungsgemeinschaft (DFG) via grant SFB-937/A1.

Viral receptor-binding site antibodies with diverse germline origins.

PubMed

Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C

2015-05-21

Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. Copyright © 2015 Elsevier Inc. All rights reserved.

Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae)

PubMed Central

Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

2016-01-01

Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703

ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter

PubMed Central

Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

2014-01-01

One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance. PMID:25089713

ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter.

PubMed

Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

2014-08-01

One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance.

Structural Investigation of a Novel N-Acetyl Glucosamine Binding Chi-Lectin Which Reveals Evolutionary Relationship with Class III Chitinases

PubMed Central

Patil, Dipak N.; Datta, Manali; Dev, Aditya; Dhindwal, Sonali; Singh, Nirpendra; Dasauni, Pushpanjali; Kundu, Suman; Sharma, Ashwani K.; Tomar, Shailly; Kumar, Pravindra

2013-01-01

The glycosyl hydrolase 18 (GH18) family consists of active chitinases as well as chitinase like lectins/proteins (CLPs). The CLPs share significant sequence and structural similarities with active chitinases, however, do not display chitinase activity. Some of these proteins are reported to have specific functions and carbohydrate binding property. In the present study, we report a novel chitinase like lectin (TCLL) from Tamarindus indica. The crystal structures of native TCLL and its complex with N-acetyl glucosamine were determined. Similar to the other CLPs of the GH18 members, TCLL lacks chitinase activity due to mutations of key active site residues. Comparison of TCLL with chitinases and other chitin binding CLPs shows that TCLL has substitution of some chitin binding site residues and more open binding cleft due to major differences in the loop region. Interestingly, the biochemical studies suggest that TCLL is an N-acetyl glucosamine specific chi-lectin, which is further confirmed by the complex structure of TCLL with N-acetyl glucosamine complex. TCLL has two distinct N-acetyl glucosamine binding sites S1 and S2 that contain similar polar residues, although interaction pattern with N-acetyl glucosamine varies extensively among them. Moreover, TCLL structure depicts that how plants utilize existing structural scaffolds ingenuously to attain new functions. To date, this is the first structural investigation of a chi-lectin from plants that explore novel carbohydrate binding sites other than chitin binding groove observed in GH18 family members. Consequently, TCLL structure confers evidence for evolutionary link of lectins with chitinases. PMID:23717482

Activity-Based Probes for Isoenzyme- and Site-Specific Functional Characterization of Glutathione S -Transferases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoddard, Ethan G.; Killinger, Bryan J.; Nair, Reji N.

Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “Hmore » site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.« less

Binding of puerarin to human serum albumin: a spectroscopic analysis and molecular docking.

PubMed

He, Yang; Wang, Yiwei; Tang, Lifei; Liu, Hui; Chen, Wei; Zheng, Zhongliang; Zou, Guolin

2008-03-01

Puerarin is a widely used compound in Chinese traditional medicine and exhibits many pharmacological activities. Binding of puerarin to human serum albumin (HSA) was investigated by ultraviolet absorbance, fluorescence, circular dichroism and molecular docking. Puerarin caused a static quenching of intrinsic fluorescence of HSA, the quenching data was analyzed by Stern-Volmer equation. There was one primary puerarin binding site on HSA with a binding constant of 4.12 x 10(4) M(-1) at 298 K. Thermodynamic analysis by Van Hoff equation found enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) were -28.01 kJ/mol and -5.63 J/mol K respectively, which indicated the hydrogen bond and Van der Waas interaction were the predominant forces in the binding process. Competitive experiments showed a displacement of warfarin by puerarin, which revealed that the binding site was located at the drug site I. Puerarin was about 2.22 nm far from the tryptophan according to the observed fluorescence resonance energy transfer between HSA and puerarin. Molecular docking suggested the hydrophobic residues such as tyrosine (Tyr) 150, Tyr 148, Tyr 149 and polar residues such as lysine (Lys) 199, Lys 195, arginine 257 and histidine 242 played an important role in the binding reaction.

Pathogenesis of Shigella diarrhea: rabbit intestinal cell microvillus membrane binding site for Shigella toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuchs, G.; Mobassaleh, M.; Donohue-Rolfe, A.

This study examined the binding of purified /sup 125/I-labeled shigella toxin to rabbit jejunal microvillus membranes (MVMs). Toxin binding was concentration dependent, saturable, reversible, and specifically inhibited by unlabeled toxin. The calculated number of toxin molecules bound at 4/sup 0/C was 7.9 X 10(10) (3 X 10(10) to 2 X 10(11))/micrograms of MVM protein or 1.2 X 10(6) per enterocyte. Scatchard analysis showed the binding site to be of a single class with an equilibrium association constant, K, of 4.7 X 10(9) M-1 at 4/sup 0/C. Binding was inversely related to the temperature of incubation. A total of 80% ofmore » the labeled toxin binding at 4/sup 0/C dissociated from MVM when the temperature was raised to 37/sup 0/C, but reassociated when the temperature was again brought to 4/sup 0/C. There was no structural or functional change of MVM due to toxin as monitored by electron microscopy or assay of MVM sucrase activity. These studies demonstrate a specific binding site for shigella toxin on rabbit MVMs. The physiological relevance of this receptor remains to be determined.« less

Structural characterization of metal binding to a cold-adapted frataxin.

PubMed

Noguera, Martín E; Roman, Ernesto A; Rigal, Juan B; Cousido-Siah, Alexandra; Mitschler, André; Podjarny, Alberto; Santos, Javier

2015-06-01

Frataxin is an evolutionary conserved protein that participates in iron metabolism. Deficiency of this small protein in humans causes a severe neurodegenerative disease known as Friedreich's ataxia. A number of studies indicate that frataxin binds iron and regulates Fe-S cluster biosynthesis. Previous structural studies showed that metal binding occurs mainly in a region of high density of negative charge. However, a comprehensive characterization of the binding sites is required to gain further insights into the mechanistic details of frataxin function. In this work, we have solved the X-ray crystal structures of a cold-adapted frataxin from a psychrophilic bacterium in the presence of cobalt or europium ions. We have identified a number of metal-binding sites, mainly solvent exposed, several of which had not been observed in previous studies on mesophilic homologues. No major structural changes were detected upon metal binding, although the structures exhibit significant changes in crystallographic B-factors. The analysis of these B-factors, in combination with crystal packing and RMSD among structures, suggests the existence of localized changes in the internal motions. Based on these results, we propose that bacterial frataxins possess binding sites of moderate affinity for a quick capture and transfer of iron to other proteins and for the regulation of Fe-S cluster biosynthesis, modulating interactions with partner proteins.

Precursor-product discrimination by La protein during tRNA metabolism.

PubMed

Bayfield, Mark A; Maraia, Richard J

2009-04-01

La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. Although the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA binding beta-sheet surface of the RNA-recognition motif (RRM1) is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. Here we show that La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 beta-surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding, whereas the processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA, but not for the UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair an RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA.

An Iron Reservoir to the Catalytic Metal

PubMed Central

Liu, Fange; Geng, Jiafeng; Gumpper, Ryan H.; Barman, Arghya; Davis, Ian; Ozarowski, Andrew; Hamelberg, Donald; Liu, Aimin

2015-01-01

The rubredoxin motif is present in over 74,000 protein sequences and 2,000 structures, but few have known functions. A secondary, non-catalytic, rubredoxin-like iron site is conserved in 3-hydroxyanthranilate 3,4-dioxygenase (HAO), from single cellular sources but not multicellular sources. Through the population of the two metal binding sites with various metals in bacterial HAO, the structural and functional relationship of the rubredoxin-like site was investigated using kinetic, spectroscopic, crystallographic, and computational approaches. It is shown that the first metal presented preferentially binds to the catalytic site rather than the rubredoxin-like site, which selectively binds iron when the catalytic site is occupied. Furthermore, an iron ion bound to the rubredoxin-like site is readily delivered to an empty catalytic site of metal-free HAO via an intermolecular transfer mechanism. Through the use of metal analysis and catalytic activity measurements, we show that a downstream metabolic intermediate can selectively remove the catalytic iron. As the prokaryotic HAO is often crucial for cell survival, there is a need for ensuring its activity. These results suggest that the rubredoxin-like site is a possible auxiliary iron source to the catalytic center when it is lost during catalysis in a pathway with metabolic intermediates of metal-chelating properties. A spare tire concept is proposed based on this biochemical study, and this concept opens up a potentially new functional paradigm for iron-sulfur centers in iron-dependent enzymes as transient iron binding and shuttling sites to ensure full metal loading of the catalytic site. PMID:25918158

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Basis for changes in the auxin-sensitivity of Avena sativa (oat) leaf-sheath pulvini during the gravitropic response

NASA Technical Reports Server (NTRS)

Kim, D.; Kaufman, P. B.

1995-01-01

During the gravitropic response, auxin-sensitivity of the lower flanks of leaf-sheath pulvini of Avena sativa (oat) is at least 1000-fold higher than those of the upper flanks and non-gravistimulated pulvini. When the pulvini are treated with 1 mM Ca2+, a 10-fold increase in auxin-sensitivity of the pulvini is observed. Related to this difference in auxin-sensitivity, in vitro activation of the vanadate-sensitive H(-)-ATPase by IAA was observed. Results show that the activation of the H(+)-ATPase by IAA is probably mediated by soluble protein factors and that the H(+)-ATPase prepared from the lower flanks is activated by IAA with a 1000-fold higher auxin-sensitivity as compared with that from the upper flanks of the graviresponding pulvini. Ammonium sulfate fractionation experiments show that these soluble protein factors are in the 30 to 60% fraction. Auxin-binding assays reveal that lower flanks contain more high-affinity soluble auxin-binding sites (kD; on the order of 10(-9) M) and less low-affinity soluble auxin-binding sites (kD; on the order of 10(-6) M) than upper flanks. It is concluded that differential auxin-sensitivity of graviresponding oat-shoot pulvini is achieved by the modulation of affinities of auxin-binding sites in upper and lower flanks of the pulvini, that Ca2+ is involved in such modulation, and that one of the probable cellular functions of these auxin binding sites is the activation of the proton pump on the plasma membranes.

Probing the binding sites and the effect of berbamine on the structure of bovine serum albumin

NASA Astrophysics Data System (ADS)

Cheng, Xiao-Xia; Lui, Yi; Zhou, Bo; Xiao, Xiao-He; Liu, Yi

2009-06-01

Berbamine, a naturally occurring isoquinoline alkaloid extracted from Berberis sp., is the active constituent of some Chinese herbal medicines and exhibits a variety of pharmacological activities. The effects of berbamine on the structure of bovine serum albumin (BSA) were investigated by circular dichroism, fluorescence and absorption spectroscopy under physiological conditions. Berbamine caused a static quenching of the intrinsic fluorescence of BSA, and the quenching data were analyzed by application of the Stern-Volmer equation. There was a single primary berbamine-binding site on BSA with a binding constant of 2.577 × 10 4 L mol -1 at 298 K. The thermodynamic parameters, enthalpy change (Δ H0) and entropy change (Δ S0) for the reaction were -76.5 kJ mol -1 and -173.4 J mol -1 K -1 according to the van't Hoff equation. The results showed that the hydrogen bond and van der Waals interaction were the predominant forces in the binding process. Competitive experiments revealed a displacement of warfarin by berbamine, indicating that the binding site was located at Drug sites I. The distance r between the donor (BSA) and the acceptor (berbamine) was obtained according to the Förster non-radiation energy transfer theory. The results of three-dimensional fluorescence spectra, UV-vis absorption difference spectra and circular dichroism of BSA in the presence of berbamine showed that the conformation of BSA was changed. The results provide a quantitative understanding of the effect of berbamine on the structure of bovine serum albumin, providing a useful guideline for further drug design.

Probing the binding sites and the effect of berbamine on the structure of bovine serum albumin.

PubMed

Cheng, Xiao-Xia; Lui, Yi; Zhou, Bo; Xiao, Xiao-He; Liu, Yi

2009-06-01

Berbamine, a naturally occurring isoquinoline alkaloid extracted from Berberis sp., is the active constituent of some Chinese herbal medicines and exhibits a variety of pharmacological activities. The effects of berbamine on the structure of bovine serum albumin (BSA) were investigated by circular dichroism, fluorescence and absorption spectroscopy under physiological conditions. Berbamine caused a static quenching of the intrinsic fluorescence of BSA, and the quenching data were analyzed by application of the Stern-Volmer equation. There was a single primary berbamine-binding site on BSA with a binding constant of 2.577x10(4)Lmol(-1) at 298K. The thermodynamic parameters, enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) for the reaction were -76.5kJmol(-1) and -173.4Jmol(-1)K(-1) according to the van't Hoff equation. The results showed that the hydrogen bond and van der Waals interaction were the predominant forces in the binding process. Competitive experiments revealed a displacement of warfarin by berbamine, indicating that the binding site was located at Drug sites I. The distance r between the donor (BSA) and the acceptor (berbamine) was obtained according to the Förster non-radiation energy transfer theory. The results of three-dimensional fluorescence spectra, UV-vis absorption difference spectra and circular dichroism of BSA in the presence of berbamine showed that the conformation of BSA was changed. The results provide a quantitative understanding of the effect of berbamine on the structure of bovine serum albumin, providing a useful guideline for further drug design.

Long-range Electrostatic Complementarity Governs Substrate Recognition by Human Chymotrypsin C, a Key Regulator of Digestive Enzyme Activation*

PubMed Central

Batra, Jyotica; Szabó, András; Caulfield, Thomas R.; Soares, Alexei S.; Sahin-Tóth, Miklós; Radisky, Evette S.

2013-01-01

Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5′ subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2′ positions of CTRC, although acidic P2′ residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels. PMID:23430245

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipiuk, J.; Gornicki, P.; Maj, L.

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

LncRNA/DNA binding analysis reveals losses and gains and lineage specificity of genomic imprinting in mammals.

PubMed

Liu, Haihua; Shang, Xiaoxiao; Zhu, Hao

2017-05-15

Genomic imprinting is regulated by lncRNAs and is important for embryogenesis, physiology and behaviour in mammals. Aberrant imprinting causes diseases and disorders. Experimental studies have examined genomic imprinting primarily in humans and mice, thus leaving some fundamental issues poorly addressed. The cost of experimentally examining imprinted genes in many tissues in diverse species makes computational analysis of lncRNAs' DNA binding sites valuable. We performed lncRNA/DNA binding analysis in imprinting clusters from multiple mammalian clades and discovered the following: (i) lncRNAs and imprinting sites show significant losses and gains and distinct lineage-specificity; (ii) binding of lncRNAs to promoters of imprinted genes may occur widely throughout the genome; (iii) a considerable number of imprinting sites occur in only evolutionarily more derived species; and (iv) multiple lncRNAs may bind to the same imprinting sites, and some lncRNAs have multiple DNA binding motifs. These results suggest that the occurrence of abundant lncRNAs in mammalian genomes makes genomic imprinting a mechanism of adaptive evolution at the epigenome level. The data and program are available at the database LongMan at lncRNA.smu.edu.cn. zhuhao@smu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

PubMed Central

Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

1995-01-01

Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

Replication of damaged DNA in vitro is blocked by p53

PubMed Central

Zhou, Jianmin; Prives, Carol

2003-01-01

The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

Structural and Biochemical Studies on ATP Binding and Hydrolysis by the Escherichia coli RNA Chaperone Hfq

PubMed Central

Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

2012-01-01

In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)15 and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq65) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions. PMID:23226421

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

Role of Protein Dimeric Interface in Allosteric Inhibition of N-Acetyl-Aspartate Hydrolysis by Human Aspartoacylase.

PubMed

Kots, Ekaterina D; Lushchekina, Sofya V; Varfolomeev, Sergey D; Nemukhin, Alexander V

2017-08-28

The results of molecular modeling suggest a mechanism of allosteric inhibition upon hydrolysis of N-acetyl-aspartate (NAA), one of the most abundant amino acid derivatives in brain, by human aspartoacylase (hAsp). Details of this reaction are important to suggest the practical ways to control the enzyme activity. Search for allosteric sites using the Allosite web server and SiteMap analysis allowed us to identify substrate binding pockets located at the interface between the subunits of the hAsp dimer molecule. Molecular docking of NAA to the pointed areas at the dimer interface predicted a specific site, in which the substrate molecule interacts with the Gly237, Arg233, Glu290, and Lys292 residues. Analysis of multiple long-scaled molecular dynamics trajectories (the total simulation time exceeded 1.5 μs) showed that binding of NAA to the identified allosteric site induced significant rigidity to the protein loops with the amino acid side chains forming gates to the enzyme active site. Application of the protein dynamical network algorithms showed that substantial reorganization of the signal propagation pathways of intersubunit communication in the dimer occurred upon allosteric NAA binding to the remote site. The modeling approaches provide an explanation to the observed decrease of the reaction rate of NAA hydrolysis by hAsp at high substrate concentrations.

Structural and Physical Basis for Anti-IgE Therapy

NASA Astrophysics Data System (ADS)

Wright, Jon D.; Chu, Hsing-Mao; Huang, Chun-Hsiang; Ma, Che; Wen Chang, Tse; Lim, Carmay

2015-06-01

Omalizumab, an anti-IgE antibody, used to treat severe allergic asthma and chronic idiopathic urticaria, binds to IgE in blood or membrane-bound on B lymphocytes but not to IgE bound to its high (FcɛRI) or low (CD23) affinity receptor. Mutagenesis studies indicate overlapping FcɛRI and omalizumab-binding sites in the Cɛ3 domain, but crystallographic studies show FcɛRI and CD23-binding sites that are far apart, so how can omalizumab block IgE from binding both receptors? We report a 2.42-Å omalizumab-Fab structure, a docked IgE-Fc/omalizumab-Fab structure consistent with available experimental data, and the free energy contributions of IgE residues to binding omalizumab, CD23, and FcɛRI. These results provide a structural and physical basis as to why omalizumab cannot bind receptor-bound IgE and why omalizumab-bound IgE cannot bind to CD23/FcɛRI. They reveal the key IgE residues and their roles in binding omalizumab, CD23, and FcɛRI.

Carbohydrate binding specificity of pea lectin studied by NMR spectroscopy and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Cheong, Youngjoo; Shim, Gyuchang; Kang, Dongil; Kim, Yangmee

1999-02-01

The conformational details of Man( α1,6)Man( α)OMe are investigated through NMR spectroscopy in conjunction with molecular modeling. The lowest energy structure (M1) in the adiabatic energy map calculated with a dielectric constant of 50 has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=180°. The other low energy structure (M2) has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=-60°. Molecular dynamics simulations and NMR experiments prove that Man( α1,6)Man( α)OMe in the free form exists with conformational averaging of M1 and M2 conformers predominantly. Molecular dynamics simulations of the pea lectin-carbohydrate complex with explicit water molecules starting from the X-ray crystallographic structure of pea lectin show that the protein-carbohydrate interaction centers mainly on the hydrogen bonds and van der Waals interactions between protein and carbohydrate. From the molecular dynamics simulation, it is found that the M1 structure can bind to pea lectin better than the M2 structure. The origin of this selectivity is the water- mediated hydrogen bond interactions between the remote mannose and the binding site of pea lectin as well as the direct hydrogen bond interaction between the terminal mannose and pea lectin. Extensive networks of interactions in the carbohydrate binding site and the metal binding site are important in maintaining the carbohydrate binding properties of pea lectin. Especially, the predominant factors of mannose binding specificity of pea lectin are the hydrogen bond interactions between the 4th hydroxyl groups of the terminal sugar ring and the side chains of Asp-81 and Asn-125 in the carbohydrate binding site, and the additional interactions between these side chains of Asp-81 and Asn-125 and the calcium ion in the metal binding site of pea lectin.

Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

PubMed

Schlaepfer, D D; Hunter, T

1996-10-01

Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

Crystal structure of Yersinia pestis virulence factor YfeA reveals two polyspecific metal-binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Radka, Christopher D.; DeLucas, Lawrence J.; Wilson, Landon S.

2017-06-30

Gram-negative bacteria use siderophores, outer membrane receptors, inner membrane transporters and substrate-binding proteins (SBPs) to transport transition metals through the periplasm. The SBPs share a similar protein fold that has undergone significant structural evolution to communicate with a variety of differentially regulated transporters in the cell. InYersinia pestis, the causative agent of plague, YfeA (YPO2439, y1897), an SBP, is important for full virulence during mammalian infection. To better understand the role of YfeA in infection, crystal structures were determined under several environmental conditions with respect to transition-metal levels. Energy-dispersive X-ray spectroscopy and anomalous X-ray scattering data show that YfeA ismore » polyspecific and can alter its substrate specificity. In minimal-media experiments, YfeA crystals grown after iron supplementation showed a threefold increase in iron fluorescence emission over the iron fluorescence emission from YfeA crystals grown from nutrient-rich conditions, and YfeA crystals grown after manganese supplementation during overexpression showed a fivefold increase in manganese fluorescence emission over the manganese fluorescence emission from YfeA crystals grown from nutrient-rich conditions. In all experiments, the YfeA crystals produced the strongest fluorescence emission from zinc and could not be manipulated otherwise. Additionally, this report documents the discovery of a novel surface metal-binding site that prefers to chelate zinc but can also bind manganese. Flexibility across YfeA crystal forms in three loops and a helix near the buried metal-binding site suggest that a structural rearrangement is required for metal loading and unloading.« less

Molecular dynamics simulations show how the FMRP Ile304Asn mutation destabilizes the KH2 domain structure and affects its function.

PubMed

Di Marino, Daniele; Achsel, Tilmann; Lacoux, Caroline; Falconi, Mattia; Bagni, Claudia

2014-01-01

Mutations or deletions of FMRP, involved in the regulation of mRNA metabolism in brain, lead to the Fragile X syndrome (FXS), the most frequent form of inherited intellectual disability. A severe manifestation of the disease has been associated with the Ile304Asn mutation, located on the KH2 domain of the protein. Several hypotheses have been proposed to explain the possible molecular mechanism responsible for the drastic effect of this mutation in humans. Here, we performed a molecular dynamics simulation and show that the Ile304Asn mutation destabilizes the hydrophobic core producing a partial unfolding of two α-helices and a displacement of a third one. The affected regions show increased residue flexibility and motion. Molecular docking analysis revealed strongly reduced binding to a model single-stranded nucleic acid in agreement with known data that the two partially unfolded helices form the RNA-binding surface. The third helix, which we show here to be also affected, is involved in the PAK1 protein interaction. These two functional binding sites on the KH2 domain do not overlap spatially, and therefore, they can simultaneously bind their targets. Since the Ile304Asn mutation affects both binding sites, this may justify the severe clinical manifestation observed in the patient in which both mRNA metabolism activity and cytoskeleton remodeling would be affected.

Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

PubMed Central

Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

2011-01-01

Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248

Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

PubMed

Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

2012-03-01

Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

Pharmacological evaluation of an [(123)I] labelled imidazopyridine-3-acetamide for the study of benzodiazepine receptors.

PubMed

Mattner, Filomena; Mardon, Karine; Loc'h, Christian; Katsifis, Andrew

2006-06-13

In vitro binding of the iodinated imidazopyridine, N',N'-dimethyl-6-methyl-(4'-[(123)I]iodophenyl)imidazo[1,2-a]pyridine-3-acetamide [(123)I]IZOL to benzodiazepine binding sites on brain cortex, adrenal and kidney membranes is reported. Saturation experiments showed that [(123)I]IZOL, bound to a single class of binding site (n(H)=0.99) on adrenal and kidney mitochondrial membranes with a moderate affinity (K(d)=30 nM). The density of binding sites was 22+/-6 and 1.2+/-0.4 pmol/mg protein on adrenal and kidney membranes, respectively. No specific binding was observed in mitochondrial-synaptosomal membranes of brain cortex. In biodistribution studies in rats, the highest uptake of [(123)I]IZOL was found 30 min post injection in adrenals (7.5% ID/g), followed by heart, kidney, lung (1% ID/g) and brain (0.12% ID/g), consistent with the distribution of peripheral benzodiazepine binding sites. Pre-administration of unlabelled IZOL and the specific PBBS drugs, PK 11195 and Ro 5-4864 significantly reduced the uptake of [(123)I]IZOL by 30% (p<0.05) in olfactory bulbs and by 51-86% (p<0.01) in kidney, lungs, heart and adrenals, while it increased by 30% to 50% (p<0.01) in the rest of the brain and the blood. Diazepam, a mixed CBR-PBBS drug, inhibited the uptake in kidney, lungs, heart, adrenals and olfactory bulbs by 32% to 44% (p<0.01) but with no effect on brain uptake and in blood concentration. Flumazenil, a central benzodiazepine drug and haloperidol (dopamine antagonist/sigma receptor drug) displayed no effect in [(123)I]IZOL in peripheral organs and in the brain. [(123)I]IZOL may deserve further development for imaging selectively peripheral benzodiazepine binding sites.

The effect of glycosylation on the transferrin structure: A molecular dynamic simulation analysis.

PubMed

Ghanbari, Z; Housaindokht, M R; Bozorgmehr, M R; Izadyar, M

2016-09-07

Transferrins have been defined by the highly cooperative binding of iron and a carbonate anion to form a Fe-CO3-Tf ternary complex. As such, the layout of the binding site residues affects transferrin function significantly; In contrast to N-lobe, C-lobe binding site of the transferrin structure has been less characterized and little research which surveyed the interaction of carbonate with transferrin in the C-lobe binding site has been found. In the present work, molecular dynamic simulation was employed to gain access into the molecular level understanding of carbonate binding site and their interactions in each lobe. Residues responsible for carbonate binding of transferrin structure were pointed out. In addition, native human transferrin is a glycoprotein that two N-linked complex glycan chains located in the C-lobe. Usually, in the molecular dynamic simulation for simplifying, glycan is removed from the protein structure. Here, we explore the effect of glycosylation on the transferrin structure. Glycosylation appears to have an effect on the layout of the binding site residue and transferrin structure. On the other hand, sometimes the entire transferrin formed by separated lobes that it allows the results to be interpreted in a straightforward manner rather than more parameters required for full length protein. But, it should be noted that there are differences between the separated lobe and full length transferrin, hence, a comparative analysis by the molecular dynamic simulation was performed to investigate such structural variations. Results revealed that separation in C-lobe caused a significant structural variation in comparison to N-lobe. Consequently, the separated lobes and the full length one are different, showing the importance of the interlobe communication and the impact of the lobes on each other in the transferrin structure. Copyright © 2016 Elsevier Ltd. All rights reserved.

Allosteric site-mediated active site inhibition of PBP2a using Quercetin 3-O-rutinoside and its combination.

PubMed

Rani, Nidhi; Vijayakumar, Saravanan; P T V, Lakshmi; Arunachalam, Annamalai

2016-08-01

Recent crystallographic study revealed the involvement of allosteric site in active site inhibition of penicillin binding protein (PBP2a), where one molecule of Ceftaroline (Cef) binds to the allosteric site of PBP2a and paved way for the other molecule (Cef) to bind at the active site. Though Cef has the potency to inhibit the PBP2a, its adverse side effects are of major concern. Previous studies have reported the antibacterial property of Quercetin derivatives, a group of natural compounds. Hence, the present study aims to evaluate the effect of Quercetin 3-o-rutinoside (Rut) in allosteric site-mediated active site inhibition of PBP2a. The molecular docking studies between allosteric site and ligands (Rut, Que, and Cef) revealed a better binding efficiency (G-score) of Rut (-7.790318) and Cef (-6.194946) with respect to Que (-5.079284). Molecular dynamic (MD) simulation studies showed significant changes at the active site in the presence of ligands (Rut and Cef) at allosteric site. Four different combinations of Rut and Cef were docked and their G-scores ranged between -6.320 and -8.623. MD studies revealed the stability of the key residue (Ser403) with Rut being at both sites, compared to other complexes. Morphological analysis through electron microscopy confirmed that combination of Rut and Cefixime was able to disturb the bacterial cell membrane in a similar fashion to that of Rut and Cefixime alone. The results of this study indicate that the affinity of Rut at both sites were equally good, with further validations Rut could be considered as an alternative for inhibiting MRSA growth.

Screening of a library of T7 phage-displayed peptides identifies alphaC helix in 14-3-3 protein as a CBP501-binding site.

PubMed

Matsumoto, Yuki; Shindo, Yosuke; Takakusagi, Yoichi; Takakusagi, Kaori; Tsukuda, Senko; Kusayanagi, Tomoe; Sato, Hitoshi; Kawabe, Takumi; Sugawara, Fumio; Sakaguchi, Kengo

2011-12-01

CBP501 is a chemically modified peptide composed of twelve unnatural d-amino acids, which inhibits Chk kinase and abrogates G2 arrest induced by DNA-damaging agents. Here we identified an alphaC helix in 14-3-3 protein as a CBP501-binding site using T7 phage display technology. An affinity selection of T7 phage-displayed peptide using biotinylated CBP501 identified a 14-mer peptide NSDCIISRKIEQKE. This peptide sequence showed similarity to a portion of the alphaC helix of human 14-3-3ε, suggesting that CBP501 may bind to this region. Surface plasmon resonance (SPR) and ELISA demonstrated that CBP501 interacts with 14-3-3ε specifically at the screen-guided region. An avidin-agarose bead pull-down assay showed that CBP501 also binds to other 14-3-3 isoforms in Jurkat cells. Among the other known Chk kinase inhibitors tested, CBP501 showed the strongest affinity for 14-3-3ε. Thus, we conclude that in addition to the direct inhibition of Chk kinase activity, CBP501 directly binds to cellular 14-3-3 proteins through alphaC helix. Copyright © 2011 Elsevier Ltd. All rights reserved.