Sample records for binding sites upstream

  1. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  2. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  3. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  4. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  5. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  6. PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

    PubMed

    Feng, Youjun; Cronan, John E

    2014-01-01

    Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  7. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  8. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

    PubMed Central

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-01-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

  9. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  10. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

    PubMed Central

    Orengo, Dorcas J.; Aguadé, Montserrat

    2017-01-01

    The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

  11. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    PubMed

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  12. A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

    PubMed Central

    Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

    2000-01-01

    Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

  13. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  14. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  15. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  16. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  17. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  18. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

    PubMed Central

    Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

    1997-01-01

    GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

  19. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  20. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  1. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  2. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  3. Expression of eukaryotic polypeptides in chloroplasts

    DOEpatents

    Mayfield, Stephen P.

    2013-06-04

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  4. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  5. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    PubMed

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  6. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  7. A mechanism underlying position-specific regulation of alternative splicing

    PubMed Central

    Hamid, Fursham M.

    2017-01-01

    Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

  8. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  9. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  10. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  11. COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.

    PubMed

    Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M

    2001-01-26

    Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.

  12. COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

    PubMed Central

    Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

    2002-01-01

    Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

  13. Characterization of Rous sarcoma virus polyadenylation site use in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maciolek, Nicole L.; McNally, Mark T.

    2008-05-10

    Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

  14. Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

    PubMed

    Kel, AlexanderE

    2017-02-01

    Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

  15. Localization of TFIIB binding regions using serial analysis of chromatin occupancy

    PubMed Central

    Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon

    2007-01-01

    Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859

  16. Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

    PubMed

    Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

    2004-09-01

    Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

  17. Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

    PubMed Central

    Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

    1993-01-01

    The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

  18. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  19. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  20. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  1. Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

    PubMed

    Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

    2017-11-01

    We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

  2. Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

    PubMed Central

    Qiao, Huan; May, James M.

    2012-01-01

    Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

  3. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  4. The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

    DOE PAGES

    Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

    2017-06-24

    In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

  5. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  6. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  7. Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

    PubMed Central

    Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

    2000-01-01

    Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

  8. Coliphage HK022 Nun protein inhibits RNA polymerase translocation

    PubMed Central

    Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

    2014-01-01

    The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

  9. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    PubMed

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  10. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  11. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    PubMed Central

    2009-01-01

    Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

  12. The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

    PubMed Central

    Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

    1997-01-01

    The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

  13. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  14. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  15. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  16. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  17. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  18. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

    PubMed Central

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-01-01

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

  19. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  20. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  1. Regulated expression of a repressor protein: FadR activates iclR.

    PubMed Central

    Gui, L; Sunnarborg, A; LaPorte, D C

    1996-01-01

    The control of the glyoxylate bypass operon (aceBAK) of Escherichia coli is mediated by two regulatory proteins, IclMR and FadR. IclMR is a repressor protein which has previously been shown to bind to a site which overlaps the aceBAK promoter. FAR is a repressor/activator protein which participates in control of the genes of fatty acid metabolism. A sequence just upstream of the iclR promoter bears a striking resemblance to FadR binding sites found in the fatty acid metabolic genes. The in vitro binding specificity of FadR, determined by oligonucleotide selection, was in good agreement with the sequences of these sites. The ability of FadR to bind to the site associated with iclR was demonstrated by gel shift and DNase I footprint analyses. Disruption of FadR or inactivation of the FadR binding site of iclR decreased the expression of an iclR::lacZ operon fusion, indicating that FadR activates the expression of iclR. It has been reported that disruption of fadR increases the expression of aceBAK. We observed a similar increase when we inactivated the FadR binding site of an iclR+ allele. This result suggests that FadR regulates aceBAK indirectly by altering the expression of IclR. PMID:8755903

  2. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  3. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  4. Identification of regulatory targets for the bacterial Nus factor complex.

    PubMed

    Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

    2017-12-11

    Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

  5. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  6. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  7. Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

    PubMed Central

    Bickhart, Derek M.; Liu, George E.

    2013-01-01

    A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

  8. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

    2010-12-03

    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

  9. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  10. Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

    PubMed Central

    Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

    2011-01-01

    Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248

  11. Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

    PubMed

    Yamasu, K; Wilt, F H

    1999-02-01

    The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

  12. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

    PubMed

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-07-27

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

    PubMed Central

    Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

    2012-01-01

    Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

  14. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  15. Role of Su(Hw) zinc finger 10 and interaction with CP190 and Mod(mdg4) proteins in recruiting the Su(Hw) complex to chromatin sites in Drosophila.

    PubMed

    Melnikova, Larisa; Kostyuchenko, Margarita; Parshikov, Alexander; Georgiev, Pavel; Golovnin, Anton

    2018-01-01

    Su(Hw) belongs to the class of proteins that organize chromosome architecture and boundaries/insulators between regulatory domains. This protein contains a cluster of 12 zinc finger domains most of which are responsible for binding to three different modules in the consensus site. Su(Hw) forms a complex with CP190 and Mod(mdg4)-67.2 proteins that binds to well-known Drosophila insulators. To understand how Su(Hw) performs its activities and binds to specific sites in chromatin, we have examined the previously described su(Hw)f mutation that disrupts the 10th zinc finger (ZF10) responsible for Su(Hw) binding to the upstream module. The results have shown that Su(Hw)f loses the ability to interact with CP190 in the absence of DNA. In contrast, complete deletion of ZF10 does not prevent the interaction between Su(Hw)Δ10 and CP190. Having studied insulator complex formation in different mutant backgrounds, we conclude that both association with CP190 and Mod(mdg4)-67.2 partners and proper organization of DNA binding site are essential for the efficient recruitment of the Su(Hw) complex to chromatin insulators.

  16. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

  17. The Global Redox Responding RegB/RegA Signal Transduction System Regulates the Genes Involved in Ferrous Iron and Inorganic Sulfur Compound Oxidation of the Acidophilic Acidithiobacillus ferrooxidans.

    PubMed

    Moinier, Danielle; Byrne, Deborah; Amouric, Agnès; Bonnefoy, Violaine

    2017-01-01

    The chemical attack of ore by ferric iron and/or sulfuric acid releases valuable metals. The products of these reactions are recycled by iron and sulfur oxidizing microorganisms. These acidophilic chemolithotrophic prokaryotes, among which Acidithiobacillus ferrooxidans , grow at the expense of the energy released from the oxidation of ferrous iron and/or inorganic sulfur compounds (ISCs). In At. ferrooxidans , it has been shown that the expression of the genes encoding the proteins involved in these respiratory pathways is dependent on the electron donor and that the genes involved in iron oxidation are expressed before those responsible for ISCs oxidation when both iron and sulfur are present. Since the redox potential increases during iron oxidation but remains stable during sulfur oxidation, we have put forward the hypothesis that the global redox responding two components system RegB/RegA is involved in this regulation. To understand the mechanism of this system and its role in the regulation of the aerobic respiratory pathways in At. ferrooxidans , the binding of different forms of RegA (DNA binding domain, wild-type, unphosphorylated and phosphorylated-like forms of RegA) on the regulatory region of different genes/operons involved in ferrous iron and ISC oxidation has been analyzed. We have shown that the four RegA forms are able to bind specifically the upstream region of these genes. Interestingly, the phosphorylation of RegA did not change its affinity for its cognate DNA. The transcriptional start site of these genes/operons has been determined. In most cases, the RegA binding site(s) was (were) located upstream from the -35 (or -24) box suggesting that RegA does not interfere with the RNA polymerase binding. Based on the results presented in this report, the role of the RegB/RegA system in the regulation of the ferrous iron and ISC oxidation pathways in At. ferrooxidans is discussed.

  18. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  19. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  20. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  1. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

    PubMed

    Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

    2013-10-01

    A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

  3. Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

    PubMed

    Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

    2017-05-05

    The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

  4. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  5. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  6. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

    PubMed

    Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

    2018-04-10

    Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Carbon repression of cellobiose dehydrogenase production in the white rot fungus Trametes versicolor is mediated at the level of gene transcription.

    PubMed

    Stapleton, P C; Dobson, A D W

    2003-04-25

    Cellobiose dehydrogenase (CDH) production in Trametes versicolor is induced in the presence of cellulose, but decreases when additional carbon sources such as glucose and maltose are added to the fungal cultures. Using T. versicolor-specific cdh primers in a reverse transcription-polymerase chain reaction-based approach, it appears that this repression in CDH production is being mediated at the level of gene transcription. When a 1.6-kb upstream region of the T. versicolor cdh gene was cloned and sequenced, a number of putative CreA-like binding sites were observed. We propose that these sites may be involved in mediating this repressive effect, based on their similarity to the consensus [5'-SYGGRGG-3'] site for binding of the CreA and Cre1 repressor proteins.

  8. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  9. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  10. Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12

    PubMed Central

    Lithgow, James K; Haider, Fouzia; Roberts, Ian S; Green, Jeffrey

    2007-01-01

    Haemolysin E is a cytolytic pore-forming toxin found in several Escherichia coli and Salmonella enterica strains. Expression of hlyE is repressed by the global regulator H-NS (histone-like nucleoid structuring protein), but can be activated by the regulator SlyA. Expression of a chromosomal hlyE–lacZ fusion in an E. coli slyA mutant was reduced to 60% of the wild-type level confirming a positive role for SlyA. DNase I footprint analysis revealed the presence of two separate SlyA binding sites, one located upstream, the other downstream of the hlyE transcriptional start site. These sites overlap AT-rich H-NS binding sites. Footprint and gel shift data showed that whereas H-NS prevented binding of RNA polymerase (RNAP) at the hlyE promoter (PhlyE), SlyA allowed binding of RNAP, but inhibited binding of H-NS. Accordingly, in vitro transcription analyses showed that addition of SlyA protein relieved H-NS-mediated repression of hlyE. Based on these observations a model for SlyA/H-NS regulation of hlyE expression is proposed in which the relative concentrations of SlyA and H-NS govern the nature of the nucleoprotein complexes formed at PhlyE. When H-NS is dominant RNAP binding is inhibited and hlyE expression is silenced; when SlyA is dominant H-NS binding is inhibited allowing RNAP access to the promoter facilitating hlyE transcription. PMID:17892462

  11. Functional importance of evolutionally conserved Tbx6 binding sites in the presomitic mesoderm-specific enhancer of Mesp2.

    PubMed

    Yasuhiko, Yukuto; Kitajima, Satoshi; Takahashi, Yu; Oginuma, Masayuki; Kagiwada, Harumi; Kanno, Jun; Saga, Yumiko

    2008-11-01

    The T-box transcription factor Tbx6 controls the expression of Mesp2, which encodes a basic helix-loop-helix transcription factor that has crucial roles in somitogenesis. In cultured cells, Tbx6 binding to the Mesp2 enhancer region is essential for the activation of Mesp2 by Notch signaling. However, it is not known whether this binding is required in vivo. Here we report that an Mesp2 enhancer knockout mouse bearing mutations in two crucial Tbx6 binding sites does not express Mesp2 in the presomitic mesoderm. This absence leads to impaired skeletal segmentation identical to that reported for Mesp2-null mice, indicating that these Tbx6 binding sites are indispensable for Mesp2 expression. T-box binding to the consensus sequences in the Mesp2 upstream region was confirmed by chromatin immunoprecipitation assays. Further enhancer analyses indicated that the number and spatial organization of the T-box binding sites are critical for initiating Mesp2 transcription via Notch signaling. We also generated a knock-in mouse in which the endogenous Mesp2 enhancer was replaced by the core enhancer of medaka mespb, an ortholog of mouse Mesp2. The homozygous enhancer knock-in mouse was viable and showed normal skeletal segmentation, indicating that the medaka mespb enhancer functionally replaced the mouse Mesp2 enhancer. These results demonstrate that there is significant evolutionary conservation of Mesp regulatory mechanisms between fish and mice.

  12. Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

    PubMed

    Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

    2012-09-01

    The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

  13. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  14. A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

    PubMed Central

    Al-Khouri, Anna Maria; Paule, Marvin R.

    2002-01-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

  15. A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

    PubMed

    Al-Khouri, Anna Maria; Paule, Marvin R

    2002-02-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

  16. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  17. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  18. The Transcription Factor AlsR Binds and Regulates the Promoter of the alsSD Operon Responsible for Acetoin Formation in Bacillus subtilis

    PubMed Central

    Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter

    2012-01-01

    Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965

  19. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

    1995-01-01

    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  20. The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

    PubMed

    Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

    2015-06-01

    IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

  1. Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

    PubMed

    Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

    2016-09-01

    Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

  2. Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

    DOE PAGES

    Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

    2015-11-10

    Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

  3. Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

    Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

  4. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  5. Involvement of the Global Crp Regulator in Cyclic AMP-Dependent Utilization of Aromatic Amino Acids by Pseudomonas putida

    PubMed Central

    Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana

    2012-01-01

    The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386

  6. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

    PubMed

    Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

    2011-09-26

    HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

  7. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    PubMed Central

    2011-01-01

    Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

  8. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

    PubMed

    Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

    1998-05-01

    Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

  9. Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

    PubMed Central

    Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

    2013-01-01

    Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

  10. Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

    PubMed

    Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

    2010-07-01

    Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

  11. Systematic prediction of control proteins and their DNA binding sites

    PubMed Central

    Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

    2009-01-01

    We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

  12. The rcsA Promoter of Pantoea stewartii subsp. stewartii Features a Low-Level Constitutive Promoter and an EsaR Quorum-Sensing-Regulated Promoter

    PubMed Central

    Carlier, Aurelien L.; von Bodman, S. B.

    2006-01-01

    The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966

  13. Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

    PubMed

    Vieille-Grosjean, I; Huber, P

    1995-03-03

    The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

  14. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  15. Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

    2016-06-01

    The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  16. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    PubMed

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

  17. Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

    PubMed Central

    Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

    2012-01-01

    The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

  18. The fundamental ribosomal RNA transcription initiation factor-IB (TIF-IB, SL1, factor D) binds to the rRNA core promoter primarily by minor groove contacts.

    PubMed

    Geiss, G K; Radebaugh, C A; Paule, M R

    1997-11-14

    Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.

  19. The Global Redox Responding RegB/RegA Signal Transduction System Regulates the Genes Involved in Ferrous Iron and Inorganic Sulfur Compound Oxidation of the Acidophilic Acidithiobacillus ferrooxidans

    PubMed Central

    Moinier, Danielle; Byrne, Deborah; Amouric, Agnès; Bonnefoy, Violaine

    2017-01-01

    The chemical attack of ore by ferric iron and/or sulfuric acid releases valuable metals. The products of these reactions are recycled by iron and sulfur oxidizing microorganisms. These acidophilic chemolithotrophic prokaryotes, among which Acidithiobacillus ferrooxidans, grow at the expense of the energy released from the oxidation of ferrous iron and/or inorganic sulfur compounds (ISCs). In At. ferrooxidans, it has been shown that the expression of the genes encoding the proteins involved in these respiratory pathways is dependent on the electron donor and that the genes involved in iron oxidation are expressed before those responsible for ISCs oxidation when both iron and sulfur are present. Since the redox potential increases during iron oxidation but remains stable during sulfur oxidation, we have put forward the hypothesis that the global redox responding two components system RegB/RegA is involved in this regulation. To understand the mechanism of this system and its role in the regulation of the aerobic respiratory pathways in At. ferrooxidans, the binding of different forms of RegA (DNA binding domain, wild-type, unphosphorylated and phosphorylated-like forms of RegA) on the regulatory region of different genes/operons involved in ferrous iron and ISC oxidation has been analyzed. We have shown that the four RegA forms are able to bind specifically the upstream region of these genes. Interestingly, the phosphorylation of RegA did not change its affinity for its cognate DNA. The transcriptional start site of these genes/operons has been determined. In most cases, the RegA binding site(s) was (were) located upstream from the −35 (or −24) box suggesting that RegA does not interfere with the RNA polymerase binding. Based on the results presented in this report, the role of the RegB/RegA system in the regulation of the ferrous iron and ISC oxidation pathways in At. ferrooxidans is discussed. PMID:28747899

  20. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

    PubMed Central

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-01-01

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

  1. Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

    PubMed Central

    Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

    2000-01-01

    The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

  2. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    PubMed Central

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

  3. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    PubMed

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  4. Common and divergent features in transcriptional control of the homologous small RNAs GlmY and GlmZ in Enterobacteriaceae

    PubMed Central

    Göpel, Yvonne; Lüttmann, Denise; Heroven, Ann Kathrin; Reichenbach, Birte; Dersch, Petra; Görke, Boris

    2011-01-01

    Small RNAs GlmY and GlmZ compose a cascade that feedback-regulates synthesis of enzyme GlmS in Enterobacteriaceae. Here, we analyzed the transcriptional regulation of glmY/glmZ from Yersinia pseudotuberculosis, Salmonella typhimurium and Escherichia coli, as representatives for other enterobacterial species, which exhibit similar promoter architectures. The GlmY and GlmZ sRNAs of Y. pseudotuberculosis are transcribed from σ54-promoters that require activation by the response regulator GlrR through binding to three conserved sites located upstream of the promoters. This also applies to glmY/glmZ of S. typhimurium and glmY of E. coli, but as a difference additional σ70-promoters overlap the σ54-promoters and initiate transcription at the same site. In contrast, E. coli glmZ is transcribed from a single σ70-promoter. Thus, transcription of glmY and glmZ is controlled by σ54 and the two-component system GlrR/GlrK (QseF/QseE) in Y. pseudotuberculosis and presumably in many other Enterobacteria. However, in a subset of species such as E. coli this relationship is partially lost in favor of σ70-dependent transcription. In addition, we show that activity of the σ54-promoter of E. coli glmY requires binding of the integration host factor to sites upstream of the promoter. Finally, evidence is provided that phosphorylation of GlrR increases its activity and thereby sRNA expression. PMID:20965974

  5. An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

    PubMed

    Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

    1998-07-01

    Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

  6. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

    Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

  8. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    PubMed

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

    PubMed Central

    Datta, Kausiki; von Hippel, Peter H.

    2008-01-01

    Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

  10. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    PubMed

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

    PubMed

    Wang, G; Liao, J; Tang, M; Yu, S

    2018-02-01

    1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

  12. Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

    PubMed

    Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

    2016-10-01

    During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

    PubMed

    Behrens, R; Hayles, J; Nurse, P

    2000-12-01

    Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

  14. Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

    PubMed Central

    Behrens, Ralf; Hayles, Jacky; Nurse, Paul

    2000-01-01

    Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

  15. Control of the actin cytoskeleton in root hair development.

    PubMed

    Pei, Weike; Du, Fei; Zhang, Yi; He, Tian; Ren, Haiyun

    2012-05-01

    The development of root hair includes four stages: bulge site selection, bulge formation, tip growth, and maturation. The actin cytoskeleton is involved in all of these stages and is organized into distinct arrangements in the different stages. In addition to the actin configuration, actin isoforms also play distinct roles in the different stages. The actin cytoskeleton is regulated by actin-binding proteins, such as formin, Arp2/3 complex, profilin, actin depolymerizing factor, and villin. Some upstream signals, i.e. calcium, phospholipids, and small GTPase regulate the activity of these actin-binding proteins to produce the proper actin configuration. We constructed a working model on how the actin cytoskeleton is controlled by actin-binding proteins and upstream signaling in root hair development based on the current literature: at the tip of hairs, actin polymerization appears to be facilitated by Arp2/3 complex that is activated by small GTPase, and profilin that is regulated by phosphatidylinositol 4,5-bisphosphate. Meanwhile, actin depolymerization and turnover are likely mediated by villin and actin depolymerizing factor, which are stimulated by calcium. At the shank, actin cables are produced by formin and villin. Under the complicated interaction, the actin cytoskeleton is controlled spatially and temporally during root hair development. © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    PubMed

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  17. Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

    PubMed Central

    Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

    2016-01-01

    The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

  18. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

    2003-01-01

    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  19. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  20. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  1. Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites

    PubMed Central

    Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme

    1998-01-01

    ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779

  2. Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

    PubMed

    Daubas, Philippe; Buckingham, Margaret E

    2013-04-15

    The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  4. Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

    PubMed

    Shows, Kathryn H; Shiang, Rita

    2008-11-01

    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

  5. Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

    PubMed

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

    1999-11-19

    As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

  6. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  7. Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria

    PubMed Central

    Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej

    2011-01-01

    HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585

  8. Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

    NASA Astrophysics Data System (ADS)

    Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2015-09-01

    An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

  9. Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

    PubMed Central

    Zheng, Zhaoqing; Keifer, Joyce

    2014-01-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

  10. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    PubMed

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  11. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

    PubMed

    Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

    2008-12-01

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

  12. Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

    PubMed

    Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

    2000-06-01

    The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

  13. Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2003-01-01

    Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

  14. CsrA Participates in a PNPase Autoregulatory Mechanism by Selectively Repressing Translation of pnp Transcripts That Have Been Previously Processed by RNase III and PNPase

    PubMed Central

    Park, Hongmarn; Yakhnin, Helen; Connolly, Michael; Romeo, Tony

    2015-01-01

    ABSTRACT Csr is a conserved global regulatory system that represses or activates gene expression posttranscriptionally. CsrA of Escherichia coli is a homodimeric RNA binding protein that regulates transcription elongation, translation initiation, and mRNA stability by binding to the 5′ untranslated leader or initial coding sequence of target transcripts. pnp mRNA, encoding the 3′ to 5′ exoribonuclease polynucleotide phosphorylase (PNPase), was previously identified as a CsrA target by transcriptome sequencing (RNA-seq). Previous studies also showed that RNase III and PNPase participate in a pnp autoregulatory mechanism in which RNase III cleavage of the untranslated leader, followed by PNPase degradation of the resulting 5′ fragment, leads to pnp repression by an undefined translational repression mechanism. Here we demonstrate that CsrA binds to two sites in pnp leader RNA but only after the transcript is fully processed by RNase III and PNPase. In the absence of processing, both of the binding sites are sequestered in an RNA secondary structure, which prevents CsrA binding. The CsrA dimer bridges the upstream high-affinity site to the downstream site that overlaps the pnp Shine-Dalgarno sequence such that bound CsrA causes strong repression of pnp translation. CsrA-mediated translational repression also leads to a small increase in the pnp mRNA decay rate. Although CsrA has been shown to regulate translation and mRNA stability of numerous genes in a variety of organisms, this is the first example in which prior mRNA processing is required for CsrA-mediated regulation. IMPORTANCE CsrA protein represses translation of numerous mRNA targets, typically by binding to multiple sites in the untranslated leader region preceding the coding sequence. We found that CsrA represses translation of pnp by binding to two sites in the pnp leader transcript but only after it is processed by RNase III and PNPase. Processing by these two ribonucleases alters the mRNA secondary structure such that it becomes accessible to the ribosome for translation as well as to CsrA. As one of the CsrA binding sites overlaps the pnp ribosome binding site, bound CsrA prevents ribosome binding. This is the first example in which regulation by CsrA requires prior mRNA processing and should link pnp expression to conditions affecting CsrA activity. PMID:26438818

  15. Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

    NASA Astrophysics Data System (ADS)

    Gresh, Nohad; Perrée-fauvet, Martine

    1999-03-01

    On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

  16. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  17. Regulation of the Vibrio vulnificus hupA gene by temperature alteration and cyclic AMP receptor protein and evaluation of its role in virulence.

    PubMed

    Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho

    2009-03-01

    Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40 degrees C compared to cells grown at 30 degrees C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter P(hupA), and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection.

  18. Regulation of the Vibrio vulnificus hupA Gene by Temperature Alteration and Cyclic AMP Receptor Protein and Evaluation of Its Role in Virulence▿

    PubMed Central

    Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho

    2009-01-01

    Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40°C compared to cells grown at 30°C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter PhupA, and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection. PMID:19139193

  19. ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

    PubMed

    Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

    2018-05-09

    Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

  20. Structural Basis of the Interaction of a Trypanosoma cruzi Surface Molecule Implicated in Oral Infection with Host Cells and Gastric Mucin

    PubMed Central

    Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.

    2012-01-01

    Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068

  1. Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

    PubMed Central

    Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

    2016-01-01

    Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

  2. Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

    PubMed

    Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

    2015-08-01

    Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

  3. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  4. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    PubMed

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  5. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

    PubMed Central

    2013-01-01

    Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

  6. Sort-Seq Approach to Engineering a Formaldehyde-Inducible Promoter for Dynamically Regulated Escherichia coli Growth on Methanol

    PubMed Central

    2017-01-01

    Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494

  7. Insulin-like growth factor binding protein-2: contributions of the C-terminal domain to insulin-like growth factor-1 binding.

    PubMed

    Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A

    2006-03-01

    Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.

  8. Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

    PubMed Central

    Shiang, Rita

    2008-01-01

    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

  9. Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae

    PubMed Central

    Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

    2016-01-01

    In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735

  10. DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

    PubMed

    Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

    2017-01-01

    Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

  11. Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

    PubMed Central

    Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

    2010-01-01

    Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

  12. Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

    PubMed

    Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

    2010-06-01

    Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

  13. miRWalk--database: prediction of possible miRNA binding sites by "walking" the genes of three genomes.

    PubMed

    Dweep, Harsh; Sticht, Carsten; Pandey, Priyanka; Gretz, Norbert

    2011-10-01

    MicroRNAs are small, non-coding RNA molecules that can complementarily bind to the mRNA 3'-UTR region to regulate the gene expression by transcriptional repression or induction of mRNA degradation. Increasing evidence suggests a new mechanism by which miRNAs may regulate target gene expression by binding in promoter and amino acid coding regions. Most of the existing databases on miRNAs are restricted to mRNA 3'-UTR region. To address this issue, we present miRWalk, a comprehensive database on miRNAs, which hosts predicted as well as validated miRNA binding sites, information on all known genes of human, mouse and rat. All mRNAs, mitochondrial genes and 10 kb upstream flanking regions of all known genes of human, mouse and rat were analyzed by using a newly developed algorithm named 'miRWalk' as well as with eight already established programs for putative miRNA binding sites. An automated and extensive text-mining search was performed on PubMed database to extract validated information on miRNAs. Combined information was put into a MySQL database. miRWalk presents predicted and validated information on miRNA-target interaction. Such a resource enables researchers to validate new targets of miRNA not only on 3'-UTR, but also on the other regions of all known genes. The 'Validated Target module' is updated every month and the 'Predicted Target module' is updated every 6 months. miRWalk is freely available at http://mirwalk.uni-hd.de/. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Modes of caldesmon binding to actin: sites of caldesmon contact and modulation of interactions by phosphorylation.

    PubMed

    Foster, D Brian; Huang, Renjian; Hatch, Victoria; Craig, Roger; Graceffa, Philip; Lehman, William; Wang, C-L Albert

    2004-12-17

    Smooth muscle caldesmon binds actin and inhibits actomyosin ATPase activity. Phosphorylation of caldesmon by extracellular signal-regulated kinase (ERK) reverses this inhibitory effect and weakens actin binding. To better understand this function, we have examined the phosphorylation-dependent contact sites of caldesmon on actin by low dose electron microscopy and three-dimensional reconstruction of actin filaments decorated with a C-terminal fragment, hH32K, of human caldesmon containing the principal actin-binding domains. Helical reconstruction of negatively stained filaments demonstrated that hH32K is located on the inner portion of actin subdomain 1, traversing its upper surface toward the C-terminal segment of actin, and forms a bridge to the neighboring actin monomer of the adjacent long pitch helical strand by connecting to its subdomain 3. Such lateral binding was supported by cross-linking experiments using a mutant isoform, which was capable of cross-linking actin subunits. Upon ERK phosphorylation, however, the mutant no longer cross-linked actin to polymers. Three-dimensional reconstruction of ERK-phosphorylated hH32K indeed indicated loss of the interstrand connectivity. These results, together with fluorescence quenching data, are consistent with a phosphorylation-dependent conformational change that moves the C-terminal end segment of caldesmon near the phosphorylation site but not the upstream region around Cys(595), away from F-actin, thus neutralizing its inhibitory effect on actomyosin interactions. The binding pattern of hH32K suggests a mechanism by which unphosphorylated, but not ERK-phosphorylated, caldesmon could stabilize actin filaments and resist F-actin severing or depolymerization in both smooth muscle and nonmuscle cells.

  15. Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

    NASA Astrophysics Data System (ADS)

    Baghaee Ravari, Soodeh

    G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

  16. Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

    PubMed Central

    Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

    2013-01-01

    In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

  17. NFI-Ski interactions mediate transforming growth factor beta modulation of human papillomavirus type 16 early gene expression.

    PubMed

    Baldwin, Amy; Pirisi, Lucia; Creek, Kim E

    2004-04-01

    Human papillomaviruses (HPVs) are present in virtually all cervical cancers. An important step in the development of malignant disease, including cervical cancer, involves a loss of sensitivity to transforming growth factor beta (TGF-beta). HPV type 16 (HPV16) early gene expression, including that of the E6 and E7 oncoprotein genes, is under the control of the upstream regulatory region (URR), and E6 and E7 expression in HPV16-immortalized human epithelial cells is inhibited at the transcriptional level by TGF-beta. While the URR contains a myriad of transcription factor binding sites, including seven binding sites for nuclear factor I (NFI), the specific sequences within the URR or the transcription factors responsible for TGF-beta modulation of the URR remain unknown. To identify potential transcription factors and binding sites involved in TGF-beta modulation of the URR, we performed DNase I footprint analysis on the HPV16 URR using nuclear extracts from TGF-beta-sensitive HPV16-immortalized human keratinocytes (HKc/HPV16) treated with and without TGF-beta. Differentially protected regions were found to be located around NFI binding sites. Electrophoretic mobility shift assays, using the NFI binding sites as probes, showed decreased binding upon TGF-beta treatment. This decrease in binding was not due to reduced NFI protein or NFI mRNA levels. Mutational analysis of individual and multiple NFI binding sites in the URR defined their role in TGF-beta sensitivity of the promoter. Overexpression of the NFI family members in HKc/HPV16 decreased the ability of TGF-beta to inhibit the URR. Since the oncoprotein Ski has been shown to interact with and increase the transcriptional activity of NFI and since cellular Ski levels are decreased by TGF-beta treatment, we explored the possibility that Ski may provide a link between TGF-beta signaling and NFI activity. Anti-NFI antibodies coimmunoprecipitated endogenous Ski in nuclear extracts from HKc/HPV16, confirming that NFI and Ski interact in these cells. Ski levels dramatically decreased upon TGF-beta treatment of HKc/HPV16, and overexpression of Ski eliminated the ability of TGF-beta to inhibit the URR. Based on these studies, we propose that TGF-beta inhibition of HPV16 early gene expression is mediated by a decrease in Ski levels, which in turn dramatically reduces NFI activity.

  18. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  19. Multiple Functions of Aromatic-Carbohydrate Interactions in a Processive Cellulase Examined with Molecular Simulation*

    PubMed Central

    Payne, Christina M.; Bomble, Yannick J.; Taylor, Courtney B.; McCabe, Clare; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

    2011-01-01

    Proteins employ aromatic residues for carbohydrate binding in a wide range of biological functions. Glycoside hydrolases, which are ubiquitous in nature, typically exhibit tunnels, clefts, or pockets lined with aromatic residues for processing carbohydrates. Mutation of these aromatic residues often results in significant activity differences on insoluble and soluble substrates. However, the thermodynamic basis and molecular level role of these aromatic residues remain unknown. Here, we calculate the relative ligand binding free energy by mutating tryptophans in the Trichoderma reesei family 6 cellulase (Cel6A) to alanine. Removal of aromatic residues near the catalytic site has little impact on the ligand binding free energy, suggesting that aromatic residues immediately upstream of the active site are not directly involved in binding, but play a role in the glucopyranose ring distortion necessary for catalysis. Removal of aromatic residues at the entrance and exit of the Cel6A tunnel, however, dramatically impacts the binding affinity, suggesting that these residues play a role in chain acquisition and product stabilization, respectively. The roles suggested from differences in binding affinity are confirmed by molecular dynamics and normal mode analysis. Surprisingly, our results illustrate that aromatic-carbohydrate interactions vary dramatically depending on the position in the enzyme tunnel. As aromatic-carbohydrate interactions are present in all carbohydrate-active enzymes, these results have implications for understanding protein structure-function relationships in carbohydrate metabolism and recognition, carbon turnover in nature, and protein engineering strategies for biomass utilization. Generally, these results suggest that nature employs aromatic-carbohydrate interactions with a wide range of binding affinities for diverse functions. PMID:21965672

  20. Mechanism of arginine sensing by CASTOR1 upstream of mTORC1

    PubMed Central

    Saxton, Robert A.; Chantranupong, Lynne; Knockenhauer, Kevin E.; Schwartz, Thomas U.; Sabatini, David M.

    2016-01-01

    Summary The mechanistic Target of Rapamycin Complex 1 (mTORC1) is a major regulator of eukaryotic growth that coordinates anabolic and catabolic cellular processes with inputs such as growth factors and nutrients, including amino acids1–3. In mammals, arginine is particularly important and promotes diverse physiological effects including immune cell activation, insulin secretion, and muscle growth, largely through activation of mTORC14–7. Arginine activates mTORC1 upstream of the Rag GTPases8, through either the lysosomal amino acid transporter SLC38A9 or the GATOR2-interacting CASTOR1 (Cellular Arginine Sensor for mTORC1)9–12. However, the mechanism by which the mTORC1 pathway detects and transmits the arginine signal has been elusive. Here, we present the 1.8 Å crystal structure of arginine-bound CASTOR1. Homodimeric CASTOR1 binds arginine at the interface of two ACT domains, enabling allosteric control of the adjacent GATOR2-binding site to trigger dissociation from GATOR2 and the downstream activation of mTORC1. Our data reveal that CASTOR1 shares substantial structural homology with the lysine-binding regulatory domain of prokaryotic aspartate kinases, suggesting that the mTORC1 pathway exploited an ancient amino-acid-dependent allosteric mechanism to acquire arginine sensitivity. Together, these results establish a structural basis for arginine sensing by the mTORC1 pathway and provide insights into the evolution of a mammalian nutrient sensor. PMID:27487210

  1. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    PubMed

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

  3. Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

    PubMed

    Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

    2011-02-01

    We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  4. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  5. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    PubMed

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  6. Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

    PubMed

    Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

    2010-05-01

    Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

  7. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  8. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    PubMed

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  9. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    PubMed

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  10. Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae.

    PubMed

    Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

    2016-07-27

    In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

    PubMed

    Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

    2013-10-01

    Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    PubMed

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  13. A novel mode for transcription inhibition mediated by PNA-induced R-loops with a model in vitro system.

    PubMed

    D'Souza, Alicia D; Belotserkovskii, Boris P; Hanawalt, Philip C

    2018-02-01

    The selective inhibition of transcription of a chosen gene by an artificial agent has numerous applications. Usually, these agents are designed to bind a specific nucleotide sequence in the promoter or within the transcribed region of the chosen gene. However, since optimal binding sites might not exist within the gene, it is of interest to explore the possibility of transcription inhibition when the agent is designed to bind at other locations. One of these possibilities arises when an additional transcription initiation site (e.g. secondary promoter) is present upstream from the primary promoter of the target gene. In this case, transcription inhibition might be achieved by inducing the formation of an RNA-DNA hybrid (R-loop) upon transcription from the secondary promoter. The R-loop could extend into the region of the primary promoter, to interfere with promoter recognition by RNA polymerase and thereby inhibit transcription. As a sequence-specific R-loop-inducing agent, a peptide nucleic acid (PNA) could be designed to facilitate R-loop formation by sequestering the non-template DNA strand. To investigate this mode for transcription inhibition, we have employed a model system in which a PNA binding site is localized between the T3 and T7 phage RNA polymerase promoters, which respectively assume the roles of primary and secondary promoters. In accord with our model, we have demonstrated that with PNA-bound DNA substrates, transcription from the T7 promoter reduces transcription from the T3 promoter by 30-fold, while in the absence of PNA binding there is no significant effect of T7 transcription upon T3 transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Autoregulation of human relaxin-2 gene expression critically involves relaxin and glucocorticoid receptor binding to glucocorticoid response half-sites in the relaxin-2 promoter.

    PubMed

    Dschietzig, Thomas; Bartsch, Cornelia; Wessler, Silja; Baumann, Gert; Stangl, Karl

    2009-06-05

    Relaxin peptides act in brain, reproductive and cardiovascular systems, kidneys, and connective tissue through different G protein-coupled receptors. We reported that human relaxin-2 and porcine relaxin are both agonists at the human glucocorticoid receptor (GR). Here, we investigated the possible auto-regulation of relaxin-2 gene expression via recently discovered GR-binding sites in the relaxin-2 promoter. We found that porcine relaxin increased the secretion of human relaxin-like immunoreactivity in HeLa and THP-1 cells. Silencing of GR gene expression completely abolished this effect whereas transfection of wild-type GR into naturally GR-devoid HT-29 cells established relaxin sensitivity. Relaxin was shown to stimulate CAT expression driven by different deletion constructs of the 5'-flanking region of the relaxin-2 promoter. In chromatin immunoprecipitation assays, we detected both GR and relaxin binding to the relaxin-2 promoter. Gel shift assays indicated binding of relaxin-activated GR to half-GREs located between 160 and 200 bp upstream of transcription start but not to the GRE at -900 bp. Relaxin bound to human GR and displaced established GR agonists. Immunofluorescence experiments visualized nuclear co-localization of relaxin and GR in response to relaxin. In conclusion, we have identified a positive auto-regulatory loop of human relaxin-2 expression which involves GR and relaxin/GR binding to half-GREs in the relaxin-2 promoter.

  15. Increased mitochondrial matrix directed superoxide production by fatty acid hydroperoxides in skeletal muscle mitochondria

    PubMed Central

    Bhattacharya, Arunabh; Lustgarten, Michael; Shi, Yun; Liu, Yuhong; Jang, Youngmok C; Pulliam, Daniel; Jernigan, Amanda L; Van Remmen, Holly

    2013-01-01

    Previous studies have shown that muscle atrophy is associated with mitochondrial dysfunction and an increased rate of mitochondrial reactive oxygen species production. We recently demonstrated that fatty acid hydroperoxides (FA-OOH) are significantly elevated in mitochondria isolated from atrophied muscles. The purpose of the current study is to determine whether FA-OOH can alter skeletal muscle mitochondrial function. We found that FA-OOH (at low micromolar concentrations) induces mitochondrial dysfunction assessed by decrease in the rate of ATP production, oxygen consumption and activity of respiratory chain complexes I and III. Using methods to distinguish superoxide release towards the matrix and inter-membrane space, we demonstrate that FA-OOH significantly elevates oxidative stress in the mitochondrial matrix (and not the inter-membrane space) with complex I as the major site of superoxide production (most likely from a site upstream of the ubiquinone binding site but downstream from the flavin binding site-the iron sulfur clusters). Our results are the first to indicate that FA-OOH’s are important modulators of mitochondrial function and oxidative stress in skeletal muscle mitochondria and may play an important role in muscle atrophies that are associated with increased generation of FA-OOH’s, e.g., denervation-induced muscle atrophy. PMID:21172427

  16. C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation.

    PubMed

    Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen

    2018-05-05

    Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.

  17. Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

    PubMed

    Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

    2015-02-18

    HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. A 10-aa-long sequence in SLP-76 upstream of the Gads binding site is essential for T cell development and function.

    PubMed

    Kumar, Lalit; Feske, Stefan; Rao, Anjana; Geha, Raif S

    2005-12-27

    The adapter SLP-76 is essential for T cell development and function. SLP-76 binds to the src homology 3 domain of Lck in vitro. This interaction depends on amino acids 185-194 of SLP-76. To examine the role of the Lck-binding region of SLP-76 in T cell development and function, SLP-76(-/-) mice were reconstituted with an SLP-76 mutant that lacks amino acids 185-194. Double and single positive thymocytes from reconstituted mice were severely reduced in numbers and exhibited impaired positive selection and increased apoptosis. Peripheral T cells were also reduced in numbers, exhibited impaired phospholipase C-gamma1 and Erk phosphorylation, and failed to flux calcium, secrete IL-2, and proliferate in response to T cell antigen receptor ligation. Delayed cutaneous hypersensitivity responses and Ab responses to T cell-dependent antigen were severely impaired. These results indicate that the Lck binding region of SLP-76 is essential for T cell antigen receptor signaling and normal T cell development and function.

  19. Tandem hnRNP A1 RNA recognition motifs act in concert to repress the splicing of survival motor neuron exon 7

    PubMed Central

    Beusch, Irene; Barraud, Pierre; Moursy, Ahmed; Cléry, Antoine; Allain, Frédéric Hai-Trieu

    2017-01-01

    HnRNP A1 regulates many alternative splicing events by the recognition of splicing silencer elements. Here, we provide the solution structures of its two RNA recognition motifs (RRMs) in complex with short RNA. In addition, we show by NMR that both RRMs of hnRNP A1 can bind simultaneously to a single bipartite motif of the human intronic splicing silencer ISS-N1, which controls survival of motor neuron exon 7 splicing. RRM2 binds to the upstream motif and RRM1 to the downstream motif. Combining the insights from the structure with in cell splicing assays we show that the architecture and organization of the two RRMs is essential to hnRNP A1 function. The disruption of the inter-RRM interaction or the loss of RNA binding capacity of either RRM impairs splicing repression by hnRNP A1. Furthermore, both binding sites within the ISS-N1 are important for splicing repression and their contributions are cumulative rather than synergistic. DOI: http://dx.doi.org/10.7554/eLife.25736.001 PMID:28650318

  20. Molecular identification and transcriptional regulation of porcine IFIT2 gene.

    PubMed

    Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

    2018-04-06

    IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

  1. Detections, concentrations, and distributional patterns of compounds of emerging concern in the San Antonio River Basin, Texas, 2011-12

    USGS Publications Warehouse

    Opsahl, Stephen P.; Lambert, Rebecca B.

    2013-01-01

    The distributional patterns of detections and concentrations of individual compounds and compound classes show the influence of wastewater-treatment plant (WWTP) outfalls on the quality of water in the San Antonio River Basin. In the Medina River Subbasin, the minimal influence of wastewater is evident as far downstream as the Macdona site. Downstream from the Macdona site, the Medina River receives treated municipal wastewater from both the Medio Creek Water Recycling Center site from an unnamed tributary at the plant and the Leon Creek Water Recycling Center site from Comanche Creek at the plant, and corresponding increases in both the number of detections and the total concentrations of all measured compounds at all downstream sampling sites were evident. Similarly, the San Antonio River receives treated municipal wastewater as far upstream as the SAR Witte site (San Antonio River at Witte Museum, San Antonio, Tex.) and additional WWTP outfalls along the Medina River upstream from the confluence of the Medina and San Antonio Rivers. Consequently, all samples collected along the main stem of the San Antonio River had higher concentrations of CECs in comparison to sites without upstream WWTPs. Sites in urbanized areas without upstream WWTPs include the Leon 35 site (Leon Creek at Interstate Highway 35, San Antonio, Tex.), the Alazan site (Alazan Creek at Tampico Street, San Antonio, Tex.), and the San Pedro site (San Pedro Creek at Probandt Street, at San Antonio, Tex.). The large number of detections at sites with no upstream wastewater source demonstrated that CECs can be detected in streams flowing through urbanized areas without a large upstream source of treated municipal wastewater. A general lack of detection of pharmaceuticals in streams without upstream outfalls of treated wastewater appears to be typical for streams throughout the San Antonio River Basin and may be a useful indicator of point-source versus nonpoint-source contributions of these compounds in urban streams. Observations of lower concentrations of compounds at the furthest downstream sampling sites in the basin indicate some natural attenuation of these compounds during transport; however, a more focused assessment is needed to make this determination.

  2. WNK3-SPAK interaction is required for the modulation of NCC and other members of the SLC12 family.

    PubMed

    Pacheco-Alvarez, Diana; Vázquez, Norma; Castañeda-Bueno, María; de-Los-Heros, Paola; Cortes-González, César; Moreno, Erika; Meade, Patricia; Bobadilla, Norma A; Gamba, Gerardo

    2012-01-01

    The serine/threonine with no lysine kinase 3 (WNK3) modulates the activity of the electroneutral cation-coupled chloride cotransporters (CCC) to promote Cl(-) influx and prevent Cl(-) efflux, thus fitting the profile for a putative "Cl(-)-sensing kinase". The Ste20-type kinases, SPAK/OSR1, become phosphorylated in response to reduction in intracellular chloride concentration and regulate the activity of NKCC1. Several studies have now shown that WNKs function upstream of SPAK/OSR1. This study was designed to analyze the role of WNK3-SPAK interaction in the regulation of CCCs with particular emphasis on NCC. In this study we used the functional expression system of Xenopus laevis oocytes to show that different SPAK binding sites in WNK3 ((241, 872, 1336)RFxV) are required for the kinase to have effects on CCCs. WNK3-F1337A no longer activated NKCC2, but the effects on NCC, NKCC1, and KCC4 were preserved. In contrast, the effects of WNK3 on these cotransporters were prevented in WNK3-F242A. The elimination of F873 had no consequence on WNK3 effects. WNK3 promoted NCC phosphorylation at threonine 58, even in the absence of the unique SPAK binding site of NCC, but this effect was abolished in the mutant WNK3-F242A. Thus, our data support the hypothesis that the effects of WNK3 upon NCC and other CCCs require the interaction and activation of the SPAK kinase. The effect is dependent on one of the three binding sites for SPAK that are present in WNK3, but not on the SPAK binding sites on the CCCs, which suggests that WNK3 is capable of binding both SPAK and CCCs to promote their phosphorylation. Copyright © 2012 S. Karger AG, Basel.

  3. The casein kinases Yck1p and Yck2p act in the secretory pathway, in part, by regulating the Rab exchange factor Sec2p

    PubMed Central

    Stalder, Danièle; Novick, Peter J.

    2016-01-01

    Sec2p is a guanine nucleotide exchange factor that activates Sec4p, the final Rab GTPase of the yeast secretory pathway. Sec2p is recruited to secretory vesicles by the upstream Rab Ypt32p acting in concert with phosphatidylinositol-4-phosphate (PI(4)P). Sec2p also binds to the Sec4p effector Sec15p, yet Ypt32p and Sec15p compete against each other for binding to Sec2p. We report here that the redundant casein kinases Yck1p and Yck2p phosphorylate sites within the Ypt32p/Sec15p binding region and in doing so promote binding to Sec15p and inhibit binding to Ypt32p. We show that Yck2p binds to the autoinhibitory domain of Sec2p, adjacent to the PI(4)P binding site, and that addition of PI(4)P inhibits Sec2p phosphorylation by Yck2p. Loss of Yck1p and Yck2p function leads to accumulation of an intracellular pool of the secreted glucanase Bgl2p, as well as to accumulation of Golgi-related structures in the cytoplasm. We propose that Sec2p is phosphorylated after it has been recruited to secretory vesicles and the level of PI(4)P has been reduced. This promotes Sec2p function by stimulating its interaction with Sec15p. Finally, Sec2p is dephosphorylated very late in the exocytic reaction to facilitate recycling. PMID:26700316

  4. NF-{kappa}B regulates Lef1 gene expression in chondrocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Kangsun; Choi, Yoo Duk; Nam, Jong Hee

    The relation of Wnt/{beta}-catenin signaling to osteoarthritis progression has been revealed with little information on the underlying molecular mechanism. In this study we found overexpression of Lef1 in cartilage tissue of osteoarthritic patients and elucidated molecular mechanism of NF-{kappa}B-mediated Lef1 gene regulation in chondrocytes. Treatment of IL-1{beta} augmented Lef1 upregulation and nuclear translocation of NF-{kappa}B in chondrocytes. Under IL-1{beta} signaling, treatment of NF-{kappa}B nuclear translocation inhibitor SN-50 reduced Lef1 expression. A conserved NF-{kappa}B-binding site between mouse and human was selected through bioinformatic analysis and mapped at the 14 kb upstream of Lef1 transcription initiation site. NF-{kappa}B binding to the sitemore » was confirmed by chromatin immunoprecipitation assay. Lef1 expression was synergistically upregulated by interactions of NF-{kappa}B with Lef1/{beta}-catenin in chondrocytes. Our results suggest a pivotal role of NF-{kappa}B in Lef1 expression in arthritic chondrocytes or cartilage degeneration.« less

  5. A dual switch controls bacterial enhancer-dependent transcription

    PubMed Central

    Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

    2012-01-01

    Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

  6. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    PubMed Central

    2016-01-01

    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

  7. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

    PubMed

    Irizarry, Kristopher J L; Bryden, Randall L

    2016-01-01

    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

  8. Inhibition of the Ras-Net (Elk-3) pathway by a novel pyrazole that affects microtubules.

    PubMed

    Wasylyk, Christine; Zheng, Hong; Castell, Christelle; Debussche, Laurent; Multon, Marie-Christine; Wasylyk, Bohdan

    2008-03-01

    Net (Elk-3/SAP-2/Erp) is a transcription factor that is phosphorylated and activated by the Ras-extracellular signal-regulated kinase (Erk) signaling pathway and is involved in wound healing, angiogenesis, and tumor growth. In a cell-based screen for small molecule inhibitors of Ras activation of Net transcriptional activity, we identified a novel pyrazole, XRP44X. XRP44X inhibits fibroblast growth factor 2 (FGF-2)-induced Net phosphorylation by the Ras-Erk signaling upstream from Ras. It also binds to the colchicine-binding site of tubulin, depolymerizes microtubules, stimulates cell membrane blebbing, and affects the morphology of the actin skeleton. Interestingly, Combretastin-A4, which produces similar effects on the cytoskeleton, also inhibits FGF-2 Ras-Net signaling. This differs from other classes of agents that target microtubules, which have either little effect (vincristine) or no effect (docetaxel and nocodazole) on the Ras-Net pathway. XRP44X inhibits various cellular properties, including cell growth, cell cycle progression, and aortal sprouting, similar to other molecules that bind to the tubulin colchicine site. XRP44X has the potentially interesting property of connecting two important pathways involved in cell transformation and may thereby represent an interesting class of molecules that could be developed for cancer treatment.

  9. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    PubMed

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  10. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    PubMed

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  11. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

    PubMed

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

    2014-08-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

    PubMed Central

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

    2014-01-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

  13. The zinc finger gene Krox20 regulates HoxB2 (Hox2.8) during hindbrain segmentation.

    PubMed

    Sham, M H; Vesque, C; Nonchev, S; Marshall, H; Frain, M; Gupta, R D; Whiting, J; Wilkinson, D; Charnay, P; Krumlauf, R

    1993-01-29

    The zinc finger gene Krox20 and many Hox homeobox genes are expressed in segment-restricted domains in the hindbrain. The restricted expression patterns appear before morphological segmentation, suggesting that these transcription factors may play an early role in the establishment and identity of rhombomeric segments. In this paper, we show that the HoxB2 (Hox2.8) gene is normally upregulated in rhombomeres (r) 3, 4, and 5, and we identify an enhancer region upstream of the gene that imposes r3/r5 expression in transgenic mice. This enhancer contains three Krox20-binding sites required in vitro for complex formation with Krox20 protein and in vivo for rhombomere-restricted expression. In transgenic mice, Krox20 expressed in ectopic domains can transactivate a reporter construct containing the HoxB2 r3/r5 enhancer. These data demonstrate that Krox20 is a part of the upstream transcriptional cascade that directly regulates HoxB2 expression during hindbrain segmentation.

  14. Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

    PubMed

    Kang, J J; Yokoi, T J; Holland, M J

    1995-12-01

    The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

  15. Regulation of the yjjQ-bglJ Operon, Encoding LuxR-Type Transcription Factors, and the Divergent yjjP Gene by H-NS and LeuO▿ †

    PubMed Central

    Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin

    2008-01-01

    The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596

  16. The Gene Regulatory Network of Lens Induction Is Wired through Meis-Dependent Shadow Enhancers of Pax6

    PubMed Central

    Antosova, Barbora; Smolikova, Jana; Klimova, Lucie; Lachova, Jitka; Bendova, Michaela; Kozmikova, Iryna; Machon, Ondrej; Kozmik, Zbynek

    2016-01-01

    Lens induction is a classical developmental model allowing investigation of cell specification, spatiotemporal control of gene expression, as well as how transcription factors are integrated into highly complex gene regulatory networks (GRNs). Pax6 represents a key node in the gene regulatory network governing mammalian lens induction. Meis1 and Meis2 homeoproteins are considered as essential upstream regulators of Pax6 during lens morphogenesis based on their interaction with the ectoderm enhancer (EE) located upstream of Pax6 transcription start site. Despite this generally accepted regulatory pathway, Meis1-, Meis2- and EE-deficient mice have surprisingly mild eye phenotypes at placodal stage of lens development. Here, we show that simultaneous deletion of Meis1 and Meis2 in presumptive lens ectoderm results in arrested lens development in the pre-placodal stage, and neither lens placode nor lens is formed. We found that in the presumptive lens ectoderm of Meis1/Meis2 deficient embryos Pax6 expression is absent. We demonstrate using chromatin immunoprecipitation (ChIP) that in addition to EE, Meis homeoproteins bind to a remote, ultraconserved SIMO enhancer of Pax6. We further show, using in vivo gene reporter analyses, that the lens-specific activity of SIMO enhancer is dependent on the presence of three Meis binding sites, phylogenetically conserved from man to zebrafish. Genetic ablation of EE and SIMO enhancers demostrates their requirement for lens induction and uncovers an apparent redundancy at early stages of lens development. These findings identify a genetic requirement for Meis1 and Meis2 during the early steps of mammalian eye development. Moreover, they reveal an apparent robustness in the gene regulatory mechanism whereby two independent "shadow enhancers" maintain critical levels of a dosage-sensitive gene, Pax6, during lens induction. PMID:27918583

  17. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    PubMed

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  18. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells

    PubMed Central

    Galardi, Silvia; Mercatelli, Neri; Farace, Maria G.; Ciafrè, Silvia A.

    2011-01-01

    MicroRNAs (miRNAs) are potent negative regulators of gene expression involved in all aspects of cell biology. They finely modulate virtually all physiological pathways in metazoans, and are deeply implicated in all main pathologies, among which cancer. Mir-221 and miR-222, two closely related miRNAs encoded in cluster from a genomic region on chromosome X, are strongly upregulated in several forms of human tumours. In this work, we report that the ectopic modulation of NF-kB modifies miR-221/222 expression in prostate carcinoma and glioblastoma cell lines, where we had previously shown their oncogenic activity. We identify two separate distal regions upstream of miR-221/222 promoter which are bound by the NF-kB subunit p65 and drive efficient transcription in luciferase reporter assays; consistently, the site-directed mutagenesis disrupting p65 binding sites or the ectopical inhibition of NF-kB activity significantly reduce luciferase activity. In the most distal enhancer region, we also define a binding site for c-Jun, and we show that the binding of this factor cooperates with that of p65, fully accounting for the observed upregulation of miR-221/222. Thus our work uncovers an additional mechanism through which NF-kB and c-Jun, two transcription factors deeply involved in cancer onset and progression, contribute to oncogenesis, by inducing miR-221/222 transcription. PMID:21245048

  19. TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements.

    PubMed

    Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D

    2009-02-01

    TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.

  20. p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding.

    PubMed

    Itakura, Eisuke; Mizushima, Noboru

    2011-01-10

    Autophagy is an intracellular degradation process by which cytoplasmic contents are degraded in the lysosome. In addition to nonselective engulfment of cytoplasmic materials, the autophagosomal membrane can selectively recognize specific proteins and organelles. It is generally believed that the major selective substrate (or cargo receptor) p62 is recruited to the autophagosomal membrane through interaction with LC3. In this study, we analyzed loading of p62 and its related protein NBR1 and found that they localize to the endoplasmic reticulum (ER)-associated autophagosome formation site independently of LC3 localization to membranes. p62 colocalizes with upstream autophagy factors such as ULK1 and VMP1 even when autophagosome formation is blocked by wortmannin or FIP200 knockout. Self-oligomerization of p62 is essential for its localization to the autophagosome formation site. These results suggest that p62 localizes to the autophagosome formation site on the ER, where autophagosomes are nucleated. This process is similar to the yeast cytoplasm to vacuole targeting pathway.

  1. Role of the RNA polymerase α subunits in CII-dependent activation of the bacteriophage λ pE promoter: identification of important residues and positioning of the α C-terminal domains

    PubMed Central

    Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.

    2004-01-01

    The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211

  2. Role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of Dr+ Escherichia coli receptor protein Decay Accelerating Factor (DAF or CD55) by Nitric oxide

    PubMed Central

    Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

    2012-01-01

    We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121

  3. Role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of Dr+ Escherichia coli receptor protein decay accelerating factor (DAF or CD55) by nitric oxide.

    PubMed

    Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

    2013-02-01

    We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.

  4. “Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

    PubMed Central

    Li, Yunlang; Schlick, Tamar

    2013-01-01

    Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

  5. Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli.

    PubMed

    Pannuri, Archana; Vakulskas, Christopher A; Zere, Tesfalem; McGibbon, Louise C; Edwards, Adrianne N; Georgellis, Dimitris; Babitzke, Paul; Romeo, Tony

    2016-11-01

    Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (RsmA) away from lower-affinity mRNA targets, thus eliciting major shifts in the bacterial lifestyle. CsrB/C transcription and turnover are activated by carbon metabolism products (e.g., formate and acetate) and by a preferred carbon source (glucose), respectively. We show that cAMP-CRP, a mediator of classical catabolite repression, inhibits csrC transcription by binding to the upstream region of this gene and also inhibits csrB transcription, apparently indirectly. We propose that glucose availability activates pathways for both synthesis and turnover of CsrB/C, thus shaping the dynamics of global signaling in response to the nutritional environment by poising CsrB/C sRNA levels for rapid response. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli

    PubMed Central

    Pannuri, Archana; Vakulskas, Christopher A.; Zere, Tesfalem; McGibbon, Louise C.; Edwards, Adrianne N.; Georgellis, Dimitris; Babitzke, Paul

    2016-01-01

    ABSTRACT Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. IMPORTANCE Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (RsmA) away from lower-affinity mRNA targets, thus eliciting major shifts in the bacterial lifestyle. CsrB/C transcription and turnover are activated by carbon metabolism products (e.g., formate and acetate) and by a preferred carbon source (glucose), respectively. We show that cAMP-CRP, a mediator of classical catabolite repression, inhibits csrC transcription by binding to the upstream region of this gene and also inhibits csrB transcription, apparently indirectly. We propose that glucose availability activates pathways for both synthesis and turnover of CsrB/C, thus shaping the dynamics of global signaling in response to the nutritional environment by poising CsrB/C sRNA levels for rapid response. PMID:27551019

  7. Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

    USGS Publications Warehouse

    Juracek, Kyle E.

    2011-01-01

    Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

  8. Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dong, Hongyan, E-mail: hongyan_dong@hc-sc.gc.ca; Yauk, Carole L.; Wade, Michael G.

    Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined withmore » chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism.« less

  9. Genome-wide Determinants of Proviral Targeting, Clonal Abundance and Expression in Natural HTLV-1 Infection

    PubMed Central

    Melamed, Anat; Laydon, Daniel J.; Gillet, Nicolas A.; Tanaka, Yuetsu; Taylor, Graham P.; Bangham, Charles R. M.

    2013-01-01

    The regulation of proviral latency is a central problem in retrovirology. We postulate that the genomic integration site of human T lymphotropic virus type 1 (HTLV-1) determines the pattern of expression of the provirus, which in turn determines the abundance and pathogenic potential of infected T cell clones in vivo. We recently developed a high-throughput method for the genome-wide amplification, identification and quantification of proviral integration sites. Here, we used this protocol to test two hypotheses. First, that binding sites for transcription factors and chromatin remodelling factors in the genome flanking the proviral integration site of HTLV-1 are associated with integration targeting, spontaneous proviral expression, and in vivo clonal abundance. Second, that the transcriptional orientation of the HTLV-1 provirus relative to that of the nearest host gene determines spontaneous proviral expression and in vivo clonal abundance. Integration targeting was strongly associated with the presence of a binding site for specific host transcription factors, especially STAT1 and p53. The presence of the chromatin remodelling factors BRG1 and INI1 and certain host transcription factors either upstream or downstream of the provirus was associated respectively with silencing or spontaneous expression of the provirus. Cells expressing HTLV-1 Tax protein were significantly more frequent in clones of low abundance in vivo. We conclude that transcriptional interference and chromatin remodelling are critical determinants of proviral latency in natural HTLV-1 infection. PMID:23555266

  10. SRY-box-containing Gene 2 Regulation of Nuclear Receptor Tailless (Tlx) Transcription in Adult Neural Stem Cells*

    PubMed Central

    Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.

    2012-01-01

    Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs. PMID:22194602

  11. SRY-box-containing gene 2 regulation of nuclear receptor tailless (Tlx) transcription in adult neural stem cells.

    PubMed

    Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M; Evans, Ronald M; Gage, Fred H

    2012-02-17

    Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs.

  12. Folding behavior of a T-shaped, ribosome-binding translation enhancer implicated in a wide-spread conformational switch

    PubMed Central

    Le, My-Tra; Kasprzak, Wojciech K; Kim, Taejin; Gao, Feng; Young, Megan YL; Yuan, Xuefeng; Shapiro, Bruce A; Seog, Joonil; Simon, Anne E

    2017-01-01

    Turnip crinkle virus contains a T-shaped, ribosome-binding, translation enhancer (TSS) in its 3’UTR that serves as a hub for interactions throughout the region. The viral RNA-dependent RNA polymerase (RdRp) causes the TSS/surrounding region to undergo a conformational shift postulated to inhibit translation. Using optical tweezers (OT) and steered molecular dynamic simulations (SMD), we found that the unusual stability of pseudoknotted element H4a/Ψ3 required five upstream adenylates, and H4a/Ψ3 was necessary for cooperative association of two other hairpins (H5/H4b) in Mg2+. SMD recapitulated the TSS unfolding order in the absence of Mg2+, showed dependence of the resistance to pulling on the 3D orientation and gave structural insights into the measured contour lengths of the TSS structure elements. Adenylate mutations eliminated one-site RdRp binding to the 3’UTR, suggesting that RdRp binding to the adenylates disrupts H4a/Ψ3, leading to loss of H5/H4b interaction and promoting a conformational switch interrupting translation and promoting replication. DOI: http://dx.doi.org/10.7554/eLife.22883.001 PMID:28186489

  13. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

    PubMed Central

    Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

    1995-01-01

    The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

  14. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  15. Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

    PubMed Central

    Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

    1999-01-01

    The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

  16. Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

    2010-01-12

    The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

  17. Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

    PubMed

    Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

    2007-08-01

    To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

  18. Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

    PubMed

    Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

    2011-01-30

    During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

  19. The genomic structure of the human UFO receptor.

    PubMed

    Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

    1993-02-01

    Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

  20. Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

    PubMed Central

    Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret

    2015-01-01

    ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636

  1. Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Brien, D.A.

    1992-11-01

    A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

  2. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  3. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  4. Regulation of neural macroRNAs by the transcriptional repressor REST

    PubMed Central

    Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J.; Stanton, Lawrence W.; Lipovich, Leonard

    2009-01-01

    The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs (“macroRNAs”), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer. PMID:19050060

  5. Regulation of neural macroRNAs by the transcriptional repressor REST.

    PubMed

    Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J; Stanton, Lawrence W; Lipovich, Leonard

    2009-01-01

    The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs ("macroRNAs"), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer.

  6. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  7. Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

    PubMed

    Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

  8. Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

    PubMed Central

    Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

  9. Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

    PubMed Central

    Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

    2008-01-01

    SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

  10. Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

    PubMed

    Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

    2008-04-11

    The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

  11. Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

    PubMed

    Zhao, Xiaoyan; Sze, Sing-Hoi

    2011-05-01

    One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

  12. Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

    PubMed Central

    Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

    2005-01-01

    Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

  13. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  14. Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

    PubMed Central

    Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

    2002-01-01

    The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

  15. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  16. Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

    USGS Publications Warehouse

    Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

    1998-01-01

    Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

  17. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  18. Efficient activation of transcription in yeast by the BPV1 E2 protein.

    PubMed Central

    Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

    1989-01-01

    The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

  19. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  20. Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2002-04-01

    Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

  1. U1snRNP-mediated suppression of polyadenylation in conjunction with the RNA structure controls poly (A) site selection in foamy viruses

    PubMed Central

    2013-01-01

    Background During reverse transcription, retroviruses duplicate the long terminal repeats (LTRs). These identical LTRs carry both promoter regions and functional polyadenylation sites. To express full-length transcripts, retroviruses have to suppress polyadenylation in the 5′LTR and activate polyadenylation in the 3′LTR. Foamy viruses have a unique LTR structure with respect to the location of the major splice donor (MSD), which is located upstream of the polyadenylation signal. Results Here, we describe the mechanisms of foamy viruses regulating polyadenylation. We show that binding of the U1 small nuclear ribonucleoprotein (U1snRNP) to the MSD suppresses polyadenylation at the 5′LTR. In contrast, polyadenylation at the 3′LTR is achieved by adoption of a different RNA structure at the MSD region, which blocks U1snRNP binding and furthers RNA cleavage and subsequent polyadenylation. Conclusion Recently, it was shown that U1snRNP is able to suppress the usage of intronic cryptic polyadenylation sites in the cellular genome. Foamy viruses take advantage of this surveillance mechanism to suppress premature polyadenylation at the 5’end of their RNA. At the 3’end, Foamy viruses use a secondary structure to presumably block access of U1snRNP and thereby activate polyadenylation at the end of the genome. Our data reveal a contribution of U1snRNP to cellular polyadenylation site selection and to the regulation of gene expression. PMID:23718736

  2. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  3. Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

    PubMed

    Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

    2014-08-01

    Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. p62 targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding

    PubMed Central

    Itakura, Eisuke

    2011-01-01

    Autophagy is an intracellular degradation process by which cytoplasmic contents are degraded in the lysosome. In addition to nonselective engulfment of cytoplasmic materials, the autophagosomal membrane can selectively recognize specific proteins and organelles. It is generally believed that the major selective substrate (or cargo receptor) p62 is recruited to the autophagosomal membrane through interaction with LC3. In this study, we analyzed loading of p62 and its related protein NBR1 and found that they localize to the endoplasmic reticulum (ER)–associated autophagosome formation site independently of LC3 localization to membranes. p62 colocalizes with upstream autophagy factors such as ULK1 and VMP1 even when autophagosome formation is blocked by wortmannin or FIP200 knockout. Self-oligomerization of p62 is essential for its localization to the autophagosome formation site. These results suggest that p62 localizes to the autophagosome formation site on the ER, where autophagosomes are nucleated. This process is similar to the yeast cytoplasm to vacuole targeting pathway. PMID:21220506

  5. Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

    PubMed

    Fahrner, Karen A; Berg, Howard C

    2015-10-01

    Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.

    PubMed

    Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S

    2000-07-01

    OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.

  7. Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

    PubMed

    Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

    2016-10-01

    E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

  8. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  9. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

    PubMed

    Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

    2004-02-11

    In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

  10. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

    PubMed Central

    Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

    2004-01-01

    In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

  11. Molecular basis of the activity of the phytopathogen pectin methylesterase

    PubMed Central

    Fries, Markus; Ihrig, Jessica; Brocklehurst, Keith; Shevchik, Vladimir E; Pickersgill, Richard W

    2007-01-01

    We provide a mechanism for the activity of pectin methylesterase (PME), the enzyme that catalyses the essential first step in bacterial invasion of plant tissues. The complexes formed in the crystal using specifically methylated pectins, together with kinetic measurements of directed mutants, provide clear insights at atomic resolution into the specificity and the processive action of the Erwinia chrysanthemi enzyme. Product complexes provide additional snapshots along the reaction coordinate. We previously revealed that PME is a novel aspartic-esterase possessing parallel β-helix architecture and now show that the two conserved aspartates are the nucleophile and general acid-base in the mechanism, respectively. Other conserved residues at the catalytic centre are shown to be essential for substrate binding or transition state stabilisation. The preferential binding of methylated sugar residues upstream of the catalytic site, and demethylated residues downstream, drives the enzyme along the pectin molecule and accounts for the sequential pattern of demethylation produced by both bacterial and plant PMEs. PMID:17717531

  12. Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

    PubMed Central

    Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

    1984-01-01

    We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

  13. Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

    USGS Publications Warehouse

    Cary, L.E.; Parrett, Charles

    1996-01-01

    Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

  14. Strong linkage disequilibrium of a HbE variant with the (AT)9(T)5 repeat in the BP1 binding site upstream of the beta-globin gene in the Thai population.

    PubMed

    Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi

    2005-01-01

    A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.

  15. Caenorhabditis elegans fibroblast growth factor receptor signaling can occur independently of the multi-substrate adaptor FRS2.

    PubMed

    Lo, Te-Wen; Bennett, Daniel C; Goodman, S Jay; Stern, Michael J

    2010-06-01

    The components of receptor tyrosine kinase signaling complexes help to define the specificity of the effects of their activation. The Caenorhabditis elegans fibroblast growth factor receptor (FGFR), EGL-15, regulates a number of processes, including sex myoblast (SM) migration guidance and fluid homeostasis, both of which require a Grb2/Sos/Ras cassette of signaling components. Here we show that SEM-5/Grb2 can bind directly to EGL-15 to mediate SM chemoattraction. A yeast two-hybrid screen identified SEM-5 as able to interact with the carboxy-terminal domain (CTD) of EGL-15, a domain that is specifically required for SM chemoattraction. This interaction requires the SEM-5 SH2-binding motifs present in the CTD (Y(1009) and Y(1087)), and these sites are required for the CTD role of EGL-15 in SM chemoattraction. SEM-5, but not the SEM-5 binding sites located in the CTD, is required for the fluid homeostasis function of EGL-15, indicating that SEM-5 can link to EGL-15 through an alternative mechanism. The multi-substrate adaptor protein FRS2 serves to link vertebrate FGFRs to Grb2. In C. elegans, an FRS2-like gene, rog-1, functions upstream of a Ras/MAPK pathway for oocyte maturation but is not required for EGL-15 function. Thus, unlike the vertebrate FGFRs, which require the multi-substrate adaptor FRS2 to recruit Grb2, EGL-15 can recruit SEM-5/Grb2 directly.

  16. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

    PubMed Central

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

    2017-01-01

    ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

  17. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

    PubMed

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

    2017-07-01

    Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

  18. Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

    PubMed

    Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

    2017-11-15

    Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

  19. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  20. cAMP Response Element-binding Protein (CREB) and Nuclear Factor κB Mediate the Tamoxifen-induced Up-regulation of Glutamate Transporter 1 (GLT-1) in Rat Astrocytes*

    PubMed Central

    Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook

    2013-01-01

    Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341

  1. Mechanism underlying selective regulation of G protein-gated inwardly rectifying potassium channels by the psychostimulant-sensitive sorting nexin 27

    PubMed Central

    Balana, Bartosz; Maslennikov, Innokentiy; Kwiatkowski, Witek; Stern, Kalyn M.; Bahima, Laia; Choe, Senyon; Slesinger, Paul A.

    2011-01-01

    G protein-gated inwardly rectifying potassium (GIRK) channels are important gatekeepers of neuronal excitability. The surface expression of neuronal GIRK channels is regulated by the psychostimulant-sensitive sorting nexin 27 (SNX27) protein through a class I (-X-Ser/Thr-X-Φ, where X is any residue and Φ is a hydrophobic amino acid) PDZ-binding interaction. The G protein-insensitive inward rectifier channel (IRK1) contains the same class I PDZ-binding motif but associates with a different synaptic PDZ protein, postsynaptic density protein 95 (PSD95). The mechanism by which SNX27 and PSD95 discriminate these channels was previously unclear. Using high-resolution structures coupled with biochemical and functional analyses, we identified key amino acids upstream of the channel's canonical PDZ-binding motif that associate electrostatically with a unique structural pocket in the SNX27-PDZ domain. Changing specific charged residues in the channel's carboxyl terminus or in the PDZ domain converts the selective association and functional regulation by SNX27. Elucidation of this unique interaction site between ion channels and PDZ-containing proteins could provide a therapeutic target for treating brain diseases. PMID:21422294

  2. Modulation of chaperone function and cochaperone interaction by novobiocin in the C-terminal domain of Hsp90: evidence that coumarin antibiotics disrupt Hsp90 dimerization.

    PubMed

    Allan, Rudi K; Mok, Danny; Ward, Bryan K; Ratajczak, Thomas

    2006-03-17

    The C-terminal domain of Hsp90 displays independent chaperone activity, mediates dimerization, and contains the MEEVD motif essential for interaction with tetratricopeptide repeat-containing immunophilin cochaperones assembled in mature steroid receptor complexes. An alpha-helical region, upstream of the MEEVD peptide, helps form the dimerization interface and includes a hydrophobic microdomain that contributes to the Hsp90 interaction with the immunophilin cochaperones and corresponds to the binding site for novobiocin, a coumarin-related Hsp90 inhibitor. Mutation of selected residues within the hydrophobic microdomain significantly impacted the chaperone function of a recombinant C-terminal Hsp90 fragment and novobiocin inhibited wild-type chaperone activity. Prior incubation of the Hsp90 fragment with novobiocin led to a direct blockade of immunophilin cochaperone binding. However, the drug had little influence on the pre-formed Hsp90-immunophilin complex, suggesting that bound cochaperones mask the novobiocin-binding site. We observed a differential effect of the drug on Hsp90-immunophilin interaction, suggesting that the immunophilins make distinct contacts within the C-terminal domain to specifically modulate Hsp90 function. Novobiocin also precluded the interaction of full-length Hsp90 with the p50(cdc37) cochaperone, which targets the N-terminal nucleotide-binding domain, and is prevalent in Hsp90 complexes with protein kinase substrates. Novobiocin therefore acts locally and allosterically to induce conformational changes within multiple regions of the Hsp90 protein. We provide evidence that coumermycin A1, a coumarin structurally related to novobiocin, interferes with dimerization of the Hsp90 C-terminal domain. Coumarin-based inhibitors then may antagonize Hsp90 function by inducing a conformation favoring separation of the C-terminal domains and release of substrate.

  3. Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

    PubMed

    Tsurushita, N; Fu, H; Warren, C

    1996-06-12

    New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

  4. Effects of Hardened Low-Water Crossings on Periphyton and Water Quality in Selected Streams at the Fort Polk Military Reservation, Louisiana, 1998-99 and 2003-04

    USGS Publications Warehouse

    Bryan, Barbara W.; Bryan, C. Frederick; Lovelace, John K.; Tollett, Roland W.

    2007-01-01

    In 2003, the U.S. Geological Survey (USGS), at the request of the U.S. Army Joint Readiness Training Center and Fort Polk, began a follow-up study to determine whether installation and modification of hardened low-water crossings had short-term (less than 1 year) or long-term (greater than 1 year) effects on periphyton or water quality in five streams at the Fort Polk Military Reservation, Louisiana. Periphyton data were statistically analyzed for possible differences between samples collected at upstream and downstream sites and before and after low-water crossings were modified on three streams, Big Brushy Creek, Tributary to East Fork of Sixmile Creek, and Tributary to Birds Creek, during 2003?04. Periphyton data also were analyzed for possible differences between samples collected at upstream and downstream sites on two streams, Tributary to Big Brushy Creek and Little Brushy Creek, during 1998?99 and 2003. Variations in periphyton communities could not be conclusively attributed to the modifications. Most of the significant changes in percent frequency of occurrence and average cell density of the 10 most frequently occurring periphyton taxa were increases at downstream sites after the hardened low-water crossing installations or modifications. However, these changes in the periphyton community are not necessarily deleterious to the community structure. Water-quality data collected from upstream and downstream sites on the five streams during 2003?04 were analyzed for possible differences caused by the hardened crossings. Generally, average water-quality values and concentrations were similar at upstream and downstream sites. When average water-quality values or concentrations changed significantly, they almost always changed significantly at both the upstream and downstream sites. It is probable that observed variations in water quality at both upstream and downstream sites are related to differences in rainfall and streamflow during the sample collection periods rather than an effect of the hardened low-water crossing installations or modifications, but additional study is needed.

  5. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

    PubMed

    Li, Shisheng; Smerdon, Michael J

    2004-04-02

    Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

  6. Spatial and temporal patterns of micropollutants upstream and downstream of 24 WWTPs across Switzerland

    NASA Astrophysics Data System (ADS)

    Spycher, Barbara; Deuber, Fabian; Kistler, David; Burdon, Frank; Reyes, Marta; Alder, Alfredo C.; Joss, Adriano; Eggen, Rik; Singer, Heinz; Stamm, Christian

    2015-04-01

    Treated wastewater is an important source of micropollutants in many streams. These chemicals consist of very diverse set of compounds that may vary in space and time. In order to improve our understanding of such spatio-temporal patterns of micropollutants in surface waters, we compared upstream and downstream locations at 24 sites across the Swiss Plateau and Jura (12 sites in the 2013 campaign, 12 sites during the 2014 campaign). Each site represents the most upstream treatment plant in the corresponding catchment. This survey is part of the interdisciplinary, Eawag-wide research project EcoImpact that aims at elucidating the ecological effects of micropollutants on stream ecosystems. In 2013, a broad analytical screening was applied to samples collected during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 were analysed for a set of about 60 selected organic micropollutants and 10 heavy metals. The screening results demonstrate that generally pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest part of the organic micropollutants. Pesticides including biocides and plant protection products are also regularly found but at lower concentrations. This presentation will analyse the variability of the micropollutant patterns across the different sites and how upstream conditions and the wastewater composition changes with season.

  7. The BMP pathway acts to directly regulate Tbx20 in the developing heart

    PubMed Central

    Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.

    2010-01-01

    TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370

  8. Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

    PubMed Central

    Veldman, Matthew B.; Lin, Shuo

    2012-01-01

    Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

  9. Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

    PubMed

    Veldman, Matthew B; Lin, Shuo

    2012-01-20

    Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

  10. Platelet-derived growth factor receptor mediates activation of ras through different signaling pathways in different cell types.

    PubMed Central

    Satoh, T; Fantl, W J; Escobedo, J A; Williams, L T; Kaziro, Y

    1993-01-01

    A series of pieces of evidence have shown that Ras protein acts as a transducer of the platelet-derived growth factor (PDGF) receptor-mediated signaling pathway: (i) formation of Ras.GTP is detected immediately on PDGF stimulation, and (ii) a dominant inhibitory mutant Ras, as well as a neutralizing anti-Ras antibody, can interfere with PDGF-induced responses. On the other hand, several signal transducing molecules including phosphatidylinositol 3-kinase (PI3-K), GTPase-activating protein (GAP), and phospholipase C gamma (PLC gamma) bind directly to the PDGF receptor and become tyrosine phosphorylated. Recently, it was shown that specific phosphorylated tyrosines of the PDGF receptor are responsible for interaction between the receptor and each signaling molecule. However, the roles of these signaling molecules have not been elucidated, and it remains unclear which molecules are implicated in the Ras pathway. In this study, we measured Ras activation in cell lines expressing mutant PDGF receptors that are deficient in coupling with specific molecules. In fibroblast CHO cells, a mutant receptor (Y708F/Y719F [PI3-K-binding sites]) was unable to stimulate Ras, whereas another mutant (Y739F [the GAP-binding site]) could do so, suggesting an indispensable role of PI3-K or a protein that binds to the same sites as PI3-K for PDGF-stimulated Ras activation. By contrast, both of the above mutants were capable of stimulating Ras protein in a pro-B-cell line, BaF3. Furthermore, a mutant receptor (Y977F/Y989F [PLC gamma-binding sites]) could fully activate Ras, and the direct activation of protein kinase C and calcium mobilization had almost no effect on the GDP/GTP state of Ras in this cell line. These results suggest that, in the pro-B-cell transfectants, each of the above pathways (PI3-K, GAP, and PLC gamma) can be eliminated without a loss of Ras activation. It remains unclear whether another unknown essential pathway which regulates Ras protein exists within BaF3 cells. Therefore, it is likely that several different PDGF receptor-mediated signaling pathways function upstream of Ras, and the extent of the contribution of each pathway for the regulation of Ras may differ among different cell types. Images PMID:8388543

  11. Regulation of mRNA abundance by polypyrimidine tract-binding protein-controlled alternate 5' splice site choice.

    PubMed

    Hamid, Fursham M; Makeyev, Eugene V

    2014-11-01

    Alternative splicing (AS) provides a potent mechanism for increasing protein diversity and modulating gene expression levels. How alternate splice sites are selected by the splicing machinery and how AS is integrated into gene regulation networks remain important questions of eukaryotic biology. Here we report that polypyrimidine tract-binding protein 1 (Ptbp1/PTB/hnRNP-I) controls alternate 5' and 3' splice site (5'ss and 3'ss) usage in a large set of mammalian transcripts. A top scoring event identified by our analysis was the choice between competing upstream and downstream 5'ss (u5'ss and d5'ss) in the exon 18 of the Hps1 gene. Hps1 is essential for proper biogenesis of lysosome-related organelles and loss of its function leads to a disease called type 1 Hermansky-Pudlak Syndrome (HPS). We show that Ptbp1 promotes preferential utilization of the u5'ss giving rise to stable mRNAs encoding a full-length Hps1 protein, whereas bias towards d5'ss triggered by Ptbp1 down-regulation generates transcripts susceptible to nonsense-mediated decay (NMD). We further demonstrate that Ptbp1 binds to pyrimidine-rich sequences between the u5'ss and d5'ss and activates the former site rather than repressing the latter. Consistent with this mechanism, u5'ss is intrinsically weaker than d5'ss, with a similar tendency observed for other genes with Ptbp1-induced u5'ss bias. Interestingly, the brain-enriched Ptbp1 paralog Ptbp2/nPTB/brPTB stimulated the u5'ss utilization but with a considerably lower efficiency than Ptbp1. This may account for the tight correlation between Hps1 with Ptbp1 expression levels observed across mammalian tissues. More generally, these data expand our understanding of AS regulation and uncover a post-transcriptional strategy ensuring co-expression of a subordinate gene with its master regulator through an AS-NMD tracking mechanism.

  12. The HIP1 initiator element plays a role in determining the in vitro requirement of the dihydrofolate reductase gene promoter for the C-terminal domain of RNA polymerase II.

    PubMed

    Buermeyer, A B; Thompson, N E; Strasheim, L A; Burgess, R R; Farnham, P J

    1992-05-01

    We examined the ability of purified RNA polymerase (RNAP) II lacking the carboxy-terminal heptapeptide repeat domain (CTD), called RNAP IIB, to transcribe a variety of promoters in HeLa extracts in which endogenous RNAP II activity was inhibited with anti-CTD monoclonal antibodies. Not all promoters were efficiently transcribed by RNAP IIB, and transcription did not correlate with the in vitro strength of the promoter or with the presence of a consensus TATA box. This was best illustrated by the GC-rich, non-TATA box promoters of the bidirectional dihydrofolate reductase (DHFR)-REP-encoding locus. Whereas the REP promoter was transcribed by RNAP IIB, the DHFR promoter remained inactive after addition of RNAP IIB to the antibody-inhibited reactions. However, both promoters were efficiently transcribed when purified RNAP with an intact CTD was added. We analyzed a series of promoter deletions to identify which cis elements determine the requirement for the CTD of RNAP II. All of the promoter deletions of both DHFR and REP retained the characteristics of their respective full-length promoters, suggesting that the information necessary to specify the requirement for the CTD is contained within approximately 65 bp near the initiation site. Furthermore, a synthetic minimal promoter of DHFR, consisting of a single binding site for Sp1 and a binding site for the HIP1 initiator cloned into a bacterial vector sequence, required RNAP II with an intact CTD for activity in vitro. Since the synthetic minimal promoter of DHFR and the smallest REP promoter deletion are both activated by Sp1, the differential response in this assay does not result from upstream activators. However, the sequences around the start sites of DHFR and REP are not similar and our data suggest that they bind different proteins. Therefore, we propose that specific initiator elements are important for determination of the requirement of some promoters for the CTD.

  13. Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

    PubMed

    Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

    2015-10-01

    Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

  14. Transcriptional activation of Mina by Sp1/3 factors.

    PubMed

    Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

  15. Transcriptional Activation of Mina by Sp1/3 Factors

    PubMed Central

    Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

  16. Loosely bound oxytetracycline in riverine sediments from two tributaries of the Chesapeake Bay

    USGS Publications Warehouse

    Simon, N.S.

    2005-01-01

    The fate of antibiotics that bind to riverine sediment is not well understood. A solution used in geochemical extraction schemes to determine loosely bound species in sediments, 1 M MgCl2 (pH 8), was chosen to determine loosely bound, and potentially bioavailable, tetracycline antibiotics (TCs), including oxytetracycline (5-OH tetracycline) (OTC) in sediment samples from two rivers on the eastern shore of the Chesapeake Bay. Bottom sediments were collected at sites upstream from, at, and downstream from municipal sewage-treatment plants (STPs) situated on two natural waterways, Yellow Bank Stream, MD, and the Pocomoke River, MD. Concentrations of easily desorbed OTC ranged from 0.6 to approximately 1.2 ??g g-1 dry wt sediment in Yellow Bank Stream and from 0.7 to approximately 3.3 ??g g-1 dry wt sediment in the Pocomoke River. Concentrations of easily desorbable OTC were generally smaller in sediment upstream than in sediment downstream from the STP in the Pocomoke River. STPs and poultry manure are both potential sources of OTC to these streams. OTC that is loosely bound to sediment is subject to desorption. Other researchers have found desorbed TCs to be biologically active compounds.

  17. Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

    PubMed Central

    Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2011-01-01

    Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

  18. Recommendations for a wind profiling network to support Space Shuttle launches

    NASA Technical Reports Server (NTRS)

    Zamora, R. J.

    1992-01-01

    The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

  19. Structural Confirmation of a Bent and Open Model for the Initiation Complex of T7 RNA Polymerase

    PubMed Central

    Turingan, Rosemary S.; Liu, Cuihua; Hawkins, Mary E.; Martin, Craig T.

    2008-01-01

    T7 RNA polymerase is known to induce bending of its promoter DNA upon binding, as evidenced by gel-shift assays and by recent end-to-end fluorescence energy transfer distance measurements. Crystal structures of promoter-bound and initially transcribing complexes, however, lack downstream DNA, providing no information on the overall path of the DNA through the protein. Crystal structures of the elongation complex do include downstream DNA and provide valuable guidance in the design of models for the complete melted bubble structure at initiation. In the current study, we test a specific structural model for the initiation complex, obtained by alignment of the C-terminal regions of the protein structures from both initiation and elongation and then simple transferal of the downstream DNA from the elongation complex onto the initiation complex. FRET measurement of distances from a point upstream on the promoter DNA to various points along the downstream helix reproduce the expected helical periodicity in the distances and support the model’s orientation and phasing of the downstream DNA. The model also makes predictions about the extent of melting downstream of the active site. By monitoring fluorescent base analogs incorporated at various positions in the DNA we have mapped the downstream edge of the bubble, confirming the model. The initially melted bubble, in the absence of substrate, encompasses 7–8 bases and is sufficient to allow synthesis of a 3 base transcript before further melting is required. The results demonstrate that despite massive changes in the N-terminal portion of the protein and in the DNA upstream of the active site, the DNA downstream of the active site is virtually identical in both initiation and elongation complexes. PMID:17253774

  20. Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.

    PubMed

    Abedini, Davar; Rashidi Monfared, Sajad

    2018-06-01

    A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.

  1. Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

    PubMed Central

    Coffee, Erin M.; Tolan, Dean R.

    2010-01-01

    SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

  2. Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

    USGS Publications Warehouse

    Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

    2017-09-06

    Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the suspended-sediment load at the downstream site was about 28,300 short tons greater than the upstream site over the study period.As expected, high-flow events (the top 5 percent of daily mean flows) accounted for the majority of the sediment load; 80 percent at the upstream site and 90 percent at the downstream site. A similar relation between turbidity (the top 5 percent of daily mean turbidity) and high loads was also noted. In general, when instantaneous streamflows at the upstream site exceeded 5,000 cubic feet per second, increased daily loads were computed at the downstream site. During low to moderate flows, estimated suspended-sediment loads were lower at the downstream site when compared to the upstream site, which suggests that sediment deposition may be occurring in the intervening reach during those conditions. During the high-flow events, the estimated suspended-sediment loads were higher at the downstream site; however, it is impossible to say with certainty whether the increase in loading was due to scouring of lake sediment, contributions from the additional source area, model error, or a combination of one or more of these factors. The computed loads for a one-week period (December 24–31, 2015), during which the two largest high-flow events of the study period occurred, were approximately 52 percent of the 2015 annual sediment load (36 percent of 2-year load) at the upstream site and approximately 72 percent of the 2015 annual sediment load (57 percent of 2-year load) at the downstream site. Six bedload samples were collected during three events; two high-flow events and one base-flow event. The contribution of bedload to the total sediment load was determined to be insignificant for sampled flows. In general, streamflows for long-term streamgages in the study area were below normal for the majority of the study period; however, flows during the last 3 months of the study period were above normal, including the extreme events during the last week of the study period.

  3. Thermal effects of dams in the Willamette River basin, Oregon

    USGS Publications Warehouse

    Rounds, Stewart A.

    2010-01-01

    Methods were developed to assess the effects of dams on streamflow and water temperature in the Willamette River and its major tributaries. These methods were used to estimate the flows and temperatures that would occur at 14 dam sites in the absence of upstream dams, and river models were applied to simulate downstream flows and temperatures under a no-dams scenario. The dams selected for this study include 13 dams built and operated by the U.S. Army Corps of Engineers (USACE) as part of the Willamette Project, and 1 dam on the Clackamas River owned and operated by Portland General Electric (PGE). Streamflows in the absence of upstream dams for 2001-02 were estimated for USACE sites on the basis of measured releases, changes in reservoir storage, a correction for evaporative losses, and an accounting of flow effects from upstream dams. For the PGE dam, no-project streamflows were derived from a previous modeling effort that was part of a dam-relicensing process. Without-dam streamflows were characterized by higher peak flows in winter and spring and much lower flows in late summer, as compared to with-dam measured flows. Without-dam water temperatures were estimated from measured temperatures upstream of the reservoirs (the USACE sites) or derived from no-project model results (the PGE site). When using upstream data to estimate without-dam temperatures at dam sites, a typical downstream warming rate based on historical data and downstream river models was applied over the distance from the measurement point to the dam site, but only for conditions when the temperature data indicated that warming might be expected. Regressions with measured temperatures from nearby or similar sites were used to extend the without-dam temperature estimates to the entire 2001-02 time period. Without-dam temperature estimates were characterized by a more natural seasonal pattern, with a maximum in July or August, in contrast to the measured patterns at many of the tall dam sites where the annual maximum temperature typically occurred in September or October. Without-dam temperatures also tended to have more daily variation than with-dam temperatures. Examination of the without-dam temperature estimates indicated that dam sites could be grouped according to the amount of streamflow derived from high-elevation, spring-fed, and snowmelt-driven areas high in the Cascade Mountains (Cougar, Big Cliff/Detroit, River Mill, and Hills Creek Dams: Group A), as opposed to flow primarily derived from lower-elevation rainfall-driven drainages (Group B). Annual maximum temperatures for Group A ranged from 15 to 20 degree(s)C, expressed as the 7-day average of the daily maximum (7dADM), whereas annual maximum 7dADM temperatures for Group B ranged from 21 to 25 degrees C. Because summertime stream temperature is at least somewhat dependent on the upstream water source, it was important when estimating without-dam temperatures to use correlations to sites with similar upstream characteristics. For that reason, it also is important to maintain long-term, year-round temperature measurement stations at representative sites in each of the Willamette River basin's physiographic regions. Streamflow and temperature estimates downstream of the major dam sites and throughout the Willamette River were generated using existing CE-QUAL-W2 flow and temperature models. These models, originally developed for the Willamette River water-temperature Total Maximum Daily Load process, required only a few modifications to allow them to run under the greatly reduced without-dam flow conditions. Model scenarios both with and without upstream dams were run. Results showed that Willamette River streamflow without upstream dams was reduced to levels much closer to historical pre-dam conditions, with annual minimum streamflows approximately one-half or less of dam-augmented levels. Thermal effects of the dams varied according to the time of year, from cooling in mid-summer to warm

  4. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6.

    PubMed

    Evans, Ben A; Smith, Olivia L; Pickerill, Ethan S; York, Mary K; Buenconsejo, Kristen J P; Chambers, Antonio E; Bernstein, Douglas A

    2018-01-01

    Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn 2+ -binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans . Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest.

  5. VIH from the mud crab is specifically expressed in the eyestalk and potentially regulated by transactivator of Sox9/Oct4/Oct1.

    PubMed

    Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping

    2018-01-01

    Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Molecular Basis for Phosphorylation-dependent SUMO Recognition by the DNA Repair Protein RAP80.

    PubMed

    Anamika; Spyracopoulos, Leo

    2016-02-26

    Recognition and repair of double-stranded DNA breaks (DSB) involves the targeted recruitment of BRCA tumor suppressors to damage foci through binding of both ubiquitin (Ub) and the Ub-like modifier SUMO. RAP80 is a component of the BRCA1 A complex, and plays a key role in the recruitment process through the binding of Lys(63)-linked poly-Ub chains by tandem Ub interacting motifs (UIM). RAP80 also contains a SUMO interacting motif (SIM) just upstream of the tandem UIMs that has been shown to specifically bind the SUMO-2 isoform. The RAP80 tandem UIMs and SIM function collectively for optimal recruitment of BRCA1 to DSBs, although the molecular basis of this process is not well understood. Using NMR spectroscopy, we demonstrate that the RAP80 SIM binds SUMO-2, and that both specificity and affinity are enhanced through phosphorylation of the canonical CK2 site within the SIM. The affinity increase results from an enhancement of electrostatic interactions between the phosphoserines of RAP80 and the SIM recognition module within SUMO-2. The NMR structure of the SUMO-2·phospho-RAP80 complex reveals that the molecular basis for SUMO-2 specificity is due to isoform-specific sequence differences in electrostatic SIM recognition modules. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Ada protein-RNA polymerase sigma subunit interaction and alpha subunit-promoter DNA interaction are necessary at different steps in transcription initiation at the Escherichia coli Ada and aidB promoters.

    PubMed

    Landini, P; Bown, J A; Volkert, M R; Busby, S J

    1998-05-22

    The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.

  8. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  9. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  10. Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

    PubMed

    Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

    2018-06-01

    To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

  11. Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

    USGS Publications Warehouse

    Dauwalter, D.C.; Fisher, W.L.

    2007-01-01

    We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

  12. Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

    PubMed

    Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

    2017-11-01

    The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

  13. Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

    PubMed

    Sawado, T; Igarashi, K; Groudine, M

    2001-08-28

    The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

  14. Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

    PubMed Central

    Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

    2009-01-01

    Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

  15. Barriers impede upstream spawning migration of flathead chub

    USGS Publications Warehouse

    Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

    2014-01-01

    Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

  16. NFATc1 regulation of the human β3 integrin promoter in osteoclast differentiation

    PubMed Central

    Crotti, Tania N.; Flannery, Merrilee; Walsh, Nicole C.; Fleming, Joseph D.; Goldring, Steven R.; McHugh, Kevin P.

    2006-01-01

    The transcription factor NFATc1 plays an essential role in transducing signals from RANKL in osteoclast differentiation. To date, however, the specific transcriptional targets of NFATc1 are unknown. Expression of the β3 integrin is required for normal osteoclast function. We therefore examined the role of NFATc1 in human β3 integrin expression in osteoclast differentiation. Analysis of the mouse and human β3 gene promoters revealed considerable sequence homology across a 1.3 kb region upstream of the transcription start site (TSS), with conserved NFAT binding elements present. The region −1242 to +29 (relative to the TSS) was cloned as a luciferase reporter construct (pB3-1.3) and a deletion construct removing to −997 (pB3-1) made. The deletion of 245 bp 5′ removed three conserved NFAT sites including a consensus NFAT:AP-1 site. The pB3-1.3 reporter construct was induced by treatment with RANKL in the range 2.5–40 ng/ml and dose-dependently induced by co-transfection with human NFATc1 in RAW264.7 cells. The pB3-1 deletion construct was minimally induced with RANKL treatment and unresponsive to co-transfected NFATc1. Direct NFAT binding to two of the consensus NFAT sites within this 245 bp 5′ region was demonstrated by EMSA and supershift with anti-NFAT antibodies. Mutation of two of the conserved NFAT sites in the −1242 to −997 fragment was required to prevent binding. The double NFAT mutant, in the context of the full-length promoter was unresponsive to RANKL treatment or co-transfected NFATc1. We generated cell-permeable TAT-dominant-negative (dn)NFATc1 fusion proteins to assess the effect of blockade of NFAT signaling. Transduction with dnNFAT inhibited RANKL induction of the human β3 integrin promoter. Involvement of the NFATc1-calcineurin pathway in regulating the human β3 integrin promoter was further confirmed using the calcineurin pathway inhibitory peptide 11R-VIVIT. Together these results establish the β3 gene as a direct target of NFATc1 in RANKL-dependent osteoclast formation. PMID:16513293

  17. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    PubMed

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  18. Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element

    PubMed Central

    Hao, Hailing; Li, Ying; Tzatzalos, Evangeline; Gilbert, Jordana; Zala, Dhara; Bhaumik, Mantu; Cai, Li

    2014-01-01

    Precise control of lineage-specific gene expression in the neural stem/progenitor cells is crucial for generation of the diversity of neuronal and glial cell types in the central nervous system (CNS). The mechanism underlying such gene regulation, however, is not fully elucidated. Here, we report that a 377 bp evolutionarily conserved DNA fragment (CR5), located approximately 32 kbp upstream of Olig2 transcription start site, acts as a cis-regulator for gene expression in the development of the neonatal forebrain. CR5 is active in a time-specific and brain region-restricted manner. CR5 activity is not detected in the embryonic stage, but it is exclusively in a subset of Sox5+ cells in the neonatal ventral forebrain. Furthermore, we show that Sox5 binding motif in CR5 is important for this cell-specific gene regulatory activity; mutation of Sox5 binding motif in CR5 alters reporter gene expression with different cellular composition. Together, our study provides new insights into the regulation of cell-specific gene expression during CNS development. PMID:24954155

  19. Identification of secretaglobin Scgb2a1 as a target for developmental reprogramming by BPA in the rat prostate.

    PubMed

    Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn

    2015-01-01

    Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.

  20. The Fur-Iron Complex Modulates Expression of the Quorum-Sensing Master Regulator, SmcR, To Control Expression of Virulence Factors in Vibrio vulnificus

    PubMed Central

    Kim, In Hwang; Wen, Yancheng; Son, Jee-Soo; Lee, Kyu-Ho

    2013-01-01

    The gene vvpE, encoding the virulence factor elastase, is a member of the quorum-sensing regulon in Vibrio vulnificus and displays enhanced expression at high cell density. We observed that this gene was repressed under iron-rich conditions and that the repression was due to a Fur (ferric uptake regulator)-dependent repression of smcR, a gene encoding a quorum-sensing master regulator with similarity to luxR in Vibrio harveyi. A gel mobility shift assay and a footprinting experiment demonstrated that the Fur-iron complex binds directly to two regions upstream of smcR (−82 to −36 and −2 to +27, with respect to the transcription start site) with differing affinities. However, binding of the Fur-iron complex is reversible enough to allow expression of smcR to be induced by quorum sensing at high cell density under iron-rich conditions. Under iron-limiting conditions, Fur fails to bind either region and the expression of smcR is regulated solely by quorum sensing. These results suggest that two biologically important environmental signals, iron and quorum sensing, converge to direct the expression of smcR, which then coordinates the expression of virulence factors. PMID:23716618

  1. Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

    NASA Technical Reports Server (NTRS)

    Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

    1999-01-01

    Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

  2. A Catharanthus roseus BPF-1 homologue interacts with an elicitor-responsive region of the secondary metabolite biosynthetic gene Str and is induced by elicitor via a JA-independent signal transduction pathway.

    PubMed

    van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J

    2000-11-01

    Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.

  3. Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

    PubMed

    Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

    2014-03-04

    Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.

  4. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  5. Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

    USGS Publications Warehouse

    Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

    2016-07-18

    The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

  6. Rv2358 and FurB: Two Transcriptional Regulators from Mycobacterium tuberculosis Which Respond to Zinc

    PubMed Central

    Canneva, Fabio; Branzoni, Manuela; Riccardi, Giovanna; Provvedi, Roberta; Milano, Anna

    2005-01-01

    In a previous work, we demonstrated that the Mycobacterium tuberculosis Rv2358-furB operon is induced by zinc. In this study, the orthologous genes from Mycobacterium smegmatis mc2155 were inactivated and mutants analyzed. Rv2358 protein was purified and found to bind upstream of the Rv2358 gene. Binding was inhibited by Zn2+ ions. PMID:16077132

  7. Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

    PubMed

    Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

    2011-09-23

    Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

  8. Dysregulation of the IGF-I/PI3K/AKT/mTOR signaling pathway in autism spectrum disorders.

    PubMed

    Chen, Jianling; Alberts, Ian; Li, Xiaohong

    2014-06-01

    The IGF-I/PI3K/AKT/mTOR signaling pathway plays an important role in the regulation of cell growth, proliferation, differentiation, motility, survival, metabolism and protein synthesis. Insulin-like growth factor-I (IGF-I) is synthesized in the liver and fibroblasts, and its biological actions are mediated by the IGF-I receptor (IGF-IR). The binding of IGF-I to IGF-IR leads to the activation of phosphatidylinositol 3-kinase (PI3K). Activated PI3K stimulates the production of phosphatidylinositol (4,5)-bisphosphate [PI(4,5)P2] and phosphatidylinositol (3,4,5)-trisphosphate [PI(3,4,5)P3]. The PH domain of AKT (protein kinase B, PKB) (v-AKT murine thymoma viral oncogene homolog) binds to PI(4,5)P2 and PI(3,4,5)P3, followed by phosphorylation of the Thr308 and Ser473 regulatory sites. Tuberous sclerosis complex 1 (TSC1) and TSC2 are upstream regulators of mammalian target of rapamycin (mTOR) and downstream effectors of the PI3K/AKT signaling pathway. The activation of AKT suppresses the TSC1/TSC2 heterodimer, which is an upstream regulator of mTOR. Dysregulated IGF-I/PI3K/AKT/mTOR signaling has been shown to be associated with autism spectrum disorders (ASDs). In this review, we discuss the emerging evidence for a functional relationship between the IGF-I/PI3K/AKT/mTOR pathway and ASDs, as well as a possible role of this signaling pathway in the diagnosis and treatment of ASDs. Copyright © 2014 ISDN. Published by Elsevier Ltd. All rights reserved.

  9. A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

    PubMed

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2018-03-01

    MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

  10. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

  11. Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos

    PubMed Central

    Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.

    2012-01-01

    The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570

  12. Non-homeodomain regions of Hox proteins mediate activation versus repression of Six2 via a single enhancer site in vivo

    PubMed Central

    Yallowitz, Alisha R.; Gong, Ke-Qin; Swinehart, Ilea T.; Nelson, Lisa T.; Wellik, Deneen M.

    2009-01-01

    Summary Hox genes control many developmental events along the AP axis, but few target genes have been identified. Whether target genes are activated or repressed, what enhancer elements are required for regulation, and how different domains of the Hox proteins contribute to regulatory specificity is poorly understood. Six2 is genetically downstream of both the Hox11 paralogous genes in the developing mammalian kidney and Hoxa2 in branchial arch and facial mesenchyme. Loss-of-function of Hox11 leads to loss of Six2 expression and loss-of-function of Hoxa2 leads to expanded Six2 expression. Herein we demonstrate that a single enhancer site upstream of the Six2 coding sequence is responsible for both activation by Hox11 proteins in the kidney and repression by Hoxa2 in the branchial arch and facial mesenchyme in vivo. DNA binding activity is required for both activation and repression, but differential activity is not controlled by differences in the homeodomains. Rather, protein domains N- and C-terminal to the homeodomain confer activation versus repression activity. These data support a model in which the DNA binding specificity of Hox proteins in vivo may be similar, consistent with accumulated in vitro data, and that unique functions result mainly from differential interactions mediated by non-homeodomain regions of Hox proteins. PMID:19716816

  13. The Cation-Responsive Protein NhaR of Escherichia coli Activates pgaABCD Transcription, Required for Production of the Biofilm Adhesin Poly-β-1,6-N-Acetyl-d-Glucosamine▿

    PubMed Central

    Goller, Carlos; Wang, Xin; Itoh, Yoshikane; Romeo, Tony

    2006-01-01

    The pgaABCD operon of Escherichia coli is required for production of the biofilm adhesin poly-β-1,6-N-acetyl-d-glucosamine (PGA). We establish here that NhaR, a DNA-binding protein of the LysR family of transcriptional regulators, activates transcription of this operon. Disruption of the nhaR gene decreased biofilm formation without affecting planktonic growth. PGA production was undetectable in an nhaR mutant strain. Expression of a pgaA′-′lacZ translational fusion was induced by NaCl and alkaline pH, but not by CaCl2 or sucrose, in an nhaR-dependent fashion. Primer extension and quantitative real-time reverse transcription-PCR analyses further revealed that NhaR affects the steady-state level of pga mRNA. A purified recombinant NhaR protein bound specifically and with high affinity within the pgaABCD promoter region; one apparent binding site overlaps the −35 element, and a second site lies immediately upstream of the first. This protein was necessary and sufficient for activation of in vitro transcription from the pgaA promoter. These results define a novel mechanism for regulation of biofilm formation in response to environmental conditions and suggest an expanded role for NhaR in promoting bacterial survival. PMID:16997959

  14. Role of Rac1 in Escherichia coli K1 invasion of human brain microvascular endothelial cells.

    PubMed

    Rudrabhatla, Rajyalakshmi S; Selvaraj, Suresh K; Prasadarao, Nemani V

    2006-02-01

    Escherichia coli K1 invasion of human brain microvascular endothelial cells (HBMEC) requires the reorganization of host cytoskeleton at the sites of bacterial entry. Both actin and myosin constitute the cytoskeletal architecture. We have previously shown that myosin light chain (MLC) phosphorylation by MLC kinase is regulated during E. coli invasion by an upstream kinase, p21-activated kinase 1 (PAK1), which is an effector protein of Rac and Cdc42 GTPases, but not of RhoA. Here, we report that the binding of only Rac1 to PAK1 decreases in HBMEC upon infection with E. coli K1, which resulted in increased phosphorylation of MLC. Overexpression of a constitutively active (cAc) form of Rac1 in HBMEC blocked the E. coli invasion significantly, whereas overexpression of a dominant negative form had no effect. Increased PAK1 phosphorylation was observed in HBMEC expressing cAc-Rac1 with a concomitant reduction in the phosphorylation of MLC. Immunocytochemistry studies demonstrated that the inhibition of E. coli invasion into cAc-Rac1/HBMEC is due to lack of phospho-MLC recruitment to the sites of E. coli entry. Taken together the data suggest that E. coli modulates the binding of Rac1, but not Cdc42, to PAK1 during the invasion of HBMEC.

  15. Sediment transport and water-quality characteristics and loads, White River, northwestern Colorado, water years 1975-88

    USGS Publications Warehouse

    Tobin, R.L.

    1993-01-01

    Streamflow, sediment, and water-quality data are summarized for 6 sites on the White River, Colorado for water years 1975-88. Correlation techniques were used to estimate annual data for unmeasured years. Annual stream discharge in the main stem of the White River ranged from about 200,000 to about 1 million acre-feet. Generally, bedload was less than/= 3.3 percent of total sediment load. Annual suspended-sediment loads ranged from about 2,100 tons at the upstream sites on the North Fork and South Fork of the White River to about 2 million tons at the most downstream site. Average annual suspended-sediment loads ranged from about 11,000 tons at the upstream sites to about 705,000 tons at the most downstream site. Annual capacity losses in a 50,000 acre-ft reservoir could range from less than 0.01 percent near upstream sites to about 2.5 percent near downstream sites. Maximum water temperatures in the White River ranged from less than 20 to 25 C in summer. Specific conductance ranged from 200 to 1,000 microsiemens/cm. Generally, values of pH ranged from 7.6 to 8.8, and concentrations of dissolved oxygen were greater than 6.0 mg/L. In small streamflows, values of pH and dissolved oxygen were affected by biologic processes. Composition of dissolved solids in the White River was mostly calcium, bicarbonate, and(or) sulfate. Changes in the composition of dissolved solids caused by the changes in the concentrations of sodium and sulfate were greatest in small stream discharges. Annual loads of dissolved solids ranged from 21,100 tons in the South Fork to about 480,000 tons at the most downstream site. Total solids transport in the White River was mostly as dissolved solids at upstream sites and mostly as suspended sediment at downstream sites. Concentration ranges of nutrients and trace constituents were determined.

  16. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  17. Alanine scanning of the rabies virus glycoprotein antigenic site III using recombinant rabies virus: implication for post-exposure treatment.

    PubMed

    Papaneri, Amy B; Wirblich, Christoph; Marissen, Wilfred E; Schnell, Matthias J

    2013-12-02

    The safety and availability of the human polyclonal sera that is currently utilized for post-exposure treatment (PET) of rabies virus (RABV) infection remain a concern. Recombinant monoclonal antibodies have been postulated as suitable alternatives by WHO. To this extent, CL184, the RABV human antibody combination comprising monoclonal antibodies (mAbs) CR57 and CR4098, has been developed and has delivered promising clinical data to support its use for RABV PET. For this fully human IgG1 cocktail, mAbs CR57 and CR4098 are produced in the PER.C6 human cell line and combined in equal amounts in the final product. During preclinical evaluation, CR57 was shown to bind to antigenic site I whereas CR4098 neutralization was influenced by a mutation of position 336 (N336) located within antigenic site III. Here, alanine scanning was used to analyze the influence of mutations within the potential binding site for CR4098, antigenic site III, in order to evaluate the possibility of mutated rabies viruses escaping neutralization. For this approach, twenty flanking amino acids (10 upstream and 10 downstream) of the RABV glycoprotein (G) asparagine (N336) were exchanged to alanine (or serine, if already alanine) by site-directed mutagenesis. Analysis of G expression revealed four of the twenty mutant Gs to be non-functional, as shown by their lack of cell surface expression, which is a requirement for the production of infectious RABV. Therefore, these mutants were excluded from further study. The remaining sixteen mutants were introduced in an infectious clone of RABV, and recombinant RABVs (rRABVs) were recovered and utilized for in vitro neutralization assays. All of the viruses were effectively neutralized by CR4098 as well as by CR57, indicating that single amino acid exchanges in this region does not affect the broad neutralizing capability of the CL184 mAb combination. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

    USGS Publications Warehouse

    Wilson, Jennifer T.

    2016-06-23

    Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

  19. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

    PubMed

    Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

    2013-09-01

    The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

  20. Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

    PubMed Central

    Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

    2015-01-01

    Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

  1. Transactivation of involucrin, a marker of differentiation in keratinocytes, by lens epithelium-derived growth factor (LEDGF).

    PubMed

    Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P

    2002-07-26

    Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand the molecular mechanism of transcriptional regulation of this gene. LEDGF may play an important role in establishing an important barrier in corneal keratinocytes by maintaining epidermal turn-over rate, and protecting HCKs against stress.

  2. A position effect on TRPS1 is associated with Ambras syndrome in humans and the Koala phenotype in mice

    PubMed Central

    Fantauzzo, Katherine A.; Tadin-Strapps, Marija; You, Yun; Mentzer, Sarah E.; Baumeister, Friedrich A.M.; Cianfarani, Stefano; Van Maldergem, Lionel; Warburton, Dorothy; Sundberg, John P.; Christiano, Angela M.

    2008-01-01

    Ambras syndrome (AS) is a rare form of congenital hypertrichosis with excessive hair on the shoulders, face and ears. Cytogenetic studies have previously implicated an association with rearrangements of chromosome 8. Here we define an 11.5 Mb candidate interval for AS on chromosome 8q based on cytogenetic breakpoints in three patients. TRPS1, a gene within this interval, was deleted in a patient with an 8q23 chromosomal rearrangement, while its expression was significantly downregulated in another patient with an inversion breakpoint 7.3 Mb downstream of TRPS1. Here, we describe the first potential long-range position effect on the expression of TRPS1. To gain insight into the mechanisms by which Trps1 affects the hair follicle, we performed a detailed analysis of the hair abnormalities in Koa mice, a mouse model of hypertrichosis. We found that the proximal breakpoint of the Koa inversion is located 791 kb upstream of Trps1. Quantitative real-time polymerase chain reaction, in situ hybridization and immunofluorescence analysis revealed that Trps1 expression levels are reduced in Koa mutant mice at the sites of pathology for the phenotype. We determined that the Koa inversion creates a new Sp1 binding site and translocates additional Sp1 binding sites within a highly conserved stretch spanning the proximal breakpoint, providing a potential mechanism for the position effect. Collectively, these results describe a position effect that downregulates TRPS1 expression as the probable cause of hypertrichosis in AS in humans and the Koa phenotype in mice. PMID:18713754

  3. The oligomerization state determines regulatory properties and inhibitor sensitivity of type 4 cAMP-specific phosphodiesterases.

    PubMed

    Richter, Wito; Conti, Marco

    2004-07-16

    PDE4 splice variants are classified into long and short forms depending on the presence or absence of two unique N-terminal domains termed upstream conserved regions 1 and 2 (UCR1 and -2). We have shown previously that the UCR module mediates dimerization of PDE4 long forms, whereas short forms, which lack UCR1, behave as monomers. In the present study, we demonstrate that dimerization is an essential structural element that determines the regulatory properties and inhibitor sensitivities of PDE4 enzymes. Comparing the properties of the dimeric wild type PDE4D3 with several monomeric mutant PDE4D3 constructs revealed that disruption of dimerization ablates the activation of PDE4 long forms by either protein kinase A phosphorylation or phosphatidic acid binding. Moreover, the analysis of heterodimers consisting of a catalytically active and a catalytically inactive PDE4D3 subunit indicates that protein kinase A phosphorylation of both subunits is essential to fully activate PDE4 enzymes. In addition to affecting enzyme regulation, disruption of dimerization reduces the sensitivity of the enzymes toward the prototypical PDE4 inhibitor rolipram. Parallel binding assays indicated that this shift in rolipram sensitivity is likely mediated by a decrease in the number of inhibitor binding sites in the high affinity rolipram binding state. Thus, although dimerization is not a requirement for high affinity rolipram binding, it functions to stabilize PDE4 long forms in their high affinity rolipram binding conformation. Taken together, our data indicate that dimerization defines the properties of PDE4 enzymes and suggest a common structural and functional organization for all PDEs.

  4. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    PubMed

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  5. Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

    PubMed Central

    2014-01-01

    Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

  6. Sequence-based model of gap gene regulatory network.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria

    2014-01-01

    The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3) functional important sites are not exclusively located in cis-regulatory elements, but are rather dispersed through regulatory region. It is of importance that some of the sites with high functional impact in hb, Kr and kni regulatory regions coincide with strong sites annotated and verified in Dnase I footprint assays.

  7. Position-dependent and neuron-specific splicing regulation by the CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans

    PubMed Central

    Kuroyanagi, Hidehito; Watanabe, Yohei; Suzuki, Yutaka; Hagiwara, Masatoshi

    2013-01-01

    A large fraction of protein-coding genes in metazoans undergo alternative pre-mRNA splicing in tissue- or cell-type-specific manners. Recent genome-wide approaches have identified many putative-binding sites for some of tissue-specific trans-acting splicing regulators. However, the mechanisms of splicing regulation in vivo remain largely unknown. To elucidate the modes of splicing regulation by the neuron-specific CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans, we performed deep sequencing of poly(A)+ RNAs from the unc-75(+)- and unc-75-mutant worms and identified more than 20 cassette and mutually exclusive exons repressed or activated by UNC-75. Motif searches revealed that (G/U)UGUUGUG stretches are enriched in the upstream and downstream introns of the UNC-75-repressed and -activated exons, respectively. Recombinant UNC-75 protein specifically binds to RNA fragments carrying the (G/U)UGUUGUG stretches in vitro. Bi-chromatic fluorescence alternative splicing reporters revealed that the UNC-75-target exons are regulated in tissue-specific and (G/U)UGUUGUG element-dependent manners in vivo. The unc-75 mutation affected the splicing reporter expression specifically in the nervous system. These results indicate that UNC-75 regulates alternative splicing of its target exons in neuron-specific and position-dependent manners through the (G/U)UGUUGUG elements in C. elegans. This study thus reveals the repertoire of target events for the CELF family in the living organism. PMID:23416545

  8. Regulation of the plasma cell transcription factor Blimp-1 gene by Bach2 and Bcl6.

    PubMed

    Ochiai, Kyoko; Muto, Akihiko; Tanaka, Hiromu; Takahashi, Shinichiro; Igarashi, Kazuhiko

    2008-03-01

    B lymphocyte-induced maturation protein 1 (Blimp-1) is a key regulator for plasma cell differentiation. Prior to the terminal differentiation into plasma cells, Blimp-1 expression is suppressed in B cells by transcription repressors BTB and CNC homology 2 (Bach2) and B cell lymphoma 6 (Bcl6). Bach2 binds to the Maf recognition element (MARE) of the promoter upstream region of the Blimp-1 gene (Prdm1) by forming a heterodimer with MafK. Bach2 and Bcl6 were found to interact with each other in B cells. While both Bach2 and Bcl6 possess the BTB domain which mediates protein-protein interactions, they interacted in a BTB-independent manner. Bcl6 is known to repress Prdm1 through a Bcl6 recognition element 1 in the intron 5, in which a putative, evolutionarily conserved MARE was identified. Both repressed the expression of a reporter gene containing the intron 5 region depending on the presence of the respective binding sites in 18-81 pre-B cells. Co-expression of Bach2 and Bcl6 resulted in further repression of the reporter plasmid. Chromatin immunoprecipitation assays showed MafK to bind to the intron MARE in various B cell lines, thus suggesting that it binds as a heterodimer with Bach2. Therefore, the interaction between Bach2 and Bcl6 might be crucial for the proper repression of Prdm1 in B cells.

  9. Position-specific binding of FUS to nascent RNA regulates mRNA length

    PubMed Central

    Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

    2015-01-01

    More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

  10. uAUG-mediated translational initiations are responsible for human mu opioid receptor gene expression

    PubMed Central

    Song, Kyu Young; Kim, Chun Sung; Hwang, Cheol Kyu; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H

    2010-01-01

    Abstract Mu opioid receptor (MOR) is the main site of interaction for major clinical analgesics, particularly morphine. MOR expression is regulated at the transcriptional and post-transcriptional levels. However, the protein expression of the MOR gene is relatively low and the translational control of MOR gene has not been well studied. The 5′-untranslated region (UTR) of the human MOR (OPRM1) mRNA contains four upstream AUG codons (uAUG) preceding the main translation initiation site. We mutated the four uAUGs individually and in combination. Mutations of the third uAUG, containing the same open reading frame, had the strongest inhibitory effect. The inhibitory effect caused by the third in-frame uAUG was confirmed by in vitro translation and receptor-binding assays. Toeprinting results showed that OPRM1 ribosomes initiated efficiently at the first uAUG, and subsequently re-initiated at the in-frame #3 uAUG and the physiological AUG site. This re-initiation resulted in negative expression of OPRM1 under normal conditions. These results indicate that re-initiation in MOR gene expression could play an important role in OPRM1 regulation. PMID:19438807

  11. PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site

    PubMed Central

    Bothe, Ingo; Deng, Su; Baylies, Mary

    2014-01-01

    Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization. PMID:24821989

  12. γ-Adducin Stimulates the Thiazide-sensitive NaCl Cotransporter

    PubMed Central

    Dimke, Henrik; San-Cristobal, Pedro; de Graaf, Mark; Lenders, Jacques W.; Deinum, Jaap; Hoenderop, Joost G.J.

    2011-01-01

    The thiazide-sensitive NaCl cotransporter (NCC) plays a key role in renal salt reabsorption and the determination of systemic BP, but the molecular mechanisms governing the regulation of NCC are not completely understood. Here, through pull-down experiments coupled to mass spectrometry, we found that γ-adducin interacts with the NCC transporter. γ-Adducin colocalized with NCC to the distal convoluted tubule. 22Na+ uptake experiments in the Xenopus laevis oocyte showed that γ-adducin stimulated NCC activity in a dose-dependent manner, an effect that occurred upstream from With No Lysine (WNK) 4 kinase. The binding site of γ-adducin mapped to the N terminus of NCC and encompassed three previously reported phosphorylation sites. Supporting this site of interaction, competition with the N-terminal domain of NCC abolished the stimulatory effect of γ-adducin on the transporter. γ-Adducin failed to increase NCC activity when these phosphorylation sites were constitutively inactive or active. In addition, γ-adducin bound only to the dephosphorylated N terminus of NCC. Taken together, our observations suggest that γ-adducin dynamically regulates NCC, likely by amending the phosphorylation state, and consequently the activity, of the transporter. These data suggest that γ-adducin may influence BP homeostasis by modulating renal NaCl transport. PMID:21164023

  13. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6

    PubMed Central

    Evans, Ben A.; Smith, Olivia L.; Pickerill, Ethan S.; York, Mary K.; Buenconsejo, Kristen J.P.; Chambers, Antonio E.

    2018-01-01

    Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn2+-binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans. Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest. PMID:29892505

  14. Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis.

    PubMed

    Kayukawa, Takumi; Jouraku, Akiya; Ito, Yuka; Shinoda, Tetsuro

    2017-01-31

    Juvenile hormone (JH) represses precocious metamorphosis of larval to pupal and adult transitions in holometabolous insects. The early JH-inducible gene Krüppel homolog 1 (Kr-h1) plays a key role in the repression of metamorphosis as a mediator of JH action. Previous studies demonstrated that Kr-h1 inhibits precocious larval-pupal transition in immature larva via direct transcriptional repression of the pupal specifier Broad-Complex (BR-C). JH was recently reported to repress the adult specifier gene Ecdysone-induced protein 93F (E93); however, its mechanism of action remains unclear. Here, we found that JH suppressed ecdysone-inducible E93 expression in the epidermis of the silkworm Bombyx mori and in a B. mori cell line. Reporter assays in the cell line revealed that the JH-dependent suppression was mediated by Kr-h1. Genome-wide ChIP-seq analysis identified a consensus Kr-h1 binding site (KBS, 14 bp) located in the E93 promoter region, and EMSA confirmed that Kr-h1 directly binds to the KBS. Moreover, we identified a C-terminal conserved domain in Kr-h1 essential for the transcriptional repression of E93 Based on these results, we propose a mechanism in which JH-inducible Kr-h1 directly binds to the KBS site upstream of the E93 locus to repress its transcription in a cell-autonomous manner, thereby preventing larva from bypassing the pupal stage and progressing to precocious adult development. These findings help to elucidate the molecular mechanisms regulating the metamorphic genetic network, including the functional significance of Kr-h1, BR-C, and E93 in holometabolous insect metamorphosis.

  15. A feedback regulatory model for RifQ-mediated repression of rifamycin export in Amycolatopsis mediterranei.

    PubMed

    Lei, Chao; Wang, Jingzhi; Liu, Yuanyuan; Liu, Xinqiang; Zhao, Guoping; Wang, Jin

    2018-01-29

    Due to the important role of rifamycin in curing tuberculosis infection, the study on rifamycin has never been stopped. Although RifZ, which locates within the rifamycin biosynthetic cluster, has recently been characterized as a pathway-specific regulator for rifamycin biosynthesis, little is known about the regulation of rifamycin export. In this work, we proved that the expression of the rifamycin efflux pump (RifP) was regulated by RifQ, a TetR-family transcriptional regulator. Deletion of rifQ had little impact on bacterial growth, but resulted in improved rifamycin production, which was consistent with the reverse transcription PCR results that RifQ negatively regulated rifP's transcription. With electrophoretic mobility shift assay and DNase I Footprinting assay, RifQ was found to directly bind to the promoter region of rifP, and a typical inverted repeat was identified within the RifQ-protected sequences. The transcription initiation site of rifP was further characterized and found to be upstream of the RifQ binding sites, well explaining the RifQ-mediated repression of rifP's transcription in vivo. Moreover, rifamycin B (the end product of rifamycin biosynthesis) remarkably decreased the DNA binding affinity of RifQ, which led to derepression of rifamycin export, reducing the intracellular concentration of rifamycin B as well as its toxicity against the host. Here, we proved that the export of rifamycin B was repressed by RifQ in Amycolatopsis mediterranei, and the RifQ-mediated repression could be specifically relieved by rifamycin B, the end product of rifamycin biosynthesis, based on which a feedback model was proposed for regulation of rifamycin export. With the findings here, one could improve the antibiotic yield by simply inactivating the negative regulator of the antibiotic transporter.

  16. Hepatocyte Nuclear Factor 4α (HNF4α) Is a Transcription Factor of Vertebrate Fatty Acyl Desaturase Gene as Identified in Marine Teleost Siganus canaliculatus

    PubMed Central

    Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou

    2016-01-01

    Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219

  17. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  18. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  19. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    PubMed

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  20. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  1. Regulation of mRNA Abundance by Polypyrimidine Tract-Binding Protein-Controlled Alternate 5′ Splice Site Choice

    PubMed Central

    Hamid, Fursham M.; Makeyev, Eugene V.

    2014-01-01

    Alternative splicing (AS) provides a potent mechanism for increasing protein diversity and modulating gene expression levels. How alternate splice sites are selected by the splicing machinery and how AS is integrated into gene regulation networks remain important questions of eukaryotic biology. Here we report that polypyrimidine tract-binding protein 1 (Ptbp1/PTB/hnRNP-I) controls alternate 5′ and 3′ splice site (5′ss and 3′ss) usage in a large set of mammalian transcripts. A top scoring event identified by our analysis was the choice between competing upstream and downstream 5′ss (u5′ss and d5′ss) in the exon 18 of the Hps1 gene. Hps1 is essential for proper biogenesis of lysosome-related organelles and loss of its function leads to a disease called type 1 Hermansky-Pudlak Syndrome (HPS). We show that Ptbp1 promotes preferential utilization of the u5′ss giving rise to stable mRNAs encoding a full-length Hps1 protein, whereas bias towards d5′ss triggered by Ptbp1 down-regulation generates transcripts susceptible to nonsense-mediated decay (NMD). We further demonstrate that Ptbp1 binds to pyrimidine-rich sequences between the u5′ss and d5′ss and activates the former site rather than repressing the latter. Consistent with this mechanism, u5′ss is intrinsically weaker than d5′ss, with a similar tendency observed for other genes with Ptbp1-induced u5′ss bias. Interestingly, the brain-enriched Ptbp1 paralog Ptbp2/nPTB/brPTB stimulated the u5′ss utilization but with a considerably lower efficiency than Ptbp1. This may account for the tight correlation between Hps1 with Ptbp1 expression levels observed across mammalian tissues. More generally, these data expand our understanding of AS regulation and uncover a post-transcriptional strategy ensuring co-expression of a subordinate gene with its master regulator through an AS-NMD tracking mechanism. PMID:25375251

  2. Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish.

    PubMed

    Tchoudakova, A; Kishida, M; Wood, E; Callard, G V

    2001-11-01

    Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.

  3. Comparative evolutionary genomics of the HADH2 gene encoding Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10)

    PubMed Central

    Marques, Alexandra T; Antunes, Agostinho; Fernandes, Pedro A; Ramos, Maria J

    2006-01-01

    Background The Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10) is an enzyme involved in pivotal metabolic processes and in the mitochondrial dysfunction seen in the Alzheimer's disease. Here we use comparative genomic analyses to study the evolution of the HADH2 gene encoding ABAD/HSD10 across several eukaryotic species. Results Both vertebrate and nematode HADH2 genes showed a six-exon/five-intron organization while those of the insects had a reduced and varied number of exons (two to three). Eutherian mammal HADH2 genes revealed some highly conserved noncoding regions, which may indicate the presence of functional elements, namely in the upstream region about 1 kb of the transcription start site and in the first part of intron 1. These regions were also conserved between Tetraodon and Fugu fishes. We identified a conserved alternative splicing event between human and dog, which have a nine amino acid deletion, causing the removal of the strand βF. This strand is one of the seven strands that compose the core β-sheet of the Rossman fold dinucleotide-binding motif characteristic of the short chain dehydrogenase/reductase (SDR) family members. However, the fact that the substrate binding cleft residues are retained and the existence of a shared variant between human and dog suggest that it might be functional. Molecular adaptation analyses across eutherian mammal orthologues revealed the existence of sites under positive selection, some of which being localized in the substrate-binding cleft and in the insertion 1 region on loop D (an important region for the Aβ-binding to the enzyme). Interestingly, a higher than expected number of nonsynonymous substitutions were observed between human/chimpanzee and orangutan, with six out of the seven amino acid replacements being under molecular adaptation (including three in loop D and one in the substrate binding loop). Conclusion Our study revealed that HADH2 genes maintained a reasonable conserved organization across a large evolutionary distance. The conserved noncoding regions identified among mammals and between pufferfishes, the evidence of an alternative splicing variant conserved between human and dog, and the detection of positive selection across eutherian mammals, may be of importance for further research on ABAD/HSD10 function and its implication in the Alzheimer's disease. PMID:16899120

  4. Identification of a high affinity nucleocapsid protein binding element within the Moloney murine leukemia virus Psi-RNA packaging signal: implications for genome recognition.

    PubMed

    D'Souza, V; Melamed, J; Habib, D; Pullen, K; Wallace, K; Summers, M F

    2001-11-23

    Murine leukemia virus (MLV) is currently the most widely used gene delivery system in gene therapy trials. The simple retrovirus packages two copies of its RNA genome by a mechanism that involves interactions between the nucleocapsid (NC) domain of a virally-encoded Gag polyprotein and a segment of the RNA genome located just upstream of the Gag initiation codon, known as the Psi-site. Previous studies indicated that the MLV Psi-site contains three stem loops (SLB-SLD), and that stem loops SLC and SLD play prominent roles in packaging. We have developed a method for the preparation and purification of large quantities of recombinant Moloney MLV NC protein, and have studied its interactions with a series of oligoribonucleotides that contain one or more of the Psi-RNA stem loops. At RNA concentrations above approximately 0.3 mM, isolated stem loop SLB forms a duplex and stem loops SL-C and SL-D form kissing complexes, as expected from previous studies. However, neither the monomeric nor the dimeric forms of these isolated stem loops binds NC with significant affinity. Longer constructs containing two stem loops (SL-BC and SL-CD) also exhibit low affinities for NC. However, NC binds with high affinity and stoichiometrically to both the monomeric and dimeric forms of an RNA construct that contains all three stem loops (SL-BCD; K(d)=132(+/-55) nM). Titration of SL-BCD with NC also shifts monomer-dimer equilibrium toward the dimer. Mutagenesis experiments demonstrate that the conserved GACG tetraloops of stem loops C and D do not influence the monomer-dimer equilibrium of SL-BCD, that the tetraloop of stem loop B does not participate directly in NC binding, and that the tetraloops of stem loops C and D probably also do not bind to NC. These surprising results differ considerably from those observed for HIV-1, where NC binds to individual stem loops with high affinity via interactions with exposed residues of the tetraloops. The present results indicate that MLV NC binds to a pocket or surface that only exists in the presence of all three stem loops. Copyright 2001 Academic Press.

  5. Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

    PubMed

    Javed, Muhammad Babar; Shotyk, William

    2018-05-10

    Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Relationships of field habitat measurements, visual habitat indices, and land cover to benthic macroinvertebrates in urbanized streams of the Santa Clara Valley, California

    USGS Publications Warehouse

    Fend, S.V.; Carter, J.L.; Kearns, F.R.

    2005-01-01

    We evaluated several approaches for measuring natural and anthropogenic habitat characteristics to predict benthic macroinvertebrate assemblages over a range of urban intensity at 85 stream sites in the Santa Clara Valley, California. Land cover was summarized as percentage urban land cover and impervious area within upstream buffers and the upstream subwatersheds. Field measurements characterized water chemistry, channel slope, sediment, and riparian canopy. In . addition to applying the visual-based habitat assessment in U.S. Environmental Protection Agency's rapid bioassessment protocol, we developed a simplified urban habitat assessment index based on turbidity, fine sediment deposition, riparian condition, and channel modification. Natural and anthropogenic habitat variables covaried along longitudinal stream gradients and were highly correlated with elevation. At the scale of the entire watershed, benthic macroinvertebrate measures were equally correlated with variables expressing natural gradients and urbanization effects. When natural gradients were reduced by partitioning sites into ecoregion subsection groupings, habitat variables most highly correlated with macroinvertebrate measures differed between upland and valley floor site groups. Among the valley floor sites, channel slope and physical modification of channel and riparian habitats appeared more important than upstream land cover or water quality in determining macroinvertebrate richness and ordination scores. Among upland sites, effects of upstream reservoir releases on habitat quality appeared important. Rapid habitat evaluation methods appeared to be an effective method for describing habitat features important to benthic macroinvertebrates when adapted for the region and the disturbance of interest. ?? 2005 by the American Fisheries Society.

  7. Mercury accumulation in biota of Thunder Creek, Saskatchewan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Munro, D.J.; Gummer, W.D.

    Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

  8. Retrotransposon profiling of RNA polymerase III initiation sites.

    PubMed

    Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

    2012-04-01

    Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes.

  9. Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

    PubMed

    Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

    2015-01-01

    Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    PubMed Central

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  11. A Reconnaissance of selected organic compounds in streams in tribal lands in Central Oklahoma, January-February 2009

    USGS Publications Warehouse

    Becker, Carol J.

    2010-01-01

    The U.S. Geological Survey worked in cooperation with the U.S. Environmental Protection Agency and the Kickapoo Tribe of Oklahoma on two separate reconnaissance projects carried out concurrently. Both projects entailed the use of passive samplers as a sampling methodology to investigate the detection of selected organic compounds at stream sites in jurisdictional areas of several tribes in central Oklahoma during January-February 2009. The focus of the project with the U.S. Environmental Protection Agency was the detection of pesticides and pesticide metabolites using Semipermeable Membrane Devices at five stream sites in jurisdictional areas of several tribes. The project with the Kickapoo Tribe of Oklahoma focused on the detection of pesticides, pesticide metabolites, polycyclic aromatic hydrocarbons, polychlorinated biphenyl compounds, and synthetic organic compounds using Semipermeable Membrane Devices and Polar Organic Chemical Integrative Samplers at two stream sites adjacent to the Kickapoo tribal lands. The seven stream sites were located in central Oklahoma on the Cimarron River, Little River, North Canadian River, Deep Fork, and Washita River. Extracts from SPMDs submerged at five stream sites, in cooperation with the U.S. Environmental Protection Agency, were analyzed for 46 pesticides and 6 pesticide metabolites. Dacthal, a pre-emergent herbicide, was detected at all five sites. Pendimethalin, also a pre-emergent, was detected at one site. The insecticides chlorpyrifos and dieldrin were detected at three sites and p,p'-DDE, a metabolite of the insecticide DDT, also was detected at three sites. SPMDs and POCIS were submerged at the upstream edge and downstream edge of the Kickapoo tribal boundaries. Both sites are downstream from the Oklahoma City metropolitan area and multiple municipal wastewater treatment plants. Extracts from the passive samplers were analyzed for 62 pesticides, 10 pesticide metabolites, 3 polychlorinated biphenyl compounds, 35 polycyclic aromatic hydrocarbons, and 49 synthetic organic compounds. Ten pesticides and four pesticide metabolites were detected at the upstream site and seven pesticides and four pesticide metabolites were detected at the downstream site. Pesticides detected at both sites were atrazine, chlorpyrifos, dacthal, dieldrin, metolachlor, pendimethalin, and trans-nonachlor. Additionally at the upstream site, heptachlor, pentachlorophenol, and prometon were detected. The pesticide metabolites p,p'-DDE, cis-chlordane, and trans-chlordane also were detected at both sites. Polychlorinated biphenyl compounds aroclor-1016/1242, aroclor-1254, and aroclor-1260 were detected at both sites. The upstream site had 16 polycyclic aromatic hydrocarbon detections and the downstream site had 8 detections. Because of chromatographic interference during analysis, a positive identification of 17 polycyclic aromatic hydrocarbons could not be made. Consequently, there may have been a greater number of these compounds detected at both sites. A total of 36 synthetic organic compounds were detected at the two sites adjacent to the Kickapoo tribal lands. The upstream site had 21 synthetic organic compound detections: three detergent metabolites, two fecal indicators, three flame retardants, seven industrial compounds, five compounds related to personal care products, and beta-sitosterol, a plant sterol. Fifteen synthetic organic compounds were detected at the downstream site and included: one fecal indicator, three flame retardants, six industrial compounds, and five compounds related to personal care products.

  12. Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

    EPA Pesticide Factsheets

    The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

  13. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  14. CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

    PubMed Central

    Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

    2010-01-01

    The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

  15. Reservoirs override seasonal variability of phytoplankton communities in a regulated Mediterranean river.

    PubMed

    Tornés, E; Pérez, M C; Durán, C; Sabater, S

    2014-03-15

    Water hydrology, temperature and transparency, as well as nutrient retention downstream of the reservoirs alter the temporal and spatial distribution patterns of phytoplankton communities in regulated rivers. The seasonal dynamics of phytoplankton communities in the Ebro was analysed in contrasting water flow periods in sections upstream and downstream of three large reservoirs, as well as in an intermediate site. Phytoplankton communities changed in response to seasonal variations in the areas not influenced by the reservoirs, but the phytoplankton distribution downstream of the reservoirs was driven by their particular hydrodynamics. The change in environmental conditions promoted by reservoirs influenced the pattern of replacement between diatoms and green algae of the upstream section. Differences in the phytoplankton community structure, abundance and environmental variables between upstream and downstream sites were maximal during low flow periods. Chlorophytes and dinoflagellates were present during low flow periods upstream of the reservoirs and in the intermediate site. Cocconeis cf. placentula characterized the downstream section, associated to the presence of macrophytes in that section. The present study sheds light on the consequences of river regulation under potential scenarios of climate change, and results could be used to anticipate ecological problems in large regulated rivers under these circumstances. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Responses of riparian reptile communities to damming and urbanization

    USGS Publications Warehouse

    Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

    2013-01-01

    Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

  17. A genetic screen for terminator function in yeast identifies a role for a new functional domain in termination factor Nab3.

    PubMed

    Loya, Travis J; O'Rourke, Thomas W; Reines, Daniel

    2012-08-01

    The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 'tail' forms an α-helical multimerization domain that helps assemble it onto an RNA substrate.

  18. Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR.

    PubMed

    Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter

    2011-05-01

    The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.

  19. Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

    USGS Publications Warehouse

    Peterson, David A.; Hargett, Eric G.; Feldman, David L.

    2011-01-01

    Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

  20. Architecture of the ParF*ParG protein complex involved in prokaryotic DNA segregation.

    PubMed

    Barillà, Daniela; Hayes, Finbarr

    2003-07-01

    The mechanism by which low copy number plasmids are segregated at cell division involves the concerted action of two plasmid-encoded proteins that assemble on a centromere-like site. This study explores the topology of the DNA segregation machinery specified by the parFG locus of TP228, a partition system which is phylogenetically distinct from more well-characterized archetypes. A variety of genetic, biochemical and biophysical strategies revealed that the ParG protein is dimeric. ParF, which is more closely related to the cell division regulator MinD than to the prototypical ParA partition protein of plasmid P1, is instead multimeric and its polymeric state appears to be modulated by ATP which correlates with the proposed ATP-binding activity of ParF. ParG interacts in a sequence-specific manner with the DNA region upstream of the parFG locus and this binding is modulated by ParF. Intriguingly, the ParF and ParG proteins form at least two types of discrete complex in the absence of this region suggesting that the assembly dynamics of these proteins onto DNA is intricate.

  1. Insulin signalling mechanisms for triacylglycerol storage.

    PubMed

    Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M

    2013-05-01

    Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.

  2. Engineering of synthetic, stress-responsive yeast promoters

    PubMed Central

    Rajkumar, Arun S.; Liu, Guodong; Bergenholm, David; Arsovska, Dushica; Kristensen, Mette; Nielsen, Jens; Jensen, Michael K.; Keasling, Jay D.

    2016-01-01

    Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducible by specific endogenous or environmental conditions is still rarely undertaken. In this study, we engineered and characterized a set of strong, synthetic promoters for budding yeast Saccharomyces cerevisiae that are inducible under acidic conditions (pH ≤ 3). Using available expression and transcription factor binding data, literature on transcriptional regulation, and known rules of promoter architecture we improved the low-pH performance of the YGP1 promoter by modifying transcription factor binding sites in its upstream activation sequence. The engineering strategy outlined for the YGP1 promoter was subsequently applied to create a response to low pH in the unrelated CCW14 promoter. We applied our best promoter variants to low-pH fermentations, enabling ten-fold increased production of lactic acid compared to titres obtained with the commonly used, native TEF1 promoter. Our findings outline and validate a general strategy to iteratively design and engineer synthetic yeast promoters inducible to environmental conditions or stresses of interest. PMID:27325743

  3. CTCF Mediates Effect of Insulin On Glucagon Expression

    PubMed Central

    Tsui, Shanli; Gao, Jie; Wang, Charles; Lu, Luo

    2013-01-01

    Pancreatic islet α-cell development and glucagon production are mainly regulated by Pax6 in the homeobox gene families. However, the molecular mechanism fine-tuning the regulation of these events in α-cell still remains unclear. In ocular cells, Pax6 transcription is regulated by CTCF through its binding to specific sites in Pax6 promoter. In this study, CTCF-mediated regulations of islet α-cell development and glucagon production were investigated in both CTCF transgenic mice and α-TC-1-6 cells. Over-expression of CTCF in transgenic mice affected development of pancreatic islets by significantly suppressing α-cell population in both embryonic and adult pancreases. The effect of CTCF on Pax6 gene expression and subsequently, on pro-glucagon production was however, examined in pancreatic islet α-cells. Over-expression and knock-down of CTCF directly affected Pax6 expression. More importantly, the CTCF binding sites upstream from Pax6 p0 promoter were required for regulating p0 promoter activity in islet α-cells. Stimulation of α-cells with insulin resulted in a significant increase in CTCF expression and a decrease in Pax6 expression, and consequently suppressed pro-glucagon expression. In contrast, these insulin-induced effects were blocked by knockdown of CTCF mRNA with specific siRNA in α-cells. Altogether, our results demonstrated for the first time that CTCF functions as a switch-like molecule between the insulin signaling and the regulations of Pax6 and glucagon expression in pancreatic islet α-cells. PMID:22426149

  4. Family 46 Carbohydrate-binding Modules Contribute to the Enzymatic Hydrolysis of Xyloglucan and β-1,3-1,4-Glucans through Distinct Mechanisms.

    PubMed

    Venditto, Immacolata; Najmudin, Shabir; Luís, Ana S; Ferreira, Luís M A; Sakka, Kazuo; Knox, J Paul; Gilbert, Harry J; Fontes, Carlos M G A

    2015-04-24

    Structural carbohydrates comprise an extraordinary source of energy that remains poorly utilized by the biofuel sector as enzymes have restricted access to their substrates within the intricacy of plant cell walls. Carbohydrate active enzymes (CAZYmes) that target recalcitrant polysaccharides are modular enzymes containing noncatalytic carbohydrate-binding modules (CBMs) that direct enzymes to their cognate substrate, thus potentiating catalysis. In general, CBMs are functionally and structurally autonomous from their associated catalytic domains from which they are separated through flexible linker sequences. Here, we show that a C-terminal CBM46 derived from BhCel5B, a Bacillus halodurans endoglucanase, does not interact with β-glucans independently but, uniquely, acts cooperatively with the catalytic domain of the enzyme in substrate recognition. The structure of BhCBM46 revealed a β-sandwich fold that abuts onto the region of the substrate binding cleft upstream of the active site. BhCBM46 as a discrete entity is unable to bind to β-glucans. Removal of BhCBM46 from BhCel5B, however, abrogates binding to β-1,3-1,4-glucans while substantially decreasing the affinity for decorated β-1,4-glucan homopolymers such as xyloglucan. The CBM46 was shown to contribute to xyloglucan hydrolysis only in the context of intact plant cell walls, but it potentiates enzymatic activity against purified β-1,3-1,4-glucans in solution or within the cell wall. This report reveals the mechanism by which a CBM can promote enzyme activity through direct interaction with the substrate or by targeting regions of the plant cell wall where the target glucan is abundant. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

    PubMed

    Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

    2011-02-24

    We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

  6. Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

    2013-03-29

    Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

  7. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  8. The human apolipoprotein AV gene is regulated by peroxisome proliferator-activated receptor-alpha and contains a novel farnesoid X-activated receptor response element.

    PubMed

    Prieur, Xavier; Coste, Herve; Rodriguez, Joan C

    2003-07-11

    The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.

  9. An Elk transcription factor is required for Runx-dependent survival signaling in the sea urchin embryo.

    PubMed

    Rizzo, Francesca; Coffman, James A; Arnone, Maria Ina

    2016-08-01

    Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W

    PubMed Central

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-01-01

    The INDUCER OF CBF EXPRESSION (ICE)–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several JASMONATE ZIM-DOMAIN (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884

  11. Jasmonate regulates the inducer of cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis.

    PubMed

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-08-01

    The inducer of cbf expression (ICE)-C-repeat binding factor/DRE binding factor1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several jasmonate ZIM-domain (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance.

  12. Expression of caveolin in trabecular meshwork cells and its possible implication in pathogenesis of primary open angle glaucoma

    PubMed Central

    Surgucheva, Irina

    2011-01-01

    Purpose Primary open-angle glaucoma (POAG), which is the most common form of glaucoma, has been associated with a heterogeneous genetic component. A genome-wide association study has identified a common sequence variant at 7q31 (rs4236601 [A]) near the caveolin genes in patients with POAG. Caveolins are a family of integral membrane proteins which participate in many cellular processes, including vesicular transport, cholesterol homeostasis, signal transduction, cell adhesion and migration. The goal of this study was to investigate the expression and regulation of caveolin 1 (CAV-1) and caveolin 2 (CAV-2) in normal and glaucoma trabecular meshwork (TM) cells. Methods CAV-1 and CAV-2 protein expression was quantified by immunoblot analysis using lysates isolated from primary and immortalized TM cells or TM tissue dissected from normal and POAG eyes. The localization of caveolins in TM cells was assessed by immunofluorescent microscopy. CAV-1 and CAV-2 protein expression was also investigated in TM cells at various time points after subjecting the cells to known glaucomatous insults like dexamethasone (DEX) and tumor growth factor beta2 (TGF-β2) treatment. Phosphorylation of CAV-1 at tyrosine 14 in normal and glaucoma TM cell lines was evaluated using a specific monoclonal antibody (Ab). The 5′ upstream region of the CAV-1 gene was amplified and the sequence variant rs4236601 (A/G polymorphic site) and several putative transcription factor-binding sites were modified by in vitro mutagenesis. The effect of nucleotide sequence modifications in the CAV-1 upstream region on gene expression was assayed in a luciferase-based system in TM and non-TM cells. Results CAV-1 and CAV-2 are expressed in TM cells, with localization to the cytoplasm and perinuclear region. DEX increased CAV-1 expression in immortalized glaucoma TM cells by 2.8±0.1 (n=3) fold at 24 h and 2.5±0.1 (n=3) fold at 48 h, compared to 1.3±0.06 (n=3) fold at 24 and 48 h in immortalized normal TM cells. Phosphorylation of CAV-1 at Tyr14 was reduced by 3.2±0.15 (n=3) fold in glaucomatous TM cells when compared to normal TM cells. In POAG and normal TM tissue, CAV-1 expression was found to be uniform. CAV-2, on the other hand, was variable in independent normal and glaucoma TM tissue. Substitution of a G for an A at base pair −2,388 upstream of the start codon of CAV-1, corresponding to the minor allele rs4236601 [A], increased transcriptional activity in TM and non-TM cells when compared to the native sequence. Deletion analysis of putative transcription factor binding sites in the CAV-1 promoter region caused cell-specific effects on gene expression. Conclusions CAV-1 and CAV-2 are expressed in normal and glaucoma tissue and TM cell lines. Phosphorylation of Tyr14 in CAV-1 and transcriptional regulation of CAV-1 expression may have a role in glaucomatous alterations in TM cells. PMID:22128235

  13. Eco-Design of River Fishways for Upstream Passage: Application for Hanfeng Dam, Pengxi River, China

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Gary E.; Rainey, William S.

    2012-05-20

    This paper provides a scientific approach to eco-design of river fishways to allow upstream movement of fish past new and existing dams in China. This eco-design approach integrates principles of fish ecology/behavior and engineering, a scientific field also known as bio-engineering or eco-hydraulics. We define a fishway as a structure or mechanism to convey fish upstream past a dam. Man-made or natural stream beds can be part of the fishway mechanism. Fish include bony and non-bony fishes, and upstream passage is the concern here, not downstream passage. The problem is dams block access to upstream habitat used for spawning, rearing,more » and refuge, i.e., dams decrease habitat connectivity. A solution to alleviate this problem is to design fishways, preferably while the dam is being designed, but if necessary, as retrofits afterward to provide a route that fish can and will use to pass safely upstream without undue delay. Our eco-design approach for fishways involves eight steps: 1) identify the primary species of importance; 2) understand basic ecology and behavior of these fish; 3) characterize the environmental conditions where passage is or will be blocked; 4 identify fishway alternatives and select a preferred alternative; 5) establish eco-design criteria for the fishway, either from management agencies or, if necessary, developed specifically for the given site; 6) where needed, identify and perform research required to resolve critical uncertainties and finalize the eco-design criteria; 7) apply the eco-design criteria and site-specific considerations to design the fishway, involving peer-review by local stakeholders in the process; 8) build the fishway, monitor its effectiveness, and apply the lessons learned. Example fishways are described showing a range of eco-designs depending on the dam site and fish species of concern. We apply the eco-design principles to recommend an approach and next steps for a fishway to pass fish upstream at Hanfeng Dam, an existing regulating dam forming Hanfeng Lake on the Pengxi River near Kaixian, China.« less

  14. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  15. Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk

    PubMed Central

    Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.

    2016-01-01

    It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407

  16. Comparative genomics of bacterial zinc regulons: enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins.

    PubMed

    Panina, Ekaterina M; Mironov, Andrey A; Gelfand, Mikhail S

    2003-08-19

    Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for gamma-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes.

  17. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less

  18. A Gibbs sampler for motif detection in phylogenetically close sequences

    NASA Astrophysics Data System (ADS)

    Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

    2004-03-01

    Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

  19. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  20. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

    PubMed Central

    Lu, X; Welsh, T M; Peterlin, B M

    1993-01-01

    The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  2. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  3. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  4. Effects of high salinity wastewater discharges on unionid mussels in the Allegheny River, Pennsylvania

    USGS Publications Warehouse

    Kathleen Patnode,; Hittle, Elizabeth A.; Robert Anderson,; Lora Zimmerman,; Fulton, John W.

    2015-01-01

    We examined the effect of high salinity wastewater (brine) from oil and natural gas drilling on freshwater mussels in the Allegheny River, Pennsylvania, during 2012. Mussel cages (N = 5 per site) were deployed at two sites upstream and four sites downstream of a brine treatment facility on the Allegheny River. Each cage contained 20 juvenile northern riffleshell mussels Epioblasma torulosa rangiana). Continuous specific conductance and temperature data were recorded by water quality probes deployed at each site. To measure the amount of mixing throughout the entire study area, specific conductance surveys were completed two times during low-flow conditions along transects from bank to bank that targeted upstream (reference) reaches, a municipal wastewater treatment plant discharge upstream of the brine-facility discharge, the brine facility, and downstream reaches. Specific conductance data indicated that high specific conductance water from the brine facility (4,000–12,000 µS/cm; mean 7,846) compared to the reference reach (103–188 µS/cm; mean 151) is carried along the left descending bank of the river and that dilution of the discharge via mixing does not occur until 0.5 mi (805 m) downstream. Juvenile northern riffleshell mussel survival was severely impaired within the high specific conductance zone (2 and 34% at and downstream of the brine facility, respectively) and at the municipal wastewater treatment plant (21%) compared to background (84%). We surveyed native mussels (family Unionidae) at 10 transects: 3 upstream, 3 within, and 4 downstream of the high specific conductance zone. Unionid mussel abundance and diversity were lower for all transects within and downstream of the high conductivity zone compared to upstream. The results of this study clearly demonstrate in situ toxicity to juvenile northern riffleshell mussels, a federally endangered species, and to the native unionid mussel assemblage located downstream of a brine discharge to the Allegheny River.

  5. ASR5 is involved in the regulation of miRNA expression in rice.

    PubMed

    Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

    2015-11-01

    The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

  6. Regulation of the sol Locus Genes for Butanol and Acetone Formation in Clostridium acetobutylicum ATCC 824 by a Putative Transcriptional Repressor

    PubMed Central

    Nair, Ramesh V.; Green, Edward M.; Watson, David E.; Bennett, George N.; Papoutsakis, Eleftherios T.

    1999-01-01

    A gene (orf1, now designated solR) previously identified upstream of the aldehyde/alcohol dehydrogenase gene aad (R. V. Nair, G. N. Bennett, and E. T. Papoutsakis, J. Bacteriol. 176:871–885, 1994) was found to encode a repressor of the sol locus (aad, ctfA, ctfB and adc) genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824. Primer extension analysis identified a transcriptional start site 35 bp upstream of the solR start codon. Amino acid comparisons of SolR identified a potential helix-turn-helix DNA-binding motif in the C-terminal half towards the center of the protein, suggesting a regulatory role. Overexpression of SolR in strain ATCC 824(pCO1) resulted in a solvent-negative phenotype owing to its deleterious effect on the transcription of the sol locus genes. Inactivation of solR in C. acetobutylicum via homologous recombination yielded mutants B and H (ATCC 824 solR::pO1X) which exhibited deregulated solvent production characterized by increased flux towards butanol and acetone formation, earlier induction of aad, lower overall acid production, markedly improved yields of solvents on glucose, a prolonged solvent production phase, and increased biomass accumulation compared to those of the wild-type strain. PMID:9864345

  7. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  8. GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

    EPA Science Inventory

    Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

  9. Identification of Natural RORγ Ligands that Regulate the Development of Lymphoid Cells

    PubMed Central

    Santori, Fabio R.; Huang, Pengxiang; van de Pavert, Serge A.; Douglass, Eugene F.; Leaver, David J.; Haubrich, Brad A.; Keber, Rok; Lorbek, Gregor; Konijn, Tanja; Rosales, Brittany N.; Horvat, Simon; Rozman, Damjana; Rahier, Alain; Mebius, Reina E.; Rastinejad, Fraydoon; Nes, W. David; Littman, Dan R.

    2015-01-01

    SUMMARY Mice deficient in the nuclear hormone receptor RORγt have defective development of thymocytes, lymphoid organs, Th17 cells and type 3 innate lymphoid cells. RORγt binds to oxysterols derived from cholesterol catabolism but it is not clear whether these are its natural ligands. Here, we show that sterol lipids are necessary and sufficient to drive RORγt-dependent transcription. We combined overexpression, RNA interference and genetic deletion of metabolic enzymes to study RORγ-dependent transcription. Our results are consistent with the RORγt ligand(s) being a cholesterol biosynthetic intermediate (CBI) downstream of lanosterol and upstream of zymosterol. Analysis of lipids bound to RORγ identified molecules with molecular weights consistent with CBIs. Furthermore, CBIs stabilized the RORγ ligand-binding domain and induced co-activator recruitment. Genetic deletion of metabolic enzymes upstream of the RORγt-ligand(s) affected the development of lymph nodes and Th17 cells. Our data suggest that CBIs play a role in lymphocyte development potentially through regulation of RORγt. PMID:25651181

  10. Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

    PubMed Central

    Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

    1993-01-01

    Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

  11. Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

    PubMed

    Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

    2018-05-03

    Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

  12. Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling

    PubMed Central

    Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf

    2010-01-01

    Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396

  13. Characterization of a spliced variant of human IRF-3 promoter and its regulation by the transcription factor Sp1.

    PubMed

    Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping

    2012-06-01

    Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.

  14. Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

    PubMed

    Leblanc, B; Read, C; Moss, T

    1993-02-01

    The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

  15. From Midges to Spiders: Mercury Biotransport in Riparian Zones Near the Buffalo River Area of Concern (AOC), USA.

    PubMed

    Pennuto, C M; Smith, M

    2015-12-01

    Riparian communities can receive environmental contaminants from adjacent aquatic 'donor' habitats. We investigated mercury biotransport from aquatic to terrestrial habitats via aquatic insect emergence and uptake by riparian spiders at sites within and upstream of the Buffalo River Area of Concern (AOC), a site with known sediment Hg contamination. Mercury concentration in emerging midges was roughly 10× less than contaminated sediment levels with the AOC, but biomagnification factors from midges to spiders ranged from 2.0 to 2.65 between sites. There was a significantly negative body mass:total mercury relationship in spiders (p < 0.001), indicating that mercury depuration is rapid or tissue dilution occurs in these riparian predators. Spiders contained significantly more mercury than their midge prey and spiders upstream of the AOC had higher mercury concentrations than spiders from within the AOC. Collectively, these data indicate that riparian spiders can be good mercury sentinels in urban environments, and that riparian communities upstream from the AOC may be at greater risk to mercury than has been previously considered.

  16. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  17. A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

    PubMed

    Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

    2004-07-01

    The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

  18. The AIRE -230Y Polymorphism Affects AIRE Transcriptional Activity: Potential Influence on AIRE Function in the Thymus.

    PubMed

    Lovewell, Thomas R J; McDonagh, Andrew J; Messenger, Andrew G; Azzouz, Mimoun; Tazi-Ahnini, Rachid

    2015-01-01

    The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions.

  19. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  20. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  1. Assessing potential effects of highway runoff on receiving-water quality at selected sites in Oregon with the Stochastic Empirical Loading and Dilution Model (SELDM)

    USGS Publications Warehouse

    Risley, John C.; Granato, Gregory E.

    2014-01-01

    6. An analysis of the use of grab sampling and nonstochastic upstream modeling methods was done to evaluate the potential effects on modeling outcomes. Additional analyses using surrogate water-quality datasets for the upstream basin and highway catchment were provided for six Oregon study sites to illustrate the risk-based information that SELDM will produce. These analyses show that the potential effects of highway runoff on receiving-water quality downstream of the outfall depends on the ratio of drainage areas (dilution), the quality of the receiving water upstream of the highway, and the concentration of the criteria of the constituent of interest. These analyses also show that the probability of exceeding a water-quality criterion may depend on the input statistics used, thus careful selection of representative values is important.

  2. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    PubMed

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  3. Responses of macroinvertebrate community metrics to a wastewater discharge in the Upper Blue River of Kansas and Missouri, USA

    USGS Publications Warehouse

    Poulton, Barry C.; Graham, Jennifer L.; Rasmussen, Teresa J.; Stone, Mandy L.

    2015-01-01

    The Blue River Main wastewater treatment facility (WWTF) discharges into the upper Blue River (725 km2), and is recently upgraded to implement biological nutrient removal. We measured biotic condition upstream and downstream of the discharge utilizing the macroinvertebrate protocol developed for Kansas streams. We examined responses of 34 metrics to determine the best indicators for discriminating site differences and for predicting biological condition. Significant differences between sites upstream and downstream of the discharge were identified for 15 metrics in April and 12 metrics in August. Upstream biotic condition scores were significantly greater than scores at both downstream sites in April (p = 0.02), and in August the most downstream site was classified as non-biologically supporting. Thirteen EPT taxa (Ephemeroptera, Plecoptera, Trichoptera) considered intolerant of degraded stream quality were absent at one or both downstream sites. Increases in tolerance metrics and filtering macroinvertebrates, and a decline in ratio of scrapers to filterers all indicated effects of increased nutrient enrichment. Stepwise regressions identified several significant models containing a suite of metrics with low redundancy (R2 = 0.90 - 0.99). Based on the rapid decline in biological condition downstream of the discharge, the level of nutrient removal resulting from the facility upgrade (10% - 20%) was not enough to mitigate negative effects on macroinvertebrate communities.

  4. Occurrence of polycyclic aromatic hydrocarbons below coal-tar-sealed parking lots and effects on stream benthic macroinvertebrate communities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scoggins, M.; McClintock, N.L.; Gosselink, L.

    2007-12-15

    Parking-lot pavement sealants recently have been recognized as a major source of polycyclic aromatic hydrocarbons (PAHs) in urban stream sediments in Austin, Texas. Laboratory and field studies have shown that PAHs in sediments can be toxic to aquatic organisms and can degrade aquatic communities. After identifying increases in concentrations of PAHs in sediments below seal-coated parking lots, we investigated whether the increases had significant effects on stream biota in 5 Austin streams. We sampled sediment chemistry and biological communities above and below the point at which stormwater runoff from the parking lots discharged into the streams, thus providing 5 upstreammore » reference sites and 5 downstream treatment sites. Differences between upstream and downstream concentrations of total PAH ranged from 3.9 to 32 mg/kg. Analysis of the species occurrence data from pool and riffle habitats indicated a significant decrease in community health at the downstream sites, including decreases in richness, intolerant taxa, Diptera taxa, and density. In pool sediments, Chironomidae density was negatively correlated with PAH concentrations, whereas Oligochaeta density responded positively to PAH concentrations. In general, pool taxa responded more strongly than riffle taxa to PAHs, but riffle taxa responded more broadly than pool taxa. Increases in PAH sediment-toxicity units between upstream and downstream sites explained decreases in taxon richness and density in pools between upstream and downstream sites.« less

  5. Antibiotic resistance of native and faecal bacteria isolated from rivers, reservoirs and sewage treatment facilities in Victoria, south-eastern Australia.

    PubMed

    Boon, P I; Cattanach, M

    1999-03-01

    The incidence of resistance to ampicillin, chloramphenicol, kanamycin, nalidixic acid, neomycin and streptomycin was significantly greater (P < 0.001) in native heterotrophic bacteria than in Escherichia coli isolated from a range of sites along the Yarra River in south-eastern Australia. There was no significant difference in the incidence of resistance between native and faecal bacteria to tetracycline. Both groups were almost totally resistant to penicillin. Multivariate analyses indicated little clear spatial pattern in the incidence of resistance in native bacteria from upstream vs downstream sites along the Yarra River. In contrast, E. coli isolated from upstream (rural) sites tended to have a lower incidence of resistance than isolates from downstream (urban) sites. These findings have implications for the use of antibiotic resistance as a bacteriological water quality parameter.

  6. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  7. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  8. FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

    PubMed

    Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

    2018-04-01

    The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Estimation of constituent concentrations, densities, loads, and yields in lower Kansas River, northeast Kansas, using regression models and continuous water-quality monitoring, January 2000 through December 2003

    USGS Publications Warehouse

    Rasmussen, Teresa J.; Ziegler, Andrew C.; Rasmussen, Patrick P.

    2005-01-01

    The lower Kansas River is an important source of drinking water for hundreds of thousands of people in northeast Kansas. Constituents of concern identified by the Kansas Department of Health and Environment (KDHE) for streams in the lower Kansas River Basin include sulfate, chloride, nutrients, atrazine, bacteria, and sediment. Real-time continuous water-quality monitors were operated at three locations along the lower Kansas River from July 1999 through September 2004 to provide in-stream measurements of specific conductance, pH, water temperature, turbidity, and dissolved oxygen and to estimate concentrations for constituents of concern. Estimates of concentration and densities were combined with streamflow to calculate constituent loads and yields from January 2000 through December 2003. The Wamego monitoring site is located 44 river miles upstream from the Topeka monitoring site, which is 65 river miles upstream from the DeSoto monitoring site, which is 18 river miles upstream from where the Kansas River flows into the Missouri River. Land use in the Kansas River Basin is dominated by grassland and cropland, and streamflow is affected substantially by reservoirs. Water quality at the three monitoring sites varied with hydrologic conditions, season, and proximity to constituent sources. Nutrient and sediment concentrations and bacteria densities were substantially larger during periods of increased streamflow, indicating important contributions from nonpoint sources in the drainage basin. During the study period, pH remained well above the KDHE lower criterion of 6.5 standard units at all sites in all years, but exceeded the upper criterion of 8.5 standard units annually between 2 percent of the time (Wamego in 2001) and 65 percent of the time (DeSoto in 2003). The dissolved oxygen concentration was less than the minimum aquatic-life-support criterion of 5.0 milligrams per liter less than 1 percent of the time at all sites. Dissolved solids, a measure of the dissolved material in water, exceeded 500 milligrams per liter about one-half of the time at the three Kansas River sites. Larger dissolved-solids concentrations upstream likely were a result of water inflow from the highly mineralized Smoky Hill River that is diluted by tributary flow as it moves downstream. Concentrations of total nitrogen and total phosphorus at the three monitoring sites exceeded the ecoregion water-quality criteria suggested by the U.S. Environmental Protection Agency during the entire study period. Median nitrogen and phosphorus concentrations were similar at all three sites, and nutrient load increased moving from the upstream to downstream sites. Total nitrogen and total phosphorus yields were nearly the same from site to site indicating that nutrient sources were evenly distributed throughout the lower Kansas River Basin. About 11 percent of the total nitrogen load and 12 percent of the total phosphorus load at DeSoto during 2000-03 originated from wastewater-treatment facilities. Escherichia coli bacteria densities were largest at the middle site, Topeka. On average, 83 percent of the annual bacteria load at DeSoto during 2000-03 occurred during 10 percent of the time, primarily in conjunction with runoff. The average annual sediment loads at the middle and downstream monitoring sites (Topeka and DeSoto) were nearly double those at the upstream site (Wamego). The average annual sediment yield was largest at Topeka. On average, 64 percent of the annual suspended-sediment load at DeSoto during 2000-03 occurred during 10 percent of the time. Trapping of sediment by reservoirs located on contributing tributaries decreases transport of sediment and sediment-related constituents. The average annual suspended-sediment load in the Kansas River at DeSoto during 2000-03 was estimated at 1.66 million tons. An estimated 13 percent of this load consisted of sand-size particles, so approximately 216,000 tons of sand were transported

  10. CcpA and CodY Coordinate Acetate Metabolism in Streptococcus mutans.

    PubMed

    Kim, Jeong Nam; Burne, Robert A

    2017-04-01

    In the dental caries pathogen Streptococcus mutans , phosphotransacetylase (Pta) and acetate kinase (Ack) convert pyruvate into acetate with the concomitant generation of ATP. The genes for this pathway are tightly regulated by multiple environmental and intracellular inputs, but the basis for differential expression of the genes for Pta and Ack in S. mutans had not been investigated. Here, we show that inactivation in S. mutans of ccpA or codY reduced the activity of the ackA promoter, whereas a ccpA mutant displayed elevated pta promoter activity. The interactions of CcpA with the promoter regions of both genes were observed using electrophoretic mobility shift and DNase protection assays. CodY bound to the ackA promoter region but only in the presence of branched-chain amino acids (BCAAs). DNase footprinting revealed that the upstream region of both genes contains two catabolite-responsive elements ( cre1 and cre2 ) that can be bound by CcpA. Notably, the cre2 site of ackA overlaps with a CodY-binding site. The CcpA- and CodY-binding sites in the promoter region of both genes were further defined by site-directed mutagenesis. Some differences between the reported consensus CodY binding site and the region protected by S. mutans CodY were noted. Transcription of the pta and ackA genes in the ccpA mutant strain was markedly different at low pH relative to transcription at neutral pH. Thus, CcpA and CodY are direct regulators of transcription of ackA and pta in S. mutans that optimize acetate metabolism in response to carbohydrate, amino acid availability, and environmental pH. IMPORTANCE The human dental caries pathogen Streptococcus mutans is remarkably adept at coping with extended periods of carbohydrate limitation during fasting periods. The phosphotransacetylase-acetate kinase (Pta-Ack) pathway in S. mutans modulates carbohydrate flux and fine-tunes the ability of the organisms to cope with stressors that are commonly encountered in the oral cavity. Here, we show that CcpA controls transcription of the pta and ackA genes via direct interaction with the promoter regions of both genes and that branched-chain amino acids (BCAAs), particularly isoleucine, enhance the ability of CodY to bind to the promoter region of the ackA gene. A working model is proposed to explain how regulation of pta and ackA genes by these allosterically controlled regulatory proteins facilitates proper carbon flow and energy production, which are essential functions during infection and pathogenesis as carbohydrate and amino acid availability continually fluctuate. Copyright © 2017 American Society for Microbiology.

  11. Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

    PubMed Central

    Yoder-Himes, Deborah R.; Kroos, Lee

    2006-01-01

    The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

  12. Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

    PubMed Central

    2014-01-01

    Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

  13. Survival, growth, and movement of subadult humpback chub, Gila cypha, in the Little Colorado River, Arizona

    USGS Publications Warehouse

    Dzul, Maria C.; Yackulic, Charles B.; Stone, Dennis M.; Van Haverbeke, David R.

    2016-01-01

    Ecologists estimate vital rates, such as growth and survival, to better understand population dynamics and identify sensitive life history parameters for species or populations of concern. Here, we assess spatiotemporal variation in growth, movement, density, and survival of subadult humpback chub living in the Little Colorado River, Grand Canyon, AZ from 2001–2002 and 2009–2013. We divided the Little Colorado River into three reaches and used a multistate mark-recapture model to determine rates of movement and differences in survival and density between sites for different cohorts. Additionally, site-specific and year-specific effects on growth were evaluated using a linear model. Results indicate that summer growth was higher for upstream sites compared with downstream sites. In contrast, there was not a consistent spatial pattern across years in winter growth; however, river-wide winter growth was negatively related to the duration of floods from 1 October to 15 May. Apparent survival was estimated to be lower at the most downstream site compared with the upstream sites; however, this could be because in part of increased emigration into the Colorado River at downstream sites. Furthermore, the 2010 cohort (i.e. fish that are age 1 in 2010) exhibited high apparent survival relative to other years. Movement between reaches varied with year, and some years exhibited preferential upstream displacement. Improving understanding of spatiotemporal effects on age 1 humpback chub survival can help inform current management efforts to translocate humpback chub into new locations and give us a better understanding of the factors that may limit this tributary's carrying capacity for humpback chub.

  14. Does biofilm contribute to diel cycling of Zn in High Ore Creek, Montana?

    USGS Publications Warehouse

    Morris, J.M.; Nimick, D.A.; Farag, A.M.; Meyer, J.S.

    2005-01-01

    Concentrations of metals cycle daily in the water column of some mining-impacted streams in the Rocky Mountains of the western USA. We hypothesized that biofilm in High Ore Creek, Montana, USA, sorbs and releases Zn on a diel cycle, and this uptake-and-release cycle controls the total and dissolved (0.45-??m filtered) Zn concentrations. We collected water samples from three sites (upstream, middle and downstream at 0, 350 and 650 m, respectively) along a 650-m reach of High Ore Creek during a 47-h period in August 2002 and from the upstream and downstream sites during a 24-h period in August 2003; we also collected biofilm samples at these sites. In 2002 and 2003, total and dissolved Zn concentrations did not exhibit a diel cycle at the upstream sampling site, which was ???30 m downstream from a settling pond through which the creek flows. However, total and dissolved Zn concentrations exhibited a diel cycle at the middle and downstream sampling sites, with the highest Zn concentrations occurring at dawn and the lowest Zn concentrations occurring during late afternoon (>2-fold range of concentrations at the downstream site). Based on (1) concentrations of Zn in biofilm at the three sites and (2) results of streamside experiments that demonstrated Zn uptake and release by nai??ve biofilm during the light and dark hours of a photocycle, respectively, we conclude that Zn uptake in photosynthetic biofilms could contribute a large percentage to the cycling of Zn concentrations in the water column in High Ore Creek. ?? Springer 2005.

  15. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  16. Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

    2006-07-07

    In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

  17. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  18. Small RNAs Targeting Transcription Start Site Induce Heparanase Silencing through Interference with Transcription Initiation in Human Cancer Cells

    PubMed Central

    Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong

    2012-01-01

    Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID:22363633

  19. Role for cis-acting RNA sequences in the temperature-dependent expression of the multiadhesive lig proteins in Leptospira interrogans.

    PubMed

    Matsunaga, James; Schlax, Paula J; Haake, David A

    2013-11-01

    The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double-stranded RNA that occludes the ribosome-binding site. At elevated temperatures, the ribosome-binding site is exposed to promote translation initiation.

  20. Functional Analysis of a Novel Genome-Wide Association Study Signal in SMAD3 That Confers Protection From Coronary Artery Disease.

    PubMed

    Turner, Adam W; Martinuk, Amy; Silva, Anada; Lau, Paulina; Nikpay, Majid; Eriksson, Per; Folkersen, Lasse; Perisic, Ljubica; Hedin, Ulf; Soubeyrand, Sebastien; McPherson, Ruth

    2016-05-01

    A recent genome-wide association study meta-analysis identified an intronic single nucleotide polymorphism in SMAD3, rs56062135C>T, the minor allele (T) which associates with protection from coronary artery disease. Relevant to atherosclerosis, SMAD3 is a key contributor to transforming growth factor-β pathway signaling. Here, we seek to identify ≥1 causal coronary artery disease-associated single nucleotide polymorphisms at the SMAD3 locus and characterize mechanisms whereby the risk allele(s) contribute to coronary artery disease risk. By genetic and epigenetic fine mapping, we identified a candidate causal single nucleotide polymorphism rs17293632C>T (D', 0.97; r(2), 0.94 with rs56062135) in intron 1 of SMAD3 with predicted functional effects. We show that the sequence encompassing rs17293632 acts as a strong enhancer in human arterial smooth muscle cells. The common allele (C) preserves an activator protein (AP)-1 site and enhancer function, whereas the protective (T) allele disrupts the AP-1 site and significantly reduces enhancer activity (P<0.001). Pharmacological inhibition of AP-1 activity upstream demonstrates that this allele-specific enhancer effect is AP-1 dependent (P<0.001). Chromatin immunoprecipitation experiments reveal binding of several AP-1 component proteins with preferential binding to the (C) allele. We show that rs17293632 is an expression quantitative trait locus for SMAD3 in blood and atherosclerotic plaque with reduced expression of SMAD3 in carriers of the protective allele. Finally, siRNA knockdown of SMAD3 in human arterial smooth muscle cells increases cell viability, consistent with an antiproliferative role. The coronary artery disease-associated rs17293632C>T single nucleotide polymorphism represents a novel functional cis-acting element at the SMAD3 locus. The protective (T) allele of rs17293632 disrupts a consensus AP-1 binding site in a SMAD3 intron 1 enhancer, reduces enhancer activity and SMAD3 expression, altering human arterial smooth muscle cell proliferation. © 2016 American Heart Association, Inc.

  1. Circuitry linking the global Csr and σE-dependent cell envelope stress response systems.

    PubMed

    Yakhnin, Helen; Aichele, Robert; Ades, Sarah E; Romeo, Tony; Babitzke, Paul

    2017-09-18

    CsrA of Escherichia coli is an RNA-binding protein that globally regulates a wide variety of cellular processes and behaviors including carbon metabolism, motility, biofilm formation, and the stringent response. CsrB and CsrC are sRNAs that sequester CsrA, thereby preventing CsrA-mRNA interaction. RpoE (σ E ) is the extracytoplasmic stress response sigma factor of E. coli Previous RNA-seq studies identified rpoE mRNA as a CsrA target. Here we explored the regulation of rpoE by CsrA and found that CsrA represses rpoE translation. Gel mobility shift, footprint and toeprint studies identified three CsrA binding sites in the rpoE leader transcript, one of which overlaps the rpoE Shine-Dalgarno (SD) sequence, while another overlaps the rpoE translation initiation codon. Coupled in vitro transcription-translation experiments showed that CsrA represses rpoE translation by binding to these sites. We further demonstrate that σ E indirectly activates transcription of csrB and csrC , leading to increased sequestration of CsrA such that repression of rpoE by CsrA is reduced. We propose that the Csr system fine-tunes the σ E -dependent cell envelope stress response. We also identified a 51 amino acid coding sequence whose stop codon overlaps the rpoE start codon, and demonstrate that rpoE is translationally coupled with this upstream open reading frame (ORF51). Loss of coupling reduces rpoE translation by more than 50%. Identification of a translationally coupled ORF upstream of rpoE suggests that this previously unannotated protein may participate in the cell envelope stress response. In keeping with existing nomenclature, we name ORF51 as rseD , resulting in an operon arrangement of rseD-rpoE-rseA-rseB-rseC IMPORTANCE CsrA posttranscriptionally represses genes required for bacterial stress responses, including the stringent response, catabolite repression, and the RpoS (σ S )-mediated general stress response. We show that CsrA represses translation of rpoE , encoding the extracytoplasmic stress response sigma factor and that σ E indirectly activates transcription of csrB and csrC , resulting in reciprocal regulation of these two global regulatory systems. These findings suggest that extracytoplasmic stress leads to derepression of rpoE translation by CsrA, and CsrA-mediated repression helps to reset RpoE abundance to pre-stress levels once envelope damage is repaired. The discovery of an ORF, RseD, translationally coupled with rpoE adds further complexity to translational control of rpoE . Copyright © 2017 American Society for Microbiology.

  2. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  3. A genetic screen for terminator function in yeast identifies a role for a new functional domain in termination factor Nab3

    PubMed Central

    Loya, Travis J.; O’Rourke, Thomas W.; Reines, Daniel

    2012-01-01

    The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 ‘tail’ forms an α-helical multimerization domain that helps assemble it onto an RNA substrate. PMID:22564898

  4. New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

    PubMed

    Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

    2015-09-01

    Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

  5. Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

    PubMed Central

    Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

    2007-01-01

    Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

  6. Activity of the Rhodopseudomonas palustris p-Coumaroyl-Homoserine Lactone-Responsive Transcription Factor RpaR ▿ †

    PubMed Central

    Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter

    2011-01-01

    The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182

  7. RNA chaperone activity of human La protein is mediated by variant RNA recognition motif.

    PubMed

    Naeeni, Amir R; Conte, Maria R; Bayfield, Mark A

    2012-02-17

    La proteins are conserved factors in eukaryotes that bind and protect the 3' trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3'OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3'OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets.

  8. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  9. Neglected sources of pharmaceuticals in river water--footprints of a Reggae festival.

    PubMed

    Daneshvar, Atlasi; Svanfelt, Jesper; Kronberg, Leif; Weyhenmeyer, Gesa A

    2012-02-01

    Wastewater treatment plants (WWTPs) are commonly considered as the main source of pharmaceuticals in surface waters. Here, however, we show that an open-air festival, attracting approximately 10,000 visitors per year at the shores of River Fyris upstream of Uppsala WWTP, can temporarily result in a higher pharmaceutical input into the river water than the WWTP. Studying the influence of Uppsala Reggae festival on the occurrence of ten commonly used acidic and basic pharmaceuticals upstream, in the effluent, and downstream of the Uppsala WWTP, we found that occasional heavy rainfalls during the festival in 2008 severely increased the mass flows of all pharmaceuticals at the WWTP upstream site. Also, strong increases in ammonium (210-fold), nitrate (21-fold), and total nitrogen (21-fold) mass flows were observed. The pharmaceutical mass flows at the upstream site were up to 3.4 times higher than those observed in the WWTP effluent. In contrast, in 2009, the festival was not accompanied with rainfalls and no major additional input of pharmaceuticals and nitrogen was observed. The findings of this study give new insights into risk assessments and are relevant for monitoring programmes.

  10. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  11. Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

    USGS Publications Warehouse

    Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

    2011-01-01

    Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

  12. Change in the Structure of Escherichia coli Population and the Pattern of Virulence Genes along a Rural Aquatic Continuum

    PubMed Central

    Petit, Fabienne; Clermont, Olivier; Delannoy, Sabine; Servais, Pierre; Gourmelon, Michèle; Fach, Patrick; Oberlé, Kenny; Fournier, Matthieu; Denamur, Erick; Berthe, Thierry

    2017-01-01

    The aim of this study was to investigate the diversity of the Escherichia coli population, focusing on the occurrence of pathogenic E. coli, in surface water draining a rural catchment. Two sampling campaigns were carried out in similar hydrological conditions (wet period, low flow) along a river continuum, characterized by two opposite density gradients of animals (cattle and wild animals) and human populations. While the abundance of E. coli slightly increased along the river continuum, the abundance of both human and ruminant-associated Bacteroidales markers, as well as the number of E. coli multi-resistant to antibiotics, evidenced a fecal contamination originating from animals at upstream rural sites, and from humans at downstream urban sites. A strong spatial modification of the structure of the E. coli population was observed. At the upstream site close to a forest, a higher abundance of the B2 phylogroup and Escherichia clade strains were observed. At the pasture upstream site, a greater proportion of both E and B1 phylogroups was detected, therefore suggesting a fecal contamination of mainly bovine origin. Conversely, in downstream urban sites, A, D, and F phylogroups were more abundant. To assess the occurrence of intestinal pathogenic strains, virulence factors [afaD, stx1, stx2, eltB (LT), estA (ST), ipaH, bfpA, eae, aaiC and aatA] were screened among 651 E. coli isolates. Intestinal pathogenic strains STEC O174:H21 (stx2) and EHEC O26:H11 (eae, stx1) were isolated in water and sediments close to the pasture site. In contrast, in the downstream urban site aEPEC/EAEC and DAEC of human origin, as well as extra-intestinal pathogenic E. coli belonging to clonal group A of D phylogroup, were sampled. Even if the estimated input of STEC (Shiga toxin-producing E. coli) – released in water at the upstream pasture site – at the downstream site was low, we show that STEC could persist in sediment. These results show that, the run-off of small cattle farms contributed, as much as the wastewater effluent, in the dissemination of pathogenic E. coli in both water and sediments, even if the microbiological quality of the water was good or to average quality according to the French water index. PMID:28458656

  13. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  14. Transcriptional deregulation of homeobox gene ZHX2 in Hodgkin lymphoma.

    PubMed

    Nagel, Stefan; Schneider, Björn; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; Macleod, Roderick A F

    2012-05-01

    Recently, we identified a novel chromosomal rearrangement in Hodgkin lymphoma (HL), t(4;8)(q27;q24), which targets homeobox gene ZHX2 at the recurrent breakpoint 8q24. This aberration deletes the far upstream region of ZHX2 and results in silenced transcription pinpointing loss of activatory elements. Here, we have looked for potential binding sites within this deleted region to analyze the transcriptional deregulation of this tumor suppressor gene in B-cell malignancies. SiRNA-mediated knockdown and reporter gene analyses identified two transcription factors, homeodomain protein MSX1 and bZIP protein XBP1, directly regulating ZHX2 expression. Furthermore, MSX1-cofactor histone H1C mediated repression of ZHX2 and showed enhanced expression levels in cell line L-1236. As demonstrated by fluorescence in situ hybridization and genomic array analysis, the gene loci of MSX1 at 4p16 and H1C at 6p22 were rearranged in several HL cell lines, correlating with their altered expression activity. The expression of XBP1 was reduced in 6/7 HL cell lines as compared to primary hematopoietic cells. Taken together, our results demonstrate multiple mechanisms decreasing expression of tumor suppressor gene ZHX2 in HL cell lines: loss of enhancing binding sites, reduced expression of activators MSX1 and XBP1, and overexpression of MSX1-corepressor H1C. Moreover, chromosomal deregulations of genes involved in this regulative network highlight their role in development and malignancy of B-cells. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Photofrin binds to procaspase-3 and mediates photodynamic treatment-triggered methionine oxidation and inactivation of procaspase-3

    PubMed Central

    Hsieh, Y-J; Chien, K-Y; Lin, S-Y; Sabu, S; Hsu, R-M; Chi, L-M; Lyu, P-C; Yu, J-S

    2012-01-01

    Diverse death phenotypes of cancer cells can be induced by Photofrin-mediated photodynamic therapy (PDT), which has a decisive role in eliciting a tumor-specific immunity for long-term tumor control. However, the mechanism(s) underlying this diversity remain elusive. Caspase-3 is a critical factor in determining cell death phenotypes in many physiological settings. Here, we report that Photofrin-PDT can modify and inactivate procaspase-3 in cancer cells. In cells exposed to an external apoptotic trigger, high-dose Photofrin-PDT pretreatment blocked the proteolytic activation of procaspase-3 by its upstream caspase. We generated and purified recombinant procaspase-3-D3A (a mutant without autolysis/autoactivation activity) to explore the underlying mechanism(s). Photofrin could bind directly to procaspase-3-D3A, and Photofrin-PDT-triggered inactivation and modification of procaspase-3-D3A was seen in vitro. Mass spectrometry-based quantitative analysis for post-translational modifications using both 16O/18O- and 14N/15N-labeling strategies revealed that Photofrin-PDT triggered a significant oxidation of procaspase-3-D3A (mainly on Met-27, -39 and -44) in a Photofrin dose-dependent manner, whereas the active site Cys-163 remained largely unmodified. Site-directed mutagenesis experiments further showed that Met-44 has an important role in procaspase-3 activation. Collectively, our results reveal that Met oxidation is a novel mechanism for the Photofrin-PDT-mediated inactivation of procaspase-3, potentially explaining at least some of the complicated cell death phenotypes triggered by PDT. PMID:22785533

  16. Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.

    PubMed

    Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram

    2008-08-01

    Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.

  17. Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

    PubMed

    Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

    2017-08-01

    The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

  18. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-11-11

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

  19. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed Central

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-01-01

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

  20. RNA Editing and Its Molecular Mechanism in Plant Organelles

    PubMed Central

    Ichinose, Mizuho; Sugita, Mamoru

    2016-01-01

    RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

  1. Engineered stabilization and structural analysis of the autoinhibited conformation of PDE4

    DOE PAGES

    Cedervall, Peder; Aulabaugh, Ann; Geoghegan, Kieran F.; ...

    2015-03-09

    Phosphodiesterase 4 (PDE4) is an essential contributor to intracellular signaling and an important drug target. The four members of this enzyme family (PDE4A to -D) are functional dimers in which each subunit contains two upstream conserved regions (UCR), UCR1 and -2, which precede the C-terminal catalytic domain. Alternative promoters, transcriptional start sites, and mRNA splicing lead to the existence of over 25 variants of PDE4, broadly classified as long, short, and supershort forms. We report the X-ray crystal structure of long form PDE4B containing UCR1, UCR2, and the catalytic domain, crystallized as a dimer in which a disulfide bond cross-linksmore » cysteines engineered into UCR2 and the catalytic domain. Biochemical and mass spectrometric analyses showed that the UCR2-catalytic domain interaction occurs in trans, and established that this interaction regulates the catalytic activity of PDE4. By elucidating the key structural determinants of dimerization, we show that only long forms of PDE4 can be regulated by this mechanism. The results also provide a structural basis for the long-standing observation of high- and low-affinity binding sites for the prototypic inhibitor rolipram.« less

  2. Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

    PubMed Central

    Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

    2007-01-01

    Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

  3. Genome and epigenome analysis of monozygotic twins discordant for congenital heart disease.

    PubMed

    Lyu, Guoliang; Zhang, Chao; Ling, Te; Liu, Rui; Zong, Le; Guan, Yiting; Huang, Xiaoke; Sun, Lei; Zhang, Lijun; Li, Cheng; Nie, Yu; Tao, Wei

    2018-06-04

    Congenital heart disease (CHD) is the leading non-infectious cause of death in infants. Monozygotic (MZ) twins share nearly all of their genetic variants before and after birth. Nevertheless, MZ twins are sometimes discordant for common complex diseases. The goal of this study is to identify genomic and epigenomic differences between a pair of twins discordant for a form of congenital heart disease, double outlet right ventricle (DORV). A monoamniotic monozygotic (MZ) twin pair discordant for DORV were subjected to genome-wide sequencing and methylation analysis. We identified few genomic differences but 1566 differentially methylated regions (DMRs) between the MZ twins. Twenty percent (312/1566) of the DMRs are located within 2 kb upstream of transcription start sites (TSS), containing 121 binding sites of transcription factors. Particularly, ZIC3 and NR2F2 are found to have hypermethylated promoters in both the diseased twin and additional patients suffering from DORV. The results showed a high correlation between hypermethylated promoters at ZIC3 and NR2F2 and down-regulated gene expression levels of these two genes in patients with DORV compared to normal controls, providing new insight into the potential mechanism of this rare form of CHD.

  4. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  5. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  6. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  8. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  9. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  10. Effects of urbanization on water quality in the Kansas River, Shunganunga Creek Basin, and Soldier Creek, Topeka, Kansas, October 1993 through September 1995

    USGS Publications Warehouse

    Pope, L.M.; Putnam, J.E.

    1997-01-01

    A study of urban-related water-qulity effects in the Kansas River, Shunganunga Creek Basin, and Soldier Creek in Topeka, Kansas, was conducted from October 1993 through September 1995. The purpose of this report is to assess the effects of urbanization on instream concentrations of selected physical and chemical constituents within the city of Topeka. A network of seven sampling sites was established in the study area. Samples principally were collected at monthly intervals from the Kansas River and from the Shunganunga Creek Basin, and at quarterly intervals from Soldier Creek. The effects of urbanization werestatistically evaluated from differences in constituent concentrations between sites on the same stream. No significant differences in median concentrations of dissolved solids, nutrients, or metals and trace elements, or median densities offecal bacteria were documented between sampling sites upstream and downstream from the major urbanized length of the Kansas River in Topeka.Discharge from the city's primary wastewater- treatment plant is the largest potential source of contamination to the Kansas River. This discharge increased concentrations of dissolved ammonia, totalphosphorus, and densities of fecal bacteria.Calculated dissolved ammonia as nitrogen concentrations in water from the Kansas River ranged from 0.03 to 1.1 milligrams per liter after receiving treatment-plant discharge. However, most of the calculated concentrations wereconsiderably less than 50 percent of Kansas Department of Health and Environment water- quality criteria, with a median value of 20 percent.Generally, treatment-plant discharge increased calculated total phosphorus concentrations in water from the Kansas River by 0.01 to 0.04 milligrams per liter, with a median percentage increase of 7.6 percent. The calculated median densities of fecal coliform and fecal Streptococci bacteria in water from the Kansas River increased from 120 and 150colonies per 100 milliliters of water, respectively, before treatment-plant discharge to a calculated 4,900 and 4,700 colonies per 100 milliliters of water, respectively, after discharge. Median concentrations of dissolved solids were not significantly different between three sampling sites in the Shunganunga Creek Basin. Median concentrations of dissolved nitrate as nitrogen, total phosphorus, and dissolved orthophosphate were significantly larger in water from the upstream- most Shunganunga Creek sampling site than in water from either of the other sampling sites in the Shunganunga Creek Basin probably because of the site's proximity to a wastewater-treatment plant.Median concentrations of dissolved nitrate as nitrogen and total phosphorus during 1993-95 at upstream sampling sites were either significantlylarger than during 1979-81 in response to increase of wastewater-treatment plant discharge or smaller because of the elimination of wastewater-treatment plant discharge. Median concentrations of dissolved ammonia as nitrogen were significantly less during 1993-95 than during 1979-81. Median concentrations of total aluminum, iron, maganese, and molybdenum were significantly larger in water from the downstream-mostShunganunga Creek sampling site than in water from the upstream-most sampling site. This probably reflects their widespread use in the urbanenvironment between the upstream and downstream Shunganunga Creek sampling sites. Little water-quality effect from the urbanization was indicated by results from the Soldier Creek sampling site. Median concentrations of most water-quality constituents in water from this sampling site were the smallest in water from any sampling site in the study area. Herbicides were detected in water from all sampling sites. Some of the more frequently detected herbicides included acetochlor, alachlor,atrazine, cyanazine, EPTC, metolachlor, prometon, simazine, and tebuthiuron. Detected insecticides including chlordane,

  11. Transforming Growth Factor-β/SMAD Target Gene SKIL Is Negatively Regulated by the Transcriptional Cofactor Complex SNON-SMAD4*

    PubMed Central

    Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-01-01

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574

  12. The phzA2-G2 Transcript Exhibits Direct RsmA-Mediated Activation in Pseudomonas aeruginosa M18

    PubMed Central

    Ren, Bin; Shen, Huifeng; Lu, Zhi John; Liu, Haiming; Xu, Yuquan

    2014-01-01

    In bacteria, RNA-binding proteins of the RsmA/CsrA family act as post-transcriptional regulators that modulate translation initiation at target transcripts. The Pseudomonas aeruginosa genome contains two phenazine biosynthetic (phz) gene clusters, phzA1-G1 (phz1) and phzA2-G2 (phz2), each of which is responsible for phenazine-1-carboxylic acid (PCA) biosynthesis. In the present study, we show that RsmA exhibits differential gene regulation on two phz clusters in P. aeruginosa M18 at the post-transcriptional level. Based on the sequence analysis, four GGA motifs, the potential RsmA binding sites, are found on the 5′-untranslated region (UTR) of the phz2 transcript. Studies with a series of lacZ reporter fusions, and gel mobility shift assays suggest that the third GGA motif (S3), located 21 nucleotides upstream of the Shine-Dalgarno (SD) sequence, is involved in direct RsmA-mediated activation of phz2 expression. We therefore propose a novel model in which the binding of RsmA to the target S3 results in the destabilization of the stem-loop structure and the enhancement of ribosome access. This model could be fully supported by RNA structure prediction, free energy calculations, and nucleotide replacement studies. In contrast, various RsmA-mediated translation repression mechanisms have been identified in which RsmA binds near the SD sequence of target transcripts, thereby blocking ribosome access. Similarly, RsmA is shown to negatively regulate phz1 expression. Our new findings suggest that the differential regulation exerted by RsmA on the two phz clusters may confer an advantage to P. aeruginosa over other pseudomonads containing only a single phz cluster in their genomes. PMID:24586939

  13. Immortalization-susceptible elements and their binding factors mediate rejuvenation of regulation of the type I collagenase gene in simian virus 40 large T antigen-transformed immortal human fibroblasts.

    PubMed Central

    Imai, S; Fujino, T; Nishibayashi, S; Manabe, T; Takano, T

    1994-01-01

    Dramatic changes occur in expression of the type I collagenase gene during the process of immortalization in simian virus 40 large T antigen-transformed human fibroblasts (S. Imai and T. Takano, Biochem. Biophys. Res. Commun. 189:148-153, 1992). From transient transfection assays, it was determined that these changes involved the functions of two immortalization-susceptible cis-acting elements, ISE1 and ISE2, located in a 100-bp region about 1.7 kb upstream. The profiles of binding of an activator, Proserpine, to the enhancer ISE1 were similar in the extracts of young, senescent preimmortalized and immortalized cells. ISE2 contained both negative and positive regulatory elements located adjacent to each other. The positive regulatory element consisted of a tandem array of putative Ets family- and AP-1-binding sites. An activator, Pluto, interacted with this positive regulatory element and had an AP-1-related component as a complex. The binding activity of Pluto was predominantly detected only in the extract from senescent preimmortalized cells. In contrast, a repressor, Orpheus, which bound to the ATG-rich negative regulatory element of ISE2, was prominently detected in extracts from both young preimmortalized and immortalized cells and appeared to suppress transcription in an orientation-dependent manner. Thus, the interplay of Pluto and Orpheus was suggested to be crucial for regulation of the collagenase gene accompanying in vitro aging and immortalization. Proserpine seemed to interact with Pluto to mediate strong expression of the collagenase gene in cellular senescence. On the basis of these results, we propose a model for regulation of the collagenase gene during in vitro aging and immortalization. Images PMID:7935433

  14. Borrelia oxidative stress response regulator, BosR: A distinctive Zn-dependent transcriptional activator

    PubMed Central

    Boylan, Julie A.; Posey, James E.; Gherardini, Frank C.

    2003-01-01

    The ability of a pathogen to cause infection depends on successful colonization of the host, which, in turn, requires adaptation to various challenges presented by that host. For example, host immune cells use a variety of mechanisms to control infection by bacterial pathogens, including the production of bactericidal reactive oxygen species. Prokaryotic and eukaryotic cells have developed ways of protecting themselves against this oxidative damage; for instance, Borrelia burgdorferi alters the expression of oxidative-stress-related proteins, such as a Dps/Dpr homolog NapA (BB0690), in response to increasing levels of oxygen and reactive oxygen species. These stress-related genes appear to be regulated by a putative metal-dependent DNA-binding protein (BB0647) that has 50.7% similarity to the peroxide-specific stress response repressor of Bacillus subtilis, PerR. We overexpressed and purified this protein from Escherichia coli and designated it Borrelia oxidative stress regulator, BosR. BosR bound to a 50-nt region 180 bp upstream of the napA transcriptional start site and required DTT and Zn2+ for optimal binding. Unlike the Bacillus subtilis PerR repressor, BosR did not require Fe2+ and Mn2+ for binding, and oxidizing agents, such as t-butyl peroxide, enhanced, not eliminated, BosR binding to the napA promoter region. Surprisingly, transcriptional fusion analysis indicated that BosR exerted a positive regulatory effect on napA that is inducible with t-butyl peroxide. On the basis of these data, we propose that, despite the similarity to PerR, BosR functions primarily as a transcriptional activator, not a repressor of oxidative stress response, in B. burgdorferi. PMID:12975527

  15. Transforming growth factor-β/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4.

    PubMed

    Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-08-03

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.

  16. Dissection of the BCR-ABL signaling network using highly specific monobody inhibitors to the SHP2 SH2 domains.

    PubMed

    Sha, Fern; Gencer, Emel Basak; Georgeon, Sandrine; Koide, Akiko; Yasui, Norihisa; Koide, Shohei; Hantschel, Oliver

    2013-09-10

    The dysregulated tyrosine kinase BCR-ABL causes chronic myelogenous leukemia in humans and forms a large multiprotein complex that includes the Src-homology 2 (SH2) domain-containing phosphatase 2 (SHP2). The expression of SHP2 is necessary for BCR-ABL-dependent oncogenic transformation, but the precise signaling mechanisms of SHP2 are not well understood. We have developed binding proteins, termed monobodies, for the N- and C-terminal SH2 domains of SHP2. Intracellular expression followed by interactome analysis showed that the monobodies are essentially monospecific to SHP2. Two crystal structures revealed that the monobodies occupy the phosphopeptide-binding sites of the SH2 domains and thus can serve as competitors of SH2-phosphotyrosine interactions. Surprisingly, the segments of both monobodies that bind to the peptide-binding grooves run in the opposite direction to that of canonical phosphotyrosine peptides, which may contribute to their exquisite specificity. When expressed in cells, monobodies targeting the N-SH2 domain disrupted the interaction of SHP2 with its upstream activator, the Grb2-associated binder 2 adaptor protein, suggesting decoupling of SHP2 from the BCR-ABL protein complex. Inhibition of either N-SH2 or C-SH2 was sufficient to inhibit two tyrosine phosphorylation events that are critical for SHP2 catalytic activity and to block ERK activation. In contrast, targeting the N-SH2 or C-SH2 revealed distinct roles of the two SH2 domains in downstream signaling, such as the phosphorylation of paxillin and signal transducer and activator of transcription 5. Our results delineate a hierarchy of function for the SH2 domains of SHP2 and validate monobodies as potent and specific antagonists of protein-protein interactions in cancer cells.

  17. Specific Activation of the Plant P-type Plasma Membrane H+-ATPase by Lysophospholipids Depends on the Autoinhibitory N- and C-terminal Domains.

    PubMed

    Wielandt, Alex Green; Pedersen, Jesper Torbøl; Falhof, Janus; Kemmer, Gerdi Christine; Lund, Anette; Ekberg, Kira; Fuglsang, Anja Thoe; Pomorski, Thomas Günther; Buch-Pedersen, Morten Jeppe; Palmgren, Michael

    2015-06-26

    Eukaryotic P-type plasma membrane H(+)-ATPases are primary active transport systems that are regulated at the post-translation level by cis-acting autoinhibitory domains, which can be relieved by protein kinase-mediated phosphorylation or binding of specific lipid species. Here we show that lysophospholipids specifically activate a plant plasma membrane H(+)-ATPase (Arabidopsis thaliana AHA2) by a mechanism that involves both cytoplasmic terminal domains of AHA2, whereas they have no effect on the fungal counterpart (Saccharomyces cerevisiae Pma1p). The activation was dependent on the glycerol backbone of the lysophospholipid and increased with acyl chain length, whereas the headgroup had little effect on activation. Activation of the plant pump by lysophospholipids did not involve the penultimate residue, Thr-947, which is known to be phosphorylated as part of a binding site for activating 14-3-3 protein, but was critically dependent on a single autoinhibitory residue (Leu-919) upstream of the C-terminal cytoplasmic domain in AHA2. A corresponding residue is absent in the fungal counterpart. These data indicate that plant plasma membrane H(+)-ATPases evolved as specific receptors for lysophospholipids and support the hypothesis that lysophospholipids are important plant signaling molecules. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Novel roles for actin in mitochondrial fission

    PubMed Central

    Hatch, Anna L.; Gurel, Pinar S.; Higgs, Henry N.

    2014-01-01

    ABSTRACT Mitochondrial dynamics, including fusion, fission and translocation, are crucial to cellular homeostasis, with roles in cellular polarity, stress response and apoptosis. Mitochondrial fission has received particular attention, owing to links with several neurodegenerative diseases. A central player in fission is the cytoplasmic dynamin-related GTPase Drp1, which oligomerizes at the fission site and hydrolyzes GTP to drive membrane ingression. Drp1 recruitment to the outer mitochondrial membrane (OMM) is a key regulatory event, which appears to require a pre-constriction step in which the endoplasmic reticulum (ER) and mitochondrion interact extensively, a process termed ERMD (ER-associated mitochondrial division). It is unclear how ER–mitochondrial contact generates the force required for pre-constriction or why pre-constriction leads to Drp1 recruitment. Recent results, however, show that ERMD might be an actin-based process in mammals that requires the ER-associated formin INF2 upstream of Drp1, and that myosin II and other actin-binding proteins might be involved. In this Commentary, we present a mechanistic model for mitochondrial fission in which actin and myosin contribute in two ways; firstly, by supplying the force for pre-constriction and secondly, by serving as a coincidence detector for Drp1 binding. In addition, we discuss the possibility that multiple fission mechanisms exist in mammals. PMID:25217628

  19. Differential Function of Lip Residues in the Mechanism and Biology of an Anthrax Hemophore

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ekworomadu, MarCia T.; Poor, Catherine B.; Owens, Cedric P.

    To replicate in mammalian hosts, bacterial pathogens must acquire iron. The majority of iron is coordinated to the protoporphyrin ring of heme, which is further bound to hemoglobin. Pathogenic bacteria utilize secreted hemophores to acquire heme from heme sources such as hemoglobin. Bacillus anthracis, the causative agent of anthrax disease, secretes two hemophores, IsdX1 and IsdX2, to acquire heme from host hemoglobin and enhance bacterial replication in iron-starved environments. Both proteins contain NEAr-iron Transporter (NEAT) domains, a conserved protein module that functions in heme acquisition in Gram-positive pathogens. Here, we report the structure of IsdX1, the first of a Gram-positivemore » hemophore, with and without bound heme. Overall, IsdX1 forms an immunoglobin-like fold that contains, similar to other NEAT proteins, a 3{sub 10}-helix near the heme-binding site. Because the mechanistic function of this helix in NEAT proteins is not yet defined, we focused on the contribution of this region to hemophore and NEAT protein activity, both biochemically and biologically in cultured cells. Site-directed mutagenesis of amino acids in and adjacent to the helix identified residues important for heme and hemoglobin association, with some mutations affecting both properties and other mutations affecting only heme stabilization. IsdX1 with mutations that reduced the ability to associate with hemoglobin and bind heme failed to restore the growth of a hemophore-deficient strain of B. anthracis on hemoglobin as the sole iron source. These data indicate that not only is the 3{sub 10}-helix important for NEAT protein biology, but also that the processes of hemoglobin and heme binding can be both separate as well as coupled, the latter function being necessary for maximal heme-scavenging activity. These studies enhance our understanding of NEAT domain and hemophore function and set the stage for structure-based inhibitor design to block NEAT domain interaction with upstream ligands.« less

  20. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1∙Nup98)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quan, Beili; Seo, Hyuk-Soo; Blobel, Günter

    2014-07-01

    mRNA export factor 1 (Rae1) and nucleoporin 98 (Nup98) are host cell targets for the matrix (M) protein of vesicular stomatitis virus (VSV). How Rae1 functions in mRNA export and how M protein targets both Rae1 and Nup98 are not understood at the molecular level. To obtain structural insights, we assembled a 1:1:1 complex of M•Rae1•Nup98 and established a crystal structure at 3.15-Å resolution. We found that the M protein contacts the Rae1•Nup98 heterodimer principally by two protrusions projecting from the globular domain of M like a finger and thumb. Both projections clamp to the side of the β-propeller ofmore » Rae1, with the finger also contacting Nup98. The most prominent feature of the finger is highly conserved Methionine 51 (Met51) with upstream and downstream acidic residues. The complementary surface on Rae1 displays a deep hydrophobic pocket, into which Met51 fastens like a bolt, and a groove of basic residues on either side, which bond to the acidic residues of the finger. Notably, the M protein competed for in vitro binding of various oligonucleotides to Rae1•Nup98. We localized this competing activity of M to its finger using a synthetic peptide. Collectively, our data suggest that Rae1 serves as a binding protein for the phosphate backbone of any nucleic acid and that the finger of M mimics this ligand. In the context of mRNA export, we propose that a given mRNA segment, after having been deproteinated by helicase, is transiently reproteinated by Nup98-tethered Rae1. We suggest that such repetitive cycles provide cytoplasmic stopover sites required for ratcheting mRNA across the nuclear pore.« less

  1. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  2. Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

    USGS Publications Warehouse

    Fallon, James D.; Yaeger, Christine S.

    2009-01-01

    Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

  3. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  4. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  5. Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

    NASA Astrophysics Data System (ADS)

    Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

    2010-12-01

    Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

  6. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

    PubMed Central

    Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

  7. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

    PubMed

    Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

  8. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  9. Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

    USGS Publications Warehouse

    Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

    2007-01-01

    In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

  10. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  11. Fish assemblages in the Upper Esopus Creek, NY: Current status, variability, and controlling factors

    USGS Publications Warehouse

    Baldigo, Barry P.; George, Scott D.; Keller, Walter T

    2015-01-01

    The Upper Esopus Creek receives water diversions from a neighboring basin through the Shandaken Tunnel (the portal) from the Schoharie Reservoir. Although the portal is closed during floods, mean flows and turbidity of portal waters are generally greater than in Esopus Creek above their confluence. These conditions could potentially affect local fish assemblages, yet such effects have not been assessed in this highly regulated stream. We studied water quality, hydrology, temperature, and fish assemblages at 18 sites in the Upper Esopus Creek during 2009–2011 to characterize the effects of the portal input on resident-fish assemblages and to document the status of the fishery resource. In general, fish-community richness increased by 2–3 species at mainstem sites near the portal, and median density and biomass of fish communities at sites downstream of the portal were significantly lower than they were at sites upstream of the portal. Median densities of Salmo trutta (Brown Trout) and all trout species were significantly lower than at mainstem sites downstream from the portal—25.1 fish/0.1 ha and 148.9 fish/0.1 ha, respectively—than at mainstem sites upstream from the portal—68.8 fish/0.1 ha and 357.7 fish/0.1 ha, respectively—yet median biomass for Brown Trout and all trout did not differ between sites from both reaches. The median density of young-of-year Brown Trout at downstream sites (9.3 fish/0.1 ha) was significantly lower than at upstream sites (33.9 fish/0.1 ha). Waters from the portal appeared to adversely affect the density and biomass of young-of-year Brown Trout, but lower temperatures and increased flows also improved habitat quality for mature trout at downstream sites during summer. These findings, and those from companion studies, indicate that moderately turbid waters from the portal had few if any adverse impacts on trout populations and overall fish communities in the Upper Esopus Creek during this study.

  12. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  14. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    PubMed

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  15. ManA is regulated by RssAB signaling and promotes motility in Serratia marcescens.

    PubMed

    Soo, Po-Chi; Horng, Yu-Tze; Chang, Yung-Lin; Tsai, Wei-Wen; Jeng, Wen-Yih; Lu, Chia-Chen; Lai, Hsin-Chih

    2014-01-01

    Serratia marcescens swarms on 0.8% LB agar at 30 °C but not at 37 °C. To understand the molecular mechanism regulating Serratia swarming, transposon mutagenesis was performed to screen for mutants that swarmed at 37 °C. In one mutant, S. marcescens WW100, the transposon was inserted in the upstream region of manA, which encodes mannose-6-phosphate isomerase, a type I phosphomannose isomerase. The transcriptional and translational levels of manA were higher in S. marcescens WW100 than in the wild-type strain. S. marcescens WW100 produced more serrawettin W1 (biosurfactant) than the wild-type, as detected by thin-layer chromatography, to promote surface motility by reducing surface tension. Serratia swarming was previously shown to be negatively regulated by the RssA-RssB two-component system. An electrophoretic mobility shift assay (EMSA) indicated that phosphorylated RssB (the response regulator) binds upstream of the transposon insertion site and manA in S. marcescens WW100. Analysis by real-time RT-PCR (qRT-PCR) revealed that, compared to the wild-type level, manA mRNA was increased in the rssA deletion mutant. The results indicated that RssA-RssB signaling directly represses the expression of manA and that overexpression of manA increases the production of serrawettin for Serratia swarming at 37 °C. Copyright © 2013 Institut Pasteur. All rights reserved.

  16. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  17. Occurrence of emerging contaminants in water and bed material in the Missouri River, North Dakota, 2007

    USGS Publications Warehouse

    Damschen, William C.; Lundgren, Robert F.

    2009-01-01

    The U.S. Geological Survey (USGS), in cooperation with the Standing Rock Sioux Tribe, conducted a reconnaissance study to determine the occurrence of emerging contaminants in water and bed sediment within the Missouri River upstream and downstream from the cities of Bismarck and Mandan, North Dakota, and upstream from the city of Fort Yates, North Dakota, during September-October 2007. At each site, water samples were collected twice and bed-sediment samples were collected once. Samples were analyzed for more than 200 emerging contaminants grouped into four compound classes - wastewater compounds, human-health pharmaceutical compounds, hormones, and antibiotics. Only sulfamethoxazole, an antibiotic, was present at a concentration higher than minimum detection limits. It was detected in a water sample collected downstream from the cities of Bismarck and Mandan, and in bed-sediment samples collected at the two sites downstream from the cities of Bismarck and Mandan and upstream from Fort Yates. Sulfamethoxazole is an antibiotic commonly used for treating bacterial infections in humans and animals.

  18. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  19. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  20. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Top