Science.gov

Sample records for binds negatively charged

  1. Tuning the affinity of anion binding sites in porin channels with negatively charged residues: molecular details for OprP.

    PubMed

    Modi, Niraj; Bárcena-Uribarri, Iván; Bains, Manjeet; Benz, Roland; Hancock, Robert E W; Kleinekathöfer, Ulrich

    2015-02-20

    The cell envelope of the Gram negative opportunistic pathogen Pseudomonas aeruginosa is poorly permeable to many classes of hydrophilic molecules including antibiotics due to the presence of the narrow and selective porins. Here we focused on one of the narrow-channel porins, that is, OprP, which is responsible for the high-affinity uptake of phosphate ions. Its two central binding sites for phosphate contain a number of positively charged amino acids together with a single negatively charged residue (D94). The presence of this negatively charged residue in a binding site for negatively charged phosphate ions is highly surprising due to the potentially reduced binding affinity. The goal of this study was to better understand the role of D94 in phosphate binding, selectivity, and transport using a combination of mutagenesis, electrophysiology, and free-energy calculations. The presence of a negatively charged residue in the binding site is critical for this specific porin OprP as emphasized by the evolutionary conservation of such negatively charged residue in the binding site of several anion-selective porins. Mutations of D94 in OprP to any positively charged or neutral residue increased the binding affinity of phosphate for OprP. Detailed analysis indicated that this anionic residue in the phosphate binding site of OprP, despite its negative charge, maintained energetically favorable phosphate binding sites in the central region of the channel and at the same time decreased residence time thus preventing excessively strong binding of phosphate that would oppose phosphate flux through the channel. Intriguingly mutations of D94 to positively charged residues, lysine and arginine, resulted in very different binding affinities and free energy profiles, indicating the importance of side chain conformations of these positively charged residues in phosphate binding to OprP.

  2. The Negatively Charged Regions of Lactoferrin Binding Protein B, an Adaptation against Anti-Microbial Peptides

    PubMed Central

    Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B.

    2014-01-01

    Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein’s C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

  3. The negatively charged regions of lactoferrin binding protein B, an adaptation against anti-microbial peptides.

    PubMed

    Morgenthau, Ari; Beddek, Amanda; Schryvers, Anthony B

    2014-01-01

    Lactoferrin binding protein B (LbpB) is a bi-lobed membrane bound lipoprotein that is part of the lactoferrin receptor complex in a variety of Gram-negative pathogens. Despite high sequence diversity among LbpBs from various strains and species, a cluster of negatively charged amino acids is invariably present in the protein's C-terminal lobe in all species except Moraxella bovis. The function of LbpB in iron acquisition has yet to be experimentally demonstrated, whereas in vitro studies have shown that LbpB confers protection against lactoferricin, a short cationic antimicrobial peptide released from the N- terminus of lactoferrin. In this study we demonstrate that the negatively charged regions can be removed from the Neisseria meningitidis LbpB without compromising stability, and this results in the inability of LbpB to protect against the bactericidal effects of lactoferricin. The release of LbpB from the cell surface by the autotransporter NalP reduces the protection against lactoferricin in the in vitro killing assay, attributed to removal of LbpB during washing steps, but is unlikely to have a similar impact in vivo. The protective effect of the negatively charged polysaccharide capsule in the killing assay was less than the protection conferred by LbpB, suggesting that LbpB plays a major role in protection against cationic antimicrobial peptides in vivo. The selective release of LbpB by NalP has been proposed to be a mechanism for evading the adaptive immune response, by reducing the antibody binding to the cell surface, but may also provide insights into the primary function of LbpB in vivo. Although TbpB and LbpB have been shown to be major targets of the human immune response, the selective release of LbpB suggests that unlike TbpB, LbpB may not be essential for iron acquisition, but important for protection against cationic antimicrobial peptides. PMID:24465982

  4. Photodetachment of gaseous multiply charged anions, copper phthalocyanine tetrasulfonate tetraanion: Tuning molecular electronic energy levels by charging and negative electron binding

    SciTech Connect

    Wang, X.B.; Ferris, K.; Wang, L.S.

    2000-01-13

    The authors report photodetachment photoelectron spectroscopy (PES) of gaseous copper phthalocyanine (CuPc) tetrasulfonate quadruply charged anions, [CuPc(SO{sub 3}){sub 4}]{sup 4{minus}}, and its monoprotonated and -sodiumated triply charged anions, [CuPc(SO{sub 3}){sub 4}H]{sup 3{minus}} and [CuPc(SO{sub 3}){sub 4}Na]{sup 3{minus}}. The [CuPc(SO{sub 3}){sub 4}]{sup 4{minus}} tetraanion was found to possess a negative electron binding energy of {minus}0.9 eV, whereas the trianions have binding energies of 1.0 and 1.2 eV for the sodiumated and protonated species, respectively. The PES spectral features of the three multiply charged anions were observed to be similar to that of the parent CuPc neutral molecule, except that the anions have lower binding energies due to the presence of the negative charges ({minus}SO{sub 3}{sup {minus}}). The data thus suggested a stepwise tuning of the molecular electronic energy levels of the CuPc molecule through charging, wherein the molecular orbital energies of the parent molecule were systematically pushed up by the negative charges. The authors further carried out semiempirical calculations, which provided insight into the nature of the localized charges on the peripheral {minus}SO{sub 3}{sup {minus}} groups and the intramolecular electrostatic interactions in the multiply charged anions and confirmed the interpretation of the stepwise tuning of molecular energy levels by charging. Photon energy-dependent studies revealed the effects of the repulsive Coulomb barriers on the photodetachment PES spectra of the multiply charged anions. The barrier heights were estimated to be about 3.5 and 2.5 eV for the tetra- and trianions, respectively. The authors also observed excited states for the multiply charged anions and resonant tunneling through the repulsive Coulomb barriers via the excited states.

  5. Bid binding to negatively charged phospholipids may not be required for its pro-apoptotic activity in vivo

    PubMed Central

    Manara, Anna; Lindsay, Jennefer; Marchioretto, Marta; Astegno, Alessandra; Gilmore, Andrew P.; Esposti, Mauro Degli; Crimi, Massimo

    2010-01-01

    Bid is a ubiquitous pro-apoptotic member of the Bcl-2 family that has been involved in a variety of pathways of cell death. Unique among pro-apoptotic proteins, Bid is activated after cleavage by the apical caspases of the extrinsic pathway; subsequently it moves to mitochondria, where it promotes the release of apoptogenic proteins in concert with other Bcl-2 family proteins like Bak. Diverse factors appear to modulate the pro-apoptotic action of Bid, from its avid binding to mitochondrial lipids (in particular, cardiolipin) to multiple phosphorylations at sites that can modulate its caspase cleavage. This work addresses the question of how the lipid interactions of Bid that are evident in vitro actually impact on its pro-apoptotic action within cells. Using site-directed mutagenesis, we identified mutations that reduced mouse Bid lipid binding in vitro. Mutation of the conserved residue Lys157 specifically decreased the binding to negatively charged lipids related to cardiolipin and additionally affected the rate of caspase cleavage. However, this lipid-binding mutant had no discernable effect on Bid pro-apoptotic function in vivo. The results are interpreted in relation to an underlying interaction of Bid with lysophosphatidylcholine, which is not disrupted in any mutant retaining pro-apoptotic function both in vitro and in vivo. PMID:19463967

  6. Linear free energy relationships for metal-ligand complexation: Bidentate binding to negatively-charged oxygen donor atoms

    NASA Astrophysics Data System (ADS)

    Carbonaro, Richard F.; Atalay, Yasemin B.; Di Toro, Dominic M.

    2011-05-01

    Stability constants for metal complexation to bidentate ligands containing negatively-charged oxygen donor atoms can be estimated from the following linear free energy relationship (LFER): log KML = χOO( αO log KHL,1 + αO log KHL,2) where KML is the metal-ligand stability constant for a 1:1 complex, KHL,1 and KHL,2 are the proton-ligand stability constants (the ligand p Ka values), and αO is the Irving-Rossotti slope. The parameter χOO is metal specific and has slightly different values for five and six membered chelate rings. LFERs are presented for 21 different metal ions and are accurate to within approximately 0.30 log units in predictions of log KML values. Ligands selected for use in LFER development include dicarboxylic acids, carboxyphenols, and ortho-diphenols. For ortho-hydroxybenzaldehydes, α-hydroxycarboxylic acids, and α-ketocarboxylic acids, a modification of the LFER where log KHL,2 is set equal to zero is required. The chemical interpretation of χOO is that it accounts for the extra stability afforded to metal complexes by the chelate effect. Cu-NOM binding constants calculated from the bidentate LFERs are similar in magnitude to those used in WHAM 6. This LFER can be used to make log KML predictions for small organic molecules. Since natural organic matter (NOM) contains many of the same functional groups (i.e. carboxylic acids, phenols, alcohols), the LFER log KML predictions shed light on the range of appropriate values for use in modeling metal partitioning in natural systems.

  7. Water Dispersible, Positively and Negatively Charged MoS2 Nanosheets: Surface Chemistry and the Role of Surfactant Binding.

    PubMed

    Gupta, Amit; Arunachalam, Vaishali; Vasudevan, Sukumaran

    2015-02-19

    Stable aqueous dispersions of atomically thin layered MoS2 nanosheets have been obtained by sonication in the presence of ionic surfactants. The dispersions are stabilized by electrostatic repulsion between the sheets, and we show that the sign of the charge on the MoS2 nanosheets, either positive or negative, can be can be controlled by the choice of the surfactant. Using techniques from solution NMR, we show that the surfactant chains are weakly bound to the MoS2 sheets and undergo rapid exchange with free surfactant chains present in the dispersion. In situ nuclear Overhauser effect spectroscopic measurements provide direct evidence that the surfactant chains lie flat, arranged randomly on the basal plane of the MoS2 nanosheets with their charged headgroup exposed. These results provide a chemical perspective for understanding the stability of these inorganic nanosheets in aqueous dispersions and the origin of the charge on the sheets.

  8. Structure/function analysis of human factor XII using recombinant deletion mutants. Evidence for an additional region involved in the binding to negatively charged surfaces.

    PubMed

    Citarella, F; Ravon, D M; Pascucci, B; Felici, A; Fantoni, A; Hack, C E

    1996-05-15

    The binding site of human factor XII (FXII) for negatively charged surfaces has been proposed to be localized in the N-terminal region of factor XII. We have generated two recombinant factor XII proteins that lack this region: one protein consisting of the second growth-factor-like domain, the kringle domain, the proline-rich region and the catalytic domain of FXII (rFXII-U-like), and another consisting of only 16 amino acids of the proline-rich region of the heavy-chain region and the catalytic domain (rFXII-1pc). Each recombinant truncated protein, as well as recombinant full-length FXII (rFXII), were produced in HepG2 cells and purified by immunoaffinity chromatography. The capability of these recombinant proteins to bind to negatively charged surfaces and to initiate contact activation was studied. Radiolabeled rFXII-U-like and, to a lesser extent, rFXII-lpc bound to glass in a concentration-dependent manner, yet with lower efficiency than rFXII. The binding of the recombinant proteins was inhibited by a 100-fold molar excess of non-labeled native factor XII. On native polyacrylamide gel electrophoresis, both truncated proteins appeared to bind also to dextran sulfate, a soluble negatively charged compound. Glass-bound rFXII-U-like was able to activate prekallikrein in FXII-deficient plasma (assessed by measuring the generation of kallikrein-C1-inhibitor complexes), but less efficiently than rFXII, rFXII-U-like and rFXII-lpc exhibited coagulant activity, but this activity was significantly lower than that of rFXII. These data confirm that the N-terminal part of the heavy-chain region of factor XII contains a binding site for negatively charged activating surfaces, and indicate that other sequences, possibly located on the second epidermal-growth-factor-like domain and/or the kringle domain, contribute to the binding of factor XII to these surfaces.

  9. Identification of a putative binding site for negatively charged surfaces in the fibronectin type II domain of human factor XII--an immunochemical and homology modeling approach.

    PubMed

    Citarella, F; te Velthuis, H; Helmer-Citterich, M; Hack, C E

    2000-12-01

    Monoclonal antibodies directed against functional sites of proteins provide useful tools for structure-function studies. Here we describe a mAb, KOK5, directed against the heavy chain region of human coagulation factor XII (FXII), which inhibits kaolin-induced clotting activity by preventing the binding of FXII to kaolin. Furthermore, mAb KOK5 enhances FXII susceptibility for cleavage by kallikrein and supports FXII autoactivation. Hence, mAb KOK5 likely is directed against the binding site of FXII for negatively charged surfaces. Screening of two phage-displayed random peptide libraries with mAb KOK5 selected phages that could be grouped on the basis of two amino acid consensus sequences: A) FXFQTPXW and B) HQ/LCTHR/KKC. Sequence A contains two motifs: one shares homology with FXII amino acid residues 30-33 (FPFQ), the second one with residues 57-60 (TPNF); both amino acid stretches belonging to the fibronectin type II domain of FXII. Sequence B also reveals homology with part of the fibronectin type II domain, i.e. the stretch 40-47 (HKCTHKGR). A three-dimensional model of FXII residues 28-65, obtained by homology modeling, indicated that the three amino acid stretches 30-33, 40-47 and 57-60 are close to each other and accessible for the solvent, i.e. in a form available for interaction with the monoclonal antibody, suggesting that mAb KOK5 recognizes a discontinuous epitope on the fibronectin type III domain of FXII. Peptides corresponding to FXII sequences 29-37 (FXII29-37) or 39-47 (FXII39-47), were synthesized and tested for the capability to inhibit FXII binding to negatively charged surfaces. Peptide FXII39-47 inhibited the binding of labeled FXII to kaolin and effectively prevented both dextran sulfate- and kaolin-induced activation of the contact system in plasma. Hence, we suggest that the fibronectin type II domain of FXII, in particular residues 39 to 47, contribute to the binding site of FXII for negatively charged surfaces.

  10. The second exon-encoded factor XII region is involved in the interaction of factor XII with factor XI and does not contribute to the binding site for negatively charged surfaces.

    PubMed

    Citarella, F; Fedele, G; Roem, D; Fantoni, A; Hack, C E

    1998-12-01

    Contact system activation, in vitro, is triggered by activation of factor XII (FXII) on binding to an activator, such as negatively charged surfaces. A putative surface-binding site of FXII has been located within the amino acid residues 1-28 by identifying the epitope recognized by a monoclonal antibody (MoAb), B7C9, which inhibits kaolin-induced clotting activity. To further elucidate the role of the amino terminal binding site in the regulation of FXII activation, we have characterized a FXII recombinant protein (rFXII-triangle up19) deleted of the amino acid residues 3-19, which are encoded by the second exon of FXII gene. A plasmid encoding for rFXII-triangle up19 was constructed and expressed in HepG2 cells by using vaccinia virus. Purified rFXII-triangle up19 migrated as a single band of Mr 77,000 on sodium dodecyl sulfate (SDS)-polyacrylamide gel, did not bind to MoAb B7C9 immobilized on Protein A-Sepharose, thus confirming that it lacked the epitope for this MoAb, and had no amidolytic activity towards the chromogenic substrate S-2302 in the absence of activator. rFXII-triangle up19 specific clotting activity was lower (44%) than that of native FXII. The activation rate of rFXII-triangle up19 by kallikrein in the absence of dextran sulfate was about four times higher than that of full-length FXII and was increased in the presence of dextran sulfate. However, rFXII-triangle up19 underwent autoactivation in the presence of dextran sulfate. Labeled rFXII-triangle up19 bound to kaolin, which binding was equally well inhibited by either, rFXII-triangle up19 or full-length FXII (IC50 = 7.2 +/- 2.2 nmol/L for both proteins). Accordingly, a synthetic peptide corresponding to FXII amino acid residues 3-19 did not inhibit the binding of labeled full-length FXII to kaolin. rFXII-triangle up19 generated a similar amount of FXIIa- and kallikrein-C1-inhibitor complexes in FXII-deficient plasma in the presence of kaolin, as did full-length FXII; but generated less factor

  11. Architecture and RNA binding of the human negative elongation factor

    PubMed Central

    Vos, Seychelle M; Pöllmann, David; Caizzi, Livia; Hofmann, Katharina B; Rombaut, Pascaline; Zimniak, Tomasz; Herzog, Franz; Cramer, Patrick

    2016-01-01

    Transcription regulation in metazoans often involves promoter-proximal pausing of RNA polymerase (Pol) II, which requires the 4-subunit negative elongation factor (NELF). Here we discern the functional architecture of human NELF through X-ray crystallography, protein crosslinking, biochemical assays, and RNA crosslinking in cells. We identify a NELF core subcomplex formed by conserved regions in subunits NELF-A and NELF-C, and resolve its crystal structure. The NELF-AC subcomplex binds single-stranded nucleic acids in vitro, and NELF-C associates with RNA in vivo. A positively charged face of NELF-AC is involved in RNA binding, whereas the opposite face of the NELF-AC subcomplex binds NELF-B. NELF-B is predicted to form a HEAT repeat fold, also binds RNA in vivo, and anchors the subunit NELF-E, which is confirmed to bind RNA in vivo. These results reveal the three-dimensional architecture and three RNA-binding faces of NELF. DOI: http://dx.doi.org/10.7554/eLife.14981.001 PMID:27282391

  12. Iodide uptake by negatively charged clay interlayers?

    PubMed

    Miller, Andrew; Kruichak, Jessica; Mills, Melissa; Wang, Yifeng

    2015-09-01

    Understanding iodide interactions with clay minerals is critical to quantifying risk associated with nuclear waste disposal. Current thought assumes that iodide does not interact directly with clay minerals due to electrical repulsion between the iodide and the negatively charged clay layers. However, a growing body of work indicates a weak interaction between iodide and clays. The goal of this contribution is to report a conceptual model for iodide interaction with clays by considering clay mineral structures and emergent behaviors of chemical species in confined spaces. To approach the problem, a suite of clay minerals was used with varying degrees of isomorphic substitution, chemical composition, and mineral structure. Iodide uptake experiments were completed with each of these minerals in a range of swamping electrolyte identities (NaCl, NaBr, KCl) and concentrations. Iodide uptake behaviors form distinct trends with cation exchange capacity and mineral structure. These trends change substantially with electrolyte composition and concentration, but do not appear to be affected by solution pH. The experimental results suggest that iodide may directly interact with clays by forming ion-pairs (e.g., NaI(aq)) which may concentrate within the interlayer space as well as the thin areas surrounding the clay particle where water behavior is more structured relative to bulk water. Ion pairing and iodide concentration in these zones is probably driven by the reduced dielectric constant of water in confined space and by the relatively high polarizability of the iodide species.

  13. Blind prediction of charged ligand binding affinities in a model binding site

    PubMed Central

    Rocklin, Gabriel J.; Boyce, Sarah E.; Fischer, Marcus; Fish, Inbar; Mobley, David L.; Shoichet, Brian K.; Dill, Ken A.

    2013-01-01

    Predicting absolute protein-ligand binding affinities remains a frontier challenge in ligand discovery and design. This becomes more difficult when ionic interactions are involved, because of the large opposing solvation and electrostatic attraction energies. In a blind test, we examined whether alchemical free energy calculations could predict binding affinities of 14 charged and 5 neutral compounds previously untested as ligands for a cavity binding site in Cytochrome C Peroxidase. In this simplified site, polar and cationic ligands compete with solvent to interact with a buried aspartate. Predictions were tested by calorimetry, spectroscopy, and crystallography. Of the 15 compounds predicted to bind, 13 were experimentally confirmed, while four compounds were false negative predictions. Predictions had an RMSE of 1.95 kcal/mol to the experimental affinities, and predicted poses had an average RMSD of 1.7 Å to the crystallographic poses. This test serves as a benchmark for these thermodynamically rigorous calculations at predicting binding affinities for charged compounds, and gives insights into the existing sources of error, which are primarily electrostatic interactions inside proteins. Our experiments also provide a useful set of ionic binding affinities in a simplified system for testing new affinity prediction methods. PMID:23896298

  14. Evaluating the Effect of Ionic Strength on Duplex Stability for PNA Having Negatively or Positively Charged Side Chains

    PubMed Central

    De Costa, N. Tilani S.; Heemstra, Jennifer M.

    2013-01-01

    The enhanced thermodynamic stability of PNA:DNA and PNA:RNA duplexes compared with DNA:DNA and DNA:RNA duplexes has been attributed in part to the lack of electrostatic repulsion between the uncharged PNA backbone and negatively charged DNA or RNA backbone. However, there are no previously reported studies that systematically evaluate the effect of ionic strength on duplex stability for PNA having a charged backbone. Here we investigate the role of charge repulsion in PNA binding by synthesizing PNA strands having negatively or positively charged side chains, then measuring their duplex stability with DNA or RNA at varying salt concentrations. At low salt concentrations, positively charged PNA binds more strongly to DNA and RNA than does negatively charged PNA. However, at medium to high salt concentrations, this trend is reversed, and negatively charged PNA shows higher affinity for DNA and RNA than does positively charged PNA. These results show that charge screening by counterions in solution enables negatively charged side chains to be incorporated into the PNA backbone without reducing duplex stability with DNA and RNA. This research provides new insight into the role of electrostatics in PNA binding, and demonstrates that introduction of negatively charged side chains is not significantly detrimental to PNA binding affinity at physiological ionic strength. The ability to incorporate negative charge without sacrificing binding affinity is anticipated to enable the development of PNA therapeutics that take advantage of both the inherent benefits of PNA and the multitude of charge-based delivery technologies currently being developed for DNA and RNA. PMID:23484047

  15. Is the negative glow plasma of a direct current glow discharge negatively charged?

    SciTech Connect

    Bogdanov, E. A.; Saifutdinov, A. I.; Demidov, V. I.; Kudryavtsev, A. A.

    2015-02-15

    A classic problem in gas discharge physics is discussed: what is the sign of charge density in the negative glow region of a glow discharge? It is shown that traditional interpretations in text-books on gas discharge physics that states a negative charge of the negative glow plasma are based on analogies with a simple one-dimensional model of discharge. Because the real glow discharges with a positive column are always two-dimensional, the transversal (radial) term in divergence with the electric field can provide a non-monotonic axial profile of charge density in the plasma, while maintaining a positive sign. The numerical calculation of glow discharge is presented, showing a positive space charge in the negative glow under conditions, where a one-dimensional model of the discharge would predict a negative space charge.

  16. Abnormal polarity of thunderclouds grown from negatively charged air.

    PubMed

    Moore, C B; Vonnegut, B; Rolan, T D; Cobb, J W; Holden, D N; Hignight, R T; McWilliams, S M; Cadwell, G W

    1986-09-26

    Experiments were carried out in New Mexico to determine whether the electrification processes that lead to the formation of lightning in clouds are influenced by the polarity of the charges in the air from which the clouds grow. The normal, positive space charge in the sub-cloud air was reversed by negative charge released from an electrified wire, suspended across a 2-kilometer-wide canyon. On more than four occasions when the clouds over the wire grew and became electrified, they were of abnormal polarity with dominant positive charges instead of the usual negative charges in the lower part of the cloud. The formation of these abnormally electrified clouds suggests both that the electrification process in thunderclouds can be initiated and that its polarity may be determined by the small charges that are present in the atmosphere.

  17. Electrostatic plasma lens for focusing negatively charged particle beams.

    PubMed

    Goncharov, A A; Dobrovolskiy, A M; Dunets, S M; Litovko, I V; Gushenets, V I; Oks, E M

    2012-02-01

    We describe the current status of ongoing research and development of the electrostatic plasma lens for focusing and manipulating intense negatively charged particle beams, electrons, and negative ions. The physical principle of this kind of plasma lens is based on magnetic isolation electrons providing creation of a dynamical positive space charge cloud in shortly restricted volume propagating beam. Here, the new results of experimental investigations and computer simulations of wide-aperture, intense electron beam focusing by plasma lens with positive space charge cloud produced due to the cylindrical anode layer accelerator creating a positive ion stream towards an axis system is presented.

  18. Cellular charge of Cryptococcus neoformans: contributions from the capsular polysaccharide, melanin, and monoclonal antibody binding.

    PubMed Central

    Nosanchuk, J D; Casadevall, A

    1997-01-01

    Cryptococcus neoformans is a human pathogenic fungus which is unusual in two respects: it has a polysaccharide capsule similar to that found in encapsulated bacteria and it can produce melanin. Capsular and melanization phenotypes are associated with virulence. In this study we analyzed the contributions of the capsular polysaccharide, melanization, and antibody binding to the capsule to the cellular charge of C. neoformans. Cell charge was inferred from measurements of zeta potential. The results indicate that (i) C. neoformans cells are significantly more negatively charged than Saccharomyces cerevisiae cells, (ii) the polysaccharide capsule of C. neoformans is responsible for the high negative charge of the cells, (iii) C. neoformans melanin is negatively charged, (iv) melanization in C. neoformans is associated with an increased negative charge per cell, and (v) antibody binding to the capsule of C. neoformans significantly alters the cell charge. These results suggest that alterations in cell charge attributable to polysaccharide capsule formation, melanization, and antibody binding may affect C. neoformans virulence given that macrophage phagocytosis is effected by the zeta potential of microorganisms. PMID:9125569

  19. Electrostatic Power Generation from Negatively Charged, Simulated Lunar Regolith

    NASA Technical Reports Server (NTRS)

    Choi, Sang H.; King, Glen C.; Kim, Hyun-Jung; Park, Yeonjoon

    2010-01-01

    Research was conducted to develop an electrostatic power generator for future lunar missions that facilitate the utilization of lunar resources. The lunar surface is known to be negatively charged from the constant bombardment of electrons and protons from the solar wind. The resulting negative electrostatic charge on the dust particles, in the lunar vacuum, causes them to repel each other minimizing the potential. The result is a layer of suspended dust about one meter above the lunar surface. This phenomenon was observed by both Clementine and Surveyor spacecrafts. During the Apollo 17 lunar landing, the charged dust was a major hindrance, as it was attracted to the astronauts' spacesuits, equipment, and the lunar buggies. The dust accumulated on the spacesuits caused reduced visibility for the astronauts, and was unavoidably transported inside the spacecraft where it caused breathing irritation [1]. In the lunar vacuum, the maximum charge on the particles can be extremely high. An article in the journal "Nature", titled "Moon too static for astronauts?" (Feb 2, 2007) estimates that the lunar surface is charged with up to several thousand volts [2]. The electrostatic power generator was devised to alleviate the hazardous effects of negatively charged lunar soil by neutralizing the charged particles through capacitive coupling and thereby simultaneously harnessing power through electric charging [3]. The amount of power generated or collected is dependent on the areal coverage of the device and hovering speed over the lunar soil surface. A thin-film array of capacitors can be continuously charged and sequentially discharged using a time-differentiated trigger discharge process to produce a pulse train of discharge for DC mode output. By controlling the pulse interval, the DC mode power can be modulated for powering devices and equipment. In conjunction with a power storage system, the electrostatic power generator can be a power source for a lunar rover or other

  20. Arabinogalactan proteins are incorporated in negatively charged coffee brew melanoidins.

    PubMed

    Bekedam, E Koen; De Laat, Marieke P F C; Schols, Henk A; Van Boekel, Martinus A J S; Smit, Gerrit

    2007-02-01

    The charge properties of melanoidins in high molecular weight (HMw) coffee brew fractions, isolated by diafiltration and membrane dialysis, were studied. Ion exchange chromatography experiments with the HMw fractions showed that coffee brew melanoidins were negatively charged whereas these molecules did not expose any positive charge at the pH of coffee brew. Fractions with different ionic charges were isolated and subsequently characterized by means of the specific extinction coefficient (K(mix 405nm)), sugar composition, phenolic group content, nitrogen content, and the arabinogalactan protein (AGP) specific Yariv gel-diffusion assay. The isolated fractions were different in composition and AGP was found to be present in one of the HMw fractions. The AGP accounted for 6% of the coffee brew dry matter and had a moderate negative charge, probably caused by the presence of uronic acids. As the fraction that precipitated with Yariv was brown (K(mix 405nm) = 1.2), compared to a white color in the green bean, it was concluded that these AGPs had undergone Maillard reaction resulting in an AGP-melanoidin complex. The presence of mannose (presumably from galactomannan) indicates the incorporation of galactomannans in the AGP-melanoidin complex. As the uronic acid content in the more negatively charged melanoidin-rich, AGP-poor HMw fractions decreased, it was hypothesized that acidic groups are formed or incorporated during melanoidin formation. PMID:17263472

  1. Arabinogalactan proteins are incorporated in negatively charged coffee brew melanoidins.

    PubMed

    Bekedam, E Koen; De Laat, Marieke P F C; Schols, Henk A; Van Boekel, Martinus A J S; Smit, Gerrit

    2007-02-01

    The charge properties of melanoidins in high molecular weight (HMw) coffee brew fractions, isolated by diafiltration and membrane dialysis, were studied. Ion exchange chromatography experiments with the HMw fractions showed that coffee brew melanoidins were negatively charged whereas these molecules did not expose any positive charge at the pH of coffee brew. Fractions with different ionic charges were isolated and subsequently characterized by means of the specific extinction coefficient (K(mix 405nm)), sugar composition, phenolic group content, nitrogen content, and the arabinogalactan protein (AGP) specific Yariv gel-diffusion assay. The isolated fractions were different in composition and AGP was found to be present in one of the HMw fractions. The AGP accounted for 6% of the coffee brew dry matter and had a moderate negative charge, probably caused by the presence of uronic acids. As the fraction that precipitated with Yariv was brown (K(mix 405nm) = 1.2), compared to a white color in the green bean, it was concluded that these AGPs had undergone Maillard reaction resulting in an AGP-melanoidin complex. The presence of mannose (presumably from galactomannan) indicates the incorporation of galactomannans in the AGP-melanoidin complex. As the uronic acid content in the more negatively charged melanoidin-rich, AGP-poor HMw fractions decreased, it was hypothesized that acidic groups are formed or incorporated during melanoidin formation.

  2. Increased negatively charged nitrogen-vacancy centers in fluorinated diamond

    SciTech Connect

    Cui, Shanying; Hu, Evelyn L.

    2013-07-29

    We investigated the effect of fluorine-terminated diamond surface on the charged state of shallow nitrogen vacancy defect centers (NVs). Fluorination is achieved with CF{sub 4} plasma, and the surface chemistry is confirmed with x-ray photoemission spectroscopy. Photoluminescence of these ensemble NVs reveals that fluorine-treated surfaces lead to a higher and more stable negatively charged nitrogen vacancy (NV{sup −}) population than oxygen-terminated surfaces. NV{sup −} population is estimated by the ratio of negative to neutral charged NV zero-phonon lines. Surface chemistry control of NV{sup −} density is an important step towards improving the optical and spin properties of NVs for quantum information processing and magnetic sensing.

  3. Space Charge Neutralization in the ITER Negative Ion Beams

    SciTech Connect

    Surrey, Elizabeth

    2007-08-10

    A model of the space charge neutralization of negative ion beams, developed from the model due to Holmes, is applied to the ITER heating and diagnostic beams. The Holmes model assumed that the plasma electron temperature was derived from the stripped electrons. This is shown to be incorrect for the ITER beams and the plasma electron temperature is obtained from the average creation energy upon ionization. The model shows that both ITER beams will be fully space charge compensated in the drift distance between the accelerator and the neutralizer. Inside the neutralizer, the plasma over compensates the space charge to the extent that a significant focusing force is predicted. At a certain position in the neutraliser this force balances the defocusing force due to the ions' transverse energy. Under these conditions the beam distribution function can change from Gaussian to Bennett and evidence of such a distribution observed in a multi-aperture, neutralized negative ion beam is presented.

  4. How Do Distance and Solvent Affect Halogen Bonding Involving Negatively Charged Donors?

    PubMed

    Chen, Zhaoqiang; Wang, Guimin; Xu, Zhijian; Wang, Jinan; Yu, Yuqi; Cai, Tingting; Shao, Qiang; Shi, Jiye; Zhu, Weiliang

    2016-09-01

    It was reported that negatively charged donors can form halogen bonding, which is stable, especially, in a polar environment. On the basis of a survey of the Protein Data Bank, we noticed that the distance between the negative charge center and the halogen atom of an organohalogen may vary greatly. Therefore, a series of model systems, composed of 4-halophenyl-conjugated polyene acids and ammonia, were designed to explore the potential effect of distance on halogen bonding in different solvents. Quantum mechanics (QM) calculations demonstrated that the longer the distance, the stronger the bonding. The energy decomposition analysis on all of the model systems demonstrated that electrostatic interaction contributes the most (44-56%) to the overall binding, followed by orbital interaction (42-36%). Natural bond orbital calculations showed that electron transfer takes place from the acceptor to the donor, whereas the halogen atom becomes more positive during the bonding, which is in agreement with the result of neutral halogen bonding. QM/molecular mechanics calculations demonstrated that the polarity of binding pockets makes all of the interactions attractive in a protein system. Hence, the strength of halogen bonding involving negatively charged donors could be adjusted by changing the distance between the negative charge center and halogen atom and the environment in which the bonding exists, which may be applied in material and drug design for tuning their function and activity. PMID:27504672

  5. Membrane Permeabilization Induced by Sphingosine: Effect of Negatively Charged Lipids

    PubMed Central

    Jiménez-Rojo, Noemi; Sot, Jesús; Viguera, Ana R.; Collado, M. Isabel; Torrecillas, Alejandro; Gómez-Fernández, J.C.; Goñi, Félix M.; Alonso, Alicia

    2014-01-01

    Sphingosine [(2S, 3R, 4E)-2-amino-4-octadecen-1, 3-diol] is the most common sphingoid long chain base in sphingolipids. It is the precursor of important cell signaling molecules, such as ceramides. In the last decade it has been shown to act itself as a potent metabolic signaling molecule, by activating a number of protein kinases. Moreover, sphingosine has been found to permeabilize phospholipid bilayers, giving rise to vesicle leakage. The present contribution intends to analyze the mechanism by which this bioactive lipid induces vesicle contents release, and the effect of negatively charged bilayers in the release process. Fluorescence lifetime measurements and confocal fluorescence microscopy have been applied to observe the mechanism of sphingosine efflux from large and giant unilamellar vesicles; a graded-release efflux has been detected. Additionally, stopped-flow measurements have shown that the rate of vesicle permeabilization increases with sphingosine concentration. Because at the physiological pH sphingosine has a net positive charge, its interaction with negatively charged phospholipids (e.g., bilayers containing phosphatidic acid together with sphingomyelins, phosphatidylethanolamine, and cholesterol) gives rise to a release of vesicular contents, faster than with electrically neutral bilayers. Furthermore, phosphorous 31-NMR and x-ray data show the capacity of sphingosine to facilitate the formation of nonbilayer (cubic phase) intermediates in negatively charged membranes. The data might explain the pathogenesis of Niemann-Pick type C1 disease. PMID:24940775

  6. Targeting Negative Surface Charges of Cancer Cells by Multifunctional Nanoprobes

    PubMed Central

    Chen, Bingdi; Le, Wenjun; Wang, Yilong; Li, Zhuoquan; Wang, Dong; Ren, Lei; Lin, Ling; Cui, Shaobin; Hu, Jennifer J.; Hu, Yihui; Yang, Pengyuan; Ewing, Rodney C.; Shi, Donglu; Cui, Zheng

    2016-01-01

    A set of electrostatically charged, fluorescent, and superparamagnetic nanoprobes was developed for targeting cancer cells without using any molecular biomarkers. The surface electrostatic properties of the established cancer cell lines and primary normal cells were characterized by using these nanoprobes with various electrostatic signs and amplitudes. All twenty two randomly selected cancer cell lines of different organs, but not normal control cells, bound specifically to the positively charged nanoprobes. The relative surface charges of cancer cells could be quantified by the percentage of cells captured magnetically. The activities of glucose metabolism had a profound impact on the surface charge level of cancer cells. The data indicate that an elevated glycolysis in the cancer cells led to a higher level secretion of lactate. The secreted lactate anions are known to remove the positive ions, leaving behind the negative changes on the cell surfaces. This unique metabolic behavior is responsible for generating negative cancer surface charges in a perpetuating fashion. The metabolically active cancer cells are shown to a unique surface electrostatic pattern that can be used for recovering cancer cells from the circulating blood and other solutions. PMID:27570558

  7. Targeting Negative Surface Charges of Cancer Cells by Multifunctional Nanoprobes.

    PubMed

    Chen, Bingdi; Le, Wenjun; Wang, Yilong; Li, Zhuoquan; Wang, Dong; Ren, Lei; Lin, Ling; Cui, Shaobin; Hu, Jennifer J; Hu, Yihui; Yang, Pengyuan; Ewing, Rodney C; Shi, Donglu; Cui, Zheng

    2016-01-01

    A set of electrostatically charged, fluorescent, and superparamagnetic nanoprobes was developed for targeting cancer cells without using any molecular biomarkers. The surface electrostatic properties of the established cancer cell lines and primary normal cells were characterized by using these nanoprobes with various electrostatic signs and amplitudes. All twenty two randomly selected cancer cell lines of different organs, but not normal control cells, bound specifically to the positively charged nanoprobes. The relative surface charges of cancer cells could be quantified by the percentage of cells captured magnetically. The activities of glucose metabolism had a profound impact on the surface charge level of cancer cells. The data indicate that an elevated glycolysis in the cancer cells led to a higher level secretion of lactate. The secreted lactate anions are known to remove the positive ions, leaving behind the negative changes on the cell surfaces. This unique metabolic behavior is responsible for generating negative cancer surface charges in a perpetuating fashion. The metabolically active cancer cells are shown to a unique surface electrostatic pattern that can be used for recovering cancer cells from the circulating blood and other solutions. PMID:27570558

  8. Study on space charge compensation in negative hydrogen ion beam.

    PubMed

    Zhang, A L; Peng, S X; Ren, H T; Zhang, T; Zhang, J F; Xu, Y; Guo, Z Y; Chen, J E

    2016-02-01

    Negative hydrogen ion beam can be compensated by the trapping of ions into the beam potential. When the beam propagates through a neutral gas, these ions arise due to gas ionization by the beam ions. However, the high neutral gas pressure may cause serious negative hydrogen ion beam loss, while low neutral gas pressure may lead to ion-ion instability and decompensation. To better understand the space charge compensation processes within a negative hydrogen beam, experimental study and numerical simulation were carried out at Peking University (PKU). The simulation code for negative hydrogen ion beam is improved from a 2D particle-in-cell-Monte Carlo collision code which has been successfully applied to H(+) beam compensated with Ar gas. Impacts among ions, electrons, and neutral gases in negative hydrogen beam compensation processes are carefully treated. The results of the beam simulations were compared with current and emittance measurements of an H(-) beam from a 2.45 GHz microwave driven H(-) ion source in PKU. Compensation gas was injected directly into the beam transport region to modify the space charge compensation degree. The experimental results were in good agreement with the simulation results. PMID:26932087

  9. Study on space charge compensation in negative hydrogen ion beam.

    PubMed

    Zhang, A L; Peng, S X; Ren, H T; Zhang, T; Zhang, J F; Xu, Y; Guo, Z Y; Chen, J E

    2016-02-01

    Negative hydrogen ion beam can be compensated by the trapping of ions into the beam potential. When the beam propagates through a neutral gas, these ions arise due to gas ionization by the beam ions. However, the high neutral gas pressure may cause serious negative hydrogen ion beam loss, while low neutral gas pressure may lead to ion-ion instability and decompensation. To better understand the space charge compensation processes within a negative hydrogen beam, experimental study and numerical simulation were carried out at Peking University (PKU). The simulation code for negative hydrogen ion beam is improved from a 2D particle-in-cell-Monte Carlo collision code which has been successfully applied to H(+) beam compensated with Ar gas. Impacts among ions, electrons, and neutral gases in negative hydrogen beam compensation processes are carefully treated. The results of the beam simulations were compared with current and emittance measurements of an H(-) beam from a 2.45 GHz microwave driven H(-) ion source in PKU. Compensation gas was injected directly into the beam transport region to modify the space charge compensation degree. The experimental results were in good agreement with the simulation results.

  10. Electron interactions with positively and negatively multiply charged biomolecular clusters

    NASA Astrophysics Data System (ADS)

    Feketeová, Linda

    2012-07-01

    Interactions of positively and negatively multiply charged biomolecular clusters with low-energy electrons, from ~ 0 up to 50 eV of electron energy, were investigated in a high resolution Fourier-Transform Ion Cyclotron Resonance mass spectrometer equipped with an electrospray ionisation source. Electron-induced dissociation reactions of these clusters depend on the energy of the electrons, the size and the charge state of the cluster. The positively charged clusters [Mn+2H]2+ of zwitterionic betaines, M = (CH3)2XCH2CO2 (X = NCH3 and S), do capture an electron in the low electron energy region (< 10 eV). At higher electron energies neutral evaporation from the cluster becomes competitive with Coulomb explosion. In addition, a series of singly charged fragments arise from bond cleavage reactions, including decarboxylation and CH3 group transfer, due to the access of electronic excited states of the precursor ions. These fragmentation reactions depend on the type of betaine (X = NCH3 or S). For the negative dianionic clusters of tryptophan [Trp9-2H]2-, the important channel at low electron energies is loss of a neutral. Coulomb explosion competes from 19.8 eV and dominates at high electron energies. A small amount of [Trp2-H-NH3]- is observed at 21.8 eV.

  11. Complexes of Negatively Charged Polypeptides with Cationic Lipids

    NASA Astrophysics Data System (ADS)

    Subramanian, G.; Li, Youli; Safinya, Cyrus R.

    1997-03-01

    Complexes of cationic lipids with oppositely charged proteins are promising candidates for new biomolecular materials. In addition to being used as a direct vehicle for protein transfection, they also find applications as templates for synthesis of molecular sieves. In spite of these wide ranging applications, the structure and interactions in these complexes have largely remained unclear. Here we report on the study of complexes formed between the cationic lipid didodecyldimethylammonium bromide (DDAB) with negatively charged polypeptide poly glutamic acid (PGA) both in the presence and absence of the neutral lipid dilauroylglycerophosphocholine (DLPC). X-ray diffraction of the complexes indicates a condensed lamellar lipid structure with the polypeptide intercalated between the layers. We present a comprehensive phase diagram on this system based on X-ray diffraction data. This work is supported in part by grants NSF DMR-9624091, PRF-31352 AC7, and CU LAR STP/UC 96-118.

  12. Laboratory Infrared Spectroscopy of Gaseous Negatively Charged Polyaromatic Hydrocarbons

    NASA Astrophysics Data System (ADS)

    Gao, Juehan; Berden, Giel; Oomens, Jos

    2014-06-01

    Based largely on infrared spectroscopic evidence, polycyclic aromatic hydrocarbon (PAH) molecules are now widely accepted to occur abundantly in the interstellar medium. Laboratory infrared spectra have been obtained for a large variety of neutral and cationic PAHs, but data for anionic PAHs are scarce. Nonetheless, in regions with relatively high electron densities and low UV photon fluxes, PAHs have been suggested to occur predominantly as negatively charged ions (anions), having substantial influence on cloud chemistry. While some matrix spectra have been reported for radical anion PAHs, no data is available for even-electron anions, which are more stable against electron detachment. Here we present the first laboratory infrared spectra of deprotonated PAHs ([PAH-H]-) in the wavelength ranges between 6 and 16 μm and around 3 μm. Wavelength-dependent infrared multiple-photon electron detachment is employed to obtain spectra for deprotonated naphthalene, anthracene, and pyrene in the gas phase. Spectra are compared with theoretical spectra computed at the density functional theory level. We show that the relative band intensities in different ranges of the IR spectrum deviate significantly from those of neutral and positively charged PAHs, and moreover from those of radical anion PAHs. These relative band intensities are, however, well reproduced by theory. An analysis of the frontier molecular orbitals of the even- and odd-electron anions reveals a high degree of charge localization in the deprotonated systems, qualitatively explaining the observed differences and suggesting unusually high electric dipole moments for this class of PAH molecules.

  13. A Negatively Charged Residue Stabilizes the Tropoelastin N-terminal Region for Elastic Fiber Assembly*

    PubMed Central

    Yeo, Giselle C.; Baldock, Clair; Wise, Steven G.; Weiss, Anthony S.

    2014-01-01

    Tropoelastin is an extracellular matrix protein that assembles into elastic fibers that provide elasticity and strength to vertebrate tissues. Although the contributions of specific tropoelastin regions during each stage of elastogenesis are still not fully understood, studies predominantly recognize the central hinge/bridge and C-terminal foot as the major participants in tropoelastin assembly, with a number of interactions mediated by the abundant positively charged residues within these regions. However, much less is known about the importance of the rarely occurring negatively charged residues and the N-terminal coil region in tropoelastin assembly. The sole negatively charged residue in the first half of human tropoelastin is aspartate 72. In contrast, the same region comprises 17 positively charged residues. We mutated this aspartate residue to alanine and assessed the elastogenic capacity of this novel construct. We found that D72A tropoelastin has a decreased propensity for initial self-association, and it cross-links aberrantly into denser, less porous hydrogels with reduced swelling properties. Although the mutant can bind cells normally, it does not form elastic fibers with human dermal fibroblasts and forms fewer atypical fibers with human retinal pigmented epithelial cells. This impaired functionality is associated with conformational changes in the N-terminal region. Our results strongly point to the role of the Asp-72 site in stabilizing the N-terminal segment of human tropoelastin and the importance of this region in facilitating elastic fiber assembly. PMID:25342751

  14. Laboratory infrared spectroscopy of gaseous negatively charged polyaromatic hydrocarbons

    SciTech Connect

    Gao, Juehan; Berden, Giel; Oomens, Jos

    2014-06-01

    Based largely on infrared spectroscopic evidence, polycyclic aromatic hydrocarbon (PAH) molecules are now widely accepted to occur abundantly in the interstellar medium. Laboratory infrared spectra have been obtained for a large variety of neutral and cationic PAHs, but data for anionic PAHs are scarce. Nonetheless, in regions with relatively high electron densities and low UV photon fluxes, PAHs have been suggested to occur predominantly as negatively charged ions (anions), having substantial influence on cloud chemistry. While some matrix spectra have been reported for radical anion PAHs, no data is available for even-electron anions, which are more stable against electron detachment. Here we present the first laboratory infrared spectra of deprotonated PAHs ([PAH-H]{sup –}) in the wavelength ranges between 6 and 16 μm and around 3 μm. Wavelength-dependent infrared multiple-photon electron detachment is employed to obtain spectra for deprotonated naphthalene, anthracene, and pyrene in the gas phase. Spectra are compared with theoretical spectra computed at the density functional theory level. We show that the relative band intensities in different ranges of the IR spectrum deviate significantly from those of neutral and positively charged PAHs, and moreover from those of radical anion PAHs. These relative band intensities are, however, well reproduced by theory. An analysis of the frontier molecular orbitals of the even- and odd-electron anions reveals a high degree of charge localization in the deprotonated systems, qualitatively explaining the observed differences and suggesting unusually high electric dipole moments for this class of PAH molecules.

  15. Negative Differential Conductance from Space Charge Limited Currents in Semiconductors

    NASA Astrophysics Data System (ADS)

    Brooks, Andrew; Zhang, Xiaoguang

    Applying the theory of space charge limited currents (SCLC), we show that negative differential conductance can arise from doubly occupied traps that are nearly degenerate with the bottom of the conduction band. Using degenerate state perturbation theory, the Coulomb energy of the doubly occupied traps is shown to depend on the hybridization with the conduction band states. Initially, when carriers are injected into the solid, traps begin to fill while the conduction band states stay relatively empty and thus accessible to trapped electrons via hopping. Trap and conduction states continue to be filled as current is increased, and the energy of trapped electrons begins to rise. A critical current is reached whereupon a further increase in current leads to a reduction of filled traps (i.e. a reduction of space charge in the solid), and thus a corresponding decrease in voltage. This trend in the current-voltage characteristic curves persists until the bottom of the conduction band has been filled, then voltage rises with current.

  16. Excited states and valley effects in a negatively charged impurity in a silicon FinFET.

    SciTech Connect

    Hollenberg, Lloyd; Klimeck, Gerhard; Carroll, Malcolm S.; Rahman, Rajib; Muller, Richard Partain; Rogge, Sven; Verduijn, Arjan; Lansbergen, Gabriel

    2010-07-01

    The observation and characterization of a single atom system in silicon is a significant landmark in half a century of device miniaturization, and presents an important new laboratory for fundamental quantum and atomic physics. We compare with multi-million atom tight binding (TB) calculations the measurements of the spectrum of a single two-electron (2e) atom system in silicon - a negatively charged (D-) gated Arsenic donor in a FinFET. The TB method captures accurate single electron eigenstates of the device taking into account device geometry, donor potentials, applied fields, interfaces, and the full host bandstructure. In a previous work, the depths and fields of As donors in six device samples were established through excited state spectroscopy of the D0 electron and comparison with TB calculations. Using self-consistent field (SCF) TB, we computed the charging energies of the D- electron for the same six device samples, and found good agreement with the measurements. Although a bulk donor has only a bound singlet ground state and a charging energy of about 40 meV, calculations show that a gated donor near an interface can have a reduced charging energy and bound excited states in the D- spectrum. Measurements indeed reveal reduced charging energies and bound 2e excited states, at least one of which is a triplet. The calculations also show the influence of the host valley physics in the two-electron spectrum of the donor.

  17. Charge transfer and negative curvature energy in magnesium boride nanotubes

    NASA Astrophysics Data System (ADS)

    Tang, Hui; Ismail-Beigi, Sohrab

    2016-07-01

    Using first-principles calculations based on density functional theory, we study the energetics and charge transfer effects in MgBx nanotubes and two-dimensional (2D) sheets. The behavior of adsorbed Mg on 2D boron sheets is found to depend on the amount of electron transfer between the two subsystems. The amount is determined by both the density of adsorbed Mg as well as the atomic-scale structure of the boron subsystem. The degree of transfer can lead to repulsive or attractive Mg-Mg interactions. In both cases, model MgBx nanotubes built from 2D MgBx sheets can display negative curvature energy: a relatively unusual situation in nanosystems where the energy cost to curve the parent 2D sheet into a small-diameter nanotube is negative. Namely, the small-diameter nanotube is energetically preferred over the corresponding flat sheet. We also discuss how these findings may manifest themselves in experimentally synthesized MgBx nanotubes.

  18. Positively charged polyethylenimines enhance nasal absorption of the negatively charged drug, low molecular weight heparin.

    PubMed

    Yang, Tianzhi; Hussain, Alamdar; Bai, Shuhua; Khalil, Ikramy A; Harashima, Hideyoshi; Ahsan, Fakhrul

    2006-10-27

    This study tests the hypothesis that positively charged polyethylenimines (PEIs) enhance nasal absorption of low molecular weight heparin (LMWH) by reducing the negative surface charge of the drug molecule. Physical interactions between PEIs and LMWH were studied by Fourier transform infrared (FTIR) spectroscopy, particle size analysis, conductivity measurements, zeta potential analysis, and azure A assay. The efficacy of PEIs in enhancing nasal absorption of LMWH was studied by administering LMWH formulated with PEI into the nose of anesthetized rats and monitoring drug absorption by measuring plasma anti-factor Xa activity. The metabolic stability of LMWH was evaluated by incubating the drug in rat nasal mucosal homogenates. FTIR spectra of the LMWH-PEI formulation showed a shift in peak position compared to LMWH or PEI alone. Decreases in conductivity, zeta potential and the amount of free LMWH in the PEI-LMWH formulation, as revealed by azure A assay, suggest that PEIs possibly neutralize the negative surface charge of LMWH. The efficacy of PEI in enhancing the bioavailability of nasally administered LMWH can be ranked as PEI-1000 kDa>or=PEI-750 kDa>PEI-25 kDa. When PEI-1000 kDa was used at a concentration of 0.25%, there was a 4-fold increase in both the absolute and relative bioavailabilities of LMWH compared to the control formulation. Overall, these results indicate that polyethylenimines can be used as potential carriers for nasally administered LMWHs. PMID:17023085

  19. First-Principle Framework for Total Charging Energies in Electrocatalytic Materials and Charge-Responsive Molecular Binding at Gas-Surface Interfaces.

    PubMed

    Tan, Xin; Tahini, Hassan A; Seal, Prasenjit; Smith, Sean C

    2016-05-01

    Heterogeneous charge-responsive molecular binding to electrocatalytic materials has been predicted in several recent works. This phenomenon offers the possibility of using voltage to manipulate the strength of the binding interaction with the target gas molecule and thereby circumvent thermochemistry constraints, which inhibit achieving both efficient binding and facile release of important targets such as CO2 and H2. Stability analysis of such charge-induced molecular adsorption has been beyond the reach of existing first-principle approaches. Here, we draw on concepts from semiconductor physics and density functional theory to develop a first principle theoretical approach that allows calculation of the change in total energy of the supercell due to charging. Coupled with the calculated adsorption energy of gas molecules at any given charge, this allows a complete description of the energetics of the charge-induced molecular adsorption process. Using CO2 molecular adsorption onto negatively charged h-BN (wide-gap semiconductor) and g-C4N3 (half metal) as example cases, our analysis reveals that - while adsorption is exothermic after charge is introduced - the overall adsorption processes are not intrinsically spontaneous due to the energetic cost of charging the materials. The energies needed to overcome the barriers of these processes are 2.10 and 0.43 eV for h-BN and g-C4N3, respectively. This first principle approach opens up new pathways for a more complete description of charge-induced and electrocatalytic processes.

  20. First-Principle Framework for Total Charging Energies in Electrocatalytic Materials and Charge-Responsive Molecular Binding at Gas-Surface Interfaces.

    PubMed

    Tan, Xin; Tahini, Hassan A; Seal, Prasenjit; Smith, Sean C

    2016-05-01

    Heterogeneous charge-responsive molecular binding to electrocatalytic materials has been predicted in several recent works. This phenomenon offers the possibility of using voltage to manipulate the strength of the binding interaction with the target gas molecule and thereby circumvent thermochemistry constraints, which inhibit achieving both efficient binding and facile release of important targets such as CO2 and H2. Stability analysis of such charge-induced molecular adsorption has been beyond the reach of existing first-principle approaches. Here, we draw on concepts from semiconductor physics and density functional theory to develop a first principle theoretical approach that allows calculation of the change in total energy of the supercell due to charging. Coupled with the calculated adsorption energy of gas molecules at any given charge, this allows a complete description of the energetics of the charge-induced molecular adsorption process. Using CO2 molecular adsorption onto negatively charged h-BN (wide-gap semiconductor) and g-C4N3 (half metal) as example cases, our analysis reveals that - while adsorption is exothermic after charge is introduced - the overall adsorption processes are not intrinsically spontaneous due to the energetic cost of charging the materials. The energies needed to overcome the barriers of these processes are 2.10 and 0.43 eV for h-BN and g-C4N3, respectively. This first principle approach opens up new pathways for a more complete description of charge-induced and electrocatalytic processes. PMID:27067063

  1. Astronomers Discover First Negatively-charged Molecule in Space

    NASA Astrophysics Data System (ADS)

    2006-12-01

    Cambridge, MA - Astronomers have discovered the first negatively charged molecule in space, identifying it from radio signals that were a mystery until now. While about 130 neutral and 14 positively charged molecules are known to exist in interstellar space, this is the first negative molecule, or anion, to be found. "We've spotted a rare and exotic species, like the white tiger of space," said astronomer Michael McCarthy of the Harvard-Smithsonian Center for Astrophysics (CfA). By learning more about the rich broth of chemicals found in interstellar space, astronomers hope to explain how the young Earth converted these basic ingredients into the essential chemicals for life. This new finding helps to advance scientists' understanding of the chemistry of the interstellar medium, and hence the birthplaces of planets. McCarthy worked with CfA colleagues Carl Gottlieb, Harshal Gupta (also from the Univ. of Texas), and Patrick Thaddeus to identify the molecular anion known as C6H-: a linear chain of six carbon atoms with one hydrogen atom at the end and an "extra" electron. Such molecules were thought to be extremely rare because ultraviolet light that suffuses space easily knocks electrons off molecules. The large size of C6H-, larger than most neutral and all positive molecules known in space, may increase its stability in the harsh cosmic environment. "The discovery of C6H- resolves a long-standing enigma in astrochemistry: the apparent lack of negatively charged molecules in space," stated Thaddeus. The team first conducted laboratory experiments to determine exactly what radio frequencies to use in their search. Then, they used the National Science Foundation's Robert C. Byrd Green Bank Telescope to hunt for C6H- in celestial objects. In particular, they targeted locations in which previous searches had spotted unidentified radio signals at the appropriate frequencies. They found C6H- in two very different locations-a shell of gas surrounding the evolved red giant

  2. Negatively Charged Lipids as a Potential Target for New Amphiphilic Aminoglycoside Antibiotics: A BIOPHYSICAL STUDY.

    PubMed

    Sautrey, Guillaume; El Khoury, Micheline; Dos Santos, Andreia Giro; Zimmermann, Louis; Deleu, Magali; Lins, Laurence; Décout, Jean-Luc; Mingeot-Leclercq, Marie-Paule

    2016-06-24

    Bacterial membranes are highly organized, containing specific microdomains that facilitate distinct protein and lipid assemblies. Evidence suggests that cardiolipin molecules segregate into such microdomains, probably conferring a negative curvature to the inner plasma membrane during membrane fission upon cell division. 3',6-Dinonyl neamine is an amphiphilic aminoglycoside derivative active against Pseudomonas aeruginosa, including strains resistant to colistin. The mechanisms involved at the molecular level were identified using lipid models (large unilamellar vesicles, giant unilamelllar vesicles, and lipid monolayers) that mimic the inner membrane of P. aeruginosa The study demonstrated the interaction of 3',6-dinonyl neamine with cardiolipin and phosphatidylglycerol, two negatively charged lipids from inner bacterial membranes. This interaction induced membrane permeabilization and depolarization. Lateral segregation of cardiolipin and membrane hemifusion would be critical for explaining the effects induced on lipid membranes by amphiphilic aminoglycoside antibiotics. The findings contribute to an improved understanding of how amphiphilic aminoglycoside antibiotics that bind to negatively charged lipids like cardiolipin could be promising antibacterial compounds.

  3. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    NASA Astrophysics Data System (ADS)

    Teyssedre, G.; Vu, T. T. N.; Laurent, C.

    2015-12-01

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  4. Evaluation of Different Virtual Screening Programs for Docking in a Charged Binding Pocket

    PubMed Central

    Deng, Wei; Verlinde, Christophe L. M. J.

    2009-01-01

    Virtual screening of small molecules against a protein target often identifies the correct pose, but the ranking in terms of binding energy remains a difficult problem, resulting in unacceptable numbers of false positives and negatives. To investigate this problem, the performance of three docking programs, FRED, QXP/FLO, and GLIDE, along with their five different scoring functions, was evaluated with the engineered cavity in cyctochrome c peroxidase (CCP). This small cavity is negatively charged and completely buried from solvent. A test set of 60 molecules, experimentally identified as 43 “binders” and 17 “non-binders”, were tested with the CCP binding site. The docking methods’ performance is quantified by the ROC curve and their reproduction of crystal poses. The effects from generation of different ligand tautomers and inclusion of water molecule in the cavity are also discussed. PMID:18821750

  5. Experimental evidence on removing copper and light-induced degradation from silicon by negative charge

    SciTech Connect

    Boulfrad, Yacine Lindroos, Jeanette; Yli-Koski, Marko; Savin, Hele; Wagner, Matthias; Wolny, Franziska

    2014-11-03

    In addition to boron and oxygen, copper is also known to cause light-induced degradation (LID) in silicon. We have demonstrated previously that LID can be prevented by depositing negative corona charge onto the wafer surfaces. Positively charged interstitial copper ions are proposed to diffuse to the negatively charged surface and consequently empty the bulk of copper. In this study, copper out-diffusion was confirmed by chemical analysis of the near surface region of negatively/positively charged silicon wafer. Furthermore, LID was permanently removed by etching the copper-rich surface layer after negative charge deposition. These results demonstrate that (i) copper can be effectively removed from the bulk by negative charge, (ii) under illumination copper forms a recombination active defect in the bulk of the wafer causing severe light induced degradation.

  6. An analysis of five negative sprite-parent discharges and their associated thunderstorm charge structures

    NASA Astrophysics Data System (ADS)

    Boggs, Levi D.; Liu, Ningyu; Splitt, Michael; Lazarus, Steven; Glenn, Chad; Rassoul, Hamid; Cummer, Steven A.

    2016-01-01

    In this study we analyze the discharge morphologies of five confirmed negative sprite-parent discharges and the associated charge structures of the thunderstorms that produced them. The negative sprite-parent lightning took place in two thunderstorms that were associated with a tropical disturbance in east central and south Florida. The first thunderstorm, which moved onshore in east central Florida, produced four of the five negative sprite-parent discharges within a period of 17 min, as it made landfall from the Atlantic Ocean. These negative sprite-parents were composed of bolt-from-the-blue (BFB), hybrid intracloud-negative cloud-to-ground (IC-NCG), and multicell IC-NCGs discharges. The second thunderstorm, which occurred inland over south Florida, produced a negative sprite-parent that was a probable hybrid IC-NCG discharge and two negative gigantic jets (GJs). Weakened upper positive charge with very large midlevel negative charge was inferred for both convective cells that initiated the negative-sprite-parent discharges. Our study suggests tall, intense convective systems with high wind shear at the middle to upper regions of the cloud accompanied by low cloud-to-ground (CG) flash rates promote these charge structures. The excess amount of midlevel negative charge results in these CG discharges transferring much more charge to ground than typical negative CG discharges. We find that BFB discharges prefer an asymmetrical charge structure that brings the negative leader exiting the upper positive charge region closer to the lateral positive screening charge layer. This may be the main factor in determining whether a negative leader exiting the upper positive region of the thundercloud forms a BFB or GJ.

  7. Unveiling Residual Molecular Binding in Triply Charged Hydrogen Bromide

    SciTech Connect

    Penent, F.; Lablanquie, P.; Palaudoux, J.; Gamblin, G.; Carniato, S.; Andric, L.; Hikosaka, Y.; Ito, K.

    2011-03-11

    We present an experimental and theoretical study of triply charged hydrogen bromide ions formed by photoionization of the inner 3d shell of Br. The experimental results, obtained by detecting the 3d photoelectron in coincidence with the two subsequent Auger electrons, are analyzed using calculated potential energy curves of HBr{sup 3+}. The competition between the short-range chemical binding potential and the Coulomb repulsion in the dissociative process is shown. Two different mechanisms are observed for double Auger decay: one, a direct process with simultaneous ejection of two Auger electrons to final HBr{sup 3+} ionic states and the other, a cascade process involving double Auger decay characterized by the autoionization of Br*{sup +} ion subsequent to the HBr{sup 2+} fragmentation.

  8. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    SciTech Connect

    Teyssedre, G. Laurent, C.; Vu, T. T. N.

    2015-12-21

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  9. New effects of a long-lived negatively charged massive particle on big bang nucleosynthesis

    SciTech Connect

    Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki; Kajino, Toshitaka; Kino, Yasushi; Mathews, Grant J.

    2014-05-02

    Primordial {sup 7}Li abundance inferred from observations of metal-poor stars is a factor of about 3 lower than the theoretical value of standard big bang nucleosynthesis (BBN) model. One of the solutions to the Li problem is {sup 7}Be destruction during the BBN epoch caused by a long-lived negatively charged massive particle, X{sup −}. The particle can bind to nuclei, and X-bound nuclei (X-nuclei) can experience new reactions. The radiative X{sup −} capture by {sup 7}Be nuclei followed by proton capture of the bound state of {sup 7}Be and X{sup −} ({sup 7}Be{sub x}) is a possible {sup 7}Be destruction reaction. Since the primordial abundance of {sup 7}Li originates mainly from {sup 7}Li produced via the electron capture of {sup 7}Be after BBN, the {sup 7}Be destruction provides a solution to the {sup 7}Li problem. We suggest a new route of {sup 7}Be{sub x} formation, that is the {sup 7}Be charge exchange at the reaction of {sup 7}Be{sup 3+} ion and X{sup −}. The formation rate depends on the ionization fraction of {sup 7}Be{sup 3+} ion, the charge exchange cross section of {sup 7}Be{sup 3+}, and the probability that excited states {sup 7}Be{sub x}* produced at the charge exchange are converted to the ground state. We find that this reaction can be equally important as or more important than ordinary radiative recombination of {sup 7}Be and X{sup −}. The effect of this new route is shown in a nuclear reaction network calculation.

  10. Hyperactive Arg39Lys mutated mnemiopsin: implication of positively charged residue in chromophore binding cavity.

    PubMed

    Mahdavi, Atiyeh; Sajedi, Reza H; Hosseinkhani, Saman; Taghdir, Majid

    2015-04-01

    Mnemiopsin, a Ca(2+)-regulated photoprotein isolated from Mnemiopsis leidyi, belongs to the family of ctenophore photoproteins. These proteins emit blue light from a chromophore, which is tightly but non-covalently bound in their central hydrophobic core that contains 21 conserved residues. In an effort to investigate the role of Arg39 (the sole charged residue in coelenterazine binding cavity of ctenophore photoproteins) in bioluminescence properties of these photoproteins, three mutated forms of mnemiopsin 1 (R39E, R39K and R39M) were constructed and characterized. The results indicate that while the luminescence activity of R39K mutated mnemiopsin has increased about nine fold compared to the wild type, R39M and R39E mutated mnemiopsins have entirely lost their activities. The most distinguished properties of R39K mutated photoprotein are its high activity, slow rate of luminescence decay and broad pH profile compared to the wild type. The complete loss of bioluminescence activity in mutated photoproteins with negatively charged and aliphatic residues (R39E and R39M, respectively) shows that the presence of a positively charged residue at this position is necessary. The results of spectroscopic studies, including CD, intrinsic and extrinsic fluorescence measurements and acrylamide quenching studies show that, while the substitutions lead to structural rigidity in R39E and R39M mutated mnemiopsins, structural flexibility is obvious in R39K mutated mnemiopsin. The presence of a more localized positive charge on ε-amino group of Lys compared to guanidinium group of Arg residue in close proximity to the choromophre might affect its fixation in the binding cavity and result in increased bioluminescence activity in this mutated photoprotein. It appears that the polarity and flexibility of positively charged residue at this position finely tunes the luminescence properties of ctenophore photoproteins. PMID:25635518

  11. Maximizing ion current by space-charge neutralization using negative ions and dust particles

    SciTech Connect

    Smirnov, A.; Raitses, Y.; Fisch, N.J.

    2005-05-15

    Ion current extracted from an ion source (ion thruster) can be increased above the Child-Langmuir limit if the ion space charge is neutralized. Similarly, the limiting kinetic energy density of the plasma flow in a Hall thruster might be exceeded if additional mechanisms of space-charge neutralization are introduced. Space-charge neutralization with high-mass negative ions or negatively charged dust particles seems, in principle, promising for the development of a high current or high energy density source of positive light ions. Several space-charge neutralization schemes that employ heavy negatively charged particles are considered. It is shown that the proposed neutralization schemes can lead, at best, only to a moderate but nonetheless possibly important increase of the ion current in the ion thruster and the thrust density in the Hall thruster.

  12. Charging-delay induced dust acoustic collisionless shock wave: Roles of negative ions

    SciTech Connect

    Ghosh, Samiran; Bharuthram, R.; Khan, Manoranjan; Gupta, M. R.

    2006-11-15

    The effects of charging-delay and negative ions on nonlinear dust acoustic waves are investigated. It has been found that the charging-delay induced anomalous dissipation causes generation of dust acoustic collisionless shock waves in an electronegative dusty plasma. The small but finite amplitude wave is governed by a Korteweg-de Vries Burger equation in which the Burger term arises due to the charging-delay. Numerical investigations reveal that the charging-delay induced dissipation and shock strength decreases (increases) with the increase of negative ion concentration (temperature)

  13. Charge as you like! Efficient manipulation of negative ion net charge in electrospray ionization of proteins and nucleic acids.

    PubMed

    Ganisl, Barbara; Taucher, Monika; Riml, Christian; Breuker, Kathrin

    2011-01-01

    Acidic proteins and nucleic acids such as RNA are most readily ionized in electrospray ionization (ESI) operated in negative-ion mode. The multiply deprotonated protein or RNA ions can be used as precursors in top- down mass spectrometry. Because the performance of the dissociation method used critically depends on precursor ion negative net charge, it is important that the extent of charging in ESI can be manipulated efficiently. We show here that (M - nH)(n-) ion net charge of proteins and RNA can be controlled efficiently by the addition of organic bases to the electrosprayed solution. Our study also highlights the fact that ion formation in ESI in negative mode is only poorly understood. PMID:22006635

  14. Interaction of quinine with negatively charged lipid vesicles studied by fluorescence spectroscopy Influence of the pH

    NASA Astrophysics Data System (ADS)

    Pedrós, Jesús; Porcar, Iolanda; Gómez, Clara M.; Campos, Agustín; Abad, Concepción

    1997-03-01

    The interaction of quinine with dimyristoylphosphatidic acid (DMPA) and dimyristoylphosphatidyl glycerol (DMPG) small unilamellar vesicles in the gel phase was studied by steady-state fluorescence spectroscopy at pHs 7, 6, 5 and 4 and 20°C. In aqueous solution, with excitation at 335 nm, the emission fluorescence spectrum of quinine varied with pH reflecting the occurrence of different charged species of the drug. In all cases, the emission maximum centered at 383 or 443 nm shifted to lower wavelength in the presence of vesicles. This indicates that the membrane-bound state quinine is in an environment of low polarity. Drug monocationic species were deeply buried in DMPG relative to DMPA bilayers whereas no significant differences were observed for dicationic species, the fluorophore being located in this case in a more aqueous-like environment. Experimental association isotherms generated from fluorescence intensity changes were quantitatively analyzed in terms of the binding equilibrium model. Although the binding affinity of quinine to anionic membranes was always higher for DMPG over DMPA, dicationic species showed a reduced ability to bind the negatively charged membrane. In addition, the binding model has been related with the partition model leading to a good agreement between the theoretical (calculated from the binding model) and the experimental (from the initial slope of the experimental isotherms) partition coefficient derived in each case.

  15. Negatively charged nanoparticles produced by splashing of water

    NASA Astrophysics Data System (ADS)

    Tammet, H.; Hõrrak, U.; Kulmala, M.

    2009-01-01

    The production of splashing-generated balloelectric intermediate ions was studied by means of mobility spectrometry in the atmosphere during the rain and in a laboratory experiment simulating the heavy rain. The partial neutralization of intermediate ions with cluster ions generated by beta rays suppressed the space charge of intermediate ions but preserved the shape of the mobility distribution. The balloelectric ions produced from the waterworks water of high TDS (Total Dissolved Solids) had about the same mobilities as the ions produced from the rainwater of low TDS. This suggests that the balloelectric ions can be considered as singly charged water nanoparticles. By different measurements, the diameter mode of these particles was 2.2-2.7 nm, which is close to the diameter of 2.5 nm of the Chaplin's 280-molecule magic icosahedron superclusters. The measurements can be explained by a hypothesis that the pressure of saturated vapor over the nanoparticle surface is suppressed by a number of magnitudes due to the internal structure of the particles near the size of 2.5 nm. The records of the concentration bursts of balloelectric ions in the atmosphere are formally similar to the records of the nucleation bursts but they cannot be qualified as nucleation bursts because the particles are not growing but shrinking.

  16. Negatively charged nanoparticles produced by splashing of water

    NASA Astrophysics Data System (ADS)

    Tammet, H.; Hõrrak, U.; Kulmala, M.

    2008-09-01

    The production of splashing-generated balloelectric intermediate ions was studied by means of mobility spectrometry in the atmosphere during the rain and in a laboratory experiment simulating the heavy rain. The partial neutralization of intermediate ions with cluster ions generated by beta rays suppressed the space charge of intermediate ions but preserved the shape of the mobility distribution. The balloelectric ions produced from the waterworks water of high TDS (Total Dissolved Solids) had about the same mobilities as the ions produced from the rainwater of low TDS. This suggests that the balloelectric ions can be considered as singly charged water nanodroplets. By different measurements, the diameter mode of these droplets was 2.2 2.7 nm, which is close to the diameter of 2.5 nm of the Chaplin's 280-molecule magic icosahedron superclusters. The measurements can be explained by a hypothesis that the pressure of saturated vapor over the nanodroplet surface is suppressed by a number of magnitudes due to the internal structure of the droplets near the size of 2.5 nm. The records of the concentration bursts of balloelectric ions in the atmosphere are formally similar to the records of the nucleation bursts but they cannot be qualified as nucleation bursts because the particles are not growing but shrinking.

  17. Enhanced antidepressant-like effects of the macromolecule trefoil factor 3 by loading into negatively charged liposomes.

    PubMed

    Qin, Jing; Yang, Xu; Mi, Jia; Wang, Jianxin; Hou, Jia; Shen, Teng; Li, Yongji; Wang, Bin; Li, Xuri; Zhu, Weili

    2014-01-01

    Immunocytes, mainly neutrophils and monocytes, exhibit an intrinsic homing property, enabling them to migrate to sites of injury and inflammation. They can thus act as Trojan horses carrying concealed drug cargoes while migrating across impermeable barriers to sites of disease, especially the blood-brain barrier (BBB). In this study, to target circulating phagocytic cells, we formulated negatively charged nanosize liposomes and loaded trefoil factor 3 (TFF3) into liposomes by the pH-gradient method. According to the optimized formulation (5:1.5 of lipid to cholesterol, 10:1 of lipid to drug, 10 mg/mL of lipid concentration, and 10 mmol/L of phosphate-buffered saline), 44.47% entrapment efficiency was obtained for TFF3 liposomes with 129.6 nm particle size and -36.6 mV zeta potential. Compared with neutrally charged liposomes, the negatively charged liposomes showed a strong binding capacity with monocytes and were effectively carried by monocytes to cross the BBB in vitro. Furthermore, enhanced antidepressant-like effects were found in the tail-suspension and forced-swim tests in mice, as measured by decreased immobility time, as well as increased swimming time and reduced immobility in rats. These results suggested that negatively charged liposomes could improve the behavioral responses of TFF3, and our study opens up a new way for the development of effective therapies for brain disease by increasing the permeability of the BBB. PMID:25419129

  18. Aberration of a negative ion beam caused by space charge effect.

    PubMed

    Miyamoto, K; Wada, S; Hatayama, A

    2010-02-01

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  19. Spatial charge configuration regulates nanoparticle transport and binding behavior in vivo

    PubMed Central

    Han, Hee-Sun; Martin, John D.; Lee, Jungmin; Harris, Daniel K.; Fukumura, Dai; Jain, Rakesh K.; Bawendi, Moungi

    2013-01-01

    Detailed Charge arrangements: A new set of zwitterionic quantum dots were synthesized and used to study the influence of microscopic charge arrangements on the in vivo behavior of nanoparticles. Experiments using cultured cells and live mice demonstrate that the microscopic arrangement of surface charges strongly influence nonspecific binding, clearance behavior, and in vivo transport of nanoparticles. PMID:23255143

  20. Interactions of PAMAM dendrimers with negatively charged model biomembranes.

    PubMed

    Yanez Arteta, Marianna; Ainalem, Marie-Louise; Porcar, Lionel; Martel, Anne; Coker, Helena; Lundberg, Dan; Chang, Debby P; Soltwedel, Olaf; Barker, Robert; Nylander, Tommy

    2014-11-13

    We have investigated the interactions between cationic poly(amidoamine) (PAMAM) dendrimers of generation 4 (G4), a potential gene transfection vector, with net-anionic model biomembranes composed of different ratios of zwitterionic phosphocholine (PC) and anionic phospho-L-serine (PS) phospholipids. Two types of model membranes were used: solid-supported bilayers, prepared with lipids carrying palmitoyl-oleoyl (PO) and diphytanoyl (DPh) acyl chains, and free-standing bilayers, formed at the interface between two aqueous droplets in oil (droplet interface bilayers, DIBs) using the DPh-based lipids. G4 dendrimers were found to translocate through POPC:POPS bilayers deposited on silica surfaces. The charge density of the bilayer affects translocation, which is reduced when the ionic strength increases. This shows that the dendrimer-bilayer interactions are largely controlled by their electrostatic attraction. The structure of the solid-supported bilayers remains intact upon translocation of the dendrimer. However, the amount of lipids in the bilayer decreases and dendrimer/lipid aggregates are formed in bulk solution, which can be deposited on the interfacial layers upon dilution of the system with dendrimer-free solvent. Electrophysiology measurements on DIBs confirm that G4 dendrimers cross the lipid membranes containing PS, which then become more permeable to ions. The obtained results have implications for PAMAM dendrimers as delivery vehicles to cells. PMID:25310456

  1. Negatively charged liposomes show potent adjuvant activity when simply admixed with protein antigens

    PubMed Central

    Yanasarn, Nijaporn; Sloat, Brian R.; Cui, Zhengrong

    2011-01-01

    Liposomes have been investigated extensively as a vaccine delivery system. Herein the adjuvant activities of liposomes with different net surface charges (neutral, positive, or negative) were evaluated when admixed with protein antigens, ovalbumin (OVA, pI = 4.7), Bacillus anthracis protective antigen protein (PA, pI = 5.6), or cationized OVA (cOVA). Mice immunized subcutaneously with OVA admixed with different liposomes generated different antibody responses. Interestingly, OVA admixed with net negatively charged liposomes prepared with DOPA was as immunogenic as OVA admixed with positively charged liposomes prepared with DOTAP. Immunization of mice with the anthrax PA protein admixed with the net negatively charged DOPA liposomes also induced a strong and functional anti-PA antibody response. When the cationized OVA was used as a model antigen, liposomes with net neutral, negative, or positive charges showed comparable adjuvant activities. Immunization of mice with the OVA admixed with DOPA liposomes also induced OVA-specific CD8+ cytotoxic T lymphocyte responses and significantly delayed the growth of OVA-expressing B16-OVA tumors in mice. However, not all net negatively charged liposomes showed a strong adjuvant activity. The adjuvant activity of the negatively charged liposomes may be related to the liposome’s ability (i) to up-regulate the expression of molecules related to the activation and maturation of antigen-presenting cells and (ii) to slightly facilitate the uptake of the antigens by antigen-presenting cells. Simply admixing certain negatively charged liposomes with certain protein antigens of interest may represent a novel platform for vaccine development. PMID:21615153

  2. Enhancement of DNA compaction by negatively charged nanoparticles: effect of nanoparticle size and surfactant chain length.

    PubMed

    Rudiuk, Sergii; Yoshikawa, Kenichi; Baigl, Damien

    2012-02-15

    We study the compaction of genomic DNA by a series of alkyltrimethylammonium bromide surfactants having different hydrocarbon chain lengths n: dodecyl-(DTAB, n=12), tetradecyl-(TTAB, n=14) and hexadecyl-(CTAB, n=16), in the absence and in the presence of negatively charged silica nanoparticles (NPs) with a diameter in the range 15-100 nm. We show that NPs greatly enhance the ability of all cationic surfactants to induce DNA compaction and that this enhancement increases with an increase in NP diameter. In the absence of NP, the ability of cationic surfactants to induce DNA compaction increases with an increase in n. Conversely, in the presence of NPs, the enhancement of DNA compaction increases with a decrease in n. Therefore, although CTAB is the most efficient surfactant to compact DNA, maximal enhancement by NPs is obtained for the largest NP diameter (here, 100 nm) and the smallest surfactant chain length (here, DTAB). We suggest a mechanism where the preaggregation of surfactants on NP surface mediated by electrostatic interactions promotes cooperative binding to DNA and thus enhances the ability of surfactants to compact DNA. We show that the amplitude of enhancement is correlated with the difference between the surfactant concentration corresponding to aggregation on DNA alone and that corresponding to the onset of adsorption on nanoparticles.

  3. Protein surface-distribution and protein-protein interactions in the binding of peripheral proteins to charged lipid membranes.

    PubMed Central

    Heimburg, T; Marsh, D

    1995-01-01

    The binding of native cytochrome c to negatively charged lipid dispersions of dioleoyl phosphatidylglycerol has been studied over a wide range of ionic strengths. Not only is the strength of protein binding found to decrease rapidly with increasing ionic strength, but also the binding curves reach an apparent saturation level that decreases rapidly with increasing ionic strength. Analysis of the binding isotherms with a general statistical thermodynamic model that takes into account not only the free energy of the electrostatic double layer, but also the free energy of the surface distribution of the protein, demonstrates that the apparent saturation effects could arise from a competition between the out-of-plane binding reaction and the lateral in-plane interactions between proteins at the surface. It is found that association with nonlocalized sites results in binding isotherms that display the apparent saturation effect to a much more pronounced extent than does the Langmuir adsorption isotherm for binding to localized sites. With the model for nonlocalized sites, the binding isotherms of native cytochrome c can be described adequately by taking into account only the entropy of the surface distribution of the protein, without appreciable enthalpic interactions between the bound proteins. The binding of cytochrome c to dioleoyl phosphatidylglycerol dispersions at a temperature at which the bound protein is denatured on the lipid surface, but is nondenatured when free in solution, has also been studied. The binding curves for the surface-denatured protein differ from those for the native protein in that the apparent saturation at high ionic strength is less pronounced. This indicates the tendency of the denatured protein to aggregate on the lipid surface, and can be described by the binding isotherms for nonlocalized sites only if attractive interactions between the surface-bound proteins are included in addition to the distributional entropic terms. Additionally

  4. The influence of negative charged centers on the hole transport in a typical molecularly doped polymer

    NASA Astrophysics Data System (ADS)

    Tyutnev, Andrey P.; Ikhsanov, Renat Sh.; Saenko, Vladimir S.; Pozhidaev, Evgenii D.

    2014-03-01

    We have studied effects of the negative charged centers on the time of flight (TOF) curves measured in a typical hole-conducting molecularly doped polymer. The main effects are the unusual TOF (surface generation) current rise in the preflight region (be it a flat plateau or a cusp) due to the accumulated space charge and the current reduction at all times because of the monomolecular recombination. TOF-2 (bulk generation) transients are less sensitive to charged centers. Analysis of these effects has proved that charged centers do not change the carrier mobility provided that the space charge field and bimolecular recombination are properly accounted for in terms of the proposed two-layer MT model. We have shown that combination of TOF, TOF-1a and TOF-2 variants of the electron-gun based technique allows one to establish definitively the character of the charge carrier transport in MDPs.

  5. Structural Basis for Negative Cooperativity in Growth Factor Binding to an EGF Receptor

    SciTech Connect

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.

    2010-09-27

    Transmembrane signaling by the epidermal growth factor receptor (EGFR) involves ligand-induced dimerization and allosteric regulation of the intracellular tyrosine kinase domain. Crystallographic studies have shown how ligand binding induces dimerization of the EGFR extracellular region but cannot explain the high-affinity and low-affinity classes of cell-surface EGF-binding sites inferred from curved Scatchard plots. From a series of crystal structures of the Drosophila EGFR extracellular region, we show here how Scatchard plot curvature arises from negatively cooperative ligand binding. The first ligand-binding event induces formation of an asymmetric dimer with only one bound ligand. The unoccupied site in this dimer is structurally restrained, leading to reduced affinity for binding of the second ligand, and thus negative cooperativity. Our results explain the cell-surface binding characteristics of EGF receptors and suggest how individual EGFR ligands might stabilize distinct dimeric species with different signaling properties.

  6. Ionic Surfactant Binding to pH-Responsive Polyelectrolyte Brush-Grafted Nanoparticles in Suspension and on Charged Surfaces.

    PubMed

    Riley, John K; An, Junxue; Tilton, Robert D

    2015-12-29

    The interactions between silica nanoparticles grafted with a brush of cationic poly(2-(dimethylamino) ethyl methacrylate) (SiO2-g-PDMAEMA) and anionic surfactant sodium dodecyl sulfate (SDS) is investigated by dynamic light scattering, electrophoretic mobility, quartz crystal microbalance with dissipation, ellipsometry, and atomic force microscopy. SiO2-g-PDMAEMA exhibits pH-dependent charge and size properties which enable the SDS binding to be probed over a range of electrostatic conditions and brush conformations. SDS monomers bind irreversibly to SiO2-g-PDMAEMA at low surfactant concentrations (∼10(-4) M) while exhibiting a pH-dependent threshold above which cooperative, partially reversible SDS binding occurs. At pH 5, SDS binding induces collapse of the highly charged and swollen brush as observed in the bulk by DLS and on surfaces by QCM-D. Similar experiments at pH 9 suggest that SDS binds to the periphery of the weakly charged and deswollen brush and produces SiO2-g-PDMAEMA/SDS complexes with a net negative charge. SiO2-g-PDMAEMA brush collapse and charge neutralization is further confirmed by colloidal probe AFM measurements, where reduced electrosteric repulsions and bridging adhesion are attributed to effects of the bound SDS. Additionally, sequential adsorption schemes with SDS and SiO2-g-PDMAEMA are used to enhance deposition relative to SiO2-g-PDMAEMA direct adsorption on silica. This work shows that the polyelectrolyte brush configuration responds in a more dramatic fashion to SDS than to pH-induced changes in ionization, and this can be exploited to manipulate the structure of adsorbed layers and the corresponding forces of compression and friction between opposing surfaces.

  7. The Role of Negative Charge in the Delivery of Quantum Dots to Neurons

    PubMed Central

    Walters, Ryan; Medintz, Igor L.; Delehanty, James B.; Stewart, Michael H.; Susumu, Kimihiro; Huston, Alan L.; Dawson, Philip E.

    2015-01-01

    Despite our extensive knowledge of the structure of negatively charged cell surface proteoglycans and sialoglycoconjugates in the brain, we have little understanding of how their negative charge contributes to brain function. We have previously shown that intensely photoluminescent 9-nm diameter quantum dots (QDs) with a CdSe core, a ZnS shell, and a negatively charged compact molecular ligand coating (CL4) selectively target neurons rather than glia. We now provide an explanation for this selective neuronal delivery. In this study, we compared three zwitterionic QD coatings differing only in their regions of positive or negative charge, as well as a positively charged (NH2) polyethylene glycol (PEG) coat, for their ability to deliver the cell-membrane-penetrating chaperone lipopeptide JB577 (WG(Palmitoyl)VKIKKP9G2H6) to individual cells in neonatal rat hippocampal slices. We confirm both that preferential uptake in neurons, and the lack of uptake in glia, is strongly associated with having a region of greater negative charge on the QD coating. In addition, the role of negatively charged chondroitin sulfate of the extracellular matrix (ECM) in restricting uptake was further suggested by digesting neonatal rat hippocampal slices with chondroitinase ABC and showing increased uptake of QDs by oligodendrocytes. Treatment still did not affect uptake in astrocytes or microglia. Finally, the future potential of using QDs as vehicles for trafficking proteins into cells continues to show promise, as we show that by administering a histidine-tagged green fluorescent protein (eGFP-His6) to hippocampal slices, we can observe neuronal uptake of GFP. PMID:26243591

  8. The Role of Negative Charge in the Delivery of Quantum Dots to Neurons.

    PubMed

    Walters, Ryan; Medintz, Igor L; Delehanty, James B; Stewart, Michael H; Susumu, Kimihiro; Huston, Alan L; Dawson, Philip E; Dawson, Glyn

    2015-01-01

    Despite our extensive knowledge of the structure of negatively charged cell surface proteoglycans and sialoglycoconjugates in the brain, we have little understanding of how their negative charge contributes to brain function. We have previously shown that intensely photoluminescent 9-nm diameter quantum dots (QDs) with a CdSe core, a ZnS shell, and a negatively charged compact molecular ligand coating (CL4) selectively target neurons rather than glia. We now provide an explanation for this selective neuronal delivery. In this study, we compared three zwitterionic QD coatings differing only in their regions of positive or negative charge, as well as a positively charged (NH2) polyethylene glycol (PEG) coat, for their ability to deliver the cell-membrane-penetrating chaperone lipopeptide JB577 (WG(Palmitoyl)VKIKKP9G2H6) to individual cells in neonatal rat hippocampal slices. We confirm both that preferential uptake in neurons, and the lack of uptake in glia, is strongly associated with having a region of greater negative charge on the QD coating. In addition, the role of negatively charged chondroitin sulfate of the extracellular matrix (ECM) in restricting uptake was further suggested by digesting neonatal rat hippocampal slices with chondroitinase ABC and showing increased uptake of QDs by oligodendrocytes. Treatment still did not affect uptake in astrocytes or microglia. Finally, the future potential of using QDs as vehicles for trafficking proteins into cells continues to show promise, as we show that by administering a histidine-tagged green fluorescent protein (eGFP-His6) to hippocampal slices, we can observe neuronal uptake of GFP. PMID:26243591

  9. Cell proliferation and cell sheet detachment from the positively and negatively charged nanocomposite hydrogels.

    PubMed

    Liu, Dan; Wang, Tao; Liu, Xinxing; Tong, Zhen

    2014-01-01

    The charged nanocomposite hydrogels (NC gels) were synthesized by copolymerization of positively or negatively chargeable monomer with N-isopropylacrylamide (NIPAm) in the aqueous suspension of hectorite clay. The ionic NC gels preserved the thermo-responsibility with the phase-transition temperature below 37°C. The L929 cell proliferation was sensitive to charge polarity and charge density. As compared to the PNIPAm NC gel, the cationic NC gels with <5 mol % of 2-(dimethylamino)ethyl methacrylate (DMAEMA) showed improved cell proliferation, whereas the cells grew slowly on the gels with negatively charged 2-acrylamido-2-methylpropane sulfonic acid (AMPSNa). By lowering temperature, rapid cell sheet detachment was observed from the surface of ionic NC gels with 1 mol % of ionizable monomers. However, lager amount of AMPSNa or DMAEMA did not support rapid cell sheet detachment, probably owing to the adverse swelling effects and/or enhanced electrostatic attraction.

  10. Presence of negative charge on the basal planes of New York talc.

    PubMed

    Burdukova, E; Becker, M; Bradshaw, D J; Laskowski, J S

    2007-11-01

    Potentiometric titration measurements as well as rheological measurements of talc aqueous suspensions indicate that the behavior of the New York talc particles is consistent with the presence of a negative charge on their basal planes. The possibility of the presence of a negative electrical charge on the basal planes of talc particles is analyzed in this paper. Samples of New York talc were studied using electron microprobe analysis and dehydration techniques and the exact chemical formula of New York talc was determined. It was found that there exists a deficiency of protons in the tetrahedral layers of talc, resulting from substitution of Si(4+) ions with Al(3+) and Ti(3+) ions. The comparison of the level of substitution of Si(4+) ions with ions of a lower valency was found to be of a similar order of magnitude as that found in other talc deposits. This strongly points to the presence of a negative charge on the talc basal planes.

  11. Dust acoustic solitary wave with variable dust charge: Role of negative ions

    SciTech Connect

    Ghosh, Samiran

    2005-09-15

    The role of negative ions on small but finite amplitude dust acoustic solitary wave including the effects of high and low charging rates of dust grains compared to the dust oscillation frequency in electronegative dusty plasma is investigated. In the case of high charging rate, the solitary wave is governed by Korteweg-de Vries (KdV) equation, but in the case of low charging rate, it is governed by KdV equation with a linear damping term. Numerical investigations reveal that in both cases dust acoustic soliton sharpens (flatens) and soliton width decreases (increases) with the increase of negative-ion number density (temperature). Also, the negative ions reduce the damping rate.

  12. Process for preparing negative plates for use in a dry charge battery

    SciTech Connect

    Wegner, P.C.

    1986-02-11

    This patent describes a process for the production of lead-containing negative plates for use in a dry charge battery. The process cnsists of drying wet negative plates while protecting them from oxidation. This improvement is accomplished by treating the wet negative plates prior to the drying operation with an aqueous soluton of an oxidation inhibiting agent selected from salicylic acid, and 2-naphtol. The plates are then protected against oxidation during drying; and dry negative plates are obtained which are resistant to the absorption of water from the atmosphere on storage but are wet immediately by battery acid in use.

  13. Gram-negative trimeric porins have specific LPS binding sites that are essential for porin biogenesis.

    PubMed

    Arunmanee, Wanatchaporn; Pathania, Monisha; Solovyova, Alexandra S; Le Brun, Anton P; Ridley, Helen; Baslé, Arnaud; van den Berg, Bert; Lakey, Jeremy H

    2016-08-23

    The outer membrane (OM) of gram-negative bacteria is an unusual asymmetric bilayer with an external monolayer of lipopolysaccharide (LPS) and an inner layer of phospholipids. The LPS layer is rigid and stabilized by divalent cation cross-links between phosphate groups on the core oligosaccharide regions. This means that the OM is robust and highly impermeable to toxins and antibiotics. During their biogenesis, OM proteins (OMPs), which function as transporters and receptors, must integrate into this ordered monolayer while preserving its impermeability. Here we reveal the specific interactions between the trimeric porins of Enterobacteriaceae and LPS. Isolated porins form complexes with variable numbers of LPS molecules, which are stabilized by calcium ions. In earlier studies, two high-affinity sites were predicted to contain groups of positively charged side chains. Mutation of these residues led to the loss of LPS binding and, in one site, also prevented trimerization of the porin, explaining the previously observed effect of LPS mutants on porin folding. The high-resolution X-ray crystal structure of a trimeric porin-LPS complex not only helps to explain the mutagenesis results but also reveals more complex, subtle porin-LPS interactions and a bridging calcium ion.

  14. Gram-negative trimeric porins have specific LPS binding sites that are essential for porin biogenesis.

    PubMed

    Arunmanee, Wanatchaporn; Pathania, Monisha; Solovyova, Alexandra S; Le Brun, Anton P; Ridley, Helen; Baslé, Arnaud; van den Berg, Bert; Lakey, Jeremy H

    2016-08-23

    The outer membrane (OM) of gram-negative bacteria is an unusual asymmetric bilayer with an external monolayer of lipopolysaccharide (LPS) and an inner layer of phospholipids. The LPS layer is rigid and stabilized by divalent cation cross-links between phosphate groups on the core oligosaccharide regions. This means that the OM is robust and highly impermeable to toxins and antibiotics. During their biogenesis, OM proteins (OMPs), which function as transporters and receptors, must integrate into this ordered monolayer while preserving its impermeability. Here we reveal the specific interactions between the trimeric porins of Enterobacteriaceae and LPS. Isolated porins form complexes with variable numbers of LPS molecules, which are stabilized by calcium ions. In earlier studies, two high-affinity sites were predicted to contain groups of positively charged side chains. Mutation of these residues led to the loss of LPS binding and, in one site, also prevented trimerization of the porin, explaining the previously observed effect of LPS mutants on porin folding. The high-resolution X-ray crystal structure of a trimeric porin-LPS complex not only helps to explain the mutagenesis results but also reveals more complex, subtle porin-LPS interactions and a bridging calcium ion. PMID:27493217

  15. Bionic design for surface optimization combining hydrophilic and negative charged biological macromolecules.

    PubMed

    Ran, Fen; Song, Haiming; Niu, Xiaoqin; Yang, Aimei; Nie, Shengqiang; Wang, Lingren; Li, Jie; Sun, Shudong; Zhao, Changsheng

    2014-06-01

    While polyethersulfone (PES) membrane represents a promising option for blood purification, the blood compatibility must be dramatically enhanced to meet today's ever-increasing demands for many emerging application. In this study, we report a bionic design for optimization and development of a modified PES membrane combining hydrophilic and negative charged biological macromolecules on its surface. The hydrophilic and ionic charged biological macromolecules sulfonated poly(styrene)-b-poly(methyl methacrylate)-b-poly-(styrene) (PSSMSS) and poly(vinyl pyrrolidone)-b-poly(methyl methacrylate)-b-poly-(vinyl pyrrolidone) were synthesized via reversible addition-fragmentation chain transfer polymerization and used together to modify PES membranes by blending method. A hydrophilic membrane surface with negative charged surface coating was obtained, imitating the hydrophilic and negatively charged structure feature of heparin. The modified PES membranes showed suppressed platelet adhesion, and a prolonged blood clotting time, and thereby improved blood compatibility. In addition, the blood clotting time of the modified membranes increased with the blended PSSMSS amounts increment, indicating that both the hydrophilic and negative charged groups play important roles in improving the blood compatibility of PES membranes.

  16. Negative space charge effects in photon-enhanced thermionic emission solar converters

    SciTech Connect

    Segev, G.; Weisman, D.; Rosenwaks, Y.; Kribus, A.

    2015-07-06

    In thermionic energy converters, electrons in the gap between electrodes form a negative space charge and inhibit the emission of additional electrons, causing a significant reduction in conversion efficiency. However, in Photon Enhanced Thermionic Emission (PETE) solar energy converters, electrons that are reflected by the electric field in the gap return to the cathode with energy above the conduction band minimum. These electrons first occupy the conduction band from which they can be reemitted. This form of electron recycling makes PETE converters less susceptible to negative space charge loss. While the negative space charge effect was studied extensively in thermionic converters, modeling its effect in PETE converters does not account for important issues such as this form of electron recycling, nor the cathode thermal energy balance. Here, we investigate the space charge effect in PETE solar converters accounting for electron recycling, with full coupling of the cathode and gap models, and addressing conservation of both electric and thermal energy. The analysis shows that the negative space charge loss is lower than previously reported, allowing somewhat larger gaps compared to previous predictions. For a converter with a specific gap, there is an optimal solar flux concentration. The optimal solar flux concentration, the cathode temperature, and the efficiency all increase with smaller gaps. For example, for a gap of 3 μm the maximum efficiency is 38% and the optimal flux concentration is 628, while for a gap of 5 μm the maximum efficiency is 31% and optimal flux concentration is 163.

  17. The description of charge transfer in fast negative ions scattering on water covered Si(100) surfaces

    NASA Astrophysics Data System (ADS)

    Chen, Lin; Qiu, Shunli; Liu, Pinyang; Xiong, Feifei; Lu, Jianjie; Liu, Yuefeng; Li, Guopeng; Liu, Yiran; Ren, Fei; Xiao, Yunqing; Gao, Lei; Zhao, Qiushuang; Ding, Bin; Li, Yuan; Guo, Yanling; Chen, Ximeng

    2016-11-01

    Doping has significantly affected the characteristics and performance of semiconductor electronic devices. In this work, we study the charge transfer processes for 8.5-22.5 keV C- and F- ions scattering on H2O-terminated p-type Si(100) surfaces with two different doping concentrations. We find that doping has no influence on negative-ion formation for fast collisions in this relatively high energy range. Moreover, we build a model to calculate negative ion fractions including the contribution from positive ions. The calculations support the nonadiabatic feature of charge transfer.

  18. Charge reorganization energy and small polaron binding energy of rubrene thin films by ultraviolet photoelectron spectroscopy.

    PubMed

    Duhm, Steffen; Xin, Qian; Hosoumi, Shunsuke; Fukagawa, Hirohiko; Sato, Kazushi; Ueno, Nobuo; Kera, Satoshi

    2012-02-14

    The hole–phonon coupling of a rubrene monolayer on graphite is measured by means of angle resolved ultraviolet photoelectron spectroscopy. Thus, the charge reorganization energy λ and the small polaron binding energy is determined, which allows insight into the nature of charge transport in condensed rubrene. PMID:22403829

  19. Bactericidal action mechanism of negatively charged food grade clove oil nanoemulsions.

    PubMed

    Majeed, Hamid; Liu, Fei; Hategekimana, Joseph; Sharif, Hafiz Rizwan; Qi, Jing; Ali, Barkat; Bian, Yuan-Yuan; Ma, Jianguo; Yokoyama, Wallace; Zhong, Fang

    2016-04-15

    Clove oil (CO) anionic nanoemulsions were prepared with varying ratios of CO to canola oil (CA), emulsified and stabilized with purity gum ultra (PGU), a newly developed succinylated waxy maize starch. Interfacial tension measurements showed that CO acted as a co-surfactant and there was a gradual decrease in interfacial tension which favored the formation of small droplet sizes on homogenization until a critical limit (5:5% v/v CO:CA) was reached. Antimicrobial activity of the negatively charged CO nanoemulsion was determined against Gram positive GPB (Listeria monocytogenes and Staphylococcus aureus) and Gram negative GNB (Escherichia coli) bacterial strains using minimum inhibitory concentration (MIC) and a time kill dynamic method. Negatively charged PGU emulsified CO nanoemulsion showed prolonged antibacterial activities against Gram positive bacterial strains. We concluded that negatively charged CO nanoemulsion droplets self-assemble with GPB cell membrane, and facilitated interaction with cellular components of bacteria. Moreover, no electrostatic interaction existed between negatively charged droplets and the GPB membrane. PMID:26616926

  20. Bactericidal action mechanism of negatively charged food grade clove oil nanoemulsions.

    PubMed

    Majeed, Hamid; Liu, Fei; Hategekimana, Joseph; Sharif, Hafiz Rizwan; Qi, Jing; Ali, Barkat; Bian, Yuan-Yuan; Ma, Jianguo; Yokoyama, Wallace; Zhong, Fang

    2016-04-15

    Clove oil (CO) anionic nanoemulsions were prepared with varying ratios of CO to canola oil (CA), emulsified and stabilized with purity gum ultra (PGU), a newly developed succinylated waxy maize starch. Interfacial tension measurements showed that CO acted as a co-surfactant and there was a gradual decrease in interfacial tension which favored the formation of small droplet sizes on homogenization until a critical limit (5:5% v/v CO:CA) was reached. Antimicrobial activity of the negatively charged CO nanoemulsion was determined against Gram positive GPB (Listeria monocytogenes and Staphylococcus aureus) and Gram negative GNB (Escherichia coli) bacterial strains using minimum inhibitory concentration (MIC) and a time kill dynamic method. Negatively charged PGU emulsified CO nanoemulsion showed prolonged antibacterial activities against Gram positive bacterial strains. We concluded that negatively charged CO nanoemulsion droplets self-assemble with GPB cell membrane, and facilitated interaction with cellular components of bacteria. Moreover, no electrostatic interaction existed between negatively charged droplets and the GPB membrane.

  1. Sprite produced by consecutive impulse charge transfers following a negative stroke: Observation and simulation

    NASA Astrophysics Data System (ADS)

    Lu, Gaopeng; Cummer, Steven A.; Tian, Ye; Zhang, Hongbo; Lyu, Fanchao; Wang, Tao; Stanley, Mark A.; Yang, Jing; Lyons, Walter A.

    2016-04-01

    On the morning of 5 June 2013, two cameras of the SpriteCam network concurrently captured a red sprite with diffuse halo over a mesoscale convective system (MCS) passing the panhandle area of Oklahoma. This sprite was produced by a negative cloud-to-ground (CG) stroke with peak current of -103 kA in a manner different from previous observations in several aspects. First of all, the causative stroke of sprite is located by the National Lightning Detection Network (NLDN) in the trailing stratiform of MCS, instead of the deep convection typically for negative sprites. Second, the sprite-producing stroke was likely the first stroke of a multistroke negative CG flash (with ≥6 CG strokes) whose evolution was mainly confined in the lower part of thunderstorm; although the parent flash of sprite might contain relatively long in-cloud evolution prior to the first stroke, there is no evidence that the negative leader had propagated into the upper positive region of thundercloud as typically observed for the sprite-producing/class negative CG strokes. Third, as shown by the simulation with a two-dimensional full-wave electrodynamic model, although the impulse charge moment change (-190 C km) produced by the main stroke was not sufficient to induce conventional breakdown in the mesosphere, a second impulse charge transfer occurred with ~2 ms delay to cause a substantial charge transfer (-290 C km) so that the overall charge moment change (-480 C km) exceeded the threshold for sprite production; this is a scenario different from the typical case discussed by Li et al. (2012). As for the source of the second current pulse that played a critical role to produce the sprite, it could be an M component whose charge source was at least 9 km horizontally displaced from the main stroke or a negative CG stroke (with weak peak current for the return stroke) that was not detected by the NLDN.

  2. Calcium diffusion enhanced after cleavage of negatively charged components of brain extracellular matrix by chondroitinase ABC

    PubMed Central

    Hrabětová, Sabina; Masri, Daniel; Tao, Lian; Xiao, Fanrong; Nicholson, Charles

    2009-01-01

    The concentration of extracellular calcium plays a critical role in synaptic transmission and neuronal excitability as well as other physiological processes. The time course and extent of local fluctuations in the concentration of this ion largely depend on its effective diffusion coefficient (D*) and it has been speculated that fixed negative charges on chondroitin sulphate proteoglycans (CSPGs) and other components of the extracellular matrix may influence calcium diffusion because it is a divalent cation. In this study we used ion-selective microelectrodes combined with pressure ejection or iontophoresis of ions from a micropipette to quantify diffusion characteristics of neocortex and hippocampus in rat brain slices. We show that D* for calcium is less than the value predicted from the behaviour of the monovalent cation tetramethylammonium (TMA), a commonly used diffusion probe, but D* for calcium increases in both brain regions after the slices are treated with chondroitinase ABC, an enzyme that predominantly cleaves chondroitin sulphate glycans. These results suggest that CSPGs do play a role in determining the local diffusion properties of calcium in brain tissue, most likely through electrostatic interactions mediating rapid equilibrium binding. In contrast, chondroitinase ABC does not affect either the TMA diffusion or the extracellular volume fraction, indicating that the enzyme does not alter the structure of the extracellular space and that the diffusion of small monovalent cations is not affected by CSPGs in the normal brain ionic milieu. Both calcium and CSPGs are known to have many distinct roles in brain physiology, including brain repair, and our study suggests they may be functionally coupled through calcium diffusion properties. PMID:19546165

  3. Dynamic secondary electron emission characteristics of polymers in negative charging process

    NASA Astrophysics Data System (ADS)

    Weng, Ming; Hu, Tian-Cun; Zhang, Na; Cao, Meng

    2016-04-01

    We studied the dynamic secondary electron emission (SEE) characteristics of a polyimide sample in negative charging process under electron bombardment. The time evolution of secondary electron yield (SEY) has been measured with a pulsed electron gun. The dynamic SEY, as well as the surface potential have been analyzed using a capacitance model. The shift in surface potential caused by the negative charge accumulation on the sample reduces the landing energy of the primary electrons (PEs), which in turn alters the SEY. The charging process tends to be stable when the landing energy of PEs reaches the secondary crossover energy where the corresponding SEY is 1. The surface potential has an approximately negative exponential relationship with the irradiation time. The total accumulated charge at the stable state is found to be proportional to the product of the sample capacitance and the difference between initial incident energy and the secondary crossover energy. The time constant of the exponential function is proportional to the ratio of final accumulated charge to the incident current.

  4. Negative Ion CID Fragmentation of O-linked Oligosaccharide Aldoses—Charge Induced and Charge Remote Fragmentation

    NASA Astrophysics Data System (ADS)

    Doohan, Roisin A.; Hayes, Catherine A.; Harhen, Brendan; Karlsson, Niclas Göran

    2011-06-01

    Collision induced dissociation (CID) fragmentation was compared between reducing and reduced sulfated, sialylated, and neutral O-linked oligosaccharides. It was found that fragmentation of the [M - H]- ions of aldoses with acidic residues gave unique Z-fragmentation of the reducing end GalNAc containing the acidic C-6 branch, where the entire C-3 branch was lost. This fragmentation pathway, which is not seen in the alditols, showed that the process involved charge remote fragmentation catalyzed by a reducing end acidic anomeric proton. With structures containing sialic acid on both the C-3 and C-6 branch, the [M - H]- ions were dominated by the loss of sialic acid. This fragmentation pathway was also pronounced in the [M - 2H]2- ions revealing both the C-6 Z-fragment plus its complementary C-3 C-fragment in addition to glycosidic and cross ring fragmentation. This generation of the Z/C-fragment pairs from GalNAc showed that the charges were not participating in their generation. Fragmentation of neutral aldoses showed pronounced Z-fragmentation believed to be generated by proton migration from the C-6 branch to the negatively charged GalNAc residue followed by charge remote fragmentation similar to the acidic oligosaccharides. In addition, A-type fragments generated by charge induced fragmentation of neutral oligosaccharides were observed when the charge migrated from C-1 of the GalNAc to the GlcNAc residue followed by rearrangement to accommodate the 0,2A-fragmentation. LC-MS also showed that O-linked aldoses existed as interchangeable α/β pyranose anomers, in addition to a third isomer (25% of the total free aldose) believed to be the furanose form.

  5. Heterostructured magnetite-titanate nanosheets for prompt charge selective binding and magnetic separation of mixed proteins.

    PubMed

    Zhou, Qinhua; Lu, Zhufeng; Cao, Xuebo

    2014-02-01

    We reported the prompt charge selective binding and magnetic separation of mixed proteins by utilizing heterostructured Fe3O4-Na2Ti3O7 nanosheets. Fe3O4-Na2Ti3O7 nanosheets are found to combine a variety of structure and property merits, such as the increased interlayer galleries, exposed exchange sites, flexible framework, and magnetic manipulability. Probing the dissociation dynamics of Na(+) inside the nanosheets reveals that they possess remarkably enhanced Na(+) dissociation capability and the dissociation rate of Na(+) reaches 7.9×10(-)(6)mol g(-)(1)s(-)(1), much superior to titanate nanotubes. In model protein separation experiments, we utilize mixed proteins containing albumin and hemoglobin to assess Fe3O4-Na2Ti3O7 nanosheets. It is found that, by controlling the pH of the sample at 6, positively charged hemoglobin and negatively charged albumin are immediately separated (∼5s) by the nanosheets and the saturated loading capacity of hemoglobin on the nanosheets reaches 4.7±0.61g g(-)(1). Furthermore, hemoglobin bound to the nanosheets can be readily released after buffer wash and is not damaged, while the nanosheets are recyclable and maintain their high efficiency. The outstanding performance of Fe3O4-Na2Ti3O7 nanosheets in separating mixed proteins is attributed to the ultrafast Na(+) dissociation rate, flexible titanate framework, open geometry, and aqueous-like environment to stabilize proteins. These merits, together with the recyclability and cost effectiveness, should make Fe3O4-Na2Ti3O7 nanosheets ideal candidates for biological recognition, isolation, and purification under technologically useful conditions.

  6. Large negatively charged organic host molecules as inhibitors of endonuclease enzymes.

    PubMed

    Tauran, Yannick; Anjard, Christophe; Kim, Beomjoon; Rhimi, Moez; Coleman, Anthony W

    2014-10-01

    Three large negatively charged organic host molecules; β-cyclodextrin sulphate, para-sulphonato-calix[6]arene and para-sulphonato-calix[8]arene have been shown to be effective inhibitors of endonuclease in the low micromolar range, additionally para-sulphonato-calix[8]arene is a partial inhibitor of rhDNase I.

  7. Ion-exchange molecularly imprinted polymer for the extraction of negatively charged acesulfame from wastewater samples.

    PubMed

    Zarejousheghani, Mashaalah; Schrader, Steffi; Möder, Monika; Lorenz, Pierre; Borsdorf, Helko

    2015-09-11

    Acesulfame is a known indicator that is used to identify the introduction of domestic wastewater into water systems. It is negatively charged and highly water-soluble at environmental pH values. In this study, a molecularly imprinted polymer (MIP) was synthesized for negatively charged acesulfame and successfully applied for the selective solid phase extraction (SPE) of acesulfame from influent and effluent wastewater samples. (Vinylbenzyl)trimethylammonium chloride (VBTA) was used as a novel phase transfer reagent, which enhanced the solubility of negatively charged acesulfame in the organic solvent (porogen) and served as a functional monomer in MIP synthesis. Different molecularly imprinted polymers were synthesized to optimize the extraction capability of acesulfame. The different materials were evaluated using equilibrium rebinding experiments, selectivity experiments and scanning electron microscopy (SEM). The most efficient MIP was used in a molecularly imprinted-solid phase extraction (MISPE) protocol to extract acesulfame from wastewater samples. Using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS-MS) analysis, detection and quantification limits were achieved at 0.12μgL(-1) and 0.35μgL(-1), respectively. Certain cross selectivity for the chemical compounds containing negatively charged sulfonamide functional group was observed during selectivity experiments. PMID:26256920

  8. Ion-exchange molecularly imprinted polymer for the extraction of negatively charged acesulfame from wastewater samples.

    PubMed

    Zarejousheghani, Mashaalah; Schrader, Steffi; Möder, Monika; Lorenz, Pierre; Borsdorf, Helko

    2015-09-11

    Acesulfame is a known indicator that is used to identify the introduction of domestic wastewater into water systems. It is negatively charged and highly water-soluble at environmental pH values. In this study, a molecularly imprinted polymer (MIP) was synthesized for negatively charged acesulfame and successfully applied for the selective solid phase extraction (SPE) of acesulfame from influent and effluent wastewater samples. (Vinylbenzyl)trimethylammonium chloride (VBTA) was used as a novel phase transfer reagent, which enhanced the solubility of negatively charged acesulfame in the organic solvent (porogen) and served as a functional monomer in MIP synthesis. Different molecularly imprinted polymers were synthesized to optimize the extraction capability of acesulfame. The different materials were evaluated using equilibrium rebinding experiments, selectivity experiments and scanning electron microscopy (SEM). The most efficient MIP was used in a molecularly imprinted-solid phase extraction (MISPE) protocol to extract acesulfame from wastewater samples. Using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS-MS) analysis, detection and quantification limits were achieved at 0.12μgL(-1) and 0.35μgL(-1), respectively. Certain cross selectivity for the chemical compounds containing negatively charged sulfonamide functional group was observed during selectivity experiments.

  9. Charged particle flows in the beam extraction region of a negative ion source for NBI.

    PubMed

    Geng, S; Tsumori, K; Nakano, H; Kisaki, M; Ikeda, K; Osakabe, M; Nagaoka, K; Takeiri, Y; Shibuya, M; Kaneko, O

    2016-02-01

    Experiments by a four-pin probe and photodetachment technique were carried out to investigate the charged particle flows in the beam extraction region of a negative hydrogen ion source for neutral beam injector. Electron and positive ion flows were obtained from the polar distribution of the probe saturation current. Negative hydrogen ion flow velocity and temperature were obtained by comparing the recovery times of the photodetachment signals at opposite probe tips. Electron and positive ions flows are dominated by crossed field drift and ambipolar diffusion. Negative hydrogen ion temperature is evaluated to be 0.12 eV. PMID:26931985

  10. Binding constraints on the evolution of enzymes and signalling proteins: the important role of negative pleiotropy.

    PubMed

    Liberles, David A; Tisdell, Makayla D M; Grahnen, Johan A

    2011-07-01

    A number of biophysical and population-genetic processes influence amino acid substitution rates. It is commonly recognized that proteins must fold into a native structure with preference over an unfolded state, and must bind to functional interacting partners favourably to function properly. What is less clear is how important folding and binding specificity are to amino acid substitution rates. A hypothesis of the importance of binding specificity in constraining sequence and functional evolution is presented. Examples include an evolutionary simulation of a population of SH2 sequences evolved by threading through the structure and binding to a native ligand, as well as SH3 domain signalling in yeast and selection for specificity in enzymatic reactions. An example in vampire bats where negative pleiotropy appears to have been adaptive is presented. Finally, considerations of compartmentalization and macromolecular crowding on negative pleiotropy are discussed. PMID:21490020

  11. Antimicrobial lipopeptide tridecaptin A1 selectively binds to Gram-negative lipid II

    PubMed Central

    Cochrane, Stephen A.; Findlay, Brandon; Bakhtiary, Alireza; Acedo, Jeella Z.; Rodriguez-Lopez, Eva M.; Mercier, Pascal; Vederas, John C.

    2016-01-01

    Tridecaptin A1 (TriA1) is a nonribosomal lipopeptide with selective antimicrobial activity against Gram-negative bacteria. Here we show that TriA1 exerts its bactericidal effect by binding to the bacterial cell-wall precursor lipid II on the inner membrane, disrupting the proton motive force. Biochemical and biophysical assays show that binding to the Gram-negative variant of lipid II is required for membrane disruption and that only the proton gradient is dispersed. The NMR solution structure of TriA1 in dodecylphosphocholine micelles with lipid II has been determined, and molecular modeling was used to provide a structural model of the TriA1–lipid II complex. These results suggest that TriA1 kills Gram-negative bacteria by a mechanism of action using a lipid-II–binding motif. PMID:27688760

  12. Photodissociation and charge transfer dynamics of negative ions studied with femtosecond photoelectron spectroscopy

    SciTech Connect

    Zanni, Martin T.

    1999-12-17

    This dissertation presents studies aimed at understanding the potential energy surfaces and dynamics of isolated negative ions, and the effects of solvent on each. Although negative ions play important roles in atmospheric and solution phase chemistry, to a large extent the ground and excited state potential energy surfaces of gas phase negative ions are poorly characterized, and solvent effects even less well understood. In an effort to fill this gap, the author's coworkers and the author have developed a new technique, anion femtosecond photoelectron spectroscopy, and applied it to gas phase photodissociation and charge transfer processes. Studies are presented that (1) characterize the ground and excited states of isolated and clustered anions, (2) monitor the photodissociation dynamics of isolated and clustered anions, and (3) explore the charge-transfer-to-solvent states of atomic iodide clustered with polar and non-polar solvents.

  13. Use of stabilizing mutations to engineer a charged group within a ligand-binding hydrophobic cavity in T4 lysozyme.

    PubMed

    Liu, Lijun; Baase, Walter A; Michael, Miya M; Matthews, Brian W

    2009-09-22

    Both large-to-small and nonpolar-to-polar mutations in the hydrophobic core of T4 lysozyme cause significant loss in stability. By including supplementary stabilizing mutations we constructed a variant that combines the cavity-creating substitution Leu99 --> Ala with the buried charge mutant Met102 --> Glu. Crystal structure determination confirmed that this variant has a large cavity with the side chain of Glu102 located within the cavity wall. The cavity includes a large disk-shaped region plus a bulge. The disk-like region is essentially nonpolar, similar to L99A, while the Glu102 substituent is located in the vicinity of the bulge. Three ordered water molecules bind within this part of the cavity and appear to stabilize the conformation of Glu102. Glu102 has an estimated pKa of about 5.5-6.5, suggesting that it is at least partially charged in the crystal structure. The polar ligands pyridine, phenol and aniline bind within the cavity, and crystal structures of the complexes show one or two water molecules to be retained. Nonpolar ligands of appropriate shape can also bind in the cavity and in some cases exclude all three water molecules. This disrupts the hydrogen-bond network and causes the Glu102 side chain to move away from the ligand by up to 0.8 A where it remains buried in a completely nonpolar environment. Isothermal titration calorimetry revealed that the binding of these compounds stabilizes the protein by 4-6 kcal/mol. For both polar and nonpolar ligands the binding is enthalpically driven. Large negative changes in entropy adversely balance the binding of the polar ligands, whereas entropy has little effect on the nonpolar ligand binding.

  14. Ionization Efficiency of Doubly Charged Ions Formed from Polyprotic Acids in Electrospray Negative Mode

    NASA Astrophysics Data System (ADS)

    Liigand, Piia; Kaupmees, Karl; Kruve, Anneli

    2016-07-01

    The ability of polyprotic acids to give doubly charged ions in negative mode electrospray was studied and related to physicochemical properties of the acids via linear discriminant analysis (LDA). It was discovered that the compound has to be strongly acidic (low p K a1 and p K a2) and to have high hydrophobicity (log P ow) to become multiply charged. Ability to give multiply charged ions in ESI/MS cannot be directly predicted from the solution phase acidities. Therefore, for the first time, a quantitative model to predict the charge state of the analyte in ESI/MS is proposed and validated for small anions. Also, a model to predict ionization efficiencies of these analytes was developed. Results indicate that acidity of the analyte, its octanol-water partition coefficient, and charge delocalization are important factors that influence ionization efficiencies as well as charge states of the analytes. The pH of the solvent was also found to be an important factor influencing the ionization efficiency of doubly charged ions.

  15. The dynamics of charged particles in the near wake of a very negatively charged body - Laboratory experiment and numerical simulation

    NASA Technical Reports Server (NTRS)

    Morgan, M. Alvin; Chan, Chung; Cooke, David L.; Tautz, Maurice F.

    1989-01-01

    A numerical simulation that is cylindrical in configuration space and three-dimensional in velocity space has been initiated to test a model for the near-wake dynamics of a very negatively charged body, with reference to the plasma environment around spacecraft. The simulation parameters were closely matched to those of a laboratory experiment so that the results can be compared directly. The laboratory study showed that the electrons and ions can display different temporal features in the filling-in of the wake; and that they can both be found within one body diameter of an object with a highly negative body potential. It was also found that the temperature of the electrons in the very near wake could be somewhat colder than the ambient value, suggesting the possibility of a filtering mechanism being operative there. The simulation results to date largely corroborate the density findings.

  16. Evaluation of electrostatic binding of PAMAM dendrimers and charged phthalocyanines by fluorescence correlation spectroscopy.

    PubMed

    Garcia-Fernandez, Emilio; Paulo, Pedro M R; Costa, Sílvia M B

    2015-02-14

    We have assessed host-guest interactions between PAMAM dendrimers and charged phthalocyanine probes by Fluorescence Correlation Spectroscopy (FCS). Our results show strong binding in water at low ionic strength with an affinity that decreases from KB ∼ 10(9) to 10(8) M(-1) upon decreasing the phthalocyanine charge of z = -4, -2 and -1. The binding affinity also decreases significantly upon salt addition leading to KB values of ca. 10(5)-10(6) M(-1). The changes of binding affinity probed by varying the phthalocyanine charge, and by changing the ionic strength or pH conditions, allowed us to evaluate the electrostatic contribution (Kel) in dendrimer-phthalocyanine interactions. In particular, this approach afforded values of electrostatic potential for PAMAM dendrimers in water at low ionic strength and at dendrimer concentrations in the nanomolar range. The electrostatic potential of PAMAM generations 4 and 7 are around 50 mV in close agreement with theoretical estimates using the Poisson-Boltzmann cell model. Interestingly, the nonelectrostatic binding is significant and contributes even more than electrostatic binding to dendrimer-phthalocyanine interactions. The nonelectrostatic binding contributes to an affinity of KB above 10(5) M(-1), as measured under conditions of low dendrimer charge and high ionic strength, which makes these dendrimers promising hosts as drug carriers.

  17. Simulation of space charge compensation in a multibeamlet negative ion beam.

    PubMed

    Sartori, E; Maceina, T J; Veltri, P; Cavenago, M; Serianni, G

    2016-02-01

    Ion beam space charge compensation occurs by cumulating in the beam potential well charges having opposite polarity, usually generated by collisional processes. In this paper we investigate the case of a H(-) ion beam drift, in a bi-dimensional approximation of the NIO1 (Negative Ion Optimization phase 1) negative ion source. H(-) beam ion transport and plasma formation are studied via particle-in-cell simulations. Differential cross sections are sampled to determine the velocity distribution of secondary particles generated by ionization of the residual gas (electrons and slow H2 (+) ions) or by stripping of the beam ions (electrons, H, and H(+)). The simulations include three beamlets of a horizontal section, so that multibeamlet space charge and secondary particle diffusion between separate generation regions are considered, and include a repeller grid biased at various potentials. Results show that after the beam space charge is effectively screened by the secondary plasma in about 3 μs (in agreement with theoretical expectations), a plasma grows across the beamlets with a characteristic time three times longer, and a slight overcompensation of the electric potential is verified as expected in the case of negative ions. PMID:26932089

  18. Generation and annihilation of traps in metal-oxide-semiconductor devices after negative air corona charging

    NASA Astrophysics Data System (ADS)

    Prasad, Ila; Srivastava, R. S.

    1993-07-01

    Surface and bulk traps along with positive oxide charge accumulation have been found to be generated in metal-oxide-semiconductor capacitors, when subjected to negative air corona discharge at slightly reduced pressure (≂10-1 Torr). The effects are neutralized and device quality improved when annealed at 200 °C in air. The bulk traps and a fraction of oxide charges were annealable when kept at room temperature for several months. The results have been analyzed by Nicollian-Goetzberger's conductance technique and a plausible explanation is given.

  19. Discharges on a negatively biased solar array in a charged particle environment

    NASA Technical Reports Server (NTRS)

    Snyder, D. B.

    1983-01-01

    The charging behavior of a negatively biased solar cell array when subjected to a charged particle environment is studied in the ion density range from 200 to 12 000 ions/sq cm with the applied bias range of -500 to -1400 V. The profile of the surface potentials across the array is related to the presence of discharges. At the low end of the ion density range the solar cell cover slides charge to from 0 to +5 volts independent of the applied voltage. No discharges are seen at bias voltages as large as -1400 V. At the higher ion densities the cover slide potential begins to fluctuate, and becomes significantly negative. Under these conditions discharges can occur. The threshold bias voltage for discharges decreases with increasing ion density. A condition for discharges emerging from the experimental observations is that the average coverslide potential must be more negative than -4 V. The observations presented suggest that the plasma potential near the array becomes negative before a discharge occurs. This suggests that discharges are driven by an instability in the plasma.

  20. Characteristics of EMI generated by negative metal-positive dielectric voltage stresses due to spacecraft charging

    NASA Astrophysics Data System (ADS)

    Chaky, R. C.; Inouye, G. T.

    1985-03-01

    Charging of spacecraft surfaces by the environmental plasma can result in differential potentials between metallic structure and adjacent dielectric surfaces in which the relative polarity of the voltage stress is either negative dielectric/positive metal or negative metal/positive dielectric. Negative metal/positive dielectric is a stress condition that may arise if relatively large areas of spacecraft surface metals are shadowed from solar UV and/or if the UV intensity is reduced as in the situation in which the spacecraft is entering into or leaving eclipse. The results of experimental studies of negative metal/positive dielectric systems are given. Information is given on: enhanced electron emission I-V curves; e(3) corona noise vs e(3) steady-state current; the localized nature of e(3) and negative metal arc discharge currents; negative metal arc discharges at stress thresholds below 1 kilovolt; negative metal arc discharge characteristics; dependence of blowoff arc discharge current on spacecraft capacitance to space (linear dimension); and damage to second surface mirrors due to negative metal arcs.

  1. Characteristics of EMI generated by negative metal-positive dielectric voltage stresses due to spacecraft charging

    NASA Technical Reports Server (NTRS)

    Chaky, R. C.; Inouye, G. T.

    1985-01-01

    Charging of spacecraft surfaces by the environmental plasma can result in differential potentials between metallic structure and adjacent dielectric surfaces in which the relative polarity of the voltage stress is either negative dielectric/positive metal or negative metal/positive dielectric. Negative metal/positive dielectric is a stress condition that may arise if relatively large areas of spacecraft surface metals are shadowed from solar UV and/or if the UV intensity is reduced as in the situation in which the spacecraft is entering into or leaving eclipse. The results of experimental studies of negative metal/positive dielectric systems are given. Information is given on: enhanced electron emission I-V curves; e(3) corona noise vs e(3) steady-state current; the localized nature of e(3) and negative metal arc discharge currents; negative metal arc discharges at stress thresholds below 1 kilovolt; negative metal arc discharge characteristics; dependence of blowoff arc discharge current on spacecraft capacitance to space (linear dimension); and damage to second surface mirrors due to negative metal arcs.

  2. Charge-mosaic membranes: enhanced permeability and negative osmosis with a symmetrical salt.

    PubMed

    Weinstein, J N; Caplan, S R

    1968-07-01

    Charge-mosaic membranes are prepared by embedding a single layer of alternating cation and anion exchange beads in silicone resin. Membranes made in an identical manner but containing only one type of exchanger serve as controls. The mosaic membranes are 50 to 100 times more permeable to potassium chloride than the controls; and furthermore they give rise to net volume flow from concentrated to dilute solutions of potassium chloride in the absence of a pressure gradient ("negative osmosis"), whereas the controls exhibit normal osmotic behavior. The negative reflection coefficients of the mosaics suggest potential applications in desalination.

  3. Optimizing charge neutralization for a magnetic sector SIMS instrument in negative mode

    SciTech Connect

    Pivovarov, Alexander L.; Guryanov, Georgiy M.

    2012-07-15

    Successful self-adjusted charge compensation was demonstrated for a CAMECA magnetic-sector secondary ion mass spectrometer applied in negative mode. Operation with the normal-incidence electron gun (NEG) potential positively biased relative to a sample potential enables substantial broadening of the Cs primary-ion-current density range available for analysis of insulators. The decrease of the negative NEG potential by 30 V allows the highest value of primary current density used for the analysis of a silica sample to increase by a factor of more than 6. By applying the improved charge neutralization technique, accurate Na depth profiles for SiO{sub 2} samples were obtained within detection limits of {approx}3 Multiplication-Sign 10{sup 15} atoms/cm{sup 3}.

  4. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    SciTech Connect

    Valerio-Lizarraga, Cristhian A.; Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard; Leon-Monzon, Ildefonso; Midttun, Øystein

    2014-02-15

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  5. Distinctive Binding of Avibactam to Penicillin-Binding Proteins of Gram-Negative and Gram-Positive Bacteria

    PubMed Central

    Asli, Abdelhamid; Brouillette, Eric; Krause, Kevin M.; Nichols, Wright W.

    2015-01-01

    Avibactam is a novel non-β-lactam β-lactamase inhibitor that covalently acylates a variety of β-lactamases, causing inhibition. Although avibactam presents limited antibacterial activity, its acylation ability toward bacterial penicillin-binding proteins (PBPs) was investigated. Staphylococcus aureus was of particular interest due to the reported β-lactamase activity of PBP4. The binding of avibactam to PBPs was measured by adding increasing concentrations to membrane preparations of a variety of Gram-positive and Gram-negative bacteria prior to addition of the fluorescent reagent Bocillin FL. Relative binding (measured here as the 50% inhibitory concentration [IC50]) to PBPs was estimated by quantification of fluorescence after gel electrophoresis. Avibactam was found to selectively bind to some PBPs. In Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, and S. aureus, avibactam primarily bound to PBP2, with IC50s of 0.92, 1.1, 3.0, and 51 μg/ml, respectively, whereas binding to PBP3 was observed in Streptococcus pneumoniae (IC50, 8.1 μg/ml). Interestingly, avibactam was able to significantly enhance labeling of S. aureus PBP4 by Bocillin FL. In PBP competition assays with S. aureus, where avibactam was used at a fixed concentration in combination with varied amounts of ceftazidime, the apparent IC50 of ceftazidime was found to be very similar to that determined for ceftazidime when used alone. In conclusion, avibactam is able to covalently bind to some bacterial PBPs. Identification of those PBP targets may allow the development of new diazabicyclooctane derivatives with improved affinity for PBPs or new combination therapies that act on multiple PBP targets. PMID:26574008

  6. Associating a negatively charged GdDOTA-derivative to the Pittsburgh compound B for targeting Aβ amyloid aggregates.

    PubMed

    Martins, André F; Oliveira, Alexandre C; Morfin, Jean-François; Laurents, Douglas V; Tóth, Éva; Geraldes, Carlos F G C

    2016-03-01

    We have conjugated the tetraazacyclododecane-tetraacetate (DOTA) chelator to Pittsburgh compound B (PiB) forming negatively charged lanthanide complexes, Ln(L4), with targeting capabilities towards aggregated amyloid peptides. The amphiphilic Gd(L4) chelate undergoes micellar aggregation in aqueous solution, with a critical micellar concentration of 0.68 mM, lower than those for the neutral complexes of similar structure. A variable temperature (17)O NMR and NMRD study allowed the assessment of the water exchange rate, k ex (298) = 9.7 × 10(6) s(-1), about the double of GdDOTA, and for the description of the rotational dynamics for both the monomeric and the micellar forms of Gd(L4). With respect to the analogous neutral complexes, the negative charge induces a significant rigidity of the micelles formed, which is reflected by slower and more restricted local motion of the Gd(3+) centers as evidenced by higher relaxivities at 20-60 MHz. Surface Plasmon Resonance results indicate that the charge does not affect significantly the binding strength to Aβ1-40 [K d = 194 ± 11 μM for La(L4)], but it does enhance the affinity constant to human serum albumin [K a = 6530 ± 68 M(-1) for Gd(L4)], as compared to neutral counterparts. Protein-based NMR points to interaction of Gd(L4) with Aβ1-40 in the monomer state as well, in contrast to neutral complexes interacting only with the aggregated form. Circular dichroism spectroscopy monitored time- and temperature-dependent changes of the Aβ1-40 secondary structure, indicating that Gd(L4) stabilizes the random coil relative to the α-helix and β-sheet. TEM images confirm that the Gd(L4) complex reduces the formation of aggregated fibrils. PMID:26613605

  7. Associating a negatively charged GdDOTA-derivative to the Pittsburgh compound B for targeting Aβ amyloid aggregates.

    PubMed

    Martins, André F; Oliveira, Alexandre C; Morfin, Jean-François; Laurents, Douglas V; Tóth, Éva; Geraldes, Carlos F G C

    2016-03-01

    We have conjugated the tetraazacyclododecane-tetraacetate (DOTA) chelator to Pittsburgh compound B (PiB) forming negatively charged lanthanide complexes, Ln(L4), with targeting capabilities towards aggregated amyloid peptides. The amphiphilic Gd(L4) chelate undergoes micellar aggregation in aqueous solution, with a critical micellar concentration of 0.68 mM, lower than those for the neutral complexes of similar structure. A variable temperature (17)O NMR and NMRD study allowed the assessment of the water exchange rate, k ex (298) = 9.7 × 10(6) s(-1), about the double of GdDOTA, and for the description of the rotational dynamics for both the monomeric and the micellar forms of Gd(L4). With respect to the analogous neutral complexes, the negative charge induces a significant rigidity of the micelles formed, which is reflected by slower and more restricted local motion of the Gd(3+) centers as evidenced by higher relaxivities at 20-60 MHz. Surface Plasmon Resonance results indicate that the charge does not affect significantly the binding strength to Aβ1-40 [K d = 194 ± 11 μM for La(L4)], but it does enhance the affinity constant to human serum albumin [K a = 6530 ± 68 M(-1) for Gd(L4)], as compared to neutral counterparts. Protein-based NMR points to interaction of Gd(L4) with Aβ1-40 in the monomer state as well, in contrast to neutral complexes interacting only with the aggregated form. Circular dichroism spectroscopy monitored time- and temperature-dependent changes of the Aβ1-40 secondary structure, indicating that Gd(L4) stabilizes the random coil relative to the α-helix and β-sheet. TEM images confirm that the Gd(L4) complex reduces the formation of aggregated fibrils.

  8. Reversal of negative charges on the surface of Escherichia coli thioredoxin: pockets versus protrusions.

    PubMed

    Mancusso, Romina; Cruz, Eduardo; Cataldi, Marcela; Mendoza, Carla; Fuchs, James; Wang, Hsin; Yang, Xiaomin; Tasayco, María Luisa

    2004-04-01

    Recent studies of proteins with reversed charged residues have demonstrated that electrostatic interactions on the surface can contribute significantly to protein stability. We have used the approach of reversing negatively charged residues using Arg to evaluate the effect of the electrostatics context on the transition temperature (T(m)), the unfolding Gibbs free energy change (DeltaG), and the unfolding enthalpy change (DeltaH). We have reversed negatively charged residues at a pocket (Asp9) and protrusions (Asp10, Asp20, Glu85), all located in interconnecting segments between elements of secondary structure on the surface of Arg73Ala Escherichia coli thioredoxin. DSC measurements indicate that reversal of Asp in a pocket (Asp9Arg/Arg73Ala, DeltaT(m) = -7.3 degrees C) produces a larger effect in thermal stability than reversal at protrusions: Asp10Arg/Arg73Ala, DeltaT(m) = -3.1 degrees C, Asp20Arg/Arg73Ala, DeltaT(m) = 2.0 degrees C, Glu85Arg/Arg73Ala, DeltaT(m) = 3.9 degrees ). The 3D structure of thioredoxin indicates that Asp20 and Glu85 have no nearby charges within 8 A, while Asp9 does not only have Asp10 as sequential neighbor, but it also forms a 5-A long-range ion pair with the solvent-exposed Lys69. Further DSC measurements indicate that neutralization of the individual charges of the ion pair Asp9-Lys69 with nonpolar residues produces a significant decrease in stability in both cases: Asp9Ala/Arg73Ala, DeltaT(m) = -3.7 degrees C, Asp9Met/Arg73Ala, DeltaT(m) = -5.5 degrees C, Lys69Leu/Arg73Ala, DeltaT(m) = -5.1 degrees C. However, thermodynamic analysis shows that reversal or neutralization of Asp9 produces a 9-15% decrease in DeltaH, while both reversal of Asp at protrusions and neutralization of Lys69 produce negligible changes. These results correlate well with the NMR analysis, which demonstrates that only the substitution of Asp9 produces extensive conformational changes and these changes occur in the surroundings of Lys69. Our results led us to

  9. Calcium currents, charge movement and dihydropyridine binding in fast- and slow-twitch muscles of rat and rabbit.

    PubMed Central

    Lamb, G D; Walsh, T

    1987-01-01

    1. The Vaseline-gap technique was used to record slow calcium currents and asymmetric charge movement in single fibres of fast-twitch muscles (extensor digitorum longus (e.d.l.) and sternomastoid) and slow-twitch muscles (soleus) from rat and rabbit, at a holding potential of -90 mV. 2. The slow calcium current in soleus fibres was about one-third of the size of the current in e.d.l. fibres, but was very similar otherwise. In both e.d.l. and soleus fibres, the dihydropyridine (DHP), nifedipine, suppressed the calcium current entirely. 3. In these normally polarized fibres, nifedipine suppressed only part (qns) of the asymmetric charge movement. The proportion of qns suppressed by various concentrations of nifedipine was linearly related to the associated reduction of the calcium current. Half-maximal suppression of both parameters was obtained with about 0.5 microM-nifedipine. The calcium current and the qns component of the charge movement also were suppressed over the same time course by nifedipine. Another DHP calcium antagonist, (+)PN200/110, was indistinguishable from nifedipine in its effects of suppressing calcium currents and qns. 4. In all muscle types, the total amount of qns in each fibre was linearly related to the size of the calcium current (in the absence of DHP). On average, qns was 3.3 times larger in e.d.l. fibres than in soleus fibres. 5. In contrast to the other dihydropyridines, (-)bay K8644, a calcium channel agonist, did not suppress any asymmetric charge movement. 6. The potential dependence of the slow calcium current implied a minimum gating charge of about five or six electronic charges. The movement of qns occurred over a more negative potential range than the change in calcium conductance. 7. Experiments on the binding of (+)PN200/110 indicated that e.d.l. muscles had between about 2 and 3 times more specific DHP binding sites than did soleus muscle. 8. These results point to a close relationship between slow calcium channels, the qns

  10. High flux and antifouling properties of negatively charged membrane for dyeing wastewater treatment by membrane distillation.

    PubMed

    An, Alicia Kyoungjin; Guo, Jiaxin; Jeong, Sanghyun; Lee, Eui-Jong; Tabatabai, S Assiyeh Alizadeh; Leiknes, TorOve

    2016-10-15

    This study investigated the applicability of membrane distillation (MD) to treat dyeing wastewater discharged by the textile industry. Four different dyes containing methylene blue (MB), crystal violet (CV), acid red 18 (AR18), and acid yellow 36 (AY36) were tested. Two types of hydrophobic membranes made of polytetrafluoroethylene (PTFE) and polyvinylidene fluoride (PVDF) were used. The membranes were characterized by testing against each dye (foulant-foulant) and the membrane-dye (membrane-foulant) interfacial interactions and their mechanisms were identified. The MD membranes possessed negative charges, which facilitated the treatment of acid and azo dyes of the same charge and showed higher fluxes. In addition, PTFE membrane reduced the wettability with higher hydrophobicity of the membrane surface. The PTFE membrane evidenced especially its resistant to dye absorption, as its strong negative charge and chemical structure caused a flake-like (loose) dye-dye structure to form on the membrane surface rather than in the membrane pores. This also enabled the recovery of flux and membrane properties by water flushing (WF), thereby direct-contact MD with PTFE membrane treating 100 mg/L of dye mixtures showed stable flux and superior color removal during five days operation. Thus, MD shows a potential for stable long-term operation in conjunction with a simple membrane cleaning process, and its suitability in dyeing wastewater treatment.

  11. High flux and antifouling properties of negatively charged membrane for dyeing wastewater treatment by membrane distillation.

    PubMed

    An, Alicia Kyoungjin; Guo, Jiaxin; Jeong, Sanghyun; Lee, Eui-Jong; Tabatabai, S Assiyeh Alizadeh; Leiknes, TorOve

    2016-10-15

    This study investigated the applicability of membrane distillation (MD) to treat dyeing wastewater discharged by the textile industry. Four different dyes containing methylene blue (MB), crystal violet (CV), acid red 18 (AR18), and acid yellow 36 (AY36) were tested. Two types of hydrophobic membranes made of polytetrafluoroethylene (PTFE) and polyvinylidene fluoride (PVDF) were used. The membranes were characterized by testing against each dye (foulant-foulant) and the membrane-dye (membrane-foulant) interfacial interactions and their mechanisms were identified. The MD membranes possessed negative charges, which facilitated the treatment of acid and azo dyes of the same charge and showed higher fluxes. In addition, PTFE membrane reduced the wettability with higher hydrophobicity of the membrane surface. The PTFE membrane evidenced especially its resistant to dye absorption, as its strong negative charge and chemical structure caused a flake-like (loose) dye-dye structure to form on the membrane surface rather than in the membrane pores. This also enabled the recovery of flux and membrane properties by water flushing (WF), thereby direct-contact MD with PTFE membrane treating 100 mg/L of dye mixtures showed stable flux and superior color removal during five days operation. Thus, MD shows a potential for stable long-term operation in conjunction with a simple membrane cleaning process, and its suitability in dyeing wastewater treatment. PMID:27486044

  12. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    SciTech Connect

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-08-15

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  13. A zinc-binding site by negative selection induces metallodrug susceptibility in an essential chaperonin.

    PubMed

    Cun, Shujian; Sun, Hongzhe

    2010-03-16

    GroES is an indispensable chaperonin virtually found throughout all life forms. Consequently, mutations of this protein must be critically scrutinized by natural selection. Nevertheless, the homolog from a potentially virulent gastric pathogen, Helicobacter pylori, strikingly features a histidine/cysteine-rich C terminus that shares no significant homology with other family members. Additionally, three more (H45, C51, and C53) are uniquely present in its apical domain. The statistical analyses show that these residues may have originated from negative selection, presumably driven by either dependent or independent amino acid mutations. In the absence of the C-terminal metal-binding domain, the mutant protein still exhibits a substantial capacity for zinc binding in vivo. The biochemical properties of site-directed mutants indicate that H45, C51, and C53 make up an oxidation-sensitive zinc-binding site that may donate the bound metal to a zinc acceptor. Of interest, bismuth antiulcer drugs strongly bind at this site (K(d) of approximately 7 x 10(-26) M), replacing the bound zinc and consequently inducing the disruption of the quaternary structure. Because biological features by negative selection are usually inert to change during evolution, this study sheds light on a promising field whereby medicines can be designed or improved to specifically target the residues that uniquely evolved in pathogenic proteins so as to retard the emergence of drug resistance. PMID:20194796

  14. Atomistic simulations of negatively charged donor states probed in STM experiments

    NASA Astrophysics Data System (ADS)

    Tankasala, Archana; Salfi, Joe; Rogge, Sven; Klimeck, Gerhard; Rahman, Rajib

    A single donor in silicon binding two electrons (D-) is important for electron spin readout and two-qubit operations in a donor based silicon (Si) quantum computer, and has recently been probed in Scanning Tunneling Microscope (STM) experiments for sub-surface dopants. In this work, atomistic configuration interaction technique is used to compute the two-electron states of the donor taking into account the geometry of the STM-vacuum-silicon-reservoir device. While 45 meV charging energy is obtained for D- in bulk Si, the electrostatics of the device reduces the charging energy to 30 meVs. It is also shown that the reduced charging energy enables spin triplet states to be bound to the donor. The exchange splitting between the singlet and triplet states can be tuned by an external electric field. The computed wavefunctions of the D- state helps to understand how the contribution of the momentum space valley states change with donor depth and electric field.

  15. Influence of surface charge, binding site residues and glycosylation on Thielavia terrestris cutinase biochemical characteristics.

    PubMed

    Shirke, Abhijit N; Basore, Danielle; Holton, Samantha; Su, An; Baugh, Evan; Butterfoss, Glenn L; Makhatadze, George; Bystroff, Christopher; Gross, Richard A

    2016-05-01

    Cutinases are esterases of industrial importance for applications in recycling and surface modification of polyesters. The cutinase from Thielavia terrestris (TtC) is distinct in terms of its ability to retain its stability and activity in acidic pH. Stability and activity in acidic pHs are desirable for esterases as the pH of the reaction tends to go down with the generation of acid. The pH stability and activity are governed by the charged state of the residues involved in catalysis or in substrate binding. In this study, we performed the detailed structural and biochemical characterization of TtC coupled with surface charge analysis to understand its acidic tolerance. The stability of TtC in acidic pH was rationalized by evaluating the contribution of charge interactions to the Gibbs free energy of unfolding at varying pHs. The activity of TtC was found to be limited by substrate binding affinity, which is a function of the surface charge. Additionally, the presence of glycosylation affects the biochemical characteristics of TtC owing to steric interactions with residues involved in substrate binding. PMID:26758295

  16. Importance of separated efficiencies between positively and negatively charged particles for cumulant calculations

    NASA Astrophysics Data System (ADS)

    Nonaka, Toshihiro; Sugiura, Tetsuro; Esumi, ShinIchi; Masui, Hiroshi; Luo, Xiaofeng

    2016-09-01

    We show the importance of separated efficiency corrections between positively and negatively charged particles for cumulant calculations by toy models and analytical calculations. Our results indicate that S σ in published net-proton results from the STAR experiment will be suppressed about 10% in central collisions and 20% in peripheral collisions at the beam energy of √{sN N}=200 GeV if the separated efficiencies are used to perform the efficiency correction, while no sizable efffect can be seen for κ σ2 .

  17. Optical spectra and intensities of graphene magnetic dot bound to a negatively charged Coulomb impurity

    SciTech Connect

    Lee, C. M. E-mail: apkschan@cityu.edu.hk; Chan, K. S. E-mail: apkschan@cityu.edu.hk

    2014-07-28

    Employing numerical diagonalization, we study the optical properties of an electron in a monolayer-graphene magnetic dot bound to an off-center negatively charged Coulomb impurity based on the massless Dirac-Weyl model. Numerical results show that, since the electron-hole symmetry is broken by the Coulomb potential, the optical absorption spectra of the magnetic dot in the presence of a Coulomb impurity are different between the electron states and the hole states. Effects of both the magnetic field and the dot size on the absorption coefficient are presented as functions of the incident photon energies.

  18. Transient performance estimation of charge plasma based negative capacitance junctionless tunnel FET

    NASA Astrophysics Data System (ADS)

    Singh, Sangeeta; Kondekar, P. N.; Pal, Pawan

    2016-02-01

    We investigate the transient behavior of an n-type double gate negative capacitance junctionless tunnel field effect transistor (NC-JLTFET). The structure is realized by using the work-function engineering of metal electrodes over a heavily doped n+ silicon channel and a ferroelectric gate stack to get negative capacitance behavior. The positive feedback in the electric dipoles of ferroelectric materials results in applied gate bias boosting. Various device transient parameters viz. transconductance, output resistance, output conductance, intrinsic gain, intrinsic gate delay, transconductance generation factor and unity gain frequency are analyzed using ac analysis of the device. To study the impact of the work-function variation of control and source gate on device performance, sensitivity analysis of the device has been carried out by varying these parameters. Simulation study reveals that it preserves inherent advantages of charge-plasma junctionless structure and exhibits improved transient behavior as well.

  19. Negative-charge-functionalized mesoporous silica nanoparticles as drug vehicles targeting hepatocellular carcinoma.

    PubMed

    Xie, Meng; Xu, Yuanguo; Shen, Haijun; Shen, Song; Ge, Yanru; Xie, Jimin

    2014-10-20

    In this paper, a series of doxorubicin-loaded and negative-charge-functionalized mesoporous silica nanoparticles (DOX-MSN/COOH) was successfully prepared and used for imaging and targeting therapy of hepatocellular carcinoma. The nanoparticles were uniform and negatively charged, with a diameter of about 55 nm, and a zeta potential of -20 mV. In vitro study showed that the nanoparticles could easily be endocytosed by liver cancer cells (HepG2) and were well-accumulated in the liver by passive targeting. In vivo study proved the ability of DOX-MSN/COOH to inhibit the tumor growth and prolong the survival time of mice bearing hepatocellular carcinoma in situ, giving better results than free DOX. More importantly, histological examination showed no histopathological abnormalities of normal liver cells and heart cells after the administration of DOX-MSN/COOH, while the treatment with free DOX caused damage to those cells. In conclusion, DOX-MSN/COOH exhibited enhanced antitumor efficacy as well as reduced side effects for liver cancer therapy. PMID:25149125

  20. Phagocytosis and transforming activity of crystalline metal sulfide particles are related to their negative surface charge

    SciTech Connect

    Abbracchio, M.P.; Heck, J.D.; Costa, M.

    1982-01-01

    Crystalline nickel sulfide (alpha NiS) and cobalt sulfide (CoS2) particles can cause greater cell transformation and cellular toxicity than the respective amorphous metal sulfide particles. Cultured mammalian cells phagocytose the crystalline metal sulfide particles more readily than the amorphous ones. In the case of the nickel sulfides, the crystalline metal sulfide particles had negatively charged surfaces (Zeta potential: -27.012 mV) in contrast to the amorphous particles, which were positively charge (Zeta potential: +9.174 mV). X-ray photoelectron spectroscopy analysis of amorphous and crystalline NiS particles revealed that the outermost surface (1-4 nm) of the two particles had striking differences in Ni/S ratios and in their sulfur oxidation states. Rendering particles' surfaces more negative by reduction with lithium aluminum hydride enhanced their phagocytosis, and in the case of amorphous NiS chemical reduction resulted in an incidence of morphological transformation of Syrian hamster embryo cells comparable to that observed with untreated crystalline alpha NiS.

  1. The negatively charged carboxy-terminal tail of β-tubulin promotes proper chromosome segregation

    PubMed Central

    Fees, Colby P.; Aiken, Jayne; O’Toole, Eileen T.; Giddings, Thomas H.; Moore, Jeffrey K.

    2016-01-01

    Despite the broadly conserved role of microtubules in chromosome segregation, we have a limited understanding of how molecular features of tubulin proteins contribute to the underlying mechanisms. Here we investigate the negatively charged carboxy-terminal tail domains (CTTs) of α- and β-tubulins, using a series of mutants that alter or ablate CTTs in budding yeast. We find that ablating β-CTT causes elevated rates of chromosome loss and cell cycle delay. Complementary live-cell imaging and electron tomography show that β-CTT is necessary to properly position kinetochores and organize microtubules within the assembling spindle. We identify a minimal region of negatively charged amino acids that is necessary and sufficient for proper chromosome segregation and provide evidence that this function may be conserved across species. Our results provide the first in vivo evidence of a specific role for tubulin CTTs in chromosome segregation. We propose that β-CTT promotes the ordered segregation of chromosomes by stabilizing the spindle and contributing to forces that move chromosomes toward the spindle poles. PMID:27053662

  2. Translocation of positively and negatively charged polystyrene nanoparticles in an in vitro placental model.

    PubMed

    Kloet, Samantha K; Walczak, Agata P; Louisse, Jochem; van den Berg, Hans H J; Bouwmeester, Hans; Tromp, Peter; Fokkink, Remco G; Rietjens, Ivonne M C M

    2015-10-01

    To obtain insight in translocation of nanoparticles across the placental barrier, translocation was studied for one positively and two negatively charged polystyrene nanoparticles (PS-NPs) of similar size in an in vitro model. The model consisted of BeWo b30 cells, derived from a human choriocarcinoma grown on a transwell insert forming a cell layer that separates an apical from a basolateral compartment. PS-NPs were characterized with respect to size, surface charge, morphology and protein corona. Translocation of PS-NPs was not related to PS-NP charge. Two PS-NPs were translocated across the BeWo transwell model to a lower extent than amoxicillin, a model compound known to be translocated over the placental barrier to only a limited extent, whereas one PS-NP showed a slightly higher translocation. Studies on the effect of transporter inhibitors on the translocation of the PS-NPs indicated that their translocation was not mediated by known transporters and mainly dependent on passive diffusion. It is concluded that the BeWo b30 model can be used as an efficient method to get an initial qualitative impression about the capacity of NPs to translocate across the placental barrier and set priorities in further in vivo studies on translocation of NPs to the fetus. PMID:26145586

  3. Activation energy of negative fixed charges in thermal ALD Al2O3

    NASA Astrophysics Data System (ADS)

    Kühnhold-Pospischil, S.; Saint-Cast, P.; Richter, A.; Hofmann, M.

    2016-08-01

    A study of the thermally activated negative fixed charges Qtot and the interface trap densities Dit at the interface between Si and thermal atomic-layer-deposited amorphous Al2O3 layers is presented. The thermal activation of Qtot and Dit was conducted at annealing temperatures between 220 °C and 500 °C for durations between 3 s and 38 h. The temperature-induced differences in Qtot and Dit were measured using the characterization method called corona oxide characterization of semiconductors. Their time dependency were fitted using stretched exponential functions, yielding activation energies of EA = (2.2 ± 0.2) eV and EA = (2.3 ± 0.7) eV for Qtot and Dit, respectively. For annealing temperatures from 350 °C to 500 °C, the changes in Qtot and Dit were similar for both p- and n-type doped Si samples. In contrast, at 220 °C the charging process was enhanced for p-type samples. Based on the observations described in this contribution, a charging model leading to Qtot based on an electron hopping process between the silicon and Al2O3 through defects is proposed.

  4. Translocation of positively and negatively charged polystyrene nanoparticles in an in vitro placental model.

    PubMed

    Kloet, Samantha K; Walczak, Agata P; Louisse, Jochem; van den Berg, Hans H J; Bouwmeester, Hans; Tromp, Peter; Fokkink, Remco G; Rietjens, Ivonne M C M

    2015-10-01

    To obtain insight in translocation of nanoparticles across the placental barrier, translocation was studied for one positively and two negatively charged polystyrene nanoparticles (PS-NPs) of similar size in an in vitro model. The model consisted of BeWo b30 cells, derived from a human choriocarcinoma grown on a transwell insert forming a cell layer that separates an apical from a basolateral compartment. PS-NPs were characterized with respect to size, surface charge, morphology and protein corona. Translocation of PS-NPs was not related to PS-NP charge. Two PS-NPs were translocated across the BeWo transwell model to a lower extent than amoxicillin, a model compound known to be translocated over the placental barrier to only a limited extent, whereas one PS-NP showed a slightly higher translocation. Studies on the effect of transporter inhibitors on the translocation of the PS-NPs indicated that their translocation was not mediated by known transporters and mainly dependent on passive diffusion. It is concluded that the BeWo b30 model can be used as an efficient method to get an initial qualitative impression about the capacity of NPs to translocate across the placental barrier and set priorities in further in vivo studies on translocation of NPs to the fetus.

  5. A Hypersweet Protein: Removal of The Specific Negative Charge at Asp21 Enhances Thaumatin Sweetness

    PubMed Central

    Masuda, Tetsuya; Ohta, Keisuke; Ojiro, Naoko; Murata, Kazuki; Mikami, Bunzo; Tani, Fumito; Temussi, Piero Andrea; Kitabatake, Naofumi

    2016-01-01

    Thaumatin is an intensely sweet-tasting protein that elicits sweet taste at a concentration of 50 nM, a value 100,000 times larger than that of sucrose on a molar basis. Here we attempted to produce a protein with enhanced sweetness by removing negative charges on the interacting side of thaumatin with the taste receptor. We obtained a D21N mutant which, with a threshold value 31 nM is much sweeter than wild type thaumatin and, together with the Y65R mutant of single chain monellin, one of the two sweetest proteins known so far. The complex model between the T1R2-T1R3 sweet receptor and thaumatin, derived from tethered docking in the framework of the wedge model, confirmed that each of the positively charged residues critical for sweetness is close to a receptor residue of opposite charge to yield optimal electrostatic interaction. Furthermore, the distance between D21 and its possible counterpart D433 (located on the T1R2 protomer of the receptor) is safely large to avoid electrostatic repulsion but, at the same time, amenable to a closer approach if D21 is mutated into the corresponding asparagine. These findings clearly confirm the importance of electrostatic potentials in the interaction of thaumatin with the sweet receptor. PMID:26837600

  6. Excitation of Kelvin Helmholtz instability by an ion beam in a plasma with negatively charged dust grains

    SciTech Connect

    Rani, Kavita; Sharma, Suresh C.

    2015-02-15

    An ion beam propagating through a magnetized dusty plasma drives Kelvin Helmholtz Instability (KHI) via Cerenkov interaction. The frequency of the unstable wave increases with the relative density of negatively charged dust grains. It is observed that the beam has stabilizing effect on the growth rate of KHI for low shear parameter, but for high shear parameter, the instability is destabilized with relative density of negatively charged dust grains.

  7. Space Charge Neutralization of DEMO Relevant Negative Ion Beams at Low Gas Density

    SciTech Connect

    Surrey, Elizabeth; Porton, Michael

    2011-09-26

    The application of neutral beams to future power plant devices (DEMO) is dependent on achieving significantly improved electrical efficiency and the most promising route to achieving this is by implementing a photoneutralizer in place of the traditional gas neutralizer. A corollary of this innovation would be a significant reduction in the background gas density through which the beam is transported between the accelerator and the neutralizer. This background gas is responsible for the space charge neutralization of the beam, enabling distances of several metres to be traversed without significant beam expansion. This work investigates the sensitivity of a D{sup -} beam to reduced levels of space charge compensation for energies from 100 keV to 1.5 MeV, representative of a scaled prototype experiment, commissioning and full energy operation. A beam transport code, following the evolution of the phase space ellipse, is employed to investigate the effect of space charge on the beam optics. This shows that the higher energy beams are insensitive to large degrees of under compensation, unlike the lower energies. The probable degree of compensation at low gas density is then investigated through a simple, two component beam-plasma model that allows the potential to be negative. The degree of under-compensation is dependent on the positive plasma ion energy, one source of which is dissociation of the gas by the beam. The subsequent space charge state of the beam is shown to depend upon the relative times for equilibration of the dissociation energy and ionization by the beam ions.

  8. Cell-penetrating compounds preferentially bind glycosaminoglycans over plasma membrane lipids in a charge density- and stereochemistry-dependent manner.

    PubMed

    Prevette, Lisa E; Benish, Nicolas C; Schoenecker, Amber R; Braden, Kristin J

    2015-12-01

    Cell-penetrating compounds (CPCs) are often conjugated to drugs and genes to facilitate cellular uptake. We hypothesize that the electrostatic interaction between the positively charged amines of the cell-penetrating compounds and the negatively charged glycosaminoglycans (GAGs) extending from cell surfaces is the initiating step in the internalization process. The interactions of generation 5 PAMAM dendrimer, Tat peptide and 25 kDa linear PEI with four different GAGs have been studied using isothermal titration calorimetry to elucidate structure-function relationships that could lead to improved drug and gene delivery methods to a wide variety of cell types. Detailed thermodynamic analysis has determined that CPC-GAG binding constants range from 8.7×10(3) to 2.4×10(6)M(-1) and that affinity is dependent upon GAG charge density and stereochemistry and CPC molecular weight. The effect of GAG composition on affinity is likely due to hydrogen bonding between CPC amines and amides and GAG hydroxyl and amine groups. These results were compared to the association of CPCs with lipid vesicles of varying composition as model plasma membranes to finally clarify the relative importance of each cell surface component in initial cell recognition. CPC-lipid affinity increases with anionic lipid content, but GAG affinity is higher for all cell-penetrating compounds, confirming the role these heterogeneous polysaccharides play in cellular association and clustering.

  9. Charging effect in Au nanoparticle memory device with biomolecule binding mechanism.

    PubMed

    Jung, Sung Mok; Kim, Hyung-Jun; Kim, Bong-Jin; Yoon, Tae-Sik; Kim, Yong-Sang; Lee, Hyun Ho

    2011-07-01

    Organic memory device having gold nanoparticle (Au NPs) has been introduced in the structure of metal-pentacene-insulator-silicon (MPIS) capacitor device, where the Au NPs layer was formed by a new bonding method. Biomolecule binding mechanism between streptavidin and biotin was used as a strong binding method for the formation of monolayered Au NPs on polymeric dielectric of poly vinyl alcohol (PVA). The self-assembled Au NPs was functioned to show storages of charge in the MPIS device. The binding by streptavidin and biotin was confirmed by AFM and UV-VIS. The UV-VIS absorption of the Au NPs was varied at 515 nm and 525 nm depending on the coating of streptavidin. The AFM image showed no formation of multi-stacked layers of the streptavidin-capped Au NPs on biotin-NHS layer. Capacitance-voltage (C-V) performance of the memory device was measured to investigate the charging effect from Au NPs. In addition, charge retention by the Au NPs storage was tested to show 10,000 s in the C-V curve.

  10. Positive and negative feedback learning and associated dopamine and serotonin transporter binding after methamphetamine.

    PubMed

    Stolyarova, Alexandra; O'Dell, Steve J; Marshall, John F; Izquierdo, Alicia

    2014-09-01

    Learning from mistakes and prospectively adjusting behavior in response to reward feedback is an important facet of performance monitoring. Dopamine (DA) pathways play an important role in feedback learning and a growing literature has also emerged on the importance of serotonin (5HT) in reward learning, particularly during punishment or reward omission (negative feedback). Cognitive impairments resulting from psychostimulant exposure may arise from altered patterns in feedback learning, which in turn may be modulated by DA and 5HT transmission. We analyzed long-term, off-drug changes in learning from positive and negative feedback and associated striatal DA transporter (DAT) and frontocortical 5HT transporter (SERT) binding in rats pretreated with methamphetamine (mAMPH). Specifically, we assessed the reversal phase of pairwise visual discrimination learning in rats receiving single dose- (mAMPHsingle) vs. escalating-dose exposure (mAMPHescal). Using fine-grained trial-by-trial analyses, we found increased sensitivity to and reliance on positive feedback in mAMPH-pretreated animals, with the mAMPHsingle group showing more pronounced use of this type of feedback. In contrast, overall negative feedback sensitivity was not altered following any mAMPH treatment. In addition to validating the enduring effects of mAMPH on early reversal learning, we found more consecutive error commissions before the first correct response in mAMPH-pretreated rats. This behavioral rigidity was negatively correlated with subregional frontocortical SERT whereas positive feedback sensitivity negatively correlated with striatal DAT binding. These results provide new evidence for the overlapping, yet dissociable roles of DA and 5HT systems in overcoming perseveration and in learning new reward rules.

  11. Positive and negative feedback learning and associated dopamine and serotonin transporter binding after methamphetamine.

    PubMed

    Stolyarova, Alexandra; O'Dell, Steve J; Marshall, John F; Izquierdo, Alicia

    2014-09-01

    Learning from mistakes and prospectively adjusting behavior in response to reward feedback is an important facet of performance monitoring. Dopamine (DA) pathways play an important role in feedback learning and a growing literature has also emerged on the importance of serotonin (5HT) in reward learning, particularly during punishment or reward omission (negative feedback). Cognitive impairments resulting from psychostimulant exposure may arise from altered patterns in feedback learning, which in turn may be modulated by DA and 5HT transmission. We analyzed long-term, off-drug changes in learning from positive and negative feedback and associated striatal DA transporter (DAT) and frontocortical 5HT transporter (SERT) binding in rats pretreated with methamphetamine (mAMPH). Specifically, we assessed the reversal phase of pairwise visual discrimination learning in rats receiving single dose- (mAMPHsingle) vs. escalating-dose exposure (mAMPHescal). Using fine-grained trial-by-trial analyses, we found increased sensitivity to and reliance on positive feedback in mAMPH-pretreated animals, with the mAMPHsingle group showing more pronounced use of this type of feedback. In contrast, overall negative feedback sensitivity was not altered following any mAMPH treatment. In addition to validating the enduring effects of mAMPH on early reversal learning, we found more consecutive error commissions before the first correct response in mAMPH-pretreated rats. This behavioral rigidity was negatively correlated with subregional frontocortical SERT whereas positive feedback sensitivity negatively correlated with striatal DAT binding. These results provide new evidence for the overlapping, yet dissociable roles of DA and 5HT systems in overcoming perseveration and in learning new reward rules. PMID:24959862

  12. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication

    PubMed Central

    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim

    2015-01-01

    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding. PMID:26337392

  13. Chondroitin sulfate addition to CD44H negatively regulates hyaluronan binding

    SciTech Connect

    Ruffell, Brian; Johnson, Pauline . E-mail: pauline@interchange.ubc.ca

    2005-08-26

    CD44 is a widely expressed cell adhesion molecule that binds hyaluronan, an extracellular matrix glycosaminoglycan, in a tightly regulated manner. This regulated interaction has been implicated in inflammation and tumor metastasis. CD44 exists in the standard form, CD44H, or as higher molecular mass isoforms due to alternative splicing. Here, we identify serine 180 in human CD44H as the site of chondroitin sulfate addition and show that lack of chondroitin sulfate addition at this site enhances hyaluronan binding by CD44. A CD44H-immunoglobulin fusion protein expressed in HEK293 cells, and CD44H expressed in murine L fibroblast cells were modified by chondroitin sulfate, as determined by reduced sulfate incorporation after chondroitinase ABC treatment. Mutation of serine 180 or glycine 181 in CD44H reduced chondroitin sulfate addition and increased hyaluronan binding, indicating that serine 180 is the site for chondroitin sulfate addition in CD44H and that this negatively regulates hyaluronan binding.

  14. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication.

    PubMed

    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim

    2015-11-01

    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding.

  15. Speciation dynamics of metals in dispersion of nanoparticles with discrete distribution of charged binding sites.

    PubMed

    Polyakov, Pavel D; Duval, Jérôme F L

    2014-02-01

    We report a comprehensive theory to evaluate the kinetics of complex formation between metal ions and charged spherical nanoparticles. The latter consist of an ion-impermeable core surrounded by a soft shell layer characterized by a discrete axisymmetric 2D distribution of charged sites that bind metal ions. The theory explicitly integrates the conductive diffusion of metal ions from bulk solution toward the respective locations of the reactive sites within the particle shell volume. The kinetic constant k for outer-sphere nanoparticle-metal association is obtained from the sum of the contributions stemming from all reactive sites, each evaluated from the corresponding incoming flux of metal ions derived from steady-state Poisson-Nernst-Planck equations. Illustrations are provided to capture the basic intertwined impacts of particle size, overall particle charge, spatial heterogeneity in site distribution, type of particle (hard, core-shell or porous) and concentration of the background electrolyte on k. As a limit, k converges with predictions from previously reported analytical expressions derived for porous particles with low and high charge density, cases that correspond to coulombic and mean-field (smeared-out) electrostatic treatments, respectively. The conditions underlying the applicability of these latter approaches are rigorously identified in terms of (i) the extent of overlap between electric double layers around charged neighbouring sites, and (ii) the magnitude of the intraparticulate metal concentration gradient. For the first time, the proposed theory integrates the differentiated impact of the local potential around the charged binding sites amidst the overall particle field, together with that of the so-far discarded intraparticulate flux of metal ions. PMID:24336523

  16. Transient negative photoconductance in a charge transfer double quantum well under optical intersubband excitation

    NASA Astrophysics Data System (ADS)

    Rüfenacht, M.; Tsujino, S.; Sakaki, H.

    1998-06-01

    Recently, it was shown that an electron-hole radiative recombination is induced by a mid-infrared light exciting an intersubband transition in a charge transfer double quantum well (CTDQW). This recombination was attributed to an upstream transfer of electrons from an electron-rich well to a hole-rich well. In this study, we investigated the electrical response of a CTDQW under intersubband optical excitation, and found that a positive photocurrent, opposite in sign and proportional to the applied electric field, accompanies the intersubband-transition-induced luminescence (ITIL) signal. A negative photocurrent component was also observed and attributed to heating processes. This work brings a further evidence of the ITIL process and shows that an important proportion of the carriers are consumed by the transfer of electrons.

  17. What happens to negatively charged lipid vesicles upon interacting with polycation species?

    PubMed

    Kabanov, V A; Yaroslavov, A A

    2002-01-17

    Complexation of synthetic polycations with negative lipid vesicles as cell-mimetic species was studied. It was found that such interaction could be accompanied by lateral lipid segregation, highly accelerated transmembrane migration of lipid molecules (polycation-induced flip-flop), incorporation of adsorbed polycations into vesicular membrane as well as aggregation and disruption of vesicles. A polycation adsorbed on the surface of liquid vesicles due to electrostatic attraction could be completely removed from the membrane by increase in simple salt concentration or by recomplexation with polyanions. In contrast, adsorption of a polycation carrying pendant hydrophobic groups was irreversible apparently due to incorporation of these groups into the hydrophobic part of the vesicular membrane. The above mentioned phenomena were examined depending on the polycation structure, fraction of charged lipids in the membrane, vesicle phase state and ionic strength of solution. PMID:11772467

  18. Polymerization on the rocks: negatively-charged alpha-amino acids

    NASA Technical Reports Server (NTRS)

    Hill, A. R. Jr; Bohler, C.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1998-01-01

    Oligomers of the negatively-charged amino acids, glutamic acid, aspartic acid, and O-phospho-L-serine are adsorbed by hydroxylapatite and illite with affinities that increase with oligomer length. In the case of oligo-glutamic acids adsorbed on hydroxylapatite, addition of an extra residue results in an approximately four-fold increase in the strength of adsorption. Oligomers much longer than the 7-mer are retained tenaciously by the mineral. Repeated incubation of short oligo-glutamic acids adsorbed on hydroxylapatite or illite with activated monomer leads to the accumulation of oligomers at least 45 units long. The corresponding reactions of aspartic acid and O-phospho-L-serine on hydroxylapatite are less effective in generating long oligomers, while illite fails to accumulate substantial amounts of long oligomers of aspartic acid or of O-phospho-L-serine.

  19. Stroke multiplicity and horizontal scale of negative charge regions in thunderclouds

    NASA Astrophysics Data System (ADS)

    Williams, Earle R.; Mattos, Enrique V.; Machado, Luiz A. T.

    2016-05-01

    An X-band polarimetric radar and multiple lightning detection systems are used to document the initial cloud-to-ground lightning flash in a large number (46 cases) of incipient thunderstorms, as part of the CHUVA-Vale field campaign during the 2011/2012 spring-summer in southeast Brazil. The results show an exceptionally low stroke multiplicity (87% of flashes with single stroke) in the initial ground flashes, a finding consistent with the limited space available for the positive leader extension into new regions of negative space charge in compact cells. The results here are contrasted with the behavior of ground flashes in mesoscale thunderstorms in previous studies. Additionally, we found evidence for a minimum scale (radar echo >20 dBZ) for lightning initiation (>3 km in radius) and that the peak currents of initial cloud-to-ground flashes in these compact thunderstorms are only half as large as return stroke peak currents in general.

  20. Penetration of negatively charged lipid interfaces by the doubly deprotonated dipicolinate.

    PubMed

    Crans, Debbie C; Trujillo, Alejandro M; Bonetti, Sandra; Rithner, Christopher D; Baruah, Bharat; Levinger, Nancy E

    2008-12-19

    The possibility that a negatively charged organic molecule penetrates the lipid interface in a reverse micellar system is examined using UV-vis absorption and NMR spectroscopy. The hypothesis that deprotonated forms of dipicolinic acid, H(2)dipic, such as Hdipic(-) and dipic(2-), can penetrate the lipid interface in a microemulsion is based on our previous finding that the insulin-enhancing anionic [VO(2)dipic](-) complex was found to reside in the hydrophobic layer of the reverse micelle (Crans et al. J. Am. Chem. Soc. 2006, 128, 4437-4445). Penetration of a polar and charged compound, namely Hdipic(-) or dipic(2-), into a hydrophobic environment is perhaps unexpected given the established rules regarding the fundamental properties of compound solubility. As such, this work has broad implications in organic chemistry and other disciplines of science. These studies required a comprehensive investigation of the different dipic species and their association in aqueous solutions at varying pH values. Combining the aqueous studies using absorption and NMR spectroscopy with those in microemulsions defines the differences observed in the heterogeneous environment. Despite the expected repulsion between the surfactant head groups and the dianionic probe molecule, these studies demonstrate that dipic resides deep in the hydrophobic portion of the reverse micellar interface. In summary, these results provide evidence that ionic molecules can reside in nonpolar locations in microheterogeneous environments. This suggests that additional factors such as solvation are important to molecule location. Documented ability to penetrate lipid surfaces of similar charge provides a rationale for why specific drugs with less than optimal hydrophobicity are successful even though they violate Lipinski's rules. PMID:19053583

  1. Negatively charged hyperbranched polyglycerol grafted membranes for osmotic power generation from municipal wastewater.

    PubMed

    Li, Xue; Cai, Tao; Chen, Chunyan; Chung, Tai-Shung

    2016-02-01

    Osmotic power holds great promise as a clean, sustainable and largely unexploited energy resource. Recent membrane development for pressure-retarded osmosis (PRO) is making the osmotic power generation more and more realistic. However, severe performance declines have been observed because the porous layer of PRO membranes is fouled by the feed stream. To overcome it, a negatively charged antifouling PRO hollow fiber membrane has been designed and studied in this work. An antifouling polymer, derived from hyperbranched polyglycerol and functionalized by α-lipoic acid and succinic anhydride, was synthesized and grafted onto the polydopamine (PDA) modified poly(ether sulfone) (PES) hollow fiber membranes. In comparison to unmodified membranes, the charged hyperbranched polyglycerol (CHPG) grafted membrane is much less affected by organic deposition, such as bovine serum albumin (BSA) adsorption, and highly resistant to microbial growths, demonstrated by Escherichia coli adhesion and Staphylococcus aureus attachment. CHPG-g-TFC was also examined in PRO tests using a concentrated wastewater as the feed. Comparing to the plain PES-TFC and non-charged HPG-g-TFC, the newly developed membrane exhibits not only the smallest decline in water flux but also the highest recovery rate. When using 0.81 M NaCl and wastewater as the feed pair in PRO tests at 15 bar, the average power density remains at 5.6 W/m(2) in comparison to an average value of 3.6 W/m(2) for unmodified membranes after four PRO runs. In summary, osmotic power generation may be sustained by properly designing and anchoring the functional polymers to PRO membranes.

  2. Negatively charged hyperbranched polyglycerol grafted membranes for osmotic power generation from municipal wastewater.

    PubMed

    Li, Xue; Cai, Tao; Chen, Chunyan; Chung, Tai-Shung

    2016-02-01

    Osmotic power holds great promise as a clean, sustainable and largely unexploited energy resource. Recent membrane development for pressure-retarded osmosis (PRO) is making the osmotic power generation more and more realistic. However, severe performance declines have been observed because the porous layer of PRO membranes is fouled by the feed stream. To overcome it, a negatively charged antifouling PRO hollow fiber membrane has been designed and studied in this work. An antifouling polymer, derived from hyperbranched polyglycerol and functionalized by α-lipoic acid and succinic anhydride, was synthesized and grafted onto the polydopamine (PDA) modified poly(ether sulfone) (PES) hollow fiber membranes. In comparison to unmodified membranes, the charged hyperbranched polyglycerol (CHPG) grafted membrane is much less affected by organic deposition, such as bovine serum albumin (BSA) adsorption, and highly resistant to microbial growths, demonstrated by Escherichia coli adhesion and Staphylococcus aureus attachment. CHPG-g-TFC was also examined in PRO tests using a concentrated wastewater as the feed. Comparing to the plain PES-TFC and non-charged HPG-g-TFC, the newly developed membrane exhibits not only the smallest decline in water flux but also the highest recovery rate. When using 0.81 M NaCl and wastewater as the feed pair in PRO tests at 15 bar, the average power density remains at 5.6 W/m(2) in comparison to an average value of 3.6 W/m(2) for unmodified membranes after four PRO runs. In summary, osmotic power generation may be sustained by properly designing and anchoring the functional polymers to PRO membranes. PMID:26630043

  3. Synthesis of positively and negatively charged silver nanoparticles and their deposition on the surface of titanium

    NASA Astrophysics Data System (ADS)

    Sharonova, A.; Loza, K.; Surmeneva, M.; Surmenev, R.; Prymak, O.; Epple, M.

    2016-02-01

    Bacterial infections related to dental implants are currently a significant complication. A good way to overcome this challenge is functionalization of implant surface with Ag nanoparticles (NPs) as antibacterial agent. This article aims at review the synthesis routes, size and electrical properties of AgNPs. Polyvinyl pyrrolidone (PVP) and polyethyleneimine (PEI) were used as stabilizers. Dynamic Light Scattering, Nanoparticle Tracking Analysis, X-ray diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive spectroscopy (EDX) have been used to characterize the prepared AgNPs. Two types of NPs were synthesized in aqueous solutions: PVP-stabilized NPs with a diameter of the metallic core of 70 ± 20 nm, and negative charge of -20 mV, PEI-stabilized NPs with the size of the metallic core of 50 ± 20 nm and positive charge of +55 mV. According to SEM results, all the NPs have a spherical shape. Functionalization of the titanium substrate surface with PVP and PEI-stabilized AgNPs was carried out by dropping method. XRD patterns revealed that the AgNPs are crystalline with the crystallite size of 14 nm.

  4. Gap state charge induced spin-dependent negative differential resistance in tunnel junctions

    NASA Astrophysics Data System (ADS)

    Jiang, Jun; Zhang, X.-G.; Han, X. F.

    2016-04-01

    We propose and demonstrate through first-principles calculation a new spin-dependent negative differential resistance (NDR) mechanism in magnetic tunnel junctions (MTJ) with cubic cation disordered crystals (CCDC) AlO x or Mg1-x Al x O as barrier materials. The CCDC is a class of insulators whose band gap can be changed by cation doping. The gap becomes arched in an ultrathin layer due to the space charge formed from metal-induced gap states. With an appropriate combination of an arched gap and a bias voltage, NDR can be produced in either spin channel. This mechanism is applicable to 2D and 3D ultrathin junctions with a sufficiently small band gap that forms a large space charge. It provides a new way of controlling the spin-dependent transport in spintronic devices by an electric field. A generalized Simmons formula for tunneling current through junction with an arched gap is derived to show the general conditions under which ultrathin junctions may exhibit NDR.

  5. Gap state charge induced spin-dependent negative differential resistance in tunnel junctions

    NASA Astrophysics Data System (ADS)

    Jiang, Jun; Zhang, X.-G.; Han, X. F.

    2016-04-01

    We propose and demonstrate through first-principles calculation a new spin-dependent negative differential resistance (NDR) mechanism in magnetic tunnel junctions (MTJ) with cubic cation disordered crystals (CCDC) AlO x or Mg1‑x Al x O as barrier materials. The CCDC is a class of insulators whose band gap can be changed by cation doping. The gap becomes arched in an ultrathin layer due to the space charge formed from metal-induced gap states. With an appropriate combination of an arched gap and a bias voltage, NDR can be produced in either spin channel. This mechanism is applicable to 2D and 3D ultrathin junctions with a sufficiently small band gap that forms a large space charge. It provides a new way of controlling the spin-dependent transport in spintronic devices by an electric field. A generalized Simmons formula for tunneling current through junction with an arched gap is derived to show the general conditions under which ultrathin junctions may exhibit NDR.

  6. Negatively-charged NV-center in SiC: Electronic structure properties

    NASA Astrophysics Data System (ADS)

    Dev, Pratibha; Economou, Sophia

    Deep defects with high-spin states in semiconductors are promising candidates as solid-state systems for quantum computing applications. The charged NV-center in diamond is the best-known and most-studied defect center, and has proven to be a good proof-of-principle structure for demonstrating the use of such defects in quantum technologies. Increasingly, however, there is an interest in exploring deep defects in alternative semiconductors such as SiC. This is due to the challenges posed by diamond as host material for defects, as well as the attractive properties of SiC. In this density functional theory work, we study the spin-1 structure of the negatively charged NV-center in two polytypes: 3C-SiC and 4H-SiC. The calculated zero phonon line for the excited state of the defect is in telecom range (0.90eV), making it a very good candidate for quantum technologies. This work provides basic ingredients required to understand the physics of this color center at a quantitative and qualitative level. We also design quantum information applications, such as a spin-photon interface and multi-photon entanglement.

  7. Strong Electrostatic Interactions Lead to Entropically Favorable Binding of Peptides to Charged Surfaces.

    PubMed

    Sprenger, K G; Pfaendtner, Jim

    2016-06-01

    Thermodynamic analyses can provide key insights into the origins of protein self-assembly on surfaces, protein function, and protein stability. However, obtaining quantitative measurements of thermodynamic observables from unbiased classical simulations of peptide or protein adsorption is challenging because of sampling limitations brought on by strong biomolecule/surface binding forces as well as time scale limitations. We used the parallel tempering metadynamics in the well-tempered ensemble (PTMetaD-WTE) enhanced sampling method to study the adsorption behavior and thermodynamics of several explicitly solvated model peptide adsorption systems, providing new molecular-level insight into the biomolecule adsorption process. Specifically studied were peptides LKα14 and LKβ15 and trpcage miniprotein adsorbing onto a charged, hydrophilic self-assembled monolayer surface functionalized with a carboxylic acid/carboxylate headgroup and a neutral, hydrophobic methyl-terminated self-assembled monolayer surface. Binding free energies were calculated as a function of temperature for each system and decomposed into their respective energetic and entropic contributions. We investigated how specific interfacial features such as peptide/surface electrostatic interactions and surface-bound ion content affect the thermodynamic landscape of adsorption and lead to differences in surface-bound conformations of the peptides. Results show that upon adsorption to the charged surface, configurational entropy gains of the released solvent molecules dominate the configurational entropy losses of the bound peptide. This behavior leads to an apparent increase in overall system entropy upon binding and therefore to the surprising and seemingly nonphysical result of an apparent increased binding free energy at elevated temperatures. Opposite effects and conclusions are found for the neutral surface. Additional simulations demonstrate that by adjusting the ionic strength of the solution

  8. Ex vivo complement protein adsorption on positively and negatively charged cellulose dialyser membranes.

    PubMed

    Mahiout, A; Matata, B M; Vienken, J; Courtney, J M

    1997-05-01

    An ex vivo test system was used to measure complement protein C3 and factor B adsorption onto small dialyser modules made from regenerated and modified cellulosic hollow fibre membranes in which positive diethylaminoethyl (DEAE) or negative carboxymethyl (CM) groups were introduced into the cellulose matrix. The extracorporeal system, which included test-dialysers and the dialysis environment, allowed the use of labelled proteins without contaminating the blood donors which were connected in an open-loop fashion to the extracorporeal test system. The modules were removed at selected time points from the extracorporeal system for radioactivity counting. The results were used to evaluate the mechanisms involved in complement reactions to foreign surfaces. The system therefore allowed the analysis of complement protein adsorption occurring in the dialyser modules and its relationship to the complement generation rate in the extracorporeal system to be evaluated. It was possible to demonstrate that significant complement C3 and factor B adsorption occurred in the test modules made of cellulosic membranes. Complement adsorption as a function of the pH and the release reaction of the adsorbed C3 and factor B after membrane blood perfusion were therefore found to be variable according to the cellulosic membrane type and the presence of positive or negative charged groups within the cellulose matrix. The data obtained from the ex vivo model therefore provided additional evidence on the discussion of the mechanisms involved in the increased complement activation by regenerated cellulose and in its attenuation by DEAE- or CM-modified cellulose.

  9. Internal configuration and electric potential in planar negatively charged lipid head group region in contact with ionic solution.

    PubMed

    Lebar, Alenka Maček; Velikonja, Aljaž; Kramar, Peter; Iglič, Aleš

    2016-10-01

    The lipid bilayer composed of negatively charged lipid 1-palmitoyl-3-oleoyl-sn-glycero-3-phosphatidylserine (POPS) in contact with an aqueous solution of monovalent salt ions was studied theoretically by using the mean-field modified Langevin-Poisson-Boltzmann (MLPB) model. The MLPB results were tested by using molecular dynamic (MD) simulations. In the MLPB model the charge distribution of POPS head groups is theoretically described by the negatively charged surface which accounts for negatively charged phosphate groups, while the positively charged amino groups and negatively charged carboxylate groups are assumed to be fixed on the rod-like structures with rotational degree of freedom. The spatial variation of relative permittivity, which is not considered in the well-known Gouy-Chapman (GC) model or in MD simulations, is thoroughly derived within a strict statistical mechanical approach. Therefore, the spatial dependence and magnitude of electric potential within the lipid head group region and its close vicinity are considerably different in the MLPB model from the GC model. The influence of the bulk salt concentration and temperature on the number density profiles of counter-ions and co-ions in the lipid head group region and aqueous solution along with the probability density function for the lipid head group orientation angle was compared and found to be in qualitative agreement in the MLPB and MD models. PMID:27209203

  10. Acanthamoeba myosin IC colocalizes with phosphatidylinositol 4,5-bisphosphate at the plasma membrane due to the high concentration of negative charge.

    PubMed

    Brzeska, Hanna; Hwang, Kae-Jung; Korn, Edward D

    2008-11-14

    The tail of Acanthamoeba myosin IC (AMIC) has a basic region (BR), which contains a putative pleckstrin homology (PH) domain, followed by two Gly/Pro/Ala (GPA)-rich regions separated by a Src homology 3 (SH3) domain. Cryoelectron microscopy had shown that the tail is folded back on itself at the junction of BR and GPA1, and nuclear magnetic resonance spectroscopy indicated that the SH3 domain may interact with the putative PH domain. The BR binds to acidic phospholipids, and the GPA region binds to F-actin. We now show that the folded tail does not affect the affinity of AMIC for acidic phospholipids. AMIC binds phosphatidylinositol 4,5-bisphosphate (PIP2) with high affinity (approximately 1 microm), but binding is not stereospecific. When normalized to net negative charge, AMIC binds with equal affinity to phosphatidylserine (PS) and PIP2. This and other data show that the putative PH domain of AMIC is not a typical PIP2-specific PH domain. We have identified a 13-residue sequence of basic-hydrophobic-basic amino acids within the putative PH domain that may be a major determinant of binding of AMIC to acidic phospholipids. Despite the lack of stereospecificity, AMIC binds 10 times more strongly to vesicles containing 5% PIP2 plus 25% PS than to vesicles containing only 25% PS, suggesting that AMIC may be targeted to PIP2-enriched regions of the plasma membrane. In agreement with this, AMIC colocalizes with PIP2 at dynamic, protrusive regions of the plasma membrane. We discuss the possibility that AMIC binding to PIP2 may initiate the formation of a multiprotein complex at the plasma membrane.

  11. Accurate vibrational frequencies using the self-consistent-charge density-functional tight-binding method

    NASA Astrophysics Data System (ADS)

    Małolepsza, Edyta; Witek, Henryk A.; Morokuma, Keiji

    2005-09-01

    An optimization technique for enhancing the quality of repulsive two-body potentials of the self-consistent-charge density-functional tight-binding (SCC-DFTB) method is presented and tested. The new, optimized potentials allow for significant improvement of calculated harmonic vibrational frequencies. Mean absolute deviation from experiment computed for a group of 14 hydrocarbons is reduced from 59.0 to 33.2 cm -1 and maximal absolute deviation, from 436.2 to 140.4 cm -1. A drawback of the new family of potentials is a lower quality of reproduced geometrical and energetic parameters.

  12. Highly efficient bioinspired molecular Ru water oxidation catalysts with negatively charged backbone ligands.

    PubMed

    Duan, Lele; Wang, Lei; Li, Fusheng; Li, Fei; Sun, Licheng

    2015-07-21

    The oxygen evolving complex (OEC) of the natural photosynthesis system II (PSII) oxidizes water to produce oxygen and reducing equivalents (protons and electrons). The oxygen released from PSII provides the oxygen source of our atmosphere; the reducing equivalents are used to reduce carbon dioxide to organic products, which support almost all organisms on the Earth planet. The first photosynthetic organisms able to split water were proposed to be cyanobacteria-like ones appearing ca. 2.5 billion years ago. Since then, nature has chosen a sustainable way by using solar energy to develop itself. Inspired by nature, human beings started to mimic the functions of the natural photosynthesis system and proposed the concept of artificial photosynthesis (AP) with the view to creating energy-sustainable societies and reducing the impact on the Earth environments. Water oxidation is a highly energy demanding reaction and essential to produce reducing equivalents for fuel production, and thereby effective water oxidation catalysts (WOCs) are required to catalyze water oxidation and reduce the energy loss. X-ray crystallographic studies on PSII have revealed that the OEC consists of a Mn4CaO5 cluster surrounded by oxygen rich ligands, such as oxyl, oxo, and carboxylate ligands. These negatively charged, oxygen rich ligands strongly stabilize the high valent states of the Mn cluster and play vital roles in effective water oxidation catalysis with low overpotential. This Account describes our endeavors to design effective Ru WOCs with low overpotential, large turnover number, and high turnover frequency by introducing negatively charged ligands, such as carboxylate. Negatively charged ligands stabilized the high valent states of Ru catalysts, as evidenced by the low oxidation potentials. Meanwhile, the oxygen production rates of our Ru catalysts were improved dramatically as well. Thanks to the strong electron donation ability of carboxylate containing ligands, a seven

  13. Highly efficient bioinspired molecular Ru water oxidation catalysts with negatively charged backbone ligands.

    PubMed

    Duan, Lele; Wang, Lei; Li, Fusheng; Li, Fei; Sun, Licheng

    2015-07-21

    The oxygen evolving complex (OEC) of the natural photosynthesis system II (PSII) oxidizes water to produce oxygen and reducing equivalents (protons and electrons). The oxygen released from PSII provides the oxygen source of our atmosphere; the reducing equivalents are used to reduce carbon dioxide to organic products, which support almost all organisms on the Earth planet. The first photosynthetic organisms able to split water were proposed to be cyanobacteria-like ones appearing ca. 2.5 billion years ago. Since then, nature has chosen a sustainable way by using solar energy to develop itself. Inspired by nature, human beings started to mimic the functions of the natural photosynthesis system and proposed the concept of artificial photosynthesis (AP) with the view to creating energy-sustainable societies and reducing the impact on the Earth environments. Water oxidation is a highly energy demanding reaction and essential to produce reducing equivalents for fuel production, and thereby effective water oxidation catalysts (WOCs) are required to catalyze water oxidation and reduce the energy loss. X-ray crystallographic studies on PSII have revealed that the OEC consists of a Mn4CaO5 cluster surrounded by oxygen rich ligands, such as oxyl, oxo, and carboxylate ligands. These negatively charged, oxygen rich ligands strongly stabilize the high valent states of the Mn cluster and play vital roles in effective water oxidation catalysis with low overpotential. This Account describes our endeavors to design effective Ru WOCs with low overpotential, large turnover number, and high turnover frequency by introducing negatively charged ligands, such as carboxylate. Negatively charged ligands stabilized the high valent states of Ru catalysts, as evidenced by the low oxidation potentials. Meanwhile, the oxygen production rates of our Ru catalysts were improved dramatically as well. Thanks to the strong electron donation ability of carboxylate containing ligands, a seven

  14. Excitation of dust acoustic waves by an ion beam in a plasma cylinder with negatively charged dust grains

    SciTech Connect

    Sharma, Suresh C.; Kaur, Daljeet; Gahlot, Ajay; Sharma, Jyotsna

    2014-10-15

    An ion beam propagating through a plasma cylinder having negatively charged dust grains drives a low frequency electrostatic dust acoustic wave (DAW) to instability via Cerenkov interaction. The unstable wave frequencies and the growth rate increase with the relative density of negatively charged dust grains. The growth rate of the unstable mode scales to the one-third power of the beam density. The real part of the frequency of the unstable mode increases with the beam energy and scales to almost one-half power of the beam energy. The phase velocity, frequency, and wavelength results of the unstable mode are in compliance with the experimental observations.

  15. Statistical mechanics of dust charging in a multi-ion plasma with negative and positive ionic species

    SciTech Connect

    Mishra, S. K.; Misra, Shikha

    2015-02-15

    On the basis of statistical mechanics and charging kinetics, the charge distribution over uniform size spherical dust particles in a multi-ion plasma comprising of multiple charged negative and positive ions is investigated. Two specific situations where the complex plasma is viz., (i) dark (no emission from dust) and (ii) irradiated by laser light (causing photoemission from dust) have been taken into account. The analytical formulation includes the population balance equation for the charged dust particles along with number and energy balance of the complex plasma constituents. The departure of the results for multi-ion plasma from that in case of usual singly charged positive ion plasma is graphically illustrated and discussed. In contrast to electron-ion plasma, significant number of particles is seen to acquire opposite charge in case of pure positive-negative ion plasma, even in the absence of electron emission from the dust grains. The effects of various plasma parameters viz., number density, particle size, and work function of dust on charge distribution have also been examined.

  16. Electrostatic interactions play an essential role in the binding of oleic acid with α-lactalbumin in the HAMLET-like complex: a study using charge-specific chemical modifications.

    PubMed

    Xie, Yongjing; Min, Soyoung; Harte, Níal P; Kirk, Hannah; O'Brien, John E; Voorheis, H Paul; Svanborg, Catharina; Hun Mok, K

    2013-01-01

    Human α-lactalbumin made lethal to tumor cells (HAMLET) and its analogs are partially unfolded protein-oleic acid (OA) complexes that exhibit selective tumoricidal activity normally absent in the native protein itself. To understand the nature of the interaction between protein and OA moieties, charge-specific chemical modifications of lysine side chains involving citraconylation, acetylation, and guanidination were employed and the biophysical and biological properties were probed. Upon converting the original positively-charged lysine residues to negatively-charged citraconyl or neutral acetyl groups, the binding of OA to protein was eliminated, as were any cytotoxic activities towards osteosarcoma cells. Retention of the positive charges by converting lysine residues to homoarginine groups (guanidination); however, yielded unchanged binding of OA to protein and identical tumoricidal activity to that displayed by the wild-type α-lactalbumin-oleic acid complex. With the addition of OA, the wild-type and guanidinated α-lactalbumin proteins underwent substantial conformational changes, such as partial unfolding, loss of tertiary structure, but retention of secondary structure. In contrast, no significant conformational changes were observed in the citraconylated and acetylated α-lactalbumins, most likely because of the absence of OA binding. These results suggest that electrostatic interactions between the positively-charged basic groups on α-lactalbumin and the negatively-charged carboxylate groups on OA molecules play an essential role in the binding of OA to α-lactalbumin and that these interactions appear to be as important as hydrophobic interactions.

  17. Negatively charged nano-grains at 67P/Churyumov-Gerasimenko

    NASA Astrophysics Data System (ADS)

    Gombosi, T. I.; Burch, J. L.; Horányi, M.

    2015-11-01

    Shortly after the Rosetta mission's rendezvous with 67P/Churyumov-Gerasimenko the RPC/IES instrument intermittently detected negative particles that were identified as singly charged nano-dust grains. These grains were recorded as a nearly mono-energetic beam of particles in the 200-500 eV range arriving from the direction of the comet. Occasionally, another population of particles in the energy range of 1-20 keV were also noticed arriving from the approximate direction of the Sun. In this paper we review the processes that can explain the energization and the directionality of the observed nano-dust populations. We show that the observations are consistent with gas-drag acceleration of the outflowing particles with radii of 3-4 nm, and with the returning fragments of bigger particles accelerated by radiation pressure with approximate radii of 30-80 nm. In addition to gas drag and radiation pressure, we also examine the role of the solar wind induced motional electric field, and its possible role in explaining the intermittency of the detection of a nano-grain population arriving from the solar direction.

  18. Identification of functionally important negatively charged residues in the carboxy end of mouse hepatitis coronavirus A59 nucleocapsid protein.

    PubMed

    Verma, Sandhya; Bednar, Valerie; Blount, Andrew; Hogue, Brenda G

    2006-05-01

    The coronavirus nucleocapsid (N) protein is a multifunctional viral gene product that encapsidates the RNA genome and also plays some as yet not fully defined role in viral RNA replication and/or transcription. A number of conserved negatively charged amino acids are located within domain III in the carboxy end of all coronavirus N proteins. Previous studies suggested that the negatively charged residues are involved in virus assembly by mediating interaction between the membrane (M) protein carboxy tail and nucleocapsids. To determine the importance of these negatively charged residues, a series of alanine and other charged-residue substitutions were introduced in place of those in the N gene within a mouse hepatitis coronavirus A59 infectious clone. Aspartic acid residues 440 and 441 were identified as functionally important. Viruses could not be isolated when both residues were replaced by positively charged amino acids. When either amino acid was replaced by a positively charged residue or both were changed to alanine, viruses were recovered that contained second-site changes within N, but not in the M or envelope protein. The compensatory role of the new changes was confirmed by the construction of new viruses. A few viruses were recovered that retained the D441-to-arginine change and no compensatory changes. These viruses exhibited a small-plaque phenotype and produced significantly less virus. Overall, results from our analysis of a large panel of plaque-purified recovered viruses indicate that the negatively charged residues at positions 440 and 441 are key residues that appear to be involved in virus assembly. PMID:16611893

  19. Interfacial charge transfer between CdTe quantum dots and Gram negative vs. Gram positive bacteria.

    SciTech Connect

    Dumas, E.; Gao, C.; Suffern, D.; Bradforth, S. E.; Dimitrejevic, N. M.; Nadeau, J. L.; McGill Univ.; Univ. of Southern California

    2010-01-01

    Oxidative toxicity of semiconductor and metal nanomaterials to cells has been well established. However, it may result from many different mechanisms, some requiring direct cell contact and others resulting from the diffusion of reactive species in solution. Published results are contradictory due to differences in particle preparation, bacterial strain, and experimental conditions. It has been recently found that C{sub 60} nanoparticles can cause direct oxidative damage to bacterial proteins and membranes, including causing a loss of cell membrane potential (depolarization). However, this did not correlate with toxicity. In this study we perform a similar analysis using fluorescent CdTe quantum dots, adapting our tools to make use of the particles fluorescence. We find that two Gram positive strains show direct electron transfer to CdTe, resulting in changes in CdTe fluorescence lifetimes. These two strains also show changes in membrane potential upon nanoparticle binding. Two Gram negative strains do not show these effects - nevertheless, they are over 10-fold more sensitive to CdTe than the Gram positives. We find subtoxic levels of Cd{sup 2+} release from the particles upon irradiation of the particles, but significant production of hydroxyl radicals, suggesting that the latter is a major source of toxicity. These results help establish mechanisms of toxicity and also provide caveats for use of certain reporter dyes with fluorescent nanoparticles which will be of use to anyone performing these assays. The findings also suggest future avenues of inquiry into electron transfer processes between nanomaterials and bacteria.

  20. Binding energies of the lithium isoelectronic sequence approaching the critical charge

    NASA Astrophysics Data System (ADS)

    Katriel, Jacob; Puchalski, Mariusz; Pachucki, Krzysztof

    2012-10-01

    The Simon-Zhislin-Hunziker theorem implies that Zc, the critical charge below which the three electron atom is not bound, is at most 2. The vanishing electron affinity of He implies that Zc is not less than 2. Hence, Zc=2. To elucidate the approach to the critical charge, we calculated nonrelativistic binding energies for the third electron in the ground state, 1s22s2S, and in the first and second excited states, 1s22p2P and 1s23s2S, for nuclear charges approaching Zc. At this limit the quantum defects for both 2S states are found to approach unity. This implies that the orbital specifying the outer (ns,n=2,3) electron becomes a very diffuse (n-1)s-type orbital, except within the relatively tiny space occupied by the inner two-electron shell. For the 2P state the quantum defect approaches zero both as Z→∞ and as Z→2. An expression for the s-p splitting at Z→2 is suggested, that improves upon earlier results based on energies computed (or measured) at integer values of Z. Rigorous large Z asymptotic expressions for the quantum defects in the 1s2ns2S states are presented, exhibiting the expected mild dependence on the principal quantum number.

  1. Radiation transport codes for potential applications related to radiobiology and radiotherapy using protons, neutrons, and negatively charged pions

    NASA Technical Reports Server (NTRS)

    Armstrong, T. W.

    1972-01-01

    Several Monte Carlo radiation transport computer codes are used to predict quantities of interest in the fields of radiotherapy and radiobiology. The calculational methods are described and comparisions of calculated and experimental results are presented for dose distributions produced by protons, neutrons, and negatively charged pions. Comparisons of calculated and experimental cell survival probabilities are also presented.

  2. Net charge changes in the calculation of relative ligand-binding free energies via classical atomistic molecular dynamics simulation.

    PubMed

    Reif, Maria M; Oostenbrink, Chris

    2014-01-30

    The calculation of binding free energies of charged species to a target molecule is a frequently encountered problem in molecular dynamics studies of (bio-)chemical thermodynamics. Many important endogenous receptor-binding molecules, enzyme substrates, or drug molecules have a nonzero net charge. Absolute binding free energies, as well as binding free energies relative to another molecule with a different net charge will be affected by artifacts due to the used effective electrostatic interaction function and associated parameters (e.g., size of the computational box). In the present study, charging contributions to binding free energies of small oligoatomic ions to a series of model host cavities functionalized with different chemical groups are calculated with classical atomistic molecular dynamics simulation. Electrostatic interactions are treated using a lattice-summation scheme or a cutoff-truncation scheme with Barker-Watts reaction-field correction, and the simulations are conducted in boxes of different edge lengths. It is illustrated that the charging free energies of the guest molecules in water and in the host strongly depend on the applied methodology and that neglect of correction terms for the artifacts introduced by the finite size of the simulated system and the use of an effective electrostatic interaction function considerably impairs the thermodynamic interpretation of guest-host interactions. Application of correction terms for the various artifacts yields consistent results for the charging contribution to binding free energies and is thus a prerequisite for the valid interpretation or prediction of experimental data via molecular dynamics simulation. Analysis and correction of electrostatic artifacts according to the scheme proposed in the present study should therefore be considered an integral part of careful free-energy calculation studies if changes in the net charge are involved.

  3. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma

    PubMed Central

    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan

    2016-01-01

    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3’UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3’UTR. The endogenous regulation of the PCBP1 3’UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients. PMID:27648147

  4. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma.

    PubMed

    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan

    2016-01-01

    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3'UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3'UTR. The endogenous regulation of the PCBP1 3'UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients. PMID:27648147

  5. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma

    PubMed Central

    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan

    2016-01-01

    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3’UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3’UTR. The endogenous regulation of the PCBP1 3’UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients.

  6. Tantalum oxide/silicon nitride: A negatively charged surface passivation stack for silicon solar cells

    SciTech Connect

    Wan, Yimao Bullock, James; Cuevas, Andres

    2015-05-18

    This letter reports effective passivation of crystalline silicon (c-Si) surfaces by thermal atomic layer deposited tantalum oxide (Ta{sub 2}O{sub 5}) underneath plasma enhanced chemical vapour deposited silicon nitride (SiN{sub x}). Cross-sectional transmission electron microscopy imaging shows an approximately 2 nm thick interfacial layer between Ta{sub 2}O{sub 5} and c-Si. Surface recombination velocities as low as 5.0 cm/s and 3.2 cm/s are attained on p-type 0.8 Ω·cm and n-type 1.0 Ω·cm c-Si wafers, respectively. Recombination current densities of 25 fA/cm{sup 2} and 68 fA/cm{sup 2} are measured on 150 Ω/sq boron-diffused p{sup +} and 120 Ω/sq phosphorus-diffused n{sup +} c-Si, respectively. Capacitance–voltage measurements reveal a negative fixed insulator charge density of −1.8 × 10{sup 12 }cm{sup −2} for the Ta{sub 2}O{sub 5} film and −1.0 × 10{sup 12 }cm{sup −2} for the Ta{sub 2}O{sub 5}/SiN{sub x} stack. The Ta{sub 2}O{sub 5}/SiN{sub x} stack is demonstrated to be an excellent candidate for surface passivation of high efficiency silicon solar cells.

  7. Theoretical study of negatively charged Fe(-)-(H2O)(n ≤ 6) clusters.

    PubMed

    Castro, Miguel

    2012-06-14

    Interactions of a singly negatively charged iron atom with water molecules, Fe(-)-(H(2)O)(n≤6), in the gas phase were studied by means of density functional theory. All-electron calculations were performed using the B3LYP functional and the 6-311++G(2d,2p) basis set for the Fe, O, and H atoms. In the lowest total energy states of Fe(-)-(H(2)O)(n), the metal-hydrogen bonding is stronger than the metal-oxygen one, producing low-symmetry structures because the water molecules are directly attached to the metal by basically one of their hydrogen atoms, whereas the other ones are involved in a network of hydrogen bonds, which together with the Fe(δ-)-H(δ+) bonding accounts for the nascent hydration of the Fe(-) anion. For Fe(-)-(H(2)O)(3≤n), three-, four-, five-, and six-membered rings of water molecules are bonded to the metal, which is located at the surface of the cluster in such a way as to reduce the repulsion with the oxygen atoms. Nevertheless, internal isomers appear also, lying less than 3 or 5 kcal/mol for n = 2-3 or n = 4-6. These results are in contrast with those of classical TM(+)-(H(2)O)(n) complexes, where the direct TM(+)-O bonding usually produces high symmetry structures with the metal defining the center of the complex. They show also that the Fe(-) anions, as the TM(+) ions, have great capability for the adsorption of water molecules, forming Fe(-)-(H(2)O)(n) structures stabilized by Fe(δ-)-H(δ+) and H-bond interactions.

  8. SPTLC1 binds ABCA1 to negatively regulate trafficking and cholesterol efflux activity of the transporter.

    PubMed

    Tamehiro, Norimasa; Zhou, Suiping; Okuhira, Keiichiro; Benita, Yair; Brown, Cari E; Zhuang, Debbie Z; Latz, Eicke; Hornemann, Thorsten; von Eckardstein, Arnold; Xavier, Ramnik J; Freeman, Mason W; Fitzgerald, Michael L

    2008-06-10

    ABCA1 transport of cholesterol and phospholipids to nascent HDL particles plays a central role in lipoprotein metabolism and macrophage cholesterol homeostasis. ABCA1 activity is regulated both at the transcriptional level and at the post-translational level. To explore mechanisms involved in the post-translational regulation of the transporter, we have used affinity purification and mass spectrometry to identify proteins that bind ABCA1 and influence its activity. Previously, we demonstrated that an interaction between beta1-syntrophin stimulated ABCA1 activity, at least in part, be slowing the degradation of the transporter. This work demonstrates that one subunit of the serine palmitoyltransferase enzyme, SPTLC1, but not subunit 2 (SPTLC2), is copurified with ABCA1 and negatively regulates its function. In human THP-I macrophages and in mouse liver, the ABCA1-SPTLC1 complex was detected by co-immunoprecipitation, demonstrating that the interaction occurs in cellular settings where ABCA1 activity is critical for HDL genesis. Pharmacologic inhibition of SPTLC1 with myriocin, which resulted in the disruption of the SPTLC1-ABCA1 complex, and siRNA knockdown of SPTLC1 expression both stimulated ABCA1 efflux by nearly 60% ( p < 0.05). In contrast, dominant-negative mutants of SPTLC1 inhibited ABCA1 efflux, indicating that a reduced level of sphingomyelin synthesis could not explain the effect of myriocin on ABCA1 activity. In 293 cells, the SPTLC1 inhibition of ABCA1 activity led to the blockade of the exit of ABCA1 from the endoplasmic reticulum. In contrast, myriocin treatment of macrophages increased the level of cell surface ABCA1. In composite, these results indicate that the physical interaction of ABCA1 and SPTLC1 results in reduction of ABCA1 activity and that inhibition of this interaction produces enhanced cholesterol efflux. PMID:18484747

  9. Role of negatively charged ions in plasma on the growth and field emission properties of spherical carbon nanotube tip

    SciTech Connect

    Tewari, Aarti; Walia, Ritu; Sharma, Suresh C.

    2012-01-15

    The role of negatively charged ions in plasma on growth (without catalyst) and field emission properties of spherical carbon nanotube (CNT) tip has been theoretically investigated. A theoretical model of charge neutrality, including the kinetics of electrons, negatively and positively charged ions, neutral atoms, and the energy balance of various species has been developed. Numerical calculations of the spherical CNT tip radius for different relative density of negatively charged ions {epsilon}{sub r}(=n{sub SF{sub 6{sup -}}}/n{sub C{sup +}}, where n{sub SF{sub 6{sup -}}} and n{sub C}{sup +} are the equilibrium densities of sulphur hexafluoride and carbon ions, respectively) have been carried out for the typical glow discharge plasma parameters. It is found that the spherical CNT tip radius decreases with {epsilon}{sub r} and hence the field emission of electrons from the spherical CNT tip increases. Some of our theoretical results are in accordance with the existing experimental observations.

  10. Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

    PubMed Central

    Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane

    2016-01-01

    The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

  11. Negatively Charged Amino Acids Near and in Transient Receptor Potential (TRP) Domain of TRPM4 Channel Are One Determinant of Its Ca2+ Sensitivity*

    PubMed Central

    Yamaguchi, Soichiro; Tanimoto, Akira; Otsuguro, Ken-ichi; Hibino, Hiroshi; Ito, Shigeo

    2014-01-01

    Transient receptor potential (TRP) channel melastatin subfamily member 4 (TRPM4) is a broadly expressed nonselective monovalent cation channel. TRPM4 is activated by membrane depolarization and intracellular Ca2+, which is essential for the activation. The Ca2+ sensitivity is known to be regulated by calmodulin and membrane phosphoinositides, such as phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2). Although these regulators must play important roles in controlling TRPM4 activity, mutation analyses of the calmodulin-binding sites have suggested that Ca2+ binds to TRPM4 directly. However, the intrinsic binding sites in TRPM4 remain to be elucidated. Here, by using patch clamp and molecular biological techniques, we show that there are at least two functionally different divalent cation-binding sites, and the negatively charged amino acids near and in the TRP domain in the C-terminal tail of TRPM4 (Asp-1049 and Glu-1062 of rat TRPM4) are required for maintaining the normal Ca2+ sensitivity of one of the binding sites. Applications of Co2+, Mn2+, or Ni2+ to the cytosolic side potentiated TRPM4 currents, increased the Ca2+ sensitivity, but were unable to evoke TRPM4 currents without Ca2+. Mutations of the acidic amino acids near and in the TRP domain, which are conserved in TRPM2, TRPM5, and TRPM8, deteriorated the Ca2+ sensitivity in the presence of Co2+ or PI(4,5)P2 but hardly affected the sensitivity to Co2+ and PI(4,5)P2. These results suggest a novel role of the TRP domain in TRPM4 as a site responsible for maintaining the normal Ca2+ sensitivity. These findings provide more insights into the molecular mechanisms of the regulation of TRPM4 by Ca2+. PMID:25378404

  12. Interaction of the Tim44 C-terminal domain with negatively charged phospholipids.

    PubMed

    Marom, Milit; Safonov, Roman; Amram, Shay; Avneon, Yoav; Nachliel, Esther; Gutman, Menachem; Zohary, Keren; Azem, Abdussalam; Tsfadia, Yossi

    2009-12-01

    The translocation of proteins from the cytosol into the mitochondrial matrix is mediated by the coordinated action of the TOM complex in the outer membrane, as well as the TIM23 complex and its associated protein import motor in the inner membrane. The focus of this work is the peripheral inner membrane protein Tim44. Tim44 is a vital component of the mitochondrial protein translocation motor that anchors components of the motor to the TIM23 complex. For this purpose, Tim44 associates with the import channel by direct interaction with the Tim23 protein. Additionally, it was shown in vitro that Tim44 associates with acidic model membranes, in particular those containing cardiolipin. The latter interaction was shown to be mediated by the carboxy-terminal domain of Tim44 [Weiss, C., et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96, 8890-8894]. The aim of this study was to determine the precise recognition site for negative lipids in the C-terminal domain of Tim44. In particular, we wanted to examine the recently suggested hypothesis that acidic phospholipids associate with Tim44 via a hydrophobic cavity that is observed in the high-resolution structure of the C-terminal domain of the protein [Josyula, R., et al. (2006) J. Mol. Biol. 359, 798-804]. Molecular dynamics simulations suggest that (i) the hydrophobic tail of lipids may interact with Tim44 via the latter's hydrophobic cavity and (ii) a region, located in the N-terminal alpha-helix of the C-terminal domain (helices A1 and A2), may serve as a membrane attachment site. To validate this assumption, N-terminal truncations of yeast Tim44 were examined for their ability to bind cardiolipin-containing phospholipid vesicles. The results indicate that removal of the N-terminal alpha-helix (helix A1) abolishes the capacity of Tim44 to associate with cardiolipin-containing liposomes. We suggest that helices A1 and A2, in Tim44, jointly promote the association of the protein with acidic phospholipids. PMID:19863062

  13. Regulation of protein C inhibitor (PCI) activity by specific oxidized and negatively charged phospholipids.

    PubMed

    Malleier, Julia M; Oskolkova, Olga; Bochkov, Valery; Jerabek, Ingrid; Sokolikova, Barbora; Perkmann, Thomas; Breuss, Johannes; Binder, Bernd R; Geiger, Margarethe

    2007-06-01

    Protein C inhibitor (PCI) is a serpin with affinity for heparin and phosphatidylethanolamine (PE). We analyzed the interaction of PCI with different phospholipids and their oxidized forms. PCI bound to oxidized PE (OxPE), and oxidized and unoxidized phosphatidylserine (PS) immobilized on microtiter plates and in aqueous suspension. Binding to OxPE and PS was competed by heparin, but not by the aminophospholipid-binding protein annexin V or the PCI-binding lipid retinoic acid. PS and OxPE stimulated the inhibition of activated protein C (aPC) by PCI in a Ca(++)-dependent manner, indicating that binding of both, aPC (Ca(++) dependent) and PCI (Ca(++) independent), to phospholipids is necessary. A peptide corresponding to the heparin-binding site of PCI abolished the stimulatory effect of PS on aPC inhibition. No stimulatory effect of phospholipids on aPC inhibition was seen with a PCI mutant lacking the heparin-binding site. A heparin-like effect of phospholipids (OxPE) was not seen with antithrombin III, another heparin-binding serpin, suggesting that it is specific for PCI. PCI and annexin V were found to be endogenously colocalized in atherosclerotic plaques, supporting the hypothesis that exposure of oxidized PE and/or PS may be important for the local regulation of PCI activity in vivo.

  14. Energy straggling of low-energy ion beam in a charge exchange cell for negative ion production

    SciTech Connect

    Takeuchi, S.; Sasao, M.; Sugawara, H.; Tanaka, N.; Kisaki, M.; Okamoto, A.; Shinto, K.; Kitajima, S.; Nishiura, M.; Wada, M.

    2008-02-15

    Energy straggling in a charge exchange cell, which is frequently used for negative ion production, was studied experimentally and compared with the results of theoretical evaluation. The change of the energy spectrum of a He{sup +} beam due to charge exchange processes in argon gas was measured in the energy range of 2-6 keV. Energy straggling by multiple collisions is expressed by the energy loss formula due to inelastic and elastic processes. The impact parameter is related to the elastic scattering angle, and the geometry of the charge exchange cell and other components of the beam transportation system determines the maximum acceptable scattering angle. The energy spread was evaluated taking the integral limit over the impact parameter into consideration. The theoretical results showed good agreement with those of actual measurement.

  15. Observations of the connection of positive and negative leaders in meter-scale electric discharges generated by clouds of negatively charged water droplets

    NASA Astrophysics Data System (ADS)

    Kostinskiy, A. Yu.; Syssoev, V. S.; Bogatov, N. A.; Mareev, E. A.; Andreev, M. G.; Bulatov, M. U.; Makal'sky, L. M.; Sukharevsky, D. I.; Rakov, V. A.

    2016-08-01

    Detailed observations of the connection between positive and negative leaders in meter-scale electric discharges generated by clouds of negatively charged water droplets are presented, and their possible implications for the attachment process in lightning are discussed. Optical images obtained with three different high-speed cameras (visible range with image enhancement, visible-range regular, and infrared) and corresponding current recordings were used. Two snapshots of the breakthrough phase of the leader connection, showing significant leader branching inside the common streamer zone, are presented for the first time. Positive and negative leader speeds inside the common streamer zone for two events were found to be similar. Higher leader speeds were generally associated with higher leader currents. In the case of head-to-head leader connection, the infrared brightness of the junction region (probably representing the gas temperature and, hence, the energy input) was typically a factor of 5 or so higher than for channel sections either below or above that region. In 16% of cases, the downward negative leader connected to the upward positive leader below its tip (attached to the lateral surface of the positive leader), with the connection being accomplished via a channel segment that appeared to be perpendicular to one or both of the leader channels.

  16. Critical role of charged residues in helix 7 of the ligand binding domain in Hepatocyte Nuclear Factor 4alpha dimerisation and transcriptional activity.

    PubMed

    Eeckhoute, Jérôme; Oxombre, Bénédicte; Formstecher, Pierre; Lefebvre, Philippe; Laine, Bernard

    2003-11-15

    Hepatocyte Nuclear Factor 4alpha (HNF4alpha, NR2A1) is central to hepatocyte and pancreatic beta-cell functions. Along with retinoid X receptor alpha (RXRalpha), HNF4alpha belongs to the nuclear receptor subfamily 2 (NR2), characterised by a conserved arginyl residue and a glutamate residue insert in helix 7 (H7) of the ligand binding domain (LBD). Crystallographic studies indicate that R348 and E352 residues in RXRalpha H7 are involved in charge-driven interactions that improve dimerisation. Consistent with these findings, we showed that removing the charge of the corresponding residues in HNF4alpha H7, R258 and E262, impaired dimerisation in solution. Moreover, our results provide a new concept according to which helices of the HNF4alpha LBD dimerisation interface contribute differently to dimerisation required for DNA binding; unlike H9 and H10, H7 is not involved in DNA binding. Substitutions of E262 decreased the repression of HNF4alpha transcriptional activity by a dominant-negative HNF4alpha mutant, highlighting the importance of this residue for dimerisation in the cell context. The E262 insert is crucial for HNF4alpha function since its deletion abolished HNF4alpha transcriptional activity and coactivator recruitment. The glutamate residue insert and the conserved arginyl residue in H7 most probably represent a signature of the NR2 subfamily of nuclear receptors.

  17. Local description of the through phenyl transfer of a negative charge within resonance theory: topological effects in xylylene radical anions

    NASA Astrophysics Data System (ADS)

    Karafiloglou, Padeleimon; Launay, Jean-Pierre

    1999-11-01

    The topological effects specifying a di-substituted phenyl ring bearing a negative charge are investigated by considering the radical anions of para- and meta-xylylene isomers as model systems. The super exchange (SE) and double exchange (DE) component mechanisms describing the through phenyl transfer of a negative charge are considered and examined within `resonance' or `mesomeric' theory. The radical anion electronic events characterizing the DE and SE resonance structures are investigated by means of poly-electron population analysis. Correlated ab initio MO wavefunctions are used as the starting material in our calculations, and the various second quantized density operators are built on the basis of natural AOs. Conditional electronic events specifying SE or DE mechanisms are defined, and the corresponding probabilities are compared for meta and para topologies. The main trends are rationalized by comparing the effects provoked in phenyl ring when the negative charge is transferred from one substituent or the other. In para topology the effects are additive for the most important resonance structures, while in meta (characterized from `quantum interferences') the same effects are antagonist in all structures and for both SE and DE mechanisms.

  18. One-dimensional Brownian motion of charged nanoparticles along microtubules: a model system for weak binding interactions.

    PubMed

    Minoura, Itsushi; Katayama, Eisaku; Sekimoto, Ken; Muto, Etsuko

    2010-04-21

    Various proteins are known to exhibit one-dimensional Brownian motion along charged rodlike polymers, such as microtubules (MTs), actin, and DNA. The electrostatic interaction between the proteins and the rodlike polymers appears to be crucial for one-dimensional Brownian motion, although the underlying mechanism has not been fully clarified. We examined the interactions of positively-charged nanoparticles composed of polyacrylamide gels with MTs. These hydrophilic nanoparticles bound to MTs and displayed one-dimensional Brownian motion in a charge-dependent manner, which indicates that nonspecific electrostatic interaction is sufficient for one-dimensional Brownian motion. The diffusion coefficient decreased exponentially with an increasing particle charge (with the exponent being 0.10 kBT per charge), whereas the duration of the interaction increased exponentially (exponent of 0.22 kBT per charge). These results can be explained semiquantitatively if one assumes that a particle repeats a cycle of binding to and movement along an MT until it finally dissociates from the MT. During the movement, a particle is still electrostatically constrained in the potential valley surrounding the MT. This entire process can be described by a three-state model analogous to the Michaelis-Menten scheme, in which the two parameters of the equilibrium constant between binding and movement, and the rate of dissociation from the MT, are derived as a function of the particle charge density. This study highlights the possibility that the weak binding interactions between proteins and rodlike polymers, e.g., MTs, are mediated by a similar, nonspecific charge-dependent mechanism.

  19. REVISED BIG BANG NUCLEOSYNTHESIS WITH LONG-LIVED, NEGATIVELY CHARGED MASSIVE PARTICLES: UPDATED RECOMBINATION RATES, PRIMORDIAL {sup 9}Be NUCLEOSYNTHESIS, AND IMPACT OF NEW {sup 6}Li LIMITS

    SciTech Connect

    Kusakabe, Motohiko; Kim, K. S.; Cheoun, Myung-Ki; Kajino, Toshitaka; Kino, Yasushi; Mathews, Grant J. E-mail: kyungsik@kau.ac.kr E-mail: kajino@nao.ac.jp E-mail: gmathews@nd.edu

    2014-09-01

    We extensively reanalyze the effects of a long-lived, negatively charged massive particle, X {sup –}, on big bang nucleosynthesis (BBN). The BBN model with an X {sup –} particle was originally motivated by the discrepancy between the {sup 6,} {sup 7}Li abundances predicted in the standard BBN model and those inferred from observations of metal-poor stars. In this model, {sup 7}Be is destroyed via the recombination with an X {sup –} particle followed by radiative proton capture. We calculate precise rates for the radiative recombinations of {sup 7}Be, {sup 7}Li, {sup 9}Be, and {sup 4}He with X {sup –}. In nonresonant rates, we take into account respective partial waves of scattering states and respective bound states. The finite sizes of nuclear charge distributions cause deviations in wave functions from those of point-charge nuclei. For a heavy X {sup –} mass, m{sub X} ≳ 100 GeV, the d-wave → 2P transition is most important for {sup 7}Li and {sup 7,} {sup 9}Be, unlike recombination with electrons. Our new nonresonant rate of the {sup 7}Be recombination for m{sub X} = 1000 GeV is more than six times larger than the existing rate. Moreover, we suggest a new important reaction for {sup 9}Be production: the recombination of {sup 7}Li and X {sup –} followed by deuteron capture. We derive binding energies of X nuclei along with reaction rates and Q values. We then calculate BBN and find that the amount of {sup 7}Be destruction depends significantly on the charge distribution of {sup 7}Be. Finally, updated constraints on the initial abundance and the lifetime of the X {sup –} are derived in the context of revised upper limits to the primordial {sup 6}Li abundance. Parameter regions for the solution to the {sup 7}Li problem and the primordial {sup 9}Be abundances are revised.

  20. The surface charge of trypanosomatids.

    PubMed

    Souto-Padrón, Thaïs

    2002-12-01

    The surface charge of trypanosomatids was evaluated by means of the binding of cationic particles, as visualized by electron microscopy and by direct measurements of the electrophoretic mobility of cells. The results obtained indicate that most of the trypanosomatids exhibit a negatively charged surface whose value is species specific and varies according to the developmental stages. Sialic acids associated with glycoproteins, glycolipids and phosphate groups are the major components responsible for the net negative surface charge of the trypanosomatids.

  1. A modified QM/MM Hamiltonian with the Self-Consistent-Charge Density-Functional-Tight-Binding Theory for highly charged QM regions

    PubMed Central

    Hou, Guanhua; Zhu, Xiao; Elstner, Marcus; Cui, Qiang

    2012-01-01

    To improve the description of electrostatic interaction between QM and MM atoms when the QM is SCC-DFTB, we adopt a Klopman-Ohno (KO) functional form which considers the finite size of the QM and MM charge distributions. Compared to the original implementation that used a simple Coulombic interaction between QM Mulliken and MM point charges, the KO based QM/MM scheme takes charge penetration effect into consideration and therefore significantly improves the description of QM/MM interaction at short range, especially when the QM region is highly charged. To be consistent with the third-order formulation of SCC-DFTB, the Hubbard parameter in the KO functional is dependent on the QM charge. As a result, the effective size of the QM charge distribution naturally adjusts as the QM region undergoes chemical transformations, making the KO based QM/MM scheme particularly attractive for describing chemical reactions in the condensed phase. Together with the van der Waals parameters for the QM atom, the KO based QM/MM model introduces four parameters for each element type. They are fitted here based on microsolvation models of small solutes, focusing on negatively charged molecular ions, for elements O, C, H and P with a specific version of SCC-DFTB (SCC-DFTBPR). Test calculations confirm that the KO based QM/MM scheme significantly improves the interactions between QM and MM atoms over the original point charge based model and it is transferable due to the small number of parameters. The new form of QM/MM Hamiltonian will greatly improve the applicability of SCC-DFTB based QM/MM methods to problems that involve highly charged QM regions, such as enzyme catalyzed phosphoryl transfers. PMID:23275762

  2. Is ionized oxygen negatively or positively charged more effective for carboxyhemoglobin reduction compare to medical oxygen at atmospheric pressure?

    PubMed

    Perečinský, S; Kron, I; Engler, I; Murínová, L; Donič, V; Varga, M; Marossy, A; Legáth, Ľ

    2015-01-01

    Carbon monoxide (CO) reversibly binds to hemoglobin forming carboxyhemoglobin (COHb). CO competes with O(2) for binding place in hemoglobin leading to tissue hypoxia. Already 30 % saturation of COHb can be deadly. Medical oxygen at atmospheric pressure as a therapy is not enough effective. Therefore hyperbaric oxygen O(2) inhalation is recommended. There was a question if partially ionized oxygen can be a better treatment at atmospheric pressure. In present study we evaluated effect of partially ionized oxygen produced by device Oxygen Ion 3000 by Dr. Engler in elimination of COHb in vitro experiments and in smokers. Diluted blood with different content of CO was purged with 5 l/min of either medicinal oxygen O(2), negatively ionized O(2) or positively ionized O(2) for 15 min, then the COHb content was checked. In vivo study, 15 smokers inhaled of either medicinal oxygen O(2) or negatively ionized O(2), than we compared CO levels in expired air before and after inhalation. In both studies we found the highest elimination of CO when we used negatively ionized O(2). These results confirmed the benefit of short inhalation of negatively ionized O(2), in frame of Ionized Oxygen Therapy (I O(2)Th/Engler) which could be used in smokers for decreasing of COHb in blood.

  3. Binding Energy of 7ΛHe and Test of Charge Symmetry Breaking in the ΛN Interaction Potential

    NASA Astrophysics Data System (ADS)

    Hashimoto, O.; Fujii, Y.; Honda, D.; Kaneta, M.; Kato, F.; Kawama, D.; Maruyama, N.; Matsumura, A.; Nakamura, S. N.; Nomura, H.; Nonaka, K.; Ohtani, A.; Okayasu, Y.; Osaka, M.; Oyamada, M.; Sumihama, M.; Tamura, H.; Baker, O. K.; Cole, L.; Christy, M.; Gueye, P.; Keppel, C.; Tang, L.; Yuan, L.; Acha, A.; Baturin, P.; Boeglin, W.; Kramer, L.; Markowitz, P.; Pamela, P.; Perez, N.; Raue, B.; Reinhold, J.; Rivera, R.; Kato, S.; Sato, Y.; Takahashi, T.; Daniel, A.; Hungerford, Ed V.; Ispiryan, M.; Kalantarians, N.; Lan, K. J.; Li, Y.; Miyoshi, T.; Randeniya, S.; Rodriguez, V. M.; Bosted, P.; Carlini, R.; Ent, R.; Fenker, H.; Gaskell, D.; Jones, M.; Mack, D.; Roche, J.; Smith, G.; Tvaskis, V.; Vulcan, W.; Wood, S.; Yan, C.; Asaturyan, A.; Asaturyan, R.; Egiyan, K.; Mkrtchyan, A.; Mkrtchyan, H.; Margaryan, A.; Marikyan, G.; Navasardyan, T.; Tadevosyan, V.; Zamkochian, S.; Hu, B.; Song, Y.; Luo, W.; Androic, D.; Furic, M.; Petkovic, T.; Seva, T.; Ahmidouch, A.; Danagoulian, S.; Gasparian, A.; Halkyard, R.; Johnston, K.; Simicevic, N.; Wells, S.; Niculescu, G.; Niculescu, M.-I.; Gan, L.; Benmokhtar, F.; Horn, T.; Elaasar, M.; Gibson, E. F.

    2011-09-01

    The binding energy of 7ΛHe has been obtained for the first time with reaction spectroscopy using the (e, e'K+) reaction at Jefferson Lab's Hall C. A comparison among the binding energies of the A = 7 T = l iso-triplet hypernuclei, 7ΛHe, 7ΛLi*and 7ΛBe, is made and possible charge symmetry breaking (CSB) in the ΛN potential is discussed. For 7ΛHe and 7ΛBe, the shifts in binding energies are opposite to those predicted by a recent cluster model calculation, which assumes that the unexplained part of the binding energy difference between 4ΛH and 4ΛHe, is due to the CSB of the ΛN potential. Further examination of CSB in light hypernuclear systems is required both experimentally and theoretically.

  4. Binding energy of (Lambda)He-7 and test of charge symmetry breaking in the Lambda N interaction potential

    SciTech Connect

    Hashimoto, O; Honda, D; Kaneta, M; Kato, F; Kawama, D; Maruyama, N; Matsumura, A; Nakamura, S N; Nomura, H; Nonaka, K; Ohtani, A; Okayasu, Y; Osaka, M; Oyamada, M; Sumihama, M; Tamura, H; Baker, O K; Cole, L; Christy, M; Gueye, P; Keppel, C; Tang, L; Yuan, L; Acha, A; Baturin, P; Boeglin, W; Kramer, L; Markowitz, P; Pamela, P; Perez, N; Raue, B; Reinhold, J; Rivera, R; Kato, S; Sato, Y; Takahashi, T; Daniel, A; Hungerford, Ed V; Ispiryan, M; Kalantarians, N; Lan, K J; Li, Y; Miyoshi, T; Randeniya, S; Rodriguez, V M; Bosted, P; Carlini, R; Ent, R; Fenker, H; Gaskell, D; Jones, M; Mack, D; Roche, J; Smith, G; Tvaskis, V; Vulcan, W; Wood, S; Yan, C; Asaturyan, A; Asaturyan, R; Egiyan, K; Mkrtchyan, H; Margaryan, A; Navasardyan, T; Tadevosyan, V; Zamkochian, S; Hu, B; Song, Y; Luo, W; Androic, D; Furic, M; Petkovic, T; Seva, T; Ahmidouch, A; Danagoulian, S; Gasparian, A; Halkyard, R; Johnson, K; Simicevic, N; Wells, S; Niculescu, G; Niculescu, M I; Gan, L; Benmokhtar, F; Horn, T; Elassar, M; Gibson, E F

    2011-09-01

    The binding energy of 7LambdaHe has been obtained for the first time with reaction spectroscopy using the (e, e'K+) reaction at Jefferson Lab's Hall C. A comparison among the binding energies of the A = 7 T = l iso-triplet hypernuclei, 7LambdaHe, 7LambdaLi*and 7LambdaBe, is made and possible charge symmetry breaking (CSB) in the LambdaN potential is discussed. For 7LambdaHe and 7LambdaBe, the shifts in binding energies are opposite to those predicted by a recent cluster model calculation, which assumes that the unexplained part of the binding energy difference between 4LambdaH and 4LambdaHe, is due to the CSB of the LambdaN potential. Further examination of CSB in light hypernuclear systems is required both experimentally and theoretically.

  5. Negative Compressibility and Charge Partitioning Between Graphene and MoS2 Two-Dimensional Electron Gases

    NASA Astrophysics Data System (ADS)

    Tolsma, John; Larentis, Stefano; Tutuc, Emanuel; MacDonald, Allan

    2014-03-01

    Electron-electron interactions often have opposite influences on thermodynamic properties of electrons in graphene compared to conventional two-dimensional electron gases (2DEGs), for example by lowering charge and spin-susceptibilities in the graphene case and enhancing them in the ordinary 2DEG case. In ordinary 2DEGs the charge susceptibility diverges at a finite carrier density, below which the compressibility becomes negative. We theoretically explore the influence of this qualitative difference on how charge is partitioned between a MoS2 and a graphene sheet 2DEG when they act as a compound capacitor electrode. Our theory is based on a random phase approximation for charge fluctuations in the 2DEGS and the coupling constant formulation for the ground state energy. We find that in the ideal case the MoS2 2DEG carrier density jumps immediately to a finite value when it is initially populated and discuss how this effect is moderated by disorder. Work supported by the Welch Foundation grant TBF1473 and the DOE Division of Materials Sciences Engineering grant DE-FG03-02ER45958.

  6. Preparation and chromatographic evaluation of zwitterionic stationary phases with controllable ratio of positively and negatively charged groups.

    PubMed

    Cheng, Xiao-Dong; Hao, Yan-Hong; Peng, Xi-Tian; Yuan, Bi-Feng; Shi, Zhi-Guo; Feng, Yu-Qi

    2015-08-15

    The present study described the preparation and application of zwitterionic stationary phases (ACS) with controllable ratio of positively charged tertiary amine groups and negatively charged carboxyl groups. Various parameters, including water content, pH values and ionic strength of the mobile phase, were investigated to study the chromatographic characteristics of ACS columns. The prepared ACS columns demonstrated a mix-mode retention mechanism composed of surface adsorption, partitioning and electrostatic interactions. The elemental analysis of different batches of the ACS phases demonstrated good reproducibility of the preparation strategy. Additionally, various categories of compounds, including nucleosides, water-soluble vitamins, benzoic acid derivatives and basic compounds were successively employed to evaluate the separation selectivity of the prepared ACS stationary phases. These ACS phases exhibited entirely different selectivity and retention behavior from each other for various polar analytes, demonstrating the excellent application potential in the analysis of polar compounds in HILIC. PMID:25966373

  7. Evidence for a Negative Cooperativity between eIF5A and eEF2 on Binding to the Ribosome

    PubMed Central

    Galvão, Fabio C.; Boldrin, Paulo E. G.; Hershey, John W. B.; Zanelli, Cleslei F.; Fraser, Christopher S.; Valentini, Sandro R.

    2016-01-01

    eIF5A is the only protein known to contain the essential and unique amino acid residue hypusine. eIF5A functions in both translation initiation due to its stimulation of methionyl-puromycin synthesis and translation elongation, being highly required for peptide-bound formation of specific ribosome stalling sequences such as poly-proline. The functional interaction between eIF5A, tRNA, and eEF2 on the surface of the ribosome is further clarified herein. Fluorescence anisotropy assays were performed to determine the affinity of eIF5A to different ribosomal complexes and reveal its interaction exclusively and directly with the 60S ribosomal subunit in a hypusine-dependent manner (Ki60S-eIF5A-Hyp = 16 nM, Ki60S-eIF5A-Lys = 385 nM). A 3-fold increase in eIF5A affinity to the 80S is observed upon charged-tRNAiMet binding, indicating positive cooperativity between P-site tRNA binding and eIF5A binding to the ribosome. Previously identified conditional mutants of yeast eIF5A, eIF5AQ22H/L93F and eIF5AK56A, display a significant decrease in ribosome binding affinity. Binding affinity between ribosome and eIF5A-wild type or mutants eIF5AK56A, but not eIF5AQ22H/L93F, is impaired in the presence of eEF2 by 4-fold, consistent with negative cooperativity between eEF2 and eIF5A binding to the ribosome. Interestingly, high-copy eEF2 is toxic only to eIF5AQ22H/L93F and causes translation elongation defects in this mutant. These results suggest that binding of eEF2 to the ribosome alters its conformation, resulting in a weakened affinity of eIF5A and impairment of this interplay compromises cell growth due to translation elongation defects. PMID:27115996

  8. Evidence for a Negative Cooperativity between eIF5A and eEF2 on Binding to the Ribosome.

    PubMed

    Rossi, Danuza; Barbosa, Natalia M; Galvão, Fabio C; Boldrin, Paulo E G; Hershey, John W B; Zanelli, Cleslei F; Fraser, Christopher S; Valentini, Sandro R

    2016-01-01

    eIF5A is the only protein known to contain the essential and unique amino acid residue hypusine. eIF5A functions in both translation initiation due to its stimulation of methionyl-puromycin synthesis and translation elongation, being highly required for peptide-bound formation of specific ribosome stalling sequences such as poly-proline. The functional interaction between eIF5A, tRNA, and eEF2 on the surface of the ribosome is further clarified herein. Fluorescence anisotropy assays were performed to determine the affinity of eIF5A to different ribosomal complexes and reveal its interaction exclusively and directly with the 60S ribosomal subunit in a hypusine-dependent manner (Ki60S-eIF5A-Hyp = 16 nM, Ki60S-eIF5A-Lys = 385 nM). A 3-fold increase in eIF5A affinity to the 80S is observed upon charged-tRNAiMet binding, indicating positive cooperativity between P-site tRNA binding and eIF5A binding to the ribosome. Previously identified conditional mutants of yeast eIF5A, eIF5AQ22H/L93F and eIF5AK56A, display a significant decrease in ribosome binding affinity. Binding affinity between ribosome and eIF5A-wild type or mutants eIF5AK56A, but not eIF5AQ22H/L93F, is impaired in the presence of eEF2 by 4-fold, consistent with negative cooperativity between eEF2 and eIF5A binding to the ribosome. Interestingly, high-copy eEF2 is toxic only to eIF5AQ22H/L93F and causes translation elongation defects in this mutant. These results suggest that binding of eEF2 to the ribosome alters its conformation, resulting in a weakened affinity of eIF5A and impairment of this interplay compromises cell growth due to translation elongation defects. PMID:27115996

  9. Binding of scandium ions to metalloporphyrin-flavin complexes for long-lived charge separation.

    PubMed

    Kojima, Takahiko; Kobayashi, Ryosuke; Ishizuka, Tomoya; Yamakawa, Shinya; Kotani, Hiroaki; Nakanishi, Tatsuaki; Ohkubo, Kei; Shiota, Yoshihito; Yoshizawa, Kazunari; Fukuzumi, Shunichi

    2014-11-17

    A porphyrin-flavin-linked dyad and its zinc and palladium complexes (MPor-Fl: 2-M, M=2 H, Zn, and Pd) were newly synthesized and the X-ray crystal structure of 2-Pd was determined. The photodynamics of 2-M were examined by femto- and nanosecond laser flash photolysis measurements. Photoinduced electron transfer (ET) in 2-H2 occurred from the singlet excited state of the porphyrin moiety (H2 Por) to the flavin (Fl) moiety to produce the singlet charge-separated (CS) state (1) (H2 Por(.+) -Fl(.-) ), which decayed through back ET (BET) to form (3) [H2 Por]*-Fl with rate constants of 1.2×10(10) and 1.2×10(9)  s(-1) , respectively. Similarly, photoinduced ET in 2-Pd afforded the singlet CS state, which decayed through BET to form (3) [PdPor]*Fl with rate constants of 2.1×10(11) and 6.0×10(10)  s(-1) , respectively. The rate constant of photoinduced ET and BET of 2-M were related to the ET and BET driving forces by using the Marcus theory of ET. One and two Sc(3+) ions bind to the flavin moiety to form the Fl-Sc(3+) and Fl-(Sc(3+) )2 complexes with binding constants of K1 =2.2×10(5)  M(-1) and K2 =1.8×10(3)  M(-1) , respectively. Other metal ions, such as Y(3+) , Zn(2+) , and Mg(2+) , form only 1:1 complexes with flavin. In contrast to 2-M and the 1:1 complexes with metal ions, which afforded the short-lived singlet CS state, photoinduced ET in 2-Pd⋅⋅⋅Sc(3+) complexes afforded the triplet CS state ((3) [PdPor(.+) -Fl(.-) (Sc(3+) )2 ]), which exhibited a remarkably long lifetime of τ=110 ms (kBET =9.1 s(-1) ).

  10. Mapping the Binding of GluN2B-Selective N-Methyl-d-aspartate Receptor Negative Allosteric Modulators

    PubMed Central

    Yuan, Hongjie; Karakas, Erkan; Geballe, Matthew; Furukawa, Hiro; Liotta, Dennis C.; Snyder, James P.; Traynelis, Stephen F.

    2012-01-01

    We have used recent structural advances in our understanding of the N-methyl-d-aspartate (NMDA) receptor amino terminal domain to explore the binding mode of multiple diaryl GluN2B-selective negative allosteric modulators at the interface between the GluN1 and GluN2B amino-terminal domains. We found that interaction of the A ring within the binding pocket seems largely invariant for a variety of structurally distinct ligands. In addition, a range of structurally diverse linkers between the two aryl rings can be accommodated by the binding site, providing a potential opportunity to tune interactions with the ligand binding pocket via changes in hydrogen bond donors, acceptors, as well as stereochemistry. The most diversity in atomic interactions between protein and ligand occur in the B ring, with functional groups that contain electron donors and acceptors providing additional atomic contacts within the pocket. A cluster of residues distant to the binding site also control ligand potency, the degree of inhibition, and show ligand-induced increases in motion during molecular dynamics simulations. Mutations at some of these residues seem to distinguish between structurally distinct ligands and raise the possibility that GluN2B-selective ligands can be divided into multiple classes. These results should help facilitate the development of well tolerated GluN2B subunit-selective antagonists. PMID:22596351

  11. Binding of cellular repressor protein or the IE2 protein to a cis-acting negative regulatory element upstream of a human cytomegalovirus early promoter.

    PubMed Central

    Huang, L; Stinski, M F

    1995-01-01

    We have previously shown that the human cytomegalovirus early UL4 promoter has upstream negative and positive cis-acting regulatory elements. In the absence of the upstream negative regulatory region, the positive element confers strong transcriptional activity. The positive element contains a CCAAT box dyad symmetry and binds the cellular transcription factor NF-Y. The effect of the negative regulatory element is negated by the viral IE2 protein (L. Huang, C.L. Malone, and M.F. Stinski, J. Virol. 68:2108, 1994). We investigated the binding of cellular or viral IE2 protein to the negative regulatory region. The major cis-acting negative regulatory element was located between -168 and -134 bp relative to the transcription start site. This element could be transferred to a heterologous promoter, and it functioned in either orientation. Mutational analysis demonstrated that a core DNA sequence in the cis-acting negative regulatory element, 5'-GTTTGGAATCGTT-3', was required for the binding of either a cellular repressor protein(s) or the viral IE2 protein. The cellular DNA binding activity was present in both nonpermissive HeLa and permissive human fibroblast cells but more abundant in HeLa cells. Binding of the cellular repressor protein to the upstream cis-acting negative regulatory element correlates with repression of transcription from the early UL4 promoter. Binding of the viral IE2 protein correlates with negation of the repressive effect. PMID:7494269

  12. Calix[4]arene-linked bisporphyrin hosts for fullerenes: binding strength, solvation effects, and porphyrin-fullerene charge transfer bands.

    PubMed

    Hosseini, Ali; Taylor, Steven; Accorsi, Gianluca; Armaroli, Nicola; Reed, Christopher A; Boyd, Peter D W

    2006-12-13

    A calix[4]arene scaffolding has been used to construct bisporphyrin ("jaws" porphyrin) hosts for supramolecular binding of fullerene guests. Fullerene affinities were optimized by varying the nature of the covalent linkage of the porphyrins to the calixarenes. Binding constants for C60 and C70 in toluene were explored as a function of substituents at the periphery of the porphyrin, and 3,5-di-tert-butylphenyl groups gave rise to the highest fullerene affinities (26,000 M(-1) for C60). The origin of this high fullerene affinity has been traced to differential solvation effects rather than to electronic effects. Studies of binding constants as a function of solvent (toluene < benzonitrile < dichloromethane < cyclohexane) correlate inversely with fullerene solubility, indicating that desolvation of the fullerene is a major factor determining the magnitude of binding constants. The energetics of fullerene binding have been determined in terms of DelatH and DeltaS and are consistent with an enthalpy-driven, solvation-dependent process. A direct relationship between supramolecular binding of a fullerene guest to a bisporphyrin host and the appearance of a broad NIR absorption band have been established. The energy of this band moves in a predictable manner as a function of the electronic structure of the porphyrin, thereby establishing its origin in porphyrin-to-fullerene charge transfer.

  13. Ligand Binding Site of Tear Lipocalin: Contribution of a Trigonal Cluster of Charged Residues Probed by 8-Anilino-1-naphthalenesulfonic Acid†

    PubMed Central

    Gasymov, Oktay K.; Abduragimov, Adil R.; Glasgow, Ben J.

    2010-01-01

    Human tear lipocalin (TL) exhibits diverse functions, most of which are linked to ligand binding. To map the binding site of TL for some amphiphilic ligands, we capitalized on the hydrophobic and hydrophilic properties of 8-anilino-1-naphthalenesulfonic acid (ANS). In single Trp mutants, resonance energy transfer from Trp to ANS indicates that the naphthalene group of ANS is proximate to Leu105 in the cavity. Binding energies of TL to ANS and its analogues reveal contributions from electrostatic interactions. The sulfonate group of ANS interacts strongly with the nonconserved intracavitary residue Lys114 and less with neighboring residues His84 and Glu34. This trigonal cluster of residues may play a role in the ligand recognition site for some negatively charged ligands. Because many drugs possess sulfonate groups, the trigonal cluster–sulfonate interaction can also be exploited as a lipocalin-based drug delivery mechanism. The binding of lauric acid and its analogues shows that fatty acids assume heterogeneous orientations in the cavity of TL. Predominantly, the hydrocarbon tail is buried in the cavity of TL and the carboxyl group is oriented toward the mouth. However, TL can also interact, albeit relatively weakly, with fatty acids oriented in the opposite direction. As the major lipid binding protein of tears, the ability to accommodate fatty acids in two opposing orientations may have functional implications for TL. At the aqueous–lipid interface, fatty acids whose carboxyl groups are positioned toward the aqueous phase are available for interaction with TL that could augment stability of the tear film. PMID:18179255

  14. Negative Ion MALDI Mass Spectrometry of Polyoxometalates (POMs): Mechanism of Singly Charged Anion Formation and Chemical Properties Evaluation

    NASA Astrophysics Data System (ADS)

    Boulicault, Jean E.; Alves, Sandra; Cole, Richard B.

    2016-08-01

    MALDI-MS has been developed for the negative ion mode analysis of polyoxometalates (POMs). Matrix optimization was performed using a variety of matrix compounds. A first group of matrixes offers MALDI mass spectra containing abundant intact singly charged anionic adduct ions, as well as abundant in-source fragmentations at elevated laser powers. A relative ranking of the ability to induce POM fragmentation is found to be: DAN > CHCA > CNA > DIT> HABA > DCTB > IAA. Matrixes of a second group provide poorer quality MALDI mass spectra without observable fragments. Sample preparation, including the testing of salt additives, was performed to optimize signals for a model POM, POMc12, the core structure of which bears four negative charges. The matrix 9-cyanoanthracene (CNA) provided the best signals corresponding to singly charged intact POMc12 anions. Decompositions of these intact anionic species were examined in detail, and it was concluded that hydrogen radical-induced mechanisms were not prevalent, but rather that the observed prompt fragments originate from transferred energy derived from initial electronic excitation of the CNA matrix. Moreover, in obtained MALDI mass spectra, clear evidence of electron transfer to analyte POM species was found: a manifestation of the POMs ability to readily capture electrons. The affinity of polyanionic POMc12 toward a variety of cations was evaluated and the following affinity ranking was established: Fe3+ > Al3+ > Li+ > Ga3+ > Co2+ > Cr3+ > Cu2+ > [Mn2+, Mg2+] > [Na+, K+]. Thus, from the available cationic species, specific adducts are preferentially formed, and evidence is given that these higher affinity POM complexes are formed in the gas phase during the early stages of plume expansion.

  15. Negative Ion MALDI Mass Spectrometry of Polyoxometalates (POMs): Mechanism of Singly Charged Anion Formation and Chemical Properties Evaluation.

    PubMed

    Boulicault, Jean E; Alves, Sandra; Cole, Richard B

    2016-08-01

    MALDI-MS has been developed for the negative ion mode analysis of polyoxometalates (POMs). Matrix optimization was performed using a variety of matrix compounds. A first group of matrixes offers MALDI mass spectra containing abundant intact singly charged anionic adduct ions, as well as abundant in-source fragmentations at elevated laser powers. A relative ranking of the ability to induce POM fragmentation is found to be: DAN > CHCA > CNA > DIT> HABA > DCTB > IAA. Matrixes of a second group provide poorer quality MALDI mass spectra without observable fragments. Sample preparation, including the testing of salt additives, was performed to optimize signals for a model POM, POMc12, the core structure of which bears four negative charges. The matrix 9-cyanoanthracene (CNA) provided the best signals corresponding to singly charged intact POMc12 anions. Decompositions of these intact anionic species were examined in detail, and it was concluded that hydrogen radical-induced mechanisms were not prevalent, but rather that the observed prompt fragments originate from transferred energy derived from initial electronic excitation of the CNA matrix. Moreover, in obtained MALDI mass spectra, clear evidence of electron transfer to analyte POM species was found: a manifestation of the POMs ability to readily capture electrons. The affinity of polyanionic POMc12 toward a variety of cations was evaluated and the following affinity ranking was established: Fe(3+) > Al(3+) > Li(+) > Ga(3+) > Co(2+) > Cr(3+) > Cu(2+) > [Mn(2+), Mg(2+)] > [Na(+), K(+)]. Thus, from the available cationic species, specific adducts are preferentially formed, and evidence is given that these higher affinity POM complexes are formed in the gas phase during the early stages of plume expansion. Graphical Abstract ᅟ. PMID:27142457

  16. Charge recombination mechanism to explain the negative capacitance in dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Lie-Feng, Feng; Kun, Zhao; Hai-Tao, Dai; Shu-Guo, Wang; Xiao-Wei, Sun

    2016-03-01

    Negative capacitance (NC) in dye-sensitized solar cells (DSCs) has been confirmed experimentally. In this work, the recombination behavior of carriers in DSC with semiconductor interface as a carrier’s transport layer is explored theoretically in detail. Analytical results indicate that the recombination behavior of carriers could contribute to the NC of DSCs under small signal perturbation. Using this recombination capacitance we propose a novel equivalent circuit to completely explain the negative terminal capacitance. Further analysis based on the recombination complex impedance show that the NC is inversely proportional to frequency. In addition, analytical recombination resistance is composed by the alternating current (AC) recombination resistance (Rrac) and the direct current (DC) recombination resistance (Rrdc), which are caused by small-signal perturbation and the DC bias voltage, respectively. Both of two parts will decrease with increasing bias voltage. Project supported by the National Natural Science Foundation of China (Grant Nos. 11204209 and 60876035) and the Natural Science Foundation of Tianjin City, China (Grant No. 13JCZDJC32800).

  17. Binding to extracellular matrix proteins and formation of biogenic amines by food-associated coagulase-negative staphylococci.

    PubMed

    Seitter, Marion; Geng, Bettina; Hertel, Christian

    2011-02-28

    In connection with a study on the DNA microarray based detection of genes involved in safety and technologically relevant properties (Seitter (née Resch) et al., 2011), food-associated coagulase-negative staphylococci (CNS) were investigated phenotypically with regard to their ability to bind to the extracellular matrix proteins (ECM) and to produce biogenic amines. The properties have been shown to be involved in the colonization of injured tissue and invasion into host cells as well as in pharmacologic effects on humans, respectively. The CNS exhibited a low, but nevertheless clearly measurable ECM binding capacity, except for strains of Staphylococcus equorum and Staphylococcus succinus, which show a comparable or even higher binding to fibrinogen and fibronectin than that of the control strain Staphylococcus aureus Cowan. Formation of biogenic amines could be often detected in S. carnosus, S. condimenti and S. strains, but rarely in S. equorum and not in S. succinus and S. xylosus strains. Mostly, 2-phenylethylamine, tyramine and tryptamine were formed by resting cells in amounts < 25 mg/l, whereas growing cells formed high amounts (> 100 mg/l) of 2-phenylethylamine and putrescine. This study confirmed the need of consideration of ECM binding and biogenic amine formation in the safety assessment of CNS used in the production of fermented foods.

  18. Phosphatidylserine flipping enhances membrane curvature and negative charge required for vesicular transport

    PubMed Central

    Xu, Peng; Baldridge, Ryan D.; Chi, Richard J.; Burd, Christopher G.

    2013-01-01

    Vesicle-mediated protein transport between organelles of the secretory and endocytic pathways is strongly influenced by the composition and organization of membrane lipids. In budding yeast, protein transport between the trans-Golgi network (TGN) and early endosome (EE) requires Drs2, a phospholipid translocase in the type IV P-type ATPase family. However, downstream effectors of Drs2 and specific phospholipid substrate requirements for protein transport in this pathway are unknown. Here, we show that the Arf GTPase-activating protein (ArfGAP) Gcs1 is a Drs2 effector that requires a variant of the ArfGAP lipid packing sensor (+ALPS) motif for localization to TGN/EE membranes. Drs2 increases membrane curvature and anionic phospholipid composition of the cytosolic leaflet, both of which are sensed by the +ALPS motif. Using mutant forms of Drs2 and the related protein Dnf1, which alter their ability to recognize phosphatidylserine, we show that translocation of this substrate to the cytosolic leaflet is essential for +ALPS binding and vesicular transport between the EE and the TGN. PMID:24019533

  19. Negatively charged metal oxide nanoparticles interact with the 20S proteasome and differentially modulate its biologic functional effects.

    PubMed

    Falaschetti, Christine A; Paunesku, Tatjana; Kurepa, Jasmina; Nanavati, Dhaval; Chou, Stanley S; De, Mrinmoy; Song, MinHa; Jang, Jung-tak; Wu, Aiguo; Dravid, Vinayak P; Cheon, Jinwoo; Smalle, Jan; Woloschak, Gayle E

    2013-09-24

    The multicatalytic ubiquitin-proteasome system (UPS) carries out proteolysis in a highly orchestrated way and regulates a large number of cellular processes. Deregulation of the UPS in many disorders has been documented. In some cases, such as carcinogenesis, elevated proteasome activity has been implicated in disease development, while the etiology of other diseases, such as neurodegeneration, includes decreased UPS activity. Therefore, agents that alter proteasome activity could suppress as well as enhance a multitude of diseases. Metal oxide nanoparticles, often developed as diagnostic tools, have not previously been tested as modulators of proteasome activity. Here, several types of metal oxide nanoparticles were found to adsorb to the proteasome and show variable preferential binding for particular proteasome subunits with several peptide binding "hotspots" possible. These interactions depend on the size, charge, and concentration of the nanoparticles and affect proteasome activity in a time-dependent manner. Should metal oxide nanoparticles increase proteasome activity in cells, as they do in vitro, unintended effects related to changes in proteasome function can be expected.

  20. Negatively Charged Metal Oxide Nanoparticles Interact with the 20S Proteasome and Differentially Modulate Its Biologic Functional Effects

    PubMed Central

    Falaschetti, Christine A.; Paunesku, Tatjana; Kurepa, Jasmina; Nanavati, Dhaval; Chou, Stanley S.; De, Mrinmoy; Song, MinHa; Jang, Jung-tak; Wu, Aiguo; Dravid, Vinayak P.; Cheon, Jinwoo; Smalle, Jan; Woloschak, Gayle E.

    2013-01-01

    The multicatalytic ubiquitin-proteasome system (UPS) carries out proteolysis in a highly orchestrated way and regulates a large number of cellular processes. Deregulation of the UPS in many disorders has been documented. In some cases, e.g. carcinogenesis, elevated proteasome activity has been implicated in disease development, while the etiology of other diseases, e.g. neurodegeneration, includes decreased UPS activity. Therefore, agents that alter proteasome activity could suppress as well as enhance a multitude of diseases. Metal oxide nanoparticles, often developed as diagnostic tools, have not previously been tested as modulators of proteasome activity. Here, several types of metal oxide nanoparticles were found to adsorb to the proteasome and show variable preferential binding for particular proteasome subunits with several peptide binding “hotspots” possible. These interactions depend on the size, charge, and concentration of the nanoparticles and affect proteasome activity in a time-dependent manner. Should metal oxide nanoparticles increase proteasome activity in cells, as they do in vitro, unintended effects related to changes in proteasome function can be expected. PMID:23930940

  1. One-step solvothermal synthesis of highly water-soluble, negatively charged superparamagnetic Fe3O4 colloidal nanocrystal clusters

    NASA Astrophysics Data System (ADS)

    Gao, Jining; Ran, Xinze; Shi, Chunmeng; Cheng, Humin; Cheng, Tianmin; Su, Yongping

    2013-07-01

    Highly charged hydrophilic superparamagnetic Fe3O4 colloidal nanocrystal clusters with an average diameter of 195 nm have been successfully synthesized using a modified one-step solvothermal method. Anionic polyelectrolyte poly(4-styrenesulfonic acid-co-maleic acid) sodium salt containing both sulfonate and carboxylate groups was used as the stabilizer. The clusters synthesized under different experimental conditions were characterized with transmission electron microscopy and dynamic light scattering; it was found that the size distribution and water dispersity were significantly affected by the concentration of the polyelectrolyte stabilizer and iron sources in the reaction mixtures. A possible mechanism involving novel gel-like large molecular networks that confined the nucleation and aggregation process was proposed and discussed. The colloidal nanocrystal clusters remained negatively charged in the experimental pH ranges from 2 to 11, and also showed high colloidal stability in phosphate buffered saline (PBS) and ethanol. These highly colloidal stable superparamagnetic Fe3O4 clusters could find potential applications in bioseparation, targeted drug delivery, and photonics.Highly charged hydrophilic superparamagnetic Fe3O4 colloidal nanocrystal clusters with an average diameter of 195 nm have been successfully synthesized using a modified one-step solvothermal method. Anionic polyelectrolyte poly(4-styrenesulfonic acid-co-maleic acid) sodium salt containing both sulfonate and carboxylate groups was used as the stabilizer. The clusters synthesized under different experimental conditions were characterized with transmission electron microscopy and dynamic light scattering; it was found that the size distribution and water dispersity were significantly affected by the concentration of the polyelectrolyte stabilizer and iron sources in the reaction mixtures. A possible mechanism involving novel gel-like large molecular networks that confined the nucleation and

  2. Relationship between the stereoselective negative inotropic effects of verapamil enantiomers and their binding to putative calcium channels in human heart.

    PubMed Central

    Ferry, D. R.; Glossmann, H.; Kaumann, A. J.

    1985-01-01

    Ventricular preparations from patients with mitral disease and hypertrophic obstructive cardiomyopathy (HOCM) were set up to contract isometrically. Ventricular membrane particles were also prepared and putative calcium channels were labelled with [3H]-nimodipine. Positive staircase was induced by varying the rate of stimulation of isolated strips from 6 min-1 to 120 min-1 in the presence of 6-60 microM (-)-adrenaline or (-)-noradrenaline. (-)-Verapamil 3-5 microM or (+)-verapamil 20-30 microM reversed the force-frequency relationship (i.e. caused negative staircase) in preparations from patients with mitral disease or HOCM. In subendocardial strips of ventricular septum from 5 patients with HOCM paced at 60 min-1, both (-)-verapamil and (+)-verapamil caused cardiodepression. Half-maximal cardiodepression was observed with 0.4 microM (-)-verapamil and with 3 microM (+)-verapamil. [3H]-nimodipine bound to ventricular membrane particles in a saturable, reversible fashion to a high affinity site with an equilibrium dissociation constant of 0.23 nM. The density of these sites was 95 fmol mg-1 of membrane protein. Binding of the tritiated 1,4-dihydropyridine was stereoselectively inhibited by 1,4-dihydropyridine enantiomers and nifedipine. (-)-Verapamil and (+)-verapamil inhibited high affinity [3H]-nimodipine binding in a negative heterotropic allosteric manner with (-)-verapamil being 5 times more potent than (+)-verapamil on an IC50 basis. At a given [3H]-nimodipine concentration, (+)-verapamil inhibited a greater fraction of specific [3H]-nimodipine binding. The allosteric mode of (+)-verapamil inhibition of [3H]-nimodipine binding was confirmed by kinetic studies. (-)-Verapamil shifted (+)-verapamil-binding inhibition curves to the right in an apparently competitive fashion. The inversion of staircase caused by both verapamil enantiomers suggests that they cause a use-dependent channel blockade. The similar potency ratios for binding and for cardiodepression are

  3. Interplay of electrostatics and lipid packing determines the binding of charged polymer coated nanoparticles to model membranes.

    PubMed

    Biswas, Nupur; Bhattacharya, Rupak; Saha, Arindam; Jana, Nikhil R; Basu, Jaydeep K

    2015-10-01

    Understanding of nanoparticle-membrane interactions is useful for various applications of nanoparticles like drug delivery and imaging. Here we report on the studies of interaction between hydrophilic charged polymer coated semiconductor quantum dot nanoparticles with model lipid membranes. Atomic force microscopy and X-ray reflectivity measurements suggest that cationic nanoparticles bind and penetrate bilayers of zwitterionic lipids. Penetration and binding depend on the extent of lipid packing and result in the disruption of the lipid bilayer accompanied by enhanced lipid diffusion. On the other hand, anionic nanoparticles show minimal membrane binding although, curiously, their interaction leads to reduction in lipid diffusivity. It is suggested that the enhanced binding of cationic QDs at higher lipid packing can be understood in terms of the effective surface potential of the bilayers which is tunable through membrane lipid packing. Our results bring forth the subtle interplay of membrane lipid packing and electrostatics which determine nanoparticle binding and penetration of model membranes with further implications for real cell membranes.

  4. A human cytomegalovirus early promoter with upstream negative and positive cis-acting elements: IE2 negates the effect of the negative element, and NF-Y binds to the positive element.

    PubMed Central

    Huang, L; Malone, C L; Stinski, M F

    1994-01-01

    The human cytomegalovirus early promoter for the UL4 gene, which codes for an early viral envelope glycoprotein designated gpUL4, requires immediate-early viral protein two (IE2) synthesis to be activated (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281, 1989). We investigated the cis-acting and trans-acting factors that regulate transcription from this UL4 promoter. In transient transfection assays, the viral IE2 protein negated the effect of an upstream cis-acting negative element and enhanced downstream gene expression. A cis-acting positive element contributed to the activity of the viral promoter when an upstream cis-acting negative element was deleted or when the viral IE2 protein was present. The cellular protein(s) that binds to the cis-acting negative element requires further investigation. The cellular protein that binds to the cis-acting positive element was characterized. Two DNA sequence-specific protein complexes were detected with DNA probes spanning the region containing the cis-acting positive element and human cytomegalovirus-infected human fibroblast cell nuclear extracts. The more slowly migrating complex was labeled complex A, and the faster was labeled complex B. Only complex B was detected with mock-infected cell nuclear extracts. Competition experiments confirmed the specificity of the A and B complexes. The protein bound to the DNA in both the complexes contacts a CCAAT box imperfect dyad symmetry (5'CCAATCACTGG3'). Either CCAAT box within the dyad symmetry could compete for binding the nuclear factor. Mutation of the CCAAT box dyad symmetry resulted in a decrease of the transcriptional activity from the UL4 promoter. A cellular transcription factor, antigenically related to nuclear factor-Y (NF-Y), was found in both complexes A and B. Events associated with viral infection caused phosphorylation of protein complex A. Dephosphorylation of the DNA-binding protein converts complex A to complex B. The effect of phosphorylation

  5. Negatively-charged residues in the polar carboxy-terminal region in FSP27 are indispensable for expanding lipid droplets.

    PubMed

    Tamori, Yoshikazu; Tateya, Sanshiro; Ijuin, Takeshi; Nishimoto, Yuki; Nakajima, Shinsuke; Ogawa, Wataru

    2016-03-01

    FSP27 has an important role in large lipid droplet (LD) formation because it exchanges lipids at the contact site between LDs. In the present study, we clarify that the amino-terminal domain of FSP27 (amino acids 1-130) is dispensable for LD enlargement, although it accelerates LD growth. LD expansion depends on the carboxy-terminal domain of FSP27 (amino acids 131-239). Especially, the negative charge of the acidic residues (D215, E218, E219 and E220) in the polar carboxy-terminal region (amino acids 202-239) is essential for the enlargement of LD. We propose that the carboxy-terminal domain of FSP27 has a crucial role in LD expansion, whereas the amino-terminal domain only has a supportive role. PMID:26921608

  6. Simultaneous iron gettering and passivation of p-type monocrystalline silicon using a negatively charged aluminum-doped dielectric

    NASA Astrophysics Data System (ADS)

    Das, Arnab; Rohatgi, Ajeet

    2012-12-01

    Rapid gettering of iron from p-type c-Si has been achieved using a negatively charged spin-on Al-doped glass. After a 10 min oxidation to cure the Al-doped glass, >99% of Fe can be gettered from silicon wafers. This is comparable to, and under some processing conditions better than, the efficiency of conventional POCl3 gettering. In the same short oxidation step, the Al-doped glass also passivates p-Si surfaces with surface recombination velocities of 100 cm/s and 10 600 cm/s achieved for surface doping of 6 × 1015 cm-3 and 4 × 1019 cm-3, respectively. These passivation results are comparable to those achieved with thermal SiO2 layers.

  7. Cell Type-Specific Activation of AKT and ERK Signaling Pathways by Small Negatively-Charged Magnetic Nanoparticles

    NASA Astrophysics Data System (ADS)

    Rauch, Jens; Kolch, Walter; Mahmoudi, Morteza

    2012-11-01

    The interaction of nanoparticles (NPs) with living organisms has become a focus of public and scientific debate due to their potential wide applications in biomedicine, but also because of unwanted side effects. Here, we show that superparamagnetic iron oxide NPs (SPIONs) with different surface coatings can differentially affect signal transduction pathways. Using isogenic pairs of breast and colon derived cell lines we found that the stimulation of ERK and AKT signaling pathways by SPIONs is selectively dependent on the cell type and SPION type. In general, cells with Ras mutations respond better than their non-mutant counterparts. Small negatively charged SPIONs (snSPIONs) activated ERK to a similar extent as epidermal growth factor (EGF), and used the same upstream signaling components including activation of the EGF receptor. Importantly, snSPIONs stimulated the proliferation of Ras transformed breast epithelial cells as efficiently as EGF suggesting that NPs can mimic physiological growth factors.

  8. Targeted delivery of chemically modified anti-miR-221 to hepatocellular carcinoma with negatively charged liposomes

    PubMed Central

    Zhang, Wendian; Peng, Fangqi; Zhou, Taotao; Huang, Yifei; Zhang, Li; Ye, Peng; Lu, Miao; Yang, Guang; Gai, Yongkang; Yang, Tan; Ma, Xiang; Xiang, Guangya

    2015-01-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death. Gene therapy was established as a new strategy for treating HCC. To explore the potential delivery system to support the gene therapy of HCC, negatively charged liposomal delivery system was used to deliver miR-221 antisense oligonucleotide (anti-miR-221) to the transferrin (Tf) receptor over expressed HepG2 cells. The liposome exhibited a mean particle size of 122.5 nm, zeta potential of −15.74 mV, anti-miR-221 encapsulation efficiency of 70%, and excellent colloidal stability at 4°C. Anti-miR-221-encapsulated Tf-targeted liposome demonstrated a 15-fold higher delivery efficiency compared to nontargeted liposome in HepG2 cells in vitro. Anti-miR-221 Tf-targeted liposome effectively delivered anti-miR-221 to HepG2 cells, upregulated miR-221 target genes PTEN, P27kip1, and TIMP3, and exhibited greater silencing efficiency over nontargeted anti-miR-221 liposome. After intravenous injection into HepG2 tumor-bearing xenografted mice with Cy3-labeled anti-miR-221 Tf-targeted liposome, Cy3-anti-miR-221 was successfully delivered to the tumor site and increased the expressions of PTEN, P27kip1, and TIMP3. Our results demonstrate that the Tf-targeted negatively charged liposome could be a potential therapeutic modality in the gene therapy of human HCC. PMID:26251599

  9. Integrating high electrical conductivity and photocatalytic activity in cotton fabric by cationizing for enriched coating of negatively charged graphene oxide.

    PubMed

    Sahito, Iftikhar Ali; Sun, Kyung Chul; Arbab, Alvira Ayoub; Qadir, Muhammad Bilal; Jeong, Sung Hoon

    2015-10-01

    Electroconductive textiles have attended tremendous focus recently and researchers are making efforts to increase conductivity of e-textiles, in order to increase the use of such flexible and low cost textile materials. In this study, surface conductivity and photo catalytic activity of standard cotton fabric (SCF) was enhanced by modifying its surface charge, from negative to positive, using Bovine Serum Albumin (BSA) as a cationic agent, to convert it into cationised cotton fabric (CCF). Then, both types of fabrics were dip coated with a simple dip and dry technique for the adsorption of negatively charged graphene oxide (GO) sheets onto its surface. This resulted in 67.74% higher loading amount of GO on the CCF making self-assembly. Finally, this coating was chemically converted by vapor reduction using hydrazine hydrate to reduced graphene oxide (rGO) for restoration of a high electrical conductivity at the fabric surface. Our results revealed that with such high loading of GO, the surface resistance of CCF was only 40Ω/sq as compared to 510Ω/sq of the SCF and a 66% higher photo catalytic activity was also achieved through cationization for improved GO coating. Graphene coated SCF and CCF were characterized using FE-SEM, FTIR, Raman, UV-vis, WAXD, EDX and XPS spectroscopy to ascertain successful reduction of GO to rGO. The effect of BSA treatment on adsorption of cotton fabric was studied using drop shape analyzer to measure contact angle and for thermal and mechanical resistance, the fabric was tested for TGA and tensile strength, respectively. rGO coated fabric also showed slightly improved thermal stability yet a minor loss of strength was observed. The high flexibility, photocatalytic activity and excellent conductivity of this fabric suggests that it can be used as an electrode material for various applications. PMID:26076630

  10. Exposure to negatively charged-particle dominant air-conditions on human lymphocytes in vitro activates immunological responses.

    PubMed

    Nishimura, Yasumitsu; Takahashi, Kazuaki; Mase, Akinori; Kotani, Muneo; Ami, Kazuhisa; Maeda, Megumi; Shirahama, Takashi; Lee, Suni; Matsuzaki, Hidenori; Kumagai-Takei, Naoko; Yoshitome, Kei; Otsuki, Takemi

    2015-12-01

    Indoor air-conditions may play an important role in human health. Investigation of house conditions that promote health revealed that negatively charged-particle dominant indoor air-conditions (NAC) induced immune stimulation. NAC was established using fine charcoal powder on walls and ceilings and utilizing forced negatively charged particles (approximate diameter: 20 nm) dominant in indoor air-conditions created by applying an electric voltage (72 V) between the backside of the walls and the ground. We reported previously that these conditions induced a slight and significant increase of interleukin-2 during 2.5 h stay, and an increase of natural killer (NK) cell cytotoxicity, when examining human subjects after a two-week night stay under these conditions. In the present study, we investigated whether exposure to NAC in vitro affects immune conditions. Although the concentrations of particles were different, an incubator for cell culture with NAC was set and cellular compositions and functions of various freshly isolated human lymphocytes derived from healthy donors were assayed in the NAC incubator and compared with those of cultures in a standard (STD) incubator. Results showed that NAC cultivation caused an increase of CD25 and PD-1 expressing cells in the CD4 positive fraction, enhancement of NK cell cytotoxicity, production of interferon-y (IFNγ), and slight enhancement of regulatory T cell function. In addition, the formula designated as the "immune-index" clearly differed between STD and NAC culture conditions. Thus, NAC conditions may promote human health through slight activation of the immune system against cancer cells and virus infection as shown by this in vitro study and our previously reported human studies.

  11. Integrating high electrical conductivity and photocatalytic activity in cotton fabric by cationizing for enriched coating of negatively charged graphene oxide.

    PubMed

    Sahito, Iftikhar Ali; Sun, Kyung Chul; Arbab, Alvira Ayoub; Qadir, Muhammad Bilal; Jeong, Sung Hoon

    2015-10-01

    Electroconductive textiles have attended tremendous focus recently and researchers are making efforts to increase conductivity of e-textiles, in order to increase the use of such flexible and low cost textile materials. In this study, surface conductivity and photo catalytic activity of standard cotton fabric (SCF) was enhanced by modifying its surface charge, from negative to positive, using Bovine Serum Albumin (BSA) as a cationic agent, to convert it into cationised cotton fabric (CCF). Then, both types of fabrics were dip coated with a simple dip and dry technique for the adsorption of negatively charged graphene oxide (GO) sheets onto its surface. This resulted in 67.74% higher loading amount of GO on the CCF making self-assembly. Finally, this coating was chemically converted by vapor reduction using hydrazine hydrate to reduced graphene oxide (rGO) for restoration of a high electrical conductivity at the fabric surface. Our results revealed that with such high loading of GO, the surface resistance of CCF was only 40Ω/sq as compared to 510Ω/sq of the SCF and a 66% higher photo catalytic activity was also achieved through cationization for improved GO coating. Graphene coated SCF and CCF were characterized using FE-SEM, FTIR, Raman, UV-vis, WAXD, EDX and XPS spectroscopy to ascertain successful reduction of GO to rGO. The effect of BSA treatment on adsorption of cotton fabric was studied using drop shape analyzer to measure contact angle and for thermal and mechanical resistance, the fabric was tested for TGA and tensile strength, respectively. rGO coated fabric also showed slightly improved thermal stability yet a minor loss of strength was observed. The high flexibility, photocatalytic activity and excellent conductivity of this fabric suggests that it can be used as an electrode material for various applications.

  12. Characterization of oil-free and oil-loaded liquid-crystalline particles stabilized by negatively charged stabilizer citrem.

    PubMed

    Nilsson, Christa; Edwards, Katarina; Eriksson, Jonny; Larsen, Susan Weng; Østergaard, Jesper; Larsen, Claus; Urtti, Arto; Yaghmur, Anan

    2012-08-14

    The present study was designed to evaluate the effect of the negatively charged food-grade emulsifier citrem on the internal nanostructures of oil-free and oil-loaded aqueous dispersions of phytantriol (PHYT) and glyceryl monooleate (GMO). To our knowledge, this is the first report in the literature on the utilization of this charged stabilizing agent in the formation of aqueous dispersions consisting of well-ordered interiors (either inverted-type hexagonal (H(2)) phases or inverted-type microemulsion systems). Synchrotron small-angle X-ray scattering (SAXS) and cryogenic transmission electron microscopy (cryo-TEM) were used to characterize the dispersed and the corresponding nondispersed phases of inverted-type nonlamellar liquid-crystalline phases and microemulsions. The results suggest a transition between different internal nanostructures of the aqueous dispersions after the addition of the stabilizer. In addition to the main function of citrem as a stabilizer that adheres to the surface of the dispersed particles, it has a significant impact on the internal nanostructures, which is governed by the following factors: (1) its penetration between the hydrophobic tails of the lipid molecules and (2) its degree of incorporation into the lipid-water interfacial area. In the presence of citrem, the formation of aqueous dispersions with functionalized hydrophilic domains by the enlargement of the hydrophilic nanochannels of the internal H(2) phase in hexosomes and the hydrophilic core of the L(2) phase in emulsified microemulsions (EMEs) could be particularly attractive for solubilizing and controlling the release of positively charged drugs.

  13. Effects of superthermal electrons and negatively (positively) charged dust grains on dust-ion acoustic wave modulation

    NASA Astrophysics Data System (ADS)

    Ainejad, H.; Mahdavi, M.; Shahmansouri, M.

    2014-05-01

    The modulational instability of dust-ion acoustic (DIA) waves is studied in an unmagnetized dusty plasma comprising arbitrarily charged dust particles, adiabatic fluid ions, and electrons satisfying a kappa ( κ) distribution. By using the multiple space and time scales perturbation, a nonlinear Schrödinger (NLS) equation is derived, and then the existence along with the stability of wave packets are discussed in the parameter space of two oppositely charged dust and ion temperature over a range of values of electron superthermality. It is found that the transition from stable dark solitons to unstable bright ones shifts to the smaller wavelength regions in a way that depends on the increase of superthermality index κ. In this case, a narrower range (in spatial extension) of the envelope solitons is observed. It is also found that the instability growth rate reduces, due to the electron superthemality. Furthermore, positive dust concentration enhances the instability region, whereas more populations of negative dust grains may control or suppress one.

  14. One-step solvothermal synthesis of highly water-soluble, negatively charged superparamagnetic Fe3O4 colloidal nanocrystal clusters.

    PubMed

    Gao, Jining; Ran, Xinze; Shi, Chunmeng; Cheng, Humin; Cheng, Tianmin; Su, Yongping

    2013-08-01

    Highly charged hydrophilic superparamagnetic Fe3O4 colloidal nanocrystal clusters with an average diameter of 195 nm have been successfully synthesized using a modified one-step solvothermal method. Anionic polyelectrolyte poly(4-styrenesulfonic acid-co-maleic acid) sodium salt containing both sulfonate and carboxylate groups was used as the stabilizer. The clusters synthesized under different experimental conditions were characterized with transmission electron microscopy and dynamic light scattering; it was found that the size distribution and water dispersity were significantly affected by the concentration of the polyelectrolyte stabilizer and iron sources in the reaction mixtures. A possible mechanism involving novel gel-like large molecular networks that confined the nucleation and aggregation process was proposed and discussed. The colloidal nanocrystal clusters remained negatively charged in the experimental pH ranges from 2 to 11, and also showed high colloidal stability in phosphate buffered saline (PBS) and ethanol. These highly colloidal stable superparamagnetic Fe3O4 clusters could find potential applications in bioseparation, targeted drug delivery, and photonics. PMID:23803791

  15. Isomer-selected photoelectron spectroscopy of isolated DNA oligonucleotides: phosphate and nucleobase deprotonation at high negative charge states.

    PubMed

    Vonderach, Matthias; Ehrler, Oli T; Matheis, Katerina; Weis, Patrick; Kappes, Manfred M

    2012-05-01

    Fractionation according to ion mobility and mass-to-charge ratio has been used to select individual isomers of deprotonated DNA oligonucleotide multianions for subsequent isomer-resolved photoelectron spectroscopy (PES) in the gas phase. Isomer-resolved PE spectra have been recorded for tetranucleotides, pentanucleotides, and hexanucleotides. These were studied primarily in their highest accessible negative charge states (3-, 4-, and 5-, respectively), as provided by electrospraying from room temperature solutions. In particular, the PE spectra obtained for pentanucleotide tetraanions show evidence for two coexisting classes of gas-phase isomeric structures. We suggest that these two classes comprise: (i) species with excess electrons localized exclusively at deprotonated phosphate backbone sites and (ii) species with at least one deprotonated base (in addition to several deprotonated phosphates). By permuting the sequence of bases in various [A(5-x)T(x)](4-) and [GT(4)](4-) pentanucleotides, we have established that the second type of isomer is most likely to occur if the deprotonated base is located at the first or last position in the sequence. We have used a combination of molecular mechanics and semiempirical calculations together with a simple electrostatic model to explore the photodetachment mechanism underlying our photoelectron spectra. Comparison of predicted to measured photoelectron spectra suggests that a significant fraction of the detected electrons originates from the DNA bases (both deprotonated and neutral).

  16. Experimental and theoretical characterization of the 3,5-didehydrobenzoate anion: a negatively charged meta-benzyne.

    PubMed

    Price, Jason M; Nizzi, Katrina Emilia; Campbell, J Larry; Kenttämaa, Hilkka I; Seierstad, Mark; Cramer, Christopher J

    2003-01-01

    A negatively charged analogue of meta-benzyne, 3,5-didehydrobenzoate, was synthesized in a Fourier transform ion cyclotron resonance mass spectrometer, and its reactivity was compared to that of the same ion generated previously in a flowing afterglow apparatus and to its positively charged cousin, N-(3,5-didehydrophenyl)-3-fluoropyridinium. 3,5-Didehydrobenzoate was found to react as a nucleophile with electrophilic reagents. In contrast, N-(3,5-didehydrophenyl)-3-fluoropyridinium does not react with the same electrophilic reagents but reacts instead with nucleophilic reagents. Neither ion is able to abstract hydrogen atoms from typical hydrogen atom donors. The absence of any radical reactivity for these meta-benzynes is consistent with predictions that radical reactions of singlet biradicals should be hindered as compared to their monoradical counterparts. High-level calculations predict that the carboxylate moiety does not significantly perturb the singlet-triplet splitting of 3,5-didehydrobenzoate relative to the parent meta-benzyne.

  17. Negatively charged silver nanoparticles cause retinal vascular permeability by activating plasma contact system and disrupting adherens junction.

    PubMed

    Long, Yan-Min; Zhao, Xing-Chen; Clermont, Allen C; Zhou, Qun-Fang; Liu, Qian; Feener, Edward P; Yan, Bing; Jiang, Gui-Bin

    2016-01-01

    Silver nanoparticles (AgNPs) have been extensively used as antibacterial component in numerous healthcare, biomedical and consumer products. Therefore, their adverse effects to biological systems have become a major concern. AgNPs have been shown to be absorbed into circulation and redistributed into various organs. It is thus of great importance to understand how these nanoparticles affect vascular permeability and uncover the underlying molecular mechanisms. A negatively charged mecaptoundeonic acid-capped silver nanoparticle (MUA@AgNP) was investigated in this work. Ex vivo experiments in mouse plasma revealed that MUA@AgNPs caused plasma prekallikrein cleavage, while positively charged or neutral AgNPs, as well as Ag ions had no effect. In vitro tests revealed that MUA@AgNPs activated the plasma kallikrein-kinin system (KKS) by triggering Hageman factor autoactivation. By using specific inhibitors aprotinin and HOE 140, we demonstrated that KKS activation caused the release of bradykinin, which activated B2 receptors and induced the shedding of adherens junction protein, VE-cadherin. These biological perturbations eventually resulted in endothelial paracellular permeability in mouse retina after intravitreal injection of MUA@AgNPs. The findings from this work provided key insights for toxicity modulation and biomedical applications of AgNPs. PMID:26399585

  18. Channel-forming activity of syringopeptin 25A in mercury-supported phospholipid monolayers and negatively charged bilayers.

    PubMed

    Becucci, Lucia; Toppi, Arianna; Fiore, Alberto; Scaloni, Andrea; Guidelli, Rolando

    2016-10-01

    Interactions of the cationic lipodepsipeptide syringopeptin 25A (SP25A) with mercury-supported dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylserine (DOPS) and dioeleoylphosphatidic acid (DOPA) self-assembled monolayers (SAMs) were investigated by AC voltammetry in 0.1M KCl at pH3, 5.4 and 6.8. SP25A targets and penetrates the DOPS SAM much more effectively than the other SAMs not only at pH6.8, where the DOPS SAM is negatively charged, but also at pH3, where it is positively charged just as SP25A. Similar investigations at tethered bilayer lipid membranes (tBLMs) consisting of a thiolipid called DPTL anchored to mercury, with a DOPS, DOPA or DOPC distal monolayer on top of it, showed that, at physiological transmembrane potentials, SP25A forms ion channels spanning the tBLM only if DOPS is the distal monolayer. The distinguishing chemical feature of the DOPS SAM is the ionic interaction between the protonated amino group of a DOPS molecule and the carboxylate group of an adjacent phospholipid molecule. Under the reasonable assumption that SP25A preferentially interacts with this ion pair, the selective lipodepsipeptide antimicrobial activity against Gram-positive bacteria may be tentatively explained by its affinity for similar protonated amino-carboxylate pairs, which are expected to be present in the peptide moieties of peptidoglycan strands.

  19. Quantum effects in electron emission from and accretion on negatively charged spherical particles in a complex plasma

    SciTech Connect

    Mishra, S. K.; Sodha, M. S.; Misra, Shikha

    2012-07-15

    The authors have investigated the electron emissions (thermionic, electric field, photoelectric, and light induced field) from and electron accretion on a charged particle in a complex plasma, on the basis of a three region electrical potential model in and around a charged spherical particle in a complex plasma, characterized by Debye shielding. A continuous variation of the transmission coefficient across the surface of a particle (corresponding to emission and accretion) with the radial electron energy {epsilon}{sub r} has been obtained. It is seen that the numerical values of the emission and accretion transmission coefficients [D({epsilon}{sub r})] are almost the same. This is the necessary and sufficient condition for the validity of Saha's equation for thermal equilibrium of a system of dust and electrons. This is in contrast to the earlier condition, which limited the range of validity of Saha's equation to the range of the applicability of Born approximation. It is seen that D({epsilon}{sub r}) increases with increasing {epsilon}{sub r}, increasing negative electric potential on the surface, decreasing radius, and deceasing Debye length. The electron currents, corresponding to thermionic, electric field, photoelectric and light induced field emission increase with increasing surface potential; this fact may have significant repercussions in complex plasma kinetics. Since numerically D({epsilon}{sub r}) is significantly different from unity in the range of {epsilon}{sub r} of interest, it is necessary to take into account the D({epsilon}{sub r})-{epsilon}{sub r} dependence in complex plasma theory.

  20. Isomer-selected photoelectron spectroscopy of isolated DNA oligonucleotides: phosphate and nucleobase deprotonation at high negative charge states.

    PubMed

    Vonderach, Matthias; Ehrler, Oli T; Matheis, Katerina; Weis, Patrick; Kappes, Manfred M

    2012-05-01

    Fractionation according to ion mobility and mass-to-charge ratio has been used to select individual isomers of deprotonated DNA oligonucleotide multianions for subsequent isomer-resolved photoelectron spectroscopy (PES) in the gas phase. Isomer-resolved PE spectra have been recorded for tetranucleotides, pentanucleotides, and hexanucleotides. These were studied primarily in their highest accessible negative charge states (3-, 4-, and 5-, respectively), as provided by electrospraying from room temperature solutions. In particular, the PE spectra obtained for pentanucleotide tetraanions show evidence for two coexisting classes of gas-phase isomeric structures. We suggest that these two classes comprise: (i) species with excess electrons localized exclusively at deprotonated phosphate backbone sites and (ii) species with at least one deprotonated base (in addition to several deprotonated phosphates). By permuting the sequence of bases in various [A(5-x)T(x)](4-) and [GT(4)](4-) pentanucleotides, we have established that the second type of isomer is most likely to occur if the deprotonated base is located at the first or last position in the sequence. We have used a combination of molecular mechanics and semiempirical calculations together with a simple electrostatic model to explore the photodetachment mechanism underlying our photoelectron spectra. Comparison of predicted to measured photoelectron spectra suggests that a significant fraction of the detected electrons originates from the DNA bases (both deprotonated and neutral). PMID:22524691

  1. Positive/negative surface charge of chitosan based nanogels and its potential influence on oral insulin delivery.

    PubMed

    Wang, Juan; Xu, Mengxue; Cheng, Xiaojie; Kong, Ming; Liu, Ya; Feng, Chao; Chen, Xiguang

    2016-01-20

    To develop insulin delivery system for the treatment of diabetes, two insulin-loaded nanogels with opposite zeta potential (-15.94 ± 0.449 mV for insulin:CMCS/CS-NGs(-) and +17.15 ± 0.492 mV for insulin:CMCS/CS-NGs(+)) were obtained. Ex vivo results showed that the nanogels with opposite surface charge exhibited different adhesion and permeation in specific intestinal segments. There was no significant differences in adhesion and permeation in rat duodenum, but in rat jejunum, insulin:CMCS/CS-NGs(-) exhibited enhanced adhesion and permeation, which were about 3 folds (adhesion) and 1.7 folds (permeation) higher than insulin:CMCS/CS-NGs(+). These results demonstrated that the surface charge property of nanogels determined the absorption sites of CMCS/CS-NGs in small intestine. In vivo study, the blood glucose level in insulin:CMCS/CS-NGs(-) group had 3 mmol/L lower than insulin:CMCS/CS-NGs(+) group during 1h to 11h after the oral administration, which demonstrated that negative insulin:CMCS/CS-NGs had a better management of blood glucose than positive ones. PMID:26572423

  2. Channel-forming activity of syringopeptin 25A in mercury-supported phospholipid monolayers and negatively charged bilayers.

    PubMed

    Becucci, Lucia; Toppi, Arianna; Fiore, Alberto; Scaloni, Andrea; Guidelli, Rolando

    2016-10-01

    Interactions of the cationic lipodepsipeptide syringopeptin 25A (SP25A) with mercury-supported dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylserine (DOPS) and dioeleoylphosphatidic acid (DOPA) self-assembled monolayers (SAMs) were investigated by AC voltammetry in 0.1M KCl at pH3, 5.4 and 6.8. SP25A targets and penetrates the DOPS SAM much more effectively than the other SAMs not only at pH6.8, where the DOPS SAM is negatively charged, but also at pH3, where it is positively charged just as SP25A. Similar investigations at tethered bilayer lipid membranes (tBLMs) consisting of a thiolipid called DPTL anchored to mercury, with a DOPS, DOPA or DOPC distal monolayer on top of it, showed that, at physiological transmembrane potentials, SP25A forms ion channels spanning the tBLM only if DOPS is the distal monolayer. The distinguishing chemical feature of the DOPS SAM is the ionic interaction between the protonated amino group of a DOPS molecule and the carboxylate group of an adjacent phospholipid molecule. Under the reasonable assumption that SP25A preferentially interacts with this ion pair, the selective lipodepsipeptide antimicrobial activity against Gram-positive bacteria may be tentatively explained by its affinity for similar protonated amino-carboxylate pairs, which are expected to be present in the peptide moieties of peptidoglycan strands. PMID:27322780

  3. Nanowires formed by the co-assembly of a negatively charged low-molecular weight gelator and a zwitterionic polythiophene.

    PubMed

    Li, Feng; Palaniswamy, Ganesan; de Jong, Menno R; Aslund, Andreas; Konradsson, Peter; Marcelis, Antonius T M; Sudhölter, Ernst J R; Stuart, Martien A Cohen; Leermakers, Frans A M

    2010-06-21

    Conjugated organic nanowires have been prepared by co-assembling a carboxylate containing low-molecular weight gelator (LMWG) and an amino acid substituted polythiophene derivative (PTT). Upon introducing the zwitterionic polyelectrolyte PTT to a basic molecular solution of the organogelator, the negative charges on the LMWG are compensated by the positive charges of the PTT. As a result, nanowires form through co-assembly. These nanowires are visualized by both transmission electron microscopy (TEM) and atomic force microscopy (AFM). Depending on the concentration and ratio of the components these nanowires can be micrometers long. These measurements further suggest that the aggregates adopt a helical conformation. The morphology of these nanowires are studied with fluorescent confocal laser scanning microscopy (CLSM). The interactions between LMWG and PTT are characterized by steady-state and time-resolved fluorescence spectroscopy studies. The steady-state spectra indicate that the backbone of the PTT adopts a more planar and more aggregated conformation when interacting with LMWG. The time- resolved fluorescence decay studies confirm this interpretation.

  4. Negatively charged silver nanoparticles cause retinal vascular permeability by activating plasma contact system and disrupting adherens junction.

    PubMed

    Long, Yan-Min; Zhao, Xing-Chen; Clermont, Allen C; Zhou, Qun-Fang; Liu, Qian; Feener, Edward P; Yan, Bing; Jiang, Gui-Bin

    2016-01-01

    Silver nanoparticles (AgNPs) have been extensively used as antibacterial component in numerous healthcare, biomedical and consumer products. Therefore, their adverse effects to biological systems have become a major concern. AgNPs have been shown to be absorbed into circulation and redistributed into various organs. It is thus of great importance to understand how these nanoparticles affect vascular permeability and uncover the underlying molecular mechanisms. A negatively charged mecaptoundeonic acid-capped silver nanoparticle (MUA@AgNP) was investigated in this work. Ex vivo experiments in mouse plasma revealed that MUA@AgNPs caused plasma prekallikrein cleavage, while positively charged or neutral AgNPs, as well as Ag ions had no effect. In vitro tests revealed that MUA@AgNPs activated the plasma kallikrein-kinin system (KKS) by triggering Hageman factor autoactivation. By using specific inhibitors aprotinin and HOE 140, we demonstrated that KKS activation caused the release of bradykinin, which activated B2 receptors and induced the shedding of adherens junction protein, VE-cadherin. These biological perturbations eventually resulted in endothelial paracellular permeability in mouse retina after intravitreal injection of MUA@AgNPs. The findings from this work provided key insights for toxicity modulation and biomedical applications of AgNPs.

  5. Estimating collision cross sections of negatively charged N-glycans using traveling wave ion mobility-mass spectrometry.

    PubMed

    Hofmann, Johanna; Struwe, Weston B; Scarff, Charlotte A; Scrivens, James H; Harvey, David J; Pagel, Kevin

    2014-11-01

    Glycosylation is one of the most common post-translational modifications occurring in proteins. A detailed structural characterization of the involved carbohydrates, however, is still one of the greatest challenges in modern glycoproteomics, since multiple regio- and stereoisomers with an identical monosaccharide composition may exist. Recently, ion mobility-mass spectrometry (IM-MS), a technique in which ions are separated according to their mass, charge, and shape, has evolved as a promising technique for the separation and structural analysis of complex carbohydrates. This growing interest is based on the fact that the measured drift times can be converted into collision cross sections (CCSs), which can be compared, implemented into databases, and used as additional search criteria for structural identification. However, most of the currently used commercial IM-MS instruments utilize a nonuniform traveling wave field to propel the ions through the IM cell. As a result, CCS measurements cannot be performed directly and require calibration. Here, we present a calibration data set consisting of over 500 reference CCSs for negatively charged N-glycans and their fragments. Moreover, we show that dextran, already widely used as a calibrant in high performance liquid chromatography, is also a suitable calibrant for CCS estimations. Our data also indicate that a considerably increased error has to be taken into account when reference CCSs acquired in a different drift gas are used for calibration. PMID:25268221

  6. Lipopolysaccharide-binding protein of Bombyx mori participates in a hemocyte-mediated defense reaction against gram-negative bacteria.

    PubMed

    Koizumi, N; Imai, Y; Morozumi, A; Imamura, M; Kadotani, T; Yaoi, K; Iwahana, H; Sato, R

    1999-09-01

    BmLBP is a lipopolysaccharide-binding protein in B. mori and participates in bacterial clearance in vivo. Here, we investigated the function of BmLBP more specifically. More than 90% of injected gram-negative rough strains to which BmLBP binds were removed from the plasma within 30 min post-injection, whereas it required 8h for the clearance of smooth strains to which BmLBP does not bind. Observation of the hemocoel after the injection of Escherichia coli rough strain showed that melanized nodules were formed at 30 min post-injection when the clearance of injected E. coli cells had occurred. Fluorescence microscope observation revealed that E. coli cells were actually trapped in the nodules formed in vivo. Furthermore, plasma pre-treated E. coli rough cells (BmLBP bound) added to hemocytes isolated in vitro caused vigorous hemocyte aggregations with the bacteria, while plasma pre-treated smooth cells did not. The formation of aggregates was inhibited by anti-BmLBP serum pre-treatment, suggesting that BmLBP causes the clearance of bacteria by promoting hemocyte nodule formation. PMID:12770298

  7. N-terminal GNBP homology domain of Gram-negative binding protein 3 functions as a beta-1,3-glucan binding motif in Tenebrio molitor.

    PubMed

    Lee, Hanna; Kwon, Hyun-Mi; Park, Ji-Won; Kurokawa, Kenji; Lee, Bok Luel

    2009-08-31

    The Toll signalling pathway in invertebrates is responsible for defense against Gram-positive bacteria and fungi, leading to the expression of antimicrobial peptides via NF-kappaB-like transcription factors. Gram-negative binding protein 3 (GNBP3) detects beta-1,3-glucan, a fungal cell wall component, and activates a three step serine protease cascade for activation of the Toll signalling pathway. Here, we showed that the recombinant N-terminal domain of Tenebrio molitor GNBP3 bound to beta-1,3-glucan, but did not activate down-stream serine protease cascade in vitro. Reversely, the N-terminal domain blocked GNBP3-mediated serine protease cascade activation in vitro and also inhibited beta-1,3-glucan-mediated antimicrobial peptide induction in Tenebrio molitor larvae. These results suggest that the N-terminal GNBP homology domain of GNBP3 functions as a beta-1,3-glucan binding domain and the C-terminal domain of GNBP3 may be required for the recruitment of immediate down-stream serine protease zymogen during Toll signalling pathway activation. PMID:19712587

  8. Negative regulation of RNA-binding protein HuR by tumor-suppressor ECRG2.

    PubMed

    Lucchesi, C; Sheikh, M S; Huang, Y

    2016-05-19

    Esophageal cancer-related gene 2 (ECRG2) is a newer tumor suppressor whose function in the regulation of cell growth and apoptosis remains to be elucidated. Here we show that ECRG2 expression was upregulated in response to DNA damage, and increased ECRG2 expression induced growth suppression in cancer cells but not in non-cancerous epithelial cells. ECRG2-mediated growth suppression was associated with activation of caspases and marked reduction in the levels of apoptosis inhibitor, X chromosome-linked inhibitor of apoptosis protein (XIAP). ECRG2, via RNA-binding protein human antigen R (HuR), regulated XIAP mRNA stability and expression. Furthermore, ECRG2 increased HuR ubiquitination and degradation but was unable to modulate the non-ubiquitinable mutant form of HuR. We also identified missense and frame-shift ECRG2 mutations in various human malignancies and noted that, unlike wild-type ECRG2, one cancer-derived ECRG2 mutant harboring glutamic acid instead of valine at position 30 (V30E) failed to induce cell death and activation of caspases. This naturally occurring V30E mutant also did not suppress XIAP and HuR. Importantly, the V30E mutant overexpressing cancer cells acquired resistance against multiple anticancer drugs, thus suggesting that ECRG2 mutations appear to have an important role in the acquisition of anticancer drug resistance in a subset of human malignancies.

  9. The nucleotide-binding proteins Nubp1 and Nubp2 are negative regulators of ciliogenesis.

    PubMed

    Kypri, Elena; Christodoulou, Andri; Maimaris, Giannis; Lethan, Mette; Markaki, Maria; Lysandrou, Costas; Lederer, Carsten W; Tavernarakis, Nektarios; Geimer, Stefan; Pedersen, Lotte B; Santama, Niovi

    2014-02-01

    Nucleotide-binding proteins Nubp1 and Nubp2 are MRP/MinD-type P-loop NTPases with sequence similarity to bacterial division site-determining proteins and are conserved, essential proteins throughout the Eukaryotes. They have been implicated, together with their interacting minus-end directed motor protein KIFC5A, in the regulation of centriole duplication in mammalian cells. Here we show that Nubp1 and Nubp2 are integral components of centrioles throughout the cell cycle, recruited independently of KIFC5A. We further demonstrate their localization at the basal body of the primary cilium in quiescent vertebrate cells or invertebrate sensory cilia, as well as in the motile cilia of mouse cells and in the flagella of Chlamydomonas. RNAi-mediated silencing of nubp-1 in C. elegans causes the formation of morphologically aberrant and additional cilia in sensory neurons. Correspondingly, downregulation of Nubp1 or Nubp2 in mouse quiescent NIH 3T3 cells markedly increases the number of ciliated cells, while knockdown of KIFC5A dramatically reduces ciliogenesis. Simultaneous double silencing of Nubp1 + KIFC5A restores the percentage of ciliated cells to control levels. We document the normal ciliary recruitment, during these silencing regimes, of basal body proteins critical for ciliogenesis, namely CP110, CEP290, cenexin, Chibby, AurA, Rab8, and BBS7. Interestingly, we uncover novel interactions of Nubp1 with several members of the CCT/TRiC molecular chaperone complex, which we find enriched at the basal body and recruited independently of the Nubps or KIFC5A. Our combined results for Nubp1, Nubp2, and KIFC5A and their striking effects on cilium formation suggest a central regulatory role for these proteins, likely involving CCT/TRiC chaperone activity, in ciliogenesis.

  10. SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations

    PubMed Central

    Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

    2016-01-01

    Predicting the effect of amino acid substitutions on protein–protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/. PMID:27077847

  11. SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

    PubMed

    Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

    2016-04-12

    Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

  12. Increasing the Net Negative Charge by Replacement of DOTA Chelator with DOTAGA Improves the Biodistribution of Radiolabeled Second-Generation Synthetic Affibody Molecules.

    PubMed

    Westerlund, Kristina; Honarvar, Hadis; Norrström, Emily; Strand, Joanna; Mitran, Bogdan; Orlova, Anna; Eriksson Karlström, Amelie; Tolmachev, Vladimir

    2016-05-01

    A promising strategy to enable patient stratification for targeted therapies is to monitor the target expression in a tumor by radionuclide molecular imaging. Affibody molecules (7 kDa) are nonimmunoglobulin scaffold proteins with a 25-fold smaller size than intact antibodies. They have shown an apparent potential as molecular imaging probes both in preclinical and clinical studies. Earlier, we found that hepatic uptake can be reduced by the incorporation of negatively charged purification tags at the N-terminus of Affibody molecules. We hypothesized that liver uptake might similarly be reduced by positioning the chelator at the N-terminus, where the chelator-radionuclide complex will provide negative charges. To test this hypothesis, a second generation synthetic anti-HER2 ZHER2:2891 Affibody molecule was synthesized and labeled with (111)In and (68)Ga using DOTAGA and DOTA chelators. The chelators were manually coupled to the N-terminus of ZHER2:2891 forming an amide bond. Labeling DOTAGA-ZHER2:2891 and DOTA-ZHER2:2891 with (68)Ga and (111)In resulted in stable radioconjugates. The tumor-targeting and biodistribution properties of the (111)In- and (68)Ga-labeled conjugates were compared in SKOV-3 tumor-bearing nude mice at 2 h postinjection. The HER2-specific binding of the radioconjugates was verified both in vitro and in vivo. Using the DOTAGA chelator gave significantly lower radioactivity in liver and blood for both radionuclides. The (111)In-labeled conjugates showed more rapid blood clearance than the (68)Ga-labeled conjugates. The most pronounced influence of the chelators was found when they were labeled with (68)Ga. The DOTAGA chelator gave significantly higher tumor-to-blood (61 ± 6 vs 23 ± 5, p < 0.05) and tumor-to-liver (10.4 ± 0.6 vs 4.5 ± 0.5, p < 0.05) ratios than the DOTA chelator. This study demonstrated that chelators may be used to alter the uptake of Affibody molecules, and most likely other scaffold-based imaging probes, for improvement

  13. Memory for positive, negative and neutral events in younger and older adults: Does emotion influence binding in event memory?

    PubMed

    Earles, Julie L; Kersten, Alan W; Vernon, Laura L; Starkings, Rachel

    2016-01-01

    When remembering an event, it is important to remember both the features of the event (e.g., a person and an action) and the connections among features (e.g., who performed which action). Emotion often enhances memory for stimulus features, but the relationship between emotion and the binding of features in memory is unclear. Younger and older adults attempted to remember events in which a person performed a negative, positive or neutral action. Memory for the action was enhanced by emotion, but emotion did not enhance the ability of participants to remember which person performed which action. Older adults were more likely than younger adults to make binding errors in which they incorrectly remembered a familiar actor performing a familiar action that had actually been performed by someone else, and this age-related associative deficit was found for both neutral and emotional actions. Emotion not only increased correct recognition of old events for older and younger adults but also increased false recognition of events in which a familiar actor performed a familiar action that had been performed by someone else. Thus, although emotion may enhance memory for the features of an event, it does not increase the accuracy of remembering who performed which action.

  14. A novel genetic system to isolate a dominant negative effector on DNA-binding activity of Oct-2.

    PubMed Central

    Terunuma, A; Shiba, K; Noda, T

    1997-01-01

    Recent studies have revealed that interactions between transcription factors play an important role in regulation of gene expression in eukaryotic cells. To isolate cDNA clones that dominantly inhibit the DNA-binding activity of Oct-2, chosen as a representative factor, we have developed a novel screening system. This employs an Escherichia coli tester strain carrying a modified lac operon as a reporter gene, with the lac operator sequence replaced by an octamer sequence. Oct-2 expressed in this tester strain represses the expression of the reporter gene and changes the phenotype of the cell from Lac+to Lac-. Introduction of a cDNA expression library prepared from a human T-cell line into the Oct-2-harboring tester strain allowed selection of three Lac+clones out of 1 x 10(5) transformants. One of them, hT86, encoding a putative zinc finger protein was found to derepress beta-galactosidase activity in the Oct-2-harboring tester strain at the transcriptional level. In gel mobility shift assays, hT86 attenuated the intensity of the retarded band composed of the octamer probe and Oct-2, suggesting a dominant negative effect on the DNA-binding activity of Oct-2. The strategy described here provides a new approach for studying protein-protein interactions that govern the complex regulation of gene expression. PMID:9115366

  15. Assessing Carbon-Based Anodes for Lithium-Ion Batteries: A Universal Description of Charge-Transfer Binding

    DOE PAGESBeta

    Liu, Yuanyue; Wang, Y. Morris; Yakobson, Boris I.; Wood, Brandon C.

    2014-07-11

    Many key performance characteristics of carbon-based lithium-ion battery anodes are largely determined by the strength of binding between lithium (Li) and sp2 carbon (C), which can vary significantly with subtle changes in substrate structure, chemistry, and morphology. We use density functional theory calculations to investigate the interactions of Li with a wide variety of sp2 C substrates, including pristine, defective, and strained graphene, planar C clusters, nanotubes, C edges, and multilayer stacks. In almost all cases, we find a universal linear relation between the Li-C binding energy and the work required to fill previously unoccupied electronic states within the substrate.more » This suggests that Li capacity is predominantly determined by two key factors—namely, intrinsic quantum capacitance limitations and the absolute placement of the Fermi level. This simple descriptor allows for straightforward prediction of the Li-C binding energy and related battery characteristics in candidate C materials based solely on the substrate electronic structure. It further suggests specific guidelines for designing more effective C-based anodes. Furthermore, this method should be broadly applicable to charge-transfer adsorption on planar substrates, and provides a phenomenological connection to established principles in supercapacitor and catalyst design.« less

  16. Assessing Carbon-Based Anodes for Lithium-Ion Batteries: A Universal Description of Charge-Transfer Binding

    SciTech Connect

    Liu, Yuanyue; Wang, Y. Morris; Yakobson, Boris I.; Wood, Brandon C.

    2014-07-11

    Many key performance characteristics of carbon-based lithium-ion battery anodes are largely determined by the strength of binding between lithium (Li) and sp2 carbon (C), which can vary significantly with subtle changes in substrate structure, chemistry, and morphology. We use density functional theory calculations to investigate the interactions of Li with a wide variety of sp2 C substrates, including pristine, defective, and strained graphene, planar C clusters, nanotubes, C edges, and multilayer stacks. In almost all cases, we find a universal linear relation between the Li-C binding energy and the work required to fill previously unoccupied electronic states within the substrate. This suggests that Li capacity is predominantly determined by two key factors—namely, intrinsic quantum capacitance limitations and the absolute placement of the Fermi level. This simple descriptor allows for straightforward prediction of the Li-C binding energy and related battery characteristics in candidate C materials based solely on the substrate electronic structure. It further suggests specific guidelines for designing more effective C-based anodes. Furthermore, this method should be broadly applicable to charge-transfer adsorption on planar substrates, and provides a phenomenological connection to established principles in supercapacitor and catalyst design.

  17. Assessing carbon-based anodes for lithium-ion batteries: a universal description of charge-transfer binding.

    PubMed

    Liu, Yuanyue; Wang, Y Morris; Yakobson, Boris I; Wood, Brandon C

    2014-07-11

    Many key performance characteristics of carbon-based lithium-ion battery anodes are largely determined by the strength of binding between lithium (Li) and sp(2) carbon (C), which can vary significantly with subtle changes in substrate structure, chemistry, and morphology. Here, we use density functional theory calculations to investigate the interactions of Li with a wide variety of sp(2) C substrates, including pristine, defective, and strained graphene, planar C clusters, nanotubes, C edges, and multilayer stacks. In almost all cases, we find a universal linear relation between the Li-C binding energy and the work required to fill previously unoccupied electronic states within the substrate. This suggests that Li capacity is predominantly determined by two key factors-namely, intrinsic quantum capacitance limitations and the absolute placement of the Fermi level. This simple descriptor allows for straightforward prediction of the Li-C binding energy and related battery characteristics in candidate C materials based solely on the substrate electronic structure. It further suggests specific guidelines for designing more effective C-based anodes. The method should be broadly applicable to charge-transfer adsorption on planar substrates, and provides a phenomenological connection to established principles in supercapacitor and catalyst design. PMID:25062244

  18. Far upstream element binding protein 2 interacts with enterovirus 71 internal ribosomal entry site and negatively regulates viral translation

    PubMed Central

    Lin, Jing-Yi; Li, Mei-Ling; Shih, Shin-Ru

    2009-01-01

    An internal ribosomal entry site (IRES) that directs the initiation of viral protein translation is a potential drug target for enterovirus 71 (EV71). Regulation of internal initiation requires the interaction of IRES trans-acting factors (ITAFs) with the internal ribosomal entry site. Biotinylated RNA-affinity chromatography and proteomic approaches were employed to identify far upstream element (FUSE) binding protein 2 (FBP2) as an ITAF for EV71. The interactions of FBP2 with EV71 IRES were confirmed by competition assay and by mapping the association sites in both viral IRES and FBP2 protein. During EV71 infection, FBP2 was enriched in cytoplasm where viral replication occurs, whereas FBP2 was localized in the nucleus in mock-infected cells. The synthesis of viral proteins increased in FBP2-knockdown cells that were infected by EV71. IRES activity in FBP2-knockdown cells exceeded that in the negative control (NC) siRNA-treated cells. On the other hand, IRES activity decreased when FBP2 was over-expressed in the cells. Results of this study suggest that FBP2 is a novel ITAF that interacts with EV71 IRES and negatively regulates viral translation. PMID:19010963

  19. Manufacturing and characterization of bent silicon crystals for studies of coherent interactions with negatively charged particles beams

    NASA Astrophysics Data System (ADS)

    Germogli, G.; Mazzolari, A.; Bandiera, L.; Bagli, E.; Guidi, V.

    2015-07-01

    Efficient steering of GeV-energy negatively charged particle beams was demonstrated to be possible with a new generation of thin bent silicon crystals. Suitable crystals were produced at the Sensor Semiconductor Laboratory of Ferrara starting from Silicon On Insulator wafers, adopting proper revisitation of silicon micromachining techniques such as Low Pressure Chemical Vapor Deposition, photolithography and anisotropic chemical etching. Mechanical holders, which allow to properly bend the crystal and to reduce unwanted torsions, were employed. Crystallographic directions and crystal holder design were optimized in order to excite quasi-mosaic effect along (1 1 1) planes. Prior to exposing the crystal to particle beams, a full set of characterizations were performed. Infrared interferometry was used to measure crystal thickness with high accuracy. White-light interferometry was employed to characterize surface deformational state and its torsion. High-resolution X-rays diffraction was used to precisely measure crystal bending angle along the beam. Manufactured crystals were installed and tested at the MAMI MAinz MIcrotron to steer sub-GeV electrons, and at SLAC to deflect an electron beam in the 1 to 10 GeV energy range.

  20. [Air negative charge ion concentration and its relationships with meteorological factors in different ecological functional zones of Hefei City].

    PubMed

    Wei, Chaoling; Wang, Jingtao; Jiang, Yuelin; Zhang, Qingguo

    2006-11-01

    Air negative charge ion concentration (ANCIC) has a close relationship with air quality. The observations on the ANCIC, sunlight intensity, air temperature, and air relative humidity in different ecological functional zones of Hefei City from 2003 to 2004 showed that the diurnal change pattern of ANCIC was of single peak in sightseeing and habitation zones, dual peak in industrial zone, and complicated in commercial zone. Different ecological functional zones had different appearance time of their daily ANCIC extremum. The diurnal fluctuation of ANCIC was in the order of commercial zone > industrial zone > habitation zone and sightseeing zone. The annual change pattern of ANCIC in these zones was similar, being the highest in summer and lowest in winter, and the mean annual ANCIC was 819, 340, 149 and 126 ions x cm(-3), respectively. The most important meteorological factor affecting the ANCIC in Hefei City was air relative humidity, followed by sunlight intensity and air temperature. There was an exponential relationship between ANCIC and air relative humidity.

  1. Effect of negatively charged cellulose nanofibers on the dispersion of hydroxyapatite nanoparticles for scaffolds in bone tissue engineering.

    PubMed

    Park, Minsung; Lee, Dajung; Shin, Sungchul; Hyun, Jinho

    2015-06-01

    Nanofibrous 2,2,6,6-tetramethylpiperidine-1-oxyl(TEMPO)-oxidized bacterial cellulose (TOBC) was used as a dispersant of hydroxyapatite (HA) nanoparticles in aqueous solution. The surfaces of TOBC nanofibers were negatively charged after the reaction with the TEMPO/NaBr/NaClO system at pH 10 and room temperature. HA nanoparticles were simply adsorbed on the TOBC nanofibers (HA-TOBC) and dispersed well in DI water. The well-dispersed HA-TOBC colloidal solution formed a hydrogel after the addition of gelatin, followed by crosslinking with glutaraldehyde (HA-TOBC-Gel). The chemical modification of the fiber surfaces and the colloidal stability of the dispersion solution confirmed TOBC as a promising HA dispersant. Both the Young's modulus and maximum tensile stress increased as the amount of gelatin increased due to the increased crosslinking of gelatin. In addition, the well-dispersed HA produced a denser scaffold structure resulting in the increase of the Young's modulus and maximum tensile stress. The well-developed porous structures of the HA-TOBC-Gel composites were incubated with Calvarial osteoblasts. The HA-TOBC-Gel significantly improved cell proliferation as well as cell differentiation confirming the material as a potential candidate for use in bone tissue engineering scaffolds. PMID:25910635

  2. Effect of negatively charged cellulose nanofibers on the dispersion of hydroxyapatite nanoparticles for scaffolds in bone tissue engineering.

    PubMed

    Park, Minsung; Lee, Dajung; Shin, Sungchul; Hyun, Jinho

    2015-06-01

    Nanofibrous 2,2,6,6-tetramethylpiperidine-1-oxyl(TEMPO)-oxidized bacterial cellulose (TOBC) was used as a dispersant of hydroxyapatite (HA) nanoparticles in aqueous solution. The surfaces of TOBC nanofibers were negatively charged after the reaction with the TEMPO/NaBr/NaClO system at pH 10 and room temperature. HA nanoparticles were simply adsorbed on the TOBC nanofibers (HA-TOBC) and dispersed well in DI water. The well-dispersed HA-TOBC colloidal solution formed a hydrogel after the addition of gelatin, followed by crosslinking with glutaraldehyde (HA-TOBC-Gel). The chemical modification of the fiber surfaces and the colloidal stability of the dispersion solution confirmed TOBC as a promising HA dispersant. Both the Young's modulus and maximum tensile stress increased as the amount of gelatin increased due to the increased crosslinking of gelatin. In addition, the well-dispersed HA produced a denser scaffold structure resulting in the increase of the Young's modulus and maximum tensile stress. The well-developed porous structures of the HA-TOBC-Gel composites were incubated with Calvarial osteoblasts. The HA-TOBC-Gel significantly improved cell proliferation as well as cell differentiation confirming the material as a potential candidate for use in bone tissue engineering scaffolds.

  3. Negatively Charged Carbon Nanohorn Supported Cationic Liposome Nanoparticles: A Novel Delivery Vehicle for Anti-Nicotine Vaccine.

    PubMed

    Zheng, Hong; Hu, Yun; Huang, Wei; de Villiers, Sabina; Pentel, Paul; Zhang, Jianfei; Dorn, Harry; Ehrich, Marion; Zhang, Chenming

    2015-12-01

    Tobacco addiction is the second-leading cause of death in the world. Due to the nature of nicotine (a small molecule), finding ways to combat nicotine's deleterious effects has been a constant challenge to the society and the medical field. In the present work, a novel anti-nicotine vaccine based on nanohorn supported liposome nanoparticles (NsL NPs) was developed. The nano-vaccine was constructed by using negatively charged carbon nanohorns as a scaffold for the assembly of cationic liposomes, which allow the conjugation of hapten conjugated carrier proteins. The assembled bio-nanoparticles are stable. Mice were immunized subcutaneously with the nano-vaccine, which induced high titer and high affinity of nicotine specific antibodies in mice. Furthermore, no evidence of clinical signs or systemic toxicity followed multiple administrations of NsL-based anti-nicotine vaccine. These results suggest that NsL-based anti-nicotine vaccine is a promising candidate in treating nicotine dependence and could have potential to significantly contribute to smoking cessation.

  4. Exploration of Porphyrin-based Semiconductors for Negative Charge Transport Applications Using Synthetic, Spectroscopic, Potentiometric, Magnetic Resonance, and Computational Methods

    NASA Astrophysics Data System (ADS)

    Rawson, Jeffrey Scott

    Organic pi-conjugated materials are emerging as commercially relevant components in electronic applications that include transistors, light-emitting diodes, and solar cells. One requirement common to all of these functions is an aptitude for accepting and transmitting charges. It is generally agreed that the development of organic semiconductors that favor electrons as the majority carriers (n-type) lags behind the advances in hole transporting (p-type) materials. This shortcoming suggests that the design space for n-type materials is not yet well explored, presenting researchers with the opportunity to develop unconventional architectures. In this regard, it is worth noting that discrete molecular materials are demonstrating the potential to usurp the preeminent positions that pi-conjugated polymers have held in these areas of organic electronics research. This dissertation describes how an extraordinary class of molecules, meso-to-meso ethyne-bridged porphyrin arrays, has been bent to these new uses. Chapter one describes vis-NIR spectroscopic and magnetic resonance measurements revealing that these porphyrin arrays possess a remarkable aptitude for the delocalization of negative charge. In fact, the miniscule electron-lattice interactions exhibited in these rigid molecules allow them to host the most vast electron-polarons ever observed in a pi-conjugated material. Chapter two describes the development of an ethyne-bridged porphyrin-isoindigo hybrid chromophore that can take the place of fullerene derivatives in the conventional thin film solar cell architecture. Particularly noteworthy is the key role played by the 5,15-bis(heptafluoropropyl)porphyrin building block in the engineering of a chromophore that, gram for gram, is twice as absorptive as poly(3-hexyl)thiophene, exhibits a lower energy absorption onset than this polymer, and yet possesses a photoexcited singlet state sufficiently energetic to transfer a hole to this polymer. Chapter three describes

  5. Binding of Macrolide Antibiotics Leads to Ribosomal Selection against Specific Substrates Based on Their Charge and Size.

    PubMed

    Sothiselvam, Shanmugapriya; Neuner, Sandro; Rigger, Lukas; Klepacki, Dorota; Micura, Ronald; Vázquez-Laslop, Nora; Mankin, Alexander S

    2016-08-16

    Macrolide antibiotic binding to the ribosome inhibits catalysis of peptide bond formation between specific donor and acceptor substrates. Why particular reactions are problematic for the macrolide-bound ribosome remains unclear. Using comprehensive mutational analysis and biochemical experiments with synthetic substrate analogs, we find that the positive charge of these specific residues and the length of their side chains underlie inefficient peptide bond formation in the macrolide-bound ribosome. Even in the absence of antibiotic, peptide bond formation between these particular donors and acceptors is rather inefficient, suggesting that macrolides magnify a problem present for intrinsically difficult substrates. Our findings emphasize the existence of functional interactions between the nascent protein and the catalytic site of the ribosomal peptidyl transferase center. PMID:27498876

  6. Special AT-rich sequence-binding protein 2 acts as a negative regulator of stemness in colorectal cancer cells

    PubMed Central

    Li, Ying; Liu, Yu-Hong; Hu, Yu-Ying; Chen, Lin; Li, Jian-Ming

    2016-01-01

    AIM To find the mechanisms by which special AT-rich sequence-binding protein 2 (SATB2) influences colorectal cancer (CRC) metastasis. METHODS Cell growth assay, colony-forming assay, cell adhesion assay and cell migration assay were used to evaluate the biological characteristics of CRC cells with gain or loss of SATB2. Sphere formation assay was used to detect the self-renewal ability of CRC cells. The mRNA expression of stem cell markers in CRC cells with upregulated or downregulated SATB2 expression was detected by quantitative real-time polymerase chain reaction. Chromatin immunoprecipitation (ChIP) was used to verify the binding loci of SATB2 on genomic sequences of stem cell markers. The Cancer Genome Atlas (TCGA) database and our clinical samples were analyzed to find the correlation between SATB2 and some key stem cell markers. RESULTS Downregulation of SATB2 led to an aggressive phenotype in SW480 and DLD-1 cells, which was characterized by increased migration and invasion abilities. Overexpression of SATB2 suppressed the migration and invasion abilities in SW480 and SW620 cells. Using sequential sphere formation assay to detect the self-renewal abilities of CRC cells, we found more secondary sphere formation but not primary sphere formation in SW480 and DLD-1 cells after SATB2 expression was knocked down. Moreover, most markers for stem cells such as CD133, CD44, AXIN2, MEIS2 and NANOG were increased in cells with SATB2 knockdown and decreased in cells with SATB2 overexpression. ChIP assay showed that SATB2 bound to regulatory elements of CD133, CD44, MEIS2 and AXIN2 genes. Using TCGA database and our clinical samples, we found that SATB2 was correlated with some key stem cell markers including CD44 and CD24 in clinical tissues of CRC patients. CONCLUSION SATB2 can directly bind to the regulatory elements in the genetic loci of several stem cell markers and consequently inhibit the progression of CRC by negatively regulating stemness of CRC cells. PMID

  7. Lysozyme Net Charge and Ion Binding in Concentrated Aqueous Electrolyte Solutions

    SciTech Connect

    Kuehner, Daniel E.; Engmann, Jan; Fergg, Florian; Wernick, Meredith; Blanch, Harvey W.; Prausnitz, John M.

    1999-02-01

    Hydrogen-ion titrations were conducted for hen-egg-white lysozyme in solutions of potassium chloride, over the range of pH 2.5 - 11.5 and for ionic strengths to 2. 0 M. The dependence of lysozyme's net proton charge, zP' on pH and ionic-strength in potassium-chloride solution is measured. From the ionic-strength dependence of zP' interactions of lysozynie with potassium and chloride ions are calculated using the molecular-thennodynamic theory of Fraaije and Lyklema 1. Lysozyme interacts preferentially with up to 12 chloride ions at pH 2.5. The observed dependence of ion-protein interactions on pH and ionic strength is explained in terms of electricdouble-layer theory. New experimental pKa data are reported for eleven ammo acids in potassium-chloride solutions of ionic strength to 3.0 M.

  8. Lysozyme net charge and ion binding in concentrated aqueous electrolyte solutions

    SciTech Connect

    Kuehner, Daniel E.; Engmann, Jan; Fergg, Florian; Wernick, Meredith; Blanch, Harvey W.; Prausnitz, John M.

    1999-02-01

    Hydrogen-ion titrations were conducted for hen-egg-white lysozyme in solutions of potassium chloride over the range pH 2.5--11.5 and for ionic strengths to 2.0 M. The dependence of lysozyme`s net proton charge, z{sub p}, on pH and ionic strength in potassium chloride solution is measured. From the ionic-strength dependence of z{sub p}, interactions of lysozyme with potassium and chloride ions are calculated using the molecular-thermodynamic theory of Fraaije and Lyklema. Lysozyme interacts preferentially with up to 12 chloride ions at pH 2.5. The observed dependence of ion-protein interactions on pH and ionic strength is explained in terms of electric-double-layer theory. New experimental pK{sub a} data are reported for 11 amino acids in potassium chloride solutions of ionic strength to 3.0 M.

  9. A 90-day study of subchronic oral toxicity of 20 nm, negatively charged zinc oxide nanoparticles in Sprague Dawley rats

    PubMed Central

    Park, Hark-Soo; Shin, Sung-Sup; Meang, Eun Ho; Hong, Jeong-sup; Park, Jong-Il; Kim, Su-Hyon; Koh, Sang-Bum; Lee, Seung-Young; Jang, Dong-Hyouk; Lee, Jong-Yun; Sun, Yle-Shik; Kang, Jin Seok; Kim, Yu-Ri; Kim, Meyoung-Kon; Jeong, Jayoung; Lee, Jong-Kwon; Son, Woo-Chan; Park, Jae-Hak

    2014-01-01

    Purpose The widespread use of nanoparticles (NPs) in industrial and biomedical applications has prompted growing concern regarding their potential toxicity and impact on human health. This study therefore investigated the subchronic, systemic oral toxicity and no-observed-adverse-effect level (NOAEL) of 20 nm, negatively charged zinc oxide (ZnOSM20(−)) NPs in Sprague Dawley rats for 90 days. Methods The high-dose NP level was set at 500 mg/kg of bodyweight, and the mid- and low-dose levels were set at 250 and 125 mg/kg, respectively. The rats were observed during a 14-day recovery period after the last NP administration for the persistence or reduction of any adverse effects. Toxicokinetic and distribution studies were also conducted to determine the systemic distribution of the NPs. Results No rats died during the test period. However, ZnOSM20(−) NPs (500 mg/kg) induced changes in the levels of anemia-related factors, prompted acinar cell apoptosis and ductular hyperplasia, stimulated periductular lymphoid cell infiltration and excessive salivation, and increased the numbers of regenerative acinar cells in the pancreas. In addition, stomach lesions were seen at 125, 250, and 500 mg/kg, and retinal atrophy was observed at 250 and 500 mg/kg. The Zn concentration was dose-dependently increased in the liver, kidney, intestines, and plasma, but not in other organs investigated. Conclusion A ZnOSM20(−) NP NOAEL could not be established from the current results, but the lowest-observed-adverse-effect level was 125 mg/kg. Furthermore, the NPs were associated with a number of undesirable systemic actions. Thus, their use in humans must be approached with caution. PMID:25565828

  10. Molecular cloning of a small DNA binding protein with specificity for a tissue-specific negative element within the rps1 promoter.

    PubMed Central

    Zhou, D X; Bisanz-Seyer, C; Mache, R

    1995-01-01

    A cDNA encoding a specific binding activity for the tissue-specific negative cis-element S1F binding site of spinach rps1 was isolated from a spinach cDNA expression library. This cDNA of 0.7 kb encodes an unusual small peptide of only 70 amino acids, with a basic domain which contains a nuclear localization signal and a putative DNA binding helix. This protein, named S1Fa, is highly conserved between dicotyledonous and monocotyledonous plants and may represent a novel class of DNA binding proteins. The corresponding mRNA is accumulated more in roots and in etiolated seedlings than in green leaves. This expression pattern is correlated with the tissue-specific function of the S1F binding site which represses the rps1 promoter preferentially in roots and in etiolated plants. Images PMID:7739894

  11. Basal electric and magnetic fields of celestial bodies come from positive-negative charge separation caused by gravitation of quasi-Casimir pressure in weak interaction

    NASA Astrophysics Data System (ADS)

    Chen, Shao-Guang

    According to f =d(mv)/dt=m(dv/dt)+ v(dm/dt), a same gravitational formula had been de-duced from the variance in physical mass of QFT and from the variance in mass of inductive energy-transfer of GR respectively: f QF T = f GR = -G (mM/r2 )((r/r)+(v/c)) when their interaction-constants are all taken the experimental values (H05-0029-08, E15-0039-08). f QF T is the quasi-Casimir pressure. f GR is equivalent to Einstein's equation, then more easy to solve it. The hypothesis of the equivalent principle is not used in f QF T , but required by f GR . The predictions of f QF T and f GR are identical except that f QF T has quantum effects but f GR has not and f GR has Lense-Thirring effect but f QF T has not. The quantum effects of gravitation had been verified by Nesvizhevsky et al with the ultracold neutrons falling in the earth's gravitational field in 2002. Yet Lense-Thirring effect had not been measured by GP-B. It shows that f QF T is essential but f GR is phenomenological. The macro-f QF T is the statistic average pressure collided by net virtual neutrinos ν 0 flux (after self-offset in opposite directions) and in direct proportion to the mass. But micro-f QF T is in direct proportion to the scattering section. The electric mass (in inverse proportion to de Broglie wavelength λ) far less than nucleonic mass and the electric scattering section (in direct proportion to λ2 ) far large than that of nucleon, then the net ν 0 flux pressure exerted to electron far large than that to nucleon and the electric displacement far large than that of nucleon, it causes the gravitational polarization of positive-negative charge center separation. Because the gravity far less than the electromagnetic binding force, in atoms the gravitational polarization only produces a little separation. But the net ν 0 flux can press a part freedom electrons in plasma of ionosphere into the earth's surface, the static electric force of redundant positive ions prevents electrons from further

  12. Protein kinase D negatively regulates hepatitis C virus secretion through phosphorylation of oxysterol-binding protein and ceramide transfer protein.

    PubMed

    Amako, Yutaka; Syed, Gulam H; Siddiqui, Aleem

    2011-04-01

    Hepatitis C virus (HCV) RNA replicates its genome on specialized endoplasmic reticulum modified membranes termed membranous web and utilizes lipid droplets for initiating the viral nucleocapsid assembly. HCV maturation and/or the egress pathway requires host sphingolipid synthesis, which occur in the Golgi. Ceramide transfer protein (CERT) and oxysterol-binding protein (OSBP) play a crucial role in sphingolipid biosynthesis. Protein kinase D (PKD), a serine/threonine kinase, is recruited to the trans-Golgi network where it influences vesicular trafficking to the plasma membrane by regulation of several important mediators via phosphorylation. PKD attenuates the function of both CERT and OSBP by phosphorylation at their respective Ser(132) and Ser(240) residues (phosphorylation inhibition). Here, we investigated the functional role of PKD in HCV secretion. Our studies show that HCV gene expression down-regulated PKD activation. PKD depletion by shRNA or inhibition by pharmacological inhibitor Gö6976 enhanced HCV secretion. Overexpression of a constitutively active form of PKD suppressed HCV secretion. The suppression by PKD was subverted by the ectopic expression of nonphosphorylatable serine mutant CERT S132A or OSBP S240A. These observations imply that PKD negatively regulates HCV secretion/release by attenuating OSBP and CERT functions by phosphorylation inhibition. This study identifies the key role of the Golgi components in the HCV maturation process. PMID:21285358

  13. A zebrafish intelectin ortholog agglutinates both Gram-negative and Gram-positive bacteria with binding capacity to bacterial polysaccharide.

    PubMed

    Chen, Lei; Yan, Jie; Sun, Weiping; Zhang, Yan; Sui, Chao; Qi, Jing; Du, Yijun; Feng, Lijun

    2016-08-01

    Intelectins are glycan-binding lectins found in various species including cephalochordates, urochordates, fish, amphibians and mammals. But their detailed functions are not well studied in zebrafish which is a good model to study native immunity. In this study, we cloned a zebrafish intelectin ortholog, zebrafish intelectin 2 (zITLN2), which contains a conserved fibrinogen-related domain (FReD) in the N-terminus and the unique intelectin domain in the C-terminus. We examined the tissue distribution of zITLN2 in adult zebrafish and found that zITLN2 was expressed in various organs with the highest level in intestine. Like amphioxus intelectins, zITLN2 expression was upregulated in adult zebrafish infected with Staphylococcus aureus with the highest expression level at 12 h after challenge. Recombinant zITLN2 protein expressed in E. coli was able to agglutinate both Gram-negative and Gram-positive bacteria to similar degrees in a calcium-dependent manner. Furthermore, recombinant zITLN2 bound lipopolysaccharide (LPS) and peptidoglycan (PGN) comparably. Our work on zITLN2 provided further information to understand functions of this new family of lectins and the innate immunity in vertebrates. PMID:27329687

  14. Effects of charged amino-acid mutation on the solution structure of cytochrome b5 and binding between cytochrome b5 and cytochrome c

    PubMed Central

    Qian, Chengmin; Yao, Yong; Ye, Keqiong; Wang, Jinfeng; Tang, Wenxia; Wang, Yunhua; Wang, Wenhu; Lu, Junxia; Xie, Yi; Huang, Zhongxian

    2001-01-01

    The solution structure of oxidized bovine microsomal cytochrome b5 mutant (E48, E56/A, D60/A) has been determined through 1524 meaningful nuclear Overhauser effect constraints together with 190 pseudocontact shift constraints. The final family of 35 conformers has rmsd values with respect to the mean structure of 0.045±0.009 nm and 0.088±0.011 nm for backbone and heavy atoms, respectively. A characteristic of this mutant is that of having no significant changes in the whole folding and secondary structure compared with the X-ray and solution structures of wild-type cytochrome b5. The binding of different surface mutants of cytochrome b5 with cytochrome c shows that electrostatic interactions play an important role in maintaining the stability and specificity of the protein complex formed. The differences in association constants demonstrate the electrostatic contributions of cytochrome b5 surface negatively charged residues, which were suggested to be involved in complex formation in the Northrup and Salemme models, have cumulative effect on the stability of cyt c-cyt b5 complex, and the contribution of Glu48 is a little higher than that of Glu44. Moreover, our result suggests that the docking geometry proposed by Northrup, which is involved in the participation of Glu48, Glu56, Asp60, and heme propionate of cytochrome b5, do occur in the association between cytochrome b5 and cytochrome c. PMID:11714912

  15. Femtosecond Hydrogen Bond Dynamics of Bulk-like and Bound Water at Positively and Negatively Charged Lipid Interfaces Revealed by 2D HD-VSFG Spectroscopy.

    PubMed

    Singh, Prashant Chandra; Inoue, Ken-Ichi; Nihonyanagi, Satoshi; Yamaguchi, Shoichi; Tahara, Tahei

    2016-08-26

    Interfacial water in the vicinity of lipids plays an important role in many biological processes, such as drug delivery, ion transportation, and lipid fusion. Hence, molecular-level elucidation of the properties of water at lipid interfaces is of the utmost importance. We report the two-dimensional heterodyne-detected vibrational sum frequency generation (2D HD-VSFG) study of the OH stretch of HOD at charged lipid interfaces, which shows that the hydrogen bond dynamics of interfacial water differ drastically, depending on the lipids. The data indicate that the spectral diffusion of the OH stretch at a positively charged lipid interface is dominated by the ultrafast (<∼100 fs) component, followed by the minor sub-picosecond slow dynamics, while the dynamics at a negatively charged lipid interface exhibit sub-picosecond dynamics almost exclusively, implying that fast hydrogen bond fluctuation is prohibited. These results reveal that the ultrafast hydrogen bond dynamics at the positively charged lipid-water interface are attributable to the bulk-like property of interfacial water, whereas the slow dynamics at the negatively charged lipid interface are due to bound water, which is hydrogen-bonded to the hydrophilic head group. PMID:27482947

  16. Charge steering of laser plasma accelerated fast ions in a liquid spray — creation of MeV negative ion and neutral atom beams

    SciTech Connect

    Schnürer, M.; Abicht, F.; Priebe, G.; Braenzel, J.; Prasad, R.; Borghesi, M.; Andreev, A.; Nickles, P. V.; Jequier, S.; Tikhonchuk, V.; Ter-Avetisyan, S.

    2013-11-15

    The scenario of “electron capture and loss” has been recently proposed for the formation of negative ion and neutral atom beams with up to MeV kinetic energy [S. Ter-Avetisyan, et al., Appl. Phys. Lett. 99, 051501 (2011)]. Validation of these processes and of their generic nature is here provided in experiments where the ion source and the interaction medium have been spatially separated. Fast positive ions accelerated from a laser plasma source are sent through a cold spray where their charge is changed. Such formed neutral atom or negative ion has nearly the same momentum as the original positive ion. Experiments are released for protons, carbon, and oxygen ions and corresponding beams of negative ions and neutral atoms have been obtained. The electron capture and loss phenomenon is confirmed to be the origin of the negative ion and neutral atom beams. The equilibrium ratios of different charge components and cross sections have been measured. Our method is general and allows the creation of beams of neutral atoms and negative ions for different species which inherit the characteristics of the positive ion source.

  17. The highly charged region of plant beta-type phosphatidylinositol 4-kinase is involved in membrane targeting and phospholipid binding.

    PubMed

    Lou, Ying; Ma, Hui; Lin, Wen-Hui; Chu, Zhao-Qing; Mueller-Roeber, Bernd; Xu, Zhi-Hong; Xue, Hong-Wei

    2006-03-01

    In Arabidopsis thaliana and Oryza sativa, two types of PI 4-kinase (PI4Ks) have been isolated and functionally characterized. The alpha-type PI4Ks (approximately 220 kDa) contain a PH domain, which is lacking in beta-type PI4Ks (approximately 120 kDa). Beta-type PI4Ks, exemplified by Arabidopsis AtPI4Kbeta and rice OsPI4K2, contain a highly charged repetitive segment designated PPC (Plant PI4K Charged) region, which is an unique domain only found in plant beta-type PI4Ks at present. The PPC region has a length of approximately 300 amino acids and harboring 11 (AtPI4Kbeta) and 14 (OsPI4K2) repeats, respectively, of a 20-aa motif. Studies employing a modified yeast-based "Sequence of Membrane-Targeting Detection" system demonstrate that the PPC(OsPI4K2) region, as well as the former 8 and latter 6 repetitive motifs within the PPC region, are able to target fusion proteins to the plasma membrane. Further detection on the transiently expressed GFP fusion proteins in onion epidermal cells showed that the PPC(OsPI4K2) region alone, as well as the region containing repetitive motifs 1-8, was able to direct GFP to the plasma membrane, while the regions containing less repetitive motifs, i.e. 6, 4, 2 or single motif(s) led to predominantly intracellular localization. Agrobacterium-mediated transient expression of PPC-GFP fusion protein further confirms the membrane-targeting capacities of PPC region. In addition, the predominant plasma membrane localization of AtPI4Kbeta was mediated by the PPC region. Recombinant PPC peptide, expressed in E. coli, strongly binds phosphatidic acid, PI and PI4P, but not phosphatidylcholine, PI5P, or PI(4,5)P2 in vitro, providing insights into potential mechanisms for regulating sub-cellular localization and lipid binding for the plant beta-type PI4Ks. PMID:16649109

  18. Deviation of negatively charged protein fractions in the trochophore and veliger larvae by the larvicidal action of baygon in freshwater pulmonate Gyraulus convexiusculus (Planorbidae).

    PubMed

    Bhide, Mangla; Gupta, Priyamvada

    2006-10-01

    In the present investigation egg capsules of Gyraulus convexiusculus were treated with different concentrations of baygon. A dose and duration dependent deviations in the number of negatively charged protein fractions in the trochophore and veliger larval stages were observed. It resulted into anomalies in the morphogenesis and organogenesis of corresponding larval stages. Most of the protein bands showed the decrease in the protein positive intensities in comparison to control. This suggested that baygon causes larval toxicity in Gyraulus convexiusculus.

  19. Symmetry-related mutants in the quinone binding sites of the reaction center -- The effects of changes in charge distribution

    SciTech Connect

    Hanson, D.K.; Schiffer, M.

    1997-09-01

    To probe the structural elements that contribute to the functional asymmetries of the two ubiquinone{sub 10}binding pockets in the reaction center of Rhodobacter capsulatus, the authors targeted the L212Glu-L213Asp (near Q{sub B}) and the M246Ala-M247Ala (near Q{sub A}) pairs of symmetry-related residues for site-specific mutagenesis. They have constructed site-specific mutants that eliminate the sequence differences at these positions (L212Glu-L213Asp{yields}Ala-Ala or M246Ala-M247Ala{yields}Glu-Asp), and have reversed that asymmetry by constructing a quadruple-mutant strain, RQ (L212Glu-L213Asp-M246Ala-M247Ala{yields}Ala-Ala-Glu-Asp). The mutations were designed to change the charge distribution in the quinone-binding region of the reaction center; none of the strains is capable of photosynthetic growth. In photocomponent phenotypic revertants of the RQ strain, second-site mutations which affect Q{sub B} function are coupled to mutations in the Q{sub A} site which restore an Ala or substitute a Tyr at the M247 site; one strain carries an additional Met{yields}Glu substitution at M260 near Q{sub A}. All of the RQ revertants retain the engineered M246Ala{yields}Glu mutation in the Q{sub A} site as well as the L212Ala-L213Ala mutations in the Q{sub B} site. Kinetic characterization of the RQ revertants will give them an idea of what structural and functional elements are important for restoring efficiency to electron and proton transfer pathways in the RQRC, which is far from native. To date, these preliminary results underscore the importance of an asymmetric distribution of polar amino acids in the quinone binding pockets and its influence on the functional properties of the reaction center.

  20. Floating gate memory with charge storage dots array formed by Dps protein modified with site-specific binding peptides

    NASA Astrophysics Data System (ADS)

    Kamitake, Hiroki; Uenuma, Mutsunori; Okamoto, Naofumi; Horita, Masahiro; Ishikawa, Yasuaki; Yamashita, Ichro; Uraoka, Yukiharu

    2015-05-01

    We report a nanodot (ND) floating gate memory (NFGM) with a high-density ND array formed by a biological nano process. We utilized two kinds of cage-shaped proteins displaying SiO2 binding peptide (minTBP-1) on their outer surfaces: ferritin and Dps, which accommodate cobalt oxide NDs in their cavities. The diameters of the cobalt NDs were regulated by the cavity sizes of the proteins. Because minTBP-1 is strongly adsorbed on the SiO2 surface, high-density cobalt oxide ND arrays were obtained by a simple spin coating process. The densities of cobalt oxide ND arrays based on ferritin and Dps were 6.8 × 1011 dots cm-2 and 1.2 × 1012 dots cm-2, respectively. After selective protein elimination and embedding in a metal-oxide-semiconductor (MOS) capacitor, the charge capacities of both ND arrays were evaluated by measuring their C-V characteristics. The MOS capacitor embedded with the Dps ND array showed a wider memory window than the device embedded with the ferritin ND array. Finally, we fabricated an NFGM with a high-density ND array based on Dps, and confirmed its competent writing/erasing characteristics and long retention time.

  1. Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

    PubMed

    Sattonnay, G; Tétot, R

    2014-02-01

    Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.

  2. Floating gate memory with charge storage dots array formed by Dps protein modified with site-specific binding peptides.

    PubMed

    Kamitake, Hiroki; Uenuma, Mutsunori; Okamoto, Naofumi; Horita, Masahiro; Ishikawa, Yasuaki; Yamashita, Ichro; Uraoka, Yukiharu

    2015-05-15

    We report a nanodot (ND) floating gate memory (NFGM) with a high-density ND array formed by a biological nano process. We utilized two kinds of cage-shaped proteins displaying SiO2 binding peptide (minTBP-1) on their outer surfaces: ferritin and Dps, which accommodate cobalt oxide NDs in their cavities. The diameters of the cobalt NDs were regulated by the cavity sizes of the proteins. Because minTBP-1 is strongly adsorbed on the SiO2 surface, high-density cobalt oxide ND arrays were obtained by a simple spin coating process. The densities of cobalt oxide ND arrays based on ferritin and Dps were 6.8 × 10(11) dots cm(-2) and 1.2 × 10(12) dots cm(-2), respectively. After selective protein elimination and embedding in a metal-oxide-semiconductor (MOS) capacitor, the charge capacities of both ND arrays were evaluated by measuring their C-V characteristics. The MOS capacitor embedded with the Dps ND array showed a wider memory window than the device embedded with the ferritin ND array. Finally, we fabricated an NFGM with a high-density ND array based on Dps, and confirmed its competent writing/erasing characteristics and long retention time.

  3. Possibility of controlling the earth's negative charge and the unitary variation of its electric field by cosmic rays

    NASA Technical Reports Server (NTRS)

    Bragin, Y. A.; Vorontsov, S. S.; Kocheyev, A. A.

    1975-01-01

    The dependence of the atmospheric conductivity upon the cosmic ray intensity, the possibility of charge generation in thunderstorms by cosmic rays, the dependence of the troposphere electricity on the stratosphere, the relationship between the unitary variation of the earth's electric field intensity and that of cosmic ray intensity (daily, yearly and 11-year latitudinal dependence of both values), deny first, the exceptional role of the tropospheric processes in maintaining the terrestrial charge and unitary variation, and, second, compel one to consider the cause mentioned above to be the result of the influence of cosmic rays.

  4. Folding without charges

    PubMed Central

    Kurnik, Martin; Hedberg, Linda; Danielsson, Jens; Oliveberg, Mikael

    2012-01-01

    Surface charges of proteins have in several cases been found to function as “structural gatekeepers,” which avoid unwanted interactions by negative design, for example, in the control of protein aggregation and binding. The question is then if side-chain charges, due to their desolvation penalties, play a corresponding role in protein folding by avoiding competing, misfolded traps? To find out, we removed all 32 side-chain charges from the 101-residue protein S6 from Thermus thermophilus. The results show that the charge-depleted S6 variant not only retains its native structure and cooperative folding transition, but folds also faster than the wild-type protein. In addition, charge removal unleashes pronounced aggregation on longer timescales. S6 provides thus an example where the bias toward native contacts of a naturally evolved protein sequence is independent of charges, and point at a fundamental difference in the codes for folding and intermolecular interaction: specificity in folding is governed primarily by hydrophobic packing and hydrogen bonding, whereas solubility and binding relies critically on the interplay of side-chain charges. PMID:22454493

  5. Salt effects on hydrophobic interaction and charge screening in the folding of a negatively charged peptide to a coiled coil (leucine zipper).

    PubMed

    Jelesarov, I; Dürr, E; Thomas, R M; Bosshard, H R

    1998-05-19

    The stability of a coiled coil or leucine zipper is controlled by hydrophobic interactions and electrostatic forces between the constituent helices. We have designed a 30-residue peptide with the repeating seven-residue pattern of a coiled coil, (abcdefg)n, and with Glu in positions e and g of each heptad. The glutamate side chains prevented folding at pH values above 6 because of electrostatic repulsion across the helix dimer interface as well as within the individual helices. Protonation of the carboxylates changed the conformation from a random coil monomer to a coiled coil dimer. Folding at alkaline pH where the peptide had a net charge of -7e was promoted by the addition of salts. The nature of the charge screening cation was less important than that of the anion. The high salt concentrations (>1 M) necessary to induce folding indicated that the salt-induced folding resulted from alterations in the protein-water interaction. Folding was promoted by the kosmotropic anions sulfate and fluoride and to a lesser extent by the weak kosmotrope formate, whereas chloride and the strong chaotrope perchlorate were ineffective. Kosmotropes are excluded from the protein surface, which is preferentially hydrated, and this promotes folding by strengthening hydrophobic interactions at the coiled coil interface. Although charge neutralization also contributed to folding, it was effective only when the screening cation was partnered by a good kosmotropic anion. Folding conformed to a two-state transition from random coil monomer to coiled coil dimer and was enthalpy driven and characterized by a change in the heat capacity of unfolding of 3.9 +/- 1.2 kJ mol-1 K-1. The rate of folding was analyzed by fluorescence stopped-flow measurements. Folding occurred in a biphasic reaction in which the rapid formation of an initial dimer (kf = 2 x 10(7) M-1 s-1) was followed by an equally rapid concentration-independent rearrangement to the folded dimer (k > 100 s-1).

  6. Salt effects on hydrophobic interaction and charge screening in the folding of a negatively charged peptide to a coiled coil (leucine zipper).

    PubMed

    Jelesarov, I; Dürr, E; Thomas, R M; Bosshard, H R

    1998-05-19

    The stability of a coiled coil or leucine zipper is controlled by hydrophobic interactions and electrostatic forces between the constituent helices. We have designed a 30-residue peptide with the repeating seven-residue pattern of a coiled coil, (abcdefg)n, and with Glu in positions e and g of each heptad. The glutamate side chains prevented folding at pH values above 6 because of electrostatic repulsion across the helix dimer interface as well as within the individual helices. Protonation of the carboxylates changed the conformation from a random coil monomer to a coiled coil dimer. Folding at alkaline pH where the peptide had a net charge of -7e was promoted by the addition of salts. The nature of the charge screening cation was less important than that of the anion. The high salt concentrations (>1 M) necessary to induce folding indicated that the salt-induced folding resulted from alterations in the protein-water interaction. Folding was promoted by the kosmotropic anions sulfate and fluoride and to a lesser extent by the weak kosmotrope formate, whereas chloride and the strong chaotrope perchlorate were ineffective. Kosmotropes are excluded from the protein surface, which is preferentially hydrated, and this promotes folding by strengthening hydrophobic interactions at the coiled coil interface. Although charge neutralization also contributed to folding, it was effective only when the screening cation was partnered by a good kosmotropic anion. Folding conformed to a two-state transition from random coil monomer to coiled coil dimer and was enthalpy driven and characterized by a change in the heat capacity of unfolding of 3.9 +/- 1.2 kJ mol-1 K-1. The rate of folding was analyzed by fluorescence stopped-flow measurements. Folding occurred in a biphasic reaction in which the rapid formation of an initial dimer (kf = 2 x 10(7) M-1 s-1) was followed by an equally rapid concentration-independent rearrangement to the folded dimer (k > 100 s-1). PMID:9585569

  7. Positively and Negatively Charged Ionic Modifications to Cellulose Assessed as Cotton-Based Protease-Lowering and Haemostatic Wound Agents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent developments in cellulose wound dressings targeted to different stages of wound healing have been based on structural and charge modifications that function to modulate events in the complex inflammatory and hemostatic phases of wound healing. Hemostasis and inflammation comprise two overlapp...

  8. Tombusvirus P19 RNA silencing suppressor (RSS) activity in mammalian cells correlates with charged amino acids that contribute to direct RNA-binding

    PubMed Central

    2012-01-01

    Background Tombusvirus P19 is a protein encoded by tomato bushy stunt virus and related tombusviruses. Earlier studies have demonstrated that P19 is an RNA silencing suppressor (RSS) in plant cells. However, it has not been systematically investigated how P19 suppresses RNA interference in various mammalian cell settings. Results We have studied the RSS effect of P19 in mammalian cells, HEK293T, HeLa, and mouse embryonic fibroblasts. We have individually mutated 18 positively charged residues in P19 and found that 6 of these charged residues in P19 reduce its ability to suppress RNA interference. In each case, the reduction of silencing of RNA interference correlated with the reduced ability by these P19 mutants to bind siRNAs (small interfering RNAs). Conclusions Our findings characterize a class of RNA-binding proteins that function as RSS moieties. We find a tight correlation between positively charged residues in P19 accounting for siRNA-binding and their RSS activity. Because P19’s activity is conserved in plant and animal cells, we conclude that its RSS function unlikely requires cell type-specific co-factors and likely arises from direct RNA-binding. PMID:23216864

  9. Distributed feature binding in the auditory modality: experimental evidence toward reconciliation of opposing views on the basis of mismatch negativity and behavioral measures.

    PubMed

    Chernyshev, Boris V; Bryzgalov, Dmitri V; Lazarev, Ivan E; Chernysheva, Elena G

    2016-08-01

    Current understanding of feature binding remains controversial. Studies involving mismatch negativity (MMN) measurement show a low level of binding, whereas behavioral experiments suggest a higher level. We examined the possibility that the two levels of feature binding coexist and may be shown within one experiment. The electroencephalogram was recorded while participants were engaged in an auditory two-alternative choice task, which was a combination of the oddball and the condensation tasks. Two types of deviant target stimuli were used - complex stimuli, which required feature conjunction to be identified, and simple stimuli, which differed from standard stimuli in a single feature. Two behavioral outcomes - correct responses and errors - were analyzed separately. Responses to complex stimuli were slower and less accurate than responses to simple stimuli. MMN was prominent and its amplitude was similar for both simple and complex stimuli, whereas the respective stimuli differed from standards in a single feature or two features respectively. Errors in response only to complex stimuli were associated with decreased MMN amplitude. P300 amplitude was greater for complex stimuli than for simple stimuli. Our data are compatible with the explanation that feature binding in auditory modality depends on two concurrent levels of processing. We speculate that the earlier level related to MMN generation is an essential and critical stage. Yet, a later analysis is also carried out, affecting P300 amplitude and response time. The current findings provide resolution to conflicting views on the nature of feature binding and show that feature binding is a distributed multilevel process. PMID:27306594

  10. Distributed feature binding in the auditory modality: experimental evidence toward reconciliation of opposing views on the basis of mismatch negativity and behavioral measures.

    PubMed

    Chernyshev, Boris V; Bryzgalov, Dmitri V; Lazarev, Ivan E; Chernysheva, Elena G

    2016-08-01

    Current understanding of feature binding remains controversial. Studies involving mismatch negativity (MMN) measurement show a low level of binding, whereas behavioral experiments suggest a higher level. We examined the possibility that the two levels of feature binding coexist and may be shown within one experiment. The electroencephalogram was recorded while participants were engaged in an auditory two-alternative choice task, which was a combination of the oddball and the condensation tasks. Two types of deviant target stimuli were used - complex stimuli, which required feature conjunction to be identified, and simple stimuli, which differed from standard stimuli in a single feature. Two behavioral outcomes - correct responses and errors - were analyzed separately. Responses to complex stimuli were slower and less accurate than responses to simple stimuli. MMN was prominent and its amplitude was similar for both simple and complex stimuli, whereas the respective stimuli differed from standards in a single feature or two features respectively. Errors in response only to complex stimuli were associated with decreased MMN amplitude. P300 amplitude was greater for complex stimuli than for simple stimuli. Our data are compatible with the explanation that feature binding in auditory modality depends on two concurrent levels of processing. We speculate that the earlier level related to MMN generation is an essential and critical stage. Yet, a later analysis is also carried out, affecting P300 amplitude and response time. The current findings provide resolution to conflicting views on the nature of feature binding and show that feature binding is a distributed multilevel process.

  11. Covalent and non-covalent binding in the ion/ion charge inversion of peptide cations with benzene-disulfonic acid anions.

    PubMed

    Stutzman, John R; Luongo, Carl A; McLuckey, Scott A

    2012-06-01

    Protonated angiotensin II and protonated leucine enkephalin-based peptides, which included YGGFL, YGGFLF, YGGFLH, YGGFLK and YGGFLR, were subjected to ion/ion reactions with the doubly deprotonated reagents 4-formyl-1,3-benzenedisulfonic acid (FBDSA) and 1,3-benzenedisulfonic acid (BDSA). The major product of the ion/ion reaction is a negatively charged complex of the peptide and reagent. Following dehydration of [M + FBDSA-H](-) via collisional-induced dissociation (CID), angiotensin II (DRVYIHPF) showed evidence for two product populations, one in which a covalent modification has taken place and one in which an electrostatic modification has occurred (i.e. no covalent bond formation). A series of studies with model systems confirmed that strong non-covalent binding of the FBDSA reagent can occur with subsequent ion trap CID resulting in dehydration unrelated to the adduct. Ion trap CID of the dehydration product can result in cleavage of amide bonds in competition with loss of the FBDSA adduct. This scenario is most likely for electrostatically bound complexes in which the peptide contains both an arginine residue and one or more carboxyl groups. Otherwise, loss of the reagent species from the complex, either as an anion or as a neutral species, is the dominant process for electrostatically bound complexes. The results reported here shed new light on the nature of non-covalent interactions in gas phase complexes of peptide ions that can be used in the rationale design of reagent ions for specific ion/ion reaction applications. PMID:22707160

  12. Negatively charged residues of the segment linking the enzyme and cytolysin moieties restrict the membrane-permeabilizing capacity of adenylate cyclase toxin

    PubMed Central

    Masin, Jiri; Osickova, Adriana; Sukova, Anna; Fiser, Radovan; Halada, Petr; Bumba, Ladislav; Linhartova, Irena; Osicka, Radim; Sebo, Peter

    2016-01-01

    The whooping cough agent, Bordetella pertussis, secretes an adenylate cyclase toxin-hemolysin (CyaA) that plays a crucial role in host respiratory tract colonization. CyaA targets CR3-expressing cells and disrupts their bactericidal functions by delivering into their cytosol an adenylate cyclase enzyme that converts intracellular ATP to cAMP. In parallel, the hydrophobic domain of CyaA forms cation-selective pores that permeabilize cell membrane. The invasive AC and pore-forming domains of CyaA are linked by a segment that is unique in the RTX cytolysin family. We used mass spectrometry and circular dichroism to show that the linker segment forms α-helical structures that penetrate into lipid bilayer. Replacement of the positively charged arginine residues, proposed to be involved in target membrane destabilization by the linker segment, reduced the capacity of the toxin to translocate the AC domain across cell membrane. Substitutions of negatively charged residues then revealed that two clusters of negative charges within the linker segment control the size and the propensity of CyaA pore formation, thereby restricting the cell-permeabilizing capacity of CyaA. The ‘AC to Hly-linking segment’ thus appears to account for the smaller size and modest cell-permeabilizing capacity of CyaA pores, as compared to typical RTX hemolysins. PMID:27581058

  13. Design of an electrolyte composition for stable and rapid charging-discharging of a graphite negative electrode in a bis(fluorosulfonyl)imide-based ionic liquid

    NASA Astrophysics Data System (ADS)

    Matsui, Yukiko; Yamagata, Masaki; Murakami, Satoshi; Saito, Yasuteru; Higashizaki, Tetsuya; Ishiko, Eriko; Kono, Michiyuki; Ishikawa, Masashi

    2015-04-01

    We evaluate the effects of lithium salt on the charge-discharge performance of a graphite negative electrode in 1-ethyl-3-methylimidazolium bis(fluorosulfonyl)imide (EMImFSI) ionic liquid-based electrolytes. Although the graphite negative electrode exhibits good cyclability and rate capability in both 0.43 mol dm-3 LiFSI/EMImFSI and LiTFSI/EMImFSI (TFSI- = bis(trifluoromethylsulfonyl)imide) at room temperature, only the LiFSI/EMImFSI system enables the graphite electrode to be operated with sufficient discharge capacity at the low temperature of 0 °C, even though there is no noticeable difference in ionic conductivity, compared with LiTFSI/EMImFSI. Furthermore, a clear difference in the low-temperature behaviors of the two cells composed of EMImFSI with a high-concentration of lithium salts is observed. Additionally, charge-discharge operation of the graphite electrode at C-rate of over 5.0 can be achieved using of the high-concentration LiFSI/EMImFSI electrolyte. Considering the low-temperature characteristics in both high-concentration electrolytes, the stable and rapid charge-discharge operation in the high-concentration LiFSI/EMImFSI is presumably attributed to a suitable electrode/electrolyte interface with low resistivity. These results suggest that optimization of the electrolyte composition can realize safe and high-performance lithium-ion batteries that utilize ionic liquid-based electrolytes.

  14. Negatively charged residues of the segment linking the enzyme and cytolysin moieties restrict the membrane-permeabilizing capacity of adenylate cyclase toxin.

    PubMed

    Masin, Jiri; Osickova, Adriana; Sukova, Anna; Fiser, Radovan; Halada, Petr; Bumba, Ladislav; Linhartova, Irena; Osicka, Radim; Sebo, Peter

    2016-01-01

    The whooping cough agent, Bordetella pertussis, secretes an adenylate cyclase toxin-hemolysin (CyaA) that plays a crucial role in host respiratory tract colonization. CyaA targets CR3-expressing cells and disrupts their bactericidal functions by delivering into their cytosol an adenylate cyclase enzyme that converts intracellular ATP to cAMP. In parallel, the hydrophobic domain of CyaA forms cation-selective pores that permeabilize cell membrane. The invasive AC and pore-forming domains of CyaA are linked by a segment that is unique in the RTX cytolysin family. We used mass spectrometry and circular dichroism to show that the linker segment forms α-helical structures that penetrate into lipid bilayer. Replacement of the positively charged arginine residues, proposed to be involved in target membrane destabilization by the linker segment, reduced the capacity of the toxin to translocate the AC domain across cell membrane. Substitutions of negatively charged residues then revealed that two clusters of negative charges within the linker segment control the size and the propensity of CyaA pore formation, thereby restricting the cell-permeabilizing capacity of CyaA. The 'AC to Hly-linking segment' thus appears to account for the smaller size and modest cell-permeabilizing capacity of CyaA pores, as compared to typical RTX hemolysins. PMID:27581058

  15. Enhanced density of negative fixed charges in Al2O3 layers on Si through a subsequent deposition of TiO2

    NASA Astrophysics Data System (ADS)

    Schneider, Thomas; Ziegler, Johannes; Kaufmann, Kai; Ilse, Klemens; Sprafke, Alexander; Wehrspohn, Ralf B.

    2016-04-01

    The passivation of silicon surfaces play an important role for achieving high-efficiency crystalline silicon solar cells. In this work, a stack system comprising of 20nm Al2O3 with a 22nm TiO2 topping layer was deposited on p-type Si using thermal atomic layer deposition (ALD) and was investigated regarding its passivation quality. Quasi-steady-state photo conductance (QSSPC) measurements reveal that the minority carrier lifetime at an injection density of 1015cm-3 increased from 1.10ms to 1.96ms after the deposition of TiO2, which shows that the deposition of TiO2 onto Al2O3 is capable of enhancing its passivation quality. Capacity voltage (CV) measurements show that the amount of negative charges in the dielectric layer has increased from -2.4·1012cm-2 to -6.3·1012cm-2 due to the deposition of TiO2. The location of the additional charges was analyzed in this work by etching the dielectric layer stack in several steps. After each step CV measurements were performed. It is found that the additional negative charges are created within the Al2O3 layer. Additionally, ToF-SIMS measurements were performed to check for diffusion processes within the Al2O3 layer.

  16. Several conserved positively charged amino acids in OATP1B1 are involved in binding or translocation of different substrates

    PubMed Central

    Weaver, Yi M.; Hagenbuch, Bruno

    2010-01-01

    OATP1B1 and 1B3 are related transporters mediating uptake of numerous compounds into hepatocytes. A putative model of OATP1B3 with a “Positive Binding Pocket” containing conserved positively charged amino acids was predicted (Meier-Abt et al., J Membr Biol 208:213–227, 2005). Based on this model, we tested the hypothesis that these positive amino acids are important for OATP1B1 function. We made mutants and measured surface expression and uptake of estradiol-17β-glucuronide, estrone-3-sulfate and bromosulfophthalein in HEK293 cells. Two of the mutants had low surface expression levels: R181K at 10 % and R580A at 30 % of wild-type OATP1B1. A lysine at position 580 (R580K) rescued the expression of R580A. Mutations of several amino acids resulted in substrate dependent effects. The largest changes were seen for estradiol-17β-glucuronide while estrone-3-sulfate and bromosulfophthalein transport was less affected. The wild-type OATP1B1 Km value for estradiol-17β-glucuronide of 5.35 ± 0.54 μM was increased by R57A to 30.5 ± 3.64 μM and decreased by R580K to 0.52 ± 0.18 μM. For estrone-3-sulfate the wild-type high affinity Km value of 0.55 ± 0.12 μM was increased by K361R to 1.8 ± 0.47 μM and decreased by R580K to 0.1 ± 0.04 μM. In addition, R580K also reduced the Vmax values for all three substrates to less than 25% of wild-type OATP1B1. Mutations at the intracellular K90, H92 and R93 mainly affected Vmax values for estradiol-17β-glucuronide uptake. In conclusion, the conserved amino acids R57, K361 and R580 seem to be part of the substrate binding sites and/or translocation pathways in OATP1B1. PMID:20821001

  17. Dominant negative mutant of retinoic acid receptor alpha inhibits retinoic acid-induced P19 cell differentiation by binding to DNA.

    PubMed

    Costa, S L; McBurney, M W

    1996-05-25

    Retinoic acid (RA) is a potent inducer of P19 cell differentiation. RA activity is thought to be mediated by nuclear RA receptors (RARs), transcription factors whose activity is dependent on RA. There are three RARs called alpha, beta, and gamma. We created truncated versions of the three RARs and compared their activities as inhibitors of RA-mediated gene transcription and of P19 cell differentiation. Only mutants of the RAR alpha were inhibitory in these assays. A mutant of RAR alpha carrying a 10-amino-acid insert was able to heterodimerize with RXRbeta or with the normal RAR alpha and the inhibitory activity of this mutant was dependent on an intact DNA binding domain. We conclude that dominant negative mutants of RAR alpha act by heterodimerizing with RXRs or RARs and binding to RA response elements on DNA, thereby preventing binding of the normal receptors to those sites. PMID:8635515

  18. Crystal structure of Jararacussin-I: the highly negatively charged catalytic interface contributes to macromolecular selectivity in snake venom thrombin-like enzymes.

    PubMed

    Ullah, A; Souza, T A C B; Zanphorlin, L M; Mariutti, R B; Santana, V S; Murakami, M T; Arni, R K

    2013-01-01

    Snake venom serine proteinases (SVSPs) are hemostatically active toxins that perturb the maintenance and regulation of both the blood coagulation cascade and fibrinolytic feedback system at specific points, and hence, are widely used as tools in pharmacological and clinical diagnosis. The crystal structure of a thrombin-like enzyme (TLE) from Bothrops jararacussu venom (Jararacussin-I) was determined at 2.48 Å resolution. This is the first crystal structure of a TLE and allows structural comparisons with both the Agkistrodon contortrix contortrix Protein C Activator and the Trimeresurus stejnegeri plasminogen activator. Despite the highly conserved overall fold, significant differences in the amino acid compositions and three-dimensional conformations of the loops surrounding the active site significantly alter the molecular topography and charge distribution profile of the catalytic interface. In contrast to other SVSPs, the catalytic interface of Jararacussin-I is highly negatively charged, which contributes to its unique macromolecular selectivity. PMID:23139169

  19. A conserved domain of the large subunit of replication factor C binds PCNA and acts like a dominant negative inhibitor of DNA replication in mammalian cells.

    PubMed

    Fotedar, R; Mossi, R; Fitzgerald, P; Rousselle, T; Maga, G; Brickner, H; Messier, H; Kasibhatla, S; Hübscher, U; Fotedar, A

    1996-08-15

    Replication factor C (RF-C), a complex of five polypeptides, is essential for cell-free SV40 origin-dependent DNA replication and viability in yeast. The cDNA encoding the large subunit of human RF-C (RF-Cp145) was cloned in a Southwestern screen. Using deletion mutants of RF-Cp145 we have mapped the DNA binding domain of RF-Cp145 to amino acid residues 369-480. This domain is conserved among both prokaryotic DNA ligases and eukaryotic poly(ADP-ribose) polymerases and is absent in other subunits of RF-C. The PCNA binding domain maps to amino acid residues 481-728 and is conserved in all five subunits of RF-C. The PCNA binding domain of RF-Cp145 inhibits several functions of RF-C, such as: (i) in vitro DNA replication of SV40 origin-containing DNA; (ii) RF-C-dependent loading of PCNA onto DNA; and (iii) RF-C-dependent DNA elongation. The PCNA binding domain of RF-Cp145 localizes to the nucleus and inhibits DNA synthesis in transfected mammalian cells. In contrast, the DNA binding domain of RF-Cp145 does not inhibit DNA synthesis in vitro or in vivo. We therefore conclude that amino acid residues 481-728 of human RF-Cp145 are critical and act as a dominant negative mutant of RF-C function in DNA replication in vivo.

  20. Negative Factor from SIV Binds to the Catalytic Subunit of the V-ATPase to Internalize CD4 and to Increase Viral Infectivity

    PubMed Central

    Mandic, Robert; Fackler, Oliver T.; Geyer, Matthias; Linnemann, Thomas; Zheng, Yong-Hui; Peterlin, B. Matija

    2001-01-01

    The accessory protein negative factor (Nef) from human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) is required for optimal viral infectivity and the progression to acquired immunodeficiency syndrome (AIDS). Nef interacts with the endocytic machinery, resulting in the down-regulation of cluster of differentiation antigen 4 (CD4) and major histocompatibility complex class I (MHCI) molecules on the surface of infected cells. Mutations in the C-terminal flexible loop of Nef result in a lower rate of internalization by this viral protein. However, no loop-dependent binding of Nef to adaptor protein-2 (AP-2), which is the adaptor protein complex that is required for the internalization of proteins from the plasma membrane, could be demonstrated. In this study we investigated the relevance of different motifs in Nef from SIVmac239 for its internalization, CD4 down-regulation, binding to components of the trafficking machinery, and viral infectivity. Our data suggest that the binding of Nef to the catalytic subunit H of the vacuolar membrane ATPase (V-ATPase) facilitates its internalization. This binding depends on the integrity of the whole flexible loop. Subsequent studies on Nef mutant viruses revealed that the flexible loop is essential for optimal viral infectivity. Therefore, our data demonstrate how Nef contacts the endocytic machinery in the absence of its direct binding to AP-2 and suggest an important role for subunit H of the V-ATPase in viral infectivity. PMID:11179428

  1. Enhancement of NK Cell Cytotoxicity Induced by Long-Term Living in Negatively Charged-Particle Dominant Indoor Air-Conditions

    PubMed Central

    Nishimura, Yasumitsu; Takahashi, Kazuaki; Mase, Akinori; Kotani, Muneo; Ami, Kazuhisa; Maeda, Megumi; Shirahama, Takashi; Lee, Suni; Matsuzaki, Hidenori; Kumagai-Takei, Naoko; Yoshitome, Kei; Otsuki, Takemi

    2015-01-01

    Investigation of house conditions that promote health revealed that negatively charged-particle dominant indoor air-conditions (NCPDIAC) induced immune stimulation. Negatively charged air-conditions were established using a fine charcoal powder on walls and ceilings and utilizing forced negatively charged particles (approximate diameter: 20 nm) dominant in indoor air-conditions created by applying an electric voltage (72 V) between the backside of the walls and the ground. We reported previously that these conditions induced a slight and significant increase of interleukin-2 during a 2.5-h stay and an increase of NK cell cytotoxicity when examining human subjects after a two-week night stay under these conditions. In the present study, seven healthy volunteers had a device installed to create NCPDIAC in the living or sleeping rooms of their own homes. Every three months the volunteers then turned the NCPDIAC device on or off. A total of 16 ON and 13 OFF trials were conducted and their biological effects were analyzed. NK activity increased during ON trials and decreased during OFF trials, although no other adverse effects were found. In addition, there were slight increases of epidermal growth factor (EGF) during ON trials. Furthermore, a comparison of the cytokine status between ON and OFF trials showed that basic immune status was stimulated slightly during ON trials under NCPIADC. Our overall findings indicate that the NCPDIAC device caused activation of NK activity and stimulated immune status, particularly only on NK activity, and therefore could be set in the home or office buildings. PMID:26173062

  2. Charge effect on the photoinactivation of Gram-negative and Gram-positive bacteria by cationic meso-substituted porphyrins

    PubMed Central

    2009-01-01

    Background In recent times photodynamic antimicrobial therapy has been used to efficiently destroy Gram (+) and Gram (-) bacteria using cationic porphyrins as photosensitizers. There is an increasing interest in this approach, namely in the search of photosensitizers with adequate structural features for an efficient photoinactivation process. In this study we propose to compare the efficiency of seven cationic porphyrins differing in meso-substituent groups, charge number and charge distribution, on the photodynamic inactivation of a Gram (+) bacterium (Enterococcus faecalis) and of a Gram (-) bacterium (Escherichia coli). The present study complements our previous work on the search for photosensitizers that might be considered good candidates for the photoinactivation of a large spectrum of environmental microorganisms. Results Bacterial suspension (107 CFU mL-1) treated with different photosensitizers concentrations (0.5, 1.0 and 5.0 μM) were exposed to white light (40 W m-2) for a total light dose of 64.8 J cm-2. The most effective photosensitizers against both bacterial strains were the Tri-Py+-Me-PF and Tri-Py+-Me-CO2Me at 5.0 μM with a light fluence of 64.8 J cm-2, leading to > 7.0 log (> 99,999%) of photoinactivation. The tetracationic porphyrin also proved to be a good photosensitizer against both bacterial strains. Both di-cationic and the monocationic porphyrins were the least effective ones. Conclusion The number of positive charges, the charge distribution in the porphyrins' structure and the meso-substituent groups seem to have different effects on the photoinactivation of both bacteria. As the Tri-Py+-Me-PF porphyrin provides the highest log reduction using lower light doses, this photosensitizer can efficiently photoinactivate a large spectrum of environmental bacteria. The complete inactivation of both bacterial strains with low light fluence (40 W m-2) means that the photodynamic approach can be applied to wastewater treatment under natural

  3. A model for the abrogation of the SOS response by an SOS protein: a negatively charged helix in DinI mimics DNA in its interaction with RecA

    PubMed Central

    Voloshin, Oleg N.; Ramirez, Benjamin E.; Bax, Ad; Camerini-Otero, R. Daniel

    2001-01-01

    DinI is a recently described negative regulator of the SOS response in Escherichia coli. Here we show that it physically interacts with RecA and prevents the binding of single-stranded DNA to RecA, which is required for the activation of the latter. DinI also displaces ssDNA from a stable RecA–DNA cofilament, thus eliminating the SOS signal. In addition, DinI inhibits RecA-mediated homologous DNA pairing, but has no effect on actively proceeding strand exchange. Biochemical data, together with the molecular structure, define the C-terminal α-helix in DinI as the active site of the protein. In an unusual example of molecular mimicry, a negatively charged surface on this α-helix, by imitating single-stranded DNA, interacts with the loop L2 homologous pairing region of RecA and interferes with the activation of RecA. PMID:11230150

  4. Fis negatively affects binding of Tn4652 transposase by out-competing IHF from the left end of Tn4652.

    PubMed

    Teras, Riho; Jakovleva, Julia; Kivisaar, Maia

    2009-04-01

    Transposition activity in bacteria is generally maintained at a low level. The activity of mobile DNA elements can be controlled by bacterially encoded global regulators. Regulation of transposition of Tn4652 in Pseudomonas putida is one such example. Activation of transposition of Tn4652 in starving bacteria requires the stationary-phase sigma factor RpoS and integration host factor (IHF). IHF plays a dual role in Tn4652 translocation by activating transcription of the transposase gene tnpA of the transposon and facilitating TnpA binding to the inverted repeats of the transposon. Our previous results have indicated that besides IHF some other P. putida-encoded global regulator(s) might bind to the ends of Tn4652 and regulate transposition activity. In this study, employing a DNase I footprint assay we have identified a binding site of P. putida Fis (factor for inversion stimulation) centred 135 bp inside the left end of Tn4652. Our results of gel mobility shift and DNase I footprint studies revealed that Fis out-competes IHF from the left end of Tn4652, thereby abolishing the binding of TnpA. Thus, the results obtained in this study indicate that the transposition of Tn4652 is regulated by the cellular amount of P. putida global regulators Fis and IHF. PMID:19332822

  5. A β-integrin from sea cucumber Apostichopus japonicus exhibits LPS binding activity and negatively regulates coelomocyte apoptosis.

    PubMed

    Wang, Zhenhui; Shao, Yina; Li, Chenghua; Lv, Zhimeng; Wang, Haihong; Zhang, Weiwei; Zhao, Xuelin

    2016-05-01

    Integrins are a family of membrane glycoproteins, which are the major receptors for extracellular matrix and cell-cell adhesion molecules. In this study, a 1038 bp sequence representing the full-length cDNA of a novel β-integrin subunit (designated as AjITGB) was cloned from Apostichopus japonicas by using combined transcriptome sequencing and RACE approaches. The deduced amino acid sequence of AjITGB shared a conserved tripeptide Arg-Gly-Asp (RGD) binding domain with an S-diglyceridecysteine or N-Palm cysteine residue (C(31)), a transmembrane domain, and a β-integrin cytoplasmic domain. Spatial distribution analysis showed that AjITGB was constitutively expressed in all tested tissues with dominant expression in the muscles and weak expression in the respiratory tree. The pathogen Vibrio splendidus challenge and LPS stimulation could both significantly down-regulate the mRNA expression of AjITGB. Functional investigation revealed that recombinant AjITGB displayed higher LPS binding activity but lower binding activity to PGN and MAN. More importantly, knockdown of AjITGB by specific siRNA resulted in the significant promotion of coelomocyte apoptosis in vitro. Results indicated that AjITGB may serve as an apoptosis inhibitor with LPS binding activity during host-pathogen interaction in sea cucumber. PMID:26994670

  6. A β-integrin from sea cucumber Apostichopus japonicus exhibits LPS binding activity and negatively regulates coelomocyte apoptosis.

    PubMed

    Wang, Zhenhui; Shao, Yina; Li, Chenghua; Lv, Zhimeng; Wang, Haihong; Zhang, Weiwei; Zhao, Xuelin

    2016-05-01

    Integrins are a family of membrane glycoproteins, which are the major receptors for extracellular matrix and cell-cell adhesion molecules. In this study, a 1038 bp sequence representing the full-length cDNA of a novel β-integrin subunit (designated as AjITGB) was cloned from Apostichopus japonicas by using combined transcriptome sequencing and RACE approaches. The deduced amino acid sequence of AjITGB shared a conserved tripeptide Arg-Gly-Asp (RGD) binding domain with an S-diglyceridecysteine or N-Palm cysteine residue (C(31)), a transmembrane domain, and a β-integrin cytoplasmic domain. Spatial distribution analysis showed that AjITGB was constitutively expressed in all tested tissues with dominant expression in the muscles and weak expression in the respiratory tree. The pathogen Vibrio splendidus challenge and LPS stimulation could both significantly down-regulate the mRNA expression of AjITGB. Functional investigation revealed that recombinant AjITGB displayed higher LPS binding activity but lower binding activity to PGN and MAN. More importantly, knockdown of AjITGB by specific siRNA resulted in the significant promotion of coelomocyte apoptosis in vitro. Results indicated that AjITGB may serve as an apoptosis inhibitor with LPS binding activity during host-pathogen interaction in sea cucumber.

  7. Carboxyl and negative charge-functionalized superparamagnetic nanochains with amorphous carbon shell and magnetic core: synthesis and their application in removal of heavy metal ions

    NASA Astrophysics Data System (ADS)

    Wang, Hui; Chen, Qian-Wang; Chen, Jian; Yu, Bin-Xing; Hu, Xian-Yi

    2011-11-01

    This communication describes carboxyl-functionalized nanochains with amorphous carbon shell (18 nm) and magnetic core using ferrocene as a single reactant under the induction of an external magnetic field (0.40 T), which shows a superparamagnetic behavior and magnetization saturation of 38.6 emu g-1. Because of mesoporous structure (3.8 nm) and surface negative charge (-35.18 mV), the nanochains can be used as adsorbent for removing the heavy metal ions (90%) from aqueous solution.This communication describes carboxyl-functionalized nanochains with amorphous carbon shell (18 nm) and magnetic core using ferrocene as a single reactant under the induction of an external magnetic field (0.40 T), which shows a superparamagnetic behavior and magnetization saturation of 38.6 emu g-1. Because of mesoporous structure (3.8 nm) and surface negative charge (-35.18 mV), the nanochains can be used as adsorbent for removing the heavy metal ions (90%) from aqueous solution. Electronic supplementary information (ESI) available: Experimental section, Fig. S1, Fig. S2, Fig. S3, Fig. S4 and Fig. S5. See DOI: 10.1039/c1nr11012h

  8. Fixed negative charge and the Donnan effect: a description of the driving forces associated with brain tissue swelling and oedema

    PubMed Central

    Elkin, Benjamin S.; Shaik, Mohammed A.; Morrison, Barclay

    2010-01-01

    Cerebral oedema or brain tissue swelling is a significant complication following traumatic brain injury or stroke that can increase the intracranial pressure (ICP) and impair blood flow. Here, we have identified a potential driver of oedema: the negatively charged molecules fixed within cells. This fixed charge density (FCD), once exposed, could increase ICP through the Donnan effect. We have shown that metabolic processes and membrane integrity are required for concealing this FCD as slices of rat cortex swelled immediately (within 30 min) following dissection if treated with 2 deoxyglucose + cyanide (2DG+CN) or Triton X-100. Slices given ample oxygen and glucose, however, did not swell significantly. We also found that dead brain tissue swells and shrinks in response to changes in ionic strength of the bathing medium, which suggests that the Donnan effect is capable of pressurizing and swelling brain tissue. As predicted, a non-ionic osmolyte, 1,2 propanediol, elicited no volume change at 2000×10−3 osmoles l−1 (Osm). Swelling data were well described by triphasic mixture theory with the calculated reference state FCD similar to that measured with a 1,9 dimethylmethylene blue assay. Taken together, these data suggest that intracellular fixed charges may contribute to the driving forces responsible for brain swelling. PMID:20047940

  9. Functional domains of the floral regulator AGAMOUS: characterization of the DNA binding domain and analysis of dominant negative mutations.

    PubMed Central

    Mizukami, Y; Huang, H; Tudor, M; Hu, Y; Ma, H

    1996-01-01

    The Arabidopsis MADS box gene AGAMOUS (AG) controls reproductive organ identity and floral meristem determinacy. The AG protein binds in vitro to DNA sequences similar to the targets of known MADS domain transcription factors. Whereas most plant MADS domain proteins begin with the MADS domain, AG and its orthologs contain a region N-terminal to the MADS domain. All plant MADS domain proteins share another region with moderate sequence similarity called the K domain. Neither the region (I region) that lies between the MADS and K domains nor the C-terminal region is conserved. We show here that the AG MADS domain and the I region are necessary and sufficient for DNA binding in vitro and that AG binds to DNA as a dimer. To investigate the in vivo function of the regions of AG not required for in vitro DNA binding, we introduced several AG constructs into wild-type plants and characterized their floral phenotypes. We show that transgenic Arabidopsis plants with a 35S-AG construct encoding an AG protein lacking the N-terminal region produced apetala 2 (ap2)-like flowers similar to those ectopically expressing AG proteins retaining the N-terminal region. This result suggests that the N-terminal region is not required to produce the ap2-like phenotype. In addition, transformants with a 35S-AG construct encoding an AG protein lacking the C-terminal region produced ag-like flowers, indicating that this truncated AG protein inhibits normal AG function. Finally, transformants with a 35S-AG construct encoding an AG protein lacking both K and C regions produced flowers with more stamens and carpels. The phenotypes of the AG transformants demonstrate that both the K domain and the C-terminal region have important and distinct in vivo functions. We discuss possible mechanisms through which AG may regulate downstream genes. PMID:8672883

  10. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9.

    PubMed

    Zhang, Ruoxi; Fang, Liurong; Wang, Dang; Cai, Kaimei; Zhang, Huan; Xie, Lilan; Li, Yi; Chen, Huanchun; Xiao, Shaobo

    2015-11-01

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses.

  11. Method for the direct observation and quantification of survival of bacteria attached to negatively or positively charged surfaces in an aqueous medium.

    PubMed

    Asadishad, Bahareh; Ghoshal, Subhasis; Tufenkji, Nathalie

    2011-10-01

    The risk of groundwater contamination by microbial pathogens is linked to their survival in the subsurface. Although there is a large body of literature on the inactivation behavior of suspended (planktonic) microorganisms, little is known about the inactivation of bacteria when attached to sand grain surfaces in groundwater aquifers. The main goal of this study was to develop a fluorescence-based experimental technique for evaluating the extent of inactivation over time of bacteria adhered onto a surface in an aqueous environment. Key features of the developed technique are as follows: (i) attached cells do not need to be removed from the surface of interest for quantification, (ii) bacterial inactivation can be examined in real-time for prolonged time periods, and (iii) the system remains undisturbed (i.e., the aqueous environment is unchanged) during the assay. A negatively or positively charged substrate (i.e., bare or coated glass slide) was mounted in a parallel-plate flow cell, bacteria were allowed to attach onto the substrate, and the loss of bacterial membrane integrity and respiratory activity were investigated as a function of time by fluorescence microscopy using Live/Dead BacLight and BacLight RedoxSensor CTC (5-cyano-2,3-ditolyl tetrazolium chloride) viability assays. These two different measures of bacterial inactivation result in comparable trends in bacterial inactivation, confirming the validity of the experimental technique. The results of this work show that the developed technique is sensitive enough to distinguish between the inactivation kinetics of different representative bacteria attached to either a negatively charged (bare glass) surface or a positively charged (coated glass) surface. Hence, the technique can be used to characterize bacterial inactivation kinetics when attached to environmentally relevant surfaces over a broad range of groundwater chemistries.

  12. Kinetic instability of the dust acoustic mode in inhomogeneous, partially magnetized plasma with both positively and negatively charged grains

    SciTech Connect

    Vranjes, J.; Poedts, S.

    2010-08-15

    A purely kinetic instability of the dust acoustic mode in inhomogeneous plasmas is discussed. In the presence of a magnetic field, electrons and ions may be magnetized while at the same time dust grains may remain unmagnetized. Although the dynamics of the light species is strongly affected by the magnetic field, the dust acoustic mode may still propagate in practically any direction. The inhomogeneity implies a source of free energy for an instability that develops through the diamagnetic drift effects of the magnetized species. It is shown that this may be a powerful mechanism for the excitation of dust acoustic waves. The analysis presented in the work is also directly applicable to plasmas containing both positive and negative ions and electrons, provided that at least one of the two ion species is unmagnetized.

  13. UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein

    PubMed Central

    Cornelis, Sigrid; Tinton, Sandrine A.; Schepens, Bert; Bruynooghe, Yanik; Beyaert, Rudi

    2005-01-01

    Upstream of N-ras (Unr) has been described as an internal initiation trans-acting factor (ITAF) in the cap-independent translation of some particular viral and cellular mRNAs. Two factors led us to hypothesize that the UNR 5′-untranslated region (5′-UTR) may contain an internal ribosome entry site (IRES). The first was the requirement for persisting Unr expression under conditions that correlate with cap-independent translation. The other was the observation that the primary UNR transcript contains a 447 nt long 5′-UTR including two upstream AUGs that may restrict translation initiation via cap-dependent ribosome scanning. Here we report that the UNR 5′-UTR allows IRES-dependent translation, as revealed by a dicistronic reporter assay. Various controls ruled out the contribution of leaky scanning, cryptic promoter sequences or RNA processing events to the ability of the UNR 5′-UTR to mediate internal initiation of translation. Ultraviolet cross-linking analysis and RNA affinity chromatography revealed the binding of polypyrimidine tract binding protein (PTB) to the UNR IRES, requiring a pyrimidine-rich region (nucleotides 335–355). Whereas overexpression of PTB in several cell lines inhibited UNR IRES activity and UNR protein expression, depletion of endogenous PTB using RNAi increased UNR IRES activity. Moreover, a mutant version of the UNR IRES lacking the PTB binding site was more efficient at directing IRES-mediated translation. In conclusion, our results demonstrate that translation of the ITAF Unr can itself be regulated by an IRES that is downregulated by PTB. PMID:15928332

  14. Positive and negative allosteric modulators of the Ca2+-sensing receptor interact within overlapping but not identical binding sites in the transmembrane domain.

    PubMed

    Petrel, Christophe; Kessler, Albane; Dauban, Philippe; Dodd, Robert H; Rognan, Didier; Ruat, Martial

    2004-04-30

    A three-dimensional model of the human extracellular Ca(2+)-sensing receptor (CaSR) has been used to identify specific residues implicated in the recognition of two negative allosteric CaSR modulators of different chemical structure, NPS 2143 and Calhex 231. To demonstrate the involvement of these residues, we have analyzed dose-inhibition response curves for the effect of these calcilytics on Ca(2+)-induced [(3)H]inositol phosphate accumulation for the selected CaSR mutants transiently expressed in HEK293 cells. These mutants were further used for investigating the binding pocket of two chemically unrelated positive allosteric CaSR modulators, NPS R-568 and (R)-2-[1-(1-naphthyl)ethylaminomethyl]-1H-indole (Calindol), a novel potent calcimimetic that stimulates (EC(50) = 0.31 microM) increases in [(3)H]inositol phosphate levels elicited by activating the wild-type CaSR by 2 mM Ca(2+). Our data validate the involvement of Trp-818(6.48), Phe-821(6.51), Glu-837(7.39), and Ile-841(7.43) located in transmembranes (TM) 6 and TM7, in the binding pocket for both calcimimetics and calcilytics, despite important differences observed between each family of compounds. The TMs involved in the recognition of both calcilytics include residues located in TM3 (Arg-680(3.28), Phe-684(3.32), and Phe-688(3.36)). However, our study indicates subtle differences between the binding of these two compounds. Importantly, the observation that some mutations that have no effect on calcimimetics recognition but which affect the binding of calcilytics in TM3 and TM5, suggests that the binding pocket of positive and negative allosteric modulators is partially overlapping but not identical. Our CaSR model should facilitate the development of novel drugs of this important therapeutic target and the identification of the molecular determinants involved in the binding of allosteric modulators of class 3 G-protein-coupled receptors. PMID:14976203

  15. Dominant role of local dipolar interactions in phosphate binding to a receptor cleft with an electronegative charge surface: equilibrium, kinetic, and crystallographic studies.

    PubMed Central

    Ledvina, P. S.; Tsai, A. L.; Wang, Z.; Koehl, E.; Quiocho, F. A.

    1998-01-01

    Stringent specificity and complementarity between the receptor, a periplasmic phosphate-binding protein (PBP) with a two-domain structure, and the completely buried and dehydrated phosphate are achieved by hydrogen bonding or dipolar interactions. We recently found that the surface charge potential of the cleft between the two domains that contains the anion binding site is intensely electronegative. This novel finding prompted the study reported here of the effect of ionic strength on the equilibrium and rapid kinetics of phosphate binding. To facilitate this study, Ala197, located on the edge of the cleft, was replaced by a Trp residue (A197W PBP) to generate a fluorescence reporter group. The A197W PBP-phosphate complex retains wild-type Kd and X-ray structure beyond the replacement residue. The Kd (0.18 microM) at no salt is increased by 20-fold at greater than 0.30 M NaCl. Stopped-flow fluorescence kinetic studies indicate a two-step binding process: (1) The phosphate (L) binds, at near diffusion-controlled rate, to the open cleft form (Po) of PBP to produce an intermediate, PoL. This rate decreases with increasing ionic strength. (2) The intermediate isomerizes to the closed-conformation form, PcL. The results indicate that the high specificity, affinity, and rate of phosphate binding are not influenced by the noncomplementary electronegative surface potential of the cleft. That binding depends almost entirely on local dipolar interactions with the receptor has important ramification in electrostatic interactions in protein structures and in ligand recognition. PMID:9865949

  16. A functional C-terminal TRAF3-binding site in MAVS participates in positive and negative regulation of the IFN antiviral response.

    PubMed

    Paz, Suzanne; Vilasco, Myriam; Werden, Steven J; Arguello, Meztli; Joseph-Pillai, Deshanthe; Zhao, Tiejun; Nguyen, Thi Lien-Anh; Sun, Qiang; Meurs, Eliane F; Lin, Rongtuan; Hiscott, John

    2011-06-01

    Recognition of viral RNA structures by the cytosolic sensor retinoic acid-inducible gene-I (RIG-I) results in the activation of signaling cascades that culminate with the generation of the type I interferon (IFN) antiviral response. Onset of antiviral and inflammatory responses to viral pathogens necessitates the regulated spatiotemporal recruitment of signaling adapters, kinases and transcriptional proteins to the mitochondrial antiviral signaling protein (MAVS). We previously demonstrated that the serine/threonine kinase IKKε is recruited to the C-terminal region of MAVS following Sendai or vesicular stomatitis virus (VSV) infection, mediated by Lys63-linked polyubiquitination of MAVS at Lys500, resulting in inhibition of downstream IFN signaling (Paz et al, Mol Cell Biol, 2009). In this study, we demonstrate that C-terminus of MAVS harbors a novel TRAF3-binding site in the aa450-468 region of MAVS. A consensus TRAF-interacting motif (TIM), 455-PEENEY-460, within this site is required for TRAF3 binding and activation of IFN antiviral response genes, whereas mutation of the TIM eliminates TRAF3 binding and the downstream IFN response. Reconstitution of MAVS(-/-) mouse embryo fibroblasts with a construct expressing a TIM-mutated version of MAVS failed to restore the antiviral response or block VSV replication, whereas wild-type MAVS reconstituted antiviral inhibition of VSV replication. Furthermore, recruitment of IKKε to an adjacent C-terminal site (aa 468-540) in MAVS via Lys500 ubiquitination decreased TRAF3 binding and protein stability, thus contributing to IKKε-mediated shutdown of the IFN response. This study demonstrates that MAVS harbors a functional C-terminal TRAF3-binding site that participates in positive and negative regulation of the IFN antiviral response.

  17. Mutation of the phospholipase C-gamma1-binding site of LAT affects both positive and negative thymocyte selection.

    PubMed

    Sommers, Connie L; Lee, Jan; Steiner, Kevin L; Gurson, Jordan M; Depersis, Corinne L; El-Khoury, Dalal; Fuller, Claudette L; Shores, Elizabeth W; Love, Paul E; Samelson, Lawrence E

    2005-04-01

    Linker for activation of T cells (LAT) is a scaffolding adaptor protein that is critical for T cell development and function. A mutation of LAT (Y136F) that disrupts phospholipase C-gamma1 activation and subsequent calcium influx causes a partial block in T cell development and leads to a severe lymphoproliferative disease in homozygous knock-in mice. One possible contribution to the fatal disease of LAT Y136F knock-in mice could be from autoreactive T cells generated in these mice because of altered thymocyte selection. To examine the impact of the LAT Y136F mutation on thymocyte positive and negative selection, we bred this mutation onto the HY T cell receptor (TCR) transgenic, recombination activating gene-2 knockout background. Female mice with this genotype showed a severe defect in positive selection, whereas male mice exhibited a phenotype resembling positive selection (i.e., development and survival of CD8(hi) HY TCR-specific T cells) instead of negative selection. These results support the hypothesis that in non-TCR transgenic, LAT Y136F knock-in mice, altered thymocyte selection leads to the survival and proliferation of autoreactive T cells that would otherwise be negatively selected in the thymus.

  18. The Aspergillus nidulans multimeric CCAAT binding complex AnCF is negatively autoregulated via its hapB subunit gene.

    PubMed

    Steidl, S; Hynes, M J; Brakhage, A A

    2001-03-01

    Cis-acting CCAAT elements are frequently found in eukaryotic promoter regions. Many of them are bound by conserved multimeric complexes. In the fungus Aspergillus nidulans the respective complex was designated AnCF (A. nidulans CCAAT binding factor). AnCF is composed of at least three subunits designated HapB, HapC and HapE. Here, we show that the promoter regions of the hapB genes in both A. nidulans and Aspergillus oryzae contain two inversely oriented, conserved CCAAT boxes (box alpha and box beta). Electrophoretic mobility shift assays (EMSAs) using both nuclear extracts and the purified, reconstituted AnCF complex indicated that AnCF binding in vitro to these boxes occurs in a non-mutually exclusive manner. Western and Northern blot analyses showed that steady-state levels of HapB protein as well as hapB mRNA were elevated in hapC and hapE deletion mutants, suggesting a repressing effect of AnCF on hapB expression. Consistently, in a hapB deletion background the hapB-lacZ expression level was elevated compared with the expression in the wild-type. This was further supported by overexpression of hapB using an inducible alcA-hapB construct. Induction of alcA-hapB expression strongly repressed the expression of a hapB-lacZ gene fusion. However, mutagenesis of box beta led to a fivefold reduced expression of a hapB-lacZ gene fusion compared with the expression derived from a wild-type hapB-lacZ fusion. These results indicate that (i) box beta is an important positive cis-acting element in hapB regulation, (ii) AnCF does not represent the corresponding positive trans-acting factor and (iii) that AnCF is involved in repression of hapB.

  19. Identification of an amphioxus intelectin homolog that preferably agglutinates gram-positive over gram-negative bacteria likely due to different binding capacity to LPS and PGN.

    PubMed

    Yan, Jie; Wang, Jianfeng; Zhao, Yaqi; Zhang, Jingye; Bai, Changcun; Zhang, Changqing; Zhang, Chao; Li, Kailin; Zhang, Haiqing; Du, Xiumin; Feng, Lijun

    2012-07-01

    Intelectin is a recently described galactofuranose-binding lectin that plays a role in innate immunity in vertebrates. Little is known about intelectin in invertebrates, including amphioxus, the transitional form between vertebrates and invertebrates. We cloned an amphioxus intelectin homolog, AmphiITLN-like, coding 302 amino acids with a conserved fibrinogen-related domain (FReD) in the N-terminus and an Intelectin domain in the C-terminus. In situ hybridization in adult amphioxus showed that AmphiITLN-like transcripts were highly expressed in the digestive tract and the skin. Quantitative real-time PCR revealed that AmphiITLN-like is significantly up-regulated in response to Staphylococcus aureus challenge, but only modestly to Escherichia coli. In addition, recombinant AmphiITLN-like expressed in E. coli agglutinates Gram-negative and Gram-positive bacteria to different degrees in a calcium dependent manner. Recombinant AmphiITLN-like could bind lipopolysaccharide (LPS) and peptidoglycan (PGN), the major cell wall components of Gram-negative and Gram-positive bacteria, respectively, with a higher affinity to PGN. Our work identified and characterized for the first time an amphioxus intelectin homolog, and provided insight into the evolution and function of the intelectin family.

  20. Negative charge trapping effects in Al2O3 films grown by atomic layer deposition onto thermally oxidized 4H-SiC

    NASA Astrophysics Data System (ADS)

    Schilirò, Emanuela; Lo Nigro, Raffaella; Fiorenza, Patrick; Roccaforte, Fabrizio

    2016-07-01

    This letter reports on the negative charge trapping in Al2O3 thin films grown by atomic layer deposition onto oxidized silicon carbide (4H-SiC). The films exhibited a permittivity of 8.4, a breakdown field of 9.2 MV/cm and small hysteresis under moderate bias cycles. However, severe electron trapping inside the Al2O3 film (1 × 1012 cm-2) occurs upon high positive bias stress (>10V). Capacitance-voltage measurements at different temperatures and stress conditions have been used to determine an activation energy of 0.1eV. The results provide indications on the possible nature of the trapping defects and, hence, on the strategies to improve this technology for 4H-SiC devices.

  1. The Aspergillus nidulans homoaconitase gene lysF is negatively regulated by the multimeric CCAAT-binding complex AnCF and positively regulated by GATA sites.

    PubMed

    Weidner, G; Steidl, S; Brakhage, A A

    2001-02-01

    In beta-lactam-antibiotic-producing fungi, such as Aspergillus (Emericella) nidulans, L-alpha-aminoadipic acid is the branching point of the lysine and penicillin biosynthesis pathways. To obtain a deeper insight into the regulation of lysine biosynthesis genes, the regulation of the A. nidulans lysF gene, which encodes homoaconitase, was studied. Band-shift assays indicated that the A. nidulans multimeric CCAAT-binding complex AnCF binds to two of four CCAAT motifs present in the lysF promoter region. AnCF consists at least of three different subunits, designated HapB, HapC, and HapE. In both a delta hapB and a delta hapC strain, the expression of a translational lysF-lacZ gene fusion integrated in single copy at the chromosomal argB gene locus was two to three-fold higher than in a wild-type strain. These data show that AnCF negatively regulates lysF expression. The results of Northern blot analysis and lysF-lacZ expression analysis did not indicate a lysine-dependent repression of lysF expression. Furthermore, mutational analysis of the lysF promoter region revealed that two GATA sites matching the GATA consensus sequence HGATAR positively affected lysF-lacZ expression. Results of Northern blot analysis also excluded that the global nitrogen regulator AreA is the responsible trans-acting GATA-binding factor.

  2. Ground-state oxygen holes and the metal–insulator transition in the negative charge-transfer rare-earth nickelates

    PubMed Central

    Bisogni, Valentina; Catalano, Sara; Green, Robert J.; Gibert, Marta; Scherwitzl, Raoul; Huang, Yaobo; Strocov, Vladimir N.; Zubko, Pavlo; Balandeh, Shadi; Triscone, Jean-Marc; Sawatzky, George; Schmitt, Thorsten

    2016-01-01

    The metal–insulator transition and the intriguing physical properties of rare-earth perovskite nickelates have attracted considerable attention in recent years. Nonetheless, a complete understanding of these materials remains elusive. Here we combine X-ray absorption and resonant inelastic X-ray scattering (RIXS) spectroscopies to resolve important aspects of the complex electronic structure of rare-earth nickelates, taking NdNiO3 thin film as representative example. The unusual coexistence of bound and continuum excitations observed in the RIXS spectra provides strong evidence for abundant oxygen holes in the ground state of these materials. Using cluster calculations and Anderson impurity model interpretation, we show that distinct spectral signatures arise from a Ni 3d8 configuration along with holes in the oxygen 2p valence band, confirming suggestions that these materials do not obey a conventional positive charge-transfer picture, but instead exhibit a negative charge-transfer energy in line with recent models interpreting the metal–insulator transition in terms of bond disproportionation. PMID:27725665

  3. Ground-state oxygen holes and the metal-insulator transition in the negative charge-transfer rare-earth nickelates

    NASA Astrophysics Data System (ADS)

    Bisogni, Valentina; Catalano, Sara; Green, Robert J.; Gibert, Marta; Scherwitzl, Raoul; Huang, Yaobo; Strocov, Vladimir N.; Zubko, Pavlo; Balandeh, Shadi; Triscone, Jean-Marc; Sawatzky, George; Schmitt, Thorsten

    2016-10-01

    The metal-insulator transition and the intriguing physical properties of rare-earth perovskite nickelates have attracted considerable attention in recent years. Nonetheless, a complete understanding of these materials remains elusive. Here we combine X-ray absorption and resonant inelastic X-ray scattering (RIXS) spectroscopies to resolve important aspects of the complex electronic structure of rare-earth nickelates, taking NdNiO3 thin film as representative example. The unusual coexistence of bound and continuum excitations observed in the RIXS spectra provides strong evidence for abundant oxygen holes in the ground state of these materials. Using cluster calculations and Anderson impurity model interpretation, we show that distinct spectral signatures arise from a Ni 3d8 configuration along with holes in the oxygen 2p valence band, confirming suggestions that these materials do not obey a conventional positive charge-transfer picture, but instead exhibit a negative charge-transfer energy in line with recent models interpreting the metal-insulator transition in terms of bond disproportionation.

  4. Purification and molecular cloning of an inducible gram-negative bacteria-binding protein from the silkworm, Bombyx mori.

    PubMed

    Lee, W J; Lee, J D; Kravchenko, V V; Ulevitch, R J; Brey, P T

    1996-07-23

    A 50-kDa hemolymph protein, having strong affinity to the cell wall of Gram(-) bacteria, was purified from the hemolymph of the silkworm, Bombyx mori. The cDNA encoding this Gram(-) bacteria-binding protein (GNBP) was isolated from an immunized silkworm fat body cDNA library and sequenced. Comparison of the deduced amino acid sequence with known sequences revealed that GNBP contained a region displaying significant homology to the putative catalytic region of a group of bacterial beta-1,3 glucanases and beta-1,3-1,4 glucanases. Silkworm GNBP was also shown to have amino acid sequence similarity to the vertebrate lipopolysaccharide receptor CD14 and was recognized specifically by a polygonal anti-CD14 antibody. Northern blot analysis showed that GNBP was constitutively expressed in fat body, as well as in cuticular epithelial cells of naive silkworms. Intense transcription was, however, rapidly induced following a cuticular or hemoceolien bacterial challenge. An mRNA that hybridized with GNBP cDNA was also found in the l(2)mbn immunocompetent Drosophila cell line. These observations suggest that GNBP is an inducible acute phase protein implicated in the immune response of the silkworm and perhaps other insects.

  5. Role of Charged Residues in the Catalytic Sites of Escherichia coli ATP Synthase

    PubMed Central

    Ahmad, Zulfiqar; Okafor, Florence; Laughlin, Thomas F.

    2011-01-01

    Here we describe the role of charged amino acids at the catalytic sites of Escherichia coli ATP synthase. There are four positively charged and four negatively charged residues in the vicinity of of E. coli ATP synthase catalytic sites. Positive charges are contributed by three arginine and one lysine, while negative charges are contributed by two aspartic acid and two glutamic acid residues. Replacement of arginine with a neutral amino acid has been shown to abrogate phosphate binding, while restoration of phosphate binding has been accomplished by insertion of arginine at the same or a nearby location. The number and position of positive charges plays a critical role in the proper and efficient binding of phosphate. However, a cluster of many positive charges inhibits phosphate binding. Moreover, the presence of negatively charged residues seems a requisite for the proper orientation and functioning of positively charged residues in the catalytic sites. This implies that electrostatic interactions between amino acids are an important constituent of initial phosphate binding in the catalytic sites. Significant loss of function in growth and ATPase activity assays in mutants generated through charge modulations has demonstrated that precise location and stereochemical interactions are of paramount importance. PMID:22312470

  6. The electrostatic co-assembly in non-stoichiometric aqueous mixtures of copolymers composed of one neutral water-soluble and one polyelectrolyte (either positively or negatively charged) block: a dissipative particle dynamics study.

    PubMed

    Šindelka, Karel; Limpouchová, Zuzana; Lísal, Martin; Procházka, Karel

    2016-06-28

    The electrostatic co-assembly in non-stoichiometric aqueous mixtures of diblock copolymers composed of a neutral water-soluble block and an either positively or negatively charged polyelectrolyte (PE) block has been studied by dissipative particle dynamics (DPD) simulations. The employed DPD variant includes explicit electrostatics and enables the investigation of the role of small ions in the co-assembly. The properties of core-shell associates containing insoluble interpolyelectrolyte complex cores and protective neutral shells were investigated as functions of the ratio of positive-to-negative charges in the system. This ratio was varied by increasing the number of positively charged PE chains of the same length as those of negatively charged chains, and by changing the PE length and charge density. The simulation results show that the associates formed in non-stoichiometric mixtures differ from those formed in stoichiometric mixtures: their association numbers are lower, their cores are charged and a fraction of excess chains remain free in the non-associated state. The study demonstrates the important role of the compatibility of the counterions with the polymer blocks. It simultaneously emphasizes the necessity of including the electrostatic interaction of all the charged species in the DPD computational scheme. PMID:27253089

  7. Manipulation of structural and optical properties in charge-separating ZnTe/ZnSe chalcogenide core/shell semiconductor nanocrystals: Atomistic tight-binding theory

    NASA Astrophysics Data System (ADS)

    Sukkabot, Worasak

    2015-11-01

    The atomistic tight-binding theory (TB) is utilized to study the electronic structures and optical properties of type-II ZnTe/ZnSe chalcogenide core/shell nanocrystals. The purpose of the present study is to theoretically understand the atomistic impact of the ZnSe growth shell on the single-particle spectra, charge densities, optical band gaps, electron-hole overlaps and oscillation strengths. The sensitivity of ZnSe growth shell thickness in analyzing the electronic structures and optical properties of ZnTe/ZnSe core/shell nanocrystals reflects the charge separation of type-II band alignment. The comprehensive calculations of ZnTe/ZnSe core/shell nanocrystals are effectively manipulated by including and changing the ZnSe growth shell thickness. As a comparison, the atomistic tight-binding calculations demonstrate a reasonable agreement with effective mass approximation and experiment. Finally, the computations successfully discover the important factors of the growth shell on the natural behaviors of type-II ZnTe/ZnSe core/shell nanocrystals which affords a guideline to be implemented to the novel electronic cadmium-free nanodevices and the environmentally friendly applications.

  8. Excitation energy transfer and charge separation are affected in Arabidopsis thaliana mutants lacking light-harvesting chlorophyll a/b binding protein Lhcb3.

    PubMed

    Adamiec, Małgorzata; Gibasiewicz, Krzysztof; Luciński, Robert; Giera, Wojciech; Chełminiak, Przemysław; Szewczyk, Sebastian; Sipińska, Weronika; van Grondelle, Rienk; Jackowski, Grzegorz

    2015-12-01

    The composition of LHCII trimers as well as excitation energy transfer and charge separation in grana cores of Arabidopsis thaliana mutant lacking chlorophyll a/b binding protein Lhcb3 have been investigated and compared to those in wild-type plants. In grana cores of lhcb3 plants we observed increased amounts of Lhcb1 and Lhcb2 apoproteins per PSII core. The additional copies of Lhcb1 and Lhcb2 are expected to substitute for Lhcb3 in LHCII trimers M as well as in the LHCII "extra" pool, which was found to be modestly enlarged as a result of the absence of Lhcb3. Time-resolved fluorescence measurements reveal a deceleration of the fast phase of excitation dynamics in grana cores of the mutant by ~15 ps, whereas the average fluorescence lifetime is not significantly altered. Monte Carlo modeling predicts a slowing down of the mean hopping time and an increased stabilization of the primary charge separation in the mutant. Thus our data imply that absence of apoprotein Lhcb3 results in detectable differences in excitation energy transfer and charge separation.

  9. Interplay between excited-state intramolecular proton transfer and charge transfer in flavonols and their use as protein-binding-site fluorescence probes

    SciTech Connect

    Sytnik, A.; Gormin, D.; Kasha, M. )

    1994-12-06

    A comparative study is presented of competitive fluorescences of three flavonols, 3-hydroxyflavone, 3,3[prime],4[prime],7-tetrahydroxyflavone (fisetin), and 4[prime]-diethylamino-3-hydroxyflavone (DHF). The normal fluorescence S[sub 1] [yields] S[sub 0] (400-nm region) is largely replaced by the proton-transfer tautomer fluorescence S[prime][sub 1] [yields] S[prime][sub 0] in the 550-nm region for all three of the flavonols in aprotic solvents at room temperature. For DHF in polar solvents the normal fluorescence becomes a charge-transfer fluorescence (460-500 nm) which competes strongly with the still dominant proton-transfer fluorescence (at 570 nm). In protic solvents, and at 77 K, the interference with intramolecular hydrogen bonding gives rise to greatly enhanced normal fluorescence, lowering the quantum yield of proton-transfer fluorescence. The utility of DHF as a discriminating fluorescence probe for protein binding sites is suggested by the strong dependence of the charge-transfer fluorescence on polarity of the environment and by various static and dynamic parameters of the charge-transfer and proton-transfer fluorescence which can be determined. 49 refs., 6 figs., 1 tab.

  10. Weakly Charged Cationic Nanoparticles Induce DNA Bending and Strand Separation

    SciTech Connect

    Railsback, Justin; Singh, Abhishek; Pearce, Ryan; McKnight, Timothy E; Collazo, Ramon; Sitar, Zlatko; Yingling, Yaroslava; Melechko, Anatoli Vasilievich

    2012-01-01

    The understanding of interactions between double stranded (ds) DNA and charged nanoparticles will have a broad bearing on many important applications from drug delivery [ 1 4 ] to DNAtemplated metallization. [ 5 , 6 ] Cationic nanoparticles (NPs) can bind to DNA, a negatively charged molecule, through a combination of electrostatic attraction, groove binding, and intercalation. Such binding events induce changes in the conformation of a DNA strand. In nature, DNA wraps around a cylindrical protein assembly (diameter and height of 6 nm) [ 7 ] with an 220 positive charge, [ 8 ] creating the complex known as chromatin. Wrapping and bending of DNA has also been achieved in the laboratory through the binding of highly charged species such as molecular assemblies, [ 9 , 10 ] cationic dendrimers, [ 11 , 12 ] and nanoparticles. [ 13 15 ] The charge of a nanoparticle plays a crucial role in its ability to induce DNA structural changes. If a nanoparticle has a highly positive surface charge density, the DNA is likely to wrap and bend upon binding to the nanoparticle [ 13 ] (as in the case of chromatin). On the other hand, if a nanoparticle is weakly charged it will not induce dsDNA compaction. [ 9 , 10 , 15 ] Consequently, there is a transition zone from extended to compact DNA conformations which depends on the chemical nature of the nanoparticle and occurs for polycations with charges between 5 and 10. [ 9 ] While the interactions between highly charged NPs and DNA have been extensively studied, the processes that occur within the transition zone are less explored.

  11. Conserved Negative Charges in the N-terminal Tetramerization Domain Mediate Efficient Assembly of Kv2.1 and Kv2.1/Kv6.4 Channels*

    PubMed Central

    Bocksteins, Elke; Labro, Alain J.; Mayeur, Evy; Bruyns, Tine; Timmermans, Jean-Pierre; Adriaensen, Dirk; Snyders, Dirk J.

    2009-01-01

    Voltage-gated potassium (Kv) channels are transmembrane tetramers of individual α-subunits. Eight different Shaker-related Kv subfamilies have been identified in which the tetramerization domain T1, located on the intracellular N terminus, facilitates and controls the assembly of both homo- and heterotetrameric channels. Only the Kv2 α-subunits are able to form heterotetramers with members of the silent Kv subfamilies (Kv5, Kv6, Kv8, and Kv9). The T1 domain contains two subdomains, A and B box, which presumably determine subfamily specificity by preventing incompatible subunits to assemble. In contrast, little is known about the involvement of the A/B linker sequence. Both Kv2 and silent Kv subfamilies contain a fully conserved and negatively charged sequence (CDD) in this linker that is lacking in the other subfamilies. Neutralizing these aspartates in Kv2.1 by mutating them to alanines did not affect the gating properties, but reduced the current density moderately. However, charge reversal arginine substitutions strongly reduced the current density of these homotetrameric mutant Kv2.1 channels and immunocytochemistry confirmed the reduced expression at the plasma membrane. Förster resonance energy transfer measurements using confocal microscopy showed that the latter was not due to impaired trafficking, but to a failure to assemble the tetramer. This was further confirmed with co-immunoprecipitation experiments. The corresponding arginine substitution in Kv6.4 prevented its heterotetrameric interaction with Kv2.1. These results indicate that these aspartates (especially the first one) in the A/B box linker of the T1 domain are required for efficient assembly of both homotetrameric Kv2.1 and heterotetrameric Kv2.1/silent Kv6.4 channels. PMID:19717558

  12. External and Internal Guest Binding of a Highly Charged Supramolecular Host in Water: Deconvoluting the Very Different Thermodynamics

    SciTech Connect

    Sgarlata, Carmelo; Mugridge, Jeffrey; Pluth, Michael; Tiedemann,, Bryan; Zito, Valeria; Arena, Giuseppe; Raymond, Kenneth N.

    2009-07-22

    NMR, UV-vis and isothermal titration calorimetry (ITC) measurements probe different aspects of competing host-guest equilibria as simple alkylammonium guest molecules interact with both the exterior (ion-association) and interior (encapsulation) of the [Ga{sub 4}L{sub 6}]{sup 12-} supramolecular assembly in water. Data obtained by each independent technique measure different components of the host-guest equilibria and only when analyzed together does a complete picture of the solution thermodynamics emerge. Striking differences between the internal and external guest binding are found. External binding is enthalpy driven and mainly due to attractive interactions between the guests and the exterior surface of the assembly while encapsulation is entropy driven as a result of desolvation and release of solvent molecules from the host cavity.

  13. Leader peptides of inducible chloramphenicol resistance genes from gram-positive and gram-negative bacteria bind to yeast and Archaea large subunit rRNA.

    PubMed Central

    Harrod, R; Lovett, P S

    1997-01-01

    catA86 is the second gene in a constitutively transcribed, two-gene operon cloned from Bacillus pumilus . The region that intervenes between the upstream gene, termed the leader, and the catA86 coding sequence contains a pair of inverted repeat sequences which cause sequestration of the catA86 ribosome binding site in mRNA secondary structure. As a consequence, the catA86 coding sequence is untranslatable in the absence of inducer. Translation of the catA86 coding sequence is induced by chloramphenicol in Gram-positives and induction requires a function of the leader coding sequence. The leader-encoded peptide has been proposed to instruct its translating ribosome to pause at leader codon 6, enabling chloramphenicol to stall the ribosome at that site. Ribosome stalling causes destabilization of the RNA secondary structure, exposing the catA86 ribosome binding site, allowing activation of its translation. A comparable mechanism of induction by chloramphenicol has been proposed for the regulated cmlA gene from Gram-negative bacteria. The catA86 and cmlA leader-encoded peptides are in vitro inhibitors of peptidyl transferase, which is thought to be the basis for selection of the site of ribosome stalling. Both leader-encoded peptides have been shown to alter the secondary structure of Escherichia coli 23S rRNA in vitro. All peptide-induced changes in rRNA conformation are within domains IV and V, which contains the peptidyl transferase center. Here we demonstrate that the leader peptides alter the conformation of domains IV and V of large subunit rRNA from yeast and a representative of the Archaea. The rRNA target for binding the leader peptides is therefore conserved across kingdoms. PMID:9108153

  14. Identification of the Zinc Finger Protein ZRANB2 as a Novel Maternal Lipopolysaccharide-binding Protein That Protects Embryos of Zebrafish against Gram-negative Bacterial Infections.

    PubMed

    Wang, Xia; Du, Xiaoyuan; Li, Hongyan; Zhang, Shicui

    2016-02-19

    Zinc finger ZRANB2 proteins are widespread in animals, but their functions and mechanisms remain poorly defined. Here we clearly demonstrate that ZRANB2 is a newly identified LPS-binding protein present abundantly in the eggs/embryos of zebrafish. We also show that recombinant ZRANB2 (rZRANB2) acts as a pattern recognition receptor capable of identifying the bacterial signature molecule LPS as well as binding the Gram-negative bacteria Escherichia coli, Vibrio anguilarum, and Aeromonas hydrophila and functions as an antibacterial effector molecule capable of directly killing the bacteria. Furthermore, we reveal that N-terminal residues 11-37 consisting of the first ZnF_RBZ domain are indispensable for ZRANB2 antimicrobial activity. Importantly, microinjection of rZRANB2 into early embryos significantly enhanced the resistance of the embryos against pathogenic A. hydrophila challenge, and this enhanced bacterial resistance was markedly reduced by co-injection of anti-ZRANB2 antibody. Moreover, precipitation of ZRANB2 in the embryo extracts by preincubation with anti-ZRANB2 antibody caused a marked decrease in the antibacterial activity of the extracts against the bacteria tested. In addition, the N-terminal peptide Z1/37 or Z11/37 with in vitro antibacterial activity also promoted the resistance of embryos against A. hydrophila, but the peptide Z38/198 without in vitro antibacterial activity did not. Collectively, these results indicate that ZRANB2 is a maternal LPS-binding protein that can protect the early embryos of zebrafish against pathogenic attacks, a novel role ever assigned to ZRANB2 proteins. This work also provides new insights into the immunological function of the zinc finger proteins that are widely distributed in various animals. PMID:26740623

  15. Particularity and universality of a putative Gram-negative bacteria-binding protein (GNBP) gene from amphioxus (Branchiostoma belcheri): insights into the function and evolution of GNBP.

    PubMed

    Jin, Ping; Zhou, Lu; Song, Xiaojun; Qian, Jinjun; Chen, Liming; Ma, Fei

    2012-10-01

    Gram-negative bacteria-binding proteins (GNBPs) are important pattern recognition proteins (PRPs), which can initiate host defense in response to pathogen surface molecules. The roles of GNBP in innate immunity of arthropods and molluscs have recently been reported. However, the GNBP gene has not been characterized in the species of higher evolutionary status yet. In this study, we identified and characterized an amphioxus GNBP gene (designated as AmphiGNBP). First, we identified and cloned the AmphiGNBP and found that the AmphiGNBP encodes a putative protein with 558 amino acids, which contains a conserved β-1, 3-glucan recognizing and binding domain. Second, we found that the AmphiGNBP encodes two extra WSC (cell Wall integrity and Stress response Component) domains, which are unique in AmphiGNBP protein. The two WSC domains of AmphiGNBP protein coupled with the expansion of amphioxus immunity repertoire might undergo intensive domain shuffling during the age of the Cambrian explosion. Finally, we found that the AmphiGNBP was mainly expressed in immune tissues, such as hepatic cecum and intestine, and the expression of AmphiGNBP was affected after LPS stimulation. In conclusion, our findings disclose the particularity and universality of AmphiGNBP and provide profound insights into the function and evolution of GNBP.

  16. Negatively charged Ir(iii) cyclometalated complexes containing a chelating bis-tetrazolato ligand: synthesis, photophysics and the study of reactivity with electrophiles.

    PubMed

    Fiorini, Valentina; Zacchini, Stefano; Raiteri, Paolo; Mazzoni, Rita; Zanotti, Valerio; Massi, Massimiliano; Stagni, Stefano

    2016-08-01

    The bis-tetrazolate dianion [1,2 BTB](2-), which is the deprotonated form of 1,2 bis-(1H-tetrazol-5-yl)benzene [1,2-H2BTB], is for the first time exploited as an ancillary N^N ligand for negatively charged [Ir(C^N)2(N^N)](-)-type complexes, where C^N is represented by cyclometalated 2-phenylpyridine (ppy) or 2-(2,4-difluorophenyl)pyridine (F2ppy). The new Ir(iii) complexes [Ir(ppy)2(1,2 BTB)]- and [Ir(F2ppy)2(1,2 BTB)]- have been fully characterised and the analysis of the X-ray structure of [Ir(ppy)2(1,2 BTB)]- confirmed the coordination of the [1,2 BTB](2-) dianion in a bis chelated fashion through the N-atoms adjacent to each of the tetrazolic carbons. Both of the new anionic Ir(iii) complexes displayed phosphorescence in the visible region, with intense sky-blue (λmax = 460-490 nm) or aqua (λmax = 490-520 nm) emissions originating from [Ir(F2ppy)2(1,2 BTB)]- and [Ir(ppy)2(1,2 BTB)]-, respectively. In comparison with our very recent examples of anionic Ir(iii)tetrazolate cyclometalates, the new Ir(iii) tris chelate complexes [Ir(F2ppy)2(1,2 BTB)]- and [Ir(ppy)2(1,2 BTB)]-, display an improved robustness, allowing the study of their reactivity toward the addition of electrophiles such as H(+) and CH3(+). In all cases, the electrophilic attacks occurred at the coordinated tetrazolate rings, involving the reversible - by a protonation deprotonation mechanism - or permanent - upon addition of a methyl moiety - switching of their global net charge from negative to positive and, in particular, the concomitant variation of their photoluminescence output. The combination of the anionic complexes [Ir(F2ppy)2(1,2 BTB)]- or [Ir(ppy)2(1,2 BTB)]- with a deep red emitting (λmax = 686 nm) cationic Ir(iii) tetrazole complex such as [IrTPYZ-Me]+, where TPYZ-Me is 2-(2-methyl-2H-tetrazol-5-yl)pyrazine, gave rise to two fully Ir(iii)-based soft salts capable of displaying additive and O2-sensitive emission colours, with an almost pure white light obtained by the appropriate

  17. Extraction of negative charges from an ion source: Transition from an electron repelling to an electron attracting plasma close to the extraction surface

    NASA Astrophysics Data System (ADS)

    Wimmer, Christian; Fantz, Ursel

    2016-08-01

    Large-scale sources for negative hydrogen ions, capable of delivering an extracted ion current of several ten amperes, are a key component of the neutral beam injection system of the upcoming ITER fusion device. Since the created heat load of the inevitably co-extracted electrons after magnetic separation from the extracted beam limits their tolerable amount, special care must be taken for the reduction of co-extracted electrons—in particular, in deuterium operation, where the larger amount of co-extracted electrons often limits the source performance. By biasing the plasma grid (PG, first grid of the extraction system) positively with respect to the source body, the plasma sheath in front of the PG can be changed from an electron repelling towards an electron attracting sheath. In this way, the flux of charged particles onto the PG can be varied, thus changing the bias current and inverse to it the amount of co-extracted electrons. The PG bias affects also the flux of surface-produced H - towards the plasma volume as well as the plasma symmetry in front of the plasma grid, strongly influenced by an E → × B → drift. The influence of varying PG sheath potential profile on the plasma drift, the negative hydrogen ion density, and the source performance at the prototype H - source is presented, comparing hydrogen and deuterium operation. The transition in the PG sheath profile takes place in both isotopes, with a minimum of co-extracted electrons formed in case of the electron attracting PG sheath. The co-extracted electron density in deuterium operation is higher than in hydrogen operation, which is accompanied by an increased plasma density in deuterium.

  18. The Effect of Lipopolysaccharide Core Oligosaccharide Size on the Electrostatic Binding of Antimicrobial Proteins to Models of the Gram Negative Bacterial Outer Membrane.

    PubMed

    Clifton, Luke A; Ciesielski, Filip; Skoda, Maximilian W A; Paracini, Nicolò; Holt, Stephen A; Lakey, Jeremy H

    2016-04-12

    Understanding the electrostatic interactions between bacterial membranes and exogenous proteins is crucial to designing effective antimicrobial agents against Gram-negative bacteria. Here we study, using neutron reflecometry under multiple isotopic contrast conditions, the role of the uncharged sugar groups in the outer core region of lipopolysaccharide (LPS) in protecting the phosphate-rich inner core region from electrostatic interactions with antimicrobial proteins. Models of the asymmetric Gram negative outer membrane on silicon were prepared with phopshatidylcholine (PC) in the inner leaflet (closest to the silicon), whereas rough LPS was used to form the outer leaflet (facing the bulk solution). We show how salt concentration can be used to reversibly alter the binding affinity of a protein antibiotic colicin N (ColN) to the anionic LPS confirming that the interaction is electrostatic in nature. By examining the interaction of ColN with two rough LPS types with different-sized core oligosaccharide regions we demonstrate the role of uncharged sugars in blocking short-range electrostatic interactions between the cationic antibiotics and the vulnerable anionic phosphate groups. PMID:27003358

  19. The Effect of Lipopolysaccharide Core Oligosaccharide Size on the Electrostatic Binding of Antimicrobial Proteins to Models of the Gram Negative Bacterial Outer Membrane

    PubMed Central

    2016-01-01

    Understanding the electrostatic interactions between bacterial membranes and exogenous proteins is crucial to designing effective antimicrobial agents against Gram-negative bacteria. Here we study, using neutron reflecometry under multiple isotopic contrast conditions, the role of the uncharged sugar groups in the outer core region of lipopolysaccharide (LPS) in protecting the phosphate-rich inner core region from electrostatic interactions with antimicrobial proteins. Models of the asymmetric Gram negative outer membrane on silicon were prepared with phopshatidylcholine (PC) in the inner leaflet (closest to the silicon), whereas rough LPS was used to form the outer leaflet (facing the bulk solution). We show how salt concentration can be used to reversibly alter the binding affinity of a protein antibiotic colicin N (ColN) to the anionic LPS confirming that the interaction is electrostatic in nature. By examining the interaction of ColN with two rough LPS types with different-sized core oligosaccharide regions we demonstrate the role of uncharged sugars in blocking short-range electrostatic interactions between the cationic antibiotics and the vulnerable anionic phosphate groups. PMID:27003358

  20. A novel phagocytic receptor (CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and gram-negative bacteria binding activity.

    PubMed

    Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng

    2015-03-01

    Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in

  1. Ligation of retinoic acid receptor alpha regulates negative selection of thymocytes by inhibiting both DNA binding of nur77 and synthesis of bim.

    PubMed

    Szegezdi, Eva; Kiss, Ildikó; Simon, Agnes; Blaskó, Bernadett; Reichert, Uwe; Michel, Serge; Sándor, Mátyás; Fésüs, László; Szondy, Zsuzsa

    2003-04-01

    Negative selection refers to the selective deletion of autoreactive thymocytes. Its molecular mechanisms have not been well defined. Previous studies in our laboratory have demonstrated that retinoic acids, physiological ligands for the nuclear retinoid receptors, selectively inhibit TCR-mediated death under in vitro conditions, and the inhibition is mediated via the retinoic acid receptor (RAR) alpha. The present studies were undertaken to investigate whether ligation of RARalpha leads to inhibition of TCR-mediated death in vivo and to identify the molecular mechanisms involved. Three models of TCR-mediated death were studied: anti-CD3-mediated death of thymocytes in wild-type mice, and Ag- and bacterial superantigen-driven thymocyte death in TCR-transgenic mice expressing a receptor specific for a fragment of pigeon cytochrome c in the context of the E(k) (class II MHC) molecule. Our data demonstrate that the molecular program of both anti-CD3- and Ag-driven, but not that of superantigen-mediated apoptosis involves up-regulation of nur77, an orphan nuclear receptor, and bim, a BH3-only member of the proapoptotic bcl-2 protein family, proteins previously implicated to participate in the negative selection. Ligation of RARalpha by the synthetic agonist CD336 inhibited apoptosis, DNA binding of nur77, and synthesis of bim induced by anti-CD3 or the specific Ag, but had no effect on the superantigen-driven cell death. Our data imply that retinoids are able to inhibit negative selection in vivo as well, and they interfere with multiple steps of the T cell selection signal pathway.

  2. Interactions and Diffusion in Fine-Stranded β-lactoglobulin Gels Determined via FRAP and Binding

    PubMed Central

    Schuster, Erich; Hermansson, Anne-Marie; Öhgren, Camilla; Rudemo, Mats; Lorén, Niklas

    2014-01-01

    The effects of electrostatic interactions and obstruction by the microstructure on probe diffusion were determined in positively charged hydrogels. Probe diffusion in fine-stranded gels and solutions of β-lactoglobulin at pH 3.5 was determined using fluorescence recovery after photobleaching (FRAP) and binding, which is widely used in biophysics. The microstructures of the β-lactoglobulin gels were characterized using transmission electron microscopy. The effects of probe size and charge (negatively charged Na2-fluorescein (376Da) and weakly anionic 70kDa FITC-dextran), probe concentration (50 to 200 ppm), and β-lactoglobulin concentration (9% to 12% w/w) on the diffusion properties and the electrostatic interaction between the negatively charged probes and the positively charged gels or solutions were evaluated. The results show that the diffusion of negatively charged Na2-fluorescein is strongly influenced by electrostatic interactions in the positively charged β-lactoglobulin systems. A linear relationship between the pseudo-on binding rate constant and the β-lactoglobulin concentration for three different probe concentrations was found. This validates an important assumption of existing biophysical FRAP and binding models, namely that the pseudo-on binding rate constant equals the product of the molecular binding rate constant and the concentration of the free binding sites. Indicators were established to clarify whether FRAP data should be analyzed using a binding-diffusion model or an obstruction-diffusion model. PMID:24411257

  3. Interactions and diffusion in fine-stranded β-lactoglobulin gels determined via FRAP and binding.

    PubMed

    Schuster, Erich; Hermansson, Anne-Marie; Ohgren, Camilla; Rudemo, Mats; Lorén, Niklas

    2014-01-01

    The effects of electrostatic interactions and obstruction by the microstructure on probe diffusion were determined in positively charged hydrogels. Probe diffusion in fine-stranded gels and solutions of β-lactoglobulin at pH 3.5 was determined using fluorescence recovery after photobleaching (FRAP) and binding, which is widely used in biophysics. The microstructures of the β-lactoglobulin gels were characterized using transmission electron microscopy. The effects of probe size and charge (negatively charged Na2-fluorescein (376Da) and weakly anionic 70kDa FITC-dextran), probe concentration (50 to 200 ppm), and β-lactoglobulin concentration (9% to 12% w/w) on the diffusion properties and the electrostatic interaction between the negatively charged probes and the positively charged gels or solutions were evaluated. The results show that the diffusion of negatively charged Na2-fluorescein is strongly influenced by electrostatic interactions in the positively charged β-lactoglobulin systems. A linear relationship between the pseudo-on binding rate constant and the β-lactoglobulin concentration for three different probe concentrations was found. This validates an important assumption of existing biophysical FRAP and binding models, namely that the pseudo-on binding rate constant equals the product of the molecular binding rate constant and the concentration of the free binding sites. Indicators were established to clarify whether FRAP data should be analyzed using a binding-diffusion model or an obstruction-diffusion model.

  4. Crossing behavior of the singlet and triplet State of the negatively charged magneto-exciton in a GaAs/AlGaAs quantum well

    SciTech Connect

    MUNTEANU,F.M.; KIM,YONGMIN; PERRY,C.H.; RICKEL,D.G.; SIMMONS,JERRY A.; RENO,JOHN L.

    2000-01-27

    Polarized magneto-photoluminescence (MPL) measurements on a high mobility {delta}-doped GaAs/AlGaAs single quantum well from 0--60 T at temperatures between 0.37--2.1 K are reported. In addition to the neutral heavy hole magneto-exciton (X{sup 0}), the singlet (X {sub s}{sup {minus}}) and triplet (X {sub t}{sup {minus}}) states of the negatively charged magneto-exciton are observed in both polarizations. The energy dispersive and time-resolved MPL data suggest that their development is fundamentally related to the formation of the neutral magneto-exciton. At a magnetic field of 40 T the singlet and the triplet states cross as a result of the role played by the higher Landau levels and higher energy subbands in their energetic evolution, confirming theoretical predictions. The authors also observed the formation of two higher energy peaks. One of them is completely right circularly polarized and its appearance can be considered a result of the electron-hole exchange interaction enhancement with an associated electron g-factor of 3.7 times the bulk value. The other peak completely dominates the MPL spectrum at fields around 30 T. Its behavior with magnetic field and temperature indicates that it may be related to previous anomalies observed in the integer and fractional quantum Hall regimes.

  5. Disinfection of Escherichia coli Gram negative bacteria using surface modified TiO2: optimization of Ag metallization and depiction of charge transfer mechanism.

    PubMed

    Gomathi Devi, LakshmipathiNaik; Nagaraj, Basavalingaiah

    2014-01-01

    The antibacterial activity of silver deposited TiO2 (Ag-TiO2 ) against Gram negative Escherichia coli bacteria was investigated by varying the Ag metal content from 0.10 to 0.50% on the surface of TiO2 . Ag depositions by the photoreduction method were found to be stable. Surface silver metallization was confirmed by EDAX and XPS studies. Photoluminescence studies show that the charge carrier recombination is less for 0.1% Ag-TiO2 and this catalyst shows superior bactericidal activity under solar light irradiation compared to Sol gel TiO2 (SG-TiO2 ) due to the surface plasmon effect. The energy levels of deposited Ag are dependent on the Ag content and it varies from -4.64 eV to -1.30 eV with respect to the vacuum energy level based on atomic silver to bulk silver deposits. The ability of electron transfer from Ag deposit to O2 depends on the position of the energy levels. The 0.25% and 0.50% Ag depositions showed detrimental effect on bactericidal activity due to the mismatch of energy levels. The effect of the EROS (External generation of the Reactive Oxygen Species by 0.1% Ag-TiO2 ) and IROS (Interior generation of Reactive Oxygen Species within the bacteria) on the bactericidal inactivation is discussed in detail. PMID:24995499

  6. Recovery rate of multiple enteric viruses artificially seeded in water and concentrated by adsorption-elution with negatively charged membranes: interaction and interference between different virus species.

    PubMed

    Vecchia, Andréia Dalla; Rigotto, Caroline; Soliman, Mayra Cristina; Souza, Fernanda Gil de; Giehl, Isabel Cristina; Spilki, Fernando Rosado

    2015-01-01

    Viral concentration method by adsorption-elution with negative membranes has been widely employed for concentrating viruses from environmental samples. In order to provide an adequate assessment of its recovery efficiency, this study was conducted to assess viral recovery rates for viral species commonly found in water (HAdV-5, EV, RV, BAdV and CAV-2), quantifying viral genomes at the end of the five different steps of the process. Recovery rates were analyzed for several viruses combined in a single water sample and for each virus assayed separately. Ultrapure water samples were artificially contaminated and analyzed by real-time quantitative polymerase chain reaction (qPCR). High recovery rates were found after the final stage when assessed individually (89 to 125%) and combined in the same sample (23 to > 164%). HAdV-5 exhibited >100% recovery when assayed with human viruses and other AdVs, whereas BAdV and CAV-2 were not detected. These data suggest that recovery efficiency could be related to viral structural characteristics, their electric charges and other interactions, so that they are retained with greater or lesser efficiency when coupled. This protocol could be applied to environmental samples, since high recovery rates were observed and infectious viruses were detected at the end of the concentration process. PMID:26676018

  7. Measurement of negatively charged pion spectra in inelastic p+p interactions at 20, 31, 40, 80 and 158 GeV/c

    NASA Astrophysics Data System (ADS)

    Abgrall, N.; Aduszkiewicz, A.; Ali, Y.; Anticic, T.; Antoniou, N.; Baatar, B.; Bay, F.; Blondel, A.; Blumer, J.; Bogomilov, M.; Bravar, A.; Brzychczyk, J.; Bunyatov, S. A.; Busygina, O.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Debieux, S.; Dembinski, H.; Diakonos, F.; Luise, S. Di; Dominik, W.; Drozhzhova, T.; Dumarchez, J.; Dynowski, K.; Engel, R.; Ereditato, A.; Feofilov, G. A.; Fodor, Z.; Fulop, A.; Gaździcki, M.; Golubeva, M.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Haesler, A.; Hasegawa, T.; Hierholzer, M.; Idczak, R.; Igolkin, S.; Ivashkin, A.; Joković, D.; Kadija, K.; Kapoyannis, A.; Kaptur, E.; Kiełczewska, D.; Kirejczyk, M.; Kisiel, J.; Kiss, T.; Kleinfelder, S.; Kobayashi, T.; Kolesnikov, V. I.; Kolev, D.; Kondratiev, V. P.; Korzenev, A.; Kovesarki, P.; Kowalski, S.; Krasnoperov, A.; Kurepin, A.; Larsen, D.; László, A.; Lyubushkin, V. V.; Maćkowiak-Pawłowska, M.; Majka, Z.; Maksiak, B.; Malakhov, A. I.; Manić, D.; Marcinek, A.; Marin, V.; Marton, K.; Mathes, H.-J.; Matulewicz, T.; Matveev, V.; Melkumov, G. L.; Mrówczyński, St.; Murphy, S.; Nakadaira, T.; Nirkko, M.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A. D.; Paul, T.; Pistillo, C.; Peryt, W.; Petukhov, O.; Płaneta, R.; Pluta, J.; Popov, B. A.; Posiadała, M.; Puławski, S.; Puzović, J.; Rauch, W.; Ravonel, M.; Redij, A.; Renfordt, R.; Robert, A.; Röhrich, D.; Rondio, E.; Roth, M.; Rubbia, A.; Rustamov, A.; Rybczyński, M.; Sadovsky, A.; Sakashita, K.; Savić, M.; Schmidt, K.; Sekiguchi, T.; Seyboth, P.; Sgalaberna, D.; Shibata, M.; Sipos, R.; Skrzypczak, E.; Słodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Ströbele, H.; Šuša, T.; Szuba, M.; Tada, M.; Tereshchenko, V.; Tolyhi, T.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberič, D.; Vechernin, V. V.; Vesztergombi, G.; Vinogradov, L.; Wilczek, A.; Włodarczyk, Z.; Wojtaszek-Szwarc, A.; Wyszyński, O.; Zambelli, L.; Zipper, W.

    2014-03-01

    We present experimental results on inclusive spectra and mean multiplicities of negatively charged pions produced in inelastic p+p interactions at incident projectile momenta of 20, 31, 40, 80 and 158 GeV/ c ( 6.3, 7.7, 8.8, 12.3 and 17.3 GeV, respectively). The measurements were performed using the large acceptance NA61/SHINE hadron spectrometer at the CERN super proton synchrotron. Two-dimensional spectra are determined in terms of rapidity and transverse momentum. Their properties such as the width of rapidity distributions and the inverse slope parameter of transverse mass spectra are extracted and their collision energy dependences are presented. The results on inelastic p+p interactions are compared with the corresponding data on central Pb+Pb collisions measured by the NA49 experiment at the CERN SPS. The results presented in this paper are part of the NA61/SHINE ion program devoted to the study of the properties of the onset of deconfinement and search for the critical point of strongly interacting matter. They are required for interpretation of results on nucleus-nucleus and proton-nucleus collisions.

  8. Ewald summation on a helix: A route to self-consistent charge density-functional based tight-binding objective molecular dynamics.

    PubMed

    Nikiforov, I; Hourahine, B; Aradi, B; Frauenheim, Th; Dumitrică, T

    2013-09-01

    We explore the generalization to the helical case of the classical Ewald method, the harbinger of all modern self-consistent treatments of waves in crystals, including ab initio electronic structure methods. Ewald-like formulas that do not rely on a unit cell with translational symmetry prove to be numerically tractable and able to provide the crucial component needed for coupling objective molecular dynamics with the self-consistent charge density-functional based tight-binding treatment of the inter-atomic interactions. The robustness of the method in addressing complex hetero-nuclear nano- and bio-systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal DNA molecule.

  9. Dopamine uptake and cocaine binding mechanisms: the involvement of charged amino acids from the transmembrane domains of the human dopamine transporter.

    PubMed

    Dar, Dalit E; Metzger, Thomas G; Vandenbergh, David J; Uhl, George R

    2006-05-24

    The wild type human dopamine transporter (DAT) and five DAT mutants were transfected into COS-7 cells and their ability to uptake dopamine or to bind cocaine was examine three days later. In each mutant, a single charged amino acid, located in areas that initial hydrophobic analysis had indicated were DAT transmembrane domains was substituted by alanine. Mutants used in this study were lysines 257 and 525 (termed K257A and K525A), arginines 283 and 521 (termed R283A and R521A), and glutamate 491 (termed E491A). Dopamine affinity was significantly enhanced in the K257A and R283A mutants, and the IC(50) for displacement of the radioactive cocaine analog 2 beta-carbomethoxy-3 beta-(4-fluorophenyl)tropane (CFT) by cocaine was significantly elevated in the E491A mutant. All mutants displayed a reduction or complete loss of the maximal velocity (V(m)) of dopamine transport. PMID:16674939

  10. Conserved charged residues in the leucine-rich repeat domain of the Ran GTPase activating protein are required for Ran binding and GTPase activation.

    PubMed Central

    Haberland, J; Gerke, V

    1999-01-01

    GTPase activating proteins (GAPs) for Ran, a Ras-related GTPase participating in nucleocytoplasmic transport, have been identified in different species ranging from yeast to man. All RanGAPs are characterized by a conserved domain consisting of eight leucine-rich repeats (LRRs) interrupted at two positions by so-called separating regions, the latter being unique for RanGAPs within the family of LRR proteins. The cytosolic RanGAP activity is essential for the Ran GTPase cycle which in turn provides directionality in nucleocytoplasmic transport, but the structural basis for the interaction between Ran and its GAP has not been elucidated. In order to gain a better understanding of this interaction we generated a number of mutant RanGAPs carrying amino acid substitutions in the LRR domain and analysed their complex formation with Ran as well as their ability to stimulate the intrinsic GTPase activity of the G protein. We show that conserved charged residues present in the separating regions of the LRR domain are indispensable for efficient Ran binding and GAP activity. These separating regions contain three conserved arginines which could possibly serve as catalytic residues similar to the arginine fingers identified in GAPs for other small GTPases. However, mutations in two of these arginines do not affect the GAP activity and replacement of the third conserved arginine (Arg91 in human RanGAP) severely interferes not only with GAP activity but also with Ran binding. This indicates that RanGAP-stimulated GTP hydrolysis on Ran does not involve a catalytic arginine residue but requires certain charged residues of the LRR domain of the GAP for mediating the protein-protein interaction. PMID:10527945

  11. Carbohydrate-Responsive Element-Binding Protein (ChREBP) Is a Negative Regulator of ARNT/HIF-1β Gene Expression in Pancreatic Islet β-Cells

    PubMed Central

    Noordeen, Nafeesa A.; Khera, Tarnjit K.; Sun, Gao; Longbottom, E. Rebecca; Pullen, Timothy J.; da Silva Xavier, Gabriela; Rutter, Guy A.; Leclerc, Isabelle

    2010-01-01

    OBJECTIVE Carbohydrate-responsive element-binding protein (ChREBP) is a transcription factor that has been shown to regulate carbohydrate metabolism in the liver and pancreatic β-cells in response to elevated glucose concentrations. Because few genes have been identified so far as bona fide ChREBP-target genes, we have performed a genome-wide analysis of the ChREBP transcriptome in pancreatic β-cells. RESEARCH DESIGN AND METHODS Chromatin immunoprecipitation and high-density oligonucleotide tiling arrays (ChIP-chip; Agilent Technologies) using MIN6 pancreatic β-cell extracts were performed together with transcriptional and other analysis using standard techniques. RESULTS One of the genes identified by ChIP-chip and linked to glucose sensing and insulin secretion was aryl hydrocarbon receptor nuclear translocator (ARNT)/hypoxia-inducible factor-1β (HIF-1β), a transcription factor implicated in altered gene expression and pancreatic-islet dysfunction in type 2 diabetes. We first confirmed that elevated glucose concentrations decreased ARNT/HIF-1β levels in INS-1 (832/13) cells and primary mouse islets. Demonstrating a role for ChREBP in ARNT gene regulation, ChREBP silencing increased ARNT mRNA levels in INS-1 (832/13) cells, and ChREBP overexpression decreased ARNT mRNA in INS-1 (832/13) cells and primary mouse islets. We demonstrated that ChREBP and Max-like protein X (MLX) bind on the ARNT/HIF-1β promoter on the proximal region that also confers the negative glucose responsiveness. CONCLUSIONS These results demonstrate that ChREBP acts as a novel repressor of the ARNT/HIF-1β gene and might contribute to β-cell dysfunction induced by glucotoxicity. PMID:19833882

  12. Mutational analysis of the complement receptor type 2 (CR2/CD21)-C3d interaction reveals a putative charged SCR1 binding site for C3d.

    PubMed

    Hannan, Jonathan P; Young, Kendra A; Guthridge, Joel M; Asokan, Rengasamy; Szakonyi, Gerda; Chen, Xiaojiang S; Holers, V Michael

    2005-02-25

    We have characterized the interaction between the first two short consensus repeats (SCR1-2) of complement receptor type 2 (CR2, CD21) and C3d in solution, by utilising the available crystal structures of free and C3d-bound forms of CR2 to create a series of informative mutations targeting specific areas of the CR2-C3d complex. Wild-type and mutant forms of CR2 were expressed on the surface of K562 erythroleukemia cells and their binding ability assessed using C3dg-biotin tetramers complexed to fluorochrome conjugated streptavidin and measured by flow cytometry. Mutations directed at the SCR2-C3d interface (R83A, R83E, G84Y) were found to strongly disrupt C3dg binding, supporting the conclusion that the SCR2 interface reflected in the crystal structure is correct. Previous epitope and peptide mapping studies have also indicated that the PILN11GR13IS sequence of the first inter-cysteine region of SCR1 is essential for the binding of iC3b. Mutations targeting residues within or in close spatial proximity to this area (N11A, N11E, R13A, R13E, Y16A, S32A, S32E), and a number of other positively charged residues located primarily on a contiguous face of SCR1 (R28A, R28E, R36A, R36E, K41A, K41E, K50A, K50E, K57A, K57E, K67A, K67E), have allowed us to reassess those regions on SCR1 that are essential for CR2-C3d binding. The nature of this interaction and the possibility of a direct SCR1-C3d association are discussed extensively. Finally, a D52N mutant was constructed introducing an N-glycosylation sequence at an area central to the CR2 dimer interface. This mutation was designed to disrupt the CR2-C3d interaction, either directly through steric inhibition, or indirectly through disruption of a physiological dimer. However, no difference in C3dg binding relative to wild-type CR2 could be observed for this mutant, suggesting that the dimer may only be found in the crystal form of CR2.

  13. Mutational analysis of the complement receptor type 2 (CR2/CD21)-C3d interaction reveals a putative charged SCR1 binding site for C3d.

    PubMed

    Hannan, Jonathan P; Young, Kendra A; Guthridge, Joel M; Asokan, Rengasamy; Szakonyi, Gerda; Chen, Xiaojiang S; Holers, V Michael

    2005-02-25

    We have characterized the interaction between the first two short consensus repeats (SCR1-2) of complement receptor type 2 (CR2, CD21) and C3d in solution, by utilising the available crystal structures of free and C3d-bound forms of CR2 to create a series of informative mutations targeting specific areas of the CR2-C3d complex. Wild-type and mutant forms of CR2 were expressed on the surface of K562 erythroleukemia cells and their binding ability assessed using C3dg-biotin tetramers complexed to fluorochrome conjugated streptavidin and measured by flow cytometry. Mutations directed at the SCR2-C3d interface (R83A, R83E, G84Y) were found to strongly disrupt C3dg binding, supporting the conclusion that the SCR2 interface reflected in the crystal structure is correct. Previous epitope and peptide mapping studies have also indicated that the PILN11GR13IS sequence of the first inter-cysteine region of SCR1 is essential for the binding of iC3b. Mutations targeting residues within or in close spatial proximity to this area (N11A, N11E, R13A, R13E, Y16A, S32A, S32E), and a number of other positively charged residues located primarily on a contiguous face of SCR1 (R28A, R28E, R36A, R36E, K41A, K41E, K50A, K50E, K57A, K57E, K67A, K67E), have allowed us to reassess those regions on SCR1 that are essential for CR2-C3d binding. The nature of this interaction and the possibility of a direct SCR1-C3d association are discussed extensively. Finally, a D52N mutant was constructed introducing an N-glycosylation sequence at an area central to the CR2 dimer interface. This mutation was designed to disrupt the CR2-C3d interaction, either directly through steric inhibition, or indirectly through disruption of a physiological dimer. However, no difference in C3dg binding relative to wild-type CR2 could be observed for this mutant, suggesting that the dimer may only be found in the crystal form of CR2. PMID:15713467

  14. Identification and characterization of anion binding sites in RNA

    SciTech Connect

    Kieft, Jeffrey S.; Chase, Elaine; Costantino, David A.; Golden, Barbara L.

    2010-05-24

    Although RNA molecules are highly negatively charged, anions have been observed bound to RNA in crystal structures. It has been proposed that anion binding sites found within isolated RNAs represent regions of the molecule that could be involved in intermolecular interactions, indicating potential contact points for negatively charged amino acids from proteins or phosphate groups from an RNA. Several types of anion binding sites have been cataloged based on available structures. However, currently there is no method for unambiguously assigning anions to crystallographic electron density, and this has precluded more detailed analysis of RNA-anion interaction motifs and their significance. We therefore soaked selenate into two different types of RNA crystals and used the anomalous signal from these anions to identify binding sites in these RNA molecules unambiguously. Examination of these sites and comparison with other suspected anion binding sites reveals features of anion binding motifs, and shows that selenate may be a useful tool for studying RNA-anion interactions.

  15. Effect of ionic strength on surface-selective patch binding-induced phase separation and coacervation in similarly charged gelatin-agar molecular systems.

    PubMed

    Boral, Shilpi; Bohidar, H B

    2010-09-23

    Coacervate is defined as a polymer-rich dense phase, which remains in thermodynamic equilibrium with its low concentrated phase called the supernatant. The effect of ionic strength (I = 0-0.1 M NaCl) on the mechanism of surface patch binding-induced protein-polysaccharide interaction leading to complex coacervation, between agar (a polyanionic polysaccharide) and gelatin B (a polyampholyte protein), both having similar net charge, at a particular mixing ratio, [gelatin]/[agar] = 1, was studied at various temperatures (20-40 °C). The coacervation transition was probed by turbidity and zeta-potential measurements. The intermolecular association had the signature of surface-selective binding, and a model calculation could explain the potential energy of interactions operative in such processes. The thermo-mechanical features of the coacervates were found to be strongly dependent on ionic strength, which has been interpreted as originating from formation of salt-bridges between the biopolymers. The microstructure of the coacervate materials was analyzed using rheology and small angle neutron scattering (SANS) techniques, which probed the heterogeneity prevailing in the system that had characteristic length in the range 1.3-2.0 nm, and the same data yielded the correlation length of concentration fluctuations, which was estimated to lay in the range 2.4-4 nm. It is concluded that the coacervation transition driven by surface-selective binding is not influenced by the ionic strength of the solution, but the mobile ions participate in the structural organization of the interacting polyions in the coacervate.

  16. The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

    PubMed Central

    Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

    1994-01-01

    The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I. Images PMID:8127870

  17. Role of specific residues in coenzyme binding, charge-transfer complex formation, and catalysis in Anabaena ferredoxin NADP+-reductase.

    PubMed

    Peregrina, José Ramón; Sánchez-Azqueta, Ana; Herguedas, Beatriz; Martínez-Júlvez, Marta; Medina, Milagros

    2010-09-01

    Two transient charge-transfer complexes (CTC) form prior and upon hydride transfer (HT) in the reversible reaction of the FAD-dependent ferredoxin-NADP+ reductase (FNR) with NADP+/H, FNR(ox)-NADPH (CTC-1), and FNR(rd)-NADP+ (CTC-2). Spectral properties of both CTCs, as well as the corresponding interconversion HT rates, are here reported for several Anabaena FNR site-directed mutants. The need for an adequate initial interaction between the 2'P-AMP portion of NADP+/H and FNR that provides subsequent conformational changes leading to CTC formation is further confirmed. Stronger interactions between the isoalloxazine and nicotinamide rings might relate with faster HT processes, but exceptions are found upon distortion of the active centre. Thus, within the analyzed FNR variants, there is no strict correlation between the stability of the transient CTCs formation and the rate of the subsequent HT. Kinetic isotope effects suggest that, while in the WT, vibrational enhanced modulation of the active site contributes to the tunnel probability of HT; complexes of some of the active site mutants with the coenzyme hardly allow the relative movement of isoalloxazine and nicotinamide rings along the HT reaction. The architecture of the WT FNR active site precisely contributes to reduce the stacking probability between the isoalloxazine and nicotinamide rings in the catalytically competent complex, modulating the angle and distance between the N5 of the FAD isoalloxazine and the C4 of the coenzyme nicotinamide to values that ensure efficient HT processes.

  18. AcEBP1, an ErbB3-Binding Protein (EBP1) from halophyte Atriplex canescens, negatively regulates cell growth and stress responses in Arabidopsis.

    PubMed

    Li, Jingtao; Yu, Gang; Sun, Xinhua; Zhang, Xianghui; Liu, Jinliang; Pan, Hongyu

    2016-07-01

    An ErbB-3-binding protein gene AcEBP1, also known as proliferation-associated 2G4 gene (PA2G4s) belonging to the M24 superfamily, was obtained from the saltbush Atriplex canescens. Subcellular localization imaging showed the fusion protein AcEBP1-eGFP was located in the nucleus of epidermal cells in Nicotiana benthamiana. The AcEBP1 gene expression levels were up-regulated under salt, osmotic stress, and hormones treatment as revealed by qRT-PCR. Overexpression of AcEBP1 in Arabidopsis demonstrated that AcEBP1 was involved in root cell growth and stress responses (NaCl, osmotic stress, ABA, low temperature, and drought). These phenotypic data were correlated with the expression patterns of stress responsive genes and PR genes. The AcEBP1 transgenic Arabidopsis plants also displayed increased sensitivity under low temperature and evaluated resistance to drought stress. Together, these results demonstrate that AcEBP1 negatively affects cell growth and is a regulator under stress conditions. PMID:27181948

  19. Extracellularly secreted APE1/Ref-1 triggers apoptosis in triple-negative breast cancer cells via RAGE binding, which is mediated through acetylation.

    PubMed

    Lee, Yu Ran; Kim, Ki Mo; Jeon, Byeong Hwa; Choi, Sunga

    2015-09-15

    The present study evaluated the mechanism of apoptosis caused by post-translational modification, hyperacetylation in triple-negative breast cancer (TNBC) cells. We previously showed that trichostatin A (TSA) induced secretion of acetylated apurinic apyrimidinic endonuclease 1/redox factor-1 (Ac-APE1/Ref-1). This is the first report showing that Ac-APE1/Ref-1 initiates apoptosis in TNBC cells by binding to the receptor for advanced glycation end products (RAGE). The functional significance of secreted Ac-APE1/Ref-1 was studied by induction of intracellular hyperacetylation through co-treatment with acetylsalicylic acid and TSA in MDA-MB-231 cells. In response to hyperacetylation, secretion of Ac-APE1/Ref-1 in vesicles was observed, resulting in significantly decreased cell viability and induction of apoptosis with increased expression of RAGE. The hyperacetylation-induced apoptosis was similar in two other TNBC cell lines: BT-459 and MDA-MB-468. Therefore, hyperacetylation may be a therapeutic target for treatment of TNBCs. This study introduces a novel paradigm whereby post-translational modification induces apoptotic cell death in breast cancer cells resistant to standard chemotherapeutic agents through secretion of auto- or paracrine molecules such as Ac-APE1/Ref-1.

  20. The role of dimension in multivalent binding events: structure-activity relationship of dendritic polyglycerol sulfate binding to L-selectin in correlation with size and surface charge density.

    PubMed

    Weinhart, Marie; Gröger, Dominic; Enders, Sven; Riese, Sebastian B; Dernedde, Jens; Kainthan, Rajesh K; Brooks, Donald E; Haag, Rainer

    2011-08-11

    L-, P-, and E-Selectin are cell adhesion molecules that play a crucial role in leukocyte recruitment from the blood stream to the afflicted tissue in an acute and chronic inflammatory setting. Since selectins mediate the initial contact of leukocytes to the vascular endothelium, they have evolved as a valuable therapeutic target in diseases related to inflammation by inhibition of the physiological selectin-ligand interactions. In a previous study, it was demonstrated that dPGS, a fully synthetic heparin analogue, works as an efficient inhibitor towards L- and P-selectin in vitro as well as in vivo. Herein, the focus is directed towards the effect of size and charge density of the polyanion. The efficiency of L-selectin inhibition via an SPR-based in vitro assay and a cell-based flow chamber assay is investigated with dPGS ranging from approximately 4 to 2000 kDa. SPR measurements show that the inhibitory potential of highly sulfated dPGS increases with size and charge density. Thereby, IC(50) values from the micromolar to the low picomolar range are determined. The same tendency could be observed in a cell-based flow chamber assay with three representative dPGS samples. This structure-affinity relationship of dPGS suggests that the strong inhibitory potential of dPGS is not only based on the strong electrostatic interaction with areas of cationic surface potential on L-selectin but is also due to a steric shielding of the carbohydrate binding site by large, flexible dPGS particles.

  1. FOREVER YOUNG FLOWER Negatively Regulates Ethylene Response DNA-Binding Factors by Activating an Ethylene-Responsive Factor to Control Arabidopsis Floral Organ Senescence and Abscission.

    PubMed

    Chen, Wei-Han; Li, Pei-Fang; Chen, Ming-Kun; Lee, Yung-I; Yang, Chang-Hsien

    2015-08-01

    In this study of Arabidopsis (Arabidopsis thaliana), we investigated the relationship between FOREVER YOUNG FLOWER (FYF) and Ethylene Response DNA-binding Factors (EDFs) and functionally analyzed a key FYF target, an Ethylene-Responsive Factor (ERF), that controls flower senescence/abscission. Ectopic expression of EDF1/2/3/4 caused promotion of flower senescence/abscission and the activation of the senescence-associated genes. The presence of a repressor domain in EDFs and the enhancement of the promotion of senescence/abscission in EDF1/2/3/4+SRDX (converting EDFs to strong repressors by fusion with the ERF-associated amphiphilic repression motif repression domain SRDX) transgenic plants suggested that EDFs act as repressors. The significant reduction of β-glucuronidase (GUS) expression by 35S:FYF in EDF1/2/3/4:GUS plants indicates that EDF1/2/3/4 functions downstream of FYF in regulating flower senescence/abscission. In this study, we also characterized an ERF gene, FOREVER YOUNG FLOWER UP-REGULATING FACTOR1 (FUF1), which is up-regulated by FYF during flower development. Ectopic expression of FUF1 caused similar delayed flower senescence/abscission as seen in 35S:FYF plants. This phenotype was correlated with deficient abscission zone formation, ethylene insensitivity, and down-regulation of EDF1/2/3/4 and abscission-associated genes in 35S:FUF1 flowers. In contrast, significant promotion of flower senescence/abscission and up-regulation of EDF1/2/3/4 were observed in 35S:FUF1+SRDX transgenic dominant-negative plants, in which FUF1 is converted to a potent repressor by fusion to an SRDX-suppressing motif. Thus, FUF1 acts as an activator in suppressing EDF1/2/3/4 function and senescence/abscission of the flowers. Our results reveal that FYF regulates flower senescence/abscission by negatively regulating EDF1/2/3/4, which is the downstream gene in the ethylene response, by activating FUF1 in Arabidopsis.

  2. FOREVER YOUNG FLOWER Negatively Regulates Ethylene Response DNA-Binding Factors by Activating an Ethylene-Responsive Factor to Control Arabidopsis Floral Organ Senescence and Abscission1

    PubMed Central

    Chen, Wei-Han; Li, Pei-Fang; Chen, Ming-Kun; Lee, Yung-I; Yang, Chang-Hsien

    2015-01-01

    In this study of Arabidopsis (Arabidopsis thaliana), we investigated the relationship between FOREVER YOUNG FLOWER (FYF) and Ethylene Response DNA-binding Factors (EDFs) and functionally analyzed a key FYF target, an Ethylene-Responsive Factor (ERF), that controls flower senescence/abscission. Ectopic expression of EDF1/2/3/4 caused promotion of flower senescence/abscission and the activation of the senescence-associated genes. The presence of a repressor domain in EDFs and the enhancement of the promotion of senescence/abscission in EDF1/2/3/4+SRDX (converting EDFs to strong repressors by fusion with the ERF-associated amphiphilic repression motif repression domain SRDX) transgenic plants suggested that EDFs act as repressors. The significant reduction of β-glucuronidase (GUS) expression by 35S:FYF in EDF1/2/3/4:GUS plants indicates that EDF1/2/3/4 functions downstream of FYF in regulating flower senescence/abscission. In this study, we also characterized an ERF gene, FOREVER YOUNG FLOWER UP-REGULATING FACTOR1 (FUF1), which is up-regulated by FYF during flower development. Ectopic expression of FUF1 caused similar delayed flower senescence/abscission as seen in 35S:FYF plants. This phenotype was correlated with deficient abscission zone formation, ethylene insensitivity, and down-regulation of EDF1/2/3/4 and abscission-associated genes in 35S:FUF1 flowers. In contrast, significant promotion of flower senescence/abscission and up-regulation of EDF1/2/3/4 were observed in 35S:FUF1+SRDX transgenic dominant-negative plants, in which FUF1 is converted to a potent repressor by fusion to an SRDX-suppressing motif. Thus, FUF1 acts as an activator in suppressing EDF1/2/3/4 function and senescence/abscission of the flowers. Our results reveal that FYF regulates flower senescence/abscission by negatively regulating EDF1/2/3/4, which is the downstream gene in the ethylene response, by activating FUF1 in Arabidopsis. PMID:26063506

  3. TATA-binding protein-like protein (TLP/TRF2/TLF) negatively regulates cell cycle progression and is required for the stress-mediated G(2) checkpoint.

    PubMed

    Shimada, Miho; Nakadai, Tomoyoshi; Tamura, Taka-Aki

    2003-06-01

    The TATA-binding protein (TBP) is a universal transcription factor required for all of the eukaryotic RNA polymerases. In addition to TBP, metazoans commonly express a distantly TBP-related protein referred to as TBP-like protein (TLP/TRF2/TLF). Although the function of TLP in transcriptional regulation is not clear, it is known that TLP is required for embryogenesis and spermiogenesis. In the present study, we investigated the cellular functions of TLP by using TLP knockout chicken DT40 cells. TLP was found to be dispensable for cell growth. Unexpectedly, TLP-null cells exhibited a 20% elevated cell cycle progression rate that was attributed to shortening of the G(2) phase. This indicates that TLP functions as a negative regulator of cell growth. Moreover, we found that TLP mainly existed in the cytoplasm and was translocated to the nucleus restrictedly at the G(2) phase. Ectopic expression of nuclear localization signal-carrying TLP resulted in an increase (1.5-fold) in the proportion of cells remaining in the G(2)/M phase and apoptotic state. Notably, TLP-null cells showed an insufficient G(2) checkpoint when the cells were exposed to stresses such as UV light and methyl methanesulfonate, and the population of apoptotic cells after stresses decreased to 40%. These phenomena in G(2) checkpoint regulation are suggested to be p53 independent because p53 does not function in DT40 cells. Moreover, TLP was transiently translocated to the nucleus shortly (15 min) after stress treatment. The expression of several stress response and cell cycle regulatory genes drifted in a both TLP- and stress-dependent manner. Nucleus-translocating TLP is therefore thought to work by checking cell integrity through its transcription regulatory ability. TLP is considered to be a signal-transducing transcription factor in cell cycle regulation and stress response.

  4. Nerve growth factor-induced derepression of peripherin gene expression is associated with alterations in proteins binding to a negative regulatory element.

    PubMed Central

    Thompson, M A; Lee, E; Lawe, D; Gizang-Ginsberg, E; Ziff, E B

    1992-01-01

    The peripherin gene, which encodes a neuronal-specific intermediate filament protein, is transcriptionally induced with a late time course when nerve growth factor (NGF) stimulates PC12 cells to differentiate into neurons. We have studied its transcriptional regulation in order to better understand the neuronal-specific end steps of the signal transduction pathway of NGF. By 5' deletion mapping of the peripherin promoter, we have localized two positive regulatory elements necessary for full induction by NGF: a distal positive element and a proximal constitutive element within 111 bp of the transcriptional start site. In addition, there is a negative regulatory element (NRE; -179 to -111), the deletion of which results in elevated basal expression of the gene. Methylation interference footprinting of the NRE defined a unique sequence, GGCAGGGCGCC, as the binding site for proteins present in nuclear extracts from both undifferentiated and differentiated PC12 cells. However, DNA mobility shift assays using an oligonucleotide probe containing the footprinted sequence demonstrate a prominent retarded complex in extracts from undifferentiated PC12 cells which migrates with slower mobility than do the complexes produced by using differentiated PC12 cell extract. Transfection experiments using peripherin-chloramphenicol acetyltransferase constructs in which the footprinted sequence has been mutated confirm that the NRE has a functional, though not exclusive, role in repressing peripherin expression in undifferentiated and nonneuronal cells. We propose a two-step model of activation of peripherin by NGF in which dissociation of a repressor from the protein complex at the NRE, coupled with a positive signal from the distal positive element, results in depression of the gene. Images PMID:1588954

  5. Multikink topological terms and charge-binding domain-wall condensation induced symmetry-protected topological states: Beyond Chern-Simons/BF field theories

    NASA Astrophysics Data System (ADS)

    Gu, Zheng-Cheng; Wang, Juven C.; Wen, Xiao-Gang

    2016-03-01

    Quantum disordering a discrete-symmetry-breaking state by condensing domain walls can lead to a trivial symmetric insulator state. In this work, we show that if we bind a one-dimensional representation of the symmetry (such as a charge) to the intersection point of several domain walls, condensing such modified domain walls can lead to a nontrivial symmetry-protected topological (SPT) state. This result is obtained by showing that the modified domain-wall condensed state has a nontrivial SPT invariant, the symmetry-twist-dependent partition function. We propose two different kinds of field theories that can describe the above-mentioned SPT states. The first one is a Ginzburg-Landau-type nonlinear sigma model theory, but with an additional multikink domain-wall topological term. Such theory has an anomalous Uk(1 ) symmetry but an anomaly-free ZNk symmetry. The second one is a gauge theory, which is beyond Abelian Chern-Simons/BF gauge theories. We argue that the two field theories are equivalent at low energies. After coupling to the symmetry twists, both theories produce the desired SPT invariant.

  6. Proposal for high-speed and high-fidelity electron-spin initialization in a negatively charged quantum dot coupled to a microcavity in a weak external magnetic field

    SciTech Connect

    Majumdar, Arka; Lin Ziliang; Faraon, Andrei; Vuckovic, Jelena

    2010-08-15

    We describe a proposal for fast electron-spin initialization in a negatively charged quantum dot coupled to a microcavity without the need for a strong magnetic field. We employ two-photon excitation to access trion states that are spin forbidden by one-photon excitation. Our simulation shows a maximum initialization speed of 1.3 GHz and maximum fidelity of 99.7% with realistic system parameters.

  7. Spatial proximity statistics suggest a regulatory role of protein phosphorylation on compound binding.

    PubMed

    Korkuć, Paula; Walther, Dirk

    2016-05-01

    Phosphorylation is an important post-translational modification that regulates protein function by the attachment of negatively charged phosphate groups to phosphorylatable amino acid residues. As a mode of action, an influence of phosphorylation on the binding of compounds to proteins has been discussed and described for a number of proteins in the literature. However, a systematic statistical survey probing for enriched phosphorylation sites close to compound binding sites in support of this notion and with properly chosen random reference distributions has not been presented yet. Using high-resolution protein structures from the Protein Data Bank including their co-crystallized non-covalently bound compounds and experimentally determined phosphorylation sites, we analyzed the pairwise distance distributions of phosphorylation and compound binding sites on protein surfaces. We found that phosphorylation sites are indeed located at significantly closer distances to compounds than expected by chance holding true specifically also for the subset of compound binding sites serving as catalytic sites of metabolic reactions. This tendency was particularly evident when treating phosphorylation sites as collective sets supporting the relevance of phosphorylation hotspots. Interestingly, phosphorylation sites were found to be closer to negatively charged than to positively charged compounds suggesting a stronger modulation of the binding of negatively charged compounds in dependence on phosphorylation status than on positively charged compounds. The enrichment of phosphorylation sites near compound binding sites confirms a regulatory role of phosphorylation in compound binding and provides a solid statistical basis for the literature-reported selected events.

  8. Sentential Negation in English

    ERIC Educational Resources Information Center

    Mowarin, Macaulay

    2009-01-01

    This paper undertakes a detailed analysis of sentential negation in the English language with Chomsky's Government-Binding theory of Transformational Grammar as theoretical model. It distinguishes between constituent and sentential negation in English. The essay identifies the exact position of Negation phrase in an English clause structure. It…

  9. Spectroscopic and molecular docking studies on the charge transfer complex of bovine serum albumin with quinone in aqueous medium and its influence on the ligand binding property of the protein

    NASA Astrophysics Data System (ADS)

    Satheshkumar, Angupillai; Elango, Kuppanagounder P.

    2014-09-01

    The spectral techniques such as UV-Vis, 1H NMR and fluorescence and electrochemical experiments have been employed to investigate the interaction between 2-methoxy-3,5,6-trichloro-1,4-benzoquinone (MQ; a water soluble quinone) and bovine serum albumin (BSA) in aqueous medium. The fluorescence of BSA was quenched by MQ via formation of a 1:1 BSA-MQ charge transfer adduct with a formation constant of 3.3 × 108 L mol-1. Based on the Forster’s theory the binding distance between them is calculated as 2.65 nm indicating high probability of binding. For the first time, influence of quinone on the binding property of various types of ligands such as aspirin, ascorbic acid, nicotinimide and sodium stearate has also been investigated. The results indicated that the strong and spontaneous binding existing between BSA and MQ, decreased the intensity of binding of these ligands with BSA. Since Tryptophan (Trp) is the basic residue present in BSA, a comparison between binding property of Trp-MQ adduct with that of BSA-MQ with these ligands has also been attempted. 1H NMR titration study indicated that the Trp forms a charge transfer complex with MQ, which reduces the interaction of Trp with the ligands. Molecular docking study supported the fact that the quinone interacts with the Trp212 unit of the BSA and the free energy change of binding (ΔG) for the BSA-MQ complex was found to be -46 kJ mol-1, which is comparable to our experimental free energy of binding (-49 kJ mol-1) obtained from fluorescence study.

  10. Modeling and mutagenesis of the binding site of Calhex 231, a novel negative allosteric modulator of the extracellular Ca(2+)-sensing receptor.

    PubMed

    Petrel, Christophe; Kessler, Albane; Maslah, Fouzia; Dauban, Philippe; Dodd, Robert H; Rognan, Didier; Ruat, Martial

    2003-12-01

    A model of the Ca2+-sensing receptor (CaSR) seven transmembrane domains was constructed based on the crystal structure of bovine rhodopsin. This model was used for docking (1S,2S,1'R)-N1-(4-chlorobenzoyl)-N2-[1-(1-naphthyl)ethyl]-1,2-diaminocyclohexane (Calhex 231), a novel potent negative allosteric modulator that blocks (IC50 = 0.39 microm) increases in [3H]inositol phosphates elicited by activating the human wild-type CaSR transiently expressed in HEK293 cells. In this model, Glu-8377.39 plays a pivotal role in anchoring the two nitrogen atoms of Calhex 231 and locating the aromatic moieties in two adjacent hydrophobic pockets delineated by transmembrane domains 3, 5, and 6 and transmembrane domains 1, 2, 3, and 7, respectively. To demonstrate its validity, we have mutated selected residues and analyzed the biochemical and pharmacological properties of the mutant receptors transfected in HEK293 cells. Two receptor mutations, F684A3.32 and E837A7.39, caused a loss of the ability of Calhex 231 to inhibit Ca2+-induced accumulation of [3H]inositol phosphates. Three other mutations, F688A3.36, W818A6.48, and I841A7.43, produced a marked increase in the IC50 of Calhex 231 for the Ca2+ response, whereas L776A5.42 and F821A6.51 led to a decrease in the IC50. Our data validate the proposed model for the allosteric interaction of Calhex 231 with the seven transmembrane domains of the CaSR. Interestingly, the residues at the same positions have been shown to delimit the antagonist-binding cavity of many diverse G-protein-coupled receptors. This study furthermore suggests that the crystal structure of bovine rhodopsin exhibits sufficient mimicry to the ground state of a very divergent class 3 receptor to predict the interaction of antagonists with the heptahelical bundle of diverse G-protein-coupled receptors. PMID:14506236

  11. Mutations in the ubiquitin-binding domain of OPTN/optineurin interfere with autophagy-mediated degradation of misfolded proteins by a dominant-negative mechanism.

    PubMed

    Shen, Wen-Chuan; Li, Huei-Ying; Chen, Guang-Chao; Chern, Yijuang; Tu, Pang-Hsien

    2015-04-01

    OPTN (optineurin) is an autophagy receptor and mutations in the OPTN gene result in familial glaucoma (E50K) and amyotrophic lateral sclerosis (ALS) (E478G). However, the mechanisms through which mutant OPTN leads to human diseases remain to be characterized. Here, we demonstrated that OPTN colocalized with inclusion bodies (IBs) formed by mutant HTT/huntingtin protein (mHTT) in R6/2 transgenic mice and IBs formed by 81QNmHTT (nuclear form), 109QmHTT (cytoplasmic form) or the truncated form of TARDBP/TDP-43 (TARDBP(ND251)) in Neuro2A cells. This colocalization required the ubiquitin (Ub)-binding domain (UbBD, amino acids 424 to 511) of OPTN. Overexpression of wild-type (WT) OPTN decreased IBs through K63-linked polyubiquitin-mediated autophagy. E50K or 210 to 410Δ (with amino acids 210 to 410 deleted) whose mutation or deletion was outside the UbBD decreased the IBs formed by 109QmHTT or TARDBP(ND251), as was the case with WT OPTN. In contrast, UbBD mutants, including E478G, D474N, UbBDΔ, 411 to 520Δ and 210 to 520Δ, increased accumulation of IBs. UbBD mutants (E478G, UbBDΔ) retained a substantial ability to interact with WT OPTN, and were found to colocalize with polyubiquitinated IBs, which might occur indirectly through their WT partner in a WT-mutant complex. They decreased autophagic flux evidenced by alteration in LC3 level and turnover and in the number of LC3-positive puncta under stresses like starvation or formation of IBs. UbBD mutants exhibited a weakened interaction with MYO6 (myosin VI) and TOM1 (target of myb1 homolog [chicken]), important for autophagosome maturation, in cells or sorted 109QmHtt IBs. Taken together, our data indicated that UbBD mutants acted as dominant-negative traps through the formation of WT-mutant hybrid complexes to compromise the maturation of autophagosomes, which in turn interfered with OPTN-mediated autophagy and clearance of IBs. PMID:25484089

  12. The self-consistent charge density functional tight binding method applied to liquid water and the hydrated excess proton: benchmark simulations.

    PubMed

    Maupin, C Mark; Aradi, Bálint; Voth, Gregory A

    2010-05-27

    The self-consistent charge density functional tight binding (SCC-DFTB) method is a relatively new approximate electronic structure method that is increasingly used to study biologically relevant systems in aqueous environments. There have been several gas phase cluster calculations that indicate, in some instances, an ability to predict geometries, energies, and vibrational frequencies in reasonable agreement with high level ab initio calculations. However, to date, there has been little validation of the method for bulk water properties, and no validation for the properties of the hydrated excess proton in water. Presented here is a detailed SCC-DFTB analysis of the latter two systems. This work focuses on the ability of the original SCC-DFTB method, and a modified version that includes a hydrogen bonding damping function (HBD-SCC-DFTB), to describe the structural, energetic, and dynamical nature of these aqueous systems. The SCC-DFTB and HBD-SCC-DFTB results are compared to experimental data and Car-Parrinello molecular dynamics (CPMD) simulations using the HCTH/120 gradient-corrected exchange-correlation energy functional. All simulations for these systems contained 128 water molecules, plus one additional proton in the case of the excess proton system, and were carried out in a periodic simulation box with Ewald long-range electrostatics. The liquid water structure for the original SCC-DFTB is shown to poorly reproduce bulk water properties, while the HBD-SCC-DFTB somewhat more closely represents bulk water due to an improved ability to describe hydrogen bonding energies. Both SCC-DFTB methods are found to underestimate the water dimer interaction energy, resulting in a low heat of vaporization and a significantly elevated water oxygen diffusion coefficient as compared to experiment. The addition of an excess hydrated proton to the bulk water resulted in the Zundel cation (H(5)O(2)(+)) stabilized species being the stable form of the charge defect, which

  13. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  14. Molecular dissection of the contribution of negatively and positively charged residues in S2, S3, and S4 to the final membrane topology of the voltage sensor in the K+ channel, KAT1.

    PubMed

    Sato, Yoko; Sakaguchi, Masao; Goshima, Shinobu; Nakamura, Tatsunosuke; Uozumi, Nobuyuki

    2003-04-11

    Voltage-dependent ion channels control changes in ion permeability in response to membrane potential changes. The voltage sensor in channel proteins consists of the highly positively charged segment, S4, and the negatively charged segments, S2 and S3. The process involved in the integration of the protein into the membrane remains to be elucidated. In this study, we used in vitro translation and translocation experiments to evaluate interactions between residues in the voltage sensor of a hyperpolarization-activated potassium channel, KAT1, and their effect on the final topology in the endoplasmic reticulum (ER) membrane. A D95V mutation in S2 showed less S3-S4 integration into the membrane, whereas a D105V mutation allowed S4 to be released into the ER lumen. These results indicate that Asp(95) assists in the membrane insertion of S3-S4 and that Asp(105) helps in preventing S4 from being releasing into the ER lumen. The charge reversal mutation, R171D, in S4 rescued the D105R mutation and prevented S4 release into the ER lumen. A series of constructs containing different C-terminal truncations of S4 showed that Arg(174) was required for correct integration of S3 and S4 into the membrane. Interactions between Asp(105) and Arg(171) and between negative residues in S2 or S3 and Arg(174) may be formed transiently during membrane integration. These data clarify the role of charged residues in S2, S3, and S4 and identify posttranslational electrostatic interactions between charged residues that are required to achieve the correct voltage sensor topology in the ER membrane.

  15. Matrix assisted ionization: new aromatic and nonaromatic matrix compounds producing multiply charged lipid, peptide, and protein ions in the positive and negative mode observed directly from surfaces.

    PubMed

    Li, Jing; Inutan, Ellen D; Wang, Beixi; Lietz, Christopher B; Green, Daniel R; Manly, Cory D; Richards, Alicia L; Marshall, Darrell D; Lingenfelter, Steven; Ren, Yue; Trimpin, Sarah

    2012-10-01

    Matrix assisted inlet ionization (MAII) is a method in which a matrix:analyte mixture produces mass spectra nearly identical to electrospray ionization without the application of a voltage or the use of a laser as is required in laserspray ionization (LSI), a subset of MAII. In MAII, the sample is introduced by, for example, tapping particles of dried matrix:analyte into the inlet of the mass spectrometer and, therefore, permits the study of conditions pertinent to the formation of multiply charged ions without the need of absorption at a laser wavelength. Crucial for the production of highly charged ions are desolvation conditions to remove matrix molecules from charged matrix:analyte clusters. Important factors affecting desolvation include heat, vacuum, collisions with gases and surfaces, and even radio frequency fields. Other parameters affecting multiply charged ion production is sample preparation, including pH and solvent composition. Here, findings from over 100 compounds found to produce multiply charged analyte ions using MAII with the inlet tube set at 450 °C are presented. Of the compounds tested, many have -OH or -NH(2) functionality, but several have neither (e.g., anthracene), nor aromaticity or conjugation. Binary matrices are shown to be applicable for LSI and solvent-free sample preparation can be applied to solubility restricted compounds, and matrix compounds too volatile to allow drying from common solvents. Our findings suggest that the physical properties of the matrix such as its morphology after evaporation of the solvent, its propensity to evaporate/sublime, and its acidity are more important than its structure and functional groups.

  16. Probing the interaction of lipids with the non-annular binding sites of the potassium channel KcsA by magic-angle spinning NMR

    PubMed Central

    Marius, Phedra; de Planque, Maurits R.R.; Williamson, Philip T.F.

    2012-01-01

    The activity of the potassium channel KcsA is tightly regulated through the interactions of anionic lipids with high-affinity non-annular lipid binding sites located at the interface between the channel's subunits. Here we present solid-state phosphorous NMR studies that resolve the negatively charged lipid phosphatidylglycerol within the non-annular lipid-binding site. Perturbations in chemical shift observed upon the binding of phosphatidylglycerol are indicative of the interaction of positively charged sidechains within the non-annular binding site and the negatively charged lipid headgroup. Site directed mutagenesis studies have attributed these charge interactions to R64 and R89. Functionally the removal of the positive charges from R64 and R89 appears to act synergistically to reduce the probability of channel opening. PMID:21963409

  17. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  18. Positive and Negative Allosteric Modulation of an α1β3γ2 γ-Aminobutyric Acid Type A (GABAA) Receptor by Binding to a Site in the Transmembrane Domain at the γ+-β- Interface.

    PubMed

    Jayakar, Selwyn S; Zhou, Xiaojuan; Savechenkov, Pavel Y; Chiara, David C; Desai, Rooma; Bruzik, Karol S; Miller, Keith W; Cohen, Jonathan B

    2015-09-18

    In the process of developing safer general anesthetics, isomers of anesthetic ethers and barbiturates have been discovered that act as convulsants and inhibitors of γ-aminobutyric acid type A receptors (GABAARs) rather than potentiators. It is unknown whether these convulsants act as negative allosteric modulators by binding to the intersubunit anesthetic-binding sites in the GABAAR transmembrane domain (Chiara, D. C., Jayakar, S. S., Zhou, X., Zhang, X., Savechenkov, P. Y., Bruzik, K. S., Miller, K. W., and Cohen, J. B. (2013) J. Biol. Chem. 288, 19343-19357) or to known convulsant sites in the ion channel or extracellular domains. Here, we show that S-1-methyl-5-propyl-5-(m-trifluoromethyl-diazirynylphenyl) barbituric acid (S-mTFD-MPPB), a photoreactive analog of the convulsant barbiturate S-MPPB, inhibits α1β3γ2 but potentiates α1β3 GABAAR responses. In the α1β3γ2 GABAAR, S-mTFD-MPPB binds in the transmembrane domain with high affinity to the γ(+)-β(-) subunit interface site with negative energetic coupling to GABA binding in the extracellular domain at the β(+)-α(-) subunit interfaces. GABA inhibits S-[(3)H]mTFD-MPPB photolabeling of γ2Ser-280 (γM2-15') in this site. In contrast, within the same site GABA enhances photolabeling of β3Met-227 in βM1 by an anesthetic barbiturate, R-[(3)H]methyl-5-allyl-5-(m-trifluoromethyl-diazirynylphenyl)barbituric acid (mTFD-MPAB), which differs from S-mTFD-MPPB in structure only by chirality and two hydrogens (propyl versus allyl). S-mTFD-MPPB and R-mTFD-MPAB are predicted to bind in different orientations at the γ(+)-β(-) site, based upon the distance in GABAAR homology models between γ2Ser-280 and β3Met-227. These results provide an explanation for S-mTFD-MPPB inhibition of α1β3γ2 GABAAR function and provide a first demonstration that an intersubunit-binding site in the GABAAR transmembrane domain binds negative and positive allosteric modulators.

  19. Positive and Negative Allosteric Modulation of an α1β3γ2 γ-Aminobutyric Acid Type A (GABAA) Receptor by Binding to a Site in the Transmembrane Domain at the γ+-β− Interface*

    PubMed Central

    Jayakar, Selwyn S.; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Chiara, David C.; Desai, Rooma; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.

    2015-01-01

    In the process of developing safer general anesthetics, isomers of anesthetic ethers and barbiturates have been discovered that act as convulsants and inhibitors of γ-aminobutyric acid type A receptors (GABAARs) rather than potentiators. It is unknown whether these convulsants act as negative allosteric modulators by binding to the intersubunit anesthetic-binding sites in the GABAAR transmembrane domain (Chiara, D. C., Jayakar, S. S., Zhou, X., Zhang, X., Savechenkov, P. Y., Bruzik, K. S., Miller, K. W., and Cohen, J. B. (2013) J. Biol. Chem. 288, 19343–19357) or to known convulsant sites in the ion channel or extracellular domains. Here, we show that S-1-methyl-5-propyl-5-(m-trifluoromethyl-diazirynylphenyl) barbituric acid (S-mTFD-MPPB), a photoreactive analog of the convulsant barbiturate S-MPPB, inhibits α1β3γ2 but potentiates α1β3 GABAAR responses. In the α1β3γ2 GABAAR, S-mTFD-MPPB binds in the transmembrane domain with high affinity to the γ+-β− subunit interface site with negative energetic coupling to GABA binding in the extracellular domain at the β+-α− subunit interfaces. GABA inhibits S-[3H]mTFD-MPPB photolabeling of γ2Ser-280 (γM2–15′) in this site. In contrast, within the same site GABA enhances photolabeling of β3Met-227 in βM1 by an anesthetic barbiturate, R-[3H]methyl-5-allyl-5-(m-trifluoromethyl-diazirynylphenyl)barbituric acid (mTFD-MPAB), which differs from S-mTFD-MPPB in structure only by chirality and two hydrogens (propyl versus allyl). S-mTFD-MPPB and R-mTFD-MPAB are predicted to bind in different orientations at the γ+-β− site, based upon the distance in GABAAR homology models between γ2Ser-280 and β3Met-227. These results provide an explanation for S-mTFD-MPPB inhibition of α1β3γ2 GABAAR function and provide a first demonstration that an intersubunit-binding site in the GABAAR transmembrane domain binds negative and positive allosteric modulators. PMID:26229099

  20. Water clusters in an argon matrix: infrared spectra from molecular dynamics simulations with a self-consistent charge density functional-based tight binding/force-field potential.

    PubMed

    Simon, Aude; Iftner, Christophe; Mascetti, Joëlle; Spiegelman, Fernand

    2015-03-19

    The present theoretical study aims at investigating the effects of an argon matrix on the structures, energetics, dynamics, and infrared (IR) spectra of small water clusters (H2O)n (n = 1-6). The potential energy surface is obtained from a hybrid self-consistent charge density functional-based tight binding/force-field approach (SCC-DFTB/FF) in which the water clusters are treated at the SCC-DFTB level and the matrix is modeled at the FF level by a cluster consisting of ∼340 Ar atoms with a face centered cubic (fcc) structure, namely (H2O)n/Ar. With respect to a pure FF scheme, this allows a quantum description of the molecular system embedded in the matrix, along with all-atom geometry optimization and molecular dynamics (MD) simulations of the (H2O)n/Ar system. Finite-temperature IR spectra are derived from the MD simulations. The SCC-DFTB/FF scheme is first benchmarked on (H2O)Arn clusters against correlated wave function results and DFT calculations performed in the present work, and against FF data available in the literature. Regarding (H2O)n/Ar systems, the geometries of the water clusters are found to adapt to the fcc environment, possibly leading to intermolecular distortion and matrix perturbation. Several energetical quantities are estimated to characterize the water clusters in the matrix. In the particular case of the water hexamer, substitution and insertion energies for the prism, bag, and cage are found to be lower than that for the 6-member ring isomer. Finite-temperature MD simulations show that the water monomer has a quasifree rotation motion at 13 K, in agreement with experimental data. In the case of the water dimer, the only large-amplitude motion is a distortion-rotation intermolecular motion, whereas only vibration motions around the nuclei equilibrium positions are observed for clusters with larger sizes. Regarding the IR spectra, we find that the matrix environment leads to redshifts of the stretching modes and almost no shift of the

  1. Description of phosphate hydrolysis reactions with the Self-Consistent-Charge Density-Functional-Tight-Binding (SCC-DFTB) theory. 1. Parameterization

    PubMed Central

    Yang, Yang; Yu, Haibo; York, Darrin; Elstner, Marcus

    2009-01-01

    Phosphate chemistry is involved in many key biological processes yet the underlying mechanism often remains unclear. For theoretical analysis to effectively complement experimental mechanistic analysis, it is essential to develop computational methods that can capture the complexity of the underlying potential energy surface and allow for sufficient sampling of the configurational space. To this end, we report the parameterization of an approximate density functional theory, Self-Consistent-Charge Density-Functional Tight-Binding (SCC-DFTB) method for systems containing phosphorus. Compared to high-level density functional theory and ab initio (MP2 and G3B3) results, the standard second-order parameterization is shown to give reliable structures for a diverse set of phosphate compounds but inaccurate energetics. With the on-site third-order terms included, referred to as SCC-DFTBPA, calculated proton affinities of phosphate compounds are substantially improved, although it remains difficult to obtain reliable proton affinity for both phosphates and compounds that do not contain phosphorus, indicating that further improvement in the formulation of SCC-DFTB is still a challenge to meet. To make SCC-DFTB applicable to phosphate reactions in the current (on-site-third-order-only) formulation, a “reaction-specific” parameterization, referred to as SCC-DFTBPR, is developed based on hydrolysis reactions of model phosphate species. Benchmark calculations in both the gas-phase and solution-phase indicate that SCC-DFTBPR gives reliable structural properties and semi-quantitative energetics for phosphate hydrolysis reactions. Since the number of reaction-specific parameters is small, it is likely that SCC-DFTBPR is applicable to a broad set of phosphate species. Indeed, for 56 reaction exothermicities and 47 energy barriers related to RNA catalysis model reactions collected from the QCRNA database, which involve molecules rather different from those used to parameterize

  2. Water clusters in an argon matrix: infrared spectra from molecular dynamics simulations with a self-consistent charge density functional-based tight binding/force-field potential.

    PubMed

    Simon, Aude; Iftner, Christophe; Mascetti, Joëlle; Spiegelman, Fernand

    2015-03-19

    The present theoretical study aims at investigating the effects of an argon matrix on the structures, energetics, dynamics, and infrared (IR) spectra of small water clusters (H2O)n (n = 1-6). The potential energy surface is obtained from a hybrid self-consistent charge density functional-based tight binding/force-field approach (SCC-DFTB/FF) in which the water clusters are treated at the SCC-DFTB level and the matrix is modeled at the FF level by a cluster consisting of ∼340 Ar atoms with a face centered cubic (fcc) structure, namely (H2O)n/Ar. With respect to a pure FF scheme, this allows a quantum description of the molecular system embedded in the matrix, along with all-atom geometry optimization and molecular dynamics (MD) simulations of the (H2O)n/Ar system. Finite-temperature IR spectra are derived from the MD simulations. The SCC-DFTB/FF scheme is first benchmarked on (H2O)Arn clusters against correlated wave function results and DFT calculations performed in the present work, and against FF data available in the literature. Regarding (H2O)n/Ar systems, the geometries of the water clusters are found to adapt to the fcc environment, possibly leading to intermolecular distortion and matrix perturbation. Several energetical quantities are estimated to characterize the water clusters in the matrix. In the particular case of the water hexamer, substitution and insertion energies for the prism, bag, and cage are found to be lower than that for the 6-member ring isomer. Finite-temperature MD simulations show that the water monomer has a quasifree rotation motion at 13 K, in agreement with experimental data. In the case of the water dimer, the only large-amplitude motion is a distortion-rotation intermolecular motion, whereas only vibration motions around the nuclei equilibrium positions are observed for clusters with larger sizes. Regarding the IR spectra, we find that the matrix environment leads to redshifts of the stretching modes and almost no shift of the

  3. Methylation at a transcription factor-binding site on the 5-HT1A receptor gene correlates with negative symptom treatment response in first episode schizophrenia.

    PubMed

    Tang, Hao; Dalton, Caroline F; Srisawat, Umarat; Zhang, Zhi Jun; Reynolds, Gavin P

    2014-04-01

    Individual variability and inadequate response of negative symptoms are major limitations of antipsychotic treatment in schizophrenia. A functional polymorphism, rs6295, in the 5-HT1A-receptor gene (HTR1A) contributes to this variability in negative symptom response. The DNA sequence containing rs6295 is rich in cytosine methylation (CpG) sites; CpG methylation is an epigenetic factor that, like rs6295, can modify transcriptional control. To investigate whether DNA methylation influences response to antipsychotic treatment, we determined methylation at CpG sites close to rs6295 in DNA from 82 Chinese subjects with a first psychotic episode. Methylation of one CpG site within a recognition sequence for HES transcriptional repressors was found to correlate with changes in total PANSS score (p = 0.006) and negative factor sub-score (p < 0.001) following 10 wk initial antipsychotic treatment, as well as with baseline negative factor score (p = 0.019); the effect on symptom change remained after correction for this baseline score. An effect of rs6295 on negative symptom response was not seen in this sample, which may not have provided sufficient power for the pharmacogenetic association. These preliminary results indicate that epigenetic modification of transcriptional regulation by specific cytosine methylation may modulate HTR1A expression, resulting in effects on emotional dysfunction and negative symptom response to antipsychotic treatment. PMID:24331356

  4. Changes in mitochondrial surface charge mediate recruitment of signaling molecules during apoptosis.

    PubMed

    Heit, Bryan; Yeung, Tony; Grinstein, Sergio

    2011-01-01

    Electrostatic interactions with negative lipids contribute to the subcellular localization of polycationic proteins. In situ measurements using cytosolic probes of surface charge indicate that normal mitochondria are not noticeably electronegative. However, during apoptosis mitochondria accrue negative charge and acquire the ability to attract cationic proteins, including K-Ras. The marked increase in the surface charge of mitochondria occurs early in apoptosis, preceding depolarization of their inner membrane, cytochrome c release, and flipping of phosphatidylserine across the plasmalemma. Using novel biosensors, we determined that the increased electronegativity of the mitochondria coincided with and was likely attributable to increased exposure of cardiolipin, which is dianionic. Ectopic (over)expression of cardiolipin-binding proteins precluded the increase in surface charge and inhibited apoptosis, implying that mitochondrial exposure of negatively charged lipids is required for progression of programmed cell death. PMID:20926778

  5. A Switch of G Protein-Coupled Receptor Binding Preference from Phosphoinositide 3-Kinase (PI3K)–p85 to Filamin A Negatively Controls the PI3K Pathway

    PubMed Central

    Najib, Souad; Saint-Laurent, Nathalie; Estève, Jean-Pierre; Schulz, Stefan; Boutet-Robinet, Elisa; Fourmy, Daniel; Lättig, Jens; Mollereau, Catherine; Pyronnet, Stéphane; Susini, Christiane

    2012-01-01

    Frequent oncogenic alterations occur in the phosphoinositide 3-kinase (PI3K) pathway, urging identification of novel negative controls. We previously reported an original mechanism for restraining PI3K activity, controlled by the somatostatin G protein-coupled receptor (GPCR) sst2 and involving a ligand-regulated interaction between sst2 with the PI3K regulatory p85 subunit. We here identify the scaffolding protein filamin A (FLNA) as a critical player regulating the dynamic of this complex. A preexisting sst2-p85 complex, which was shown to account for a significant basal PI3K activity in the absence of ligand, is disrupted upon sst2 activation. FLNA was here identified as a competitor of p85 for direct binding to two juxtaposed sites on sst2. Switching of GPCR binding preference from p85 toward FLNA is determined by changes in the tyrosine phosphorylation of p85- and FLNA-binding sites on sst2 upon activation. It results in the disruption of the sst2-p85 complex and the subsequent inhibition of PI3K. Knocking down FLNA expression, or abrogating FLNA recruitment to sst2, reversed the inhibition of PI3K and of tumor growth induced by sst2. Importantly, we report that this FLNA inhibitory control on PI3K can be generalized to another GPCR, the mu opioid receptor, thereby providing an unprecedented mechanism underlying GPCR-negative control on PI3K. PMID:22203038

  6. The empirical dependence of radiation-induced charge neutralization on negative bias in dosimeters based on the metal-oxide-semiconductor field-effect transistor

    SciTech Connect

    Benson, Chris; Albadri, Abdulrahman; Joyce, Malcolm J.; Price, Robert A.

    2006-08-15

    The dependence of radiation-induced charge neutralization (RICN) has been studied in metal-oxide-semiconductor field-effect transistor (MOSFET) dosimeters. These devices were first exposed to x rays under positive bias and then to further dose increments at a selection of reverse bias levels. A nonlinear empirical trend has been established that is consistent with that identified in the data obtained in this work. Estimates for the reverse bias level corresponding to the maximum rate of RICN have been extracted from the data. These optimum bias levels appear to be independent of the level of initial absorbed dose under positive bias. The established models for threshold voltage change have been considered and indicate a related nonlinear trend for neutralization cross section {sigma}{sub N} as a function of oxide field. These data are discussed in the context of dose measurement with MOSFETs and within the framework of statistical mechanics associated with neutral traps and their field dependence.

  7. Membrane binding properties of IRSp53-missing in metastasis domain (IMD) protein.

    PubMed

    Futó, Kinga; Bódis, Emőke; Machesky, Laura M; Nyitrai, Miklós; Visegrády, Balázs

    2013-11-01

    The 53-kDa insulin receptor substrate protein (IRSp53) organizes the actin cytoskeleton in response to stimulation of small GTPases, promoting the formation of cell protrusions such as filopodia and lamellipodia. IMD is the N-terminal 250 amino acid domain (IRSp53/MIM Homology Domain) of IRSp53 (also called I-BAR), which can bind to negatively charged lipid molecules. Overexpression of IMD induces filopodia formation in cells and purified IMD assembles finger-like protrusions in reconstituted lipid membranes. IMD was shown by several groups to bundle actin filaments, but other groups showed that it also binds to membranes. IMD binds to negatively charged lipid molecules with preference to clusters of PI(4,5)P2. Here, we performed a range of different in vitro fluorescence experiments to determine the binding properties of the IMD to phospholipids. We used different constructs of large unilamellar vesicles (LUVETs), containing neutral or negatively charged phospholipids. We found that IMD has a stronger binding interaction with negatively charged PI(4,5)P2 or PS lipids than PS/PC or neutral PC lipids. The equilibrium dissociation constant for the IMD-lipid interaction falls into the 78-170μM range for all the lipids tested. The solvent accessibility of the fluorescence labels on the IMD during its binding to lipids is also reduced as the lipids become more negatively charged. Actin affects the IMD-lipid interaction, depending on its polymerization state. Monomeric actin partially disrupts the binding, while filamentous actin can further stabilize the IMD-lipid interaction. PMID:23872532

  8. Nicotinic acetylcholine receptor expression on B-lymphoblasts of healthy versus schizophrenic subjects stratified for smoking: [3H]-nicotine binding is decreased in schizophrenia and correlates with negative symptoms.

    PubMed

    Luckhaus, Christian; Henning, Uwe; Ferrea, Stefano; Musso, Francesco; Mobascher, Arian; Winterer, Georg

    2012-05-01

    Heavy smoking and schizophrenia are diversely associated with nicotinic acetylcholine receptor expression, as was shown for brain and lymphocytes. Most studies so far have not systematically differentiated between schizophrenia smokers and non-smokers and were confined either to in vivo or post-mortem study approaches. In order to avoid variable in vivo influences or post-mortem bias, we used stably transformed B-lymphoblast cultures derived from healthy and schizophrenia subjects stratified for smoking versus non-smoking in order to differentiate these clinical conditions with regard to nicotinic acetylcholine receptor expression and regulation. Receptor quantities were measured using [(3)H]-nicotine and [(3)H]-epibatidine binding. At baseline, [(3)H]-nicotine binding was not statistically different between healthy smokers and never-smokers (1.59 ± 0.73 vs. 1.26 ± 0.91 fmol/10(6) cells), while it was reduced in schizophrenia smokers compared to healthy smokers (1.05 ± 0.69 fmol vs. 1.44 ± 0.84/10(6) cells, P = 0.01). In schizophrenia, baseline [(3)H]-nicotine correlated inversely with higher PANSS negative subscale scores. After long-term nicotine incubation (1 μM), [3H]-nicotine binding increased in the group of schizophrenia smokers only (from 1.05 ± 0.69 to 1.54 ± 0.77 fmol/106 cells, P = 0.013), while [(3)H]-epibatidine binding decreased in this group (4.52 ± 1.52 to 3.82 ± 1.38 fmol/10(6) cells, P = 0.038). Our data are in further support of a decrease of nicotinic acetylcholine receptor expression in schizophrenia linked to negative psychotic symptoms, which may be counter-regulated by nicotine exposure.

  9. Melittin binding to mixed phosphatidylglycerol/phosphatidylcholine membranes

    SciTech Connect

    Beschiaschvili, G.; Seelig, J. )

    1990-01-09

    The binding of bee venom melittin to negatively charged unilamellar vesicles and planar lipid bilayers composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) was studied with circular dichroism and deuterium NMR spectroscopy. The melittin binding isotherm was measured for small unilamellar vesicles containing 10 or 20 mol % POPG. Due to electrostatic attraction, binding of the positively charged melittin was much enhanced as compared to the binding to neutral lipid vesicles. However, after correction for electrostatic effects by means of the Gouy-Chapman theory, all melittin binding isotherms could be described by a partition Kp = (4.5 +/- 0.6) x 10(4) M-1. It was estimated that about 50% of the total melittin surface was embedded in a hydrophobic environment. The melittin partition constant for small unilamellar vesicles was by a factor of 20 larger than that of planar bilayers and attests to the tighter lipid packing in the nonsonicated bilayers. Deuterium NMR studies were performed with coarse lipid dispersions. Binding of melittin to POPC/POPG (80/20 mol/mol) membranes caused systematic changes in the conformation of the phosphocholine and phosphoglycerol head groups which were ascribed to the influence of electrostatic charge on the choline dipole. While the negative charge of phosphatidylglycerol moved the N+ end of the choline -P-N+ dipole toward the bilayer interior, the binding of melittin reversed this effect and rotated the N+ end toward the aqueous phase. No specific melittin-POPG complexes could be detected. The phosphoglycerol head group was less affected by melittin binding than its choline counterpart.

  10. Multiplicity distribution and spectra of negatively charged hadrons in Au+Au collisions at square root of (sNN) = 130 GeV.

    PubMed

    Adler, C; Ahammed, Z; Allgower, C; Amonett, J; Anderson, B D; Anderson, M; Averichev, G S; Balewski, J; Barannikova, O; Barnby, L S; Baudot, J; Bekele, S; Belaga, V V; Bellwied, R; Berger, J; Bichsel, H; Bland, L C; Blyth, C O; Bonner, B E; Bossingham, R; Boucham, A; Brandin, A; Caines, H; Calderón De La Barca Sánchez, M; Cardenas, A; Carroll, J; Castillo, J; Castro, M; Cebra, D; Chattopadhyay, S; Chen, M L; Chen, Y; Chernenko, S P; Cherney, M; Chikanian, A; Choi, B; Christie, W; Coffin, J P; Conin, L; Cormier, T M; Cramer, J G; Crawford, H J; DeMello, M; Deng, W S; Derevschikov, A A; Didenko, L; Draper, J E; Dunin, V B; Dunlop, J C; Eckardt, V; Efimov, L G; Emelianov, V; Engelage, J; Eppley, G; Erazmus, B; Fachini, P; Finch, E; Fisyak, Y; Flierl, D; Foley, K J; Fu, J; Gagunashvili, N; Gans, J; Gaudichet, L; Germain, M; Geurts, F; Ghazikhanian, V; Grabski, J; Grachov, O; Greiner, D; Grigoriev, V; Guedon, M; Gushin, E; Hallman, T J; Hardtke, D; Harris, J W; Heffner, M; Heppelmann, S; Herston, T; Hippolyte, B; Hirsch, A; Hjort, E; Hoffmann, G W; Horsley, M; Huang, H Z; Humanic, T J; Hümmler, H; Igo, G; Ishihara, A; Ivanshin, Y I; Jacobs, P; Jacobs, W W; Janik, M; Johnson, I; Jones, P G; Judd, E; Kaneta, M; Kaplan, M; Keane, D; Kisiel, A; Klay, J; Klein, S R; Klyachko, A; Konstantinov, A S; Kotchenda, L; Kovalenko, A D; Kramer, M; Kravtsov, P; Krueger, K; Kuhn, C; Kulikov, A I; Kunde, G J; Kunz, C L; Kutuev, R K; Kuznetsov, A A; Lakehal-Ayat, L; Lamas-Valverde, J; Lamont, M A; Landgraf, J M; Lange, S; Lansdell, C P; Lasiuk, B; Laue, F; Lebedev, A; LeCompte, T; Lednický, R; Leontiev, V M; Leszczynski, P; LeVine, M J; Li, Q; Li, Q; Lindenbaum, S J; Lisa, M A; Ljubicic, T; Llope, W J; LoCurto, G; Long, H; Longacre, R S; Lopez-Noriega, M; Love, W A; Lynn, D; Majka, R; Maliszewski, A; Margetis, S; Martin, L; Marx, J; Matis, H S; Matulenko, Y A; McShane, T S; Meissner, F; Melnick, Y; Meschanin, A; Messer, M; Miller, M L; Milosevich, Z; Minaev, N G; Mitchell, J; Moiseenko, V A; Moltz, D; Moore, C F; Morozov, V; de Moura, M M; Munhoz, M G; Mutchler, G S; Nelson, J M; Nevski, P; Nikitin, V A; Nogach, L V; Norman, B; Nurushev, S B; Odyniec, G; Ogawa, A; Okorokov, V; Oldenburg, M; Olson, D; Paic, G; Pandey, S U; Panebratsev, Y; Panitkin, S Y; Pavlinov, A I; Pawlak, T; Perevoztchikov, V; Peryt, W; Petrov, V A; Pinganaud, W; Platner, E; Pluta, J; Porile, N; Porter, J; Poskanzer, A M; Potrebenikova, E; Prindle, D; Pruneau, C; Radomski, S; Rai, G; Ravel, O; Ray, R L; Razin, S V; Reichhold, D; Reid, J G; Retiere, F; Ridiger, A; Ritter, H G; Roberts, J B; Rogachevski, O V; Romero, J L; Roy, C; Russ, D; Rykov, V; Sakrejda, I; Sandweiss, J; Saulys, A C; Savin, I; Schambach, J; Scharenberg, R P; Schweda, K; Schmitz, N; Schroeder, L S; Schüttauf, A; Seger, J; Seliverstov, D; Seyboth, P; Shahaliev, E; Shestermanov, K E; Shimanskii, S S; Shvetcov, V S; Skoro, G; Smirnov, N; Snellings, R; Sowinski, J; Spinka, H M; Srivastava, B; Stephenson, E J; Stock, R; Stolpovsky, A; Strikhanov, M; Stringfellow, B; Stroebele, H; Struck, C; Suaide, A A; Sugarbaker, E; Suire, C; Sumbera, M; Symons, T J; Szanto De Toledo, A; Szarwas, P; Takahashi, J; Tang, A H; Thomas, J H; Tikhomirov, V; Trainor, T A; Trentalange, S; Tokarev, M; Tonjes, M B; Trofimov, V; Tsai, O; Turner, K; Ullrich, T; Underwood, D G; Van Buren, G; VanderMolen, A M; Vanyashin, A; Vasilevski, I M; Vasiliev, A N; Vigdor, S E; Voloshin, S A; Wang, F; Ward, H; Watson, J W; Wells, R; Wenaus, T; Westfall, G D; Whitten, C; Wieman, H; Willson, R; Wissink, S W; Witt, R; Xu, N; Xu, Z; Yakutin, A E; Yamamoto, E; Yang, J; Yepes, P; Yokosawa, A; Yurevich, V I; Zanevski, Y V; Zborovský, I; Zhang, W M; Zoulkarneev, R; Zubarev, A N

    2001-09-10

    The minimum-bias multiplicity distribution and the transverse momentum and pseudorapidity distributions for central collisions have been measured for negative hadrons ( h(-)) in Au+Au interactions at square root of ([s(NN)]) = 130 GeV. The multiplicity density at midrapidity for the 5% most central interactions is dN(h(-))/d(eta)/(eta = 0) = 280+/-1(stat)+/-20(syst), an increase per participant of 38% relative to pp collisions at the same energy. The mean transverse momentum is 0.508+/-0.012 GeV/c and is larger than in central Pb+Pb collisions at lower energies. The scaling of the h(-) yield per participant is a strong function of p( perpendicular). The pseudorapidity distribution is almost constant within /eta/<1. PMID:11531517

  11. Charge and aggregation pattern govern the interaction of plasticins with LPS monolayers mimicking the external leaflet of the outer membrane of Gram-negative bacteria.

    PubMed

    Michel, J P; Wang, Y X; Dé, E; Fontaine, P; Goldmann, M; Rosilio, V

    2015-11-01

    Bacterial resistance to antibiotics has become today a major public health issue. In the development of new anti-infectious therapies, antimicrobial peptides appear as promising candidates. However, their mechanisms of action against bacterial membranes are still poorly understood. We describe for the first time the interaction and penetration of plasticins into lipid monolayers and bilayers modeling the two leaflets of the asymmetrical outer membrane of Gram-negative bacteria. The lipid composition of these monolayers mimics that of each leaflet: mixtures of LPS Re 595 mutant and wild type S-form from Salmonella enterica for the external leaflet, and SOPE/SOPG/cardiolipin (80/15/5) for the inner one. The analysis of the interfacial behavior of native (PTCDA1) and modified (PTCDA1-KF) antimicrobial plasticins showed that PTCDA1-KF exhibited better surface properties than its unmodified counterpart. Both peptides could penetrate into the model monolayers at concentrations higher than 0.1 μM. The penetration was particularly enhanced for PTCDA1-KF into the mixed LPS monolayer, due to attractive electrostatic interactions. Grazing X-ray diffraction and atomic force microscopy studies revealed the changes in LPS monolayers organization upon peptide insertion. The interaction of plasticins with liposomes was also monitored by light scattering and circular dichroism techniques. Only the cationic plasticin achieved full disaggregation and structuration in α helices, whereas the native one remained aggregated and unstructured. The main steps of the penetration mechanism of the two plasticins into lipid models of the external leaflet of the outer membrane of Gram-negative bacteria have been established.

  12. Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

    NASA Astrophysics Data System (ADS)

    Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

    2013-11-01

    The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges -5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol-1) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non-periodic PB

  13. Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

    SciTech Connect

    Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

    2013-11-14

    The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges −5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol{sup −1}) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non

  14. Binding affinity between dietary polyphenols and β-lactoglobulin negatively correlates with the protein susceptibility to digestion and total antioxidant activity of complexes formed.

    PubMed

    Stojadinovic, Marija; Radosavljevic, Jelena; Ognjenovic, Jana; Vesic, Jelena; Prodic, Ivana; Stanic-Vucinic, Dragana; Cirkovic Velickovic, Tanja

    2013-02-15

    Non-covalent interactions between β-lactoglobulin (BLG) and polyphenol extracts of teas, coffee and cocoa were studied by fluorescence and CD spectroscopy at pH values of the gastrointestinal tract (GIT). The biological implications of non-covalent binding of polyphenols to BLG were investigated by in vitro pepsin and pancreatin digestibility assay and ABTS radical scavenging activity of complexes formed. The polyphenol-BLG systems were stable at pH values of the GIT. The most profound effect of pH on binding affinity was observed for polyphenol extracts rich in phenolic acids. Stronger non-covalent interactions delayed pepsin and pancreatin digestion of BLG and induced β-sheet to α-helix transition at neutral pH. All polyphenols tested protected protein secondary structure at an extremely acidic pH of 1.2. A positive correlation was found between the strength of protein-polyphenol interactions and (a) half time of protein decay in gastric conditions (R(2)=0.85), (b) masking of total antioxidant capacity of protein-polyphenol complexes (R(2)=0.95).

  15. Phosphorylation of S344 in the calmodulin-binding domain negatively affects CCaMK function during bacterial and fungal symbioses.

    PubMed

    Routray, Pratyush; Miller, J Benjamin; Du, Liqun; Oldroyd, Giles; Poovaiah, B W

    2013-10-01

    Calcium and Ca(2+)/calmodulin-dependent protein kinase (CCaMK) plays a critical role in the signaling pathway that establishes root nodule symbiosis and arbuscular mycorrhizal symbiosis. Calcium-dependent autophosphorylation is central to the regulation of CCaMK, and this has been shown to promote calmodulin binding. Here, we report a regulatory mechanism of Medicago truncatula CCaMK (MtCCaMK) through autophosphorylation of S344 in the calmodulin-binding/autoinhibitory domain. The phospho-ablative mutation S344A did not have significant effect on its kinase activities, and supports root nodule symbiosis and arbuscular mycorrhizal symbiosis, indicating that phosphorylation at this position is not required for establishment of symbioses. The phospho-mimic mutation S344D show drastically reduced calmodulin-stimulated substrate phosphorylation, and this coincides with a compromised interaction with calmodulin and its interacting partner, IPD3. Functional complementation tests revealed that the S344D mutation blocked root nodule symbiosis and reduced the mycorrhizal association. Furthermore, S344D was shown to suppress the spontaneous nodulation associated with a gain-of-function mutant of MtCCaMK (T271A), revealing that phosphorylation at S344 of MtCCaMK is adequate for shutting down its activity, and is epistatic over previously identified T271 autophosphorylation. These results reveal a mechanism that enables CCaMK to 'turn off' its function through autophosphorylation.

  16. Suppression of telomere-binding protein TPP1 resulted in telomere dysfunction and enhanced radiation sensitivity in telomerase-negative osteosarcoma cell line

    SciTech Connect

    Qiang, Weiguang; Wu, Qinqin; Zhou, Fuxiang; Xie, Conghua; Wu, Changping; Zhou, Yunfeng

    2014-03-07

    Highlights: • Down-regulation of TPP1 shortened telomere length in telomerase-negative cells. • Down-regulation of TPP1 induced cell apoptosis in telomerase-negative cells. • Down-regulation of TPP1 increased radiosensitivity in telomerase-negative cells. - Abstract: Mammalian telomeres are protected by the shelterin complex that contains the six core proteins POT1, TPP1, TIN2, TRF1, TRF2 and RAP1. TPP1, formerly known as TINT1, PTOP, and PIP1, is a key factor that regulates telomerase recruitment and activity. In addition to this, TPP1 is required to mediate the shelterin assembly and stabilize telomere. Previous work has found that TPP1 expression was elevated in radioresistant cells and that overexpression of TPP1 led to radioresistance and telomere lengthening in telomerase-positive cells. However, the exact effects and mechanism of TPP1 on radiosensitivity are yet to be precisely defined in the ALT cells. Here we report on the phenotypes of the conditional deletion of TPP1 from the human osteosarcoma U2OS cells using ALT pathway to extend the telomeres.TPP1 deletion resulted in telomere shortening, increased apoptosis and radiation sensitivity enhancement. Together, our findings show that TPP1 plays a vital role in telomere maintenance and protection and establish an intimate relationship between TPP1, telomere and cellular response to ionizing radiation, but likely has the specific mechanism yet to be defined.

  17. Mutation of the phospholipase C-γ1–binding site of LAT affects both positive and negative thymocyte selection

    PubMed Central

    Sommers, Connie L.; Lee, Jan; Steiner, Kevin L.; Gurson, Jordan M.; DePersis, Corinne L.; El-Khoury, Dalal; Fuller, Claudette L.; Shores, Elizabeth W.; Love, Paul E.; Samelson, Lawrence E.

    2005-01-01

    Linker for activation of T cells (LAT) is a scaffolding adaptor protein that is critical for T cell development and function. A mutation of LAT (Y136F) that disrupts phospholipase C-γ1 activation and subsequent calcium influx causes a partial block in T cell development and leads to a severe lymphoproliferative disease in homozygous knock-in mice. One possible contribution to the fatal disease of LAT Y136F knock-in mice could be from autoreactive T cells generated in these mice because of altered thymocyte selection. To examine the impact of the LAT Y136F mutation on thymocyte positive and negative selection, we bred this mutation onto the HY T cell receptor (TCR) transgenic, recombination activating gene-2 knockout background. Female mice with this genotype showed a severe defect in positive selection, whereas male mice exhibited a phenotype resembling positive selection (i.e., development and survival of CD8hi HY TCR-specific T cells) instead of negative selection. These results support the hypothesis that in non-TCR transgenic, LAT Y136F knock-in mice, altered thymocyte selection leads to the survival and proliferation of autoreactive T cells that would otherwise be negatively selected in the thymus. PMID:15795236

  18. A Highly Active and Negatively Charged Streptococcus pyogenes Lysin with a Rare d-Alanyl-l-Alanine Endopeptidase Activity Protects Mice against Streptococcal Bacteremia

    PubMed Central

    Lood, Rolf; Raz, Assaf; Molina, Henrik; Euler, Chad W.

    2014-01-01

    Bacteriophage endolysins have shown great efficacy in killing Gram-positive bacteria. PlyC, a group C streptococcal phage lysin, represents the most efficient lysin characterized to date, with a remarkably high specificity against different streptococcal species, including the important pathogen Streptococcus pyogenes. However, PlyC is a unique lysin, in terms of both its high activity and structure (two distinct subunits). We sought to discover and characterize a phage lysin active against S. pyogenes with an endolysin architecture distinct from that of PlyC to determine if it relies on the same mechanism of action as PlyC. In this study, we identified and characterized an endolysin, termed PlyPy (phage lysin from S. pyogenes), from a prophage infecting S. pyogenes. By in silico analysis, PlyPy was found to have a molecular mass of 27.8 kDa and a pI of 4.16. It was active against a majority of group A streptococci and displayed high levels of activity as well as binding specificity against group B and C streptococci, while it was less efficient against other streptococcal species. PlyPy showed the highest activity at neutral pH in the presence of calcium and NaCl. Surprisingly, its activity was not affected by the presence of the group A-specific carbohydrate, while the activity of PlyC was partly inhibited. Additionally, PlyPy was active in vivo and could rescue mice from systemic bacteremia. Finally, we developed a novel method to determine the peptidoglycan bond cleaved by lysins and concluded that PlyPy exhibits a rare d-alanyl-l-alanine endopeptidase activity. PlyPy thus represents the first lysin characterized from Streptococcus pyogenes and has a mechanism of action distinct from that of PlyC. PMID:24637688

  19. Membrane potential mediates the cellular binding of nanoparticles

    NASA Astrophysics Data System (ADS)

    Shin, Edwin H.; Li, Ye; Kumar, Umesh; Sureka, Hursh V.; Zhang, Xianren; Payne, Christine K.

    2013-06-01

    The use of nanoparticles for cellular therapeutic or sensing applications requires nanoparticles to bind, or adhere, to the cell surface. While nanoparticle parameters such as size, shape, charge, and composition are important factors in cellular binding, the cell itself must also be considered. All cells have an electrical potential across the plasma membrane driven by an ion gradient. Under standard conditions the ion gradient will result in a -10 to -100 mV potential across the membrane with a net negative charge on the cytosolic face. Using a combination of flow cytometry and fluorescence microscopy experiments and dissipative particle dynamics simulations, we have found that a decrease in membrane potential leads to decreased cellular binding of anionic nanoparticles. The decreased cellular binding of anionic nanoparticles is a general phenomenon, independent of depolarization method, nanoparticle composition, and cell type. Increased membrane potential reverses this trend resulting in increased binding of anionic nanoparticles. The cellular binding of cationic nanoparticles is minimally affected by membrane potential due to the interaction of cationic nanoparticles with cell surface proteins. The influence of membrane potential on the cellular binding of nanoparticles is especially important when considering the use of nanoparticles in the treatment or detection of diseases, such as cancer, in which the membrane potential is decreased.The use of nanoparticles for cellular therapeutic or sensing applications requires nanoparticles to bind, or adhere, to the cell surface. While nanoparticle parameters such as size, shape, charge, and composition are important factors in cellular binding, the cell itself must also be considered. All cells have an electrical potential across the plasma membrane driven by an ion gradient. Under standard conditions the ion gradient will result in a -10 to -100 mV potential across the membrane with a net negative charge on the

  20. Charged fullerenes as high-capacity hydrogen storage media.

    PubMed

    Yoon, Mina; Yang, Shenyuan; Wang, Enge; Zhang, Zhenyu

    2007-09-01

    Using first-principles calculations within density functional theory, we explore systematically the capacity of charged carbon fullerenes Cn (20 binding strength of molecular hydrogen on either positively or negatively charged fullerenes can be dramatically enhanced to 0.18-0.32 eV, a desirable range for potential room-temperature, near ambient applications. The enhanced binding is delocalized in nature, surrounding the whole surface of a charged fullerene, and is attributed to the polarization of the hydrogen molecules by the high electric field generated near the surface of the charged fullerene. At full hydrogen coverage, these charged fullerenes can gain storage capacities of up to approximately 8.0 wt %. We also find that, contrary to intuitive expectation, fullerenes containing encapsulated metal atoms only exhibit negligible enhancement in the hydrogen binding strength, because the charge donated by the metal atoms is primarily confined inside the fullerene cages. These predictions may prove to be instrumental in searching for a new class of high-capacity hydrogen storage media.

  1. Influence of negatively charged plume grains on the structure of Enceladus' Alfvén wings: Hybrid simulations versus Cassini Magnetometer data

    NASA Astrophysics Data System (ADS)

    Kriegel, Hendrik; Simon, Sven; Motschmann, Uwe; Saur, Joachim; Neubauer, Fritz M.; Persoon, Ann M.; Dougherty, Michele K.; Gurnett, Donald A.

    2011-10-01

    We apply the hybrid simulation code AIKEF (adaptive ion kinetic electron fluid) to the interaction between Enceladus' plume and Saturn's magnetospheric plasma. For the first time, the influence of the electron-absorbing dust grains in the plume on the plasma structures and magnetic field perturbation, the Alfvén wing, is taken into account within the framework of a global simulation. Our work continues the analytical calculations by Simon et al. (2011), who showed that electron absorption within the plume leads to a negative sign of the Hall conductivity. The resulting twist of the magnetic field, referred to as the Anti-Hall effect, has been observed during all targeted Enceladus flybys between 2005 and 2010. We show that (1) applying a plume model that considers both, the neutral gas and the dust allow us to quantitatively explain Cassini Magnetometer (MAG) data, (2) dust enhances the anti-Saturnward deflection of the ions, causing asymmetries which are evident in the MAG data, and (3) the ions in the plume are slowed down below 1 km s-1; and we compare our results to MAG data in order to systematically analyze variations in the plume activity and orientation for selected pairs of similar flybys: (E5, E6), (E7, E9) and (E8, E11).

  2. Overlapping protein-binding sites within a negative regulatory element modulate the brain-preferential expression of the human HPRT gene

    SciTech Connect

    Rincon-Limas, D.E.; Amaya-Manzanares, E.; Nino-Rosales, M.L.

    1994-09-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene, whose deficiency in humans causes the Lesch-Nyhan syndrome, is constitutively expressed at low levels in all tissues but at higher levels in the brain, the significance and mechanism of which is unknown. Towards dissecting this molecular mechanism, we have previously identified a 182 bp element (hHPRT-NE) within the 5{prime}-flanking region of the human HPRT gene which is involved not only in conferring neuronal specificity but also in repressing gene expression in non-neuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation, as demonstrated by RT-PCR and RNAase protection assays. We also mapped the binding sites for both complexes to a 60 bp region which, when tested by transient transfections in cultured fibroblasts, functioned as a repressor element. Methylation interference footprinting revealed a minimal unique DNA motif as the binding site for nuclear proteins from both neuronal and non-neuronal sources. Moreover, UV-crosslinking experiments showed that both complexes are formed by the association of several distinct proteins. Strikingly, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the association of these two complexes. These data suggest that differential formation of DNA-protein complexes at this regulatory domain could be a major determinant in the brain-preferential expression of the human HPRT gene.

  3. Thermodynamics of Ion Pair Formations Between Charged Poly(Amino Acid)s.

    PubMed

    Petrauskas, Vytautas; Maximowitsch, Eglė; Matulis, Daumantas

    2015-09-17

    Electrostatic interactions between the positively and negatively charged amino acids in proteins play an important role in macromolecular stability, binding, and recognition. Numerous amino acids in proteins are ionizable and may exist in negatively (e.g., Glu, Asp, Cys, Tyr) or positively (e.g., Arg, Lys, His, Orn) charged form dependent on pH and their pKas. In this work, isothermal titration calorimetry was used to determine the average standard values of thermodynamic parameters (the Gibbs free energy, enthalpy, entropy, and the heat capacity) of interaction between the positively charged amino acid homopolymers (polyarginine, polylysine, and polyornithine) and the negatively charged homopolymers (polyaspartic and polyglutamic acids). These values are of potential use in the computational models of interacting proteins and other biological macromolecules. The study showed that oppositely charged poly(amino acid)s bound each other with the stoichiometry of one positive to one negative charge. Arginine bound to the negatively charged amino acids with exothermic enthalpy and higher affinity than lysine. This result also suggests that positive charges in proteins should not be considered entirely equivalent if carried by lysine or arginine. The difference in binding energy of arginine and lysine association with the negatively charged amino acids was attributed to the enthalpy of the second ionic hydrogen bond formation between the guanidine and carboxylic groups. Despite the favorable enthalpic contribution, all such ion pair formation reactions were largely entropy-driven. Consistent with previously observed ionic interactions, the positive heat capacity was always observed during the amino acid ion pair formation.

  4. Unique charge distribution in surface loops confers high velocity on the fast motor protein Chara myosin.

    PubMed

    Ito, Kohji; Yamaguchi, Yukie; Yanase, Kenji; Ichikawa, Yousuke; Yamamoto, Keiichi

    2009-12-22

    Most myosins have a positively charged loop 2 with a cluster of lysine residues that bind to the negatively charged N-terminal segment of actin. However, the net charge of loop 2 of very fast Chara myosin is zero and there is no lysine cluster in it. In contrast, Chara myosin has a highly positively charged loop 3. To elucidate the role of these unique surface loops of Chara myosin in its high velocity and high actin-activated ATPase activity, we have undertaken mutational analysis using recombinant Chara myosin motor domain. It was found that net positive charge in loop 3 affected V(max) and K(app) of actin activated ATPase activity, while it affected the velocity only slightly. The net positive charge in loop 2 affected K(app) and the velocity, although it did not affect V(max). Our results suggested that Chara myosin has evolved to have highly positively charged loop 3 for its high ATPase activity and have less positively charged loop 2 for its high velocity. Since high positive charge in loop 3 and low positive charge in loop 2 seem to be one of the reasons for Chara myosin's high velocity, we manipulated charge contents in loops 2 and 3 of Dictyostelium myosin (class II). Removing positive charge from loop 2 and adding positive charge to loop 3 of Dictyostelium myosin made its velocity higher than that of the wild type, suggesting that the charge strategy in loops 2 and 3 is widely applicable.

  5. Fusion of the Fc part of human IgG1 to CD14 enhances its binding to gram-negative bacteria and mediates phagocytosis by Fc receptors of neutrophils.

    PubMed

    Vida, András; Bardoel, Bart; Milder, Fin; Majoros, László; Sümegi, Andrea; Bácsi, Attila; Vereb, György; van Kessel, Kok P M; van Strijp, Jos A G; Antal-Szalmás, Péter

    2012-08-30

    Microbial resistance to antimicrobial drugs is promoting a search for new antimicrobial agents that target highly conservative structures of pathogens. Human CD14 - a known pattern recognition receptor (PRR) which recognizes multiple ligands from different microbes might be a worthy candidate. The aim of our work was to create a CD14/Fc dimer protein and evaluate its whole bacteria binding and opsonizing capabilities. Fusion of CD14 with the fragment crystallisable (Fc) part of human IgG1 could not only lead to an artificial opsonin but the dimerization through the Fc part might also increase its affinity to different ligands. Human CD14 and the Fc part of human IgG1 was fused and expressed in HEK293 cells. A histidine tagged CD14 (CD14/His) was also expressed as control. Using flow cytometry we could prove that CD14/Fc bound to whole Gram-negative bacteria, especially to short lipopolysaccharide (Ra and Re) mutants, and weak interaction was observed between the fusion protein and Listeria monocytogenes. Other Gram-positive bacteria and fungi did not show any association with CD14/Fc. CD14/His showed about 50-times less potent binding to Gram-negative bacteria. CD14/Fc acted as an opsonin and enhanced phagocytosis of these bacteria by neutrophil granulocytes, monocyte-derived macrophages and dendritic cells. Internalization of bacteria was confirmed by trypan blue quenching and confocal microscopy. On neutrophils the Fc part of the fusion protein was recognized by Fc receptors (CD16, CD32), as determined by blocking experiments. CD14/Fc enhanced the killing of bacteria in an ex vivo whole blood assay. Our experiments confirm that PRR/Fc fusion proteins can give a boost to FcR dependent phagocytosis and killing provided the antimicrobial part binds efficiently to microbes.

  6. Surface charge effects in protein adsorption on nanodiamonds

    NASA Astrophysics Data System (ADS)

    Aramesh, M.; Shimoni, O.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins (bovine serum albumin and lysozyme) of different properties (charge, molecular weight and rigidity), the main driving mechanism responsible for the protein binding to the charged nanoparticles was identified. Electrostatic interactions were found to dominate the protein adsorption dynamics, attachment and conformation. We developed a simple electrostatic model that can qualitatively explain the observed adsorption behaviour based on charge-induced pH modifications near the charged nanoparticle surfaces. Under neutral conditions, the local pH around the positively and negatively charged nanodiamonds becomes very high (11-12) and low (1-3) respectively, which has a profound impact on the protein charge, hydration and affinity to the nanodiamonds. Small proteins (lysozyme) were found to form multilayers with significant conformational changes to screen the surface charge, while larger proteins (albumin) formed monolayers with minor conformational changes. The findings of this study provide a step forward toward understanding and eventually predicting nanoparticle interactions with biofluids.Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins

  7. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    NASA Astrophysics Data System (ADS)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  8. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies.

    PubMed

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N(+)-H⋯O(-) type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  9. Nanoparticle coagulation in fractionally charged and charge fluctuating dusty plasmas

    SciTech Connect

    Nunomura, Shota; Kondo, Michio; Shiratani, Masaharu; Koga, Kazunori; Watanabe, Yukio

    2008-08-15

    The kinetics of nanoparticle coagulation has been studied in fractionally charged and charge fluctuating dusty plasmas. The coagulation occurs when the mutual collision frequency among nanoparticles exceeds their charging and decharging/neutralization frequency. Interestingly, the coagulation is suppressed while a fraction (several percent) of nanoparticles are negatively charged in a plasma, in which stochastic charging plays an important role. A model is developed to predict a phase diagram of the coagulation and its suppression.

  10. How Do Structure and Charge Affect Metal-Complex Binding to DNA? An Upper-Division Integrated Laboratory Project Using Cyclic Voltammetry

    ERIC Educational Resources Information Center

    Kulczynska, Agnieszka; Johnson, Reed; Frost, Tony; Margerum, Lawrence D.

    2011-01-01

    An advanced undergraduate laboratory project is described that integrates inorganic, analytical, physical, and biochemical techniques to reveal differences in binding between cationic metal complexes and anionic DNA (herring testes). Students were guided to formulate testable hypotheses based on the title question and a list of different metal…

  11. Serum retinol binding protein 4 is negatively related to beta cell function in Chinese women with non-alcoholic fatty liver disease: a cross-sectional study

    PubMed Central

    2013-01-01

    Background To observe the relationship between serum retinol binding protein 4(RBP4) and β cell function in Chinese subjects with non-alcoholic fatty liver disease (NAFLD) and without known diabetes. Methods 106 patients diagnosed as fatty liver by ultrasonography (M/F: 61/45; aged 47.44 ± 14.16 years) were enrolled in our current cross-sectional study. Subjects with known diabetes, chronic virus hepatitis and excessive alcohol consumption were excluded. Serum RBP4 was detected by ELISA and validated by quantitative Western blotting. β cell function were assessed by HOMA in all subjects and by hyperglycemic clamp in 17 normal glucose tolerance subjects (M = 6, F = 11). Results The levels of serum RBP4 in men were higher than that in women (55.96 ± 11.14 vs 45.87 ± 10.31 μg/ml, p < 0.001). Pearson’s correlation analysis demonstrated that in women, serum RBP4 levels were significantly associated with fasting blood glucose (FBG), HOMA-β, and increment of first phase insulin secretion (1PH), but not associated with age, BMI, waist circumference, WHR, systolic (SBP) and diastolic blood pressure (DBP), TC, TG, HDL-c, LDL-c, 2 h blood glucose, HOMA-IR, ALT, AST, γ-GT, hepatic fat content (HFC), and insulin sensitivity index (ISI). However, in men, serum RBP4 levels were significantly associated with HDL-c, ALT, AST, but not associated with any other parameters as mentioned above. A stepwise multiple linear regression analysis demonstrated that in women, HOMA-IR and RBP4 were significantly associated with HOMA-β, while in men, HOMA-IR and BMI were significantly variables associated with HOMA-β. Conclusions Serum RBP4, secreted mainly by liver and adipose tissue, may involve in the pathogenesis of β cell dysfunction in Chinese women patients with NAFLD. PMID:24160775

  12. Freeze-fracture cytochemistry of rat glomerular capillary tuft. Determination of wheat germ agglutinin binding sites and localization of anionic charges.

    PubMed

    Chevalier, J; Appay, M D; Wang, X Y; Bariety, J; Pinto Da Silva, P

    1987-12-01

    We propose here the use of freeze-fracture to gain access and to label in vitro glomerular components and locate WGA receptors and anionic sites. Tissues are frozen, fractured under liquid nitrogen, and thawed. Freeze-fracture rendered all glomerular structures directly accessible to the reagents. This made possible study of the nature and topology of cationized ferritin and WGA binding sites. WGA-gold complexes were observed over plasma membranes of podocytes and of endothelial and mesangial cells. Labeling of podocytes and endothelial cells was similar in the mesangial area and in the peripheral part of the capillary loop. Cross-fractures of extracellular matrices showed that WGA bound uniformly to the glomerular basement membrane (GBM) as well as to mesangial matrix. In fractured specimens treated with neuraminidase, WGA was no longer observed over podocytes but it consistently labeled the surface of endothelial and mesangial cells. Whereas in GBM cross-sections WGA binding was greatly reduced or even abolished, it remained unmodified in the mesangium. This shows that only NeuNAc (sialic acid) might account for the binding of WGA to podocytes, whereas GlcNAcs appear to be the main WGA binding sites on endothelial and mesangial cells and in the mesangial matrix. Both NeuNAc and GLcNAc residues are probably associated in GBM. With cationized ferritin (pI 8.3) at pH 7.4, intense, continuous labeling was seen all over the different plasma membranes, denser in podocytes than in endothelial cells. CF was also observed in cross-fractured profiles of extracellular matrices and never appeared agglutinated in discrete sites. PMID:3680932

  13. Binding interaction of differently charged fluorescent probes with egg yolk phosphatidylcholine and the effect of β-cyclodextrin on the lipid-probe complexes: a fluorometric investigation.

    PubMed

    Kundu, Pronab; Ghosh, Saptarshi; Jana, Barnali; Chattopadhyay, Nitin

    2015-05-01

    Interaction of cationic phenosafranin (PSF), anionic 8-anilino-1-naphthalene sulfonate (ANS) and non-ionic nile red (NR) have been studied with the zwitterionic phospholipid, egg yolk L-α-phosphatidylcholine (EYPC). The study reveals discernible binding interactions of the three fluorescent probes with the EYPC lipid vesicle. Once the binding of the probes with the lipid is established, the effect of cyclic oligosaccharide, β-cyclodextrin (β-CD), on these lipid bound probes has been investigated. Different fluorometric techniques suggest that addition of β-CD to the probe-lipid complexes leads to the release of the probes from the lipid medium through the formation of probe-β-CD inclusion complexes. A competitive binding of the probes between β-cyclodextrin and the lipid is ascribed to be responsible for the effect. This provides an easy avenue for the removal of the probe molecules from the lipid environment. Extension of this work with drug molecules in cell membranes is expected to give rise to a strategy for the removal of adsorbed drugs from the cell membranes by the use of non-toxic β-cyclodextrin.

  14. Binding interaction of differently charged fluorescent probes with egg yolk phosphatidylcholine and the effect of β-cyclodextrin on the lipid-probe complexes: A fluorometric investigation

    NASA Astrophysics Data System (ADS)

    Kundu, Pronab; Ghosh, Saptarshi; Jana, Barnali; Chattopadhyay, Nitin

    2015-05-01

    Interaction of cationic phenosafranin (PSF), anionic 8-anilino-1-naphthalene sulfonate (ANS) and non-ionic nile red (NR) have been studied with the zwitterionic phospholipid, egg yolk L-α-phosphatidylcholine (EYPC). The study reveals discernible binding interactions of the three fluorescent probes with the EYPC lipid vesicle. Once the binding of the probes with the lipid is established, the effect of cyclic oligosaccharide, β-cyclodextrin (β-CD), on these lipid bound probes has been investigated. Different fluorometric techniques suggest that addition of β-CD to the probe-lipid complexes leads to the release of the probes from the lipid medium through the formation of probe-β-CD inclusion complexes. A competitive binding of the probes between β-cyclodextrin and the lipid is ascribed to be responsible for the effect. This provides an easy avenue for the removal of the probe molecules from the lipid environment. Extension of this work with drug molecules in cell membranes is expected to give rise to a strategy for the removal of adsorbed drugs from the cell membranes by the use of non-toxic β-cyclodextrin.

  15. Protein charge ladders reveal that the net charge of ALS-linked superoxide dismutase can be different in sign and magnitude from predicted values.

    PubMed

    Shi, Yunhua; Abdolvahabi, Alireza; Shaw, Bryan F

    2014-10-01

    This article utilized "protein charge ladders"-chemical derivatives of proteins with similar structure, but systematically altered net charge-to quantify how missense mutations that cause amyotrophic lateral sclerosis (ALS) affect the net negative charge (Z) of superoxide dismutase-1 (SOD1) as a function of subcellular pH and Zn(2+) stoichiometry. Capillary electrophoresis revealed that the net charge of ALS-variant SOD1 can be different in sign and in magnitude-by up to 7.4 units per dimer at lysosomal pH-than values predicted from standard pKa values of amino acids and formal oxidation states of metal ions. At pH 7.4, the G85R, D90A, and G93R substitutions diminished the net negative charge of dimeric SOD1 by up to +2.29 units more than predicted; E100K lowered net charge by less than predicted. The binding of a single Zn(2+) to mutant SOD1 lowered its net charge by an additional +2.33 ± 0.01 to +3.18 ± 0.02 units, however, each protein regulated net charge when binding a second, third, or fourth Zn(2+) (ΔZ < 0.44 ± 0.07 per additional Zn(2+) ). Both metalated and apo-SOD1 regulated net charge across subcellular pH, without inverting from negative to positive at the theoretical pI. Differential scanning calorimetry, hydrogen-deuterium exchange, and inductively coupled plasma mass spectrometry confirmed that the structure, stability, and metal content of mutant proteins were not significantly affected by lysine acetylation. Measured values of net charge should be used when correlating the biophysical properties of a specific ALS-variant SOD1 protein with its observed aggregation propensity or clinical phenotype.

  16. RsmC of Erwinia carotovora subsp. carotovora Negatively Controls Motility, Extracellular Protein Production, and Virulence by Binding FlhD and Modulating Transcriptional Activity of the Master Regulator, FlhDC▿

    PubMed Central

    Chatterjee, Asita; Cui, Yaya; Chatterjee, Arun K.

    2009-01-01

    RsmC and FlhDC are global regulators controlling extracellular proteins/enzymes, rsmB RNA, motility, and virulence of Erwinia carotovora subsp. carotovora. FlhDC, the master regulator of flagellar genes, controls these traits by positively regulating gacA, fliA, and rsmC and negatively regulating hexA. RsmC, on the other hand, is a negative regulator of extracellular proteins/enzymes, motility, and virulence since the deficiency of RsmC in FlhDC+ strain results in overproduction of extracellular proteins/enzymes, hypermotility, and hypervirulence. These phenotypes are abolished in an RsmC− FlhDC− double mutant. We show that RsmC interferes with FlhDC action. Indeed, the expression of all three targets (i.e., gacA, rsmC, and fliA) positively regulated in E. carotovora subsp. carotovora by FlhDC is inhibited by RsmC. RsmC also partly relieves the inhibition of hexA expression by FlhDC. The results of yeast two-hybrid analysis revealed that RsmC binds FlhD and FlhDC, but not FlhC. We propose that binding of RsmC with FlhD/FlhDC interferes with its regulatory functions and that RsmC acts as an anti-FlhD4FlhC2 factor. We document here for the first time that RsmC interferes with activation of fliA and motility in several members of the Enterobacteriaceae family. The extent of E. carotovora subsp. carotovora RsmC-mediated inhibition of FlhDC-dependent expression of fliA and motility varies depending upon enterobacterial species. The data presented here support the idea that differences in structural features in enterobacterial FlhD are responsible for differential susceptibility to E. carotovora subsp. carotovora RsmC action. PMID:19447906

  17. The role of surface charge on the uptake and biocompatibility of hydroxyapatite nanoparticles with osteoblast cells

    NASA Astrophysics Data System (ADS)

    Chen, Liang; Mccrate, Joseph M.; C-M Lee, James; Li, Hao

    2011-03-01

    The objective of this study is to evaluate the effect of hydroxyapatite (HAP) nanoparticles with different surface charges on the cellular uptake behavior and in vitro cell viability and proliferation of MC3T3-E1 cell lines (osteoblast). The nanoparticles' surface charge was varied by surface modification with two carboxylic acids: 12-aminododecanoic acid (positive) and dodecanedioic acid (negative). The untreated HAP nanoparticles and dodecanoic acid modified HAP nanoparticles (neutral) were used as the control. X-ray diffraction (XRD) revealed that surface modifications by the three carboxylic acids did not change the crystal structure of HAP nanoparticles; Fourier transform infrared spectroscopy (FT-IR) confirmed the adsorption and binding of the carboxylic acids on the HAP nanoparticles' surfaces; and zeta potential measurement confirmed that the chemicals successfully modified the surface charge of HAP nanoparticles in water based solution. Transmission electron microscopy (TEM) images showed that positively charged, negatively charged and untreated HAP nanoparticles, with similar size and shape, all penetrated into the cells and cells had more uptake of HAP nanoparticles with positive charge compared to those with negative charge, which might be attributed to the attractive or repulsive interaction between the negatively charged cell membrane and positively/negatively charged HAP nanoparticles. The neutral HAP nanoparticles could not penetrate the cell membrane due to their larger size. MTT assay and LDH assay results indicated that as compared with the polystyrene control, greater cell viability and cell proliferation were measured on MC3T3-E1 cells treated with the three kinds of HAP nanoparticles (neutral, positive, and untreated), among which positively charged HAP nanoparticles showed the strongest improvement for cell viability and cell proliferation. In summary, the surface charge of HAP nanoparticles can be modified to influence the cellular uptake of

  18. Correlation-induced DNA adsorption on like-charged membranes

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin; Blossey, Ralf

    2016-10-01

    The adsorption of DNA or other polyelectrolyte molecules on charged membranes is a recurrent motif in soft matter and bionanotechnological systems. Two typical situations encountered are the deposition of single DNA chains onto substrates for further analysis, e.g., by force microscopy, or the pulling of polyelectrolytes into membrane nanopores, as in sequencing applications. In this paper, we present a theoretical analysis of such scenarios based on the self-consistent field theory approach, which allows us to address the important effect of charge correlations. We calculate the grand potential of a stiff polyelectrolyte immersed in an electrolyte in contact with a negatively charged dielectric membrane. For the sake of conciseness, we neglect conformational polymer fluctuations and model the molecule as a rigid charged line. At strongly charged membranes, the adsorbed counterions enhance the screening ability of the interfacial region. In the presence of highly charged polymers such as double-stranded DNA molecules close to the membrane, this enhanced interfacial screening dominates the mean-field level DNA-membrane repulsion and results in the adsorption of the DNA molecule to the surface. This picture provides a simple explanation for the recently observed DNA binding onto similarly charged substrates [G. L.-Caballero et al., Soft Matter 10, 2805 (2014), 10.1039/c3sm52428k] and points out charge correlations as a non-negligible ingredient of polymer-surface interactions.

  19. A comparative study on the effect of Curcumin and Chlorin-p6 on the diffusion of two organic cations across a negatively charged lipid bilayer probed by second harmonic spectroscopy

    NASA Astrophysics Data System (ADS)

    Saini, R. K.; Varshney, G. K.; Dube, A.; Gupta, P. K.; Das, K.

    2014-09-01

    The influence of Curcumin and Chlorin-p6 (Cp6) on the real time diffusion kinetics of two organic cations, LDS (LDS-698) and Malachite Green (MG) across a negatively charged phospholipid bilayer is investigated by Second Harmonic (SH) spectroscopy. The diffusion time constant of LDS at neutral pH in liposomes containing either Curcumin or Cp6 is significantly reduced, the effect being more pronounced with Curcumin. At acidic pH, the quantum of reduction in the diffusion time constant of MG by both the drugs was observed to be similar. The relative changes in the average diffusion time constants of the cations with increasing drug concentration at pH 5.0 and 7.4 shows a substantial pH effect for Curcumin induced membrane permeability, while a modest pH effect was observed for Cp6 induced membrane permeability. Based on available evidence this can be attributed to the increased interaction between the drug and the polar head groups of the lipid at pH 7.4 where the drug resides closer to the lipid-water interface.

  20. New insight in the structural features of haloadaptation in α-amylases from halophilic Archaea following homology modeling strategy: folded and stable conformation maintained through low hydrophobicity and highly negative charged surface.

    PubMed

    Zorgani, Mohamed Amine; Patron, Kevin; Desvaux, Mickaël

    2014-07-01

    Proteins from halophilic archaea, which live in extreme saline conditions, have evolved to remain folded, active and stable at very high ionic strengths. Understanding the mechanism of haloadaptation is the first step toward engineering of halostable biomolecules. Amylases are one of the main enzymes used in industry. Yet, no three-dimensional structure has been experimentally resolved for α-amylases from halophilic archaea. In this study, homology structure modeling of α-amylases from the halophilic archaea Haloarcula marismortui, Haloarcula hispanica, and Halalkalicoccus jeotgali were performed. The resulting models were subjected to energy minimization, evaluation, and structural analysis. Calculations of the amino acid composition, salt bridges and hydrophobic interactions were also performed and compared to a set of non-halophilic counterparts. It clearly appeared that haloarchaeal α-amylases exhibited lower propensities for helix formation and higher propensities for coil-forming regions. Furthermore, they could maintain a folded and stable conformation in high salt concentration through highly negative charged surface with over representation of acidic residues, especially Asp, and low hydrophobicity with increase of salt bridges and decrease in hydrophobic interactions on the protein surface. This study sheds some light on the stability of α-amylases from halophilic archaea and provides strong basis not only to understand haloadaptation mechanisms of proteins in microorganisms from hypersalines environments but also for biotechnological applications.

  1. Charged particles interacting with a mixed supported lipid bilayer as a biomimetic pulmonary surfactant.

    PubMed

    Munteanu, B; Harb, F; Rieu, J P; Berthier, Y; Tinland, B; Trunfio-Sfarghiu, A-M

    2014-08-01

    This study shows the interactions of charged particles with mixed supported lipid bilayers (SLB) as biomimetic pulmonary surfactants. We tested two types of charged particles: positively charged and negatively charged particles. Two parameters were measured: adsorption density of particles on the SLB and the diffusion coefficient of lipids by FRAPP techniques as a measure of interaction strength between particles and lipids. We found that positively charged particles do not adsorb on the bilayer, probably due to the electrostatic repulsion between positively charged parts of the lipid head and the positive groups on the particle surface, therefore no variation in diffusion coefficient of lipid molecules was observed. On the contrary, the negatively charged particles, driven by electrostatic interactions are adsorbed onto the supported bilayer. The adsorption of negatively charged particles increases with the zeta-potential of the particle. Consecutively, the diffusion coefficient of lipids is reduced probably due to binding onto the lipid heads which slows down their Brownian motion. The results are directly relevant for understanding the interactions of particulate matter with pulmonary structures which could lead to pulmonary surfactant inhibition or deficiency causing severe respiratory distress or pathologies.

  2. Negative magnetoresistivity in holography

    NASA Astrophysics Data System (ADS)

    Sun, Ya-Wen; Yang, Qing

    2016-09-01

    Negative magnetoresistivity is a special magnetotransport property associated with chiral anomaly in four dimensional chiral anomalous systems, which refers to the transport behavior that the DC longitudinal magnetoresistivity decreases with increasing magnetic field. We calculate the longitudinal magnetoconductivity in the presence of back-reactions of the magnetic field to gravity in holographic zero charge and axial charge density systems with and without axial charge dissipation. In the absence of axial charge dissipation, we find that the quantum critical conductivity grows with increasing magnetic field when the backreaction strength is larger than a critical value, in contrast to the monotonically decreasing behavior of quantum critical conductivity in the probe limit. With axial charge dissipation, we find the negative magnetoresistivity behavior. The DC longitudinal magnetoconductivity scales as B in the large magnetic field limit, which deviates from the exact B 2 scaling of the probe limit result. In both cases, the small frequency longitudinal magnetoconductivity still agrees with the formula obtained from the hydrodynamic linear response theory, even in the large magnetic field limit.

  3. The Positively Charged COOH-terminal Glycosaminoglycan-binding CXCL9(74-103) Peptide Inhibits CXCL8-induced Neutrophil Extravasation and Monosodium Urate Crystal-induced Gout in Mice.

    PubMed

    Vanheule, Vincent; Janssens, Rik; Boff, Daiane; Kitic, Nikola; Berghmans, Nele; Ronsse, Isabelle; Kungl, Andreas J; Amaral, Flavio Almeida; Teixeira, Mauro Martins; Van Damme, Jo; Proost, Paul; Mortier, Anneleen

    2015-08-28

    The ELR(-)CXC chemokine CXCL9 is characterized by a long, highly positively charged COOH-terminal region, absent in most other chemokines. Several natural leukocyte- and fibroblast-derived COOH-terminally truncated CXCL9 forms missing up to 30 amino acids were identified. To investigate the role of the COOH-terminal region of CXCL9, several COOH-terminal peptides were chemically synthesized. These peptides display high affinity for glycosaminoglycans (GAGs) and compete with functional intact chemokines for GAG binding, the longest peptide (CXCL9(74-103)) being the most potent. The COOH-terminal peptide CXCL9(74-103) does not signal through or act as an antagonist for CXCR3, the G protein-coupled CXCL9 receptor, and does not influence neutrophil chemotactic activity of CXCL8 in vitro. Based on the GAG binding data, an anti-inflammatory role for CXCL9(74-103) was further evidenced in vivo. Simultaneous intravenous injection of CXCL9(74-103) with CXCL8 injection in the joint diminished CXCL8-induced neutrophil extravasation. Analogously, monosodium urate crystal-induced neutrophil migration to the tibiofemural articulation, a murine model of gout, is highly reduced by intravenous injection of CXCL9(74-103). These data show that chemokine-derived peptides with high affinity for GAGs may be used as anti-inflammatory peptides; by competing with active chemokines for binding and immobilization on GAGs, these peptides may lower chemokine presentation on the endothelium and disrupt the generation of a chemokine gradient, thereby preventing a chemokine from properly performing its chemotactic function. The CXCL9 peptide may serve as a lead molecule for further development of inhibitors of inflammation based on interference with chemokine-GAG interactions.

  4. The Positively Charged COOH-terminal Glycosaminoglycan-binding CXCL9(74–103) Peptide Inhibits CXCL8-induced Neutrophil Extravasation and Monosodium Urate Crystal-induced Gout in Mice*

    PubMed Central

    Vanheule, Vincent; Janssens, Rik; Boff, Daiane; Kitic, Nikola; Berghmans, Nele; Ronsse, Isabelle; Kungl, Andreas J.; Amaral, Flavio Almeida; Teixeira, Mauro Martins; Van Damme, Jo; Proost, Paul; Mortier, Anneleen

    2015-01-01

    The ELR−CXC chemokine CXCL9 is characterized by a long, highly positively charged COOH-terminal region, absent in most other chemokines. Several natural leukocyte- and fibroblast-derived COOH-terminally truncated CXCL9 forms missing up to 30 amino acids were identified. To investigate the role of the COOH-terminal region of CXCL9, several COOH-terminal peptides were chemically synthesized. These peptides display high affinity for glycosaminoglycans (GAGs) and compete with functional intact chemokines for GAG binding, the longest peptide (CXCL9(74–103)) being the most potent. The COOH-terminal peptide CXCL9(74–103) does not signal through or act as an antagonist for CXCR3, the G protein-coupled CXCL9 receptor, and does not influence neutrophil chemotactic activity of CXCL8 in vitro. Based on the GAG binding data, an anti-inflammatory role for CXCL9(74–103) was further evidenced in vivo. Simultaneous intravenous injection of CXCL9(74–103) with CXCL8 injection in the joint diminished CXCL8-induced neutrophil extravasation. Analogously, monosodium urate crystal-induced neutrophil migration to the tibiofemural articulation, a murine model of gout, is highly reduced by intravenous injection of CXCL9(74–103). These data show that chemokine-derived peptides with high affinity for GAGs may be used as anti-inflammatory peptides; by competing with active chemokines for binding and immobilization on GAGs, these peptides may lower chemokine presentation on the endothelium and disrupt the generation of a chemokine gradient, thereby preventing a chemokine from properly performing its chemotactic function. The CXCL9 peptide may serve as a lead molecule for further development of inhibitors of inflammation based on interference with chemokine-GAG interactions. PMID:26183778

  5. Phosphatidylserine-binding protein lactadherin inhibits protein translocation across the ER membrane.

    PubMed

    Yamamoto, Hitoshi; Kida, Yuichiro; Sakaguchi, Masao

    2013-05-10

    Secretory and membrane proteins are translocated across and inserted into the endoplasmic reticulum membrane via translocon channels. To investigate the effect of the negatively-charged phospholipid phosphatidylserine on the translocation of nascent polypeptide chains through the translocon, we used the phosphatidylserine-binding protein lactadherin C2-domain. Lactadherin inhibited targeting of nascent chain to the translocon by signal sequence and the initiation of translocation. Moreover, lactadherin inhibited the movement of the translocating polypeptide chain regardless of the presence or absence of positively-charged residues. Phosphatidylserine might be critically involved in translocon function, but it is not a major determinant for translocation arrest of positively-charged residues. PMID:23583395

  6. Light-controlled cellular internalization and cytotoxicity of nucleic acid-binding agents. Studies in vitro and in zebrafish embryos

    PubMed Central

    Penas, Cristina; Sánchez, Mateo I.; Guerra-Varela, Jorge; Sanchez-Piñón, Laura; Vázquez, M. Eugenio; Mascareñas, José L.

    2016-01-01

    We have synthesized oligoarginine conjugates of selected DNA-binding agents (a bisbenzamidine, acridine and thiazole orange) and demonstrated that the DNA binding and cell internalization properties of such conjugates can be inhibited by appending a negatively charged oligoglutamic tail through a photolabile linker. Irradiation with UV light releases the parent octaarginine conjugates, thus restoring their cell internalization and biological activity. Preliminary assays using zebrafish embryos demonstrates the potential of this prodrug strategy for controlling in vivo cytotoxicity. PMID:26534774

  7. Large-scale relativistic calculations of ionization energies and total binding energies of all atoms and positive atomic ions with nuclear charge Z = 1-110

    NASA Astrophysics Data System (ADS)

    Kramida, Alexander; Froese Fischer, Charlotte; Reader, Joseph; Indelicato, Paul

    2015-05-01

    The latest versions of advanced multiconfiguration Dirac-Fock atomic codes, MCDFGME and Grasp2K, are used to calculate ionization energies (IE) and total binding energies of all atomic systems. Comparison with experiment and other benchmark data shows an excellent accuracy achieved in these calculations for H-, He-, and Li-like ions. In particular, our results for H-like ions with Z >2, obtained with the MCDFGME code, are the most accurate available today. For multi-electron ions, we combine the accurate single-configuration MCDFGME calculations with the correlation-difference energy (difference between the multiconfiguration and single-configuration total energies) calculated with Grasp2K. This approach results in a dramatically improved agreement of calculated IEs with experiment (less than 0.7 eV on average) for all systems, excluding those involving open f-shells. The most probable ground states are found for most systems, leaving questionable only about 100 out of total 6105 considered systems.

  8. Mucin Binding Reduces Colistin Antimicrobial Activity.

    PubMed

    Huang, Johnny X; Blaskovich, Mark A T; Pelingon, Ruby; Ramu, Soumya; Kavanagh, Angela; Elliott, Alysha G; Butler, Mark S; Montgomery, A Bruce; Cooper, Matthew A

    2015-10-01

    Colistin has found increasing use in treating drug-resistant bacterial lung infections, but potential interactions with pulmonary biomolecules have not been investigated. We postulated that colistin, like aminoglycoside antibiotics, may bind to secretory mucin in sputum or epithelial mucin that lines airways, reducing free drug levels. To test this hypothesis, we measured binding of colistin and other antibiotics to porcine mucin, a family of densely glycosylated proteins used as a surrogate for human sputum and airway mucin. Antibiotics were incubated in dialysis tubing with or without mucin, and concentrations of unbound antibiotics able to penetrate the dialysis tubing were measured over time using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The percentage of antibiotic measured in the dialysate after 4 h in the presence of mucin, relative to the amount without mucin, was 15% for colistin, 16% for polymyxin B, 19% for tobramycin, 52% for ciprofloxacin, and 78% for daptomycin. Antibiotics with the strongest mucin binding had an overall polybasic positive charge, whereas those with comparatively little binding were less basic. When comparing MICs measured with or without added mucin, colistin and polymyxin B showed >100-fold increases in MICs for multiple Gram-negative bacteria. Preclinical evaluation of mucin binding should become a standard procedure when considering the potential pulmonary use of new or existing antibiotics, particularly those with a polybasic overall charge. In the airways, mucin binding may reduce the antibacterial efficacy of inhaled or intravenously administered colistin, and the presence of sub-MIC effective antibiotic concentrations could result in the development of antibiotic resistance. PMID:26169405

  9. Mucin Binding Reduces Colistin Antimicrobial Activity.

    PubMed

    Huang, Johnny X; Blaskovich, Mark A T; Pelingon, Ruby; Ramu, Soumya; Kavanagh, Angela; Elliott, Alysha G; Butler, Mark S; Montgomery, A Bruce; Cooper, Matthew A

    2015-10-01

    Colistin has found increasing use in treating drug-resistant bacterial lung infections, but potential interactions with pulmonary biomolecules have not been investigated. We postulated that colistin, like aminoglycoside antibiotics, may bind to secretory mucin in sputum or epithelial mucin that lines airways, reducing free drug levels. To test this hypothesis, we measured binding of colistin and other antibiotics to porcine mucin, a family of densely glycosylated proteins used as a surrogate for human sputum and airway mucin. Antibiotics were incubated in dialysis tubing with or without mucin, and concentrations of unbound antibiotics able to penetrate the dialysis tubing were measured over time using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The percentage of antibiotic measured in the dialysate after 4 h in the presence of mucin, relative to the amount without mucin, was 15% for colistin, 16% for polymyxin B, 19% for tobramycin, 52% for ciprofloxacin, and 78% for daptomycin. Antibiotics with the strongest mucin binding had an overall polybasic positive charge, whereas those with comparatively little binding were less basic. When comparing MICs measured with or without added mucin, colistin and polymyxin B showed >100-fold increases in MICs for multiple Gram-negative bacteria. Preclinical evaluation of mucin binding should become a standard procedure when considering the potential pulmonary use of new or existing antibiotics, particularly those with a polybasic overall charge. In the airways, mucin binding may reduce the antibacterial efficacy of inhaled or intravenously administered colistin, and the presence of sub-MIC effective antibiotic concentrations could result in the development of antibiotic resistance.

  10. Mechanism of preferential packaging of negative sense genomic RNA by viral nucleoproteins in Crimean-Congo hemorrhagic Fever virus.

    PubMed

    Dayer, Mohammad Reza; Dayer, Mohammad Saaid; Rezatofighi, Seyedeh Elham

    2015-04-01

    The Crimean-Congo Hemorrhagic Fever (CCHF) is an infectious disease of high virulence and mortality caused by a negative sense RNA nairovirus. The genomic RNA of CCHFV is enwrapped by its nucleoprotein. Positively charged residues on CCHFV nucleoprotein provide multiple binding sites to facilitate genomic RNA encapsidation. In the present work, we investigated the mechanism underlying preferential packaging of the negative sense genomic RNA by CCHFV nucleoprotein in the presence of host cell RNAs during viral assembly. The work included genome sequence analyses for different families of negative and positive sense RNA viruses, using serial docking experiments and molecular dynamic simulations. Our results indicated that the main determinant parameter of the nucleoprotein binding affinity for negative sense RNA is the ratio of purine/pyrimidine in the RNA molecule. A negative sense RNA with a purine/pyrimidine ratio (>1) higher than that of a positive sense RNA (<1) exhibits higher affinity for the nucleoprotein. Our calculations revealed that a negative sense RNA expresses about 0.5 kJ/mol higher binding energy per nucleotide compared to a positive sense RNA. This energy difference produces a binding energy high enough to make the negative sense RNA, the preferred substrate for packaging by CCHFV nucleoprotein in the presence of cellular or complementary positive sense RNAs. The outcome of this study may contribute to ongoing researches on other viral diseases caused by negative sense RNA viruses such as Ebola virus which poses a security threat to all humanity.

  11. Nepsilon-(3-[*I]Iodobenzoyl)-Lys5-Nalpha-maleimido-Gly1-GEEEK ([*I]IB-Mal-D-GEEEK): a radioiodinated prosthetic group containing negatively charged D-glutamates for labeling internalizing monoclonal antibodies.

    PubMed

    Vaidyanathan, Ganesan; Alston, Kevin L; Bigner, Darrel D; Zalutsky, Michael R

    2006-01-01

    Novel methods are needed for the radiohalogenation of cell-internalizing proteins and peptides because rapid loss of label occurs after lysosomal processing when these molecules are labeled using conventional radioiodination methodologies. We have developed a radiolabeled prosthetic group that contains multiple negatively charged D-amino acids to facilitate trapping of the radioactivity in the cell after proteolysis of the labeled protein. N(epsilon)-(3-[(125)I]iodobenzoyl)-Lys(5)-N(alpha)-maleimido-Gly(1)-GEEEK ([(125)I]IB-Mal-D-GEEEK) was synthesized via iododestannylation in 90.3 +/- 3.9% radiochemical yields. This radioiodinated agent was conjugated to iminothiolane-treated L8A4, an anti-epidermal growth factor receptor variant III (EGFRvIII) specific monoclonal antibody (mAb) in 54.3 +/- 17.7% conjugation yields. In vitro assays with the EGFRvIII-expressing U87MGDeltaEGFR glioma cell line demonstrated that the internalized radioactivity for the [(125)I]IB-Mal-D-GEEEK-L8A4 conjugate increased from 14.1% at 1 h to 44.7% at 24 h and was about 15-fold higher than that of directly radioiodinated L8A4 at 24 h. A commensurately increased tumor uptake in vivo in athymic mice bearing subcutaneous U87MGDeltaEGFR xenografts (52.6 +/- 14.3% injected dose per gram versus 17.4 +/- 3.5% ID/g at 72 h) also was observed. These results suggest that [(125)I]IB-Mal-d-GEEEK is a promising reagent for the radioiodination of internalizing mAbs. PMID:16848419

  12. Mass spectrometry reveals synergistic effects of nucleotides, lipids, and drugs binding to a multidrug resistance efflux pump.

    PubMed

    Marcoux, Julien; Wang, Sheila C; Politis, Argyris; Reading, Eamonn; Ma, Jerome; Biggin, Philip C; Zhou, Min; Tao, Houchao; Zhang, Qinghai; Chang, Geoffrey; Morgner, Nina; Robinson, Carol V

    2013-06-11

    Multidrug resistance is a serious barrier to successful treatment of many human diseases, including cancer, wherein chemotherapeutics are exported from target cells by membrane-embedded pumps. The most prevalent of these pumps, the ATP-Binding Cassette transporter P-glycoprotein (P-gp), consists of two homologous halves each comprising one nucleotide-binding domain and six transmembrane helices. The transmembrane region encapsulates a hydrophobic cavity, accessed by portals in the membrane, that binds cytotoxic compounds as well as lipids and peptides. Here we use mass spectrometry (MS) to probe the intact P-gp small molecule-bound complex in a detergent micelle. Activation in the gas phase leads to formation of ions, largely devoid of detergent, yet retaining drug molecules as well as charged or zwitterionic lipids. Measuring the rates of lipid binding and calculating apparent KD values shows that up to six negatively charged diacylglycerides bind more favorably than zwitterionic lipids. Similar experiments confirm binding of cardiolipins and show that prior binding of the immunosuppressant and antifungal antibiotic cyclosporin A enhances subsequent binding of cardiolipin. Ion mobility MS reveals that P-gp exists in an equilibrium between different states, readily interconverted by ligand binding. Overall these MS results show how concerted small molecule binding leads to synergistic effects on binding affinities and conformations of a multidrug efflux pump.

  13. Isolation and characterizations of oxalate-binding proteins in the kidney.

    PubMed

    Roop-ngam, Piyachat; Chaiyarit, Sakdithep; Pongsakul, Nutkridta; Thongboonkerd, Visith

    2012-08-01

    Oxalate-binding proteins are thought to serve as potential modulators of kidney stone formation. However, only few oxalate-binding proteins have been identified from previous studies. Our present study, therefore, aimed for large-scale identification of oxalate-binding proteins in porcine kidney using an oxalate-affinity column containing oxalate-conjugated EAH Sepharose 4B beads for purification followed by two-dimensional gel electrophoresis (2-DE) to resolve the recovered proteins. Comparing with those obtained from the controlled column containing uncoupled EAH-Sepharose 4B (to subtract the background of non-specific bindings), a total of 38 protein spots were defined as oxalate-binding proteins. These protein spots were successfully identified by quadrupole time-of-flight mass spectrometry (MS) and/or tandem MS (MS/MS) as 26 unique proteins, including several nuclear proteins, mitochondrial proteins, oxidative stress regulatory proteins, metabolic enzymes and others. Identification of oxalate-binding domain using the PRATT tool revealed "L-x(3,5)-R-x(2)-[AGILPV]" as a functional domain responsible for oxalate-binding in 25 of 26 (96%) unique identified proteins. We report herein, for the first time, large-scale identification and characterizations of oxalate-binding proteins in the kidney. The presence of positively charged arginine residue in the middle of this functional domain suggested its significance for binding to the negatively charged oxalate. These data will enhance future stone research, particularly on stone modulators. PMID:22796524

  14. Configuration effects on satellite charging response

    NASA Technical Reports Server (NTRS)

    Purvis, C. K.

    1980-01-01

    The response of various spacecraft configurations to a charging environment in sunlight was studied using the NASA Charging Analyzer Program code. The configuration features geometry, type of stabilization, and overall size. Results indicate that sunlight charging response is dominated by differential charging effects. Shaded insulation charges negatively result in the formation of potential barriers which suppress photoelectron emission from sunlit surfaces. Sunlight charging occurs relatively slowly: with 30 minutes of charging simulations, in none of the configurations modeled did the most negative surface cell reach half its equilibrium potential in eclipse.

  15. Impact of charge variation on the encapsulation of nanoparticles by virus coat proteins

    NASA Astrophysics Data System (ADS)

    Lin, Hsiang-Ku; van der Schoot, Paul; Zandi, Roya

    2012-12-01

    Electrostatic interaction is the driving force for the encapsulation by virus coat proteins of nanoparticles such as quantum dots, gold particles and magnetic beads for, e.g., imaging and therapeutic purposes. In recent experimental work, Daniel et al (2010 ACS Nano 4 3853-60) found the encapsulation efficiency to sensitively depend on the interplay between the surface charge density of negatively charged gold nanoparticles and the number of positive charges on the RNA binding domains of the proteins. Surprisingly, these experiments reveal that despite the highly cooperative nature of the co-assembly at low pH, the efficiency of encapsulation is a gradual function of their surface charge density. We present a simple all-or-nothing mass action law combined with an electrostatic interaction model to explain the experiments. We find quantitative agreement with experimental observations, supporting the existence of a natural statistical charge distribution between nanoparticles.

  16. Impact of charge variation on the encapsulation of nanoparticles by virus coat proteins.

    PubMed

    Lin, Hsiang-Ku; van der Schoot, Paul; Zandi, Roya

    2012-12-01

    Electrostatic interaction is the driving force for the encapsulation by virus coat proteins of nanoparticles such as quantum dots, gold particles and magnetic beads for, e.g., imaging and therapeutic purposes. In recent experimental work, Daniel et al (2010 ACS Nano 4 3853-60) found the encapsulation efficiency to sensitively depend on the interplay between the surface charge density of negatively charged gold nanoparticles and the number of positive charges on the RNA binding domains of the proteins. Surprisingly, these experiments reveal that despite the highly cooperative nature of the co-assembly at low pH, the efficiency of encapsulation is a gradual function of their surface charge density. We present a simple all-or-nothing mass action law combined with an electrostatic interaction model to explain the experiments. We find quantitative agreement with experimental observations, supporting the existence of a natural statistical charge distribution between nanoparticles.

  17. Multiple binding modes for dicationic Hoechst 33258 to DNA.

    PubMed

    Guan, Yuan; Shi, Ruina; Li, Xiaomin; Zhao, Meiping; Li, Yuanzong

    2007-06-28

    The binding of dicationic Hoechst 33258 (ligand) to DNA was characterized by means of the fluorescence spectra, fluorescence intensity titration, time-resolved fluorescence decay, light scattering, circular dichroism, and fluorescence thermal denaturation measurements, and two binding modes were distinguished by the experimental results. Type 1 binding has the stoichiometry of one ligand to more than 12 base pairs, and it is defined as quasi-minor groove binding which has the typical prolonged fluorescence lifetime of about 4.4 ns. In type 1 binding, planar conformation of the ligand is favorable. Type 2 binding with phosphate to ligand ratio (P/L) < 2.5 has the stoichiometry of one ligand to two phosphates. It is defined as a highly dense and orderly stacked binding with DNA backbone as the template. Electrostatic interactions between doubly protonated ligands and negatively charged DNA backbone play a predominant role in the type 2 binding mode. The characteristics of this type of binding result in a twisted conformation of the ligand that has a fluorescence lifetime of less than 1 ns. The results also indicate that the binding is in a cooperative manner primarily by stacking of the aromatic rings of the neighboring ligands. Type 1 binding is only observed for double-stranded DNA (dsDNA) with affinity constant of 1.83 x 10(7) M-1. In the type 2 binding mode, the binding affinity constants are 4.9 x 10(6) and 4.3 x 10(6) M-1 for dsDNA and single-stranded DNA (ssDNA), respectively. The type 2 binding is base pair independent while the type 1 binding is base pair related. The experiments described in this paper revealed that the dication bindings are different from the monocation bindings reported by previous study. The dication binding leads to stronger aggregation at low ligand concentration and results in orderly arrangements of the ligands along DNA chains. Furthermore the dication binding is demonstrated to be beneficial for enhancing the DNA's stability.

  18. Negative differential conductance and hysteretic current switching of benzene molecular junction in a transverse electric field

    NASA Astrophysics Data System (ADS)

    Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing

    2014-11-01

    We study charge transport through single benzene molecular junction (BMJ) directly sandwiched between two platinum electrodes by using a tight-binding model and the non-equilibrium Green's function approach. Pronounced negative differential conductance is observed at finite bias voltage, resulting from charge redistribution in BMJ and a Coulomb blockade effect at the interface of molecule-electrode contacts. In the presence of a transverse electric field, hysteretic switching behavior and large spin-polarization of current are obtained, indicating the potential application of BMJ for acting as a nanoscale current modulator or spintronic molecular device.

  19. Surface charge modulated aptasensor in a single glass conical nanopore.

    PubMed

    Cai, Sheng-Lin; Cao, Shuo-Hui; Zheng, Yu-Bin; Zhao, Shuang; Yang, Jin-Lei; Li, Yao-Qun

    2015-09-15

    In this work, we have proposed a label-free nanopore-based biosensing strategy for protein detection by performing the DNA-protein interaction inside a single glass conical nanopore. A lysozyme binding aptamer (LBA) was used to functionalize the walls of glass nanopore via siloxane chemistry and negatively charged recognition sites were thus generated. The covalent modification procedures and their recognition towards lysozyme of the single conical nanopore were characterized via ionic current passing through the nanopore membrane, which was measured by recording the current-voltage (I-V) curves in 1mM KCl electrolyte at pH=7.4. With the occurring of recognition event, the negatively charged wall was partially neutralized by the positively charged lysozyme molecules, leading to a sensitive change of the surface charge-dependent current-voltage (I-V) characteristics. Our results not only demonstrate excellent selectivity and sensitivity towards the target protein, but also suggest a route to extend this nanopore-based sensing strategy to the biosensing platform designs of a wide range of proteins based on a charge modulation.

  20. Synthesis, spectral investigations, antimicrobial activity and DNA-binding studies of novel charge transfer complex of 1,10-phenanthroline as an electron donor with π-acceptor p-Nitrophenol

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq

    2010-08-01

    Proton or charge transfer (CT) complex of donor, 1,10-phenanthroline (Phen) with π-acceptor, p-Nitrophenol (PNP) has been studied spectrophotometrically in methanol at room temperature. The binding of the CT complex with calf thymus (ct) DNA has been investigated by fluorescence spectrum, to establish the ability of the CT complex of its interaction with DNA. Stern-Volmer quenching constant ( Ksv) has also been calculated. The formation constant ( KCT), molar extinction coefficient ( ɛCT), free energy (Δ Go) and stoichiometric ratio of the CT complex have been determined by Benesi-Hildebrand equation. The stoichiometry was found to be 1:1. The CT complex was screened for its pharmacology as antibacterial and antifungal activity against various bacterial and fungal strains, showing excellent antibacterial and antifungal activity. The newly synthesized CT complex has been characterized by FTIR spectra, elemental analysis, 1H NMR, electronic absorption spectra. TGA-DTA studies were also carried out to check the stability of CT complex.

  1. A single-nucleotide polymorphism in the 3'-UTR region of the adipocyte fatty acid binding protein 4 gene is associated with prognosis of triple-negative breast cancer.

    PubMed

    Wang, Wenmiao; Yuan, Peng; Yu, Dianke; Du, Feng; Zhu, Anjie; Li, Qing; Zhang, Pin; Lin, Dongxin; Xu, Binghe

    2016-04-01

    Triple-negative breast cancer (TNBC) is a subtype of breast cancer with poor prognosis and high heterogeneity. The aim of this study was to screen patients for single-nucleotide polymorphisms (SNPs) associated with the prognosis of TNBC. Database-derived SNPs (NextBio, Ensembl, NCBI and MirSNP) located in the 3'-untranslated regions (3'-UTRs) of genes that are differentially expressed in breast cancer were selected. The possible associations between 111 SNPs and progression risk among 323 TNBC patients were investigated using a two-step case-control study with a discovery cohort (n=162) and a validation cohort (n=161). We identified the rs1054135 SNP in the adipocyte fatty acid binding protein 4 (FABP4) gene as a predictor of TNBC recurrence. The G allele of rs1054135 was associated with a reduced risk of disease progression as well as a prolonged disease-free survival time (DFS), with a hazard ratio (HR) for recurrence in the combined sample of 0.269 [95%CI: 0.098-0.735;P=0.001]. Notably, for individuals having the rs1054135 SNP with the AA/AG genotype, the magnitude of increased tumour recurrence risk for overweight patients (BMI≥25kg/m2) was significantly elevated (HR2.53; 95%CI: 1.06-6.03). Immunohistochemical staining of adipocytes adjacent to TNBC tissues showed that the expression level of FABP4 was statistically significantly lower in patients with the rs1054135-GG genotype and those in the disease-free group (P=0.0004 and P=0.0091, respectively). These results suggested that the expression of a lipid metabolism-related gene and an important SNP in the 3'-UTR of FABP4 are associated with TNBC prognosis, which may aid in the screening of high-risk patients with TNBC recurrence and the development of novel chemotherapeutic agents.

  2. Influence of the size and charge of gold nanoclusters on complexation with siRNA: a molecular dynamics simulation study.

    PubMed

    Mudedla, Sathish Kumar; Azhagiya Singam, Ettayapuram Ramaprasad; Balamurugan, Kanagasabai; Subramanian, Venkatesan

    2015-11-11

    The complexation of small interfering RNA (siRNA) with positively charged gold nanoclusters has been studied in the present investigation with the help of classical molecular dynamics and steered molecular dynamics simulations accompanied by free energy calculations. The results show that gold nanoclusters form a stable complex with siRNA. The wrapping of siRNA around the gold nanocluster depends on the size and charge on the surface of the gold cluster. The binding pattern of the gold nanocluster with siRNA is also influenced by the presence of another cluster. The interaction between the positively charged amines in the gold nanocluster and the negatively charged phosphate group in the siRNA is responsible for the formation of complexes. The binding free energy value increases with the size of the gold cluster and the number of positive charges present on the surface of the gold nanocluster. The results reveal that the binding energy of small gold nanoclusters increases in the presence of another gold nanocluster while the binding of large gold nanoclusters decreases due to the introduction of another gold nanocluster. Overall, the findings have clearly demonstrated the effect of size and charge of gold nanoclusters on their interaction pattern with siRNA.

  3. Effect of phosphorylation of phosphatidylinositol on myelin basic protein-mediated binding of actin filaments to lipid bilayers in vitro.

    PubMed

    Boggs, Joan M; Rangaraj, Godha; Dicko, Awa

    2012-09-01

    Myelin basic protein (MBP) binds to negatively charged lipids on the cytosolic surface of oligodendrocytes and is believed to be responsible for adhesion of these surfaces in the multilayered myelin sheath. It can also assemble actin filaments and tether them to lipid bilayers through electrostatic interactions. Here we investigate the effect of increased negative charge of the lipid bilayer due to phosphorylation of phosphatidylinositol (PI) on MBP-mediated binding of actin to the lipid bilayer, by substituting phosphatidylinositol 4-phosphate or phosphatidylinositol 4,5-bisphosphate for PI in phosphatidylcholine/phosphatidylglycerol lipid vesicles. Phosphorylation of PI caused dissociation of the MBP/actin complex from the lipid vesicles due to repulsion of the negatively charged complex from the negatively charged membrane surface. An effect of phosphorylation could be detected even if the inositol lipid was only 2mol% of the total lipid. Calcium-calmodulin dissociated actin from the MBP-lipid vesicles and phosphorylation of PI increased the amount dissociated. These results show that changes to the lipid composition of myelin, which could occur during signaling or other physiological events, could regulate the ability of MBP to act as a scaffolding protein and bind actin filaments to the lipid bilayer.

  4. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    SciTech Connect

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was found to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.

  5. Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C.

    PubMed

    Seo, Jong Bae; Jung, Seung-Ryoung; Huang, Weigang; Zhang, Qisheng; Koh, Duk-Su

    2015-01-01

    Hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) of the plasma membrane by phospholipase C (PLC) generates two critical second messengers, inositol-1,4,5-trisphosphate and diacylglycerol. For the enzymatic reaction, PIP2 binds to positively charged amino acids in the pleckstrin homology domain of PLC. Here we tested the hypothesis that positively charged divalent and multivalent cations accumulate around the negatively charged PIP2, a process called electrostatic charge shielding, and therefore inhibit electrostatic PIP2-PLC interaction. This charge shielding of PIP2 was measured quantitatively with an in vitro enzyme assay using WH-15, a PIP2 analog, and various recombinant PLC proteins (β1, γ1, and δ1). Reduction of PLC activity by divalent cations, polyamines, and neomycin was well described by a theoretical model considering accumulation of cations around PIP2 via their electrostatic interaction and chemical binding. Finally, the charge shielding of PIP2 was also observed in live cells. Perfusion of the cations into cells via patch clamp pipette reduced PIP2 hydrolysis by PLC as triggered by M1 muscarinic receptors with a potency order of Mg2+ < spermine4+ < neomycin6+. Accumulation of divalent cations into cells through divalent-permeable TRPM7 channel had the same effect. Altogether our results suggest that Mg2+ and polyamines modulate the activity of PLCs by controlling the amount of free PIP2 available for the enzymes and that highly charged biomolecules can be inactivated by counterions electrostatically. PMID:26658739

  6. Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C.

    PubMed

    Seo, Jong Bae; Jung, Seung-Ryoung; Huang, Weigang; Zhang, Qisheng; Koh, Duk-Su

    2015-01-01

    Hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) of the plasma membrane by phospholipase C (PLC) generates two critical second messengers, inositol-1,4,5-trisphosphate and diacylglycerol. For the enzymatic reaction, PIP2 binds to positively charged amino acids in the pleckstrin homology domain of PLC. Here we tested the hypothesis that positively charged divalent and multivalent cations accumulate around the negatively charged PIP2, a process called electrostatic charge shielding, and therefore inhibit electrostatic PIP2-PLC interaction. This charge shielding of PIP2 was measured quantitatively with an in vitro enzyme assay using WH-15, a PIP2 analog, and various recombinant PLC proteins (β1, γ1, and δ1). Reduction of PLC activity by divalent cations, polyamines, and neomycin was well described by a theoretical model considering accumulation of cations around PIP2 via their electrostatic interaction and chemical binding. Finally, the charge shielding of PIP2 was also observed in live cells. Perfusion of the cations into cells via patch clamp pipette reduced PIP2 hydrolysis by PLC as triggered by M1 muscarinic receptors with a potency order of Mg2+ < spermine4+ < neomycin6+. Accumulation of divalent cations into cells through divalent-permeable TRPM7 channel had the same effect. Altogether our results suggest that Mg2+ and polyamines modulate the activity of PLCs by controlling the amount of free PIP2 available for the enzymes and that highly charged biomolecules can be inactivated by counterions electrostatically.

  7. Charge Shielding of PIP2 by Cations Regulates Enzyme Activity of Phospholipase C

    PubMed Central

    Seo, Jong Bae; Jung, Seung-Ryoung; Huang, Weigang; Zhang, Qisheng; Koh, Duk-Su

    2015-01-01

    Hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) of the plasma membrane by phospholipase C (PLC) generates two critical second messengers, inositol-1,4,5-trisphosphate and diacylglycerol. For the enzymatic reaction, PIP2 binds to positively charged amino acids in the pleckstrin homology domain of PLC. Here we tested the hypothesis that positively charged divalent and multivalent cations accumulate around the negatively charged PIP2, a process called electrostatic charge shielding, and therefore inhibit electrostatic PIP2-PLC interaction. This charge shielding of PIP2 was measured quantitatively with an in vitro enzyme assay using WH-15, a PIP2 analog, and various recombinant PLC proteins (β1, γ1, and δ1). Reduction of PLC activity by divalent cations, polyamines, and neomycin was well described by a theoretical model considering accumulation of cations around PIP2 via their electrostatic interaction and chemical binding. Finally, the charge shielding of PIP2 was also observed in live cells. Perfusion of the cations into cells via patch clamp pipette reduced PIP2 hydrolysis by PLC as triggered by M1 muscarinic receptors with a potency order of Mg2+ < spermine4+ < neomycin6+. Accumulation of divalent cations into cells through divalent-permeable TRPM7 channel had the same effect. Altogether our results suggest that Mg2+ and polyamines modulate the activity of PLCs by controlling the amount of free PIP2 available for the enzymes and that highly charged biomolecules can be inactivated by counterions electrostatically. PMID:26658739

  8. Triboelectric and plasma charging of microparticles

    NASA Astrophysics Data System (ADS)

    Heijmans, L. C. J.; Nijdam, S.

    2016-06-01

    The charge on two sets of 100 μm polystyrene particles has been measured using their acceleration in an externally applied electric field. This allows for the measurement of the individual charge on multiple particles at the same time. It is found that particles will charge each other both positively and negatively due to the triboelectric effect. This leads to a broad particle-charge distribution with positive, negative and neutral particles. The particle charge can be largely removed by applying a plasma over the particle containing surface. After plasma charge removal, the particles are triboelectrically recharged when they come into contact with other materials.

  9. Photoelectric Charging of Dust Particles

    NASA Technical Reports Server (NTRS)

    Sickafoose, A.; Colwell, J.; Horanyi, M.; Robertson, S.; Walch, B.

    1999-01-01

    Laboratory experiments have been performed on the photoelectric charging of dust particles which are either isolated or adjacent to a surface that is also a photoemitter. We find that zinc dust charges to a positive potential of a few volts when isolated in vacuum and that it charges to a negative potential of a few volts when passed by a photoemitting surface. The illumination is an arc lamp emitting wavelengths longer than 200 nm and the emitting surface is a zirconium foil.

  10. Negative necrotaxis.

    PubMed

    Ragot, R

    1993-01-01

    We studied necrotaxis in several strains of protists and compared the reaction of living cells in the vicinity of cells killed by a ruby laser. Negative necrotaxis was observed for the unicellular green alga Euglena gracilis, whereas Chlamydomonas was shown to exhibit positive necrotaxis. The cellular colony Pandorina morum exhibited no reaction to the killing of nearby colonies. Both the colorless cryptomonad Chilomonas paramecium and the ciliate Tetrahymena pyriformis exhibited negative necrotaxis following the lysis of vitally stained specimens of their own species. They also exhibited negative necrotaxis following the lysis of Euglena cells. It was also demonstrated that the cellular content of Euglena cells lysed by heat or by a mechanical procedure acts as a repellent to intact Euglena cells. These results suggest that the negative necrotaxis provoked in Euglena by the laser irradiation is probably due to the chemotactic effect produced by the release of cell content in the extracellular medium. This cell content could, according to its chemical composition, act either as a repellent, an attractant, or be inactive. The sensitivity of cells (specific or nonspecific ion channels or chemoreceptors) are also of prime importance in the process.

  11. Getting a charge out of transparent tape

    NASA Astrophysics Data System (ADS)

    Harrington, Randal

    2000-01-01

    When two pieces of transparent tape are placed on top of each other (sticky side to nonsticky side) and then separated, it is observed that one piece becomes negatively charged and the other positively charged. The sign of the charge on each piece depends on the brand of tape used. This phenomenon is frequently used to investigate the properties of charge and charged objects in introductory physics courses.

  12. CHARGE IMBALANCE

    SciTech Connect

    Clarke, John

    1980-09-01

    The purpose of this article is to review the theory of charge imbalance, and to discuss its relevance to a number of experimental situations. We introduce the concepts of quasiparticle charge and charge imbalance, and discuss the generation and detection of charge imbalance by tunneling. We describe the relaxation of the injected charge imbalance by inelastic scattering processes, and show how the Boltzmann equation can be solved to obtain the steady state quasiparticle distribution and the charge relaxation rate. Details are given of experiments to measure charge imbalance and the charge relaxation rate when inelastic scattering is the predominant relaxation mechanism. Experiments on and theories of other charge relaxation mechanisms are discussed, namely relaxation via elastic scattering in the presence of energy gap anisotropy, or in the presence of a pair breaking mechanism such as magnetic impurities or an applied supercurrent or magnetic field. We describe three other situations in which charge imbalance occurs, namely the resistance of the NS interface, phase slip centers, and the flow of a supercurrent in the presence of a temperature gradient.

  13. Charge and hydrophobicity effects of NIR fluorophores on bone-specific imaging.

    PubMed

    Bao, Kai; Nasr, Khaled A; Hyun, Hoon; Lee, Jeong Heon; Gravier, Julien; Gibbs, Summer L; Choi, Hak Soo

    2015-01-01

    Recent advances in near-infrared (NIR) fluorescence imaging enabled real-time intraoperative detection of bone metastases, bone growth, and tissue microcalcification. Pamidronate (PAM) has been widely used for this purpose because of its high binding affinity toward bone and remarkable therapeutic effects. Herein we describe the development of a series of PAM-conjugated NIR fluorophores that varied in net charges and hydrophobicity, and compared their bone targeting efficiency, biodistribution, and blood clearance. Since the targeting moiety, PAM, is highly negatively charged but small, the overall in vivo bone targeting and biodistribution were mediated by the physicochemical properties of conjugated fluorophores. PMID:25825600

  14. Critical interpretation of CH– and OH– stretching regions for infrared spectra of methanol clusters (CH{sub 3}OH){sub n} (n = 2–5) using self-consistent-charge density functional tight-binding molecular dynamics simulations

    SciTech Connect

    Nishimura, Yoshifumi; Lee, Yuan-Pern; Irle, Stephan; Witek, Henryk A.

    2014-09-07

    Vibrational infrared (IR) spectra of gas-phase O–H⋅⋅⋅O methanol clusters up to pentamer are simulated using self-consistent-charge density functional tight-binding method using two distinct methodologies: standard normal mode analysis and Fourier transform of the dipole time-correlation function. The twofold simulations aim at the direct critical assignment of the C–H stretching region of the recently recorded experimental spectra [H.-L. Han, C. Camacho, H. A. Witek, and Y.-P. Lee, J. Chem. Phys. 134, 144309 (2011)]. Both approaches confirm the previous assignment (ibid.) of the C–H stretching bands based on the B3LYP/ANO1 harmonic frequencies, showing that ν{sub 3}, ν{sub 9}, and ν{sub 2} C–H stretching modes of the proton-accepting (PA) and proton-donating (PD) methanol monomers experience only small splittings upon the cluster formation. This finding is in sharp discord with the assignment based on anharmonic B3LYP/VPT2/ANO1 vibrational frequencies (ibid.), suggesting that some procedural faults, likely related to the breakdown of the perturbational vibrational treatment, led the anharmonic calculations astray. The IR spectra based on the Fourier transform of the dipole time-correlation function include new, previously unaccounted for physical factors such as non-zero temperature of the system and large amplitude motions of the clusters. The elevation of temperature results in a considerable non-homogeneous broadening of the observed IR signals, while the presence of large-amplitude motions (methyl group rotations and PA-PD flipping), somewhat surprisingly, does not introduce any new features in the spectrum.

  15. Internal Charging

    NASA Technical Reports Server (NTRS)

    Minow, Joseph I.

    2014-01-01

    (1) High energy (>100keV) electrons penetrate spacecraft walls and accumulate in dielectrics or isolated conductors; (2) Threat environment is energetic electrons with sufficient flux to charge circuit boards, cable insulation, and ungrounded metal faster than charge can dissipate; (3) Accumulating charge density generates electric fields in excess of material breakdown strenght resulting in electrostatic discharge; and (4) System impact is material damage, discharge currents inside of spacecraft Faraday cage on or near critical circuitry, and RF noise.

  16. On the Preon Model with Preonic Charge

    NASA Astrophysics Data System (ADS)

    Senju, H.

    1987-05-01

    It is proposed to identify ghe recently introduced preonic charge as the source of the binding force with the magnetic charge. This identification leads to the necessary relation of composite quarks and leptons among preonic charges. The reason why the charge of quark is a third of e is under stood. The color number 3 and the preon number 3 in lepton and quark are correlated.

  17. Negative refraction and superconductivity

    NASA Astrophysics Data System (ADS)

    Amariti, Antonio; Forcella, Davide; Mariotti, Alberto; Siani, Massimo

    2011-10-01

    We discuss exotic properties of charged hydrodynamical systems, in the broken superconducting phase, probed by electromagnetic waves. Motivated by general arguments from hydrodynamics, we observe that negative refraction, namely the propagation in opposite directions of the phase velocities and of the energy flux, is expected for low enough frequencies. We corroborate this general idea by analyzing a holographic superconductor in the AdS/CFT correspondence, where the response functions can be explicitly computed. We study the dual gravitational theory both in the probe and in the backreacted case. We find that, while in the first case the refractive index is positive at every frequency, in the second case there is negative refraction at low enough frequencies. This is in agreement with hydrodynamic considerations.

  18. Backside Charging of Ccds

    NASA Astrophysics Data System (ADS)

    Iyer, Venkatraman

    1997-10-01

    Backside illuminated thinned CCDs have the highest response in the UV and blue spectral region. Their use in detectors is limited due to the instability of the CCD. A low temperature oxide nearly 30 A thick is grown on the acid thinned backside to tie up dangling bonds. The oxide carries fixed positive charges that attract and trap photogenerated electrons. A permanent and stable backside charging procedure is necessary to create a negative bias that will drive electrons to the frontside collection wells. We have shown chemisorption charging to be a novel method to permanently charge CCDs. The catalytic nature of certain metals are exploited to chemisorb oxygen as negative atomic species at the metal/oxide interface. Charging is shown to occur by depositing a thin film 10 A of platinum on the backside. No tunneling occurs because of the thick oxide. The Passivated Platinum Film (PPtF) which utilizes a hafnium oxide antireflection coating to passivate the platinum is an effective process, but it is sensitive to the environment and discharges quickly upon hydrogen exposure. A silver catalytic coating is shown to be far superior to other charging techniques. Silver irreversibly chemisorbs oxygen and hydrogen is not dissociatively adsorbed except at temperatures <100oK. High quantum efficiencies have been recorded for the UV-blue ranges. A slight drop is seen at cold temperatures due to interaction of water with oxygen to form hydroxyl ions. No change in QE is seen upon exposure to hydrogen or during outgassing. Silver is also one of the most transparent metals and easily deposited by evaporation. We therefore have developed a charging process which is nearly ideal for CCD imaging.

  19. Predicting Nonspecific Ion Binding Using DelPhi

    PubMed Central

    Petukh, Marharyta; Zhenirovskyy, Maxim; Li, Chuan; Li, Lin; Wang, Lin; Alexov, Emil

    2012-01-01

    Ions are an important component of the cell and affect the corresponding biological macromolecules either via direct binding or as a screening ion cloud. Although some ion binding is highly specific and frequently associated with the function of the macromolecule, other ions bind to the protein surface nonspecifically, presumably because the electrostatic attraction is strong enough to immobilize them. Here, we test such a scenario and demonstrate that experimentally identified surface-bound ions are located at a potential that facilitates binding, which indicates that the major driving force is the electrostatics. Without taking into consideration geometrical factors and structural fluctuations, we show that ions tend to be bound onto the protein surface at positions with strong potential but with polarity opposite to that of the ion. This observation is used to develop a method that uses a DelPhi-calculated potential map in conjunction with an in-house-developed clustering algorithm to predict nonspecific ion-binding sites. Although this approach distinguishes only the polarity of the ions, and not their chemical nature, it can predict nonspecific binding of positively or negatively charged ions with acceptable accuracy. One can use the predictions in the Poisson-Boltzmann approach by placing explicit ions in the predicted positions, which in turn will reduce the magnitude of the local potential and extend the limits of the Poisson-Boltzmann equation. In addition, one can use this approach to place the desired number of ions before conducting molecular-dynamics simulations to neutralize the net charge of the protein, because it was shown to perform better than standard screened Coulomb canned routines, or to predict ion-binding sites in proteins. This latter is especially true for proteins that are involved in ion transport, because such ions are loosely bound and very difficult to detect experimentally. PMID:22735539

  20. Electrogenic Steps Associated with Substrate Binding to the Neuronal Glutamate Transporter EAAC1.

    PubMed

    Tanui, Rose; Tao, Zhen; Silverstein, Nechama; Kanner, Baruch; Grewer, Christof

    2016-05-27

    Glutamate transporters actively take up glutamate into the cell, driven by the co-transport of sodium ions down their transmembrane concentration gradient. It was proposed that glutamate binds to its binding site and is subsequently transported across the membrane in the negatively charged form. With the glutamate binding site being located partially within the membrane domain, the possibility has to be considered that glutamate binding is dependent on the transmembrane potential and, thus, is electrogenic. Experiments presented in this report test this possibility. Rapid application of glutamate to the wild-type glutamate transporter subtype EAAC1 (excitatory amino acid carrier 1) through photo-release from caged glutamate generated a transient inward current, as expected for the electrogenic inward movement of co-transported Na(+) In contrast, glutamate application to a transporter with the mutation A334E induced transient outward current, consistent with movement of negatively charged glutamate into its binding site within the dielectric of the membrane. These results are in agreement with electrostatic calculations, predicting a valence for glutamate binding of -0.27. Control experiments further validate and rule out other possible explanations for the transient outward current. Electrogenic glutamate binding can be isolated in the mutant glutamate transporter because reactions, such as glutamate translocation and/or Na(+) binding to the glutamate-bound state, are inhibited by the A334E substitution. Electrogenic glutamate binding has to be considered together with other voltage-dependent partial reactions to cooperatively determine the voltage dependence of steady-state glutamate uptake and glutamate buffering at the synapse. PMID:27044739

  1. Spacecraft charging

    NASA Technical Reports Server (NTRS)

    Stevens, N. John

    1989-01-01

    The effects of spacecraft charging on spacecraft materials are studied. Spacecraft charging interactions seem to couple environment to system performance through materials. Technology is still developing concerning both environment-driven and operating system-driven interactions. The meeting addressed environment but lacked specific mission requirements, as a result system definition are needed to prioritize interactions.

  2. Charging machine

    DOEpatents

    Medlin, John B.

    1976-05-25

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine.

  3. Multiscale simulations of protein G B1 adsorbed on charged self-assembled monolayers.

    PubMed

    Liu, Jie; Liao, Chenyi; Zhou, Jian

    2013-09-10

    The orientation of an antibody plays an important role in the development of immunosensors. Protein G is an antibody binding protein, which specifically targets the Fc fragment of an antibody. In this work, the orientation of prototypical and mutated protein G B1 adsorbed on positively and negatively charged self-assembled monolayers was studied by parallel tempering Monte Carlo and all-atom molecular dynamics simulations. Both methods present generally similar orientation distributions of protein G B1 for each kind of surface. The root-mean-square deviation, DSSP, gyration radius, eccentricity, dipole moment, and superimposed structures of protein G B1 were analyzed. Moreover, the orientation of binding antibody was also predicted in this work. Simulation results show that with the same orientation trends, the mutant exhibits narrower orientation distributions than does the prototype, which was mainly caused by the stronger dipole of the mutant. Both kinds of proteins adsorbed on charged surfaces were induced by the competition of electrostatic interaction and vdW interaction; the electrostatic interaction energy dominated the adsorption behavior. The protein adsorption was also largely affected by the distribution of charged residues within the proteins. Thus, the prototype could adsorb on a negatively charged surface, although it keeps a net charge of -4 e. The mutant has imperfect opposite orientation when it adsorbed on oppositely charged surfaces. For the mutant on a carboxyl-functionalized self-assembled monolayer (COOH-SAM), the orientation was the same as that inferred by experiments. While for the mutant on amine-functionalized self-assembled monolayer (NH2-SAM), the orientation was induced by the competition between attractive interactions (led by ASP40 and GLU56) and repulsive interactions (led by LYS10); thus, the perfect opposite orientation could not be obtained. On both surfaces, the adsorbed protein could retain its native conformation. The desired

  4. Isolation and characterizations of oxalate-binding proteins in the kidney

    SciTech Connect

    Roop-ngam, Piyachat; Chaiyarit, Sakdithep; Pongsakul, Nutkridta; Thongboonkerd, Visith

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer The first large-scale characterizations of oxalate-binding kidney proteins. Black-Right-Pointing-Pointer The recently developed oxalate-conjugated EAH Sepharose 4B beads were applied. Black-Right-Pointing-Pointer 38 forms of 26 unique oxalate-binding kidney proteins were identified. Black-Right-Pointing-Pointer 25/26 (96%) of identified proteins had 'L-x(3,5)-R-x(2)-[AGILPV]' domain. -- Abstract: Oxalate-binding proteins are thought to serve as potential modulators of kidney stone formation. However, only few oxalate-binding proteins have been identified from previous studies. Our present study, therefore, aimed for large-scale identification of oxalate-binding proteins in porcine kidney using an oxalate-affinity column containing oxalate-conjugated EAH Sepharose 4B beads for purification followed by two-dimensional gel electrophoresis (2-DE) to resolve the recovered proteins. Comparing with those obtained from the controlled column containing uncoupled EAH-Sepharose 4B (to subtract the background of non-specific bindings), a total of 38 protein spots were defined as oxalate-binding proteins. These protein spots were successfully identified by quadrupole time-of-flight mass spectrometry (MS) and/or tandem MS (MS/MS) as 26 unique proteins, including several nuclear proteins, mitochondrial proteins, oxidative stress regulatory proteins, metabolic enzymes and others. Identification of oxalate-binding domain using the PRATT tool revealed 'L-x(3,5)-R-x(2)-[AGILPV]' as a functional domain responsible for oxalate-binding in 25 of 26 (96%) unique identified proteins. We report herein, for the first time, large-scale identification and characterizations of oxalate-binding proteins in the kidney. The presence of positively charged arginine residue in the middle of this functional domain suggested its significance for binding to the negatively charged oxalate. These data will enhance future stone research, particularly on stone

  5. The specificity of protection against cationic antimicrobial peptides by lactoferrin binding protein B.

    PubMed

    Morgenthau, Ari; Partha, Sarathy K; Adamiak, Paul; Schryvers, Anthony B

    2014-10-01

    A variety of Gram-negative pathogens possess host-specific lactoferrin (Lf) receptors that mediate the acquisition of iron from host Lf. The integral membrane protein component of the receptor, lactoferrin binding protein A specifically binds host Lf and is required for acquisition of iron from Lf. In contrast, the role of the bi-lobed surface lipoprotein, lactoferrin binding protein B (LbpB), in Lf binding and iron acquisition is uncertain. A common feature of LbpBs from most species is the presence of clusters of negatively charged amino acids in the protein's C-terminal lobe. Recently it has been shown that the negatively charged regions from the Neisseria meningitidis LbpB are responsible for protecting against an 11 amino acid cationic antimicrobial peptide (CAP), lactoferricin (Lfcin), derived from human Lf. In this study we investigated whether the LbpB confers resistance to other CAPs since N. meningitidis is likely to encounter other CAPs from the host. LbpB provided protection against the cathelicidin derived peptide, cathelicidin related antimicrobial peptide (mCRAMP), but did not confer protection against Tritrp 1 or LL37 under our experimental conditions. When tested against a range of rationally designed synthetic peptides, LbpB was shown to protect against IDR-1002 and IDR-0018 but not against HH-2 or HHC10. PMID:25038734

  6. Membrane interactions in nerve myelin: II. Determination of surface charge from biochemical data.

    PubMed Central

    Inouye, H; Kirschner, D A

    1988-01-01

    In our accompanying paper (Inouye and Kirschner, 1988) we calculated the surface charge density at the extracellular surfaces in peripheral and central nervous system (PNS; CNS) myelins from observations on the dependency of the width of the extracellular space on pH and ionic strength. Here, we have determined the surface charge density of the membrane surfaces in myelin from its chemical composition and the localization of some of its molecular components. We then analyzed the attractive and repulsive forces between the apposed surfaces and calculated equilibrium periods for comparison with the measured values. The biochemical model accounts for the observed isoelectric range of the myelin period and, with the surface charge reduced (possibly by divalent cation binding or a space charge approximation), the model also accounts for the dependency of period on pH above the isoelectric range. At the extracellular (and cytoplasmic) surfaces the contribution of lipid (with pI approximately 2) to the net surface charge is about the same in both PNS and CNS myelin, whereas the contribution of protein depends on which ones are exposed at the two surfaces. The protein conformation and localization modulate the surface charge of the lipid, resulting in positively-charged cytoplasmic surfaces (pI approximately 9) and negatively-charged extracellular surfaces (pI approximately 2-4). The net negative charge at the extracellular surface is due in CNS myelin to lipid, and in PNS myelin to both lipid and (PO) glycoprotein. The net positive charge at the cytoplasmic surface is due in CNS myelin mostly to basic protein, and in PNS myelin to PO glycoprotein and basic protein. The invariance of the cytoplasmic packing may be due to specific short-range interactions. Our models demonstrate how the particular myelin proteins and their localization and conformation can account for the differences in inter-membrane interactions in CNS and PNS myelins. PMID:3345333

  7. Modeling the Interaction between Integrin-Binding Peptide (RGD) and Rutile Surface: The Effect of Na+ on Peptide Adsorption

    SciTech Connect

    Wu, Chunya; Skelton, Adam; Chen, Mingjun; Vlcek, Lukas; Cummings, Peter T

    2011-01-01

    The dynamics of a single tripeptide Arg-Gly-Asp (RGD) adsorbing onto negatively charged hydroxylated rutile (110) surface in aqueous solution was studied using molecular dynamics (MD) simulations. The results indicate that the adsorbed Na{sup +} ions play an important role in determining the binding geometry of RGD. With an initial 'horseshoe' configuration, the charged side groups (COO{sup -} and NH{sub 2}) of the peptide are able to interact with the surface through direct hydrogen bonds (H bonds) in the very early stage of adsorption. The Na{sup +} ions approach the positively charged Arg side chain, competing with the Arg side chain for adsorption to the negatively charged hydroxyl oxygen. In coordination with the structural adjustment of the peptide, the Arg residue is driven to detach from the rutile surface. In contrast, the Na+ ions in close proximity to the negatively charged Asp side chain contribute to the binding of the COO{sup -} group on the surface, helping the carboxyl oxygen not involved in COO{sup -}-surface H bonds to orientate toward the hydroxyl hydrogens. Once both carboxyl oxygens form enough H bonds with the hydroxyl hydrogens, the redundant ions move toward a more favorable adsorption site.

  8. Mechanism of ligand-protein interaction in plant seed thiamin-binding proteins. Probing the binding site of protein isolated from buckwheat seeds with a series of thiamin-related compounds.

    PubMed

    Rapała-Kozik, M; Kozik, A

    1992-09-23

    Affinities of 14 thiamin derivatives or antagonists to a thiamin-binding protein isolated from buckwheat seeds were determined. A competitive displacement of radiolabeled thiamin by unlabeled ligand was analysed by a computerized model-fitting procedure. The dissociation constant of the thiamin-protein complex was 0.93 microM. Most modifications in ligand chemical structure weakened the ligand-protein interaction. A model of the thiamin-binding site is suggested. The hydroxyethyl-chain of thiamin while protein-bound appears to be excluded from the binding region. A positively charged quaternary nitrogen atom of the thiazolium ring probably interacts with some negative group(s) of protein. The rest of the thiazolium ring as well as the amino group of the pyrimidine fragment serve as additional anchors. The three structural features of the thiamin molecule accounting for binding contribute equally to overall binding energy by about 11-12 kJ/mol.

  9. Formation of hexagonal fullerene layers from neutral and negatively charged fullerenes in {(Ph3P)3Au(+)}2(C60(•-))2(C60)·C6H4Cl2 containing gold cations with the C3v symmetry.

    PubMed

    Konarev, Dmitri V; Khasanov, Salavat S; Otsuka, Akihiro; Ishikawa, Manabu; Yamochi, Hideki; Saito, Gunzi; Lyubovskaya, Rimma N

    2014-07-01

    Fullerene salt {(Ph3P)3Au(+)}2(C60(•-))2(C60)·C6H4Cl2 (1) containing (Ph3P)3Au(+) cations with the C3v symmetry has been obtained as single crystals. Hexagonal corrugated fullerene layers formed in 1 alternate with the layers consisting of (Ph3P)3Au(+) and C6H4Cl2 along the c axis. According to IR spectra and peculiarities of the crystal structure, the charge on fullerenes in the layers is evaluated to be -1 for two and close to zero for one C60. These fullerenes have different cationic surroundings, and positively charged gold atoms approach closer to C60(•-). Charged and neutral fullerenes are closely packed within hexagonal layers with an interfullerene center-to-center distance of 10.02 Å and multiple short van der Waals C···C contacts. The distances between C60(•-) are essentially longer with an interfullerene center-to-center distance of 10.37 Å due to corrugation of the layers, and no van der Waals contacts are formed in this case. As a result, each C60(•-) has only three negatively charged fullerene neighbors with rather long interfullerene distances providing only weak antiferromagnetic interaction of spins in the fullerene layers with a Weiss temperature of -5 K.

  10. Spectroscopic studies on the thermodynamic and thermal denaturation of the ct-DNA binding of methylene blue

    NASA Astrophysics Data System (ADS)

    Mudasir; Wahyuni, Endang Tri; Tjahjono, Daryono H.; Yoshioka, Naoki; Inoue, Hidenari

    2010-10-01

    The ct-DNA binding properties of methylene blue (MB) including binding constant, thermodynamic parameter and thermal denaturation ( Tm) have been systematically studied by spectrophotometric method. The binding of MB to ct-DNA is quite strong as indicated by remarkable hypochromicity, red shift and equilibrium binding constant ( Kb). Van't Hoff plot of 1/ T versus ln Kb suggests that the MB dye binds exothermically to ct-DNA which is characterized by large negative enthalpy and entropy changes. According to polyelectrolyte theory, the charge release ( Z) when ct-DNA interacts with MB is +1.09 which corresponds very well to the one positive charge carried by the MB dye. The Kb at a low concentration of salt is dominated by electrostatic interaction (90%) while that at a high concentration of salt is mostly controlled by non-electrostatic process (85%). However, the stabilization of the DNA binding event in both cases is governed by non-electrostatic process. A moderate stabilization of double helix ct-DNA occurs when the MB dye binds to ct-DNA as indicated by the increase in Tm of ct-DNA of about 5.5 °C in the presence of MB. This suggests that MB dye possibly binds to ct-DNA via electrostatic and intercalation modes.

  11. Negative Mass Propulsion

    NASA Astrophysics Data System (ADS)

    Winterberg, F.

    Schrödinger's analysis of the Dirac equation gives a hint for the existence of negative masses hidden behind positive masses. But their use for propulsion by reducing the inertia of matter for example, in the limit of macroscopic bodied with zero rest mass, depends on a technical solution to free them from their imprisonment by positive masses. It appears that there are basically two ways this might be achieved: 1. By the application of strong electromagnetic or gravitational fields or by high particle energies. 2. By searching for places in the universe where nature has already done this separation, and from where the negative masses can be mined. The first of these two possibilities is for all practical means excluded, because if possible at all, it would depend on electromagnetic or gravitational fields with strength beyond what is technically attainable, or on extremely large likewise not attainable particle energies. With regard to the 2nd possibility, it has been observed that non-baryonic cold dark matter tends to accumulate near the center of galaxies, or places in the universe which have a large gravitational potential well. Because of the equivalence principle of general relativity, the attraction towards the center of a gravitational potential well, produced by a positive mass, is for negative masses the same as for positive masses, and large amounts of negative masses might have over billions of years been trapped in these gravitational potential wells. Now it just happens that the center of the moon is a potential well, not too deep that it cannot be reached by making a tunnel through the moon, not possible for the deeper potential well of the earth, where the temperature and pressure are too high. Making a tunnel through the moon, provided there is a good supply of negative mass, could revolutionize interstellar space flight. A sequence of thermonuclear shape charges would make such tunnel technically feasible.

  12. Identification of a putative motif for binding of peptides to HLA-DQ2.

    PubMed

    Johansen, B H; Vartdal, F; Eriksen, J A; Thorsby, E; Sollid, L M

    1996-02-01

    To understand the rules determining peptide binding to the celiac disease and type 1 diabetes mellitus associated HLA-DQ2 molecule, we have studies in detail the binding of a peptide OVA 258-276Y (IINFEKLTEWTSSNVMEERY) which exhibits strong binding to DQ2. First we tested a set of N- and C-terminal truncated variants, and found the core binding region to comprise residues 267-276Y. Single alanine substitution analysis of the OVA 267-276Y peptide revealed that replacements of V272, E275 and the C-terminal Y had negative effects whereas the substitution of N271 had a positive effect. A polyalanine analogue of the OVA 267-276Y peptide with V272, E275 and a C-terminal Y bound at least as well as the original peptide. A variant peptide with a deletion of R276 displayed decreased binding, suggesting that the anchor residues were out of frame in this analogue. To further characterize the residues playing a role in the binding of the OVA 267-276Y peptide to DQ2 we tested the binding of several analogues with substitutions for V272, E275 and the C-terminal Y residue. Our results indicate that peptides binding to DQ2 have anchor residues in relative positions 4, 7 and (P4, P7 and P9). Residues with negatively charged or hydrophobic aliphatic but not positively charged side chains are preferred in P4 and P7, whereas residues with bulky hydrophobic side chains are preferred in P9. PMID:8671602

  13. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding dEF1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an estrogen receptor-enhanced cell line when treated with estrogen. This promoter-enhancer also binds unidentified proteins that recognize a consens...

  14. Binding of small basic peptides to membranes containing acidic lipids: theoretical models and experimental results.

    PubMed Central

    Ben-Tal, N; Honig, B; Peitzsch, R M; Denisov, G; McLaughlin, S

    1996-01-01

    We measured directly the binding of Lys3, Lys5, and Lys7 to vesicles containing acidic phospholipids. When the vesicles contain 33% acidic lipids and the aqueous solution contains 100 mM monovalent salt, the standard Gibbs free energy for the binding of these peptides is 3, 5, and 7 kcal/mol, respectively. The binding energies decrease as the mol% of acidic lipids in the membrane decreases and/or as the salt concentration increases. Several lines of evidence suggest that these hydrophilic peptides do not penetrate the polar headgroup region of the membrane and that the binding is mainly due to electrostatic interactions. To calculate the binding energies from classical electrostatics, we applied the nonlinear Poisson-Boltzmann equation to atomic models of the phospholipid bilayers and the basic peptides in aqueous solution. The electrostatic free energy of interaction, which arises from both a long-range coulombic attraction between the positively charged peptide and the negatively charged lipid bilayer, and a short-range Born or image charge repulsion, is a minimum when approximately 2.5 A (i.e., one layer of water) exists between the van der Waals surfaces of the peptide and the lipid bilayer. The calculated molar association constants, K, agree well with the measured values: K is typically about 10-fold smaller than the experimental value (i.e., a difference of about 1.5 kcal/mol in the free energy of binding). The predicted dependence of K (or the binding free energies) on the ionic strength of the solution, the mol% of acidic lipids in the membrane, and the number of basic residues in the peptide agree very well with the experimental measurements. These calculations are relevant to the membrane binding of a number of important proteins that contain clusters of basic residues. Images FIGURE 2 FIGURE 3 PMID:8842196

  15. Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

    SciTech Connect

    Newberry, K.J.; Huffman, J.L.; Miller, M.C.; Vazquez-Laslop, N.; Neyfakh, A.A.; Brennan, R.G.

    2009-05-22

    BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets, that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.

  16. Taming Highly Charged Radioisotopes

    NASA Astrophysics Data System (ADS)

    Chowdhury, Usman; Eberhardt, Benjamin; Jang, Fuluni; Schultz, Brad; Simon, Vanessa; Delheij, Paul; Dilling, Jens; Gwinner, Gerald

    2012-10-01

    The precise and accurate mass of short-lived radioisotopes is a very important parameter in physics. Contribution to the improvement of nuclear models, metrological standard fixing and tests of the unitarity of the Caibbibo-Kobayashi-Maskawa (CKM) matrix are a few examples where the mass value plays a major role. TRIUMF's ion trap for atomic and nuclear physics (TITAN) is a unique facility of three online ion traps that enables the mass measurement of short-lived isotopes with high precision (˜10-8). At present TITAN's electron beam ion trap (EBIT) increases the charge state to increase the precision, but there is no facility to significantly reduce the energy spread introduced by the charge breeding process. The precision of the measured mass of radioisotopes is linearly dependent on the charge state while the energy spread of the charged radioisotopes affects the precision adversely. To boost the precision level of mass measurement at TITAN without loosing too many ions, a cooler Penning trap (CPET) is being developed. CPET is designed to use either positively (proton) or negatively (electron) charged particles to reduce the energy spread via sympathetic cooling. Off-line setup of CPET is complete. Details of the working principles and updates are presented

  17. MARCKS is a natively unfolded protein with an inaccessible actin-binding site: evidence for long-range intramolecular interactions.

    PubMed

    Tapp, Hazel; Al-Naggar, Iman M; Yarmola, Elena G; Harrison, Alexis; Shaw, Gerry; Edison, Arthur S; Bubb, Michael R

    2005-03-18

    Myristoylated alanine-rich C kinase substrate (MARCKS) is an unfolded protein that contains well characterized actin-binding sites within the phosphorylation site domain (PSD), yet paradoxically, we now find that intact MARCKS does not bind to actin. Intact MARCKS also does not bind as well to calmodulin as does the PSD alone. Myristoylation at the N terminus alters how calmodulin binds to MARCKS, implying that, despite its unfolded state, the distant N terminus influences binding events at the PSD. We show that the free PSD binds with site specificity to MARCKS, suggesting that long-range intramolecular interactions within MARCKS are also possible. Because of the unusual primary sequence of MARCKS with an overall isoelectric point of 4.2 yet a very basic PSD (overall charge of +13), we speculated that ionic interactions between oppositely charged domains of MARCKS were responsible for long-range interactions within MARCKS that sterically influence binding events at the PSD and that explain the observed differences between properties of the PSD and MARCKS. Consistent with this hypothesis, chemical modifications of MARCKS that neutralize negatively charged residues outside of the PSD allow the PSD to bind to actin and increase the affinity of MARCKS for calmodulin. Similarly, both myristoylation of MARCKS and cleavage of MARCKS by calpain are shown to increase the availability of the PSD so as to activate its actin-binding activity. Because abundant evidence supports the conclusion that MARCKS is an important protein in regulating actin dynamics, our data imply that post-translational modifications of MARCKS are necessary and sufficient to regulate actin-binding activity. PMID:15640140

  18. Electrode measurements of the net charge on muscle proteins

    NASA Astrophysics Data System (ADS)

    Bryson, Elzbieta Anna

    1997-12-01

    Electrode techniques for measuring Donnan potentials in protein solutions were studied and applied to elucidate the effect of methylation on the net charge of heavy meromyosin (HMM) and the effect of Ca2+ on the net charge of the thin filament proteins. Drifts in potentials, observed for macroelectrodes, were examined and their cause established to be KCl leakage out of electrodes. The microelectrode technique was applied to protein solutions and microelectrodes with resistance less than 1 MΩ were used: the conditions for manufacturing and maintaining electrodes functional were established. HMM was isolated (from rabbit muscle) and methylated; the modification was verified by amino acid analysis. ATPase activity of methylated HMM was found to be significantly elevated in the presence of Ca2+ and decreased in the presence of EDTA with respect to the activity of the native protein. Values of the net charge of both proteins were determined at pH 6.7 and no significant difference was found between them. Calculations of the theoretical charge of lysine and Nɛ-dimethyllysine were performed which indicated only 0.5% difference at pH 6.7. F-actin, tropomyosin-troponin (Tm-tn) and reconstituted thin filaments (RTFs) were isolated from rabbit muscle. Conditions for preserving the binding between F-actin and Tm-tn were established. Net charges of F-actin, Tm-tn, RTFs and BSA (control) were measured in solutions of pCa 3.2-8.7 at ionic strength 0.02 M and pH 7.0. Significant decrease in the negative charge of the RTFs, Tm-tn and F- actin was observed with increasing concentrations of free Ca2+, between pCa 6.5 and 3 approximately. Values of the molecular and specific charge at pH 7.0 and the isoelectric point were calculated from the amino acid sequences of the main muscle proteins.

  19. Estimation of the binding ability of main transport proteins of blood plasma with liver cirrhosis by the fluorescent probe method

    NASA Astrophysics Data System (ADS)

    Korolenko, E. A.; Korolik, E. V.; Korolik, A. K.; Kirkovskii, V. V.

    2007-07-01

    We present results from an investigation of the binding ability of the main transport proteins (albumin, lipoproteins, and α-1-acid glycoprotein) of blood plasma from patients at different stages of liver cirrhosis by the fluorescent probe method. We used the hydrophobic fluorescent probes anionic 8-anilinonaphthalene-1-sulfonate, which interacts in blood plasma mainly with albumin; cationic Quinaldine red, which interacts with α-1-acid glycoprotein; and neutral Nile red, which redistributes between lipoproteins and albumin in whole blood plasma. We show that the binding ability of albumin and α-1-acid glycoprotein to negatively charged and positively charged hydrophobic metabolites, respectively, increases in the compensation stage of liver cirrhosis. As the pathology process deepens and transitions into the decompensation stage, the transport abilities of albumin and α-1-acid glycoprotein decrease whereas the binding ability of lipoproteins remains high.

  20. Charge donation to and dearomatization of benzene attending complexation: DFT estimates of binding energies of TpMXO(L) with benzene, for Tp = hydridotris(pyrazolyl) borate, MXO = MoNO, ReCO, and WNO, and L = ammonia, N-methylimidazole, pyridine, phosphine, methyl isocyanide, and carbon monoxide.

    PubMed

    Harman, W Dean; Trindle, Carl

    2005-01-30

    By density functional methods we characterize the bonding and charge distribution in complexes of benzene with dearomatizing agents tpReCO(L), tpMoNO(L), and tpWNO(L), where tp = hydrido Tris (pyrazolyl)borate), for a range of ligands L. Our LSDA and B3LYP density functional calculations use the Spartan LACVP+ basis and pseudopotential on Re, Mo, and W and 6-31G* on light atoms. The binding energy is strongly dependent on the nature of the ligand L, being greatest for L = ammonia and N-methylimidazole and weakest for CH3NC and CO. We find a correlation between strength of binding and electron transfer from the dearomatizing agents toward benzene. For the most strongly bound systems we find substantial (up to 500 millielectrons) charge transfer towards benzene, while for the most weakly bound systems charge is withdrawn from benzene. Structural details illustrate the ability of Re, Mo, and W species to dearomatize complexed benzene, which is extensive for all but the most weakly bound species with L = MeNC and CO. Re and W dearomatizing agents, which are computed and observed to form stable complexes with benzene, may be economic alternatives to osmium dearomatizing agents. PMID:15593348