Sample records for binds viral dna

  1. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.


    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S


    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  2. Nbs1-dependent binding of Mre11 to adenovirus E4 mutant viral DNA is important for inhibiting DNA replication

    SciTech Connect

    Mathew, Shomita S.; Bridge, Eileen


    Adenovirus (Ad) infections stimulate the activation of cellular DNA damage response and repair pathways. Ad early regulatory proteins prevent activation of DNA damage responses by targeting the MRN complex, composed of the Mre11, Rad50 and Nbs1 proteins, for relocalization and degradation. In the absence of these viral proteins, Mre11 colocalizes with viral DNA replication foci. Mre11 foci formation at DNA damage induced by ionizing radiation depends on the Nbs1 component of the MRN complex and is stabilized by the mediator of DNA damage checkpoint protein 1 (Mdc1). We find that Nbs1 is required for Mre11 localization at DNA replication foci in Ad E4 mutant infections. Mre11 is important for Mdc1 foci formation in infected cells, consistent with its role as a sensor of DNA damage. Chromatin immunoprecipitation assays indicate that both Mre11 and Mdc1 are physically bound to viral DNA, which could account for their localization in viral DNA containing foci. Efficient binding of Mre11 to E4 mutant DNA depends on the presence of Nbs1, and is correlated with a significant E4 mutant DNA replication defect. Our results are consistent with a model in which physical interaction of Mre11 with viral DNA is mediated by Nbs1, and interferes with viral DNA replication.

  3. Mutations that decrease DNA binding of the processivity factor of the herpes simplex virus DNA polymerase reduce viral yield, alter the kinetics of viral DNA replication, and decrease the fidelity of DNA replication.


    Jiang, Changying; Hwang, Ying T; Randell, John C W; Coen, Donald M; Hwang, Charles B C


    The processivity subunit of the herpes simplex virus DNA polymerase, UL42, is essential for viral replication and possesses both Pol- and DNA-binding activities. Previous studies demonstrated that the substitution of alanine for each of four arginine residues, which reside on the positively charged surface of UL42, resulted in decreased DNA binding affinity and a decreased ability to synthesize long-chain DNA by the polymerase. In this study, the effects of each substitution on the production of viral progeny, viral DNA replication, and DNA replication fidelity were examined. Each substitution mutant was able to complement the replication of a UL42 null mutant in transient complementation assays and to support the replication of plasmid DNA containing herpes simplex virus type 1 (HSV-1) origin sequences in transient DNA replication assays. Mutant viruses containing each substitution and a lacZ insertion in a nonessential region of the genome were constructed and characterized. In single-cycle growth assays, the mutants produced significantly less progeny virus than the control virus containing wild-type UL42. Real-time PCR assays revealed that these UL42 mutants synthesized less viral DNA during the early phase of infection. Interestingly, during the late phase of infection, the mutant viruses synthesized larger amounts of viral DNA than the control virus. The frequencies of mutations of the virus-borne lacZ gene increased significantly in the substitution mutants compared to those observed for the control virus. These results demonstrate that the reduced DNA binding of UL42 is associated with significant effects on virus yields, viral DNA replication, and replication fidelity. Thus, a processivity factor can influence replication fidelity in mammalian cells.

  4. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities.


    Guo, Yang; Kragelund, Birthe B; White, Malcolm F; Peng, Xu


    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5' → 3' ssDNA exonuclease activity, in addition to the previously demonstrated ssDNA endonuclease activity. Further, in vitro pull-down assay demonstrated interactions between gp17 and gp18 and between gp18 and gp19 with the former being mediated by the intrinsically disordered C-terminus of gp17. The strand-displacement replication mode proposed previously for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.

  5. EBV noncoding RNA binds nascent RNA to drive host PAX5 to viral DNA

    PubMed Central

    Lee, Nara; Moss, Walter N.; Yario, Therese A.; Steitz, Joan A.


    Summary EBER2 is an abundant nuclear noncoding RNA expressed by Epstein-Barr virus (EBV). Probing its possible chromatin localization by CHART revealed EBER2’s presence at the terminal repeats (TRs) of the latent EBV genome, overlapping previously identified binding sites for the B-cell transcription factor PAX5. EBER2 interacts with and is required for PAX5 localization to the TRs. EBER2 knockdown phenocopies PAX5 depletion in upregulating the expression of LMP2A/B and LMP1, genes nearest the TRs. Knockdown of EBER2 also decreases EBV lytic replication, underscoring the essential role of the TRs in viral replication. Recruitment of the EBER2-PAX5 complex is mediated by base-pairing between EBER2 and nascent transcripts from the TR locus. The interaction is evolutionarily conserved in the related primate herpesvirus CeHV15 despite great sequence divergence. Using base-pairing with nascent RNA to guide an interacting transcription factor to its DNA target site is a previously undescribed function for a trans-acting noncoding RNA. PMID:25662012

  6. KSHV but not MHV-68 LANA induces a strong bend upon binding to terminal repeat viral DNA

    PubMed Central

    Ponnusamy, Rajesh; Petoukhov, Maxim V.; Correia, Bruno; Custodio, Tania F.; Juillard, Franceline; Tan, Min; Pires de Miranda, Marta; Carrondo, Maria A.; Simas, J. Pedro; Kaye, Kenneth M.; Svergun, Dmitri I.; McVey, Colin E.


    Latency-associated nuclear antigen (LANA) is central to episomal tethering, replication and transcriptional regulation of γ2-herpesviruses. LANA binds cooperatively to the terminal repeat (TR) region of the viral episome via adjacent LANA binding sites (LBS), but the molecular mechanism by which LANA assembles on the TR remains elusive. We show that KSHV LANA and MHV-68 LANA proteins bind LBS DNA using strikingly different modes. Solution structure of LANA complexes revealed that while kLANA tetramer is intrinsically bent both in the free and bound state to LBS1–2 DNA, mLANA oligomers instead adopt a rigid linear conformation. In addition, we report a novel non-ring kLANA structure that displays more flexibility at its assembly interface than previously demonstrated. We identified a hydrophobic pivot point located at the dimer–dimer assembly interface, which gives rotational freedom for kLANA to adopt variable conformations to accommodate both LBS1–2 and LBS2–1–3 DNA. Alterations in the arrangement of LBS within TR or at the tetramer assembly interface have a drastic effect on the ability of kLANA binding. We also show kLANA and mLANA DNA binding functions can be reciprocated. Although KSHV and MHV-68 are closely related, the findings provide new insights into how the structure, oligomerization, and DNA binding of LANA have evolved differently to assemble on the TR DNA. PMID:26424851

  7. Processivity factor of KSHV contains a nuclear localization signal and binding domains for transporting viral DNA polymerase into the nucleus

    SciTech Connect

    Chen Yali; Ciustea, Mihai; Ricciardi, Robert P. . E-mail:


    Kaposi's sarcoma-associated human herpesvirus (KSHV) encodes a processivity factor (PF-8, ORF59) that forms homodimers and binds to viral DNA polymerase (Pol-8, ORF9). PF-8 is essential for stabilizing Pol-8 on template DNA so that Pol-8 can incorporate nucleotides continuously. Here, the intracellular interaction of these two viral proteins was examined by confocal immunofluorescence microscopy. When individually expressed, PF-8 was observed exclusively in the nucleus, whereas Pol-8 was found only in the cytoplasm. However, when co-expressed, Pol-8 was co-translocated with PF-8 into the nucleus. Mutational analysis revealed that PF-8 contains a nuclear localization signal (NLS) as well as domains located at the N-terminus and the C-proximal regions that are required for Pol-8 binding. This study suggests that the mechanism that enables PF-8 to transport Pol-8 into the nucleus is the first critical step required for Pol-8 and PF-8 to function processively in KSHV DNA synthesis.

  8. Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.


    Saribas, A Sami; Mun, Sarah; Johnson, Jaslyn; El-Hajmoussa, Mohammad; White, Martyn K; Safak, Mahmut


    JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive. In this report, we have attempted to shed more light on this process by investigating molecular interactions between large T antigen (LT-Ag), Hsp70 and minor capsid proteins, VP2/VP3. We demonstrated that Hsp70 interacts with VP2/VP3 and LT-Ag; and accumulates heavily in the nucleus of the infected cells. We also showed that VP2/VP3 associates with LT-Ag through their DNA binding domains resulting in enhancement in LT-Ag DNA binding to Ori and induction in viral DNA replication. Altogether, our results suggest that VP2/VP3 and Hsp70 actively participate in JCV DNA replication and may play critical roles in coupling of viral DNA replication to virion encapsidation.

  9. Human T-Cell Leukemia Virus Type 1 Tax Requires Direct Access to DNA for Recruitment of CREB Binding Protein to the Viral Promoter

    PubMed Central

    Lenzmeier, Brian A.; Giebler, Holli A.; Nyborg, Jennifer K.


    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5′-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter. PMID:9447968

  10. Efficient Induction of Nuclear Aggresomes by Specific Single Missense Mutations in the DNA-binding Domain of a Viral AP-1 Homolog*

    PubMed Central

    Park, Richard; Wang'ondu, Ruth; Heston, Lee; Shedd, Duane; Miller, George


    Nuclear aggresomes induced by proteins containing an expanded polyglutamine (polyQ) tract are pathologic hallmarks of certain neurodegenerative diseases. Some GFP fusion proteins lacking a polyQ tract may also induce nuclear aggresomes in cultured cells. Here we identify single missense mutations within the basic DNA recognition region of Bam HI Z E B virus replication activator (ZEBRA), an Epstein-Barr virus (EBV)-encoded basic zipper protein without a polyQ tract, that efficiently induced the formation of nuclear aggresomes. Wild-type (WT) ZEBRA was diffusely distributed within the nucleus. Four non-DNA-binding mutants, Z(R179E), Z(R183E), Z(R190E), and Z(K178D) localized to the periphery of large intranuclear spheres, to discrete nuclear aggregates, and to the cytoplasm. Other non-DNA-binding mutants, Z(N182K), Z(N182E), and Z(S186E), did not exhibit this phenotype. The interior of the spheres contained promyelocytic leukemia and HSP70 proteins. ZEBRA mutants directly induced the nuclear aggresome pathway in cells with and without EBV. Specific cellular proteins (SC35 and HDAC6) and viral proteins (WT ZEBRA, Rta, and BMLF1) but not other cellular or viral proteins were recruited to nuclear aggresomes. Co-transfection of WT ZEBRA with aggresome-inducing mutants Z(R183E) and Z(R179E) inhibited late lytic viral protein expression and lytic viral DNA amplification. This is the first reported instance in which nuclear aggresomes are induced by single missense mutations in a viral or cellular protein. We discuss conformational changes in the mutant viral AP-1 proteins that may lead to formation of nuclear aggresomes. PMID:21233201

  11. The AT-hook DNA binding ability of the Epstein Barr virus EBNA1 protein is necessary for the maintenance of viral genomes in latently infected cells.


    Chakravorty, Adityarup; Sugden, Bill


    Epstein Barr Virus (EBV) is a human tumor virus that is causally linked to malignancies such as Burkitt׳s lymphoma, and gastric and nasopharyngeal carcinomas. Tethering of EBV genomes to cellular chromosomes is required for the synthesis and persistence of viral plasmids in tumor cells. However, it is not established how EBV genomes are tethered to cellular chromosomes. We test the hypothesis that the viral protein EBNA1 tethers EBV genomes to chromosomes specifically through its N-terminal AT-hook DNA-binding domains by using a small molecule, netropsin, that has been shown to inhibit the AT-hook DNA-binding of EBNA1 in vitro. We show that netropsin forces the loss of EBV genomes from epithelial and lymphoid cells in an AT-hook dependent manner and that EBV-positive lymphoma cells are significantly more inhibited in their growth by netropsin than are corresponding EBV-negative cells.

  12. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication

    PubMed Central

    Spriggs, Chelsey C.


    ABSTRACT The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV. PMID:28196964

  13. Amino Acids in the Basic Domain of Epstein-Barr Virus ZEBRA Protein Play Distinct Roles in DNA Binding, Activation of Early Lytic Gene Expression, and Promotion of Viral DNA Replication

    PubMed Central

    Heston, Lee; El-Guindy, Ayman; Countryman, Jill; Dela Cruz, Charles; Delecluse, Henri-Jacques; Miller, George


    The ZEBRA protein of Epstein-Barr virus (EBV) drives the viral lytic cycle cascade. The capacity of ZEBRA to recognize specific DNA sequences resides in amino acids 178 to 194, a region in which 9 of 17 residues are either lysine or arginine. To define the basic domain residues essential for activity, a series of 46 single-amino-acid-substitution mutants were examined for their ability to bind ZIIIB DNA, a high-affinity ZEBRA binding site, and for their capacity to activate early and late EBV lytic cycle gene expression. DNA binding was obligatory for the protein to activate the lytic cascade. Nineteen mutants that failed to bind DNA were unable to disrupt latency. A single acidic replacement of a basic amino acid destroyed DNA binding and the biologic activity of the protein. Four mutants that bound weakly to DNA were defective at stimulating the expression of Rta, the essential first target of ZEBRA in lytic cycle activation. Four amino acids, R183, A185, C189, and R190, are likely to contact ZIIIB DNA specifically, since alanine or valine substitutions at these positions drastically weakened or eliminated DNA binding. Twenty-three mutants were proficient in binding to ZIIIB DNA. Some DNA binding-proficient mutants were refractory to supershift by BZ-1 monoclonal antibody (epitope amino acids 214 to 230), likely as the result of the increased solubility of the mutants. Mutants competent to bind DNA could be separated into four functional groups: the wild-type group (eight mutants), a group defective at activating Rta (five mutants, all with mutations at the S186 site), a group defective at activating EA-D (three mutants with the R179A, S186T, and K192A mutations), and a group specifically defective at activating late gene expression (seven mutants). Three late mutants, with a Y180A, Y180E, or K188A mutation, were defective at stimulating EBV DNA replication. This catalogue of point mutants reveals that basic domain amino acids play distinct functions in binding

  14. Binding of host-cell factors to DNA sequences in the long terminal repeat of human T-cell leukemia virus type I: implications for viral gene expression

    SciTech Connect

    Nyborg, J.K.; Dynan, W.S.; Chen, I.S.Y.; Wachsman, W.


    Efficient expression of human T-cell leukemia virus type I (HTLV-I) genes requires both host and viral proteins and is dependent on DNA sequences in the proviral long terminal repeats (LTRs). The authors have used DNase I-protection assays (footprinting) to construct a map of protein-DNA interactions over a 250-nucleotide region of the LTR upstream of the start site for viral RNA synthesis. They find that a host factor (host expression factor 1, or HEF-1) binds to the imperfect 21-nucleotide repeats that have previously been implicated in HTLV-I gene expression. HEF-1 binding activity is present in preparations from both lymphoid and nonlymphoid cells lines. However, the boundaries of the protected regions and the presence of a flanking DNase-hypersensitive site vary with cell type. Several regions of binding are detected in addition to the HEF-1 sites, including a complex group of sites 40-90 nucleotides upstream of the RNA start site. A comparison of HTLV-I transformed T lymphocytes that do and do not express the viral trans-activating protein p40/sup xI/ shows that none of the observed features of the DNase I footprint pattern correlate directly with the presence of this protein in the extract. These results suggest (i) that the primary recognition of promoter elements in the HTLV-I LTR involves specific interactions with host-cell proteins and (ii) that p40/sup xI/ influences the activity of one or more of these proteins, rather than interacting directly with the DNA.

  15. Apo B100 similarities to viral proteins suggest basis for LDL-DNA binding and transfection capacity.


    Guevara, Juan; Prashad, Nagindra; Ermolinsky, Boris; Gaubatz, John W; Kang, Dongcheul; Schwarzbach, Andrea E; Loose, David S; Guevara, Natalia Valentinova


    LDL mediates transfection with plasmid DNA in a variety of cell types in vitro and in several tissues in vivo in the rat. The transfection capacity of LDL is based on apo B100, as arginine/lysine clusters, suggestive of nucleic acid-binding domains and nuclear localization signal sequences, are present throughout the molecule. Apo E may also contribute to this capacity because of its similarity to the Dengue virus capsid proteins and its ability to bind DNA. Synthetic peptides representing two apo B100 regions with prominent Arg/Lys clusters were shown to bind DNA. Region 1 (0014Lys-Ser0160) shares sequence motifs present in DNA binding domains of Interferon Regulatory Factors and Flaviviridae capsid/core proteins. It also contains a close analog of the B/E receptor ligand of apo E. Region 1 peptides, B1-1 (0014Lys-Glu0054) and B1-2 (0055Leu-Ala0096), mediate transfection of HeLa cells but are cytotoxic. Region 2 (3313Asp-Thr3431), containing the known B/E receptor ligand, shares analog motifs with the human herpesvirus 5 immediate-early transcriptional regulator (UL122) and Flaviviridae NS3 helicases. Region 2 peptides, B2-1 (3313Asp-Glu3355), and B2-2 (3356Gly-Thr3431) are ineffective in cell transfection and are noncytotoxic. These results confirm the role of LDL as a natural transfection vector in vivo, a capacity imparted by the apo B100, and suggest a basis for Flaviviridae cell entry.

  16. The Emerging Role of Nuclear Viral DNA Sensors*

    PubMed Central

    Diner, Benjamin A.; Lum, Krystal K.; Cristea, Ileana M.


    Detecting pathogenic DNA by intracellular receptors termed “sensors” is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. PMID:26354430

  17. HIV-1 Integrase Binds the Viral RNA Genome and Is Essential during Virion Morphogenesis.


    Kessl, Jacques J; Kutluay, Sebla B; Townsend, Dana; Rebensburg, Stephanie; Slaughter, Alison; Larue, Ross C; Shkriabai, Nikoloz; Bakouche, Nordine; Fuchs, James R; Bieniasz, Paul D; Kvaratskhelia, Mamuka


    While an essential role of HIV-1 integrase (IN) for integration of viral cDNA into human chromosome is established, studies with IN mutants and allosteric IN inhibitors (ALLINIs) have suggested that IN can also influence viral particle maturation. However, it has remained enigmatic as to how IN contributes to virion morphogenesis. Here, we demonstrate that IN directly binds the viral RNA genome in virions. These interactions have specificity, as IN exhibits distinct preference for select viral RNA structural elements. We show that IN substitutions that selectively impair its binding to viral RNA result in eccentric, non-infectious virions without affecting nucleocapsid-RNA interactions. Likewise, ALLINIs impair IN binding to viral RNA in virions of wild-type, but not escape mutant, virus. These results reveal an unexpected biological role of IN binding to the viral RNA genome during virion morphogenesis and elucidate the mode of action of ALLINIs.

  18. E1 initiator DNA binding specificity is unmasked by selective inhibition of non-specific DNA binding

    PubMed Central

    Stenlund, Arne


    Initiator proteins are critical components of the DNA replication machinery and mark the site of initiation. This activity probably requires highly selective DNA binding; however, many initiators display modest specificity in vitro. We demonstrate that low specificity of the papillomavirus E1 initiator results from the presence of a non-specific DNA-binding activity, involved in melting, which masks the specificity intrinsic to the E1 DNA-binding domain. The viral factor E2 restores specificity through a physical interaction with E1 that suppresses non-specific binding. We propose that this arrangement, where one DNA-binding activity tethers the initiator to ori while another alters DNA structure, is a characteristic of other viral and cellular initiator proteins. This arrangement would provide an explanation for the low selectivity observed for DNA binding by initiator proteins. PMID:12574131

  19. Recombination-dependent concatemeric viral DNA replication.


    Lo Piano, Ambra; Martínez-Jiménez, María I; Zecchi, Lisa; Ayora, Silvia


    The initiation of viral double stranded (ds) DNA replication involves proteins that recruit and load the replisome at the replication origin (ori). Any block in replication fork progression or a programmed barrier may act as a factor for ori-independent remodelling and assembly of a new replisome at the stalled fork. Then replication initiation becomes dependent on recombination proteins, a process called recombination-dependent replication (RDR). RDR, which is recognized as being important for replication restart and stability in all living organisms, plays an essential role in the replication cycle of many dsDNA viruses. The SPP1 virus, which infects Bacillus subtilis cells, serves as a paradigm to understand the links between replication and recombination in circular dsDNA viruses. SPP1-encoded initiator and replisome assembly proteins control the onset of viral replication and direct the recruitment of host-encoded replisomal components at viral oriL. SPP1 uses replication fork reactivation to switch from ori-dependent θ-type (circle-to-circle) replication to σ-type RDR. Replication fork arrest leads to a double strand break that is processed by viral-encoded factors to generate a D-loop into which a new replisome is assembled, leading to σ-type viral replication. SPP1 RDR proteins are compared with similar proteins encoded by other viruses and their possible in vivo roles are discussed.

  20. Live cell imaging reveals the relocation of dsRNA binding proteins upon viral infection.


    Barton, Deborah; Roovers, Elke; Gouil, Quentin; C da Fonseca, Guilherme; Reis, Rodrigo S; Jackson, Craig; Overall, Robyn; Fusaro, Adriana; Waterhouse, Peter


    Viral infection triggers a range of plant responses such as the activation of the RNA interference (RNAi) pathway. The double-stranded RNA binding (DRB) proteins, DRB3 and DRB4, are part of this pathway and aid in defending against DNA and RNA viruses, respectively. Using live cell imaging, we show that DRB2, DRB3 and DRB5 relocate from their uniform cytoplasmic distribution to concentrated accumulation in nascent viral replication complexes (VRCs) that develop following cell invasion by viral RNA. Inactivation of the DRB3 gene in Arabidopsis, by T-DNA insertion, rendered these plants less able to repress RNA viral replication. We propose a model for the early stages of virus defense in which DRB2, DRB3 and DRB5 are invasion sensors that relocate to nascent VRCs, where they bind to viral RNA and inhibit virus replication.

  1. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)


    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  2. Targeted DNA mutagenesis for the cure of chronic viral infections.


    Schiffer, Joshua T; Aubert, Martine; Weber, Nicholas D; Mintzer, Esther; Stone, Daniel; Jerome, Keith R


    Human immunodeficiency virus type 1 (HIV-1), hepatitis B virus (HBV), and herpes simplex virus (HSV) have been incurable to date because effective antiviral therapies target only replicating viruses and do not eradicate latently integrated or nonreplicating episomal viral genomes. Endonucleases that can target and cleave critical regions within latent viral genomes are currently in development. These enzymes are being engineered with high specificity such that off-target binding of cellular DNA will be absent or minimal. Imprecise nonhomologous-end-joining (NHEJ) DNA repair following repeated cleavage at the same critical site may permanently disrupt translation of essential viral proteins. We discuss the benefits and drawbacks of three types of DNA cleavage enzymes (zinc finger endonucleases, transcription activator-like [TAL] effector nucleases [TALENs], and homing endonucleases [also called meganucleases]), the development of delivery vectors for these enzymes, and potential obstacles for successful treatment of chronic viral infections. We then review issues regarding persistence of HIV-1, HBV, and HSV that are relevant to eradication with genome-altering approaches.

  3. Targeted DNA Mutagenesis for the Cure of Chronic Viral Infections

    PubMed Central

    Schiffer, Joshua T.; Aubert, Martine; Weber, Nicholas D.; Mintzer, Esther; Stone, Daniel


    Human immunodeficiency virus type 1 (HIV-1), hepatitis B virus (HBV), and herpes simplex virus (HSV) have been incurable to date because effective antiviral therapies target only replicating viruses and do not eradicate latently integrated or nonreplicating episomal viral genomes. Endonucleases that can target and cleave critical regions within latent viral genomes are currently in development. These enzymes are being engineered with high specificity such that off-target binding of cellular DNA will be absent or minimal. Imprecise nonhomologous-end-joining (NHEJ) DNA repair following repeated cleavage at the same critical site may permanently disrupt translation of essential viral proteins. We discuss the benefits and drawbacks of three types of DNA cleavage enzymes (zinc finger endonucleases, transcription activator-like [TAL] effector nucleases [TALENs], and homing endonucleases [also called meganucleases]), the development of delivery vectors for these enzymes, and potential obstacles for successful treatment of chronic viral infections. We then review issues regarding persistence of HIV-1, HBV, and HSV that are relevant to eradication with genome-altering approaches. PMID:22718830

  4. Topological friction strongly affects viral DNA ejection

    PubMed Central

    Marenduzzo, Davide; Micheletti, Cristian; Orlandini, Enzo; Sumners, De Witt


    Bacteriophages initiate infection by releasing their double-stranded DNA into the cytosol of their bacterial host. However, what controls and sets the timescales of DNA ejection? Here we provide evidence from stochastic simulations which shows that the topology and organization of DNA packed inside the capsid plays a key role in determining these properties. Even with similar osmotic pressure pushing out the DNA, we find that spatially ordered DNA spools have a much lower effective friction than disordered entangled states. Such spools are only found when the tendency of nearby DNA strands to align locally is accounted for. This topological or conformational friction also depends on DNA knot type in the packing geometry and slows down or arrests the ejection of twist knots and very complex knots. We also find that the family of (2, 2k+1) torus knots unravel gradually by simplifying their topology in a stepwise fashion. Finally, an analysis of DNA trajectories inside the capsid shows that the knots formed throughout the ejection process mirror those found in gel electrophoresis experiments for viral DNA molecules extracted from the capsids. PMID:24272939

  5. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.


    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  6. Membrane-assisted viral DNA ejection.


    Santos-Pérez, Isaac; Oksanen, Hanna M; Bamford, Dennis H; Goñi, Felix M; Reguera, David; Abrescia, Nicola G A


    Genome packaging and delivery are fundamental steps in the replication cycle of all viruses. Icosahedral viruses with linear double-stranded DNA (dsDNA) usually package their genome into a preformed, rigid procapsid using the power generated by a virus-encoded packaging ATPase. The pressure and stored energy due to this confinement of DNA at a high density is assumed to drive the initial stages of genome ejection. Membrane-containing icosahedral viruses, such as bacteriophage PRD1, present an additional architectural complexity by enclosing their genome within an internal membrane vesicle. Upon adsorption to a host cell, the PRD1 membrane remodels into a proteo-lipidic tube that provides a conduit for passage of the ejected linear dsDNA through the cell envelope. Based on volume analyses of PRD1 membrane vesicles captured by cryo-electron tomography and modeling of the elastic properties of the vesicle, we propose that the internal membrane makes a crucial and active contribution during infection by maintaining the driving force for DNA ejection and countering the internal turgor pressure of the host. These novel functions extend the role of the PRD1 viral membrane beyond tube formation or the mere physical confinement of the genome. The presence and assistance of an internal membrane might constitute a biological advantage that extends also to other viruses that package their linear dsDNA to high density within an internal vesicle.

  7. DNA-Binding Proteins Essential for Protein-Primed Bacteriophage Φ29 DNA Replication

    PubMed Central

    Salas, Margarita; Holguera, Isabel; Redrejo-Rodríguez, Modesto; de Vega, Miguel


    Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5′ ends of the DNA. This protein, called terminal protein (TP), is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB) that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP) that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3′–5′ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding and

  8. The DNA Binding Domain of a Papillomavirus E2 Protein Programs a Chimeric Nuclease To Cleave Integrated Human Papillomavirus DNA in HeLa Cervical Carcinoma Cells▿

    PubMed Central

    Horner, Stacy M.; DiMaio, Daniel


    Viral DNA binding proteins that direct nucleases or other protein domains to viral DNA in lytically or latently infected cells may provide a novel approach to modulate viral gene expression or replication. Cervical carcinogenesis is initiated by high-risk human papillomavirus (HPV) infection, and viral DNA persists in the cancer cells. To test whether a DNA binding domain of a papillomavirus protein can direct a nuclease domain to cleave HPV DNA in cervical cancer cells, we fused the DNA binding domain of the bovine papillomavirus type 1 (BPV1) E2 protein to the catalytic domain of the FokI restriction endonuclease, generating a BPV1 E2-FokI chimeric nuclease (BEF). BEF introduced DNA double-strand breaks on both sides of an E2 binding site in vitro, whereas DNA binding or catalytic mutants of BEF did not. After expression of BEF in HeLa cervical carcinoma cells, we detected cleavage at E2 binding sites in the integrated HPV18 DNA in these cells and also at an E2 binding site in cellular DNA. BEF-expressing cells underwent senescence, which required the DNA binding activity of BEF, but not its nuclease activity. These results demonstrate that DNA binding domains of viral proteins can target effector molecules to cognate binding sites in virally infected cells. PMID:17392356

  9. A core viral protein binds host nucleosomes to sequester immune danger signals.


    Avgousti, Daphne C; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C; Blumenthal, Daniel; Paris, Andrew J; Reyes, Emigdio D; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H; Worthen, G Scott; Black, Ben E; Garcia, Benjamin A; Weitzman, Matthew D


    Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important part in innate immune responses. Viral-encoded core basic proteins compact viral genomes, but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles, it is unknown whether protein VII affects cellular chromatin. Here we show that protein VII alters cellular chromatin, leading us to hypothesize that this has an impact on antiviral responses during adenovirus infection in human cells. We find that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter the protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in the chromatin of members of the high-mobility-group protein B family (HMGB1, HMGB2 and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together, our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling.

  10. A core viral protein binds host nucleosomes to sequester immune danger signals

    PubMed Central

    Avgousti, Daphne C.; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J.; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C.; Blumenthal, Daniel; Paris, Andrew J.; Reyes, Emigdio D.; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H.; Worthen, G. Scott; Black, Ben E.; Garcia, Benjamin A.; Weitzman, Matthew D.


    Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses1. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important role in innate immune responses2. Viral encoded core basic proteins compact viral genomes but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones3. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles4,5, it is unknown whether protein VII impacts cellular chromatin. Our observation that protein VII alters cellular chromatin led us to hypothesize that this impacts antiviral responses during adenovirus infection. We found that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in chromatin of members of the high-mobility group protein B family (HMGB1, HMGB2, and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses6,7. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

  11. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn


    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  12. Effect of clustered peptide binding on DNA condensation.


    Haley, Jennifer; Kabiru, Paul; Geng, Yan


    DNA condensation in-vitro has been studied as a model system to reveal common principles underlying gene packaging in biology, and as the critical first step towards the development of non-viral gene delivery vectors. In this study, we use a bio-inspired approach, where small DNA-binding peptides are controllably clustered by an amphiphilic block copolymer scaffold, to reveal the effect of clustered peptide binding on the energetics, size, shape and physical properties of DNA condensation in-vitro. This provides insights into the general architectural effect of gene-binding proteins on DNA condensation process. Moreover, the versatility afforded by regulating the clustering density and composition of peptides may provide a novel design platform for gene delivery applications in the future.

  13. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    SciTech Connect

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.


    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures of IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.

  14. Adenovirus DNA-binding protein forms a multimeric protein complex with double-stranded DNA and enhances binding of nuclear factor I.

    PubMed Central

    Stuiver, M H; van der Vliet, P C


    The 72-kilodalton adenovirus DNA-binding protein (DBP) binds to single-stranded DNA as well as to RNA and double-stranded DNA and is essential for the replication of viral DNA. We investigated the binding of DBP to double-stranded DNA by gel retardation analysis. By using a 114-base-pair DNA fragment, five or six different complexes were observed by gel retardation. The mobility of these complexes is dependent on the DBP concentration, suggesting that the complexes arise by sequential binding of DBP molecules to the DNA. In contrast to binding to single-stranded DNA, the binding of DBP to double-stranded DNA appears to be noncooperative. DBP binds to linear DNA as well as to circular DNA, while linear DNA containing the adenovirus terminal protein was also recognized. No specificity for adenovirus origin sequences was observed. To study whether the binding of DBP could influence initiation of DNA replication, we analyzed the effect of DBP on the binding of nuclear factor I (NFI) and NFIII, two sequence-specific origin-recognizing proteins that enhance initiation. At subsaturating levels of NFI, DBP increases the rate of binding of NFI considerably, while no effect was seen on NFIII. This stimulation of NFI binding is specific for DBP and was not observed with another protein (NFIV), which forms a similar DNA-multimeric protein complex. In agreement with enhanced NFI binding, DBP stimulates initiation of adenovirus DNA replication in vitro especially strongly at subsaturating NFI concentrations. We explain our results by assuming that DBP forms a complex with origin DNA that promotes formation of an alternative DNA structure, thereby facilitating the binding of NFI as well as the initiation of DNA replication via NFI. Images PMID:2293667

  15. New DNA-binding radioprotectors

    NASA Astrophysics Data System (ADS)

    Martin, Roger

    The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is

  16. DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.


    Rowles, Daniell L; Tsai, Yuan-Chin; Greco, Todd M; Lin, Aaron E; Li, Minghao; Yeh, Justin; Cristea, Ileana M


    Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. These changes can act to promote viral replication or host defense. Herpes simplex virus type 1 (HSV-1) is a prominent human pathogen, which relies on interactions with host factors for efficient replication and spread. Nevertheless, the knowledge regarding its modulation of epigenetic factors remains limited. Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine-5)-methyltransferase 3A (DNMT3A), which we confirmed by reciprocal isolations and microscopy. We show that drug-induced inhibition of DNA methyltransferase activity, as well as siRNA- and shRNA-mediated DNMT3A knockdowns trigger reductions in virus titers. Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection.

  17. HTLV-1 Tax Protein Stimulation of DNA Binding of bZIP Proteins by Enhancing Dimerization

    NASA Astrophysics Data System (ADS)

    Wagner, Susanne; Green, Michael R.


    The Tax protein of human T cell leukemia virus type-1 (HTLV-I) transcriptionally activates the HTLV-I promoter. This activation requires binding sites for activating transcription factor (ATF) proteins, a family of cellular proteins that contain basic region-leucine zipper (bZIP) DNA binding domains. Data are presented showing that Tax increases the in vitro DNA binding activity of multiple ATF proteins. Tax also stimulated DNA binding by other bZIP proteins, but did not affect DNA binding proteins that lack a bZIP domain. The increase in DNA binding occurred because Tax promotes dimerization of the bZIP domain in the absence of DNA, and the elevated concentration of the bZIP homodimer then facilitates the DNA binding reaction. These results help explain how Tax activates viral transcription and transforms cells.

  18. The Sunscreen Octyl Methoxycinnamate Binds to DNA

    NASA Astrophysics Data System (ADS)

    Norrell, Johannes; Vohra, Shikhar; Nordlund, T. M.


    Sunscreens are designed to prevent skin cancer by absorbing ultraviolet radiation from the sun before it gets to the DNA in skin cells. The purpose of this work is to determine whether or not octyl methoxycinnamate, an active ingredient in many sunscreens, will bind to DNA. If so, the sunscreen could transfer the energy it absorbed from the sun to the DNA and cause damage. To determine this, we prepared samples with varying concentrations of cinnamate added to herring sperm DNA, sonicating the mixture to disperse the hydrophobic sunscreen into solution. Absorption and fluorescence spectra of the mixtures showed (i) much more sunscreen was dispersed into solution when DNA was present, and (ii) the spectra of both DNA and sunscreen differed from those of the separate solutions. We conclude that the octyl methoxycinnamate can indeed bind to DNA in aqueous solution. Energy transfer experiments from DNA to sunscreen and from sunscreen to 2-aminopurine- (a fluorescent DNA base) labeled DNA will be presented.

  19. Viral Discovery and Sequence Recovery Using DNA Microarrays

    PubMed Central

    Wang, David; Urisman, Anatoly; Liu, Yu-Tsueng; Springer, Michael; Ksiazek, Thomas G; Erdman, Dean D; Mardis, Elaine R; Hickenbotham, Matthew; Magrini, Vincent; Eldred, James; Latreille, J. Phillipe; Wilson, Richard K; Ganem, Don


    Because of the constant threat posed by emerging infectious diseases and the limitations of existing approaches used to identify new pathogens, there is a great demand for new technological methods for viral discovery. We describe herein a DNA microarray-based platform for novel virus identification and characterization. Central to this approach was a DNA microarray designed to detect a wide range of known viruses as well as novel members of existing viral families; this microarray contained the most highly conserved 70mer sequences from every fully sequenced reference viral genome in GenBank. During an outbreak of severe acute respiratory syndrome (SARS) in March 2003, hybridization to this microarray revealed the presence of a previously uncharacterized coronavirus in a viral isolate cultivated from a SARS patient. To further characterize this new virus, approximately 1 kb of the unknown virus genome was cloned by physically recovering viral sequences hybridized to individual array elements. Sequencing of these fragments confirmed that the virus was indeed a new member of the coronavirus family. This combination of array hybridization followed by direct viral sequence recovery should prove to be a general strategy for the rapid identification and characterization of novel viruses and emerging infectious disease. PMID:14624234

  20. DNA binding studies of tartrazine food additive.


    Kashanian, Soheila; Zeidali, Sahar Heidary


    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  1. A Low Protein Binding Cationic Poly(2-oxazoline) as Non-Viral Vector

    PubMed Central

    He, Zhijian; Miao, Lei; Jordan, Rainer; S-Manickam, Devika; Luxenhofer, Robert; Kabanov, Alexander V


    Developing safe and efficient non-viral gene delivery systems remains a major challenge. We present a new cationic poly(2-oxazoline) (CPOx) block copolymer for gene therapy that was synthesized by sequential polymerization of non-ionic 2-methyl-2-oxazoline and a new 2-oxazoline monomer, 2-(N-methyl, N-Boc-amino)-methyl-2-oxazoline, followed by deprotection of the pendant secondary amine groups. Upon mixing with plasmid DNA (pDNA), CPOx forms small (diameter ≈ 80 nm) and narrowly dispersed polyplexes (PDI < 0.2), which are stable upon dilution in saline and against thermal challenge. These polyplexes exhibited low plasma protein binding and very low cytotoxicity in vitro compared to the polyplexes of pDNA and poly(ethylene glycol)-b-poly(l-lysine) (PEG-b-PLL). CPOx/pDNA polyplexes at N/P = 5 bound considerably less plasma protein compared to polyplexes of PEG-b-PLL at the same N/P ratio. This is a unique aspect of the developed polyplexes emphasizing their potential for systemic delivery in vivo. The transfection efficiency of the polyplexes in B16 murine melanoma cells was low after 4 h but increased significantly for 10 h exposure time, indicative of slow internalization of polyplexes. Addition of Pluronic P85 boosted the transfection using CPOx/pDNA polyplexes considerably. The low protein binding of CPOx/pDNA polyplexes is particularly interesting for the future development of targeted gene delivery. PMID:25846127

  2. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope


    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  3. Rhodopsin targeted transcriptional silencing by DNA-binding.


    Botta, Salvatore; Marrocco, Elena; de Prisco, Nicola; Curion, Fabiola; Renda, Mario; Sofia, Martina; Lupo, Mariangela; Carissimo, Annamaria; Bacci, Maria Laura; Gesualdo, Carlo; Rossi, Settimio; Simonelli, Francesca; Surace, Enrico Maria


    Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations.

  4. Rhodopsin targeted transcriptional silencing by DNA-binding

    PubMed Central

    Botta, Salvatore; Marrocco, Elena; de Prisco, Nicola; Curion, Fabiola; Renda, Mario; Sofia, Martina; Lupo, Mariangela; Carissimo, Annamaria; Bacci, Maria Laura; Gesualdo, Carlo; Rossi, Settimio; Simonelli, Francesca; Surace, Enrico Maria


    Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations. DOI: PMID:26974343

  5. Inhibition of RNA Polymerase II Transcription in Human Cells by Synthetic DNA-Binding Ligands

    NASA Astrophysics Data System (ADS)

    Dickinson, Liliane A.; Gulizia, Richard J.; Trauger, John W.; Baird, Eldon E.; Mosier, Donald E.; Gottesfeld, Joel M.; Dervan, Peter B.


    Sequence-specific DNA-binding small molecules that can permeate human cells potentially could regulate transcription of specific genes. Multiple cellular DNA-binding transcription factors are required by HIV type 1 for RNA synthesis. Two pyrrole--imidazole polyamides were designed to bind DNA sequences immediately adjacent to binding sites for the transcription factors Ets-1, lymphoid-enhancer binding factor 1, and TATA-box binding protein. These synthetic ligands specifically inhibit DNA-binding of each transcription factor and HIV type 1 transcription in cell-free assays. When used in combination, the polyamides inhibit virus replication by >99% in isolated human peripheral blood lymphocytes, with no detectable cell toxicity. The ability of small molecules to target predetermined DNA sequences located with RNA polymerase II promoters suggests a general approach for regulation of gene expression, as well as a mechanism for the inhibition of viral replication.

  6. Role of Single-Stranded DNA Binding Activity of T Antigen in Simian Virus 40 DNA Replication

    PubMed Central

    Wu, Chunxiao; Roy, Rupa; Simmons, Daniel T.


    We have previously mapped the single-stranded DNA binding domain of large T antigen to amino acid residues 259 to 627. By using internal deletion mutants, we show that this domain most likely begins after residue 301 and that the region between residues 501 and 550 is not required. To study the function of this binding activity, a series of single-point substitutions were introduced in this domain, and the mutants were tested for their ability to support simian virus 40 (SV40) replication and to bind to single-stranded DNA. Two replication-defective mutants (429DA and 460EA) were grossly impaired in single-stranded DNA binding. These two mutants were further tested for other biochemical activities needed for viral DNA replication. They bound to origin DNA and formed double hexamers in the presence of ATP. Their ability to unwind origin DNA and a helicase substrate was severely reduced, although they still had ATPase activity. These results suggest that the single-stranded DNA binding activity is involved in DNA unwinding. The two mutants were also very defective in structural distortion of origin DNA, making it likely that single-stranded DNA binding is also required for this process. These data show that single-stranded DNA binding is needed for at least two steps during SV40 DNA replication. PMID:11222709

  7. Binding mode and affinity studies of DNA-binding agents using topoisomerase I DNA unwinding assay.


    McKnight, Ruel E; Gleason, Aaron B; Keyes, James A; Sahabi, Sadia


    A topoisomerase I DNA unwinding assay has been used to determine the relative DNA-binding affinities of a model pair of homologous naphthalene diimides. Binding affinity data were corroborated using calorimetric (ITC) and spectrophotometric (titration and T(m)) studies, with substituent size playing a significant role in binding. The assay was also used to investigate the mode of binding adopted by several known DNA-binding agents, including SYBR Green and PicoGreen. Some of the compounds exhibited unexpected binding modes.

  8. Free-radical-mediated DNA binding.

    PubMed Central

    O'Brien, P J


    Free-radical metabolites can be generated metabolically by a one-electron reductase-catalyzed reaction or a "peroxidase" catalyzed oxidation or by photoactivation of a wide variety of aromatic xenobiotics. Radicals may also be generated during lipid peroxidation. Some radicals can react with DNA or bind covalently or noncovalently as a dismutation product or as a dimer, trimer or polymeric product. Modification to the DNA can result in single-strand breaks, loss of template activity, and crosslinking. The binding can prevent enzymic digestion. In some cases, the radicals react with oxygen, resulting before conversion to DNA reactive oxygen species. Most radicals probably do not interact with DNA. PMID:3007090

  9. Viral receptor-binding site antibodies with diverse germline origins

    PubMed Central

    Schmidt, Aaron G.; Therkelsen, Matthew D.; Stewart, Shaun; Kepler, Thomas B.; Liao, Hua-Xin; Moody, M. Anthony; Haynes, Barton F.; Harrison, Stephen C.


    Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by eleven different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B-cell targets. PMID:25959776

  10. N-ethylmaleimide inhibition of the DNA-binding activity of the herpes simplex virus type 1 major DNA-binding protein

    SciTech Connect

    Ruyechan, W.T. )


    The major herpes simplex virus DNA-binding protein, designated ICP8, binds tightly to single-stranded DNA and is required for replication of viral DNA. The sensitivity of the DNA-binding activity of ICP8 to the action of the sulfhydryl reagent N-ethylmaleimide has been examined by using nitrocellulose filter-binding and agarose gel electrophoresis assays. Incubation of ICP8 with N-ethylmaleimide results in a rapid loss of DNA-binding activity. Preincubation of ICP8 with single-stranded DNA markedly inhibits this loss of binding activity. These results imply that a free sulfhydryl group is involved in the interaction of ICP8 with single-stranded DNA and that this sulfhydryl group becomes less accessible to the environment upon binding. Agarose gel electrophoretic analysis of the binding interaction in the presence and absence of N-ethylmaleimide indicates that the cooperative binding exhibited by ICP8 is lost upon treatment with this reagent but that some residual noncooperative binding may remain. This last result was confirmed by equilibrium dialysis experiments with the {sup 32}P-labeled oligonucleotide dT{sub 10} and native and N-ethylmaleimide-treated ICP8.

  11. DNA-binding-defective mutants of the Epstein-Barr virus lytic switch activator Zta transactivate with altered specificities.

    PubMed Central

    Flemington, E K; Lytle, J P; Cayrol, C; Borras, A M; Speck, S H


    The Epstein-Barr virus BRLF1 and BZLF1 genes are the first viral genes transcribed upon induction of the viral lytic cycle. The protein products of both genes (referred to here as Rta and Zta, respectively) activate expression of other viral genes, thereby initiating the lytic cascade. Among the viral antigens expressed upon induction of the lytic cycle, however, Zta is unique in its ability to disrupt viral latency; expression of the BZLF1 gene is both necessary and sufficient for triggering the viral lytic cascade. We have previously shown that Zta can activate its own promoter (Zp), through binding to two Zta recognition sequences (ZIIIA and ZIIIB). Here we describe mutant Zta proteins that do not bind DNA (referred to as Zta DNA-binding mutants [Zdbm]) but retain the ability to transactivate Zp. Consistent with the inability of these mutants to bind DNA, transactivation of Zp by Zdbm is not dependent on the Zta recognition sequences. Instead, transactivation by Zdbm is dependent upon promoter elements that bind cellular factors. An examination of other viral and cellular promoters identified promoters that are weakly responsive or unresponsive to Zdbm. An analysis of a panel of artificial promoters containing one copy of various promoter elements demonstrated a specificity for Zdbm activation that is distinct from that of Zta. These results suggest that non-DNA-binding forms of some transactivators retain the ability to transactivate specific target promoters without direct binding to DNA. Images PMID:8164660

  12. Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes

    PubMed Central

    Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya


    Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

  13. Direct DNA binding by Brca1

    PubMed Central

    Paull, Tanya T.; Cortez, David; Bowers, Blair; Elledge, Stephen J.; Gellert, Martin


    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein–DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription. PMID:11353843

  14. Sequence-specific binding of simian virus 40 A protein to nonorigin and cellular DNA.

    PubMed Central

    Wright, P J; DeLucia, A L; Tegtmeyer, P


    The simian virus 40 A protein (T antigen) recognized and bound to the consensus sequence 5'-GAGGC-3' in DNA from many sources. Sequence-specific binding to single pentanucleotides in randomly chosen DNA predominated over binding to nonspecific sequences. The asymmetric orientation of protein bound to nonorigin recognition sequences also resembled that of protein bound to the origin region of simian virus 40 DNA. Sequence variations in the DNA adjacent to single pentanucleotides influenced binding affinities even though methylation interference and protection studies did not reveal specific interactions outside of pentanucleotides. Thus, potential locations of A protein bound to any DNA can be predicted although the determinants of binding affinity are not yet understood. Sequence-specific binding of A protein to cellular DNA would provide a mechanism for specific alterations of host gene expression that facilitate viral function. Images PMID:6570189

  15. Importance of DNA stiffness in protein-DNA binding specificity

    NASA Astrophysics Data System (ADS)

    Hogan, M. E.; Austin, R. H.


    From the first high-resolution structure of a repressor bound specifically to its DNA recognition sequence1 it has been shown that the phage 434 repressor protein binds as a dimer to the helix. Tight, local interactions are made at the ends of the binding site, causing the central four base pairs (bp) to become bent and overtwisted. The centre of the operator is not in contact with protein but repressor binding affinity can be reduced at least 50-fold in response to a sequence change there2. This observation might be explained should the structure of the intervening DNA segment vary with its sequence, or if DNA at the centre of the operator resists the torsional and bending deformation necessary for complex formation in a sequence dependent fashion. We have considered the second hypothesis by demonstrating that DNA stiffness is sequence dependent. A method is formulated for calculating the stiffness of any particular DNA sequence, and we show that this predicted relationship between sequence and stiffness can explain the repressor binding data in a quantitative manner. We propose that the elastic properties of DNA may be of general importance to an understanding of protein-DNA binding specificity.

  16. Viral evasion of DNA-stimulated innate immune responses

    PubMed Central

    Christensen, Maria H; Paludan, Søren R


    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769

  17. Synthesis of parvovirus H-1 replicative form from viral DNA by DNA polymerase gamma.

    PubMed Central

    Kollek, R; Goulian, M


    The initial event in the replication cycle of parvovirus H-1 is conversion of the single-stranded linear viral DNA to the double-stranded linear replicative form. We describe here detection of an activity in uninfected cell extracts that carries out this reaction. The activity was purified and identified as DNA polymerase gamma. Images PMID:6947222

  18. DNA Origami Seesaws as Comparative Binding Assay

    PubMed Central

    Nickels, Philipp C.; Høiberg, Hans C.; Simmel, Stephanie S.; Holzmeister, Phil; Tinnefeld, Philip


    Abstract The application of commonly used force spectroscopy in biological systems is often limited by the need for an invasive tether connecting the molecules of interest to a bead or cantilever tip. Here we present a DNA origami‐based prototype in a comparative binding assay. It has the advantage of in situ readout without any physical connection to the macroscopic world. The seesaw‐like structure has a lever that is able to move freely relative to its base. Binding partners on each side force the structure into discrete and distinguishable conformations. Model experiments with competing DNA hybridisation reactions yielded a drastic shift towards the conformation with the stronger binding interaction. With reference DNA duplexes of tuneable length on one side, this device can be used to measure ligand interactions in comparative assays. PMID:27038073

  19. Biophysical characterization of DNA binding from single molecule force measurements

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.


    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

  20. Biophysical characterization of DNA binding from single molecule force measurements

    PubMed Central

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.


    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function. PMID:20576476

  1. A conserved binding site within the Tomato Golden Mosaic Virus AL-1629 promoter is necessary for expression of viral genes important for pathogenesis

    PubMed Central

    Tu, Jun; Sunter, Garry


    We have identified a nine base pair sequence in Tomato golden mosaic virus that is required for binding of nuclear proteins from tobacco and Arabidopsis to viral DNA. The sequence is located within the promoter for a 0.7 kb complementary sense mRNA (AL-1629). Mutation of the binding site results in a two to six-fold reduction in the accumulation of AL-1629 mRNA, leading to reduced AL2 and AL3 gene expression. Viral sequences located immediately adjacent to the core binding site appear to influence AL2 and AL3 expression, but retain some binding affinity to a soluble host protein(s). The ability of a nuclear protein(s) to bind sequences within the AL-1629 promoter correlates with efficient viral DNA replication, as mutation of these sequences results in reduced viral DNA levels. Analysis of begomo- and curtoviruses indicates extensive conservation of this binding site, which suggests a common mechanism regulating expression of two viral genes involved in replication and suppression of host defense responses. PMID:17532021

  2. A conserved binding site within the Tomato golden mosaic virus AL-1629 promoter is necessary for expression of viral genes important for pathogenesis

    SciTech Connect

    Tu Jun; Sunter, Garry


    We have identified a nine base pair sequence in Tomato golden mosaic virus that is required for binding of nuclear proteins from tobacco and Arabidopsis to viral DNA. The sequence is located within the promoter for a 0.7 kb complementary sense mRNA (AL-1629). Mutation of the binding site results in a two- to six-fold reduction in the accumulation of AL-1629 mRNA, leading to reduced AL2 and AL3 gene expression. Viral sequences located immediately adjacent to the core binding site appear to influence AL2 and AL3 expression, but retain some binding affinity to a soluble host protein(s). The ability of a nuclear protein(s) to bind sequences within the AL-1629 promoter correlates with efficient viral DNA replication, as mutation of these sequences results in reduced viral DNA levels. Analysis of begomo- and curtoviruses indicates extensive conservation of this binding site, which suggests a common mechanism regulating expression of two viral genes involved in replication and suppression of host defense responses.

  3. Biological consequences of strand breaks in plasmid and viral DNA.

    PubMed Central

    Schulte-Frohlinde, D.


    Some biological consequences of strand breakage in biologically active single- and double-stranded plasmid and viral DNA are examined. A double-strand break in DNA produced by restriction-endonucleases in aqueous solution is not a 100% lethal damage. The survival depends strongly on the structure of the end groups. Evidence is presented that survival is the result of a balance between degradation and repair. The enzymatically produced double-strand break (dsb) is a potentially lethal damage similar to the irradiation-produced dsb in cells. Results with double-stranded biologically active DNA treated either with gamma-rays, heat, pancrease nuclease or UV-light in aqueous solution suggest that a single-strand damage is also a potentially lethal damage. Mechanisms for conversion of single-strand damage to lethal events are discussed. PMID:3307866

  4. Curcumin binding to DNA and RNA.


    Nafisi, Shohreh; Adelzadeh, Maryam; Norouzi, Zeinab; Sarbolouki, Mohammad Nabi


    Curcumin, the yellow pigment from the rhizoma of Curcuma longa, is a widely studied phytochemical with a variety of biological activities. The ongoing research and clinical trials have proved that this natural phenolic compound has great and diverse pharmacological potencies. Beside its effective antioxidant, antiinflammatory, and antimicrobial/antiviral properties, curcumin is also considered as a cancer chemopreventive agent. While the antioxidant activity of curcumin is well documented, its interaction with DNA and RNA is not fully investigated. This study was designed to examine the interactions of curcumin with calf thymus DNA and yeast RNA in aqueous solution at physiological conditions, using constant DNA and RNA concentration (6.25 mM) and various curcumin/polynucleotide (phosphate) ratios of 1/120, 1/80, 1/40, 1/20, and 1/10. Fourier transform infrared (FTIR) and UV-visible spectroscopic methods were used to determine the ligand binding modes, the binding constants, and the stability of curcumin-DNA and curcumin-RNA complexes in aqueous solution. Spectroscopic evidence showed that curcumin binds to the major and minor grooves of DNA duplex and to RNA bases as well as to the back bone phosphate group with overall binding constants of K(curcumin-DNA) = 4.255 x 10(4) M(-1) and K(curcumin-RNA) = 1.262 x 10(4) M(-1). Major DNA and RNA aggregation occurred at high pigment concentration. No conformational changes were observed upon curcumin interaction with these biopolymers; that is, DNA remains in the B, and RNA retains its A-family structure.

  5. HTLV-I Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization.


    Wagner, S; Green, M R


    The Tax protein of human T cell leukemia virus type-1 (HTLV-I) transcriptionally activates the HTLV-I promoter. This activation requires binding sites for activating transcription factor (ATF) proteins, a family of cellular proteins that contain basic region-leucine zipper (bZIP) DNA binding domains. Data are presented showing that Tax increases the in vitro DNA binding activity of multiple ATF proteins. Tax also stimulated DNA binding by other bZIP proteins, but did not affect DNA binding proteins that lack a bZIP domain. The increase in DNA binding occurred because Tax promotes dimerization of the bZIP domain in the absence of DNA, and the elevated concentration of the bZIP homodimer then facilitates the DNA binding reaction. These results help explain how Tax activates viral transcription and transforms cells.

  6. The phiX174 protein J mediates DNA packaging and viral attachment to host cells.


    Bernal, Ricardo A; Hafenstein, Susan; Esmeralda, Raquel; Fane, Bentley A; Rossmann, Michael G


    Packaging of viral genomes into their respective capsids requires partial neutralization of the highly negatively charged RNA or DNA. Many viruses, including the Microviridae bacteriophages phiX174, G4, and alpha3, have solved this problem by coding for a highly positively charged nucleic acid-binding protein that is packaged along with the genome. The phiX174 DNA-binding protein, J, is 13 amino acid residues longer than the alpha3 and G4 J proteins by virtue of an additional nucleic acid-binding domain at the amino terminus. Chimeric phiX174 particles containing the smaller DNA-binding protein cannot be generated due to procapsid instability during DNA packaging. However, chimeric alpha3 and G4 phages, containing the phiX174 DNA-binding protein in place of the endogenous J protein, assemble and are infectious, but are less dense than the respective wild-type species. In addition, host cell attachment and native gel migration assays indicate surface variations of these viruses that are controlled by the nature of the J protein. The structure of alpha3 packaged with phiX174 J protein was determined to 3.5A resolution and compared with the previously determined structures of phiX174 and alpha3. The structures of the capsid and spike proteins in the chimeric particle remain unchanged within experimental error when compared to the wild-type alpha3 virion proteins. The amino-terminal region of the phiX174 J protein, which is missing from wild-type alpha3 virions, is mostly disordered in the alpha3 chimera. The differences observed between solution properties of wild-type phiX174, wild-type alpha3, and alpha3 chimera, including their ability to attach to host cells, correlates with the degree of order in the amino-terminal domain of the J protein. When ordered, this domain binds to the interior of the viral capsid and, thus, might control the flexibility of the capsid. In addition, the properties of the phiX174 J protein in the chimera and the results of mutational

  7. A fusion DNA vaccine that targets antigen-presenting cells increases protection from viral challenge

    NASA Astrophysics Data System (ADS)

    Deliyannis, Georgia; Boyle, Jefferey S.; Brady, Jamie L.; Brown, Lorena E.; Lew, Andrew M.


    Improving the immunological potency, particularly the Ab response, is a serious hurdle for the protective efficacy and hence broad application of DNA vaccines. We examined the immunogenicity and protective efficacy of a hemagglutinin-based influenza DNA vaccine that was targeted to antigen-presenting cells (APCs) by fusion to CTLA4. The targeted vaccine was shown to induce an accelerated and increased Ab response (as compared with those receiving the nontargeted control) that was predominated by IgG1 and recognized conformationally dependent viral epitopes. Moreover, mice receiving the APC-targeted DNA vaccine had significantly reduced viral titers (100-fold) after a nonlethal virus challenge. The increased protective efficacy was most likely because of increased Ab responses, as cytotoxic T lymphocyte responses were not enhanced. Targeting was demonstrated by direct binding studies of CTLA4 fusion proteins to the cognate ligand (B7; expressed on APCs in vivo). In addition, a targeted protein was detected at 4-fold higher levels in draining lymph nodes within 2-24 h of administration. Therefore, this study demonstrates that targeting DNA-encoded antigen to APCs results in enhanced immunity and strongly suggests that this approach may be useful in improving the protective efficacy of DNA vaccines.

  8. Thermolabile in vivo DNA-binding activity associated with a protein encoded by mutants of herpes simplex virus type 1.

    PubMed Central

    Lee, C K; Knipe, D M


    The major DNA-binding protein encoded by several temperature-sensitive mutants of herpes simplex virus type 1 was thermolabile for binding to intracellular viral DNA. The ability of DNase I to release this protein from isolated nuclei was used as a measure of the amount of protein bound to viral DNA. This assay was based upon our previous observation that the fraction of herpesviral DNA-binding protein which can be eluted from nuclei with DNase I represents proteins associated with progeny viral DNA (D. M. Knipe and A. E. Spang, J. Virol. 43:314-324, 1982). In this study, we found that several temperature-sensitive mutants encoded proteins which rapidly chased from a DNase I-sensitive to a DNase I-resistant nuclear form upon shift to the nonpermissive temperature. We interpret this change in DNase I sensitivity to represent the denaturation of the DNA-binding site at the nonpermissive temperature and the association with the nuclear framework via a second site on the protein. The DNA-binding activity measured by the DNase I sensitivity assay represents an important function of the protein in viral replication because three of five mutants tested were thermolabile for this activity. A fourth mutant encoded a protein which did not associate with the nucleus at the nonpermissive temperature and therefore would not be available for DNA binding in the nucleus. We also present supportive evidence for the binding of the wild-type protein to intracellular viral DNA by showing that a monoclonal antibody coprecipitated virus-specific DNA sequences with the major DNA-binding protein. Images PMID:6304350

  9. Identification and properties of the crenarchaeal single-stranded DNA binding protein from Sulfolobus solfataricus

    PubMed Central

    Wadsworth, Ross I. M.; White, Malcolm F.


    Single-stranded DNA binding proteins (SSBs) play central roles in cellular and viral processes involving the generation of single-stranded DNA. These include DNA replication, homologous recombination and DNA repair pathways. SSBs bind DNA using four ‘OB-fold’ (oligonucleotide/oligosaccharide binding fold) domains that can be organised in a variety of overall quaternary structures. Thus eubacterial SSBs are homotetrameric whilst the eucaryal RPA protein is a heterotrimer and euryarchaeal proteins vary significantly in their subunit compositions. We demonstrate that the crenarchaeal SSB protein is an abundant protein with a unique structural organisation, existing as a monomer in solution and multimerising on DNA binding. The protein binds single-stranded DNA distributively with a binding site size of ~5 nt per monomer. Sulfolobus SSB lacks the zinc finger motif found in the eucaryal and euryarchaeal proteins, possessing instead a flexible C-terminal tail, sensitive to trypsin digestion, that is not required for DNA binding. In comparison with Escherichia coli SSB, the tail may play a role in protein–protein interactions during DNA replication and repair. PMID:11160923

  10. KSHV encoded LANA recruits Nucleosome Assembly Protein NAP1L1 for regulating viral DNA replication and transcription

    PubMed Central

    Gupta, Namrata; Thakker, Suhani; Verma, Subhash C.


    The establishment of latency is an essential for lifelong persistence and pathogenesis of Kaposi’s sarcoma-associated herpesvirus (KSHV). Latency-associated nuclear antigen (LANA) is the most abundantly expressed protein during latency and is important for viral genome replication and transcription. Replication-coupled nucleosome assembly is a major step in packaging the newly synthesized DNA into chromatin, but the mechanism of KSHV genome chromatinization post-replication is not understood. Here, we show that nucleosome assembly protein 1-like protein 1 (NAP1L1) associates with LANA. Our binding assays revealed an association of LANA with NAP1L1 in KSHV-infected cells, which binds through its amino terminal domain. Association of these proteins confirmed their localization in specific nuclear compartments of the infected cells. Chromatin immunoprecipitation assays from NAP1L1-depleted cells showed LANA-mediated recruitment of NAP1L1 at the terminal repeat (TR) region of the viral genome. Presence of NAP1L1 stimulated LANA-mediated DNA replication and persistence of a TR-containing plasmid. Depletion of NAP1L1 led to a reduced nucleosome positioning on the viral genome. Furthermore, depletion of NAP1L1 increased the transcription of viral lytic genes and overexpression decreased the promoter activities of LANA-regulated genes. These results confirmed that LANA recruitment of NAP1L1 helps in assembling nucleosome for the chromatinization of newly synthesized viral DNA. PMID:27599637

  11. CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus.


    Ramanan, Vyas; Shlomai, Amir; Cox, David B T; Schwartz, Robert E; Michailidis, Eleftherios; Bhatta, Ankit; Scott, David A; Zhang, Feng; Rice, Charles M; Bhatia, Sangeeta N


    Chronic hepatitis B virus (HBV) infection is prevalent, deadly, and seldom cured due to the persistence of viral episomal DNA (cccDNA) in infected cells. Newly developed genome engineering tools may offer the ability to directly cleave viral DNA, thereby promoting viral clearance. Here, we show that the CRISPR/Cas9 system can specifically target and cleave conserved regions in the HBV genome, resulting in robust suppression of viral gene expression and replication. Upon sustained expression of Cas9 and appropriately chosen guide RNAs, we demonstrate cleavage of cccDNA by Cas9 and a dramatic reduction in both cccDNA and other parameters of viral gene expression and replication. Thus, we show that directly targeting viral episomal DNA is a novel therapeutic approach to control the virus and possibly cure patients.

  12. The DNA damage response in viral-induced cellular transformation.


    Nikitin, P A; Luftig, M A


    The DNA damage response (DDR) has emerged as a critical tumour suppressor pathway responding to cellular DNA replicative stress downstream of aberrant oncogene over-expression. Recent studies have now implicated the DDR as a sensor of oncogenic virus infection. In this review, we discuss the mechanisms by which tumour viruses activate and also suppress the host DDR. The mechanism of tumour virus induction of the DDR is intrinsically linked to the need for these viruses to promote an S-phase environment to replicate their nucleic acid during infection. However, inappropriate expression of viral oncoproteins can also activate the DDR through various mechanisms including replicative stress, direct interaction with DDR components and induction of reactive oxygen species. Given the growth-suppressive consequences of activating the DDR, tumour viruses have also evolved mechanisms to attenuate these pathways. Aberrant expression of viral oncoproteins may therefore promote tumourigenesis through increased somatic mutation and aneuploidy due to DDR inactivation. This review will focus on the interplay between oncogenic viruses and the DDR with respect to cellular checkpoint control and transformation.

  13. Asymmetric assembly of Merkel cell polyomavirus large T-antigen origin binding domains at the viral origin.


    Harrison, Celia J; Meinke, Gretchen; Kwun, Hyun Jin; Rogalin, Henry; Phelan, Paul J; Bullock, Peter A; Chang, Yuan; Moore, Patrick S; Bohm, Andrew


    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 Å crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be ~740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  14. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    SciTech Connect

    C Harrison; G Meinke; H Kwun; H Rogalin; P Phelan; P Bullock; Y Chang; P Moore; A Bohm


    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  15. The p53 Protein is an Unusually Shaped Tetramer that Binds Directly to DNA

    NASA Astrophysics Data System (ADS)

    Friedman, Paula N.; Chen, Xinbin; Bargonetti, Jill; Prives, Carol


    We have analyzed the size and structure of native immunopurified human p53 protein. By using a combination of chemical crosslinking, gel filtration chromatography, and zonal velocity gradient centrifugation, we have determined that the predominant form of p53 in such preparations is a tetramer. The behavior of purified p53 in gels and sucrose gradients implies that the protein has an extended shape. Wild-type p53 has been shown to bind specifically to sites in cellular and viral DNA. We show in this study by Southwestern ligand blotting and by analysis of DNA-bound crosslinked p53 that p53 monomers, dimers, and tetramers can bind directly to DNA.

  16. Nucleotides in the polyomavirus enhancer that control viral transcription and DNA replication.

    PubMed Central

    Tang, W J; Berger, S L; Triezenberg, S J; Folk, W R


    The polyomavirus enhancer is required in cis for high-level expression of the viral early region and for replication of the viral genome. We introduced multiple mutations in the enhancer which reduced transcription and DNA replication. Polyomaviruses with these mutant enhancers formed very small plaques in whole mouse embryo cells. Revertants of the viral mutants were isolated and characterized. Reversion occurred by any of the following events: restoration of guanosines at nucleotide (nt) 5134 and nt 5140 within the adenovirus 5 E1A enhancer core AGGAAGTGACT; acquisition of an A----G mutation at nt 5258, which is the same mutation that enables polyomavirus to grow in embryonal carcinoma F9 cells; duplication of mutated sequences between nt 5146 and 5292 (including sequences homologous with immunoglobulin G, simian virus 40, and bovine papillomavirus enhancer elements). Reversion restored both the replicative and transcriptional functions of the viruses. Revertants that acquired the F9 mutation at nt 5258 grew at least 20-fold better than the original mutant in whole mouse embryo cells, but replicated only marginally better than the original mutant in 3T6 cells. Viruses with a reversion of the mutation at nt 5140 replicated equally well in both types of cells. Since individual nucleotides in the polyomavirus enhancer simultaneously altered DNA replication and transcription in specific cell types, it is likely that these processes rely upon a common element, such as an enhancer-binding protein. Images PMID:3037332

  17. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    NASA Astrophysics Data System (ADS)

    Laporta, Robert F.; Taichman, Lorne B.


    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  18. Conserved Cysteine Residue in the DNA-Binding Domain of the Bovine Papillomavirus Type 1 E2 Protein Confers Redox Regulation of the DNA- Binding Activity in Vitro

    NASA Astrophysics Data System (ADS)

    McBride, Alison A.; Klausner, Richard D.; Howley, Peter M.


    The bovine papillomavirus type 1 E2 open reading frame encodes three proteins involved in viral DNA replication and transcriptional regulation. These polypeptides share a carboxyl-terminal domain with a specific DNA-binding activity; through this domain the E2 polypeptides form dimers. In this study, we demonstrate the inhibition of E2 DNA binding in vitro by reagents that oxidize or otherwise chemically modify the free sulfydryl groups of reactive cysteine residues. However, these reagents had no effect on DNA-binding activity when the E2 polypeptide was first bound to DNA, suggesting that the free sulfydryl group(s) may be protected by DNA binding. Sensitivity to sulfydryl modification was mapped to a cysteine residue at position 340 in the E2 DNA-binding domain, an amino acid that is highly conserved among the E2 proteins of different papillomaviruses. Replacement of this residue with other amino acids abrogated the sensitivity to oxidation-reduction changes but did not affect the DNA-binding property of the E2 protein. These results suggest that papillomavirus DNA replication and transcriptional regulation could be modulated through the E2 proteins by changes in the intracellular redox environment. Furthermore, a motif consisting of a reactive cysteine residue carboxyl-terminal to a lysine residue in a basic region of the DNA-binding domain is a feature common to a number of transcriptional regulatory proteins that, like E2, are subject to redox regulation. Thus, posttranslational regulation of the activity of these proteins by the intracellular redox environment may be a general phenomenon.

  19. State of hepatitis B viral DNA in a human hepatoma cell line.

    PubMed Central

    Marion, P L; Salazar, F H; Alexander, J J; Robinson, W S


    PLC/PRF/5, a tissue culture cell line isolated from a human hepatocellular carcinoma and producing hepatitis B surface antigen, was studied for the presence of hepatitis B virus (HBV)-specific DNA and RNA. PLC/PRF/5 cell DNA accelerated the rate of reassociation of HBV [32P]DNA, and quantitative experiments indicated that the cells contained approximately four copies of viral DNA per haploid, mammalian cell DNA equivalent. PLC/PRF/5 DNA accelerated the rate of reassociation of all individual restriction endonucleases HincII and HaeIII fragments of HBV [32P]DNA, indicating that DNA from all regions of the viral genome is present in the cells. This suggests that these cells contain at least most, and possibly all, of the viral genome. Digestion of PLC/PRF/5 cell DNA with restriction endonuclease HindIII (an enzyme found not to cleave the DNA of any HBV isolate so far examined) yielded only three fragments, all larger than virion DNA, which contained HBV DNA base sequences, suggesting that HBV DNA is integrated in high-molecular-weight DNA at three different sites in these cells and that there is no viral DNA in an episomal form. PLC/PRF/5 cell [32P]RNA was found to hybridize with all restriction fragments of HBV DNA adequately tested, indicating that at least most, and possibly all, of the viral DNA in these cells is transcribed. Images PMID:6251250

  20. Non-DNA-binding cofactors enhance DNA-binding specificity of a transcriptional regulatory complex

    PubMed Central

    Siggers, Trevor; Duyzend, Michael H; Reddy, Jessica; Khan, Sidra; Bulyk, Martha L


    Recruitment of cofactors to specific DNA sites is integral for specificity in gene regulation. As a model system, we examined how targeting and transcriptional control of the sulfur metabolism genes in Saccharomyces cerevisiae is governed by recruitment of the transcriptional co-activator Met4. We developed genome-scale approaches to measure transcription factor (TF) DNA-binding affinities and cofactor recruitment to >1300 genomic binding site sequences. We report that genes responding to the TF Cbf1 and cofactor Met28 contain a novel ‘recruitment motif' (RYAAT), adjacent to Cbf1 binding sites, which enhances the binding of a Met4–Met28–Cbf1 regulatory complex, and that abrogation of this motif significantly reduces gene induction under low-sulfur conditions. Furthermore, we show that correct recognition of this composite motif requires both non-DNA-binding cofactors Met4 and Met28. Finally, we demonstrate that the presence of an RYAAT motif next to a Cbf1 site, rather than Cbf1 binding affinity, specifies Cbf1-dependent sulfur metabolism genes. Our results highlight the need to examine TF/cofactor complexes, as novel specificity can result from cofactors that lack intrinsic DNA-binding specificity. PMID:22146299

  1. Viral DNA Replication-Dependent DNA Damage Response Activation during BK Polyomavirus Infection

    PubMed Central

    Verhalen, Brandy; Justice, Joshua L.; Imperiale, Michael J.


    ABSTRACT BK polyomavirus (BKPyV) reactivation is associated with severe human disease in kidney and bone marrow transplant patients. The interplay between viral and host factors that regulates the productive infection process remains poorly understood. We have previously reported that the cellular DNA damage response (DDR) is activated upon lytic BKPyV infection and that its activation is required for optimal viral replication in primary kidney epithelial cells. In this report, we set out to determine what viral components are responsible for activating the two major phosphatidylinositol 3-kinase-like kinases (PI3KKs) involved in the DDR: ataxia telangiectasia mutated (ATM) kinase and ATM and Rad3-related (ATR) kinase. Using a combination of UV treatment, lentivirus transduction, and mutant virus infection experiments, our results demonstrate that neither the input virus nor the expression of large T antigen (TAg) alone is sufficient to trigger the activation of ATM or ATR in our primary culture model. Instead, our data suggest that the activation of both the ATM- and ATR-mediated DDR pathways is linked to viral DNA replication. Intriguingly, a TAg mutant virus that is unable to activate the DDR causes substantial host DNA damage. Our study provides insight into how DDRs are activated by polyomaviruses in primary cells with intact cell cycle checkpoints and how the activation might be linked to the maintenance of host genome stability. IMPORTANCE Polyomaviruses are opportunistic pathogens that are associated with several human diseases under immunosuppressed conditions. BK polyomavirus (BKPyV) affects mostly kidney and bone marrow transplant patients. The detailed replication mechanism of these viruses remains to be determined. We have previously reported that BKPyV activates the host DNA damage response (DDR), a response normally used by the host cell to combat genotoxic stress, to aid its own replication. In this study, we identified that the trigger for DDR

  2. Multiple specific binding sites for purified glucocorticoid receptors on mammary tumor virus DNA.


    Payvar, F; Firestone, G L; Ross, S R; Chandler, V L; Wrange, O; Carlstedt-Duke, J; Gustafsson, J A; Yamamoto, K R


    Glucocorticoid hormones selectively stimulate the rate of transcription of integrated mammary tumor virus (MTV) sequences in infected rat hepatoma cells. Using two independent assays, we find that purified rat liver glucocorticoid receptor protein binds specifically to at least four widely separated regions on pure MTV proviral DNA. One of these specific binding domains, which itself contains at least two distinct receptor binding sites, resides within a fragment of viral DNA that maps 110-449 bp upstream of the promoter for MTV RNA synthesis. Three other binding domains lie downstream of the promoter and within the MTV primary transcription unit. Restriction fragments bearing separate binding domains have been introduced into cultured cells; transformants have been recovered in which the introduced fragments are expressed under glucocorticoid control. Thus, it appears that this assay will be useful for assessing the biological significance of the receptor binding sites detected in vitro.

  3. Mechanisms for Binding between Methylene Blue and DNA

    NASA Astrophysics Data System (ADS)

    Vardevanyan, P. O.; Antonyan, A. P.; Parsadanyan, M. A.; Shahinyan, M. A.; Hambardzumyan, L. A.


    We have used absorption and fl uorimetric methods to study the interaction between methylene blue (MB) and calfthymus DNA. Based on Scatchard analysis of the experimental data, we plotted the methylene blue-DNA binding curve. This curve consists of two linear sections, which indicates two types of interaction, for which we determined the constants K and the number of binding sites n for binding of this ligand to DNA. Comparison of the data obtained with analogous values found for interaction between ethidium bromide and DNA allowed us to conclude that there are two modes of interaction between methylene blue and DNA: strong binding (semi-intercalation) and weak binding (electrostatic).

  4. DNA binding studies of Vinca alkaloids: experimental and computational evidence.


    Pandya, Prateek; Gupta, Surendra P; Pandav, Kumud; Barthwal, Ritu; Jayaram, B; Kumar, Surat


    Fluorescence studies on the indole alkaloids vinblastine sulfate, vincristine sulfate, vincamine and catharanthine have demonstrated the DNA binding ability of these molecules. The binding mode of these molecules in the minor groove of DNA is non-specific. A new parameter of the purine-pyrimidine base sequence specificty was observed in order to define the non-specific DNA binding of ligands. Catharanthine had shown 'same' pattern of 'Pu-Py' specificity while evaluating its DNA binding profile. The proton resonances of a DNA decamer duplex were assigned. The models of the drug:DNA complexes were analyzed for DNA binding features. The effect of temperature on the DNA binding was also evaluated.

  5. RNA and DNA binding properties of HIV-1 Vif protein: a fluorescence study.


    Bernacchi, Serena; Henriet, Simon; Dumas, Philippe; Paillart, Jean-Christophe; Marquet, Roland


    The HIV-1 viral infectivity factor (Vif) is a small basic protein essential for viral fitness and pathogenicity. Some "non-permissive" cell lines cannot sustain replication of Vif(-) HIV-1 virions. In these cells, Vif counteracts the natural antiretroviral activity of the DNA-editing enzymes APOBEC3G/3F. Moreover, Vif is packaged into viral particles through a strong interaction with genomic RNA in viral nucleoprotein complexes. To gain insights into determinants of this binding process, we performed the first characterization of Vif/nucleic acid interactions using Vif intrinsic fluorescence. We determined the affinity of Vif for RNA fragments corresponding to various regions of the HIV-1 genome. Our results demonstrated preferential and moderately cooperative binding for RNAs corresponding to the 5'-untranslated region of HIV-1 (5'-untranslated region) and gag (cooperativity parameter omega approximately 65-80, and K(d) = 45-55 nM). In addition, fluorescence spectroscopy allowed us to point out the TAR apical loop and a short region in gag as primary strong affinity binding sites (K(d) = 9.5-14 nM). Interestingly, beside its RNA binding properties, the Vif protein can also bind the corresponding DNA oligonucleotides and their complementary counterparts with an affinity similar to the one observed for the RNA sequences, while other DNA sequences displayed reduced affinity. Taken together, our results suggest that Vif binding to RNA and DNA offers several non-exclusive ways to counteract APOBEC3G/3F factors, in addition to the well documented Vif-induced degradation by the proteasome and to the Vif-mediated repression of translation of these antiviral factors.

  6. Binding characteristics of salbutamol with DNA by spectral methods.


    Bi, Shuyun; Pang, Bo; Zhao, Tingting; Wang, Tianjiao; Wang, Yu; Yan, Lili


    Salbutamol interacting with deoxyribonucleic acid (DNA) was examined by fluorescence, UV absorption, viscosity measurements, and DNA melting techniques. The binding constants and binding sites were obtained at different temperatures by fluorescence quenching. The Stern-Volmer plots showed that the quenching of fluorescence of salbutamol by DNA was a static quenching. To probe the binding mode, various analytical methods were performed and the results were as follows: hyperchromic effect was shown in the absorption spectra of salbutamol upon addition of DNA; there was no appreciable increase in melting temperature of DNA when salbutamol was presented in DNA solution; the fluorescence intensity of salbutamol-DNA decrease with the increasing ionic strength; the relative viscosity of DNA did not change in the presence of salbutamol; the binding constant of salbutamol with double strand DNA (dsDNA) was much higher than that of it with single strand DNA (ssDNA). All these results indicated that the binding mode of salbutamol to DNA should be groove binding. The thermodynamic parameters suggested that hydrogen bond or van der Waals force might play an important role in salbutamol binding to DNA. According to the Förster energy transference theory, the binding distance between the acceptor and donor was 3.70 nm.

  7. Binding characteristics of salbutamol with DNA by spectral methods

    NASA Astrophysics Data System (ADS)

    Bi, Shuyun; Pang, Bo; Zhao, Tingting; Wang, Tianjiao; Wang, Yu; Yan, Lili


    Salbutamol interacting with deoxyribonucleic acid (DNA) was examined by fluorescence, UV absorption, viscosity measurements, and DNA melting techniques. The binding constants and binding sites were obtained at different temperatures by fluorescence quenching. The Stern-Volmer plots showed that the quenching of fluorescence of salbutamol by DNA was a static quenching. To probe the binding mode, various analytical methods were performed and the results were as follows: hyperchromic effect was shown in the absorption spectra of salbutamol upon addition of DNA; there was no appreciable increase in melting temperature of DNA when salbutamol was presented in DNA solution; the fluorescence intensity of salbutamol-DNA decrease with the increasing ionic strength; the relative viscosity of DNA did not change in the presence of salbutamol; the binding constant of salbutamol with double strand DNA (dsDNA) was much higher than that of it with single strand DNA (ssDNA). All these results indicated that the binding mode of salbutamol to DNA should be groove binding. The thermodynamic parameters suggested that hydrogen bond or van der Waals force might play an important role in salbutamol binding to DNA. According to the Förster energy transference theory, the binding distance between the acceptor and donor was 3.70 nm.

  8. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.


    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E


    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  9. Prediction of zinc finger DNA binding protein.


    Nakata, K


    Using the neural network algorithm with back-propagation training procedure, we analysed the zinc finger DNA binding protein sequences. We incorporated the characteristic patterns around the zinc finger motifs TFIIIA type (Cys-X2-5-Cys-X12-13-His-X2-5-His) and the steroid hormone receptor type (Cys-X2-5-Cys-X12-15-Cys-X2-5-Cys-X15-16-Cys-X4-5-Cys-X8-10- Cys-X2-3-Cys) in the neural network algorithm. The patterns used in the neural network were the amino acid pattern, the electric charge and polarity pattern, the side-chain chemical property and subproperty patterns, the hydrophobicity and hydrophilicity patterns and the secondary structure propensity pattern. Two consecutive patterns were also considered. Each pattern was incorporated in the single layer perceptron algorithm and the combinations of patterns were considered in the two-layer perceptron algorithm. As for the TFIIIA type zinc finger DNA binding motifs, the prediction results of the two-layer perceptron algorithm reached up to 96.9% discrimination, and the prediction results of the discriminant analysis using the combination of several characters reached up to 97.0%. As for the steroid hormone receptor type zinc finger, the prediction results of neural network algorithm and the discriminant analyses reached up to 96.0%.

  10. Distinct Z-DNA binding mode of a PKR-like protein kinase containing a Z-DNA binding domain (PKZ)

    PubMed Central

    Kim, Doyoun; Hur, Jeonghwan; Park, Kwangsoo; Bae, Sangsu; Shin, Donghyuk; Ha, Sung Chul; Hwang, Hye-Yeon; Hohng, Sungchul; Lee, Joon-Hwa; Lee, Sangho; Kim, Yang-Gyun; Kim, Kyeong Kyu


    Double-stranded ribonucleic acid-activated protein kinase (PKR) downregulates translation as a defense mechanism against viral infection. In fish species, PKZ, a PKR-like protein kinase containing left-handed deoxyribonucleic acid (Z-DNA) binding domains, performs a similar role in the antiviral response. To understand the role of PKZ in Z-DNA recognition and innate immune response, we performed structural and functional studies of the Z-DNA binding domain (Zα) of PKZ from Carassius auratus (caZαPKZ). The 1.7-Å resolution crystal structure of caZαPKZ:Z-DNA revealed that caZαPKZ shares the overall fold with other Zα, but has discrete structural features that differentiate its DNA binding mode from others. Functional analyses of caZαPKZ and its mutants revealed that caZαPKZ mediates the fastest B-to-Z transition of DNA among Zα, and the minimal interaction for Z-DNA recognition is mediated by three backbone phosphates and six residues of caZαPKZ. Structure-based mutagenesis and B-to-Z transition assays confirmed that Lys56 located in the β-wing contributes to its fast B-to-Z transition kinetics. Investigation of the DNA binding kinetics of caZαPKZ further revealed that the B-to-Z transition rate is positively correlated with the association rate constant. Taking these results together, we conclude that the positive charge in the β-wing largely affects fast B-to-Z transition activity by enhancing the DNA binding rate. PMID:24682817

  11. Difference in DNA-binding abilities of Fur-homolog DNA binding protein from Neisseria gonorrhoeae.


    Bagchi, Angshuman


    Gonorrhea is a severe disease infecting both men and women worldwide. The causative agent of the disease is Neisseria gonorrhoeae. The organism mostly affects human beings in iron restricted environments. In such an environment the organism produces a set of proteins which are mostly absent in iron rich environments. The expressions of the genes for the proteins are regulated by the transcription factor (TF) belonging to the Fur family. Interestingly, the same TF acts as the activator and repressor of genes. In this present work, an attempt has been made to analyze the molecular details of the differential DNA-binding activities of the TF from Neisseria gonorrhoeae to come up with a plausible molecular reason behind the difference DNA binding activities of the same TF. Computational modelling technique was used to build the three dimensional structure of the TF. Molecular docking and molecular dynamics simulations were employed to determine the binding interactions between the TF and the promoter DNA. With the help of the computational techniques, the biochemical reason behind the different modes of DNA binding by the TF was analyzed. Results from this analysis may be useful to future drug development endeavours to curtail the spread of Gonorrhea.

  12. Requirement of the N-terminal residues of human cytomegalovirus UL112-113 proteins for viral growth and oriLyt-dependent DNA replication.


    Kim, Young-Eui; Park, Mi Young; Kang, Kyeong Jin; Han, Tae Hee; Lee, Chan Hee; Ahn, Jin-Hyun


    The UL112-113 region of the human cytomegalovirus (HCMV) genome encodes four phosphoproteins of 34, 43, 50, and 84 kDa that promote viral DNA replication. Co-transfection assays have demonstrated that self-interaction of these proteins via the shared N-termini is necessary for their intranuclear distribution as foci and for the efficient relocation of a viral DNA polymerase processivity factor (UL44) to the viral replication sites. However, the requirement of UL112-113 N-terminal residues for viral growth and DNA replication has not been fully elucidated. Here, we investigated the effect of deletion of the N-terminal regions of UL112-113 proteins on viral growth and oriLyt-dependent DNA replication. A deletion of the entire UL112 region or the region encoding the 25 N-terminal amino-acid residues from the HCMV (Towne strain) bacmid impaired viral growth in bacmid-transfected human fibroblast cells, indicating their requirement for viral growth. In co-immunoprecipitation assays using the genomic gene expressing the four UL112-113 proteins together, the 25 N-terminal amino-acid residues were found to be necessary for stable expression of UL112-113 proteins and their self-interaction. These residues were also required for efficient binding to and relocation of UL44, but not for interaction with IE2, an origin-binding transcription factor. In co-transfection/replication assays, replication of the oriLyt-containing plasmid was promoted by expression of intact UL112-113 proteins, but not by the expression of 25-amino-acid residue-deleted proteins. Our results demonstrate that the 25 N-terminal amino-acid residues of UL112-113 proteins that mediate self-interaction contribute to viral growth by promoting their binding to UL44 and the initiation of oriLyt-dependent DNA replication.

  13. DNA cleavage enzymes for treatment of persistent viral infections: Recent advances and the pathway forward

    SciTech Connect

    Weber, Nicholas D.; Aubert, Martine; Dang, Chung H.; Stone, Daniel; Jerome, Keith R.


    Treatment for most persistent viral infections consists of palliative drug options rather than curative approaches. This is often because long-lasting viral DNA in infected cells is not affected by current antivirals, providing a source for viral persistence and reactivation. Targeting latent viral DNA itself could therefore provide a basis for novel curative strategies. DNA cleavage enzymes can be used to induce targeted mutagenesis of specific genes, including those of exogenous viruses. Although initial in vitro and even in vivo studies have been carried out using DNA cleavage enzymes targeting various viruses, many questions still remain concerning the feasibility of these strategies as they transition into preclinical research. Here, we review the most recent findings on DNA cleavage enzymes for human viral infections, consider the most relevant animal models for several human viral infections, and address issues regarding safety and enzyme delivery. Results from well-designed in vivo studies will ideally provide answers to the most urgent remaining questions, and allow continued progress toward clinical application. - Highlights: • Recent in vitro and in vivo results for DNA cleavage enzymes targeting persistent viral infections. • Analysis of the best animal models for testing enzymes for HBV, HSV, HIV and HPV. • Challenges facing in vivo delivery of therapeutic enzymes for persistent viral infections. • Safety issues to be addressed with proper animal studies.

  14. An Interaction between Human Papillomavirus 16 E2 and TopBP1 Is Required for Optimum Viral DNA Replication and Episomal Genome Establishment

    PubMed Central

    Donaldson, Mary M.; Mackintosh, Lorna J.; Bodily, Jason M.; Dornan, Edward S.; Laimins, Laimonis A.


    In human papillomavirus DNA replication, the viral protein E2 forms homodimers and binds to 12-bp palindromic DNA sequences surrounding the origin of DNA replication. Via a protein-protein interaction, it then recruits the viral helicase E1 to an A/T-rich origin of replication, whereupon a dihexamer forms, resulting in DNA replication initiation. In order to carry out DNA replication, the viral proteins must interact with host factors that are currently not all known. An attractive cellular candidate for regulating viral replication is TopBP1, a known interactor of the E2 protein. In mammalian DNA replication, TopBP1 loads DNA polymerases onto the replicative helicase after the G1-to-S transition, and this process is tightly cell cycle controlled. The direct interaction between E2 and TopBP1 would allow E2 to bypass this cell cycle control, resulting in DNA replication more than once per cell cycle, which is a requirement for the viral life cycle. We report here the generation of an HPV16 E2 mutant compromised in TopBP1 interaction in vivo and demonstrate that this mutant retains transcriptional activation and repression functions but has suboptimal DNA replication potential. Introduction of this mutant into a viral life cycle model results in the failure to establish viral episomes. The results present a potential new antiviral target, the E2-TopBP1 interaction, and increase our understanding of the viral life cycle, suggesting that the E2-TopBP1 interaction is essential. PMID:22973044

  15. Selective binding of single-stranded DNA-binding proteins onto DNA molecules adsorbed on single-walled carbon nanotubes.


    Nii, Daisuke; Hayashida, Takuya; Yamaguchi, Yuuki; Ikawa, Shukuko; Shibata, Takehiko; Umemura, Kazuo


    Single-stranded DNA-binding (SSB) proteins were treated with hybrids of DNA and single-walled carbon nanotubes (SWNTs) to examine the biological function of the DNA molecules adsorbed on the SWNT surface. When single-stranded DNA (ssDNA) was used for the hybridization, significant binding of the SSB molecules to the ssDNA-SWNT hybrids was observed by using atomic force microscopy (AFM) and agarose gel electrophoresis. When double-stranded DNA (dsDNA) was used, the SSB molecules did not bind to the dsDNA-SWNT hybrids in most of the conditions that we evaluated. A specifically modified electrophoresis procedure was used to monitor the locations of the DNA, SSB, and SWNT molecules. Our results clearly showed that ssDNA/dsDNA molecules on the SWNT surfaces retained their single-stranded/double-stranded structures.

  16. How does viral DNA find the nucleus of an infected cell?

    PubMed Central

    Widulle, Herbert


    If all locations of a living cell would have the same chemical potential, most viral infections of a cell should be abortive, even after the a penetration of the cell wall by the viral DNA-polymer or viral RNA-polymer occurred. This is obviously not the case. Therefore, there must be a mechanism which transports a viral DNA-polymer from the cell wall to the nucleus and not to any other location. A possible mechanism is proposed which is in accordance with biophysical chemistry. The presented description of the mechanism uses non equilibrium thermodynamics to find a simple solution for the problem. PMID:22558035

  17. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection

    PubMed Central

    Diner, Benjamin A.; Lum, Krystal K.; Toettcher, Jared E.


    ABSTRACT The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. PMID:27935834

  18. Chemotherapy targeting by DNA capture in viral protein particles

    PubMed Central

    Agadjanian, Hasmik; Chu, David; Hwang, Jae Youn; Wachsmann-Hogiu, Sebastian; Rentsendorj, Altan; Song, Lei; Valluripalli, Vinod; Lubow, Jay; Ma, Jun; Sharifi, Behrooz; Farkas, Daniel L; Medina-Kauwe, Lali K


    Aim This study tests the hypothesis that DNA intercalation and electrophilic interactions can be exploited to noncovalently assemble doxorubicin in a viral protein nanoparticle designed to target and penetrate tumor cells through ligand-directed delivery. We further test whether this new paradigm of doxorubicin targeting shows therapeutic efficacy and safety in vitro and in vivo. Materials & methods We tested serum stability, tumor targeting and therapeutic efficacy in vitro and in vivo using biochemical, microscopy and cytotoxicity assays. Results Self-assembly formed approximately 10-nm diameter serum-stable nanoparticles that can target and ablate HER2+ tumors at >10× lower dose compared with untargeted doxorubicin, while sparing the heart after intravenous delivery. The targeted nanoparticle tested here allows doxorubicin potency to remain unaltered during assembly, transport and release into target cells, while avoiding peripheral tissue damage and enabling lower, and thus safer, drug dose for tumor killing. Conclusion This nanoparticle may be an improved alternative to chemical conjugates and signal-blocking antibodies for tumor-targeted treatment. PMID:22385197

  19. Mutant p53 proteins bind DNA in a DNA structure-selective mode

    PubMed Central

    Göhler, Thomas; Jäger, Stefan; Warnecke, Gabriele; Yasuda, Hideyo; Kim, Ella; Deppert, Wolfgang


    Despite the loss of sequence-specific DNA binding, mutant p53 (mutp53) proteins can induce or repress transcription of mutp53-specific target genes. To date, the molecular basis for transcriptional modulation by mutp53 is not understood, but increasing evidence points to the possibility that specific interactions of mutp53 with DNA play an important role. So far, the lack of a common denominator for mutp53 DNA binding, i.e. the existence of common sequence elements, has hampered further characterization of mutp53 DNA binding. Emanating from our previous discovery that DNA structure is an important determinant of wild-type p53 (wtp53) DNA binding, we analyzed the binding of various mutp53 proteins to oligonucleotides mimicking non-B DNA structures. Using various DNA-binding assays we show that mutp53 proteins bind selectively and with high affinity to non-B DNA. In contrast to sequence-specific and DNA structure-dependent binding of wtp53, mutp53 DNA binding to non-B DNA is solely dependent on the stereo-specific configuration of the DNA, and not on DNA sequence. We propose that DNA structure-selective binding of mutp53 proteins is the basis for the well-documented interaction of mutp53 with MAR elements and for transcriptional activities mediates by mutp53. PMID:15722483

  20. Development of Viral Capsid DNA Aptamer Conjugates as Cell-Targeted Delivery Vehicles

    NASA Astrophysics Data System (ADS)

    Tong, Gary Jen-Wei

    The ability to generate semi-synthetic DNA-protein conjugates has become increasingly important in the fields of chemical biology and nanobiotechnology. As applications in these fields become more complex, there is also an increased need for methods of attaching synthetic DNA to protein substrates in a well-defined manner. This work outlines the development of new methods for site-specific DNA-protein bioconjugation, as well as the development of novel viral capsid DNA aptamer conjugates for cell-targeting purposes. In order to generate DNA-protein conjugates in a site-specific manner, chemistries orthogonal to native functional groups present on DNA and proteins were exploited. In one method, the attachment of DNA to proteins was achieved via oxime formation. This strategy involved the in situ deprotection of an allyloxycarbonyl-protected alkoxyamine-bearing DNA in the presence of a protein containing a single ketone group. The utility of this approach was demonstrated in the synthesis of a DNA-GFP conjugate. In addition to the oxime formation route, two oxidative coupling methods were also developed for DNA-protein bioconjugation. The first reaction coupled phenylenediamine-containing DNA to anilines, which had been site-specifically incorporated into proteins, in the presence of NaIO4. These reaction conditions were demonstrated on the proteins bacteriophage MS2 and GFP, and were mild enough for the components to retain both protein structure and DNA base-pairing capabilities. The second oxidative coupling reaction conjugated aniline-containing proteins to DNA bearing an o-aminophenol moiety. This reaction occurred under similarly mild conditions; however, higher coupling yields were achieved on MS2 at shorter reaction times by using this strategy. In all three of these methods, the generation of a singly-modified product was achieved. Using one of our oxidative coupling strategies, MS2-DNA aptamer conjugates were synthesized for the development of multivalent

  1. Structural Basis for Viral Late-Domain Binding to Alix

    SciTech Connect

    Lee,S.; Joshi, A.; Nagashima, K.; Freed, E.; Hurley, J.


    The modular protein Alix is a central node in endosomal-lysosomal trafficking and the budding of human immunodeficiency virus (HIV)-1. The Gag p6 protein of HIV-1 contains a LYPx{sub n}LxxL motif that is required for Alix-mediated budding and binds a region of Alix spanning residues 360-702. The structure of this fragment of Alix has the shape of the letter 'V' and is termed the V domain. The V domain has a topologically complex arrangement of 11 {alpha}-helices, with connecting loops that cross three times between the two arms of the V. The conserved residue Phe676 is at the center of a large hydrophobic pocket and is crucial for binding to a peptide model of HIV-1 p6. Overexpression of the V domain inhibits HIV-1 release from cells. This inhibition of release is reversed by mutations that block binding of the Alix V domain to p6.

  2. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.


    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart


    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers.

  3. Cleavage of Grb2-Associated Binding Protein 2 by Viral Proteinase 2A during Coxsackievirus Infection

    PubMed Central

    Deng, Haoyu; Fung, Gabriel; Qiu, Ye; Wang, Chen; Zhang, Jingchun; Jin, Zheng-Gen; Luo, Honglin


    Coxsackievirus type B3 (CV-B3), an enterovirus associated with the pathogenesis of several human diseases, subverts, or employs the host intracellular signaling pathways to support effective viral infection. We have previously demonstrated that Grb2-associated binding protein 1 (GAB1), a signaling adaptor protein that serves as a platform for intracellular signaling assembly and transduction, is cleaved upon CV-B3 infection, resulting in a gain-of-pro-viral-function via the modification of GAB1-mediated ERK1/2 pathway. GAB2 is a mammalian homolog of GAB1. In this study, we aim to address whether GAB2 plays a synergistic role with GAB1 in the regulation of CV-B3 replication. Here, we reported that GAB2 is also a target of CV-B3-encoded viral proteinase. We showed that GAB2 is cleaved at G238 during CV-B3 infection by viral proteinase 2A, generating two cleaved fragments of GAB2-N1−237 and GAB2-C238−676. Moreover, knockdown of GAB2 significantly inhibits the synthesis of viral protein and subsequent viral progeny production, accompanied by reduced levels of phosphorylated p38, suggesting a pro-viral function for GAB2 linked to p38 activation. Finally, we examined whether the cleavage of GAB2 can promote viral replication as observed for GAB1 cleavage. We showed that expression of neither GAB2-N1−237 nor GAB2-C238−676 results in enhanced viral infectivity, indicating a loss-of-function, rather than a gain-of-function of GAB2 cleavage in mediating virus replication. Taken together, our findings in this study suggest a novel host defense machinery through which CV-B3 infection is limited by the cleavage of a pro-viral protein. PMID:28361043

  4. Direct assessment of viral diversity in soils by random PCR amplification of polymorphic DNA.


    Srinivasiah, Sharath; Lovett, Jacqueline; Polson, Shawn; Bhavsar, Jaysheel; Ghosh, Dhritiman; Roy, Krishnakali; Fuhrmann, Jeffry J; Radosevich, Mark; Wommack, K Eric


    Viruses are the most abundant and diverse biological entities within soils, yet their ecological impact is largely unknown. Defining how soil viral communities change with perturbation or across environments will contribute to understanding the larger ecological significance of soil viruses. A new approach to examining the composition of soil viral communities based on random PCR amplification of polymorphic DNA (RAPD-PCR) was developed. A key methodological improvement was the use of viral metagenomic sequence data for the design of RAPD-PCR primers. This metagenomically informed approach to primer design enabled the optimization of RAPD-PCR sensitivity for examining changes in soil viral communities. Initial application of RAPD-PCR viral fingerprinting to soil viral communities demonstrated that the composition of autochthonous soil viral assemblages noticeably changed over a distance of meters along a transect of Antarctic soils and across soils subjected to different land uses. For Antarctic soils, viral assemblages segregated upslope from the edge of dry valley lakes. In the case of temperate soils at the Kellogg Biological Station, viral communities clustered according to land use treatment. In both environments, soil viral communities changed along with environmental factors known to shape the composition of bacterial host communities. Overall, this work demonstrates that RAPD-PCR fingerprinting is an inexpensive, high-throughput means for addressing first-order questions of viral community dynamics within environmental samples and thus fills a methodological gap between narrow single-gene approaches and comprehensive shotgun metagenomic sequencing for the analysis of viral community diversity.

  5. Flavonoid-DNA binding studies and thermodynamic parameters

    NASA Astrophysics Data System (ADS)

    Janjua, Naveed Kausar; Shaheen, Amber; Yaqub, Azra; Perveen, Fouzia; Sabahat, Sana; Mumtaz, Misbah; Jacob, Claus; Ba, Lalla Aicha; Mohammed, Hamdoon A.


    Interactional studies of new flavonoid derivatives (Fl) with chicken blood ds.DNA were investigated spectrophotometrically in DMSO-H 2O (9:1 v/v) at various temperatures. Spectral parameters suggest considerable binding between the flavonoid derivatives studied and ds.DNA. The binding constant values lie in the enhanced-binding range. Thermodynamic parameters obtained from UV studies also point to strong spontaneous binding of Fl with ds.DNA. Viscometric studies complimented the UV results where a small linear increase in relative viscosity of the DNA solution was observed with added optimal flavonoid concentration. An overall mixed mode of interaction (intercalative plus groove binding) is proposed between DNA and flavonoids. Conclusively, investigated flavonoid derivatives are found to be strong DNA binders and seem to be promising drug candidates like their natural analogues.

  6. Engineering large viral DNA genomes using the CRISPR-Cas9 system.


    Suenaga, Tadahiro; Kohyama, Masako; Hirayasu, Kouyuki; Arase, Hisashi


    Manipulation of viral genomes is essential for studying viral gene function and utilizing viruses for therapy. Several techniques for viral genome engineering have been developed. Homologous recombination in virus-infected cells has traditionally been used to edit viral genomes; however, the frequency of the expected recombination is quite low. Alternatively, large viral genomes have been edited using a bacterial artificial chromosome (BAC) plasmid system. However, cloning of large viral genomes into BAC plasmids is both laborious and time-consuming. In addition, because it is possible for insertion into the viral genome of drug selection markers or parts of BAC plasmids to affect viral function, artificial genes sometimes need to be removed from edited viruses. Herpes simplex virus (HSV), a common DNA virus with a genome length of 152 kbp, causes labialis, genital herpes and encephalitis. Mutant HSV is a candidate for oncotherapy, in which HSV is used to kill tumor cells. In this study, the clustered regularly interspaced short palindromic repeat-Cas9 system was used to very efficiently engineer HSV without inserting artificial genes into viral genomes. Not only gene-ablated HSV but also gene knock-in HSV were generated using this method. Furthermore, selection with phenotypes of edited genes promotes the isolation efficiencies of expectedly mutated viral clones. Because our method can be applied to other DNA viruses such as Epstein-Barr virus, cytomegaloviruses, vaccinia virus and baculovirus, our system will be useful for studying various types of viruses, including clinical isolates.

  7. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria

    PubMed Central

    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc


    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin. PMID:25916847

  8. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria.


    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc


    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin.

  9. Barrier to auto integration factor becomes dephosphorylated during HSV-1 Infection and Can Act as a host defense by impairing viral DNA replication and gene expression.


    Jamin, Augusta; Thunuguntla, Prasanth; Wicklund, April; Jones, Clinton; Wiebe, Matthew S


    BAF (Barrier to Autointegration Factor) is a highly conserved DNA binding protein that senses poxviral DNA in the cytoplasm and tightly binds to the viral genome to interfere with DNA replication and transcription. To counteract BAF, a poxviral-encoded protein kinase phosphorylates BAF, which renders BAF unable to bind DNA and allows efficient viral replication to occur. Herein, we examined how BAF phosphorylation is affected by herpes simplex virus type 1 (HSV-1) infection and tested the ability of BAF to interfere with HSV-1 productive infection. Interestingly, we found that BAF phosphorylation decreases markedly following HSV-1 infection. To determine whether dephosphorylated BAF impacts HSV-1 productive infection, we employed cell lines stably expressing a constitutively unphosphorylated form of BAF (BAF-MAAAQ) and cells overexpressing wild type (wt) BAF for comparison. Although HSV-1 production in cells overexpressing wtBAF was similar to that in cells expressing no additional BAF, viral growth was reduced approximately 80% in the presence of BAF-MAAAQ. Experiments were also performed to determine the mechanism of the antiviral activity of BAF with the following results. BAF-MAAAQ was localized to the nucleus, whereas wtBAF was dispersed throughout cells prior to infection. Following infection, wtBAF becomes dephosphorylated and relocalized to the nucleus. Additionally, BAF was associated with the HSV-1 genome during infection, with BAF-MAAAQ associated to a greater extent than wtBAF. Importantly, unphosphorylated BAF inhibited both viral DNA replication and gene expression. For example, expression of two regulatory proteins, ICP0 and VP16, were substantially reduced in cells expressing BAF-MAAAQ. However, other viral genes were not dramatically affected suggesting that expression of certain viral genes can be differentially regulated by unphosphorylated BAF. Collectively, these results suggest that BAF can act in a phosphorylation-regulated manner to impair

  10. MCM ring hexamerization is a prerequisite for DNA-binding


    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.


    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  11. MCM ring hexamerization is a prerequisite for DNA-binding

    SciTech Connect

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.


    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in the hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.

  12. Gene expression regulation in retinal pigment epithelial cells induced by viral RNA and viral/bacterial DNA

    PubMed Central

    Brosig, Anton; Kuhrt, Heidrun; Wiedemann, Peter; Kohen, Leon; Bringmann, Andreas


    Purpose The pathogenesis of age-related macular degeneration (AMD) is associated with systemic and local inflammation. Various studies suggested that viral or bacterial infection may aggravate retinal inflammation in the aged retina. We compared the effects of synthetic viral RNA (poly(I:C)) and viral/bacterial DNA (CpG-ODN) on the expression of genes known to be involved in the development of AMD in retinal pigment epithelial (RPE) cells. Methods Cultured human RPE cells were stimulated with poly(I:C; 500 µg/ml) or CpG-ODN (500 nM). Alterations in gene expression and protein secretion were determined with real-time RT–PCR and ELISA, respectively. Phosphorylation of signal transduction molecules was revealed by western blotting. Results Poly(I:C) induced gene expression of the pattern recognition receptor TLR3, transcription factors (HIF-1α, p65/NF-κB), the angiogenic factor bFGF, inflammatory factors (IL-1β, IL-6, TNFα, MCP-1, MIP-2), and complement factors (C5, C9, CFB). Poly(I:C) also induced phosphorylation of ERK1/2 and p38 MAPK proteins, and the secretion of bFGF and TNFα from the cells. CpG-ODN induced moderate gene expression of transcription factors (p65/NF-κB, NFAT5) and complement factors (C5, C9), while it had no effect on the expression of various TLR, angiogenic factor, and inflammatory factor genes. The activities of various signal transduction pathways and transcription factors were differentially involved in mediating the poly(I:C)-induced transcriptional activation of distinct genes. Conclusions The widespread effects of viral RNA, and the restricted effects of viral/bacterial DNA, on the gene expression pattern of RPE cells may suggest that viral RNA rather than viral/bacterial DNA induces physiologic alterations of RPE cells, which may aggravate inflammation in the aged retina. The data also suggest that selective inhibition of distinct signal transduction pathways or individual transcription factors may not be effective to inhibit

  13. Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

    SciTech Connect

    Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki; Kim, Woo-Taek; Kim, Ho-Guen; Lee, Sang-Kyou


    Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS, and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.

  14. DNA topology, not DNA sequence, is a critical determinant for Drosophila ORC–DNA binding

    PubMed Central

    Remus, Dirk; Beall, Eileen L; Botchan, Michael R


    Drosophila origin recognition complex (ORC) localizes to defined positions on chromosomes, and in follicle cells the chorion gene amplification loci are well-studied examples. However, the mechanism of specific localization is not known. We have studied the DNA binding of DmORC to investigate the cis-requirements for DmORC:DNA interaction. DmORC displays at best six-fold differences in the relative affinities to DNA from the third chorion locus and to random fragments in vitro, and chemical probing and DNase1 protection experiments did not identify a discrete binding site for DmORC on any of these fragments. The intrinsic DNA-binding specificity of DmORC is therefore insufficient to target DmORC to origins of replication in vivo. However, the topological state of the DNA significantly influences the affinity of DmORC to DNA. We found that the affinity of DmORC for negatively supercoiled DNA is about 30-fold higher than for either relaxed or linear DNA. These data provide biochemical evidence for the notion that origin specification in metazoa likely involves mechanisms other than simple replicator–initiator interactions and that in vivo other proteins must determine ORC's localization. PMID:14765124

  15. Structural Investigation of a Viral Ortholog of Human NEIL2/3 DNA Glycosylases

    PubMed Central

    Prakash, Aishwarya; Eckenroth, Brian E.; Averill, April M.; Imamura, Kayo; Wallace, Susan S.; Doublié, Sylvie


    Assault to DNA that leads to oxidative base damage is repaired by the base excision repair (BER) pathway with specialized enzymes called DNA glycosylases catalyzing the first step of this pathway. These glycosylases can be categorized into two families: the HhH superfamily, which includes endonuclease III (or Nth), and the Fpg/Nei family, which comprises formamidopyrimidine DNA glycosylase (or Fpg) and endonuclease VIII (or Nei). In humans there are three Nei-like (NEIL) glycosylases: NEIL1, 2, and 3. Here we present the first crystal structure of a viral ortholog of the human NEIL2/NEIL3 proteins, Mimivirus Nei2 (MvNei2), determined at 2.04 Å resolution. The C-terminal region of the MvNei2 enzyme comprises two conserved DNA binding motifs: the helix-two-turns-helix (H2TH) motif and a C-H-C-C type zinc-finger similar to that of human NEIL2. The N-terminal region of MvNei2 is most closely related to NEIL3. Like NEIL3, MvNei2 bears a valine at position 2 instead of the usual proline and it lacks two of the three conserved void-filling residues present in other members of the Fpg/Nei family. Mutational analysis of the only conserved void-filling residue methionine 72 to alanine yields an MvNei2 variant with impaired glycosylase activity. Mutation of the adjacent His73 causes the enzyme to be more productive thereby suggesting a plausible role for this residue in the DNA lesion search process. PMID:24120312

  16. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA

    SciTech Connect

    Sharma A.; Heroux A.; Jenkins K. R.; Bowman G. D.


    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves.

  17. Equilibrium binding of single-stranded DNA to the secondary DNA binding site of the bacterial recombinase RecA.


    Gourves, A S; Defais, M; Johnson, N P


    The bacterial recombinase RecA forms a nucleoprotein filament in vitro with single-stranded DNA (ssDNA) at its primary DNA binding site, site I. This filament has a second site, site II, which binds ssDNA and double-stranded DNA. We have investigated the binding of ssDNA to the RecA protein in the presence of adenosine 5'-O-(thiotriphosphate) cofactor using fluorescence anisotropy. The RecA protein carried out DNA strand exchange with a 5'-fluorescein-labeled 32-mer oligonucleotide. The anisotropy signal was shown to measure oligonucleotide binding to RecA, and the relationship between signal and binding density was determined. Binding of ssDNA to site I of RecA was stable at high NaCl concentrations. Binding to site II could be described by a simple two-state equilibrium, K = 4.5 +/- 1.5 x 10(5) m(-1) (37 degrees C, 150 mm NaCl, pH 7.4). The reaction was enthalpy-driven and entropy-opposed. It depended on salt concentration and was sensitive to the type of monovalent anion, suggesting that anion-dependent protein conformations contribute to ssDNA binding at site II.

  18. In vitro DNA binding studies of Aspartame, an artificial sweetener.


    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh


    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1).

  19. Damage-specific DNA-binding proteins from human cells

    SciTech Connect

    Kanjilal, S.


    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1% NP-40.

  20. Human Cytomegalovirus Can Procure Deoxyribonucleotides for Viral DNA Replication in the Absence of Retinoblastoma Protein Phosphorylation

    PubMed Central

    Kuny, Chad V.


    ABSTRACT Viral DNA replication requires deoxyribonucleotide triphosphates (dNTPs). These molecules, which are found at low levels in noncycling cells, are generated either by salvage pathways or through de novo synthesis. Nucleotide synthesis utilizes the activity of a series of nucleotide-biosynthetic enzymes (NBEs) whose expression is repressed in noncycling cells by complexes between the E2F transcription factors and the retinoblastoma (Rb) tumor suppressor. Rb-E2F complexes are dissociated and NBE expression is activated during cell cycle transit by cyclin-dependent kinase (Cdk)-mediated Rb phosphorylation. The DNA virus human cytomegalovirus (HCMV) encodes a viral Cdk (v-Cdk) (the UL97 protein) that phosphorylates Rb, induces the expression of cellular NBEs, and is required for efficient viral DNA synthesis. A long-held hypothesis proposed that viral proteins with Rb-inactivating activities functionally similar to those of UL97 facilitated viral DNA replication in part by inducing the de novo production of dNTPs. However, we found that dNTPs were limiting even in cells infected with wild-type HCMV in which UL97 is expressed and Rb is phosphorylated. Furthermore, we revealed that both de novo and salvage pathway enzymes contribute to viral DNA replication during HCMV infection and that Rb phosphorylation by cellular Cdks does not correct the viral DNA replication defect observed in cells infected with a UL97-deficient virus. We conclude that HCMV can obtain dNTPs in the absence of Rb phosphorylation and that UL97 can contribute to the efficiency of DNA replication in an Rb phosphorylation-independent manner. IMPORTANCE Transforming viral oncoproteins, such as adenovirus E1A and papillomavirus E7, inactivate Rb. The standard hypothesis for how Rb inactivation facilitates infection with these viruses is that it is through an increase in the enzymes required for DNA synthesis, which include nucleotide-biosynthetic enzymes. However, HCMV UL97, which functionally

  1. A role for dNTP binding of human immunodeficiency virus type 1 reverse transcriptase in viral mutagenesis.


    Weiss, Kellie K; Chen, Renxiang; Skasko, Mark; Reynolds, Holly M; Lee, Kwi; Bambara, Robert A; Mansky, Louis M; Kim, Baek


    HIV-1 reverse transcriptase (RT) is a highly error prone DNA polymerase. We assessed whether the ability of RT to bind nucleotide substrates affects viral mutagenesis. Structural modeling predicts that the V148 and Q151 residues influence the interaction between RT and the incoming dNTP. When we introduce either a V148I or Q151N mutation, RT fidelity increases 8.7- or 13-fold, respectively, as measured by the M13 lacZalpha forward mutation assay. Interestingly, pre-steady state kinetic studies demonstrated that these mutations do not alter polymerase fidelity during the first step of mutation synthesis, misincorporation. Rather, the V148I and Q151N mutations alter RT fidelity by weakening the ability of the polymerase to complete mismatch extension, the second step of mutation synthesis. While both these mutations minimally affect the binding of RT (K(D)) to a mismatched template-primer complex (T/P), these mutant RTs are significantly impaired in their ability to bind (K(d)) and chemically incorporate (k(pol)) nucleotide substrate onto a mismatched T/P. These differences in binding and catalysis translate into 24- and 15.9-fold increase in mismatch extension fidelity for the V148I and Q151N RT mutants, respectively. Finally, we employed a cell-based pseudotyped HIV-1 mutation assay to determine whether changes in these dNTP binding residues alter RT fidelity in vivo. We found that the V148I and Q151N mutant viruses had 3.8- and 5.7-fold higher fidelities than wild-type viruses, respectively, indicating that the molecular interaction between HIV-1 RT and the dNTP substrate contributes to viral mutagenesis.

  2. Nuclear Sensing of Viral DNA, Epigenetic Regulation of Herpes Simplex Virus Infection, and Innate Immunity

    PubMed Central

    Knipe, David M.


    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. Herpes viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. PMID:25742715

  3. A protein ballet around the viral genome orchestrated by HIV-1 reverse transcriptase leads to an architectural switch: from nucleocapsid-condensed RNA to Vpr-bridged DNA.


    Lyonnais, Sébastien; Gorelick, Robert J; Heniche-Boukhalfa, Fatima; Bouaziz, Serge; Parissi, Vincent; Mouscadet, Jean-François; Restle, Tobias; Gatell, Jose Maria; Le Cam, Eric; Mirambeau, Gilles


    HIV-1 reverse transcription is achieved in the newly infected cell before viral DNA (vDNA) nuclear import. Reverse transcriptase (RT) has previously been shown to function as a molecular motor, dismantling the nucleocapsid complex that binds the viral genome as soon as plus-strand DNA synthesis initiates. We first propose a detailed model of this dismantling in close relationship with the sequential conversion from RNA to double-stranded (ds) DNA, focusing on the nucleocapsid protein (NCp7). The HIV-1 DNA-containing pre-integration complex (PIC) resulting from completion of reverse transcription is translocated through the nuclear pore. The PIC nucleoprotein architecture is poorly understood but contains at least two HIV-1 proteins initially from the virion core, namely integrase (IN) and the viral protein r (Vpr). We next present a set of electron micrographs supporting that Vpr behaves as a DNA architectural protein, initiating multiple DNA bridges over more than 500 base pairs (bp). These complexes are shown to interact with NCp7 bound to single-stranded nucleic acid regions that are thought to maintain IN binding during dsDNA synthesis, concurrently with nucleocapsid complex dismantling. This unexpected binding of Vpr conveniently leads to a compacted but filamentous folding of the vDNA that should favor its nuclear import. Finally, nucleocapsid-like aggregates engaged in dsDNA synthesis appear to efficiently bind to F-actin filaments, a property that may be involved in targeting complexes to the nuclear envelope. More generally, this article highlights unique possibilities offered by in vitro reconstitution approaches combined with macromolecular imaging to gain insights into the mechanisms that alter the nucleoprotein architecture of the HIV-1 genome, ultimately enabling its insertion into the nuclear chromatin.

  4. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    SciTech Connect

    Kennedy, Edward M.; Cullen, Bryan R.


    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  5. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    SciTech Connect

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan; Lynn, Annie; Cotmore, Susan F.; Tattersall, Peter; Zhao, Haiyan; Tang, Liang


    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase active site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.

  6. Binding of globular proteins to DNA from surface tension measurement.


    Mitra, A; Chattoraj, D K; Chakraborty, P


    Extent of binding (gammap) of globular proteins to calf-thymus DNA have been measured in mole per mole of nucleotide as function of equilibrium protein concentration. We have exploited measurement of the surface tension of the protein solution in the presence and absence of DNA to calculate the binding ration (gammap). Interaction of bovine serum albumin with DNA has been studied at different pH. Interaction of bovine serum albumin with DNA has been studied at different pH, ionic strength and in presence of Ca2+. Interaction of BSA with denatured DNA has also been investigated. Binding isotherms for other globular proteins like beta-lactoglobulin, alpha-lactalbumin and lysozyme have been compared under identical physicochemical condition. It has been noted with considerable interest that globular form of protein is important to some extent in protein-DNA interaction. An attempt has been made to explain the significance of difference in binding ratios of these two biopolymers in aqueous medium for different systems in the light of electrostatic and hydrophobic effects. Values of maximum binding ration (gammap(m)) at saturated level for different systems have been also presented. The Gibb's free energy decrease (-deltaG0) of the binding of proteins to DNA has been compared more precisely for the saturation of binding sites in the DNA with the change of activity of protein in solution from zero to unity in the rational mole fraction scale.

  7. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.


    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo


    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH2 groups (CONH2-SWNT) exhibited very strong interactions between the CONH2-SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  8. The quinobenzoxazines: relationship between DNA binding and biological activity.


    Kwok, Y; Sun, D; Clement, J J; Hurley, L H


    The quinobenzoxazine compounds, derived from antibacterial quinolones, is active in vitro and in vivo against murine and human tumors. In this contribution, we show that the relative DNA binding affinity of the quinobenzoxazine compounds correlates with their cytotoxicity, their ability to inhibit gyrase-DNA complex formation, and the decatenation of kinetoplast DNA by human topoisomerase II. DNA binding studies with the descarboxy-A-62176 analogue indicate that the beta-keto acid moiety of the quinobenzoxazine compounds plays an important role in their interaction with DNA.

  9. Probing the binding mode of psoralen to calf thymus DNA.


    Zhou, Xiaoyue; Zhang, Guowen; Wang, Langhong


    The binding properties between psoralen (PSO) and calf thymus DNA (ctDNA) were predicted by molecular docking, and then determined with the use of UV-vis absorption, fluorescence, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy, coupled with DNA melting and viscosity measurements. The data matrix obtained from UV-vis spectra was resolved by multivariate curve resolution-alternating least squares (MCR-ALS) approach. The pure spectra and the equilibrium concentration profiles for PSO, ctDNA and PSO-ctDNA complex extracted from the highly overlapping composite response were obtained simultaneously to evaluate the PSO-ctDNA interaction. The intercalation mode of PSO binding to ctDNA was supported by the results from the melting studies, viscosity measurements, iodide quenching and fluorescence polarization experiments, competitive binding investigations and CD analysis. The molecular docking prediction showed that the specific binding most likely occurred between PSO and adenine bases of ctDNA. FT-IR spectra studies further confirmed that PSO preferentially bound to adenine bases, and this binding decreased right-handed helicity of ctDNA and enhanced the degree of base stacking with the preservation of native B-conformation. The calculated thermodynamic parameters indicated that hydrogen bonds and van der Waals forces played a major role in the binding process.

  10. Variola type IB DNA topoisomerase: DNA binding and supercoil unwinding using engineered DNA minicircles.


    Anderson, Breeana G; Stivers, James T


    Type IB topoisomerases unwind positive and negative DNA supercoils and play a key role in removing supercoils that would otherwise accumulate at replication and transcription forks. An interesting question is whether topoisomerase activity is regulated by the topological state of the DNA, thereby providing a mechanism for targeting the enzyme to highly supercoiled DNA domains in genomes. The type IB enzyme from variola virus (vTopo) has proven to be useful in addressing mechanistic questions about topoisomerase function because it forms a reversible 3'-phosphotyrosyl adduct with the DNA backbone at a specific target sequence (5'-CCCTT-3') from which DNA unwinding can proceed. We have synthesized supercoiled DNA minicircles (MCs) containing a single vTopo target site that provides highly defined substrates for exploring the effects of supercoil density on DNA binding, strand cleavage and ligation, and unwinding. We observed no topological dependence for binding of vTopo to these supercoiled MC DNAs, indicating that affinity-based targeting to supercoiled DNA regions by vTopo is unlikely. Similarly, the cleavage and religation rates of the MCs were not topologically dependent, but topoisomers with low superhelical densities were found to unwind more slowly than highly supercoiled topoisomers, suggesting that reduced torque at low superhelical densities leads to an increased number of cycles of cleavage and ligation before a successful unwinding event. The K271E charge reversal mutant has an impaired interaction with the rotating DNA segment that leads to an increase in the number of supercoils that were unwound per cleavage event. This result provides evidence that interactions of the enzyme with the rotating DNA segment can restrict the number of supercoils that are unwound. We infer that both superhelical density and transient contacts between vTopo and the rotating DNA determine the efficiency of supercoil unwinding. Such determinants are likely to be important in

  11. Differential activities of cellular and viral macro domain proteins in binding of ADP-ribose metabolites.


    Neuvonen, Maarit; Ahola, Tero


    Macro domain is a highly conserved protein domain found in both eukaryotes and prokaryotes. Macro domains are also encoded by a set of positive-strand RNA viruses that replicate in the cytoplasm of animal cells, including coronaviruses and alphaviruses. The functions of the macro domain are poorly understood, but it has been suggested to be an ADP-ribose-binding module. We have here characterized three novel human macro domain proteins that were found to reside either in the cytoplasm and nucleus [macro domain protein 2 (MDO2) and ganglioside-induced differentiation-associated protein 2] or in mitochondria [macro domain protein 1 (MDO1)], and compared them with viral macro domains from Semliki Forest virus, hepatitis E virus, and severe acute respiratory syndrome coronavirus, and with a yeast macro protein, Poa1p. MDO2 specifically bound monomeric ADP-ribose with a high affinity (K(d)=0.15 microM), but did not bind poly(ADP-ribose) efficiently. MDO2 also hydrolyzed ADP-ribose-1'' phosphate, resembling Poa1p in all these properties. Ganglioside-induced differentiation-associated protein 2 did not show affinity for ADP-ribose or its derivatives, but instead bound poly(A). MDO1 was generally active in these reactions, including poly(A) binding. Individual point mutations in MDO1 abolished monomeric ADP-ribose binding, but not poly(ADP-ribose) binding; in poly(ADP-ribose) binding assays, the monomer did not compete against polymer binding. The viral macro proteins bound poly(ADP-ribose) and poly(A), but had a low affinity for monomeric ADP-ribose. Thus, the viral proteins do not closely resemble any of the human proteins in their biochemical functions. The differential activity profiles of the human proteins implicate them in different cellular pathways, some of which may involve RNA rather than ADP-ribose derivatives.

  12. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].


    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V


    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  13. Development of Potent Antiviral Drugs Inspired by Viral Hexameric DNA-Packaging Motors with Revolving Mechanism

    PubMed Central

    Pi, Fengmei; Zhao, Zhengyi; Chelikani, Venkata; Yoder, Kristine; Kvaratskhelia, Mamuka


    The intracellular parasitic nature of viruses and the emergence of antiviral drug resistance necessitate the development of new potent antiviral drugs. Recently, a method for developing potent inhibitory drugs by targeting biological machines with high stoichiometry and a sequential-action mechanism was described. Inspired by this finding, we reviewed the development of antiviral drugs targeting viral DNA-packaging motors. Inhibiting multisubunit targets with sequential actions resembles breaking one bulb in a series of Christmas lights, which turns off the entire string. Indeed, studies on viral DNA packaging might lead to the development of new antiviral drugs. Recent elucidation of the mechanism of the viral double-stranded DNA (dsDNA)-packaging motor with sequential one-way revolving motion will promote the development of potent antiviral drugs with high specificity and efficiency. Traditionally, biomotors have been classified into two categories: linear and rotation motors. Recently discovered was a third type of biomotor, including the viral DNA-packaging motor, beside the bacterial DNA translocases, that uses a revolving mechanism without rotation. By analogy, rotation resembles the Earth's rotation on its own axis, while revolving resembles the Earth's revolving around the Sun (see animations at Herein, we review the structures of viral dsDNA-packaging motors, the stoichiometries of motor components, and the motion mechanisms of the motors. All viral dsDNA-packaging motors, including those of dsDNA/dsRNA bacteriophages, adenoviruses, poxviruses, herpesviruses, mimiviruses, megaviruses, pandoraviruses, and pithoviruses, contain a high-stoichiometry machine composed of multiple components that work cooperatively and sequentially. Thus, it is an ideal target for potent drug development based on the power function of the stoichiometries of target complexes that work sequentially. PMID:27356896

  14. Characterization of a DNA binding protein of bacteriophage PRD1 involved in DNA replication.

    PubMed Central

    Pakula, T M; Caldentey, J; Serrano, M; Gutierrez, C; Hermoso, J M; Salas, M; Bamford, D H


    Escherichia coli phage PRD1 protein P12, involved in PRD1 DNA replication in vivo, has been highly purified from E. coli cells harbouring a gene XII-containing plasmid. Protein P12 binds to single-stranded DNA as shown by gel retardation assays and nuclease protection experiments. Binding of protein P12 to single-stranded DNA increases about 14% the contour length of the DNA as revealed by electron microscopy. Binding to single-stranded DNA seems to be cooperative, and it is not sequence specific. Protein P12 also binds to double-stranded DNA although with an affinity 10 times lower than to single-stranded DNA. Using the in vitro phage phi 29 DNA replication system, it is shown that protein P12 stimulates the overall phi 29 DNA replication. Images PMID:2251117

  15. A viral packaging motor varies its DNA rotation and step size to preserve subunit coordination as the capsid fills.


    Liu, Shixin; Chistol, Gheorghe; Hetherington, Craig L; Tafoya, Sara; Aathavan, K; Schnitzbauer, Joerg; Grimes, Shelley; Jardine, Paul J; Bustamante, Carlos


    Multimeric, ring-shaped molecular motors rely on the coordinated action of their subunits to perform crucial biological functions. During these tasks, motors often change their operation in response to regulatory signals. Here, we investigate a viral packaging machine as it fills the capsid with DNA and encounters increasing internal pressure. We find that the motor rotates the DNA during packaging and that the rotation per base pair increases with filling. This change accompanies a reduction in the motor's step size. We propose that these adjustments preserve motor coordination by allowing one subunit to make periodic, specific, and regulatory contacts with the DNA. At high filling, we also observe the downregulation of the ATP-binding rate and the emergence of long-lived pauses, suggesting a throttling-down mechanism employed by the motor near the completion of packaging. This study illustrates how a biological motor adjusts its operation in response to changing conditions, while remaining highly coordinated.

  16. RNA recognition by the DNA end-binding Ku heterodimer.


    Dalby, Andrew B; Goodrich, Karen J; Pfingsten, Jennifer S; Cech, Thomas R


    Most nucleic acid-binding proteins selectively bind either DNA or RNA, but not both nucleic acids. The Saccharomyces cerevisiae Ku heterodimer is unusual in that it has two very different biologically relevant binding modes: (1) Ku is a sequence-nonspecific double-stranded DNA end-binding protein with prominent roles in nonhomologous end-joining and telomeric capping, and (2) Ku associates with a specific stem-loop of TLC1, the RNA subunit of budding yeast telomerase, and is necessary for proper nuclear localization of this ribonucleoprotein enzyme. TLC1 RNA-binding and dsDNA-binding are mutually exclusive, so they may be mediated by the same site on Ku. Although dsDNA binding by Ku is well studied, much less is known about what features of an RNA hairpin enable specific recognition by Ku. To address this question, we localized the Ku-binding site of the TLC1 hairpin with single-nucleotide resolution using phosphorothioate footprinting, used chemical modification to identify an unpredicted motif within the hairpin secondary structure, and carried out mutagenesis of the stem-loop to ascertain the critical elements within the RNA that permit Ku binding. Finally, we provide evidence that the Ku-binding site is present in additional budding yeast telomerase RNAs and discuss the possibility that RNA binding is a conserved function of the Ku heterodimer.

  17. RNA recognition by the DNA end-binding Ku heterodimer

    PubMed Central

    Dalby, Andrew B.; Goodrich, Karen J.; Pfingsten, Jennifer S.; Cech, Thomas R.


    Most nucleic acid-binding proteins selectively bind either DNA or RNA, but not both nucleic acids. The Saccharomyces cerevisiae Ku heterodimer is unusual in that it has two very different biologically relevant binding modes: (1) Ku is a sequence-nonspecific double-stranded DNA end-binding protein with prominent roles in nonhomologous end-joining and telomeric capping, and (2) Ku associates with a specific stem–loop of TLC1, the RNA subunit of budding yeast telomerase, and is necessary for proper nuclear localization of this ribonucleoprotein enzyme. TLC1 RNA-binding and dsDNA-binding are mutually exclusive, so they may be mediated by the same site on Ku. Although dsDNA binding by Ku is well studied, much less is known about what features of an RNA hairpin enable specific recognition by Ku. To address this question, we localized the Ku-binding site of the TLC1 hairpin with single-nucleotide resolution using phosphorothioate footprinting, used chemical modification to identify an unpredicted motif within the hairpin secondary structure, and carried out mutagenesis of the stem–loop to ascertain the critical elements within the RNA that permit Ku binding. Finally, we provide evidence that the Ku-binding site is present in additional budding yeast telomerase RNAs and discuss the possibility that RNA binding is a conserved function of the Ku heterodimer. PMID:23610127

  18. Nuclear sensing of viral DNA, epigenetic regulation of herpes simplex virus infection, and innate immunity

    SciTech Connect

    Knipe, David M.


    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. HSV viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. - Highlights: • HSV lytic and latent gene expression is regulated differentially by epigenetic processes. • The sensors of foreign DNA have not been defined fully. • IFI16 and cGAS cooperate to sense viral DNA in HSV-infected cells. • IFI16 plays a role in both innate sensing of HSV DNA and in restricting its expression.

  19. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    SciTech Connect

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; Chattopadhyay, Debasish


    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This also represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.

  20. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase


    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...


    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  1. The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA.

    PubMed Central

    Giraldo, R; Rhodes, D


    The protein RAP1 is essential for the maintenance of the telomeres of Saccharomyces cerevisiae and binds in vitro to multiple sites found within the TG1-3 telomeric repeats. We show here that, in addition to its known binding activity for double-stranded DNA, RAP1 binds sequence-specifically to the GT-strands. This indicates that RAP1 is the protein that binds to the telomeric terminal GT-tails. Furthermore, we have found that RAP1 binds to and promotes the formation of G-tetrads, i.e. DNA quadruplexes, in GT-strand oligonucleotides at nanomolar concentrations. The formation of DNA quadruplexes appears to involve the intermolecular association of GT-strands. The minimal DNA-binding domain of RAP1 (DBD) binds only to double-stranded DNA, so that the novel DNA-binding activity we have found involves regions of the protein located outside of the DBD. The finding that a telomeric protein promotes the formation of G-tetrads argues for the use of DNA quadruplexes in telomere association. Images PMID:8194531

  2. Quantitative analysis of the binding of simian virus 40 large T antigen to DNA.


    Fradet-Turcotte, Amélie; Vincent, Caroline; Joubert, Simon; Bullock, Peter A; Archambault, Jacques


    SV40 large T antigen (T-ag) is a multifunctional protein that successively binds to 5'-GAGGC-3' sequences in the viral origin of replication, melts the origin, unwinds DNA ahead of the replication fork, and interacts with host DNA replication factors to promote replication of the simian virus 40 genome. The transition of T-ag from a sequence-specific binding protein to a nonspecific helicase involves its assembly into a double hexamer whose formation is likely dictated by the propensity of T-ag to oligomerize and its relative affinities for the origin as well as for nonspecific double- and single-stranded DNA. In this study, we used a sensitive assay based on fluorescence anisotropy to measure the affinities of wild-type and mutant forms of the T-ag origin-binding domain (OBD), and of a larger fragment containing the N-terminal domain (N260), for different DNA substrates. We report that the N-terminal domain does not contribute to binding affinity but reduces the propensity of the OBD to self-associate. We found that the OBD binds with different affinities to its four sites in the origin and determined a consensus binding site by systematic mutagenesis of the 5'-GAGGC-3' sequence and of the residue downstream of it, which also contributes to affinity. Interestingly, the OBD also binds to single-stranded DNA with an approximately 10-fold higher affinity than to nonspecific duplex DNA and in a mutually exclusive manner. Finally, we provide evidence that the sequence specificity of full-length T-ag is lower than that of the OBD. These results provide a quantitative basis onto which to anchor our understanding of the interaction of T-ag with the origin and its assembly into a double hexamer.

  3. Crystal structure of the adenovirus DNA binding protein reveals a hook-on model for cooperative DNA binding.

    PubMed Central

    Tucker, P A; Tsernoglou, D; Tucker, A D; Coenjaerts, F E; Leenders, H; van der Vliet, P C


    The adenovirus single-stranded DNA binding protein (Ad DBP) is a multifunctional protein required, amongst other things, for DNA replication and transcription control. It binds to single- and double-stranded DNA, as well as to RNA, in a sequence-independent manner. Like other single-stranded DNA binding proteins, it binds ssDNA, cooperatively. We report the crystal structure, at 2.6 A resolution, of the nucleic acid binding domain. This domain is active in DNA replication. The protein contains two zinc atoms in different, novel coordinations. The zinc atoms appear to be required for the stability of the protein fold rather than being involved in direct contacts with the DNA. The crystal structure shows that the protein contains a 17 amino acid C-terminal extension which hooks onto a second molecule, thereby forming a protein chain. Deletion of this C-terminal arm reduces cooperativity in DNA binding, suggesting a hook-on model for cooperativity. Based on this structural work and mutant studies, we propose that DBP forms a protein core around which the single-stranded DNA winds. Images PMID:8039495

  4. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes

    PubMed Central

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas


    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. PMID:27112572

  5. DNA-Based Nanostructures: Changes of Mechanical Properties of DNA upon Ligand Binding

    NASA Astrophysics Data System (ADS)

    Nechipurenko, Yury; Grokhovsky, Sergey; Gursky, Georgy; Nechipurenko, Dmitry; Polozov, Robert

    The formation of DNA-based nanostructures involves the binding of different kinds of ligands to DNA as well as the interaction of DNA molecules with each other. Complex formation between ligand and DNA can alter physicochemical properties of the DNA molecule. In the present work, the accessibility of DNA-ligand complexes to cleavage by DNase I are considered, and the exact algorithms for analysis of diagrams of DNase I footprinting for ligand-DNA complexes are obtained. Changes of mechanical properties of the DNA upon ligand binding are also demonstrated by the cleavage patterns generated upon ultrasound irradiation of cis-platin-DNA complexes. Propagation of the mechanical perturbations along DNA in the presence of bound ligands is considered in terms of a string model with a heterogeneity corresponding to the position of a bound ligand on DNA. This model can reproduce qualitatively the cleavage patterns obtained upon ultrasound irradiation of cis-platin-DNA complexes.

  6. Measuring Equilibrium Binding Constants for the WT1-DNA Interaction Using a Filter Binding Assay.


    Romaniuk, Paul J


    Equilibrium binding of WT1 to specific sites in DNA and potentially RNA molecules is central in mediating the regulatory roles of this protein. In order to understand the functional effects of mutations in the nucleic acid-binding domain of WT1 proteins and/or mutations in the DNA- or RNA-binding sites, it is necessary to measure the equilibrium constant for formation of the protein-nucleic acid complex. This chapter describes the use of a filter binding assay to make accurate measurements of the binding of the WT1 zinc finger domain to the consensus WT1-binding site in DNA. The method described is readily adapted to the measurement of the effects of mutations in either the WT1 zinc finger domain or the putative binding sites within a promoter element or cellular RNA.

  7. A filter microplate assay for quantitative analysis of DNA binding proteins using fluorescent DNA.


    Yang, William C; Swartz, James R


    We present a rapid method for quantifying the apparent DNA binding affinity and capacity of recombinant transcription factors (TFs). We capture His6-tagged TFs using nickel-nitrilotriacetic acid (Ni-NTA) agarose and incubate the immobilized TFs with fluorescently labeled cognate DNA probes. After washing, the strength of the fluorescence signal indicates the extent of DNA binding. The assay was validated using two pluripotency-regulating TFs: SOX2 and NANOG. Using competitive binding analysis with nonlabeled competitor DNA, we show that SOX2 and NANOG specifically bind to their consensus sequences. We also determined the apparent affinity of SOX2 and NANOG for their consensus sequences to be 54.2±9 and 44.0±6nM, respectively, in approximate agreement with literature values. Our assay does not require radioactivity, but radioactively labeling the TFs enables the measurement of absolute amounts of immobilized SOX2 and NANOG and, hence, a DNA-to-protein binding ratio. SOX2 possesses a 0.95 DNA-to-protein binding ratio, whereas NANOG possesses a 0.44 ratio, suggesting that most of the SOX2 and approximately half of the NANOG are competent for DNA binding. Alternatively, the NANOG dimer may be capable of binding only one DNA target. This flexible DNA binding assay enables the analysis of crude or purified samples with or without radioactivity.

  8. Consistent detection of Felis domesticus papillomavirus 2 DNA sequences within feline viral plaques.


    Munday, John S; Peters-Kennedy, Jeanine


    Viral plaques are well recognized skin lesions of cats. They are thought to be caused by papillomavirus infection; however, the causative papillomavirus is uncertain. In the current study, polymerase chain reaction using 2 consensus primer sets and 1 primer set specific for Felis domesticus papillomavirus 2 (FdPV-2) was used to amplify DNA from a series of 14 feline viral plaques. The FdPV-2 sequences were detected in all 14 viral plaques by the specific primers but in only 1 of 14 feline cutaneous trichoblastomas. Papillomavirus DNA was amplified from 8 plaques using the consensus primers. Sequences from FdPV-2 were amplified using the consensus primers from 4 plaques. In addition, 3 plaques contained papillomavirus DNA sequences from Felis domesticus papillomavirus sequence MY1, and a previously unreported papillomavirus DNA sequence was amplified from 1 plaque. As FdPV-2 was consistently present within the plaques, this suggests that this papillomavirus is the likely etiologic agent. Feline viral plaques can undergo neoplastic transformation to Bowenoid in situ carcinomas (BISCs). As FdPV-2 DNA is frequently present within BISCs, this suggests that FdPV-2 induces viral plaque formation and then remains detectible after neoplastic transformation.

  9. Self-entanglement of long linear DNA vectors using transient non-B-DNA attachment points: a new concept for improvement of non-viral therapeutic gene delivery.


    Tolmachov, Oleg E


    The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II

  10. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.


    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng


    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  11. Molecular Genetic and Biochemical Characterization of the Vaccinia Virus I3 Protein, the Replicative Single-Stranded DNA Binding Protein

    PubMed Central

    Greseth, Matthew D.; Boyle, Kathleen A.; Bluma, Matthew S.; Unger, Bethany; Wiebe, Matthew S.; Soares-Martins, Jamaria A.; Wickramasekera, Nadi T.; Wahlberg, James


    Vaccinia virus, the prototypic poxvirus, efficiently and faithfully replicates its ∼200-kb DNA genome within the cytoplasm of infected cells. This intracellular localization dictates that vaccinia virus encodes most, if not all, of its own DNA replication machinery. Included in the repertoire of viral replication proteins is the I3 protein, which binds to single-stranded DNA (ssDNA) with great specificity and stability and has been presumed to be the replicative ssDNA binding protein (SSB). We substantiate here that I3 colocalizes with bromodeoxyuridine (BrdU)-labeled nascent viral genomes and that these genomes accumulate in cytoplasmic factories that are delimited by membranes derived from the endoplasmic reticulum. Moreover, we report on a structure/function analysis of I3 involving the isolation and characterization of 10 clustered charge-to-alanine mutants. These mutants were analyzed for their biochemical properties (self-interaction and DNA binding) and biological competence. Three of the mutant proteins, encoded by the I3 alleles I3-4, -5, and -7, were deficient in self-interaction and unable to support virus viability, strongly suggesting that the multimerization of I3 is biologically significant. Mutant I3-5 was also deficient in DNA binding. Additionally, we demonstrate that small interfering RNA (siRNA)-mediated depletion of I3 causes a significant decrease in the accumulation of progeny genomes and that this reduction diminishes the yield of infectious virus. PMID:22438556

  12. Nucleic acid sensing with enzyme-DNA binding protein conjugates cascade and simple DNA nanostructures.


    Aktas, Gülsen Betül; Skouridou, Vasso; Masip, Lluis


    A versatile and universal DNA sensing platform is presented based on enzyme-DNA binding protein tags conjugates and simple DNA nanostructures. Two enzyme conjugates were thus prepared, with horseradish peroxidase linked to the dimeric single-chain bacteriophage Cro repressor protein (HRP-scCro) and glucose oxidase linked to the dimeric headpiece domain of Escherichia coli LacI repressor protein (GOx-dHP), and used in conjunction with a hybrid ssDNA-dsDNA detection probe. This probe served as a simple DNA nanostructure allowing first for target recognition through its target-complementary single-stranded DNA (ssDNA) part and then for signal generation after conjugate binding on the double-stranded DNA (dsDNA) containing the specific binding sites for the dHP and scCro DNA binding proteins. The DNA binding proteins chosen in this work have different sequence specificity, high affinity, and lack of cross-reactivity. The proposed sensing system was validated for the detection of model target ssDNA from high-risk human papillomavirus (HPV16) and the limits of detection of 45, 26, and 21 pM were achieved using the probes with scCro/dHP DNA binding sites ratio of 1:1, 2:1, and 1:2, respectively. The performance of the platform in terms of limit of detection was comparable to direct HRP systems using target-specific oligonucleotide-HRP conjugates. The ratio of the two enzymes can be easily manipulated by changing the number of binding sites on the detection probe, offering further optimization possibilities of the signal generation step. Moreover, since the signal is obtained in the absence of externally added hydrogen peroxide, the described platform is compatible with paper-based assays for molecular diagnostics applications. Finally, just by changing the ssDNA part of the detection probe, this versatile nucleic acid platform can be used for the detection of different ssDNA target sequences or in a multiplex detection configuration without the need to change any of the

  13. Host Tissue and Glycan Binding Specificities of Avian Viral Attachment Proteins Using Novel Avian Tissue Microarrays

    PubMed Central

    Ambepitiya Wickramasinghe, Iresha N.; de Vries, Robert P.; Eggert, Amber M.; Wandee, Nantaporn; de Haan, Cornelis A. M.; Gröne, Andrea; Verheije, Monique H.


    The initial interaction between viral attachment proteins and the host cell is a critical determinant for the susceptibility of a host for a particular virus. To increase our understanding of avian pathogens and the susceptibility of poultry species, we developed novel avian tissue microarrays (TMAs). Tissue binding profiles of avian viral attachment proteins were studied by performing histochemistry on multi-species TMA, comprising of selected tissues from ten avian species, and single-species TMAs, grouping organ systems of each species together. The attachment pattern of the hemagglutinin protein was in line with the reported tropism of influenza virus H5N1, confirming the validity of TMAs in profiling the initial virus-host interaction. The previously believed chicken-specific coronavirus (CoV) M41 spike (S1) protein displayed a broad attachment pattern to respiratory tissues of various avian species, albeit with lower affinity than hemagglutinin, suggesting that other avian species might be susceptible for chicken CoV. When comparing tissue-specific binding patterns of various avian coronaviral S1 proteins on the single-species TMAs, chicken and partridge CoV S1 had predominant affinity for the trachea, while pigeon CoV S1 showed marked preference for lung of their respective hosts. Binding of all coronaviral S1 proteins was dependent on sialic acids; however, while chicken CoV S1 preferred sialic acids type I lactosamine (Gal(1-3)GlcNAc) over type II (Gal(1-4)GlcNAc), the fine glycan specificities of pigeon and partridge CoVs were different, as chicken CoV S1-specific sialylglycopolymers could not block their binding to tissues. Taken together, TMAs provide a novel platform in the field of infectious diseases to allow identification of binding specificities of viral attachment proteins and are helpful to gain insight into the susceptibility of host and organ for avian pathogens. PMID:26035584

  14. DNA polymerase having modified nucleotide binding site for DNA sequencing


    Tabor, S.; Richardson, C.


    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  15. DNA polymerase having modified nucleotide binding site for DNA sequencing


    Tabor, Stanley; Richardson, Charles


    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  16. Mechanochemical regulations of RPA's binding to ssDNA

    NASA Astrophysics Data System (ADS)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie


    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  17. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd


    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  18. Quantitative Determination of DNA-Ligand Binding Using Fluorescence Spectroscopy

    ERIC Educational Resources Information Center

    Healy, Eamonn F.


    The effective use of fluorescence spectroscopy for determining the binding of the intercalcating agent crhidium bromide to DNA is being described. The analysis used simple measurement techniques and hence can be easily adopted by the students for a better understanding.

  19. A molecular modeling study of inhibitors of nuclear factor kappa-B (p50) DNA binding

    NASA Astrophysics Data System (ADS)

    Pande, Vineet; Sharma, Rakesh K.; Inoue, Jun-Ichiro; Otsuka, Masami; Ramos, Maria J.


    Nuclear Factor-kappa B (NF-κB) is an inducible transcription factor of the Rel family, and is sequestered in the cytoplasm by the IκB family of proteins. NF-κB can exist in several dimeric forms, but the p50/p65 heterodimer is the predominant one. Activation of NF-κB by a range of stimuli including viral products, and oxidative stress, leads to phosphorylation and proteasome dependent degradation of IκB, leading to the release of free NF-κB. This free NF-κB then binds to its target sites (κB sites in the DNA) to initiate transcription. These κB sites are also present in the Long Terminal Repeat (LTR) of HIV-1, and hence NF-κB (p50 subunit) binding to LTR-DNA is critical in viral replication. Targeting direct p50-DNA binding, in this regard, is a novel approach to design anti-HIV gene expression inhibitors, which do not have the problem of resistance unlike in other anti-HIV strategies. The present study is a part of our search for leads for the specific inhibition of p50-DNA binding. We have been experimentally studying different types of these inhibitors, and in this work, we attempted to get a common definition of their structural mechanism onto p50-DNA binding. Using three different classes of inhibitors, we modelled their association with the DNA-Binding Region (DBR) of the p50 subunit of NF-κB. Docking studies were carried out using a genetic algorithm based program (GOLD). Further, to compare electrostatic complementarity in the association of the inhibitors with the DBR, Molecular Electrostatic Potentials (MEPs) were generated for the DBR and each inhibitor. The results of docking revealed a strong network of hydrogen bonding interactions for every active inhibitor, and the contrary for the less active ones. Further, the MEPs revealed that the DBR of p50 represents a surface of electropositive potential, and the active inhibitors represent a complementary electronegative surface. With the present modelling study we conclude that the principal

  20. A molecular modeling study of inhibitors of nuclear factor kappa-B (p50)--DNA binding.


    Pande, Vineet; Sharma, Rakesh K; Inoue, Jun-Ichiro; Otsuka, Masami; Ramos, Maria J


    Nuclear Factor-kappa B (NF-kappaB) is an inducible transcription factor of the Rel family, and is sequestered in the cytoplasm by the IkappaB family of proteins. NF-kappaB can exist in several dimeric forms, but the p50/p65 heterodimer is the predominant one. Activation of NF-kappaB by a range of stimuli including viral products, and oxidative stress, leads to phosphorylation and proteasome dependent degradation of IkappaB, leading to the release of free NF-kappaB. This free NF-kappaB then binds to its target sites (KB sites in the DNA) to initiate transcription. These kappaB sites are also present in the Long Terminal Repeat (LTR) of HIV-1, and hence NF-kappaB (p50 subunit) binding to LTR-DNA is critical in viral replication. Targeting direct p50-DNA binding, in this regard, is a novel approach to design anti-HIV gene expression inhibitors, which do not have the problem of resistance unlike in other anti-HIV strategies. The present study is a part of our search for leads for the specific inhibition of p50-DNA binding. We have been experimentally studying different types of these inhibitors, and in this work, we attempted to get a common definition of their structural mechanism onto p50-DNA binding. Using three different classes of inhibitors, we modelled their association with the DNA-Binding Region (DBR) of the p50 subunit of NF-kappaB. Docking studies were carried out using a genetic algorithm based program (GOLD). Further, to compare electrostatic complementarity in the association of the inhibitors with the DBR, Molecular Electrostatic Potentials (MEPs) were generated for the DBR and each inhibitor. The results of docking revealed a strong network of hydrogen bonding interactions for every active inhibitor, and the contrary for the less active ones. Further, the MEPs revealed that the DBR of p50 represents a surface of electropositive potential, and the active inhibitors represent a complementary electronegative surface. With the present modelling study we

  1. Nitropyrene: DNA binding and adduct formation in respiratory tissues.

    PubMed Central

    Jackson, M A; King, L C; Ball, L M; Ghayourmanesh, S; Jeffrey, A M; Lewtas, J


    Binding of 1-nitro (14C)pyrene (NP) or its metabolites to cellular DNA and protein in cultures of rabbit alveolar macrophages, lung tissue, and tracheal tissue was examined. DNA binding in tracheal tissue (136 +/- 18.3 pmole NP/mg DNA) was four to five times the levels measured in either lung tissue (38 +/- 9.4 pmole NP/mg DNA) or macrophages (26 +/- 7.5 pmole NP/mg DNA). Adduct analysis of DNA isolated from lung tissue incubated with 1-nitro[H3]pyrene in vitro resulted in the identification of 2 to 5% of the NP adducts as C8-deoxyguanosine 1-aminopyrene. NP was also bound to cellular protein in tracheal tissue and lung tissue, and at a lower level in macrophages. Cocultivation of the macrophages with lung and tracheal tissue decreased the DNA binding in tracheal tissue by 45%. Following intratracheal instillation of diesel particles (5 mg) vapor-coated with 14C-NP (380 ppm, 0.085 muCi/mg) particles into rats, 5-8% of the radioactivity remained in the lungs after 20 hr. Most of the diesel particles were also deposited in the lung. Examination of DNA and protein binding in this tissue showed 5 to 12% of the pulmonary 14C bound to protein and no detectable levels of 14C bound to DNA. PMID:3841313

  2. Structural basis for DNA binding by replication initiator Mcm10

    SciTech Connect

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin; Greer, Briana; Bielinsky, Anja-Katrin; Chazin, Walter J.; Eichman, Brandt F.


    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae result in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.

  3. Structural framework for DNA translocation via the viral portal protein

    PubMed Central

    Lebedev, Andrey A; Krause, Margret H; Isidro, Anabela L; Vagin, Alexei A; Orlova, Elena V; Turner, Joanne; Dodson, Eleanor J; Tavares, Paulo; Antson, Alfred A


    Tailed bacteriophages and herpesviruses load their capsids with DNA through a tunnel formed by the portal protein assembly. Here we describe the X-ray structure of the bacteriophage SPP1 portal protein in its isolated 13-subunit form and the pseudoatomic structure of a 12-subunit assembly. The first defines the DNA-interacting segments (tunnel loops) that pack tightly against each other forming the most constricted part of the tunnel; the second shows that the functional dodecameric state must induce variability in the loop positions. Structural observations together with geometrical constraints dictate that in the portal–DNA complex, the loops form an undulating belt that fits and tightly embraces the helical DNA, suggesting that DNA translocation is accompanied by a ‘mexican wave' of positional and conformational changes propagating sequentially along this belt. PMID:17363899

  4. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.


    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi


    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  5. Oligomerization of Baculovirus LEF-11 Is Involved in Viral DNA Replication

    PubMed Central

    Dong, Zhan-Qi; Hu, Nan; Zhang, Jun; Chen, Ting-Ting; Cao, Ming-Ya; Li, Hai-Qing; Lei, Xue-Jiao; Chen, Peng; Lu, Cheng; Pan, Min-Hui


    We have previously reported that baculovirus Bombyx mori nucleopolyhedrovirus (BmNPV) late expression factor 11 (lef-11) is associated with viral DNA replication and have demonstrated that it potentially interacts with itself; however, whether LEF-11 forms oligomers and the impact of LEF-11 oligomerization on viral function have not been substantiated. In this study, we first demonstrated that LEF-11 is capable of forming oligomers. Additionally, a series of analyses using BmNPV LEF-11 truncation mutants indicated that two distinct domains control LEF-11 oligomerization (aa 42–61 and aa 72–101). LEF-11 truncation constructs were inserted into a lef-11-knockout BmNPV bacmid, which was used to demonstrate that truncated LEF-11 lacking either oligomerization domain abrogates viral DNA replication. Finally, site-directed mutagenesis was used to determine that the conserved hydrophobic residues Y58&I59 (representing Y58 and I59), I85 and L88&L89 (representing L88 and L89) are required for LEF-11 oligomerization and viral DNA replication. Collectively, these data indicate that BmNPV LEF-11 oligomerization influences viral DNA replication. PMID:26660313

  6. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.


    Pessler, Frank; Hernandez, Nouria


    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  7. Isohelical DNA-Binding Oligomers: Antiviral Activity and Application for the Design of Nanostructured Devices

    NASA Astrophysics Data System (ADS)

    Gursky, Georgy; Nikitin, Alexei; Surovaya, Anna; Grokhovsky, Sergey; Andronova, Valeria; Galegov, Georgy

    We performed a systematic search for new structural motifs isohelical to double-stranded DNA and found five motifs that can be used for the design and synthesis of new DNA-binding oligomers. Some of the DNA-binding oligomers can be equipped with fluorescence chromophores and metal-chelating groups and may serve as conductive wires in nano-scaled electric circuits. A series of new DNA-binding ligands were synthesized by a modular assembly of pyrrole carboxamides and novel pseudopeptides of the form (XY)n. Here, Y is a glycine residue; n is the degree of polymerization. X is an unusual amino acid residue containing a five-membered aromatic ring. Antiviral activity of bis-linked netropsin derivatives is studied. Bis-netropsins containing 15 and 31 lysine residues at the N-termini inhibit most effectively reproduction of the herpes virus type 1 in the Vero cell culture, including virus variants resistant to acyclovir and its analogues. Antiviral activity of bis-linked netropsin derivatives is correlated with their ability to interact with long clusters of AT-base pairs in the origin of replication of the viral DNA.

  8. Thermodynamics of cationic lipid binding to DNA and DNA condensation: roles of electrostatics and hydrophobicity.


    Matulis, Daumantas; Rouzina, Ioulia; Bloomfield, Victor A


    Alkylammonium binding to DNA was studied by isothermal titration calorimetry. Experimental data, obtained as functions of alkyl chain length, salt concentration, DNA concentration, and temperature, provided a detailed thermodynamic description of lipid-DNA binding reactions leading to DNA condensation. Lipid binding, counterion displacement, and DNA condensation were highly cooperative processes, driven by a large increase in entropy and opposed by a relatively small endothermic enthalpy at room temperature. Large negative heat capacity change indicated a contribution from hydrophobic interactions between aliphatic tails. An approximation of lipid-DNA binding as dominated by two factors-ionic and hydrophobic interactions-yielded a model that was consistent with experimental data. Chemical group contributions to the energetics of binding were determined and could be used to predict energetics of other lipid binding to DNA. Electrostatic and hydrophobic contributions to Gibbs free energy, enthalpy, entropy, and heat capacity could be distinguished by applying additivity principles. Binding of lipids with two, three, and four aliphatic tails was investigated and compared to single-tailed lipid binding. Structurally, the model suggests that lipid cationic headgroups and aliphatic tails distribute evenly and lay down on DNA surface without the formation of micelles.

  9. ssDNA binding reveals the atomic structure of graphene.


    Husale, By Sudhir; Sahoo, Sangeeta; Radenovic, Aleksandra; Traversi, Floriano; Annibale, Paolo; Kis, Andras


    We used AFM to investigate the interaction of polyelectrolytes such as ssDNA and dsDNA molecules with graphene as a substrate. Graphene is an appropriate substrate due to its planarity, relatively large surfaces that are detectable via an optical microscope, and straightforward identification of the number of layers. We observe that in the absence of the screening ions deposited ssDNA will bind only to the graphene and not to the SiO(2) substrate, confirming that the binding energy is mainly due to the π-π stacking interaction. Furthermore, deposited ssDNA will map the graphene underlying structure. We also quantify the π-π stacking interaction by correlating the amount of deposited DNA with the graphene layer thickness. Our findings agree with reported electrostatic force microscopy (EFM) measurements. Finally, we inspected the suitability of using a graphene as a substrate for DNA origami-based nanostructures.

  10. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P


    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  11. The Paradoxical Effects of Different Hepatitis C Viral Loads on Host DNA Damage and Repair Abilities

    PubMed Central

    Li, Chia-Yang; Chiang, Chi-Shiun; Yu, Guann-Yi; Sakamoto, Naoya; Tu, Wen-Yu; Hsieh, Meng-Hsuan; Huang, Jee-Fu; Chuang, Wan-Long; Dai, Chia-Yen


    Hepatitis C virus (HCV)-induced hepatic stress is associated with increased oxidative DNA damage and has been implicated in hepatic inflammation. However, HCV infection and replication are uneven and vary among individual hepatocytes. To investigate the effect of the viral load on host DNA damage, we used an Enhanced Yellow Fluorescent Protein gene (EYFP)-tagged HCV virus to distinguish between HCV intracellular high viral load (HVL) cells and low viral load (LVL) cells. The cell sorting efficiency was confirmed by the high expression of the HCV polyprotein. We found DNA damage γ-H2AX foci in the HVL population. Comet assays demonstrated that HVL was related to the extent of the DNA strand breaks. Surprisingly, the DNA qPCR arrays and western blotting showed that the damage-related genes GPX2, MRE11, phospho-ATM, and OGG1 were significantly up-regulated in LVL cells but inversely down-regulated or consistently expressed in HVL cells. The colony survival assay to examine the repair abilities of these cells in response to irradiation showed that the LVL cells were more resistant to irradiation and had an increased ability to repair radiation-induced damage. This study found that intracellular viral loads drove cellular DNA damage levels but suppressed damage-related gene expression. However, the increase in damage-related gene expression in the LVL cells may be affected by ROS from the HVL cells. These findings provide new insights into the distinct DNA damage and repair responses resulting from different viral loads in HCV-infected cells. PMID:28052067

  12. The Paradoxical Effects of Different Hepatitis C Viral Loads on Host DNA Damage and Repair Abilities.


    Wang, Shu-Chi; Lai, Kuan-Ru; Li, Chia-Yang; Chiang, Chi-Shiun; Yu, Guann-Yi; Sakamoto, Naoya; Tu, Wen-Yu; Hsieh, Meng-Hsuan; Huang, Jee-Fu; Chuang, Wan-Long; Dai, Chia-Yen; Yu, Ming-Lung


    Hepatitis C virus (HCV)-induced hepatic stress is associated with increased oxidative DNA damage and has been implicated in hepatic inflammation. However, HCV infection and replication are uneven and vary among individual hepatocytes. To investigate the effect of the viral load on host DNA damage, we used an Enhanced Yellow Fluorescent Protein gene (EYFP)-tagged HCV virus to distinguish between HCV intracellular high viral load (HVL) cells and low viral load (LVL) cells. The cell sorting efficiency was confirmed by the high expression of the HCV polyprotein. We found DNA damage γ-H2AX foci in the HVL population. Comet assays demonstrated that HVL was related to the extent of the DNA strand breaks. Surprisingly, the DNA qPCR arrays and western blotting showed that the damage-related genes GPX2, MRE11, phospho-ATM, and OGG1 were significantly up-regulated in LVL cells but inversely down-regulated or consistently expressed in HVL cells. The colony survival assay to examine the repair abilities of these cells in response to irradiation showed that the LVL cells were more resistant to irradiation and had an increased ability to repair radiation-induced damage. This study found that intracellular viral loads drove cellular DNA damage levels but suppressed damage-related gene expression. However, the increase in damage-related gene expression in the LVL cells may be affected by ROS from the HVL cells. These findings provide new insights into the distinct DNA damage and repair responses resulting from different viral loads in HCV-infected cells.

  13. Subgenomic viral DNA species synthesized in simian cells by human and simian adenoviruses.

    PubMed Central

    Daniell, E


    DNA synthesized after infection of simian tissue culture cells (BSC-1 or CV-1) with human adenovirus type 2 or 5 or with simian adenovirus 7 was characterized. It was demonstrated that as much as 40% of the virus-specific DNA in nuclei of infected monkey cells consists of subgenomic pieces. No subgenomic viral DNA species were detected in the nuclei of human (HeLa) cells infected with these adenovirus types. Restriction analysis showed that these short viral DNA molecules contain normal amounts of the sequences from the ends of the viral genome, whereas internal regions are underrepresented. The production of subgenomic DNAs is not correlated with semipermissive infection. Although adenovirus types 2 and 5 are restricted in monkey cells, these cells are fully permissive for simian adenovirus 7. HR404, an adenovirus type 5 mutant which is not restricted in monkey cells, produced the same percentage of subgenomic DNAs as did its wild type (restricted) parent, and coinfection of monkey cells with adenovirus type 5 DNAs. The array of predominant size classes among the heterogeneously sized short DNAs is serotype specific. Extensive plaque purification and comparison of wild-type adenovirus type 5 with several viral mutants indicated that the distribution of aberrant sizes of DNA is characteristic of the virus and not a result of random replicative errors and then enrichment of particular species. Images PMID:6261009

  14. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.


    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang


    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  15. Defining a minimal estrogen receptor DNA binding domain.

    PubMed Central

    Mader, S; Chambon, P; White, J H


    The estrogen receptor (ER) is a transcriptional regulator which binds to cognate palindromic DNA sequences known as estrogen response elements (EREs). A 66 amino acid core region which contains two zinc fingers and is highly conserved among the nuclear receptors is essential for site specific DNA recognition. However, it remains unclear how many flanking amino acids in addition to the zinc finger core are required for DNA binding. Here, we have characterized the minimal DNA binding region of the human ER by analysing the DNA binding properties of a series of deletion mutants expressed in bacteria. We find that the 66 amino acid zinc finger core of the DBD fails to bind DNA, and that the C-terminal end of the minimal ER DBD required for binding to perfectly palindromic EREs corresponds to the limit of 100% amino acid homology between the chicken and human receptors, which represents the boundary between regions C and D in the ER. Moreover, amino acids of region D up to 30 residues C-terminal to the zinc fingers greatly stabilize DNA binding by the DBD to perfectly palindromic EREs and are absolutely required for formation of gel retardation complexes by the DBD on certain physiological imperfectly palindromic EREs. These results indicate that in addition to the zinc finger core, amino acids C-terminal to the core in regions C and D play a key role in DNA binding by the ER, particularly to imperfectly palindromic response elements. The ER DBD expressed in E. coli binds as a dimer to ERE palindromes in a highly cooperative manner and forms only low levels of monomeric protein-DNA complexes on either palindromic or half-palindromic response elements. Conversion of ER amino acids 222 to 226, which lie within region C, to the corresponding residues of the human RAR alpha abolishes formation of dimeric protein-DNA complexes. Conversely, replacement of the same region of RAR alpha with ER residues 222 to 226 creates a derivative that, unlike the RAR alpha DBD, binds

  16. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence.


    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J Pedro; Carrondo, Maria A; McVey, Colin E; Kaye, Kenneth M


    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes.

  17. DNA Conforming Dynamics and Protein Binding

    DTIC Science & Technology


    spectroscopy". We repeat this Introduction here for completeness. The Watson - Crick double- helix is the thermodynamically stable configuration of a DNA ...molecule under physiological conditions (normal salt and room/body temperature). This stability is effected (a) by Watson - Crick H-bonding, that is...contribution to DNA helix stability comes from base-stacking between neighboring base pairs: through hydrophobic interactions between the planar aromatic

  18. Potency of carcinogens derived from covalent DNA binding and stimulation of DNA synthesis in rat liver

    SciTech Connect

    Lutz, W.K.; Buesser, M.T.; Sagelsdorff, P.


    In order to investigate the role of the stimulation of cell division for the initiation (and possibly promotion) of liver tumors by chemical carcinogens, the incorporation of radiolabelled thymidine into liver DNA was determined in male rats. Single doses of various levels of aflatoxin B1, benzidine and carbon tetrachloride (all known to be genotoxic via DNA binding) did not affect cell division, whereas several hepatocarcinogens known not to bind to DNA (alpha-HCH, clofibrate, and 2,3,7,8-tetrachlorodibenzo-p-dioxin) gave rise to a dose-dependent stimulation of liver DNA synthesis within 24 h. An equation combining the influences of mitotic stimulation, expressed as dose required to double the control level of DNA synthesis, and DNA binding potency, expressed as the Covalent Binding Index, correlated well with the carcinogenic potency for both classes of hepatocarcinogens.

  19. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.


    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  20. DNA-binding properties of ARID family proteins

    PubMed Central

    Patsialou, Antonia; Wilsker, Deborah; Moran, Elizabeth


    The ARID (A–T Rich Interaction Domain) is a helix–turn–helix motif-based DNA-binding domain, conserved in all eukaryotes and diagnostic of a family that includes 15 distinct human proteins with important roles in development, tissue-specific gene expression and proliferation control. The 15 human ARID family proteins can be divided into seven subfamilies based on the degree of sequence identity between individual members. Most ARID family members have not been characterized with respect to their DNA-binding behavior, but it is already apparent that not all ARIDs conform to the pattern of binding AT-rich sequences. To understand better the divergent characteristics of the ARID proteins, we undertook a survey of DNA-binding properties across the entire ARID family. The results indicate that the majority of ARID subfamilies (i.e. five out of seven) bind DNA without obvious sequence preference. DNA-binding affinity also varies somewhat between subfamilies. Site-specific mutagenesis does not support suggestions made from structure analysis that specific amino acids in Loop 2 or Helix 5 are the main determinants of sequence specificity. Most probably, this is determined by multiple interacting differences across the entire ARID structure. PMID:15640446

  1. Protein-DNA binding in high-resolution

    PubMed Central

    Mahony, Shaun; Pugh, B. Franklin


    Recent advances in experimental and computational methodologies are enabling ultra-high resolution genome-wide profiles of protein-DNA binding events. For example, the ChIP-exo protocol precisely characterizes protein-DNA crosslinking patterns by combining chromatin immunoprecipitation (ChIP) with 5′ → 3′ exonuclease digestion. Similarly, deeply sequenced chromatin accessibility assays (e.g. DNase-seq and ATACseq) enable the detection of protected footprints at protein-DNA binding sites. With these techniques and others, we have the potential to characterize the individual nucleotides that interact with transcription factors, nucleosomes, RNA polymerases, and other regulatory proteins in a particular cellular context. In this review, we explain the experimental assays and computational analysis methods that enable high-resolution profiling of protein-DNA binding events. We discuss the challenges and opportunities associated with such approaches. PMID:26038153

  2. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment.


    Kennedy, Edward M; Cullen, Bryan R


    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  3. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    PubMed Central

    Kennedy, Edward M.; Cullen, Bryan R.


    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  4. Nucleocytoplasmic Shuttling of Bovine Papillomavirus E1 Helicase Downregulates Viral DNA Replication in S Phase▿

    PubMed Central

    Hsu, Chiung-Yueh; Mechali, Francisca; Bonne-Andrea, Catherine


    The papillomavirus E1 protein is essential for the initiation of viral replication. We previously showed that the bovine papillomavirus E1 protein is unstable and becomes resistant to ubiquitin-mediated degradation when tightly bound to cyclin E-cyclin-dependent kinase 2 (Cdk2) before the start of DNA synthesis. However, neither the protection nor the targeted degradation of E1 appears to depend on its phosphorylation by Cdk. Here, we report that Cdk phosphorylation of E1 is also not a prerequisite for the initiation of viral DNA replication either in vitro or in vivo. Nevertheless, we found that phosphorylation of one Cdk site, Ser283, abrogates E1 replicative activity only in a cellular context. We show that this site-specific phosphorylation of E1 drives its export from the nucleus and promotes its continuous nucleocytoplasmic shuttling. In addition, we find that E1 shuttling occurs in S phase, when cyclin A-Cdk2 is activated. E1 interacts with the active cyclin A-Cdk2 complex and is phosphorylated on Ser283 by this kinase. These data suggest that the phosphorylation of E1 on Ser283 is a negative regulatory event that is involved in preventing the amplification of viral DNA during S phase. This finding reveals a novel facet of E1 regulation that could account for the variations of the viral replication capacity during different cell cycle phases, as well as in different stages of the viral cycle. PMID:17035309

  5. DNA binding, DNA cleavage, and cytotoxicity studies of two new copper (II) complexes.


    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Roshanfekr, Hamideh; Shahabadi, Nahid; Rezvani, Alireza; Mansouri, Ghobad


    The DNA binding behavior of [Cu(phen)(phen-dione)Cl]Cl (1) and [Cu(bpy)(phen-dione)Cl]Cl (2) was studied with a series of techniques including UV-vis absorption, circular dichroism spectroscopy, and viscometric methods. Cytotoxicity effect and DNA unwinding properties were also investigated. The results indicate that the Cu(II) complexes interact with calf-thymus DNA by both partially intercalative and hydrogen binding. These findings have been further substantiated by the determination of intrinsic binding constants spectrophotometrically, 12.5 × 10(5) and 5 × 10(5) for 1 and 2, respectively. Our findings suggest that the type of ligands and structure of complexes have marked effect on the binding affinity of complexes involving CT-DNA. Circular dichroism results show that complex 1 causes considerable increase in base stacking of DNA, whereas 2 decreases the base stacking, which is related to more extended aromatic area of 1,10-phenanthroline in 1 rather than bipyridine in 2. Slow decrease in DNA viscosity indicates partially intercalative binding in addition to hydrogen binding on the surface of DNA. The second binding mode was also confirmed by additional tests: interaction in denaturation condition and acidic pH. Also, these new complexes induced cleavage in pUC18 plasmid DNA as indicated in gel electrophoresis and showed excellent antitumor activity against K562 (human chronic myeloid leukemia) cells.

  6. Structure-based Analysis to Hu-DNA Binding

    SciTech Connect

    Swinger,K.; Rice, P.


    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  7. Structure-based analysis of HU-DNA binding.


    Swinger, Kerren K; Rice, Phoebe A


    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from approximately 10-14.5 kcal/mol, representing K(d) values in the nanomolar to low picomolar range, and a maximum stabilization of at least approximately 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  8. Purified JC virus T antigen derived from insect cells preferentially interacts with binding site II of the viral core origin under replication conditions.


    Bollag, B; Mackeen, P C; Frisque, R J


    The human polyomavirus JC virus (JCV) establishes persistent, asymptomatic infections in most individuals, but in severely immunocompromised hosts it may cause the fatal demyelinating brain disease progressive multifocal leukoencephalopathy. In cell culture JCV multiplies inefficiently and exhibits a narrow host range. This restricted behavior occurs, in part, at the level of DNA replication, which is regulated by JCV's multifunctional large tumor protein (TAg). To prepare purified JCV TAg (JCT) for biochemical analyses, the recombinant baculovirus B-JCT was generated by cotransfection of insect cells with wild-type baculovirus and the vector pVL-JCT(Int-) containing the JCT-coding sequence downstream of the efficient polyhedrin promoter. JCT expressed in infected cells was immunoaffinity purified using the anti-JCT monoclonal antibody PAb 2000. Characterization of the viral oncoprotein indicated that it exists in solution as a mixture of monomeric and oligomeric species. With the addition of ATP, the population of monomers decreased and that of hexamers and double hexamers increased. A DNA mobility shift assay indicated that origin binding occurred primarily with the double-hexamer form. A comparison of the specific DNA-binding activities of JCT and SV40 TAg (SVT) revealed that JCT generally exhibited greater affinity for binding site II relative to binding site I (B.S. I) of both viral origin regions, whereas SVT preferentially bound B.S. I. Furthermore, JCT bound nonviral DNA more efficiently than did SVT. These functional differences between the two TAgs may contribute to the reduced DNA replication potential of JCV in vitro, and to the virus' ability to establish persistent infections in vivo.

  9. Effects of DNA-binding drugs on T4 DNA ligase.

    PubMed Central

    Montecucco, A; Pedrali-Noy, G; Spadari, S; Lestingi, M; Ciarrocchi, G


    A number of DNA intercalating and externally binding drugs have been found to inhibit nick sealing, cohesive and blunt end ligation, AMP-dependent DNA topoisomerization and EDTA-induced DNA nicking mediated by bacteriophage T4 DNA ligase. The inhibition seems to arise from drug-substrate interaction so that formation of active DNA-Mg2(+)-AMP-enzyme complex is impaired while assembled and active complexes are not disturbed by drug binding to the substrate. Images Fig. 2. Fig. 4. Fig. 5. PMID:2156493

  10. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  11. Sendai virus assembly: M protein binds to viral glycoproteins in transit through the secretory pathway.

    PubMed Central

    Sanderson, C M; McQueen, N L; Nayak, D P


    We have examined the relative ability of Sendai virus M (matrix) protein to associate with membranes containing viral glycoproteins at three distinct stages of the exocytic pathway prior to cell surface appearance. By the use of selective low-temperature incubations or the ionophore monensin, the transport of newly synthesized viral glycoproteins was restricted to either the pre-Golgi intermediate compartment (by incubation at 15 degrees C), the medial Golgi (in the presence of monensin), or the trans-Golgi network (by incubation at 20 degrees C). All three of these treatments resulted in a marked accumulation of the M protein on perinuclear Golgi-like membranes which in each case directly reflected the distribution of the viral F protein. Subsequent redistribution of the F protein to the plasma membrane by removal of the low-temperature (20 degrees C) block resulted in a concomitant redistribution of the M protein, thus implying association of the two components during intracellular transit. The extent of M protein-glycoprotein association was further examined by cell fractionation studies performed under each of the three restrictive conditions. Following equilibrium sedimentation of membranes derived from monensin-treated cells, approximately 40% of the recovered M protein was found to cofractionate with membranes containing the viral glycoproteins. Also, by flotation analyses, a comparable subpopulation of M protein was found to be membrane associated whether viral glycoproteins were restricted to the trans-Golgi network, the medial Golgi, or the pre-Golgi intermediate compartment. Additionally, transient expression of M protein alone from cloned cDNA showed that neither membrane association nor Golgi localization occurs in the absence of Sendai virus glycoproteins. Images PMID:8380460

  12. Viral hemorrhagic fevers of animals caused by DNA viruses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we outline serious diseases of food and fiber animals that cause damaging economic effects on producers all over the world. The only vector-borne DNA virus is included here (i.e., African swine fever virus), and the herpesviruses discussed have a complex epidemiology characterized by outbreaks ...

  13. Viral hemorrhagic fevers of animals caused by DNA viruses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we outline serious diseases of food and fiber animals that cause damaging economic effect on products all over the world. The only vector-borne DNA virus is included here, such as African swine fever virus, and the herpes viruses discussed have a complex epidemiology characterized by outbreak...

  14. Impact of DNA vector topology on non-viral gene therapeutic safety and efficacy.


    Sum, Chi H; Wettig, Shawn; Slavcev, Roderick A


    Gene therapy continues to grow as an emerging treatment strategy toward numerous diseases. However, such prospects are hindered by the use of viral vectors prompting significant safety concerns along with limitations concerning repeat administrations, size of delivered gene construct, scale-up, high production costs, contamination during production, and lack of desired tissue selectivity. Non-viral gene delivery demonstrates the potential to address the abovementioned limitations, but itself generally suffers from low efficacy. Continuing efforts have been made to develop innovative delivery systems, synthetic gene carriers, and DNA vectors in a concerted attempt to enhance gene delivery suitable for clinical applications. In this review, we focus on the advances in the design of novel DNA vectors catered to enhance transfection and transgene expression and their influences on the efficacy and safety of existing and emerging delivery systems and synthetic vectors for non viral gene delivery.

  15. Genetic Determinants of Symptoms on Viral DNA Satellites ▿

    PubMed Central

    Ding, Chenjun; Qing, Ling; Li, Zhenghe; Liu, Yi; Qian, Yajuan; Zhou, Xueping


    Begomovirus-DNA-β disease complexes induce different symptom phenotypes in their hosts. To investigate the genetic determinants of the phenotypic differences, Nicotiana spp. and tomato plants were inoculated with infectious clones of Tobacco curly shoot virus (TbCSV)/TbCSV DNA-β (TbCSB) and Tomato yellow leaf curl China virus (TYLCCNV)/TYLCCNV DNA-β (TYLCCNB) pseudorecombinants and showed that TYLCCNB induced characteristic vein-thickening and enation symptoms, while TbCSB only slightly exacerbated the leaf-curling symptoms, regardless of the helper virus being used. The roles of DNA-β-encoded βC1 and a 430-nucleotide fragment containing the A-rich region and the putative βC1 promoter region of the βC1 gene (referred to as AP) in symptom development were further investigated by constructing hybrid satellites in which the βC1 coding region or AP was exchanged between the two satellite molecules. A TYLCCNB hybrid with TbCSB βC1 lost the ability to elicit the vein-thickening and enation phenotypes. TbCSB hybrids containing the TYLCCNB βC1 or AP fragment failed to induce the characteristic vein thickening and enations. A TYLCCNB hybrid having the TbCSB AP fragment produced the enations, but the number of enations was less and their sizes were reduced. Differently from the phloem-specific pattern of the TYLCCNB promoter, a full-length fragment upstream of the TbCSB βC1 gene confers a constitutive β-glucuronidase expression pattern in transgenic tobacco plants. The above results indicate that the DNA-β-encoded βC1 protein is the symptom determinant, but the promoter of the βC1 gene has influence on symptom production. PMID:19542327

  16. Novel DNA-binding properties of the RNA-binding protein TIAR.


    Suswam, Esther A; Li, Yan Yan; Mahtani, Harry; King, Peter H


    TIA-1 related protein binds avidly to uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes, including interleukin (IL)-8 and vascular endothelial growth factor (VEGF). The protein has diverse regulatory roles, which in part depend on the locus of binding within the transcript, including translational control, splicing and apoptosis. Here, we observed selective and potent inhibition of TIAR-RNP complex formation with IL-8 and VEGF 3'-untranslated regions (3'-UTRs) using thymidine-rich deoxyoligonucleotide (ODN) sequences derived from the VEFG 3'-UTR. We show by ultraviolet crosslinking and electrophoretic mobility shift assays that TIAR can bind directly to single-stranded, thymidine-rich ODNs but not to double-stranded ODNs containing the same sequence. TIAR had a nearly 6-fold greater affinity for DNA than RNA (K(d)app = 1.6x10(-9) M versus 9.4 x 10(-9) M). Truncation of TIAR indicated that the high affinity DNA-binding site overlaps with the RNA-binding site involving RNA recognition motif 2 (RRM2). However, RRM1 alone could also bind to DNA. Finally, we show that TIAR can be displaced from single-stranded DNA by active transcription through the binding site. These results provide a potential mechanism by which TIAR can shuttle between RNA and DNA ligands.

  17. Viral nanomotors for packaging of dsDNA and dsRNA

    PubMed Central

    Guo, Peixuan; Lee, Tae Jin


    While capsid proteins are assembled around single-stranded genomic DNA or RNA in rod-shaped viruses, the lengthy double-stranded genome of other viruses is packaged forcefully within a preformed protein shell. This entropically unfavourable DNA or RNA packaging is accomplished by an ATP-driven viral nanomotor, which is mainly composed of two components, the oligomerized channel and the packaging enzymes. This intriguing DNA or RNA packaging process has provoked interest among virologists, bacteriologists, biochemists, biophysicists, chemists, structural biologists and computational scientists alike, especially those interested in nanotechnology, nanomedicine, AAA+ family proteins, energy conversion, cell membrane transport, DNA or RNA replication and antiviral therapy. This review mainly focuses on the motors of double-stranded DNA viruses, but double-stranded RNA viral motors are also discussed due to interesting similarities. The novel and ingenious configuration of these nanomotors has inspired the development of biomimetics for nanodevices. Advances in structural and functional studies have increased our understanding of the molecular basis of biological movement to the point where we can begin thinking about possible applications of the viral DNA packaging motor in nanotechnology and medical applications. PMID:17501915

  18. Evaluation of the presence of equine viral herpesvirus 1 (EHV-1) and equine viral herpesvirus 4 (EHV-4) DNA in stallion semen using polymerase chain reaction (PCR).


    Hebia-Fellah, Imen; Léauté, Anne; Fiéni, Francis; Zientara, Stéphan; Imbert-Marcille, Berthe-Marie; Besse, Bernard; Fortier, Guillaume; Pronost, Stephane; Miszczak, Fabien; Ferry, Bénédicte; Thorin, Chantal; Pellerin, Jean-Louis; Bruyas, Jean-François


    In the horse, the risk of excretion of two major equine pathogens (equine herpesvirus types 1 (EHV-1) and 4 (EHV-4)) in semen is unknown. The objective of our study was to assess the possible risks for the horizontal transmission of equine rhinopneumonitis herpesviruses via the semen and the effect of the viruses on stallion fertility. Samples of stallion semen (n=390) were gathered from several different sources. Examination of the semen involved the detection of viral DNA using specific PCR. The mean fertility of the stallions whose sperm tested positive for viral DNA and the mean fertility of stallions whose sperm did not contain viral DNA, were compared using the Student's t-test. EHV-4 viral DNA was not detected in any of the semen samples. EHV-1 DNA was identified in 51 of the 390 samples, (13%). One hundred and eighty-two samples came from 6 studs and there was significant difference (p<0.05) among the proportion of stallions whose semen tested positive for viral DNA from 0 to 55% between the studs. There was a significant difference (p<0.014) between the fertility of stallions whose semen tested positive for viral DNA and those whose semen was free from viral DNA. The stallions that excreted the EHV-1 virus in their semen appeared to be more fertile than the non-excretors, but this difference was in fact related to the breeding technique since higher proportion of excretors were found among those whose semen was used fresh rather than preserved by cooling or freezing. In conclusion, this study suggests that the EHV-1 virus may be transmitted via the semen at mating or by artificial insemination as demonstrated with other herpes viruses in other species.

  19. High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein.


    Morten, Michael J; Gamsjaeger, Roland; Cubeddu, Liza; Kariawasam, Ruvini; Peregrina, Jose; Penedo, J Carlos; White, Malcolm F


    Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.

  20. Dynamics of nucleosome invasion by DNA binding proteins.


    Tims, Hannah S; Gurunathan, Kaushik; Levitus, Marcia; Widom, Jonathan


    Nucleosomes sterically occlude their wrapped DNA from interacting with many large protein complexes. How proteins gain access to nucleosomal DNA target sites in vivo is not known. Outer stretches of nucleosomal DNA spontaneously unwrap and rewrap with high frequency, providing rapid and efficient access to regulatory DNA target sites located there; however, rates for access to the nucleosome interior have not been measured. Here we show that for a selected high-affinity nucleosome positioning sequence, the spontaneous DNA unwrapping rate decreases dramatically with distance inside the nucleosome. The rewrapping rate also decreases, but only slightly. Our results explain the previously known strong position dependence on the equilibrium accessibility of nucleosomal DNA, which is characteristic of both selected and natural sequences. Our results point to slow nucleosome conformational fluctuations as a potential source of cell-cell variability in gene activation dynamics, and they reveal the dominant kinetic path by which multiple DNA binding proteins cooperatively invade a nucleosome.

  1. Comparison of DNA extraction methods from small samples of newborn screening cards suitable for retrospective perinatal viral research.


    McMichael, Gai L; Highet, Amanda R; Gibson, Catherine S; Goldwater, Paul N; O'Callaghan, Michael E; Alvino, Emily R; MacLennan, Alastair H


    Reliable detection of viral DNA in stored newborn screening cards (NSC) would give important insight into possible silent infection during pregnancy and around birth. We sought a DNA extraction method with sufficient sensitivity to detect low copy numbers of viral DNA from small punch samples of NSC. Blank NSC were spotted with seronegative EDTA-blood and seropositive EBV EDTA-blood. DNA was extracted with commercial and noncommercial DNA extraction methods and quantified on a spectrofluorometer using a PicoGreen dsDNA quantification kit. Serial dilutions of purified viral DNA controls determined the sensitivity of the amplification protocol, and seropositive EBV EDTA-blood amplified by nested PCR (nPCR) validated the DNA extraction methods. There were considerable differences between the commercial and noncommercial DNA extraction methods (P=0.014; P=0.016). Commercial kits compared favorably, but the QIamp DNA micro kit with an added forensic filter step was marginally more sensitive. The mean DNA yield from this method was 3 ng/μl. The limit of detection was 10 viral genome copies in a 50-μl reaction. EBV nPCR detection in neat and 1:10 diluted DNA extracts could be replicated reliably. We conclude that the QIamp Micro DNA extraction method with the added forensic spin-filter step was suitable for retrospective DNA viral assays from NSC.

  2. Recombinant covalently closed circular hepatitis B virus DNA induces prolonged viral persistence in immunocompetent mice.


    Qi, Zhihua; Li, Gaiyun; Hu, Hao; Yang, Chunhui; Zhang, Xiaoming; Leng, Qibin; Xie, Youhua; Yu, Demin; Zhang, Xinxin; Gao, Yueqiu; Lan, Ke; Deng, Qiang


    It remains crucial to develop a laboratory model for studying hepatitis B virus (HBV) chronic infection. We hereby produced a recombinant covalently closed circular DNA (rcccDNA) in view of the key role of cccDNA in HBV persistence. A loxP-chimeric intron was engineered into a monomeric HBV genome in a precursor plasmid (prcccDNA), which was excised using Cre/loxP-mediated DNA recombination into a 3.3-kb rcccDNA in the nuclei of hepatocytes. The chimeric intron was spliced from RNA transcripts without interrupting the HBV life cycle. In cultured hepatoma cells, cotransfection of prcccDNA and pCMV-Cre (encoding Cre recombinase) resulted in accumulation of nuclear rcccDNA that was heat stable and epigenetically organized as a minichromosome. A mouse model of HBV infection was developed by hydrodynamic injection of prcccDNA. In the presence of Cre recombinase, rcccDNA was induced in the mouse liver with effective viral replication and expression, triggering a compromised T-cell response against HBV. Significant T-cell hyporesponsiveness occurred in mice receiving 4 μg prcccDNA, resulting in prolonged HBV antigenemia for up to 9 weeks. Persistent liver injury was observed as elevated alanine transaminase activity in serum and sustained inflammatory infiltration in the liver. Although a T-cell dysfunction was induced similarly, mice injected with a plasmid containing a linear HBV replicon showed rapid viral clearance within 2 weeks. Collectively, our study provides an innovative approach for producing a cccDNA surrogate that established HBV persistence in immunocompetent mice. It also represents a useful model system in vitro and in vivo for evaluating antiviral treatments against HBV cccDNA. Importance: (i) Unlike plasmids that contain a linear HBV replicon, rcccDNA established HBV persistence with sustained liver injury in immunocompetent mice. This method could be a prototype for developing a mouse model of chronic HBV infection. (ii) An exogenous intron was

  3. The herpes simplex virus 1 UL15 gene encodes two proteins and is required for cleavage of genomic viral DNA.

    PubMed Central

    Baines, J D; Poon, A P; Rovnak, J; Roizman, B


    Previous studies have shown that a ts mutant [herpes simplex virus 1 (mP)ts66.4] in the UL15 gene fails to package viral DNA into capsids (A. P. W. Poon and B. Roizman, J. Virol. 67:4497-4503, 1993) and that although the intron separating the first and second exons of the UL15 gene contains UL16 and UL17 open reading frames, replacement of the first exon with a cDNA copy of the entire gene does not affect viral replication (J.D. Baines, and B. Roizman, J. Virol. 66:5621-5626, 1992). We report that (i) a polyclonal rabbit antiserum generated against a chimeric protein consisting of the bacterial maltose-binding protein fused in frame to the majority of sequences contained in the second exon of the UL15 gene reacted with two proteins with M(r) of 35,000 and 75,000, respectively, in cells infected with a virus containing the authentic gene yielding a spliced mRNA or with a virus in which the authentic UL15 gene was replaced with a cDNA copy. (ii) Insertion of 20 additional codons into the C terminus of UL15 exon II caused a reduction in the electrophoretic mobility of both the apparently 35,000- and 75,000-M(r) proteins, unambiguously demonstrating that both share the carboxyl terminus of the UL15 exon II. (iii) Accumulation of the 35,000-M(r) protein was reduced in cells infected and maintained in the presence of phosphonoacetate, an inhibitor of viral DNA synthesis. (iv) The UL15 proteins were localized in the perinuclear space at 6 h after infection and largely in the nucleus at 12 h after infection. (v) Viral DNA accumulating in cells infected with herpes simplex virus 1(mP)ts66.4 and maintained at the nonpermissive temperature was in an endless (concatemeric) form, and therefore UL15 is required for the cleavage of mature, unit-length molecules for packaging into capsids. Images PMID:7966602

  4. Predicting DNA-Binding Specificities of Eukaryotic Transcription Factors

    PubMed Central

    Schröder, Adrian; Eichner, Johannes; Supper, Jochen; Eichner, Jonas; Wanke, Dierk; Henneges, Carsten; Zell, Andreas


    Today, annotated amino acid sequences of more and more transcription factors (TFs) are readily available. Quantitative information about their DNA-binding specificities, however, are hard to obtain. Position frequency matrices (PFMs), the most widely used models to represent binding specificities, are experimentally characterized only for a small fraction of all TFs. Even for some of the most intensively studied eukaryotic organisms (i.e., human, rat and mouse), roughly one-sixth of all proteins with annotated DNA-binding domain have been characterized experimentally. Here, we present a new method based on support vector regression for predicting quantitative DNA-binding specificities of TFs in different eukaryotic species. This approach estimates a quantitative measure for the PFM similarity of two proteins, based on various features derived from their protein sequences. The method is trained and tested on a dataset containing 1 239 TFs with known DNA-binding specificity, and used to predict specific DNA target motifs for 645 TFs with high accuracy. PMID:21152420

  5. pH-dependent specific binding and combing of DNA.

    PubMed Central

    Allemand, J F; Bensimon, D; Jullien, L; Bensimon, A; Croquette, V


    Recent developments in the rapid sequencing, mapping, and analysis of DNA rely on the specific binding of DNA to specially treated surfaces. We show here that specific binding of DNA via its unmodified extremities can be achieved on a great variety of surfaces by a judicious choice of the pH. On hydrophobic surfaces the best binding efficiency is reached at a pH of approximately 5.5. At that pH a approximately 40-kbp DNA is 10 times more likely to bind by an extremity than by a midsegment. A model is proposed to account for the differential adsorption of the molecule extremities and midsection as a function of pH. The pH-dependent specific binding can be used to align anchored DNA molecules by a receding meniscus, a process called molecular combing. The resulting properties of the combed molecules will be discussed. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 7 PMID:9336201

  6. Chitosan-graft-polyethylenimine/DNA nanoparticles as novel non-viral gene delivery vectors targeting osteoarthritis.


    Lu, Huading; Dai, Yuhu; Lv, Lulu; Zhao, Huiqing


    The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes.

  7. High Serum Lipopolysaccharide-Binding Protein Level in Chronic Hepatitis C Viral Infection Is Reduced by Anti-Viral Treatments

    PubMed Central

    Nien, Hsiao-Ching; Hsu, Shih-Jer; Su, Tung-Hung; Yang, Po-Jen; Sheu, Jin-Chuan; Wang, Jin-Town; Chow, Lu-Ping; Chen, Chi-Ling


    Background Lipopolysaccharide-binding protein (LBP) has been reported to associate with metabolic diseases, such as obesity, diabetes, and non-alcoholic fatty liver disease. Since chronic hepatitis C virus (HCV) infection is associated with metabolic derangements, the relationship between LBP and HCV deserves additional studies. This study aimed to determine the serum LBP level in subjects with or without HCV infection and investigate the change of its level after anti-viral treatments with or without interferon. Methods and Findings We recruited 120 non-HCV subjects, 42 and 17 HCV-infected subjects respectively treated with peginterferon α-2a/ribavirin and direct-acting antiviral drugs. Basic information, clinical data, serum LBP level and abdominal ultrasonography were collected. All the subjects provided written informed consent before being enrolled approved by the Research Ethics Committee of the National Taiwan University Hospital. Serum LBP level was significantly higher in HCV-infected subjects than non-HCV subjects (31.0 ± 8.8 versus 20.0 ± 6.4 μg/mL; p-value < 0.001). After multivariate analyses, LBP at baseline was independently associated with body mass index, hemoglobin A1c, alanine aminotransferase (ALT) and HCV infection. Moreover, the baseline LBP was only significantly positively associated with ALT and inversely with fatty liver in HCV-infected subjects. The LBP level significantly decreased at sustained virologic response (27.4 ± 6.6 versus 34.6 ± 7.3 μg/mL, p-value < 0.001; 15.9 ± 4.4 versus 22.2 ± 5.7 μg/mL, p-value = 0.001), regardless of interferon-based or -free therapy. Conclusions LBP, an endotoxemia associated protein might be used as an inflammatory biomarker of both infectious and non-infectious origins in HCV-infected subjects. PMID:28107471

  8. Effect of sodium butyrate on induction of cellular and viral DNA syntheses in polyoma virus-infected mouse kidney cells.

    PubMed Central

    Wawra, E; Pöckl, E; Müllner, E; Wintersberger, E


    Sodium butyrate inhibited initiation of viral and cellular DNA replication in polyoma virus-infected mouse kidney cells. Ongoing viral or cellular DNA replication, however, was not affected by the presence of the substance. Butyrate had no effect on T-antigen synthesis and on the stimulation of transcription, one of the earliest reactions of the infected cells to the appearance of T-antigen, nor did it inhibit expression of late viral genes (synthesis of viral capsid proteins). In addition to blocking the onset of DNA synthesis, butyrate also inhibited stimulation of the activities of enzymes involved in DNA synthesis. When butyrate was removed, viral and cellular DNA syntheses were induced in parallel after a lag period of approximately 4 h. At the same time, the activities of enzymes involved in DNA synthesis increase. If protein synthesis was inhibited during part of the lag period, the initiation of DNA synthesis was retarded for the same time interval, suggesting that the proteins involved in the initiation of DNA replication had to be made. We have developed an in vitro system for measuring DNA synthesis in crude nuclear preparations which mimics the status of DNA replication in intact cells and may help in future experiments to study the requirements for initiation of cellular and viral DNA synthesis and the possible involvement of T-antigens in this reaction. Images PMID:6264167

  9. Ultrasound enhances the transfection of plasmid DNA by non-viral vectors.


    Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko


    Increasing attention has been paid to technology used for the delivery of genetic materials into cells for gene therapy and the generation of genetically engineered cells. So far, viral vectors have been mainly used because of their inherently high transfection efficiency of gene. However, there are some problems to be resolved for the clinical applications, such as the pathogenicity and immunogenicity of viral vectors themselves. Therefore, many research trials with non-viral vectors have been performed to enhance their efficiency to a level comparable to the viral vector. Two directions of these trials exist: material improvement of non-viral vectors and their combination with various external physical stimuli. This paper reviews the latter research trials, with special attention paid to the enhancement of gene expression by ultrasound (US). The expression level of plasmid DNA by various cationized polymers and liposomes is promoted by US irradiation in vitro as well as in vivo. This US-enhanced expression of plasmid DNA will be discussed to emphasize the technical feasibility of US in gene therapy and biotechnology.

  10. Prediction of DNA-binding proteins from relational features

    PubMed Central


    Background The process of protein-DNA binding has an essential role in the biological processing of genetic information. We use relational machine learning to predict DNA-binding propensity of proteins from their structures. Automatically discovered structural features are able to capture some characteristic spatial configurations of amino acids in proteins. Results Prediction based only on structural relational features already achieves competitive results to existing methods based on physicochemical properties on several protein datasets. Predictive performance is further improved when structural features are combined with physicochemical features. Moreover, the structural features provide some insights not revealed by physicochemical features. Our method is able to detect common spatial substructures. We demonstrate this in experiments with zinc finger proteins. Conclusions We introduced a novel approach for DNA-binding propensity prediction using relational machine learning which could potentially be used also for protein function prediction in general. PMID:23146001

  11. Asymmetric DNA binding by a homodimeric bHLH protein.


    Winston, R L; Ehley, J A; Baird, E E; Dervan, P B; Gottesfeld, J M


    Protein-DNA interactions that lie outside of the core recognition sequence for the Drosophila bHLH transcription factor Deadpan (Dpn) were investigated using minor groove binding pyrrole-imidazole polyamides. Electrophoretic mobility shift assays and DNase I footprinting demonstrate that hairpin polyamides bound immediately upstream, but not immediately downstream of the Dpn homodimer selectively inhibit protein-DNA complex formation. Mutation of the Dpn consensus binding site from the asymmetric sequence 5'-CACGCG-3' to the palindromic sequence 5'-CACGTG-3' abolishes asymmetric inhibition. A Dpn mutant containing the unnatural amino acid norleucine in place of lysine at position 80 in the bHLH loop region is not inhibited by the polyamide, suggesting that the epsilon amino group at this position is responsible for DNA contacts outside the major groove. We conclude that the nonpalindromic Dpn recognition site imparts binding asymmetry by providing unique contacts to the basic region of each monomer in the bHLH homodimer.

  12. Solution structure and binding specificity of the p63 DNA binding domain

    PubMed Central

    Enthart, Andreas; Klein, Christian; Dehner, Alexander; Coles, Murray; Gemmecker, Gerd; Kessler, Horst; Hagn, Franz


    p63 is a close homologue of p53 and, together with p73, is grouped into the p53 family of transcription factors. p63 is known to be involved in the induction of controlled apoptosis important for differentiation processes, germ line integrity and development. Despite its high homology to p53, especially within the DNA binding domain (DBD), p63-DBD does not show cooperative DNA binding properties and is significantly more stable against thermal and chemical denaturation. Here, we determined the solution structure of p63-DBD and show that it is markedly less dynamic than p53-DBD. In addition, we also investigate the effect of a double salt bridge present in p53-DBD, but not in p63-DBD on the cooperative binding behavior and specificity to various DNA sites. Restoration of the salt bridges in p63-DBD by mutagenesis leads to enhanced binding affinity to p53-specific, but not p63-specific response elements. Furthermore, we show that p63-DBD is capable of binding to anti-apoptotic BclxL via its DNA binding interface, a feature that has only been shown for p53 so far. These data suggest that all p53 family members - despite alterations in the specificity and binding affinity - are capable of activating pro-apoptotic pathways in a tissue specific manner. PMID:27225672

  13. Solution structure and binding specificity of the p63 DNA binding domain.


    Enthart, Andreas; Klein, Christian; Dehner, Alexander; Coles, Murray; Gemmecker, Gerd; Kessler, Horst; Hagn, Franz


    p63 is a close homologue of p53 and, together with p73, is grouped into the p53 family of transcription factors. p63 is known to be involved in the induction of controlled apoptosis important for differentiation processes, germ line integrity and development. Despite its high homology to p53, especially within the DNA binding domain (DBD), p63-DBD does not show cooperative DNA binding properties and is significantly more stable against thermal and chemical denaturation. Here, we determined the solution structure of p63-DBD and show that it is markedly less dynamic than p53-DBD. In addition, we also investigate the effect of a double salt bridge present in p53-DBD, but not in p63-DBD on the cooperative binding behavior and specificity to various DNA sites. Restoration of the salt bridges in p63-DBD by mutagenesis leads to enhanced binding affinity to p53-specific, but not p63-specific response elements. Furthermore, we show that p63-DBD is capable of binding to anti-apoptotic BclxL via its DNA binding interface, a feature that has only been shown for p53 so far. These data suggest that all p53 family members - despite alterations in the specificity and binding affinity - are capable of activating pro-apoptotic pathways in a tissue specific manner.

  14. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products.


    Sowd, Gregory A; Mody, Dviti; Eggold, Joshua; Cortez, David; Friedman, Katherine L; Fanning, Ellen


    Simian virus 40 (SV40) and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PK(cs) kinase activity, facilitates some aspects of double strand break (DSB) repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR) and do not colocalize with non-homologous end joining (NHEJ) factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PK(cs) and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5' to 3' end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication.

  15. The crystal structure of the DNA-binding domain of vIRF-1 from the oncogenic KSHV reveals a conserved fold for DNA binding and reinforces its role as a transcription factor

    PubMed Central

    Hew, Kelly; Venkatachalam, Rajakannan; Nasertorabi, Fariborz; Lim, Bee Ting; Cornvik, Tobias; Nordlund, Pär


    Kaposi’s sarcoma-associated herpesvirus encodes four viral homologues to cellular interferon regulatory factors (IRFs), where the most studied is vIRF-1. Even though vIRF-1 shows sequence homology to the N-terminal DNA-binding domain (DBD) of human IRFs, a specific role for this domain in vIRF-1’s function has remained uncertain. To provide insights into the function of the vIRF-1 DBD, we have determined the crystal structure of it in complex with DNA and in its apo-form. Using a thermal stability shift assay (TSSA), we show that the vIRF-1 DBD binds DNA, whereas full-length vIRF-1 does not, suggesting a cis-acting regulatory mechanism in similarity to human IRFs. The complex structure of vIRF-1 DBD reveals interactions with the DNA backbone and the positioning of two arginines for specific recognition in the major grove. A superimposition with human IRF-3 reveals a similar positioning of the two specificity-determining arginines, and additional TSSAs indicate binding of vIRF-1 to an IRF-3 operator consensus sequence. The results from this study, therefore, provide support that vIRF-1 has evolved to bind DNA and plays a role in DNA binding in the context of transcriptional regulation and might act on some of the many operator sequences controlled by human IRF-3. PMID:23435230

  16. Sendai virus-erythrocyte membrane interaction: quantitative and kinetic analysis of viral binding, dissociation, and fusion.


    Hoekstra, D; Klappe, K


    A kinetic and quantitative analysis of the binding and fusion of Sendai virus with erythrocyte membranes was performed by using a membrane fusion assay based on the relief of fluorescence self-quenching. At 37 degrees C, the process of virus association displayed a half time of 2.5 min; at 4 degrees C, the half time was 3.0 min. The fraction of the viral dose which became cell associated was independent of the incubation temperature and increased with increasing target membrane concentration. On the average, one erythrocyte ghost can accommodate ca. 1,200 Sendai virus particles. The stability of viral attachment was sensitive to a shift in temperature: a fraction of the virions (ca. 30%), attached at 4 degrees C, rapidly (half time, ca. 2.5 min) eluted from the cell surface at 37 degrees C, irrespective of the presence of free virus in the medium. The elution can be attributed to a spontaneous, temperature-induced release, rather than to viral neuraminidase activity. Competition experiments with nonlabeled virus revealed that viruses destined to fuse do not exchange with free particles in the medium but rather bind in a rapid and irreversible manner. The fusion rate of Sendai virus was affected by the density of the virus particles on the cell surface and became restrained when more than 170 virus particles were attached per ghost. In principle, all virus particles added displayed fusion activity. However, at high virus-to-ghost ratios, only a fraction actually fused, indicating that a limited number of fusion sites exist on the erythrocyte membrane. We estimate that ca. 180 virus particles maximally can fuse with one erythrocyte ghost.

  17. Portal control of viral prohead expansion and DNA packaging

    SciTech Connect

    Ray, Krishanu; Oram, Mark; Ma, Jinxia; Black, Lindsay W.


    Bacteriophage T4 terminase packages DNA in vitro into empty small or large proheads (esps or elps). In vivo maturation of esps yields the more stable and voluminous elps required to contain the 170 kb T4 genome. Functional proheads can be assembled containing portal-GFP fusion proteins. In the absence of terminase activity these accumulated in esps in vivo, whereas wild-type portals were found in elps. By nuclease protection assay dsDNAs of lengths 0.1, 0.2, 0.5, 5, 11, 20, 40 or 170 kb were efficiently packaged into wild-type elps in vitro, but less so into esps and gp20-GFP elps; particularly with DNAs shorter than 11 kb. However, 0.1 kb substrates were equally efficiently packaged into all types of proheads as judged by fluorescence correlation spectroscopy. These data suggest the portal controls the expansion of the major capsid protein lattice during prohead maturation, and that this expansion is necessary for DNA protection but not for packaging.

  18. DNA Mutagenic Activity and Capacity for HIV-1 Restriction of the Cytidine Deaminase APOBEC3G Depends on Whether DNA or RNA Binds to Tyrosine 315.


    Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E; Bennett, Ryan P; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A; Smith, Harold C


    APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. RNA and ssDNA bind to the same three A3G tryptic peptides (amino acids 181-194, 314-320, and 345-374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C-terminus of A3G to its N-terminus. We show here that the A3G tyrosines 181 and 315 directly cross-link ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an E. coli DNA mutator reporter, while Y181A and Y182A mutants retained ~50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Y315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Y315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity.

  19. Chromatin landscape dictates HSF binding to target DNA elements.


    Guertin, Michael J; Lis, John T


    Sequence-specific transcription factors (TFs) are critical for specifying patterns and levels of gene expression, but target DNA elements are not sufficient to specify TF binding in vivo. In eukaryotes, the binding of a TF is in competition with a constellation of other proteins, including histones, which package DNA into nucleosomes. We used the ChIP-seq assay to examine the genome-wide distribution of Drosophila Heat Shock Factor (HSF), a TF whose binding activity is mediated by heat shock-induced trimerization. HSF binds to 464 sites after heat shock, the vast majority of which contain HSF Sequence-binding Elements (HSEs). HSF-bound sequence motifs represent only a small fraction of the total HSEs present in the genome. ModENCODE ChIP-chip datasets, generated during non-heat shock conditions, were used to show that inducibly bound HSE motifs are associated with histone acetylation, H3K4 trimethylation, RNA Polymerase II, and coactivators, compared to HSE motifs that remain HSF-free. Furthermore, directly changing the chromatin landscape, from an inactive to an active state, permits inducible HSF binding. There is a strong correlation of bound HSEs to active chromatin marks present prior to induced HSF binding, indicating that an HSE's residence in "active" chromatin is a primary determinant of whether HSF can bind following heat shock.

  20. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L


    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  1. Exploring the DNA-binding specificities of zinc fingers with DNA microarrays

    PubMed Central

    Bulyk, Martha L.; Huang, Xiaohua; Choo, Yen; Church, George M.


    A key step in the regulation of networks that control gene expression is the sequence-specific binding of transcription factors to their DNA recognition sites. A more complete understanding of these DNA–protein interactions will permit a more comprehensive and quantitative mapping of the regulatory pathways within cells, as well as a deeper understanding of the potential functions of individual genes regulated by newly identified DNA-binding sites. Here we describe a DNA microarray-based method to characterize sequence-specific DNA recognition by zinc-finger proteins. A phage display library, prepared by randomizing critical amino acid residues in the second of three fingers of the mouse Zif268 domain, provided a rich source of zinc-finger proteins with variant DNA-binding specificities. Microarrays containing all possible 3-bp binding sites for the variable zinc fingers permitted the quantitation of the binding site preferences of the entire library, pools of zinc fingers corresponding to different rounds of selection from this library, as well as individual Zif268 variants that were isolated from the library by using specific DNA sequences. The results demonstrate the feasibility of using DNA microarrays for genome-wide identification of putative transcription factor-binding sites. PMID:11404456

  2. Estimation of biologically damaging UV levels in marine surface waters with DNA and viral dosimeters.


    Wilhelm, Steven W; Jeffrey, Wade H; Suttle, Curtis A; Mitchell, David L


    We have surveyed the biologically harmful radiation penetrating the water column along a transect in the western Gulf of Mexico using dosimeters consisting of intact viruses or naked calf-thymus DNA (ctDNA). The indigenous marine bacteriophage PWH3a-P1, which lytically infects the heterotrophic bacterium Vibrio natriegens (strain PWH3a), displayed decay rates for infectivity approaching 1.0 h(-1) in surface waters when deployed in a seawater-based dosimeter. The accumulation of pyrimidine dimers in ctDNA dosimeters provided a strong correlation to these results, with pyrimidine dimers representing more than 0.3% (up to ca 3800 dimers Mb(-1) DNA) of the total DNA in dosimeters exposed to sea surface levels of solar radiation. The results demonstrate a strong correlation between the dimer formation in the DNA dosimeters, the decay rates of viral infectivity and the penetration of UVB radiation into the water column. The decay of viral infectivity attenuated with depth in a manner similar to the decay of solar radiation and was still significant at 10 m in offshore oligotrophic water and at dimer frequencies less than 0.1% (ca 200-300 dimers Mb(-1) DNA).

  3. Inhibition of DNA Methylation Suppresses Intestinal Tumor Organoids by Inducing an Anti-Viral Response.


    Saito, Yoshimasa; Nakaoka, Toshiaki; Sakai, Kasumi; Muramatsu, Toshihide; Toshimitsu, Kohta; Kimura, Masaki; Kanai, Takanori; Sato, Toshiro; Saito, Hidetsugu


    Recent studies have proposed that the major anti-tumor effect of DNA methylation inhibitors is induction of interferon-responsive genes via dsRNAs-containing endogenous retroviruses. Recently, a 3D culture system for stem cells known as organoid culture has been developed. Lgr5-positive stem cells form organoids that closely recapitulate the properties of original tissues. To investigate the effect of DNA demethylation on tumor organoids, we have established organoids from intestinal tumors of Apc(Min/+) (Min) mice and subjected them to 5-aza-2'-deoxycytidine (5-Aza-CdR) treatment and Dnmt1 knockdown. DNA demethylation induced by 5-Aza-CdR treatment and Dnmt1 knockdown significantly reduced the cell proliferation of the tumor organoids. Microarray analyses of the tumor organoids after 5-Aza-CdR treatment and Dnmt1 knockdown revealed that interferon-responsive genes were activated by DNA demethylation. Gene ontology and pathway analyses clearly demonstrated that these genes activated by DNA demethylation are involved in the anti-viral response. These findings indicate that DNA demethylation suppresses the proliferation of intestinal tumor organoids by inducing an anti-viral response including activation of interferon-responsive genes. Treatment with DNA methylation inhibitors to activate a growth-inhibiting immune response may be an effective therapeutic approach for colon cancers.

  4. Intercalative DNA binding of the marine anticancer drug variolin B

    PubMed Central

    Canals, Albert; Arribas-Bosacoma, Raquel; Albericio, Fernando; Álvarez, Mercedes; Aymamí, Joan; Coll, Miquel


    Variolin B is a rare marine alkaloid that showed promising anti-cancer activity soon after its isolation. It acts as a cyclin-dependent kinase inhibitor, although the precise mechanism through which it exerts the cytotoxic effects is still unknown. The crystal structure of a variolin B bound to a DNA forming a pseudo-Holliday junction shows that this compound can also contribute, through intercalative binding, to either the formation or stabilization of multi-stranded DNA forms. PMID:28051169

  5. DNA scissors device used to measure MutS binding to DNA mis-pairs.


    Gu, Hongzhou; Yang, Wei; Seeman, Nadrian C


    MutS is a DNA repair protein that recognizes unpaired and bulged bases. When it binds to DNA, it bends the double helix. We have developed a novel DNA-based nanomechanical device that measures the amount of work that a DNA-bending protein can do when it binds to the double helix. The device we report here is a scissors-like device consisting of two double-crossover (DX) molecules connected to each other by a flexible Holliday junction. The two DX components are connected by a double helix that contains the binding site for MutS; when the binding site duplex is bent, the scissors contracts. The two DX molecules are also joined by sticky ends on an edge adjacent to the binding site; the sticky ends can be disrupted if the protein binds with sufficient free energy. Those sticky ends are flanked by a pair of dyes; when the sticky ends are disrupted, the dyes separate, and the fluorescence resonance energy transfer signal can monitor the disruption. The strength of the sticky ends is readily varied, so that the ability of the protein to disrupt them can be quantitated. We use this device to measure work in conjunction with a second device that measures the bending angle resulting from protein binding, so as to calibrate the system. Our data are in good agreement with previous measurements of MutS binding, indicating that this device is able to measure the strength of binding correctly.

  6. Annexin II binds to capsid protein VP1 of enterovirus 71 and enhances viral infectivity.


    Yang, Su-Lin; Chou, Ying-Ting; Wu, Cheng-Nan; Ho, Mei-Shang


    Enterovirus type 71 (EV71) causes hand, foot, and mouth disease (HFMD), which is mostly self-limited but may be complicated with a severe to fatal neurological syndrome in some children. Understanding the molecular basis of virus-host interactions might help clarify the largely unknown neuropathogenic mechanisms of EV71. In this study, we showed that human annexin II (Anx2) protein could bind to the EV71 virion via the capsid protein VP1. Either pretreatment of EV71 with soluble recombinant Anx2 or pretreatment of host cells with an anti-Anx2 antibody could result in reduced viral attachment to the cell surface and a reduction of the subsequent virus yield in vitro. HepG2 cells, which do not express Anx2, remained permissive to EV71 infection, though the virus yield was lower than that for a cognate lineage expressing Anx2. Stable transfection of plasmids expressing Anx2 protein into HepG2 cells (HepG2-Anx2 cells) could enhance EV71 infectivity, with an increased virus yield, especially at a low infective dose, and the enhanced infectivity could be reversed by pretreating HepG2-Anx2 cells with an anti-Anx2 antibody. The Anx2-interacting domain was mapped by yeast two-hybrid analysis to VP1 amino acids 40 to 100, a region different from the known receptor binding domain on the surface of the picornavirus virion. Our data suggest that binding of EV71 to Anx2 on the cell surface can enhance viral entry and infectivity, especially at a low infective dose.

  7. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim


    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  8. Transcriptional activation and repression by cellular DNA-binding protein C/EBP.

    PubMed Central

    Pei, D Q; Shih, C H


    A putative transcription factor, C/EBP, isolated from rat liver nuclei, has been shown to bind to at least two different sequence motifs: the CCAAT promoter domain and a core sequence [GTGG(T/A)(T/A)(T/A)G] common to many viral enhancers, including simian virus 40 and human hepatitis B virus. It has been proposed that C/EBP might function as a positive transcription factor by facilitating the communication between promoter and enhancer elements through its dual binding activities to DNA. Surprisingly, results from three different approaches suggest that C/EBP functions as a transcriptional repressor to hepatitis B virus and simian virus 40. Further investigation indicated that C/EBP can function as both a transcriptional activator and a repressor, depending on the reporter gene system. Images PMID:2157040

  9. Homologous recombinational repair factors are recruited and loaded onto the viral DNA genome in Epstein-Barr virus replication compartments.


    Kudoh, Ayumi; Iwahori, Satoko; Sato, Yoshitaka; Nakayama, Sanae; Isomura, Hiroki; Murata, Takayuki; Tsurumi, Tatsuya


    Homologous recombination is an important biological process that facilitates genome rearrangement and repair of DNA double-strand breaks (DSBs). The induction of Epstein-Barr virus (EBV) lytic replication induces ataxia telangiectasia-mutated (ATM)-dependent DNA damage checkpoint signaling, leading to the clustering of phosphorylated ATM and Mre11/Rad50/Nbs1 (MRN) complexes to sites of viral genome synthesis in nuclei. Here we report that homologous recombinational repair (HRR) factors such as replication protein A (RPA), Rad51, and Rad52 as well as MRN complexes are recruited and loaded onto the newly synthesized viral genome in replication compartments. The 32-kDa subunit of RPA is extensively phosphorylated at sites in accordance with those with ATM. The hyperphosphorylation of RPA32 causes a change in RPA conformation, resulting in a switch from the catalysis of DNA replication to the participation in DNA repair. The levels of Rad51 and phosphorylated RPA were found to increase with the progression of viral productive replication, while that of Rad52 proved constant. Furthermore, biochemical fractionation revealed increases in levels of DNA-bound forms of these HRRs. Bromodeoxyuridine-labeled chromatin immunoprecipitation and PCR analyses confirmed the loading of RPA, Rad 51, Rad52, and Mre11 onto newly synthesized viral DNA, and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling analysis demonstrated DSBs in the EBV replication compartments. HRR factors might be recruited to repair DSBs on the viral genome in viral replication compartments. RNA interference knockdown of RPA32 and Rad51 prevented viral DNA synthesis remarkably, suggesting that homologous recombination and/or repair of viral DNA genome might occur, coupled with DNA replication to facilitate viral genome synthesis.

  10. Cell specificity in DNA binding and repair of chemical carcinogens.

    PubMed Central

    Swenberg, J A; Rickert, D E; Baranyi, B L; Goodman, J I


    Many animal models for organ specific neoplasia have been developed and used to study the pathogenesis of cancer. Morphologic studies have usually concentrated on the response of target cells, whereas biochemical investigations have usually employed whole organ homogenates. Since hepatocytes comprise nearly 90% of the liver's mass and 70-80% of its DNA, alterations in DNA replication, covalent binding and DNA repair of nonparenchymal cells are usually obscured when whole organ homogenates are used. By utilizing cell separation methods, we have been able to demonstrate differences between hepatocyte and nonparenchymal cell replication. DNA damage and repair following exposure to a variety of hepatocarcinogen. Differences in removal of simple O6-alkylguanine and DNA replication correlate with cell specific carcinogenesis of simply alkylating agents. For several other procarcinogens, including 2-acetylaminofluorene and dinitroluene, cell specificity appears to reside primarily in the differential metabolic competence of hepatocytes and nonparenchymal cells. This results in greater covalent binding of the carcinogen to hepatocyte DNA, although the DNA adducts are removed at a similar rate in both cell types. Images FIGURE 1. PMID:6832089

  11. Conversion of bacteriophage G4 single-stranded viral DNA to double-stranded replicative form in dna mutants of Escherichia coli.


    Kodaira, K I; Taketo, A


    Host functions involved in synthesis of parental replicative form of bacteriophage G4 were investigated using various replication mutants of Escheria coli. In dna+ bacteria, conversion of single-stranded viral DNA to replicative form DNA was insensitive to 200 microng/ml of rifampicin or 25 microng/ml of chloramphenicol. At high temperature, synthesis of parental replicative form was unaffected in mutants thermosensitive for dnaA, dnaB, dnaC(D), dnaE or dnaH. In dnaG or dnaZ mutants, however, parental replicative from DNA synthesis was clearly thermosensitive at 43 degrees C. Although the host rep product was essential for viral multiplication, the conversion of single stranded to replicative form was independent of the rep function.

  12. Association of Human Papillomavirus 16 E2 with Rad50-Interacting Protein 1 Enhances Viral DNA Replication

    PubMed Central

    Campos-León, Karen; Wijendra, Kalpanee; Siddiqa, Abida; Pentland, Ieisha; Feeney, Katherine M.; Knapman, Alison; Davies, Rachel


    ABSTRACT Rad50-interacting protein 1 (Rint1) associates with the DNA damage response protein Rad50 during the transition from the S phase to the G2/M phase and functions in radiation-induced G2 checkpoint control. It has also been demonstrated that Rint1 is essential in vesicle trafficking from the Golgi apparatus to the endoplasmic reticulum (ER) through an interaction with Zeste-White 10 (ZW10). We have isolated a novel interaction between Rint1 and the human papillomavirus 16 (HPV16) transcription and replication factor E2. E2 binds to Rint1 within its ZW10 interaction domain, and we show that in the absence of E2, Rint1 is localized to the ER and associates with ZW10. E2 expression results in a disruption of the Rint1-ZW10 interaction and an accumulation of nuclear Rint1, coincident with a significant reduction in vesicle movement from the ER to the Golgi apparatus. Interestingly, nuclear Rint1 and members of the Mre11/Rad50/Nbs1 (MRN) complex were found in distinct E2 nuclear foci, which peaked during mid-S phase, indicating that the recruitment of Rint1 to E2 foci within the nucleus may also result in the recruitment of this DNA damage-sensing protein complex. We show that exogenous Rint1 expression enhances E2-dependent virus replication. Conversely, the overexpression of a truncated Rint1 protein that retains the E2 binding domain but not the Rad50 binding domain acts as a dominant negative inhibitor of E2-dependent HPV replication. Put together, these experiments demonstrate that the interaction between Rint1 and E2 has an important function in HPV replication. IMPORTANCE HPV infections are an important driver of many epithelial cancers, including those within the anogenital and oropharyngeal tracts. The HPV life cycle is tightly regulated and intimately linked to the differentiation of the epithelial cells that it infects. HPV replication factories formed in the nucleus are locations where viral DNA is copied to support virus persistence and amplification

  13. Association of Human Papillomavirus 16 E2 with Rad50-Interacting Protein 1 Enhances Viral DNA Replication.


    Campos-León, Karen; Wijendra, Kalpanee; Siddiqa, Abida; Pentland, Ieisha; Feeney, Katherine M; Knapman, Alison; Davies, Rachel; Androphy, Elliot J; Parish, Joanna L


    Rad50-interacting protein 1 (Rint1) associates with the DNA damage response protein Rad50 during the transition from the S phase to the G2/M phase and functions in radiation-induced G2 checkpoint control. It has also been demonstrated that Rint1 is essential in vesicle trafficking from the Golgi apparatus to the endoplasmic reticulum (ER) through an interaction with Zeste-White 10 (ZW10). We have isolated a novel interaction between Rint1 and the human papillomavirus 16 (HPV16) transcription and replication factor E2. E2 binds to Rint1 within its ZW10 interaction domain, and we show that in the absence of E2, Rint1 is localized to the ER and associates with ZW10. E2 expression results in a disruption of the Rint1-ZW10 interaction and an accumulation of nuclear Rint1, coincident with a significant reduction in vesicle movement from the ER to the Golgi apparatus. Interestingly, nuclear Rint1 and members of the Mre11/Rad50/Nbs1 (MRN) complex were found in distinct E2 nuclear foci, which peaked during mid-S phase, indicating that the recruitment of Rint1 to E2 foci within the nucleus may also result in the recruitment of this DNA damage-sensing protein complex. We show that exogenous Rint1 expression enhances E2-dependent virus replication. Conversely, the overexpression of a truncated Rint1 protein that retains the E2 binding domain but not the Rad50 binding domain acts as a dominant negative inhibitor of E2-dependent HPV replication. Put together, these experiments demonstrate that the interaction between Rint1 and E2 has an important function in HPV replication.IMPORTANCE HPV infections are an important driver of many epithelial cancers, including those within the anogenital and oropharyngeal tracts. The HPV life cycle is tightly regulated and intimately linked to the differentiation of the epithelial cells that it infects. HPV replication factories formed in the nucleus are locations where viral DNA is copied to support virus persistence and amplification of

  14. Preparation of (32)P-end-labeled DNA fragments for performing DNA-binding experiments.


    Carey, Michael F; Peterson, Craig L; Smale, Stephen T


    The generation of a uniquely (32)P-end-labeled DNA fragment is essential for DNA-binding experiments such as DNase I footprinting and ethylation interference. We describe here a protocol for end-labeling a restriction fragment. For a plasmid DNA bearing a region containing the binding site of interest, cleaving with a single restriction endonuclease generates a 5' overhang containing a phosphate. This is generally necessary for both common forms of fragment end-labeling: phosphorylation with polynucleotide kinase and "filling in the end" with DNA polymerases (e.g., Klenow fragment). For the phosphorylation reaction, as described here, the phosphate is removed with calf intestinal phosphatase or bacterial alkaline phosphatase, and the resulting free 5'-OH is phosphorylated with polynucleotide kinase and [γ-(32)P]ATP. This generates a plasmid labeled at each end with γ-(32)P. The molar amount of plasmid DNA must be below the amount of ATP added to the reaction and the ATP must be of sufficiently high specific activity to generate a fragment labeled to the extent necessary for many DNA-binding experiments. To generate a uniquely end-labeled DNA fragment, the labeled plasmid is heat-treated to inactivate any remaining kinase and recleaved with a second endonuclease, releasing a short DNA fragment and a longer vector fragment. The DNA fragment is purified from the labeled vector on a 5%-8% native polyacrylamide gel. The preparation and labeling of DNA restriction fragments typically takes 1-2 d.

  15. An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA.

    PubMed Central

    Matsuo, K; Silke, J; Georgiev, O; Marti, P; Giovannini, N; Rungger, D


    In vertebrates, transcriptionally active promoters are undermethylated. Since the transcription factor Sp1, and more recently NF-kappaB, have been implicated in the demethylation process, we examined the effect of transcription factors on demethylation by injecting in vitro methylated plasmid DNA into Xenopus fertilized eggs. We found that various transactivation domains, including a strong acidic activation domain from the viral protein VP16, can enhance demethylation of a promoter region when fused to a DNA binding domain which recognizes the promoter. Furthermore, demethylation occurs only after the midblastula transition, when the general transcription machinery of the host embryo becomes available. Nevertheless, transcription factor binding need not be followed by actual transcription, since demethylation is not blocked by alpha-amanitin treatment. Finally, replication of the target DNA is a prerequisite for efficient demethylation since only plasmids that carry the bovine papilloma virus sequences which support plasmid replication after the midblastula transition are demethylated. No demethylation is detectable in the oocyte system where DNA is not replicated. These results suggest that, in the Xenopus embryo, promoters for which transcription factors are available are demethylated by a replication-dependent, possibly passive mechanism. PMID:9482741

  16. Structural modeling for DNA binding to antioxidants resveratrol, genistein and curcumin.


    N'soukpoé-Kossi, C N; Bourassa, P; Mandeville, J S; Bekale, L; Tajmir-Riahi, H A


    Several models are presented here for the bindings of the antioxidant polyphenols resveratrol, genistein and curcumin with DNA in aqueous solution at physiological conditions. Multiple spectroscopic methods and molecular modeling were used to locate the binding sites of these polyphenols with DNA duplex. Structural models showed that intercalation is more stable for resveratrol and genistein than groove bindings, while curcumin interaction is via DNA grooves. Docking showed more stable complexes formed with resveratrol and genistein than curcumin with the free binding energies of -4.62 for resveratrol-DNA (intercalation), -4.28 for resveratrol-DNA (groove binding), -4.54 for genistein-DNA (intercalation), -4.38 for genistein-DNA (groove binding) and -3.84 kcal/mol for curcumin-DNA (groove binding). The free binding energies show polyphenol-DNA complexation is spontaneous at room temperature. At high polyphenol concentration a major DNA aggregation occurred, while biopolymer remained in B-family structure.

  17. Fluoroquinolone-gyrase-DNA complexes: two modes of drug binding.


    Mustaev, Arkady; Malik, Muhammad; Zhao, Xilin; Kurepina, Natalia; Luan, Gan; Oppegard, Lisa M; Hiasa, Hiroshi; Marks, Kevin R; Kerns, Robert J; Berger, James M; Drlica, Karl


    DNA gyrase and topoisomerase IV control bacterial DNA topology by breaking DNA, passing duplex DNA through the break, and then resealing the break. This process is subject to reversible corruption by fluoroquinolones, antibacterials that form drug-enzyme-DNA complexes in which the DNA is broken. The complexes, called cleaved complexes because of the presence of DNA breaks, have been crystallized and found to have the fluoroquinolone C-7 ring system facing the GyrB/ParE subunits. As expected from x-ray crystallography, a thiol-reactive, C-7-modified chloroacetyl derivative of ciprofloxacin (Cip-AcCl) formed cross-linked cleaved complexes with mutant GyrB-Cys(466) gyrase as evidenced by resistance to reversal by both EDTA and thermal treatments. Surprisingly, cross-linking was also readily seen with complexes formed by mutant GyrA-G81C gyrase, thereby revealing a novel drug-gyrase interaction not observed in crystal structures. The cross-link between fluoroquinolone and GyrA-G81C gyrase correlated with exceptional bacteriostatic activity for Cip-AcCl with a quinolone-resistant GyrA-G81C variant of Escherichia coli and its Mycobacterium smegmatis equivalent (GyrA-G89C). Cip-AcCl-mediated, irreversible inhibition of DNA replication provided further evidence for a GyrA-drug cross-link. Collectively these data establish the existence of interactions between the fluoroquinolone C-7 ring and both GyrA and GyrB. Because the GyrA-Gly(81) and GyrB-Glu(466) residues are far apart (17 Å) in the crystal structure of cleaved complexes, two modes of quinolone binding must exist. The presence of two binding modes raises the possibility that multiple quinolone-enzyme-DNA complexes can form, a discovery that opens new avenues for exploring and exploiting relationships between drug structure and activity with type II DNA topoisomerases.

  18. p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner

    SciTech Connect

    Miller, S.D.; Farmer, G.; Prives, C.


    This report discusses new findings that the tumor supressor gene product p53 may play a role as a DNA-binding-dependent regulator of DNA replication. The results were obtained using polyomavirus in replication assays. Details regarding effects on cell growth arrest and transcriptional activation are discussed. 61 refs., 7 figs.

  19. Insight into the cooperative DNA binding of the O⁶-alkylguanine DNA alkyltransferase.


    Tessmer, Ingrid; Fried, Michael G


    The O(6)-alkylguanine DNA alkyltransferase (AGT) is a highly conserved protein responsible for direct repair of alkylated guanine and to a lesser degree thymine bases. While specific DNA lesion-bound complexes in crystal structures consist of monomeric AGT, several solution studies have suggested that cooperative DNA binding plays a role in the physiological activities of AGT. Cooperative AGT-DNA complexes have been described by theoretical models, which can be tested by atomic force microscopy (AFM). Direct access to structural features of AGT-DNA complexes at the single molecule level by AFM imaging revealed non-specifically bound, cooperative complexes with limited cluster length. Implications of cooperative binding in AGT-DNA interactions are discussed.

  20. Development of a protein microarray using sequence-specific DNA binding domain on DNA chip surface

    SciTech Connect

    Choi, Yoo Seong; Pack, Seung Pil; Yoo, Young Je . E-mail:


    A protein microarray based on DNA microarray platform was developed to identify protein-protein interactions in vitro. The conventional DNA chip surface by 156-bp PCR product was prepared for a substrate of protein microarray. High-affinity sequence-specific DNA binding domain, GAL4 DNA binding domain, was introduced to the protein microarray as fusion partner of a target model protein, enhanced green fluorescent protein. The target protein was oriented immobilized directly on the DNA chip surface. Finally, monoclonal antibody of the target protein was used to identify the immobilized protein on the surface. This study shows that the conventional DNA chip can be used to make a protein microarray directly, and this novel protein microarray can be applicable as a tool for identifying protein-protein interactions.

  1. Cooperative binding of Ets-1 and core binding factor to DNA.

    PubMed Central

    Wotton, D; Ghysdael, J; Wang, S; Speck, N A; Owen, M J


    Two phorbol ester-inducible elements (beta E2 and beta E3) within the human T-cell receptor beta gene enhancer each contain consensus binding sites for the Ets and core binding factor (CBF) transcription factor families. Recombinant Ets-1 and purified CBF bound individually to beta E2 and beta E3, in which the Ets and core sites are directly adjacent. In this report, we show that CBF and Ets-1 bind together to beta E2 and beta E3 and that Ets-1-CBF-DNA complexes are favored over the binding of either protein alone to beta E2. Formation of Ets-1-CBF-DNA complexes increased the affinity of Ets-1-DNA interactions and decreased the rate of dissociation of CBF from DNA. Ets-1-CBF-DNA complexes were not observed when either the Ets or core site was mutated. The spatial requirements for the cooperative interaction of Ets-1 and CBF were analyzed by oligonucleotide mutagenesis and binding site selection experiments. Core and Ets sites were coselected, and there appeared to be little constraint on the relative orientation and spacing of the two sites. These results demonstrate that CBF and Ets-1 form a high-affinity DNA-binding complex when both of their cognate sites are present and that the relative spacing and orientation of the two sites are unimportant. Ets and core sites are found in several T-cell-specific enhancers, suggesting that this interaction is of general importance in T-cell-specific transcription. Images PMID:8264651

  2. Viral Contribution to Dissolved DNA in the Marine Environment as Determined by Differential Centrifugation and Kingdom Probing

    PubMed Central

    Jiang, S. C.; Paul, J. H.


    Dissolved or filterable (<0.2-(mu)m-pore-size filter) DNA is a ubiquitous component of the dissolved organic matter in the surface waters of this planet. In an effort to understand the composition and possible sources, we subjected dissolved DNA concentrated by vortex flow filtration from offshore and coastal environments to differential centrifugation and probing with 16S rRNA-targeted kingdom oligonucleotide probes. Initial studies with calf thymus soluble DNA and T2 phage particles indicated that high-speed ultracentrifugation (201,000 x g for 90 min), a method to separate viral particles from soluble DNA used by other investigators, resulted in pelleting of nearly all the DNA and virus particles. Lower-speed centrifugation (11,200 to 25,800 x g for 90 min) resulted in >99% of the virus particles being collected in the pellet and (equiv)65% of the calf thymus DNA remaining in the supernatant. Employing this approach, we estimate that approximately 50% of the filterable DNA from marine environments is truly soluble or free DNA and that the other half is composed of bound forms (viral particles and, potentially, colloids). Of the bound form, 17 to 30% could be accounted for by viral particles, by calculating the amount of viral DNA on the basis of viral abundance, leaving a portion of the bound form uncharacterized. Kingdom probing with universal, eubacterial, and eucaryotic probes indicated that dissolved DNA hybridized with all of these probes, while purified standard viral DNAs did not, or hybridized only slightly with the universal probe (tailed oligonucleotide only). Collectively, these data indicate that DNA in viral particles is a small component of the dissolved DNA, the majority being of eubacterial and eucaryotic origin. PMID:16534913

  3. Synthetic sialylphosphatidylethanolamine derivatives bind to human influenza A viruses and inhibit viral infection.


    Guo, C T; Wong, C H; Kajimoto, T; Miura, T; Ida, Y; Juneja, L R; Kim, M J; Masuda, H; Suzuki, T; Suzuki, Y


    We synthesized the sialylphosphatidylethanolamine (sialyl PE) derivatives Neu5Ac-PE, (Neu5Ac)2-PE, Neu5Ac-PE (amide) and Neu5Ac-PE (methyl). We examined the anti-viral effects of the derivatives on human influenza A virus infection by ELISA/virus-binding, hemagglutination inhibition, hemolysis inhibition and neutralization assays. The sialyl PE derivatives that we examined bound to A/Aichi/2/68, A/Singapore/1/57 and A/Memphis/1/71 strains of H3N2 subtype, but not to A/PR/8/34 strain of H1N1 subtype. The derivatives inhibited viral hemagglutination and hemolysis of human erythrocytes with A/Aichi/2/68 and A/Singapore/1/57 (H3N2), but not with A/PR/8/34 (H1N1). The inhibitory activity of the (Neu5Ac)2-PE derivative was the strongest of all sialyl PE derivatives (IC50, 35 microM to 40 microM). Sialyl PE derivatives also inhibited the infection of A/Aichi/2/68 in MDCK cells. Complete inhibition was observed at a concentration between 0.3 to 1.3 mM. IC50 of (Neu5Ac)2-PE was 15 microM in A/Aichi/2/68 strain. Taken together, the synthetic sialyl PE derivatives may be effective reagents against infection of some types of influenza A viruses.

  4. Polyomavirus large T antigen binds symmetrical repeats at the viral origin in an asymmetrical manner.


    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M; Schaffhausen, Brian; Bohm, Andrew


    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication.

  5. Polyomavirus Large T Antigen Binds Symmetrical Repeats at the Viral Origin in an Asymmetrical Manner

    PubMed Central

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M.; Schaffhausen, Brian


    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication. PMID:24109229

  6. Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.


    Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R


    The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

  7. Quantitative keratinocyte assay detects two biological activities of human papillomavirus DNA and identifies viral types associated with cervical carcinoma.

    PubMed Central

    Schlegel, R; Phelps, W C; Zhang, Y L; Barbosa, M


    Keratinocytes electroporated with human papillomavirus (HPV) DNA (HPV-6, 11, 16 and 18) exhibited an increased cellular proliferation which was quantitated as microcolony and macrocolony formation. However, only macrocolonies induced by HPV-16 or HPV-18 DNA (the two viral types most commonly found in human cervical carcinomas) gave rise to proliferating, poorly-stratified colonies when grown in the presence of serum and calcium. Hydrocortisone increased the frequency of these differentiation-resistant colonies, and studies showed that they were immortalized, contained one copy of viral DNA per cell, expressed three discrete species of viral RNA and synthesized the viral E7 protein. HPV-induced cellular proliferation and altered differentiation are therefore separable events and may represent the activity of different viral genes. Images PMID:2460337

  8. Universal protein binding microarrays for the comprehensive characterization of the DNA binding specificities of transcription factors

    PubMed Central

    Berger, Michael F.; Bulyk, Martha L.


    Protein binding microarray (PBM) technology provides a rapid, high-throughput means of characterizing the in vitro DNA binding specificities of transcription factors (TFs). Using high-density, custom-designed microarrays containing all 10-mer sequence variants, one can obtain comprehensive binding site measurements for any TF, regardless of its structural class or species of origin. Here, we present a protocol for the examination and analysis of TF binding specificities at high resolution using such ‘all 10-mer’ universal PBMs. This procedure involves double-stranding a commercially synthesized DNA oligonucleotide array, binding a TF directly to the double-stranded DNA microarray, and labeling the protein-bound microarray with a fluorophore-conjugated antibody. We describe how to computationally extract the relative binding preferences of the examined TF for all possible contiguous and gapped 8-mers over the full range of affinities, from highest affinity sites to nonspecific sites. Multiple proteins can be tested in parallel in separate chambers on a single microarray, enabling the processing of a dozen or more TFs in a single day. PMID:19265799

  9. Nanoparticles inhibit DNA replication by binding to DNA: modeling and experimental validation.


    Li, Kungang; Zhao, Xiaonan; K Hammer, Brian; Du, Songyan; Chen, Yongsheng


    Predictive models are beneficial tools for researchers to use in prioritizing nanoparticles (NPs) for toxicological tests, but experimental evaluation can be time-consuming and expensive, and thus, priority should be given to tests that identify the NPs most likely to be harmful. For characterization of NPs, the physical binding of NPs to DNA molecules is important to measure, as interference with DNA function may be one cause of toxicity. Here, we determined the interaction energy between 12 types of NPs and DNA based on the Derjaguin-Landau-Verwey-Overbeek (DLVO) model and then predicted the affinity of the NPs for DNA. Using the single-molecule imaging technique known as atomic force microscopy (AFM), we experimentally determined the binding affinity of those NPs for DNA. Theoretical predictions and experimental observations of the binding affinity agreed well. Furthermore, the effect of NPs on DNA replication in vitro was investigated with the polymerase chain reaction (PCR) technique. The results showed that NPs with a high affinity for DNA strongly inhibited DNA replication, whereas NPs with low affinity had no or minimal effects on DNA replication. The methodology here is expected to benefit the genotoxicological testing of NPs as well as the design of safe NPs.

  10. Analysis of dsDNA and RNA viromes in methanogenic digesters reveals novel viral genetic diversity.


    Calusinska, Magdalena; Marynowska, Martyna; Goux, Xavier; Lentzen, Esther; Delfosse, Philippe


    Although viruses are not the key players of the anaerobic digestion process, they may affect the dynamics of bacterial and archaeal populations involved in biogas production. Until now viruses have received very little attention in this specific habitat; therefore, as a first step towards their characterization, we optimized a virus filtration protocol from anaerobic sludge. Afterwards, to assess dsDNA and RNA viral diversity in sludge samples from nine different reactors fed either with waste water, agricultural residues or solid municipal waste plus agro-food residues, we performed metagenomic analyses. As a result we showed that, while the dsDNA viromes (21 assigned families in total) were dominated by dsDNA phages of the order Caudovirales, RNA viruses (14 assigned families in total) were less diverse and were for the main part plant-infecting viruses. Interestingly, less than 2% of annotated contigs were assigned as putative human and animal pathogens. Our study greatly extends the existing view of viral genetic diversity in methanogenic reactors and shows that these viral assemblages are distinct not only among the reactor types but also from nearly 30 other environments already studied, including the human gut, fermented food, deep sea sediments and other aquatic habitats.

  11. Cellular DNA ligase I is recruited to cytoplasmic vaccinia virus factories and masks the role of the vaccinia ligase in viral DNA replication.


    Paran, Nir; De Silva, Frank S; Senkevich, Tatiana G; Moss, Bernard


    Vaccinia virus (VACV) encodes DNA polymerase and additional proteins that enable cytoplasmic replication. We confirmed the ability of VACV DNA ligase mutants to replicate and tested the hypothesis that cellular ligases compensate for loss of viral gene expression. RNA silencing of human DNA ligase I expression and a small molecule inhibitor of human DNA ligase I [corrected] severely reduced replication of viral DNA in cells infected with VACV ligase-deficient mutants, indicating that the cellular enzyme plays a complementary role. Replication of ligase-deficient VACV was greatly reduced and delayed in resting primary cells, correlating with initial low levels of ligase I and subsequent viral induction and localization of ligase I in virus factories. These studies indicate that DNA ligation is essential for poxvirus replication and explain the ability of ligase deletion mutants to replicate in dividing cells but exhibit decreased pathogenicity in mice. Encoding its own ligase might allow VACV to "jump-start" DNA synthesis.

  12. Z-DNA binding protein from chicken blood nuclei

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.


    A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.

  13. Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure.

    PubMed Central

    Thayer, M M; Ahern, H; Xing, D; Cunningham, R P; Tainer, J A


    The 1.85 A crystal structure of endonuclease III, combined with mutational analysis, suggests the structural basis for the DNA binding and catalytic activity of the enzyme. Helix-hairpin-helix (HhH) and [4Fe-4S] cluster loop (FCL) motifs, which we have named for their secondary structure, bracket the cleft separating the two alpha-helical domains of the enzyme. These two novel DNA binding motifs and the solvent-filled pocket in the cleft between them all lie within a positively charged and sequence-conserved surface region. Lys120 and Asp138, both shown by mutagenesis to be catalytically important, lie at the mouth of this pocket, suggesting that this pocket is part of the active site. The positions of the HhH motif and protruding FCL motif, which contains the DNA binding residue Lys191, can accommodate B-form DNA, with a flipped-out base bound within the active site pocket. The identification of HhH and FCL sequence patterns in other DNA binding proteins suggests that these motifs may be a recurrent structural theme for DNA binding proteins. Images PMID:7664751

  14. Predicting DNA-binding proteins and binding residues by complex structure prediction and application to human proteome.


    Zhao, Huiying; Wang, Jihua; Zhou, Yaoqi; Yang, Yuedong


    As more and more protein sequences are uncovered from increasingly inexpensive sequencing techniques, an urgent task is to find their functions. This work presents a highly reliable computational technique for predicting DNA-binding function at the level of protein-DNA complex structures, rather than low-resolution two-state prediction of DNA-binding as most existing techniques do. The method first predicts protein-DNA complex structure by utilizing the template-based structure prediction technique HHblits, followed by binding affinity prediction based on a knowledge-based energy function (Distance-scaled finite ideal-gas reference state for protein-DNA interactions). A leave-one-out cross validation of the method based on 179 DNA-binding and 3797 non-binding protein domains achieves a Matthews correlation coefficient (MCC) of 0.77 with high precision (94%) and high sensitivity (65%). We further found 51% sensitivity for 82 newly determined structures of DNA-binding proteins and 56% sensitivity for the human proteome. In addition, the method provides a reasonably accurate prediction of DNA-binding residues in proteins based on predicted DNA-binding complex structures. Its application to human proteome leads to more than 300 novel DNA-binding proteins; some of these predicted structures were validated by known structures of homologous proteins in APO forms. The method [SPOT-Seq (DNA)] is available as an on-line server at

  15. Independent versus Cooperative Binding in Polyethylenimine–DNA and Poly(L-lysine)–DNA Polyplexes

    PubMed Central

    Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J.; Green, Jordan J.; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina


    The mechanism of polyethylenimine–DNA and poly(L-lysine)–DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

  16. Purified glucocorticoid receptors bind selectively in vitro to a cloned DNA fragment whose transcription is regulated by glucocorticoids in vivo.


    Payvar, F; Wrange, O; Carlstedt-Duke, J; Okret, S; Gustafsson, J A; Yamamoto, K R


    Activated glucocorticoid receptor protein, purified to 40-60% homogeneity from rat liver extracts, binds selectively in vitro to a cloned fragment of murine mammary tumor virus (MTV) DNA. The DNA fragment tested contains about half of the sequences present in intact MTV DNA, and its rate of transcription, like that of the intact viral element, is strongly stimulated by glucocorticoids when it is introduced into the genome of a receptor-containing cell. In contrast, the receptor fails to bind selectively to DNA restriction fragments from E. coli plasmids pBR322 and RSF2124 or from bacteriophages lambda and T4. Preliminary experiments to localize regions within MTV DNA responsible for selective binding have revealed thus far one subfragment that fails to bind the receptor and one selectively bound subfragment that maps far downstream from the 5' terminus of the normal RNA transcript. These studies are consistent with the notion that steroid receptors may modulate rates of transcription by recognizing specific DNA sequences within or near the regulated genes.

  17. Mg NMR in DNA solutions: Dominance of site binding effects.


    Rose, D M; Bleam, M L; Record, M T; Bryant, R G


    (25)Mg NMR spectroscopy is applied to a study of magnesium ion interactions with DNA, which is considered as a model for a linear polyelectrolyte. It is demonstrated that the magnesium ion spectrum is complicated by a non-Lorent-zian line shape and is dominated by the effects of chemical exchange with macromolecule binding sites. A distinction is made between specific-site interactions in which the magnesium ion loses a water molecule from the first coordination sphere on binding and those interactions, referred to as territorial binding, in which the ion maintains its first coordination sphere complement of solvent. The first type of site-binding interactions are shown to dominate the magnesium ion NMR spectrum, based on a consideration of the magnitudes of the observed (25)Mg relaxation rates compared with (23)Na relaxation rates, the clear contributions of chemical exchange-limited relaxation, and an ion displacement experiment employing sodium.

  18. Temporal order of evolution of DNA replication systems inferred by comparison of cellular and viral DNA polymerases

    PubMed Central

    Koonin, Eugene V


    Background The core enzymes of the DNA replication systems show striking diversity among cellular life forms and more so among viruses. In particular, and counter-intuitively, given the central role of DNA in all cells and the mechanistic uniformity of replication, the core enzymes of the replication systems of bacteria and archaea (as well as eukaryotes) are unrelated or extremely distantly related. Viruses and plasmids, in addition, possess at least two unique DNA replication systems, namely, the protein-primed and rolling circle modalities of replication. This unexpected diversity makes the origin and evolution of DNA replication systems a particularly challenging and intriguing problem in evolutionary biology. Results I propose a specific succession for the emergence of different DNA replication systems, drawing argument from the differences in their representation among viruses and other selfish replicating elements. In a striking pattern, the DNA replication systems of viruses infecting bacteria and eukaryotes are dominated by the archaeal-type B-family DNA polymerase (PolB) whereas the bacterial replicative DNA polymerase (PolC) is present only in a handful of bacteriophage genomes. There is no apparent mechanistic impediment to the involvement of the bacterial-type replication machinery in viral DNA replication. Therefore, I hypothesize that the observed, markedly unequal distribution of the replicative DNA polymerases among the known cellular and viral replication systems has a historical explanation. I propose that, among the two types of DNA replication machineries that are found in extant life forms, the archaeal-type, PolB-based system evolved first and had already given rise to a variety of diverse viruses and other selfish elements before the advent of the bacterial, PolC-based machinery. Conceivably, at that stage of evolution, the niches for DNA-viral reproduction have been already filled with viruses replicating with the help of the archaeal

  19. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding.


    Bradshaw, Elizabeth M; Sanford, David G; Luo, Xuelian; Sudmeier, James L; Gurard-Levin, Zachary A; Bullock, Peter A; Bachovchin, William W


    To better understand origin recognition and initiation of DNA replication, we have examined by NMR complexes formed between the origin-binding domain of SV40 T antigen (T-ag-obd), the initiator protein of the SV40 virus, and cognate and noncognate DNA oligomers. The results reveal two structural effects associated with "origin-specific" binding that are absent in nonspecific DNA binding. The first is the formation of a hydrogen bond (H-bond) involving His 203, a residue that genetic studies have previously identified as crucial to both specific and nonspecific DNA binding in full-length T antigen. In free T-ag-obd, the side chain of His 203 has a pK(a) value of approximately 5, titrating to the N(epsilon)(1)H tautomer at neutral pH (Sudmeier, J. L., et al. (1996) J. Magn. Reson., Ser. B 113, 236-247). In complexes with origin DNA, His 203 N(delta)(1) becomes protonated and remains nontitrating as the imidazolium cation at all pH values from 4 to 8. The H-bonded N(delta1)H resonates at 15.9 ppm, an unusually large N-H proton chemical shift, of a magnitude previously observed only in the catalytic triad of serine proteases at low pH. The formation of this H-bond requires the middle G/C base pair of the recognition pentanucleotide, GAGGC. The second structural effect is a selective distortion of the A/T base pair characterized by a large (0.6 ppm) upfield chemical-shift change of its Watson-Crick proton, while nearby H-bonded protons remain relatively unaffected. The results indicate that T antigen, like many other DNA-binding proteins, may employ "catalytic" or "transition-state-like" interactions in binding its cognate DNA (Jen-Jacobson, L. (1997) Biopolymers 44, 153-180), which may be the solution to the well-known paradox between the relatively modest DNA-binding specificity exhibited by initiator proteins and the high specificity of initiation.

  20. Membrane vesicles in sea water: heterogeneous DNA content and implications for viral abundance estimates.


    Biller, Steven J; McDaniel, Lauren D; Breitbart, Mya; Rogers, Everett; Paul, John H; Chisholm, Sallie W


    Diverse microbes release membrane-bound extracellular vesicles from their outer surfaces into the surrounding environment. Vesicles are found in numerous habitats including the oceans, where they likely have a variety of functional roles in microbial ecosystems. Extracellular vesicles are known to contain a range of biomolecules including DNA, but the frequency with which DNA is packaged in vesicles is unknown. Here, we examine the quantity and distribution of DNA associated with vesicles released from five different bacteria. The average quantity of double-stranded DNA and size distribution of DNA fragments released within vesicles varies among different taxa. Although some vesicles contain sufficient DNA to be visible following staining with the SYBR fluorescent DNA dyes typically used to enumerate viruses, this represents only a small proportion (<0.01-1%) of vesicles. Thus DNA is packaged heterogeneously within vesicle populations, and it appears that vesicles are likely to be a minor component of SYBR-visible particles in natural sea water compared with viruses. Consistent with this hypothesis, chloroform treatment of coastal and offshore seawater samples reveals that vesicles increase epifluorescence-based particle (viral) counts by less than an order of magnitude and their impact is variable in space and time.

  1. Host DNA Damage Response Factors Localize to Merkel Cell Polyomavirus DNA Replication Sites To Support Efficient Viral DNA Replication

    PubMed Central

    Tsang, Sabrina H.; Wang, Xin; Li, Jing; Buck, Christopher B.


    ABSTRACT Accumulating evidence indicates a role for Merkel cell polyomavirus (MCPyV) in the development of Merkel cell carcinoma (MCC), making MCPyV the first polyomavirus to be clearly associated with human cancer. With the high prevalence of MCPyV infection and the increasing amount of MCC diagnosis, there is a need to better understand the virus and its oncogenic potential. In this study, we examined the relationship between the host DNA damage response (DDR) and MCPyV replication. We found that components of the ATM- and ATR-mediated DDR pathways accumulate in MCPyV large T antigen (LT)-positive nuclear foci in cells infected with native MCPyV virions. To further study MCPyV replication, we employed our previously established system, in which recombinant MCPyV episomal DNA is autonomously replicated in cultured cells. Similar to native MCPyV infection, where both MCPyV origin and LT are present, the host DDR machinery colocalized with LT in distinct nuclear foci. Immunofluorescence in situ hybridization and bromodeoxyuridine (BrdU) incorporation analysis showed that these DDR proteins and MCPyV LT in fact colocalized at the actively replicating MCPyV replication complexes, which were absent when a replication-defective LT mutant or an MCPyV-origin mutant was introduced in place of wild-type LT or wild-type viral origin. Inhibition of DDR kinases using chemical inhibitors and ATR/ATM small interfering RNA (siRNA) knockdown reduced MCPyV DNA replication without significantly affecting LT expression or the host cell cycle. This study demonstrates that these host DDR factors are important for MCPyV DNA replication, providing new insight into the host machinery involved in the MCPyV life cycle. IMPORTANCE MCPyV is the first polyomavirus to be clearly associated with human cancer. However, the MCPyV life cycle and its oncogenic mechanism remain poorly understood. In this report, we show that, in cells infected with native MCPyV virions, components of the ATM- and ATR

  2. Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein

    SciTech Connect

    Ryzhikov, Mikhail; Koroleva, Olga; Postnov, Dmitri; Tran, Andrew; Korolev, Sergey


    RecO is a recombination mediator protein (RMP) important for homologous recombination, replication repair and DNA annealing in bacteria. In all pathways, the single-stranded (ss) DNA binding protein, SSB, plays an inhibitory role by protecting ssDNA from annealing and recombinase binding. Conversely, SSB may stimulate each reaction through direct interaction with RecO. We present a crystal structure of Escherichia coli RecO bound to the conserved SSB C-terminus (SSB-Ct). SSB-Ct binds the hydrophobic pocket of RecO in a conformation similar to that observed in the ExoI/SSB-Ct complex. Hydrophobic interactions facilitate binding of SSB-Ct to RecO and RecO/RecR complex in both low and moderate ionic strength solutions. In contrast, RecO interaction with DNA is inhibited by an elevated salt concentration. The SSB mutant lacking SSB-Ct also inhibits RecO-mediated DNA annealing activity in a salt-dependent manner. Neither RecO nor RecOR dissociates SSB from ssDNA. Therefore, in E. coli, SSB recruits RMPs to ssDNA through SSB-Ct, and RMPs are likely to alter the conformation of SSB-bound ssDNA without SSB dissociation to initiate annealing or recombination. Intriguingly, Deinococcus radiodurans RecO does not bind SSB-Ct and weakly interacts with the peptide in the presence of RecR, suggesting the diverse mechanisms of DNA repair pathways mediated by RecO in different organisms.

  3. Antitumor drug nogalamycin binds DNA in both grooves simultaneously: molecular structure of nogalamycin-DNA complex.


    Liaw, Y C; Gao, Y G; Robinson, H; van der Marel, G A; van Boom, J H; Wang, A H


    The three-dimensional molecular structures of the complexes between an interesting antitumor drug, nogalamycin, and two DNA hexamers, d[CGT(pS)ACG] and d[m5CGT(pS)Am5CG], were determined at high resolution by X-ray diffraction analyses. Two nogalamycins bind to the DNA double helix in a 2:1 ratio with the aglycon chromophore intercalated between the CpG steps at both ends of the helix. The nogalose and aminoglucose sugars lie in the minor and major grooves, respectively, of the distorted B-DNA double helix. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through. Specific hydrogen bonds are found in the complex between the drug and guanine bases. We suggest that nogalamycin may prefer GC sequences embedded in a stretch of AT sequences.

  4. Eukaryotic damaged DNA-binding proteins: DNA repair proteins or transcription factors?

    SciTech Connect

    Protic, M.


    Recognition and removal of structural defects in the genome, caused by diverse physical and chemical agents, are among the most important cell functions. Proteins that recognize and bind to modified DNA, and thereby initiate damage-induced recovery processes, have been identified in prokaryotic and eukaryotic cells. Damaged DNA-binding (DDB) proteins from prokaryotes are either DNA repair enzymes or noncatalytic subunits of larger DNA repair complexes that participate in excision repair, or in recombinational repair and SOS-mutagenesis. Although the methods employed may not have allowed detection of all eukaryotic DDB proteins and identification of their functions, it appears that during evolution cells have developed a wide array of DDB proteins that can discriminate among the diversity of DNA conformations found in the eukaryotic nucleus, as well as a gene-sharing feature found in DDB proteins that also act as transcription factors.

  5. Dendritic star polymers for efficient DNA binding and stimulus-dependent DNA release.


    Yin, Meizhen; Ding, Ke; Gropeanu, Radu A; Shen, Jie; Berger, Rüdiger; Weil, Tanja; Müllen, Klaus


    Water-soluble core-shell star polymers consisting of a dendritic polyphenylene core and an outer shell containing a defined number of amino groups have been synthesized via atom transfer radical polymerization (ATRP). All macromolecules efficiently interacted with a diverse set of DNA fragments, and stable complexes were formed and visualized by atomic force microscopy. The observed tight binding of DNA, which was found in the sub-nanomolar range, was mainly attributed to strong electrostatic interactions. Complex stoichiometries between the polyelectrolytes were controlled via the number of amino groups of the star polymers, and well-defined nanoscopic architectures were formed. DNA was released from the complexes after treatment with high concentrations of sodium chloride in aqueous solution. Such star polymers, which allow the binding and release of DNA, represent attractive candidates for the development of novel anion-exchange resins for DNA purification or as nonviral vector systems for gene delivery.

  6. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.


    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  7. Meta-Analysis of DNA Tumor-Viral Integration Site Selection Indicates a Role for Repeats, Gene Expression and Epigenetics.


    Doolittle-Hall, Janet M; Cunningham Glasspoole, Danielle L; Seaman, William T; Webster-Cyriaque, Jennifer


    Oncoviruses cause tremendous global cancer burden. For several DNA tumor viruses, human genome integration is consistently associated with cancer development. However, genomic features associated with tumor viral integration are poorly understood. We sought to define genomic determinants for 1897 loci prone to hosting human papillomavirus (HPV), hepatitis B virus (HBV) or Merkel cell polyomavirus (MCPyV). These were compared to HIV, whose enzyme-mediated integration is well understood. A comprehensive catalog of integration sites was constructed from the literature and experimentally-determined HPV integration sites. Features were scored in eight categories (genes, expression, open chromatin, histone modifications, methylation, protein binding, chromatin segmentation and repeats) and compared to random loci. Random forest models determined loci classification and feature selection. HPV and HBV integrants were not fragile site associated. MCPyV preferred integration near sensory perception genes. Unique signatures of integration-associated predictive genomic features were detected. Importantly, repeats, actively-transcribed regions and histone modifications were common tumor viral integration signatures.

  8. The plasmid replicon of EBV consists of multiple cis-acting elements that facilitate DNA synthesis by the cell and a viral maintenance element.

    PubMed Central

    Aiyar, A; Tyree, C; Sugden, B


    Plasmids containing oriP, the plasmid origin of Epstein-Barr virus (EBV), are replicated stably in human cells that express a single viral trans-acting factor, EBNA-1. Unlike plasmids of other viruses, but akin to human chromosomes, oriP plasmids are synthesized once per cell cycle, and are partitioned faithfully to daughter cells during mitosis. Although EBNA-1 binds multiple sites within oriP, its role in DNA synthesis and partitioning has been obscure. EBNA-1 lacks enzymatic activities that are present in the origin-binding proteins of other mammalian viruses, and does not interact with human cellular proteins that provide equivalent enzymatic functions. We demonstrate that plasmids with oriP or its constituent elements are synthesized efficiently in human cells in the absence of EBNA-1. Further, we show that human cells rapidly eliminate or destroy newly synthesized plasmids, and that both EBNA-1 and the family of repeats of oriP are required for oriP plasmids to escape this catastrophic loss. These findings indicate that EBV's plasmid replicon consists of genetic elements with distinct functions, multiple cis-acting elements that facilitate DNA synthesis and viral cis/trans elements that permit retention of replicated DNA in daughter cells. They also explain historical failures to identify mammalian origins of DNA synthesis as autonomously replicating sequences. PMID:9799247

  9. Differential DNA binding of Ku antigen determines its involvement in DNA replication.


    Schild-Poulter, Caroline; Matheos, Diamanto; Novac, Olivia; Cui, Bo; Giffin, Ward; Ruiz, Marcia T; Price, Gerald B; Zannis-Hadjopoulos, Maria; Haché, Robert J G


    Ku antigen (Ku70/Ku80) is a regulatory subunit of DNA-dependent protein kinase, which participates in the regulation of DNA replication and gene transcription through specific DNA sequences. In this study, we have compared the mechanism of action of Ku from A3/4, a DNA sequence that appears in mammalian origins of DNA replication, and NRE1, a transcriptional regulatory element in the long terminal repeat of mouse mammary tumor virus through which Ku antigen and its associated kinase, DNA-dependent protein kinase (DNA-PK(cs)), act to repress steroid-induced transcription. Our results indicate that replication from a minimal replication origin of ors8 is independent of DNA-PK(cs) and that Ku interacts with A3/4-like sequences and NRE1 in fundamentally different ways. UV crosslinking experiments revealed differential interactions of the Ku subunits with A3/4, NRE1, and two other proposed Ku transcriptional regulatory elements. In vitro footprinting experiments showed direct contact of Ku on A3/4 and over the region of ors8 homologous to A3/4. In vitro replication assays using ors8 templates bearing mutations in the A3/4-like sequence suggested that Ku binding to this element was necessary for replication. By contrast, in vitro replication experiments revealed that NRE1 was not involved in DNA replication. Our results establish A3/4 as a new class of Ku DNA binding site. Classification of Ku DNA binding into eight categories of interaction based on recognition and DNA crosslinking experiments is discussed.

  10. Specific enrichment of prokaryotic DNA using a recombinant DNA-binding protein.


    Sandetskaya, Natalia; Naumann, Andreas; Hennig, Katharina; Kuhlmeier, Dirk


    Targeted enrichment of DNA is often necessary for its detection and characterization in complex samples. We describe the development and application of the novel molecular tool for the specific enrichment of prokaryotic DNA. A fused protein comprising the DNA-binding subunit of the bacterial topoisomerase II, gyrase, was expressed, purified, and immobilized on magnetic particles. We demonstrated the specific affinity of the immobilized protein towards bacterial DNA and investigated its efficiency in the samples with high background of eukaryotic DNA. The reported approach allowed for the selective isolation and further detection of as few as 5 pg Staphylococcus aureus DNA from the sample with 4 × 10(6)-fold surplus of human DNA. This method is a promising approach for the preparation of such type of samples, for example in molecular diagnostics of sepsis.

  11. RNA-binding protein CPEB1 remodels host and viral RNA landscapes.


    Batra, Ranjan; Stark, Thomas J; Clark, Elizabeth; Belzile, Jean-Philippe; Wheeler, Emily C; Yee, Brian A; Huang, Hui; Gelboin-Burkhart, Chelsea; Huelga, Stephanie C; Aigner, Stefan; Roberts, Brett T; Bos, Tomas J; Sathe, Shashank; Donohue, John Paul; Rigo, Frank; Ares, Manuel; Spector, Deborah H; Yeo, Gene W


    Host and virus interactions occurring at the post-transcriptional level are critical for infection but remain poorly understood. Here, we performed comprehensive transcriptome-wide analyses revealing that human cytomegalovirus (HCMV) infection results in widespread alternative splicing (AS), shortening of 3' untranslated regions (3' UTRs) and lengthening of poly(A)-tails in host gene transcripts. We found that the host RNA-binding protein CPEB1 was highly induced after infection, and ectopic expression of CPEB1 in noninfected cells recapitulated infection-related post-transcriptional changes. CPEB1 was also required for poly(A)-tail lengthening of viral RNAs important for productive infection. Strikingly, depletion of CPEB1 reversed infection-related cytopathology and post-transcriptional changes, and decreased productive HCMV titers. Host RNA processing was also altered in herpes simplex virus-2 (HSV-2)-infected cells, thereby indicating that this phenomenon might be a common occurrence during herpesvirus infections. We anticipate that our work may serve as a starting point for therapeutic targeting of host RNA-binding proteins in herpesvirus infections.

  12. Molecular spectroscopy evidence of berberine binding to DNA: comparative binding and thermodynamic profile of intercalation.


    Li, Xiao-Ling; Hu, Yan-Jun; Wang, Hong; Yu, Bing-Qiong; Yue, Hua-Li


    Berberine (BH) is an important traditional medicinal herb endowed with diverse pharmacological and biological activities. In this work, the binding characteristics and molecular mechanism of the interaction between the BH and herring sperm DNA were explored by UV-vis absorbance and fluorescence spectroscopy. In the mechanism discussion, fluorescence quenching, absorption spectra, competition experiment, and iodide quenching experiment studies hinted at an intercalative mode of binding for BH to DNA. Fluorescence studies revealed the binding constant (K) of BH-DNA was ∼10(4) L·mol(-1). The effects of temperature, chemical denaturants, thermal denaturation, and pH were studied to show the factors of the interaction and provided further support for the intercalative binding mode. The results of thermodynamic parameters ΔG, ΔH, and ΔS at different temperatures indicated that the hydrogen bonds and van der Waals interactions played major roles in the reaction, and the effect of ionic strength indicated that electrostatic attraction between the BH and DNA was also a component of the interaction.

  13. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions

    PubMed Central

    Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko


    The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

  14. Facile dimer synthesis for DNA-binding polyamide ligands.


    Wetzler, Modi; Wemmer, David E


    Pyrrole-imidazole polyamide ligands are highly sequence specific synthetic DNA-binding ligands that bind with high affinity. To counter the synthetic difficulties associated with coupling the electron-rich heterocyclic acids to the electron-deficient nucleophilic imidazole amine, a novel approach is described for synthesis of Fmoc-protected dimers for solid-phase peptide synthesis (SPPS). This method produces the dimers in high yields, is broadly applicable to other heterocyclic-containing polyamides, and results in improved ligand yields and synthesis times.

  15. DBD2BS: connecting a DNA-binding protein with its binding sites

    PubMed Central

    Chien, Ting-Ying; Lin, Chih-Kang; Lin, Chih-Wei; Weng, Yi-Zhong; Chen, Chien-Yu; Chang, Darby Tien-Hao


    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes can be summarized as a PWM. This technique provides an effective alternative when the chromatin immunoprecipitation data are unavailable for PWM inference. To facilitate the procedure of predicting PWMs based on protein–DNA complexes or even structures of the unbound state, the web server, DBD2BS, is presented in this study. The DBD2BS uses an atom-level knowledge-based potential function to predict PWMs characterizing the sequences to which the query DBD structure can bind. For unbound queries, a list of 1066 DBD–DNA complexes (including 1813 protein chains) is compiled for use as templates for synthesizing bound structures. The DBD2BS provides users with an easy-to-use interface for visualizing the PWMs predicted based on different templates and the spatial relationships of the query protein, the DBDs and the DNAs. The DBD2BS is the first attempt to predict PWMs of DBDs from unbound structures rather than from bound ones. This approach increases the number of existing protein structures that can be exploited when analyzing protein–DNA interactions. In a recent study, the authors showed that the kernel adopted by the DBD2BS can generate PWMs consistent with those obtained from the experimental data. The use of DBD2BS to predict PWMs can be incorporated with sequence-based methods to discover binding sites in genome-wide studies. Available at:,, and PMID:22693214

  16. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    NASA Astrophysics Data System (ADS)

    Shokri, Leila; Rouzina, Ioulia; Williams, Mark C.


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork.

  17. DNA-binding and fluorescence properties of the DNA bisintercalating purple oxazole dimer POPO-1

    NASA Astrophysics Data System (ADS)

    Winter, Stefan; Loeber, Gunter


    Dimers of the fluorescent DNA intercalators oxazole yellow and thiazole orange are used for high-sensitivity DNA detection due to their excellent fluorescence properties. Fluorescence lifetime techniques and absorption spectroscopy were used to investigate the DNA binding properties of POPO- 1 [4,4,8,8-tetramethyl-4,8-diazaundecamethylene)bis-4-(3- methyl-2,3-dihydrobenzo-1,3-oxazolyl)-2-methylidene] with the double-stranded homopurine-homopyrimidine polynucleotides poly(dA(DOT)dT), poly(dG(DOT)dC) and calf thymus DNA. The coexistence of different binding modes of POPO-1 with polynucleotides such as bisintercalation and monointercalation was found in connection with minor groove binding as well as electrostatic attachment. At high excess of polynucleotides, bisintercalation is the only existing form of binding whereas an increasing amount of POPO-1 leads to the coexistence of bis- and monointercalated dye molecules. The amount of bound dye increases with decreasing ionic strength of the buffer and is dependent on the polynucleotide itself. The best binding conditions were found with calf thymus DNA, followed by poly(dA(DOT)dT) and poly(dG(DOT)dC).

  18. Single-Molecule Studies of the Temperature Dependence of Viral DNA Packaging Motors

    NASA Astrophysics Data System (ADS)

    White, Michael; Raymer, Dorian; Rickgauer, Peter; Fuller, Derek; Grimes, Shelley; Jardine, Paul; Anderson, Dwight; Smith, Doug


    A key step in the assembly of many viruses is the packaging of dsDNA into a preformed capsid by the action of a portal molecular motor complex. We have developed methods for directly measuring viral DNA translocation at the single molecule level using optical tweezers and applied these methods to study bacteriophages φ29, lambda, and T4. Our previous measurements with φ29 were performed at room temperature. Here we report that the rate of DNA translocation is strongly temperature dependent. Preliminary measurements indicate that the motor velocity increases ˜2-fold, to ˜250-300 bp/s when the temperature is increased from ˜20 to 30 degrees C. As the viral packaging motors are enzymes that catalyze ATP hydrolysis, such a trend with increasing temperature is to be expected, at least up to the point where the motor complex is thermally dissociated or denatured. However, the detailed form of the temperature dependence is difficult to quantify using standard bulk assay methods. We have installed a heating/cooling system in our optical tweezers instrument that allows us to precisely control the temperature in our sample chamber. This system allows us to systematically study the temperature dependence of the DNA translocation rate.

  19. DNA binding site for a factor(s) required to initiate simian virus 40 DNA replication.

    PubMed Central

    Yamaguchi, M; DePamphilis, M L


    Efficient initiation of DNA replication in the absence of nonspecific DNA repair synthesis was obtained by using a modification of the system developed by J.J. Li and T.J. Kelly [(1984) Proc. Natl. Acad. Sci. USA 81, 6973-6977]. Circular double-stranded DNA plasmids replicated in extracts of CV-1 cells only when the plasmids contained the cis-acting origin sequence for simian virus 40 DNA replication (ori) and the extract contained simian virus 40 large tumor antigen. Competition between plasmids containing ori and plasmids carrying deletions in and about ori served to identify a sequence that binds the rate-limiting factor(s) required to initiate DNA replication. The minimum binding site (nucleotides 72-5243) encompassed one-half of the simian virus 40 ori sequence that is required for initiation of replication (ori-core) plus the contiguous sequence on the late gene side of ori-core containing G + C-rich repeats that facilitates initiation (ori-auxiliary). This initiation factor binding site was specific for the simian virus 40 ori region, even though it excluded the high-affinity large tumor antigen DNA binding sites. Images PMID:3006062

  20. Structural and Molecular Basis for Coordination in a Viral DNA Packaging Motor

    PubMed Central

    Reyes-Aldrete, Emilio; Sherman, Michael B.; Woodson, Michael; Atz, Rockney; Grimes, Shelley; Jardine, Paul J.; Morais, Marc C.


    SUMMARY Ring NTPases are a class of ubiquitous molecular motors involved in basic biological partitioning processes. dsDNA viruses encode ring ATPases that translocate their genomes to near-crystalline densities within pre-assembled viral capsids. Here, X-ray crystallography, cryoEM, and biochemical analyses of the dsDNA packaging motor in bacteriophage phi29 show how individual subunits are arranged in a pentameric ATPase ring, and suggest how their activities are coordinated to translocate dsDNA. The resulting pseudo-atomic structure of the motor and accompanying functional analyses show how ATP is bound in the ATPase active site; identify two DNA contacts, including a potential DNA translocating loop; demonstrate that a trans-acting arginine finger is involved in coordinating hydrolysis around the ring; and suggest a functional coupling between the arginine finger and the DNA translocating loop. The ability to visualize the motor in action illuminates how the different motor components interact with each other and with their DNA substrate. PMID:26904950

  1. Specific glucocorticoid receptor binding to DNA reconstituted in a nucleosome.

    PubMed Central

    Perlmann, T; Wrange, O


    We have reconstituted a nucleosome with core histones from rat liver using a restriction fragment containing a sequence from the mouse mammary tumour virus (MTV) long terminal repeat (LTR). This sequence harbours glucocorticoid responsive elements (GREs) which mediate glucocorticoid hormone induction of transcription from the MTV promoter via glucocorticoid receptor (GR) binding. Exonuclease III and DNase I footprinting demonstrated that the reconstituted nucleosome was specifically located between positions -219 and -76. A nucleosome was previously shown to be located at a similar or identical position in the MTV promoter in situ and to be structurally altered upon glucocorticoid hormone induction. We demonstrated, by DNase I footprinting, that GR is able to bind sequence specifically to the DNA in the in vitro assembled nucleosome. No evidence for unfolding of the nucleosome was obtained, but the DNase I footprinting pattern demonstrated GR induced local alterations in the DNA. Images PMID:2846275

  2. Hybrid Nonviral/Viral Vector Systems for Improved piggyBac DNA Transposon In Vivo Delivery

    PubMed Central

    Cooney, Ashley L; Singh, Brajesh K; Sinn, Patrick L


    The DNA transposon piggyBac is a potential therapeutic agent for multiple genetic diseases such as cystic fibrosis (CF). Recombinant piggyBac transposon and transposase are typically codelivered by plasmid transfection; however, plasmid delivery is inefficient in somatic cells in vivo and is a barrier to the therapeutic application of transposon-based vector systems. Here, we investigate the potential for hybrid piggyBac/viral vectors to transduce cells and support transposase-mediated genomic integration of the transposon. We tested both adenovirus (Ad) and adeno-associated virus (AAV) as transposon delivery vehicles. An Ad vector expressing hyperactive insect piggyBac transposase (iPB7) was codelivered. We show transposase-dependent transposition activity and mapped integrations in mammalian cells in vitro and in vivo from each viral vector platform. We also demonstrate efficient and persistent transgene expression following nasal delivery of piggyBac/viral vectors to mice. Furthermore, using piggyBac/Ad expressing Cystic Fibrosis transmembrane Conductance Regulator (CFTR), we show persistent correction of chloride current in well-differentiated primary cultures of human airway epithelial cells derived from CF patients. Combining the emerging technologies of DNA transposon-based vectors with well-studied adenoviral and AAV delivery provides new tools for in vivo gene transfer and presents an exciting opportunity to increase the delivery efficiency for therapeutic genes such as CFTR. PMID:25557623

  3. Differential DNA binding properties of three human homeodomain proteins.

    PubMed Central

    Corsetti, M T; Briata, P; Sanseverino, L; Daga, A; Airoldi, I; Simeone, A; Palmisano, G; Angelini, C; Boncinelli, E; Corte, G


    The products of three human homeobox containing (HOX) genes, 2C, 3C and 4B, were produced in insect cells using the Baculovirus expression system and purified to near homogeneity. In this system we observed that the DNA binding forms of the three proteins are not glycosylated. HOX 3C and 4B are phosphorylated in insect cells, while HOX 2C is not. The three HOX proteins bind to a DNA sequence known to be a target site for Antennapedia protein with a very similar affinity (Kd = 1-2 x 10(-9) M). We then measured their binding properties to four human sequences present in the HOX 3D, 4C, 1C and 4B promoters. Two of these sequences have been reported to be binding sites for HOX proteins. HOX 2C, 3C and 4B behaved quite differently, showing low affinity for promoters of genes located upstream from their own gene in the HOX clusters and a higher affinity for regulatory sequences of their own gene and downstream HOX genes. Images PMID:1357628

  4. Computational redesign of endonuclease DNA binding and cleavage specificity

    NASA Astrophysics Data System (ADS)

    Ashworth, Justin; Havranek, James J.; Duarte, Carlos M.; Sussman, Django; Monnat, Raymond J.; Stoddard, Barry L.; Baker, David


    The reprogramming of DNA-binding specificity is an important challenge for computational protein design that tests current understanding of protein-DNA recognition, and has considerable practical relevance for biotechnology and medicine. Here we describe the computational redesign of the cleavage specificity of the intron-encoded homing endonuclease I-MsoI using a physically realistic atomic-level forcefield. Using an in silico screen, we identified single base-pair substitutions predicted to disrupt binding by the wild-type enzyme, and then optimized the identities and conformations of clusters of amino acids around each of these unfavourable substitutions using Monte Carlo sampling. A redesigned enzyme that was predicted to display altered target site specificity, while maintaining wild-type binding affinity, was experimentally characterized. The redesigned enzyme binds and cleaves the redesigned recognition site ~10,000 times more effectively than does the wild-type enzyme, with a level of target discrimination comparable to the original endonuclease. Determination of the structure of the redesigned nuclease-recognition site complex by X-ray crystallography confirms the accuracy of the computationally predicted interface. These results suggest that computational protein design methods can have an important role in the creation of novel highly specific endonucleases for gene therapy and other applications.

  5. Synthesis and DNA-binding properties of novel DNA cyclo-intercalators containing purine-glucuronic acid hybrids.


    Zhang, Renshuai; Chen, Shaopeng; Wang, Xueting; Yu, Rilei; Li, Mingjing; Ren, Sumei; Jiang, Tao


    Novel DNA cyclo-intercalators, which incorporated two intercalator subunits linked by two bridges, were synthesized. Binding of the compounds to calf-thymus DNA was studied by fluorescence spectroscopy, and docking simulations were used to predict the binding modes of these cyclic compounds. The spectral data demonstrated that all of these compounds can interact with CT-DNA. The sugar moiety played an important role in the process of binding between the intercalators containing glucuronic acid and DNA. The length and flexibility of the connecting bridges affected the binding affinity of the resultant cyclo-intercalators. Docking simulations showed that compounds 7 and 8 interact with DNA as mono-intercalators.

  6. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis

    SciTech Connect

    Stella, Stefano; Cascio, Duilio; Johnson, Reid C.


    The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of {approx}65{sup o}, and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.

  7. Contrasting enantioselective DNA preference: chiral helical macrocyclic lanthanide complex binding to DNA.


    Zhao, Chuanqi; Ren, Jinsong; Gregoliński, Janusz; Lisowski, Jerzy; Qu, Xiaogang


    There is great interest in design and synthesis of small molecules which selectively target specific genes to inhibit biological functions in which particular DNA structures participate. Among these studies, chiral recognition has been received much attention because more evidences have shown that conversions of the chirality and diverse conformations of DNA are involved in a series of important life events. Here, we report that a pair of chiral helical macrocyclic lanthanide (III) complexes, (M)-Yb[L(SSSSSS)](3+) and (P)-Yb[L(RRRRRR)](3+), can enantioselectively bind to B-form DNA and show remarkably contrasting effects on GC-rich and AT-rich DNA. Neither of them can influence non-B-form DNA, nor quadruplex DNA stability. Our results clearly show that P-enantiomer stabilizes both poly(dG-dC)(2) and poly(dA-dT)(2) while M-enantiomer stabilizes poly(dA-dT)(2), however, destabilizes poly(dG-dC)(2). To our knowledge, this is the best example of chiral metal compounds with such contrasting preference on GC- and AT-DNA. Ligand selectively stabilizing or destabilizing DNA can interfere with protein-DNA interactions and potentially affect many crucial biological processes, such as DNA replication, transcription and repair. As such, bearing these unique capabilities, the chiral compounds reported here may shed light on the design of novel enantiomers targeting specific DNA with both sequence and conformation preference.

  8. Probing Ca2+-binding capability of viral proteins with the EF-hand motif by grafting approach.


    Zhou, Yubin; Xue, Shenghui; Chen, Yanyi; Yang, Jenny J


    Ca(2+) is implicated in almost every step of the life cycle of viruses, including virus entry into host cells, virus replication, virion assembly, maturation, and release. However, due to the lack of prediction algorithms and rigorous validation methods, only limited cases of viral Ca(2+)-binding sites are reported. Here, we introduce a method to predict continuous EF-hand or EF-hand-like motifs in the viral genomes based on their primary sequences. We then introduce a grafting approach, and the use of luminescence resonance energy transfer and Ca(2+) competition assay for experimental verification of predicted Ca(2+)-binding sites. This protocol will be valuable for the prediction and identification of unknown Ca(2+)-binding sites in virus.

  9. Potent inhibition of DNA unwinding and ATPase activities of pea DNA helicase 45 by DNA-binding agents.


    Pham, Xuan Hoi; Tuteja, Narendra


    Pea DNA helicase 45 (PDH45) is an ATP-dependent DNA unwinding enzyme, with intrinsic DNA-dependent ATPase activity [Plant J. 24 (2000) 219]. We have determined the effect of various DNA-binding agents, such as daunorubicin, ethidium bromide, ellipticine, cisplatin, nogalamycin, actinomycin C1, and camptothecin on the DNA unwinding and ATPase activities of the plant nuclear DNA helicase PDH45. The results show that all the agents except actinomycin C1, and camptothecin inhibited the helicase (apparent K(i) values ranging from 1.5 to 7.0 microM) and ATPase (apparent K(i) values ranging from 2.5 to 11.9 microM) activities. This is the first study to show the effect of various DNA-binding agents on the plant nuclear helicase and also first to demonstrate inhibition of any helicase by cisplatin. Another striking finding that the actinomycin C1 and ellipticine act differentially on PDH45 as compared to pea chloroplast helicase suggests that the mechanism of DNA unwinding could be different in nucleus and chloroplast. These results suggest that the intercalation of the inhibitors into duplex DNA generates a complex that impedes translocation of PDH45, resulting in both the inhibitions of unwinding activity and ATP hydrolysis. This study would be useful to obtain a better understanding of the mechanism of plant nuclear DNA helicase unwinding and the mechanism by which these agents can disturb genome integrity.


    PubMed Central

    Li, Jiangwei; Lee, Ji-Young; Yeung, Edward S.


    We describe a novel quantitative viral screening method based on single-molecule detection that does not require amplification. DNA of human papilloma virus (HPV), the major etiological agent of cervical cancer, served as the screening target in this study. Eight 100-nucleotide (nt) single-stranded (ss)-DNA probes were designed complementary to the E6-E7 gene of HPV-16 DNA. The probes were covalently stained with Alexa Fluor 532 and hybridized to the target in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell, and had a linear dynamic range of over six orders of magnitude. In the dual-color mode, we employed fluorescence resonance energy transfer (FRET) and added YOYO-3 dye as the acceptor. The two colors from Alexa Fluor 532 and YOYO-3 were dispersed by a transmission grating located in front of the ICCD. With this reinforced criteria for identifying the hybridized molecules, zero false-positive count was achieved. We also showed that DNA extracts from Pap test specimens did not interfere with the measurements. PMID:16970325

  11. Fluorescence-determined preferential binding of quinacrine to DNA.

    PubMed Central

    Baldini, G; Doglia, S; Dolci, S; Sassi, G


    Quinacrine complexes with native DNA (Calf thymus, Micrococcus lysodeikticus, Escherichia coli, Bacillus subtilis, and Colstridium perfringens) and synthetic polynucleotides (poly(dA) . poly(dT), poly[d(A-T)] . poly[d(A-T)], poly(dG) . poly(dC) and poly[d(G-C)] . poly[d(G-C)]) has been investigated in solution at 0.1 M NaCl, 0.05 M Tris HCl, 0.001 M EDTA, pH 7.5, at 20 degrees C. Fluorescence excitation spectra of complexes with dye concentration D = 5-30 microM and DNA phosphate concentration P = 400 microM have been examined from 300 to 500 nm, while collecting the emission above 520 nm. The amounts of free and bound quinacrine in the dye-DNA complexes have been determined by means of equilibrium dialysis experiments. Different affinities have been found for the various DNAs and their values have been examined with a model that assumes that the binding constants associated with alternating purine and pyrimidine sequences are larger than those relative to nonalternating ones. Among the alternating nearest neighbor base sequences, the Pyr(3'-5')Pur sequences, i.e., C-G, T-G, C-A and T-A seem to bind quinacrine stronger than the remaining sequences. In particular the three sites, where a G . C base pair is involved, are found to display higher affinities. Good agreement is found with recent calculations on the energetics of intercalation sites in DNA. The analysis of the equilibrium shows also that the strength of the excitation spectrum of bound dye depends strongly upon the ratio of bound quinacrine to DNA. This effect can be attributed to dye-dye energy transfer along DNA. PMID:7326321

  12. DNA binding properties of human Cdc45 suggest a function as molecular wedge for DNA unwinding.


    Szambowska, Anna; Tessmer, Ingrid; Kursula, Petri; Usskilat, Christian; Prus, Piotr; Pospiech, Helmut; Grosse, Frank


    The cell division cycle protein 45 (Cdc45) represents an essential replication factor that, together with the Mcm2-7 complex and the four subunits of GINS, forms the replicative DNA helicase in eukaryotes. Recombinant human Cdc45 (hCdc45) was structurally characterized and its DNA-binding properties were determined. Synchrotron radiation circular dichroism spectroscopy, dynamic light scattering, small-angle X-ray scattering and atomic force microscopy revealed that hCdc45 exists as an alpha-helical monomer and possesses a structure similar to its bacterial homolog RecJ. hCdc45 bound long (113-mer or 80-mer) single-stranded DNA fragments with a higher affinity than shorter ones (34-mer). hCdc45 displayed a preference for 3' protruding strands and bound tightly to single-strand/double-strand DNA junctions, such as those presented by Y-shaped DNA, bubbles and displacement loops, all of which appear transiently during the initiation of DNA replication. Collectively, our findings suggest that hCdc45 not only binds to but also slides on DNA with a 3'-5' polarity and, thereby acts as a molecular 'wedge' to initiate DNA strand displacement.

  13. Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions

    PubMed Central

    Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.


    DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

  14. OGG1-DNA interactions facilitate NF-κB binding to DNA targets

    PubMed Central

    Pan, Lang; Hao, Wenjing; Zheng, Xu; Zeng, Xianlu; Ahmed Abbasi, Adeel; Boldogh, Istvan; Ba, Xueqing


    DNA repair protein counteracting oxidative promoter lesions may modulate gene expression. Oxidative DNA bases modified by reactive oxygen species (ROS), primarily as 7, 8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair (BER) pathway. Because cellular response to oxidative challenge is accompanied by DNA damage repair, we tested whether the repair by OGG1 is compatible with transcription factor binding and gene expression. We performed electrophoretic mobility shift assay (EMSA) using wild-type sequence deriving from Cxcl2 gene promoter and the same sequence bearing a single synthetic 8-oxoG at defined 5′ or 3′ guanine in runs of guanines to mimic oxidative effects. We showed that DNA occupancy of NF-κB present in nuclear extracts from tumour necrosis factor alpha (TNFα) exposed cells is OGG1 and 8-oxoG position dependent, importantly, OGG1 counteracting 8-oxoG outside consensus motif had a profound influence on purified NF-κB binding to DNA. Furthermore, OGG1 is essential for NF-κB dependent gene expression, prior to 8-oxoG excised from DNA. These observations imply that pre-excision step(s) during OGG1 initiated BER evoked by ROS facilitates NF-κB DNA occupancy and gene expression. PMID:28266569

  15. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    PubMed Central

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  16. p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner.

    PubMed Central

    Miller, S D; Farmer, G; Prives, C


    The p53 tumor suppressor gene product is a sequence-specific DNA-binding protein that is necessary for the G1 arrest of many cell types. Consistent with its role as a cell cycle checkpoint factor, p53 has been shown to be capable of both transcriptional activation and repression. Here we show a new potential role for p53 as a DNA-binding-dependent regulator of DNA replication. Constructs containing multiple copies of the ribosomal gene cluster (RGC) p53 binding site cloned on the late side of the polyomavirus origin were used in in vitro replication assays. In the presence of p53, the replication of these constructs was strongly inhibited, while the replication of constructs containing a mutant version of the RGC site was not affected by p53. Several tumor-derived mutant p53 proteins were unable to inhibit replication of the construct with wild-type RGC sites. Additionally, the transactivator GAL4-VP16 was unable to inhibit replication of a construct containing GAL4 binding sites adjacent to the polyomavirus origin. We also show that the inhibition by p53 can occur from sites cloned as far as 600 bp from the origin. Preincubation experiments suggest that p53 inhibits replication at a step mediated by ATP, possibly by inhibiting the binding of polyomavirus T antigen to the core origin. The presence of an endogenous p53 binding site in the polyomavirus origin suggests potential mechanisms for the observed inhibition. PMID:8524220

  17. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues

    PubMed Central

    Guo, Jing; Sun, Xiao


    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at PMID:27907159

  18. Molecular beacons for DNA binding proteins: an emerging technology for detection of DNA binding proteins and their ligands.


    Dummitt, Benjamin; Chang, Yie-Hwa


    Quantitation of the level or activity of specific proteins is one of the most commonly performed experiments in biomedical research. Protein detection has historically been difficult to adapt to high throughput platforms because of heavy reliance upon antibodies for protein detection. Molecular beacons for DNA binding proteins is a recently developed technology that attempts to overcome such limitations. Protein detection is accomplished using inexpensive, easy-to-synthesize oligonucleotides, accompanied by a fluorescence readout. Importantly, detection of the protein and reporting of the signal occur simultaneously, allowing for one-step protocols and increased potential for use in high throughput analysis. While the initial iteration of the technology allowed only for the detection of sequence-specific DNA binding proteins, more recent adaptations allow for the possibility of development of beacons for any protein, independent of native DNA binding activity. Here, we discuss the development of the technology, the mechanism of the reaction, and recent improvements and modifications made to improve the assay in terms of sensitivity, potential for multiplexing, and broad applicability.

  19. Cyclophilin A binds to the viral RNA and replication proteins, resulting in inhibition of tombusviral replicase assembly.


    Kovalev, Nikolay; Nagy, Peter D


    Replication of plus-stranded RNA viruses is greatly affected by numerous host-encoded proteins that act as restriction factors. Cyclophilins, which are a large family of cellular prolyl isomerases, have been found to inhibit Tomato bushy stunt tombusvirus (TBSV) replication in a Saccharomyces cerevisiae model based on genome-wide screens and global proteomics approaches. In this report, we further characterize single-domain cyclophilins, including the mammalian cyclophilin A and plant Roc1 and Roc2, which are orthologs of the yeast Cpr1p cyclophilin, a known inhibitor of TBSV replication in yeast. We found that recombinant CypA, Roc1, and Roc2 strongly inhibited TBSV replication in a cell-free replication assay. Additional in vitro studies revealed that CypA, Roc1, and Roc2 cyclophilins bound to the viral replication proteins, and CypA and Roc1 also bound to the viral RNA. These interactions led to inhibition of viral RNA recruitment, the assembly of the viral replicase complex, and viral RNA synthesis. A catalytically inactive mutant of CypA was also able to inhibit TBSV replication in vitro due to binding to the replication proteins and the viral RNA. Overexpression of CypA and its mutant in yeast or plant leaves led to inhibition of tombusvirus replication, confirming that CypA is a restriction factor for TBSV. Overall, the current work has revealed a regulatory role for the cytosolic single-domain Cpr1-like cyclophilins in RNA virus replication.

  20. The RXL motif of the African cassava mosaic virus Rep protein is necessary for rereplication of yeast DNA and viral infection in plants

    SciTech Connect

    Hipp, Katharina; Rau, Peter; Schäfer, Benjamin; Gronenborn, Bruno; Jeske, Holger


    Geminiviruses, single-stranded DNA plant viruses, encode a replication-initiator protein (Rep) that is indispensable for virus replication. A potential cyclin interaction motif (RXL) in the sequence of African cassava mosaic virus Rep may be an alternative link to cell cycle controls to the known interaction with plant homologs of retinoblastoma protein (pRBR). Mutation of this motif abrogated rereplication in fission yeast induced by expression of wildtype Rep suggesting that Rep interacts via its RXL motif with one or several yeast proteins. The RXL motif is essential for viral infection of Nicotiana benthamiana plants, since mutation of this motif in infectious clones prevented any symptomatic infection. The cell-cycle link (Clink) protein of a nanovirus (faba bean necrotic yellows virus) was investigated that activates the cell cycle by binding via its LXCXE motif to pRBR. Expression of wildtype Clink and a Clink mutant deficient in pRBR-binding did not trigger rereplication in fission yeast. - Highlights: • A potential cyclin interaction motif is conserved in geminivirus Rep proteins. • In ACMV Rep, this motif (RXL) is essential for rereplication of fission yeast DNA. • Mutating RXL abrogated viral infection completely in Nicotiana benthamiana. • Expression of a nanovirus Clink protein in yeast did not induce rereplication. • Plant viruses may have evolved multiple routes to exploit host DNA synthesis.

  1. Enhanced neutralising antibody response to bovine viral diarrhoea virus (BVDV) induced by DNA vaccination in calves.


    R El-Attar, Laila M; Thomas, Carole; Luke, Jeremy; A Williams, James; Brownlie, Joe


    DNA vaccination is effective in inducing potent immunity in mice; however it appears to be less so in large animals. Increasing the dose of DNA plasmid to activate innate immunity has been shown to improve DNA vaccine adaptive immunity. Retinoic acid-inducible gene I (RIG-I) is a critical cytoplasmic double-stranded RNA pattern receptor required for innate immune activation in response to viral infection. RIG-I recognise viral RNA and trigger antiviral response, resulting in type I interferon (IFN) and inflammatory cytokine production. In an attempt to enhance the antibody response induced by BVDV DNA in cattle, we expressed BVDV truncated E2 (E2t) and NS3 codon optimised antigens from antibiotic free-plasmid vectors expressing a RIG-I agonist and designated either NTC E2t(co) and NTC NS3(co). To evaluate vaccine efficacy, groups of five BVDV-free calves were intramuscularly injected three times with NTC E2t(co) and NTC NS3(co) vaccine plasmids individually or in combination. Animals vaccinated with our (previously published) conventional DNA vaccines pSecTag/E2 and pTriExNS3 and plasmids expressing RIG-I agonist only presented both the positive and mock-vaccine groups. Our results showed that vaccines coexpressing E2t with a RIG-I agonist induced significantly higher E2 antigen specific antibody response (p<0.05). Additionally, E2t augmented the immune response to NS3 when the two vaccines were delivered in combination. Despite the lack of complete protection, on challenge day 4/5 calves vaccinated with NTC E2t(co) alone or NTC E2t(co) plus NTC NS3(co) had neutralising antibody titres exceeding 1/240 compared to 1/5 in the mock vaccine control group. Based on our results we conclude that co-expression of a RIG-I agonist with viral antigen could enhance DNA vaccine potency in cattle.

  2. Poxvirus DNA Replication

    PubMed Central

    Moss, Bernard


    Poxviruses are large, enveloped viruses that replicate in the cytoplasm and encode proteins for DNA replication and gene expression. Hairpin ends link the two strands of the linear, double-stranded DNA genome. Viral proteins involved in DNA synthesis include a 117-kDa polymerase, a helicase–primase, a uracil DNA glycosylase, a processivity factor, a single-stranded DNA-binding protein, a protein kinase, and a DNA ligase. A viral FEN1 family protein participates in double-strand break repair. The DNA is replicated as long concatemers that are resolved by a viral Holliday junction endonuclease. PMID:23838441

  3. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    SciTech Connect

    Lu, Xun; Guanga, Gerald P; Wan, Cheng; Rose, Robert B


    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G–5C–4 and central C0/G0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.

  4. A robust assay to measure DNA topology-dependent protein binding affinity.


    Litwin, Tamara R; Solà, Maria; Holt, Ian J; Neuman, Keir C


    DNA structure and topology pervasively influence aspects of DNA metabolism including replication, transcription and segregation. However, the effects of DNA topology on DNA-protein interactions have not been systematically explored due to limitations of standard affinity assays. We developed a method to measure protein binding affinity dependence on the topology (topological linking number) of supercoiled DNA. A defined range of DNA topoisomers at equilibrium with a DNA binding protein is separated into free and protein-bound DNA populations using standard nitrocellulose filter binding techniques. Electrophoretic separation and quantification of bound and free topoisomers combined with a simple normalization procedure provide the relative affinity of the protein for the DNA as a function of linking number. Employing this assay we measured topology-dependent DNA binding of a helicase, a type IB topoisomerase, a type IIA topoisomerase, a non-specific mitochondrial DNA binding protein and a type II restriction endonuclease. Most of the proteins preferentially bind negatively supercoiled DNA but the details of the topology-dependent affinity differ among proteins in ways that expose differences in their interactions with DNA. The topology-dependent binding assay provides a robust and easily implemented method to probe topological influences on DNA-protein interactions for a wide range of DNA binding proteins.

  5. Phase Behavior of DNA in the Presence of DNA-Binding Proteins

    PubMed Central

    Le Treut, Guillaume; Képès, François; Orland, Henri


    To characterize the thermodynamical equilibrium of DNA chains interacting with a solution of nonspecific binding proteins, we implemented a Flory-Huggins free energy model. We explored the dependence on DNA and protein concentrations of the DNA collapse. For physiologically relevant values of the DNA-protein affinity, this collapse gives rise to a biphasic regime with a dense and a dilute phase; the corresponding phase diagram was computed. Using an approach based on Hamiltonian paths, we show that the dense phase has either a molten globule or a crystalline structure, depending on the DNA bending rigidity, which is influenced by the ionic strength. These results are valid at the thermodynamical equilibrium and therefore should be consistent with many biological processes, whose characteristic timescales range typically from 1 ms to 10 s. Our model may thus be applied to biological phenomena that involve DNA-binding proteins, such as DNA condensation with crystalline order, which occurs in some bacteria to protect their chromosome from detrimental factors; or transcription initiation, which occurs in clusters called transcription factories that are reminiscent of the dense phase characterized in this study. PMID:26745409

  6. Nucleoprotein of influenza B virus binds to its type A counterpart and disrupts influenza A viral polymerase complex formation

    SciTech Connect

    Jaru-ampornpan, Peera Narkpuk, Jaraspim; Wanitchang, Asawin; Jongkaewwattana, Anan


    Highlights: •FluB nucleoprotein (BNP) can bind to FluA nucleoprotein (ANP). •BNP–ANP interaction inhibits FluA polymerase activity. •BNP binding prevents ANP from forming a functional FluA polymerase complex. •Nuclear localization of BNP is necessary for FluA polymerase inhibition. •Viral RNA is not required for the BNP–ANP interaction. -- Abstract: Upon co-infection with influenza B virus (FluB), influenza A virus (FluA) replication is substantially impaired. Previously, we have shown that the nucleoprotein of FluB (BNP) can inhibit FluA polymerase machinery, retarding the growth of FluA. However, the molecular mechanism underlying this inhibitory action awaited further investigation. Here, we provide evidence that BNP hinders the proper formation of FluA polymerase complex by competitively binding to the nucleoprotein of FluA. To exert this inhibitory effect, BNP must be localized in the nucleus. The interaction does not require the presence of the viral RNA but needs an intact BNP RNA-binding motif. The results highlight the novel role of BNP as an anti-influenza A viral agent and provide insights into the mechanism of intertypic interference.

  7. Identifying DNA Binding Motifs by Combining Data from Different Sources

    SciTech Connect

    Mao, Linyong; Resat, Haluk; Nagib Callaos; Katsuhisa Horimoto; Jake Chen; Amy Sze Chan


    A transcription factor regulates the expression of its target genes by binding to their operator regions. It functions by affecting the interactions between RNA polymerases and the gene's promoter. Many transcription factors bind to their targets by recognizing a specific DNA sequence pattern, which is referred to as a consensus sequence or a motif. Since it would remove the possible biases, combining biological data from different sources can be expected to improve the quality of the information extracted from the biological data. We analyzed the microarray gene expression data and the organism's genome sequence jointly to determine the transcription factor recognition sequences with more accuracy. Utilizing such a data integration approach, we have investigated the regulation of the photosynthesis genes of the purple non-sulphur photosynthetic bacterium Rhodobacter sphaeroides. The photosynthesis genes in this organism are tightly regulated as a function of environmental growth conditions by three major regulatory systems, PrrB/PrrA, AppA/PpsR and FnrL. In this study, we have detected a previously undefined PrrA consensus sequence, improved the previously known DNA-binding motif of PpsR, and confirmed the consensus sequence of the global regulator FnrL.

  8. Studies of the viral binding proteins of shrimp BP53, a receptor of white spot syndrome virus.


    Li, Chen; Gao, Xiao-Xiao; Huang, Jie; Liang, Yan


    The specific binding between viral attachment proteins (VAPs) of a virus and its cellular receptors on host cells mediates virus entry into host cells, which triggers subsequent viral infections. Previous studies indicate that F1 ATP synthase β subunit (named BP53), is found on the surface of shrimp cells and involved in white spot syndrome virus (WSSV) infection by functioning as a potential viral receptor. Herein, in a far-western blotting assay, three WSSV proteins with molecular weights of 28 kDa, 37 kDa, and >50 kDa were found to interact with BP53. The 28 kDa and 37 kDa proteins were identified as the envelope protein VP28 and VP37 of WSSV respectively, which could be recognized by the polyclonal antibodies. Enzyme-linked immunosorbent binding assays revealed that VP37 contributed to almost 80% of the binding capability for BP53 compared with the same amount of total WSSV protein. The relationship between BP53 and its complementary interacting protein, VP37, was visualized using a co-localization assay. Bound VP37 on the cell surface co-localized with BP53 and shared a similar subcellular location on the outer surface of shrimp cells. Pearson's correlation coefficients reached to 0.67 ± 0.05 and the Mander's overlap coefficients reached 0.70 ± 0.05, which indicated a strong relationship between the localization of BP53 and bound rVP37. This provides evidence for an interaction between BP53 and VP37 obtained at the molecular and cellular levels, supporting the hypothesis that BP53 serves as a receptor for WSSV by binding to VP37. The identification of the viral binding proteins of shrimp BP53 is helpful for better understanding the pathogenic mechanisms of WSSV to infect shrimp at the cellular level.

  9. Improving the MVA Vaccine Potential by Deleting the Viral Gene Coding for the IL-18 Binding Protein

    PubMed Central

    Pascutti, María Fernanda; Rodríguez, Ana María; Maeto, Cynthia; Perdiguero, Beatriz; Gómez, Carmen E.; Esteban, Mariano; Calamante, Gabriela; Gherardi, María Magdalena


    Background Modified Vaccinia Ankara (MVA) is an attenuated strain of Vaccinia virus (VACV) currently employed in many clinical trials against HIV/AIDS and other diseases. MVA still retains genes involved in host immune response evasion, enabling its optimization by removing some of them. The aim of this study was to evaluate cellular immune responses (CIR) induced by an IL-18 binding protein gene (C12L) deleted vector (MVAΔC12L). Methodology/Principal Findings BALB/c and C57BL/6 mice were immunized with different doses of MVAΔC12L or MVA wild type (MVAwt), then CIR to VACV epitopes in immunogenic proteins were evaluated in spleen and draining lymph nodes at acute and memory phases (7 and 40 days post-immunization respectively). Compared with parental MVAwt, MVAΔC12L immunization induced a significant increase of two to three-fold in CD8+ and CD4+ T-cell responses to different VACV epitopes, with increased percentage of anti-VACV cytotoxic CD8+ T-cells (CD107a/b+) during the acute phase of the response. Importantly, the immunogenicity enhancement was also observed after MVAΔC12L inoculation with different viral doses and by distinct routes (systemic and mucosal). Potentiation of MVA's CIR was also observed during the memory phase, in correlation with a higher protection against an intranasal challenge with VACV WR. Of note, we could also show a significant increase in the CIR against HIV antigens such as Env, Gag, Pol and Nef from different subtypes expressed from two recombinants of MVAΔC12L during heterologous DNA prime/MVA boost vaccination regimens. Conclusions/Significance This study demonstrates the relevance of IL-18 bp contribution in the immune response evasion during MVA infection. Our findings clearly show that the deletion of the viral IL-18 bp gene is an effective approach to increase MVA vaccine efficacy, as immunogenicity improvements were observed against vector antigens and more importantly to HIV antigens. PMID:22384183

  10. The biotin repressor: thermodynamic coupling of corepressor binding, protein assembly, and sequence-specific DNA binding.


    Streaker, Emily D; Gupta, Aditi; Beckett, Dorothy


    The Escherichia coli biotin repressor, an allosteric transcriptional regulator, is activated for binding to the biotin operator by the small molecule biotinyl-5'-AMP. Results of combined thermodynamic, kinetic, and structural studies of the protein have revealed that corepressor binding results in disorder to order transitions in the protein monomer that facilitate tighter dimerization. The enhanced stability of the dimer leads to stabilization of the resulting biotin repressor-biotin operator complex. It is not clear, however, that the allosteric response in the system is transmitted solely through the protein-protein interface. In this work, the allosteric mechanism has been quantitatively probed by measuring the biotin operator binding and dimerization properties of three biotin repressor species: the apo or unliganded form, the biotin-bound form, and the holo or bio-5'-AMP-bound form. Comparisons of the pairwise differences in the bioO binding and dimerization energetics for the apo and holo species reveal that the enhanced DNA binding energetics resulting from adenylate binding track closely with the enhanced assembly energetics. However, when the results for repressor pairs that include the biotin-bound species are compared, no such equivalence is observed.

  11. Viral eukaryogenesis: was the ancestor of the nucleus a complex DNA virus?


    Bell, P J


    In the theory of viral eukaryogenesis I propose here, the eukaryotic nucleus evolved from a complex DNA virus. It is proposed that the virus established a persistent presence in the cytoplasm of a methanogenic mycoplasma and evolved into the eukaryotic nucleus by acquiring a set of essential genes from the host genome and eventually usurping its role. It is proposed that several characteristic features of the eukaryotic nucleus derive from its viral ancestry. These include mRNA capping, linear chromosomes, and separation of transcription from translation. In the model, phagocytosis and other membrane fusion-based processes are derived from viral membrane fusion processes and evolved in concert with the nucleus. The coevolution of phagocytosis and the nucleus rendered much of the host archaeal genome redundant since the protoeukaryote could obtain raw materials and energy by engulfing bacterial syntrophs/prey. This redundancy allowed loss of the archaeal chromosome, generating an organism with eukaryotic features. The evolution of phagocytosis allowed the eukaryotes to be the first organisms to occupy the niche of predator.

  12. Coupling between ATP Binding and DNA Cleavage by DNA Topoisomerase II

    PubMed Central

    Mueller-Planitz, Felix; Herschlag, Daniel


    DNA topoisomerase II is a molecular machine that couples ATP hydrolysis to the transport of one DNA segment through a transient break in another segment. To learn about the energetic connectivity that underlies this coupling, we investigated how the ATPase domains exert control over DNA cleavage. We dissected the DNA cleavage reaction by measuring rate and equilibrium constants for the individual reaction steps utilizing defined DNA duplexes in the presence and absence of the nonhydrolyzable ATP analog 5′-adenylyl-β,γ-imidodiphosphate (AMPPNP). Our results revealed the existence of two enzyme conformations whose relative abundance is sensitive to the presence of nucleotides. The predominant species in the absence of nucleotides binds DNA at a diffusion limited rate but cannot efficiently cleave DNA. In the presence of AMPPNP, most of the enzyme is converted to a state in which DNA binding and release is extremely slow but which allows DNA cleavage. A minimal kinetic and thermodynamic framework is established that accounts for the cooperativity of cleavage of the two DNA strands in the presence and absence of bound AMPPNP and includes conformational steps revealed in the kinetic studies. The model unifies available kinetic, thermodynamic, and structural data to provide a description for the reaction in terms of the order and rate of individual reaction steps and the physical nature of the species on the reaction path. Furthermore, this reaction framework provides a foundation for a future in-depth analysis of energy transduction by topoisomerase II, for guiding and interpreting future structural studies, and for analyzing the mechanism of drugs that convert topoisomerase into a cellular poison. PMID:18403371

  13. A case of bilateral human herpes virus 6 panuveitis with genomic viral DNA integration

    PubMed Central


    Background We report a rare case of bilateral panuveitis from human herpes virus 6 (HHV-6) with genomic viral DNA integration in an immunocompromised man. Findings A 59-year-old man with history of multiple myeloma presented with altered mental status, bilateral eye redness, and blurry vision. Examination revealed bilateral diffuse keratic precipitates, 4+ anterior chamber cell, hypopyon, vitritis, and intraretinal hemorrhages. Intraocular fluid testing by polymerase chain reaction (PCR) was positive for HHV-6. The patient was successfully treated with intravitreal foscarnet and intravenous ganciclovir and foscarnet. Despite clinical improvement, his serum HHV-6 levels remained high, and it was concluded that he had HHV-6 chromosomal integration. Conclusions HHV-6 should be considered in the differential for infectious uveitis in immunocompromised hosts who may otherwise have a negative work-up. HHV-6 DNA integration may lead to difficulties in disease diagnosis and determining disease resolution. PMID:24995045

  14. Crystal Structure of a Bacterial Topoisomerase IB in Complex with DNA Reveals a Secondary DNA Binding Site

    SciTech Connect

    Patel, Asmita; Yakovleva, Lyudmila; Shuman, Stewart; Mondragón, Alfonso


    Type IB DNA topoisomerases (TopIB) are monomeric enzymes that relax supercoils by cleaving and resealing one strand of duplex DNA within a protein clamp that embraces a {approx}21 DNA segment. A longstanding conundrum concerns the capacity of TopIB enzymes to stabilize intramolecular duplex DNA crossovers and form protein-DNA synaptic filaments. Here we report a structure of Deinococcus radiodurans TopIB in complex with a 12 bp duplex DNA that demonstrates a secondary DNA binding site located on the surface of the C-terminal domain. It comprises a distinctive interface with one strand of the DNA duplex and is conserved in all TopIB enzymes. Modeling of a TopIB with both DNA sites suggests that the secondary site could account for DNA crossover binding, nucleation of DNA synapsis, and generation of a filamentous plectoneme. Mutations of the secondary site eliminate synaptic plectoneme formation without affecting DNA cleavage or supercoil relaxation.

  15. Altering the GTP binding site of the DNA/RNA-binding protein, Translin/TB-RBP, decreases RNA binding and may create a dominant negative phenotype.


    Chennathukuzhi, V M; Kurihara, Y; Bray, J D; Yang, J; Hecht, N B


    The DNA/RNA-binding protein, Translin/Testis Brain RNA-binding protein (Translin/TB-RBP), contains a putative GTP binding site in its C-terminus which is highly conserved. To determine if guanine nucleotide binding to this site functionally alters nucleic acid binding, electrophoretic mobility shift assays were performed with RNA and DNA binding probes. GTP, but not GDP, reduces RNA binding by approximately 50% and the poorly hydrolyzed GTP analog, GTPgammaS, reduces binding by >90% in gel shift and immunoprecipitation assays. No similar reduction of DNA binding is seen. When the putative GTP binding site of TB-RBP, amino acid sequence VTAGD, is altered to VTNSD by site directed mutagenesis, GTP will no longer bind to TB-RBP(GTP) and TB-RBP(GTP) no longer binds to RNA, although DNA binding is not affected. Yeast two-hybrid assays reveal that like wild-type TB-RBP, TB-RBP(GTP) will interact with itself, with wild-type TB-RBP and with Translin associated factor X (Trax). Transfection of TB-RBP(GTP) into NIH 3T3 cells leads to a marked increase in cell death suggesting a dominant negative function for TB-RBP(GTP) in cells. These data suggest TB-RBP is an RNA-binding protein whose activity is allosterically controlled by nucleotide binding.

  16. Interaction of zanamivir with DNA and RNA: Models for drug DNA and drug RNA bindings

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Kahangi, Fatemeh Ghoreyshi; Azizi, Ebrahim; Zebarjad, Nader; Tajmir-Riahi, Heidar-Ali


    Zanamivir (ZAN) is the first of a new generation of influenza virus-specific drugs known as neuraminidase inhibitors, which acts by interfering with life cycles of influenza viruses A and B. It prevents the virus spreading infection to other cells by blocking the neuraminidase enzyme present on the surface of the virus. The aim of this study was to examine the stability and structural features of calf thymus DNA and yeast RNA complexes with zanamivir in aqueous solution, using constant DNA or RNA concentration (12.5 mM) and various zanamivir/polynucleotide ( P) ratios of 1/20, 1/10, 1/4, and 1/2. FTIR and UV-visible spectroscopy are used to determine the drug external binding modes, the binding constant and the stability of zanamivir-DNA and RNA complexes in aqueous solution. Structural analysis showed major interaction of zanamivir with G-C (major groove) and A-T (minor groove) base pairs and minor perturbations of the backbone PO 2 group with overall binding constants of Kzanamivir-DNA = 1.30 × 10 4 M -1 and Kzanamivir-RNA = 1.38 × 10 4 M -1. The drug interaction induces a partial B to A-DNA transition, while RNA remains in A-conformation.

  17. BindUP: a web server for non-homology-based prediction of DNA and RNA binding proteins.


    Paz, Inbal; Kligun, Efrat; Bengad, Barak; Mandel-Gutfreund, Yael


    Gene expression is a multi-step process involving many layers of regulation. The main regulators of the pathway are DNA and RNA binding proteins. While over the years, a large number of DNA and RNA binding proteins have been identified and extensively studied, it is still expected that many other proteins, some with yet another known function, are awaiting to be discovered. Here we present a new web server, BindUP, freely accessible through the website, for predicting DNA and RNA binding proteins using a non-homology-based approach. Our method is based on the electrostatic features of the protein surface and other general properties of the protein. BindUP predicts nucleic acid binding function given the proteins three-dimensional structure or a structural model. Additionally, BindUP provides information on the largest electrostatic surface patches, visualized on the server. The server was tested on several datasets of DNA and RNA binding proteins, including proteins which do not possess DNA or RNA binding domains and have no similarity to known nucleic acid binding proteins, achieving very high accuracy. BindUP is applicable in either single or batch modes and can be applied for testing hundreds of proteins simultaneously in a highly efficient manner.

  18. Characterization of human herpesvirus 6A/B U94 as ATPase, helicase, exonuclease and DNA-binding proteins

    PubMed Central

    Trempe, Frédéric; Gravel, Annie; Dubuc, Isabelle; Wallaschek, Nina; Collin, Vanessa; Gilbert-Girard, Shella; Morissette, Guillaume; Kaufer, Benedikt B.; Flamand, Louis


    Human herpesvirus-6A (HHV-6A) and HHV-6B integrate their genomes into the telomeres of human chromosomes, however, the mechanisms leading to integration remain unknown. HHV-6A/B encode a protein that has been proposed to be involved in integration termed U94, an ortholog of adeno-associated virus type 2 (AAV-2) Rep68 integrase. In this report, we addressed whether purified recombinant maltose-binding protein (MBP)-U94 fusion proteins of HHV-6A/B possess biological functions compatible with viral integration. We could demonstrate that MBP-U94 efficiently binds both dsDNA and ssDNA containing telomeric repeats using gel shift assay and surface plasmon resonance. MBP-U94 is also able to hydrolyze adenosine triphosphate (ATP) to ADP, providing the energy for further catalytic activities. In addition, U94 displays a 3′ to 5′ exonuclease activity on dsDNA with a preference for 3′-recessed ends. Once the DNA strand reaches 8–10 nt in length, the enzyme dissociates it from the complementary strand. Lastly, MBP-U94 compromises the integrity of a synthetic telomeric D-loop through exonuclease attack at the 3′ end of the invading strand. The preferential DNA binding of MBP-U94 to telomeric sequences, its ability to hydrolyze ATP and its exonuclease/helicase activities suggest that U94 possesses all functions required for HHV-6A/B chromosomal integration. PMID:25999342

  19. Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

    SciTech Connect

    Chen, L.-W.; Raghavan, Vineetha; Chang, Pey-Jium; Shedd, Duane; Heston, Lee; Delecluse, Henri-Jacques; Miller, George


    The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalanines (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of

  20. Base specific binding of deoxyguanylate and deoxycytidylate antibodies to double stranded DNA.

    PubMed Central

    Jacob, A; Jacob, T M


    Antibodies raised in rabbits against deoxyguanylate and deoxycytidylate bind to 3H-lambda double stranded DNA and the binding is base specific. The concentrations of antibody populations that bind to double stranded DNA are much less than those binding to denatured DNA. Due to their low concentrations, these antibodies were not detected in earlier studies. These antibodies are expected to be useful to probe the conformational flexibilities of double stranded DNAs. PMID:6217448

  1. DNA sensing by a Eu-binding peptide containing a proflavine unit.


    Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale


    Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

  2. A designed DNA binding motif that recognizes extended sites and spans two adjacent major grooves†

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; García-Fandiño, Rebeca; Vázquez, M. Eugenio; Mascareñas, José L.


    We report the rational design of a DNA-binding peptide construct composed of the DNA-contacting regions of two transcription factors (GCN4 and GAGA) linked through an AT-hook DNA anchor. The resulting chimera, which represents a new, non-natural DNA binding motif, binds with high affinity and selectivity to a long composite sequence of 13 base pairs (TCAT-AATT-GAGAG). PMID:27252825

  3. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication.


    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanpin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang


    The interplay between the host and Human cytomegalovirus (HCMV) plays a pivotal role in the outcome of an infection. HCMV growth in endothelial and epithelial cells requires expression of viral proteins UL128, UL130, and UL131 proteins (UL128-131), of which UL130 is the largest gene and the only one that is not interrupted by introns.Mutation of the C terminus of the UL130 protein causes reduced tropism of endothelial cells (EC). However, very few host factors have been identified that interact with the UL130 protein. In this study, HCMV UL130 protein was shown to directly interact with the human protein Snapin in human embryonic kidney HEK293 cells by Yeast two-hybrid screening, in vitro glutathione S-transferase (GST) pull-down, and co-immunoprecipitation. Additionally, heterologous expression of protein UL130 revealed co-localization with Snapin in the cell membrane and cytoplasm of HEK293 cells using fluorescence confocal microscopy. Furthermore, decreasing the level of Snapin via specific small interfering RNAs decreased the number of viral DNA copies and titer inHCMV-infected U373-S cells. Taken together, these results suggest that Snapin, the pUL130 interacting protein, has a role in modulating HCMV DNA synthesis.

  4. Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing

    PubMed Central

    Blevins, Todd; Rajeswaran, Rajendran; Shivaprasad, Padubidri V.; Beknazariants, Daria; Si-Ammour, Azeddine; Park, Hyun-Sook; Vazquez, Franck; Robertson, Dominique; Meins, Frederick; Hohn, Thomas; Pooggin, Mikhail M.


    Like other eukaryotes, plants use DICER-LIKE (DCL) proteins as the central enzymes of RNA silencing, which regulates gene expression and mediates defense against viruses. But why do plants like Arabidopsis express four DCLs, a diversity unmatched by other kingdoms? Here we show that two nuclear DNA viruses (geminivirus CaLCuV and pararetrovirus CaMV) and a cytoplasmic RNA tobamovirus ORMV are differentially targeted by subsets of DCLs. DNA virus-derived small interfering RNAs (siRNAs) of specific size classes (21, 22 and 24 nt) are produced by all four DCLs, including DCL1, known to process microRNA precursors. Specifically, DCL1 generates 21 nt siRNAs from the CaMV leader region. In contrast, RNA virus infection is mainly affected by DCL4. While the four DCLs are partially redundant for CaLCuV-induced mRNA degradation, DCL4 in conjunction with RDR6 and HEN1 specifically facilitates extensive virus-induced silencing in new growth. Additionally, we show that CaMV infection impairs processing of endogenous RDR6-derived double-stranded RNA, while ORMV prevents HEN1-mediated methylation of small RNA duplexes, suggesting two novel viral strategies of silencing suppression. Our work highlights the complexity of virus interaction with host silencing pathways and suggests that DCL multiplicity helps mediate plant responses to diverse viral infections. PMID:17090584

  5. Efficient Non-Viral Ocular Gene Transfer with Compacted DNA Nanoparticles

    PubMed Central

    Farjo, Rafal; Skaggs, Jeff; Quiambao, Alexander B.; Cooper, Mark J.; Naash, Muna I.


    Background The eye is an excellent candidate for gene therapy as it is immune privileged and much of the disease-causing genetics are well understood. Towards this goal, we evaluated the efficiency of compacted DNA nanoparticles as a system for non-viral gene transfer to ocular tissues. The compacted DNA nanoparticles examined here have been shown to be safe and effective in a human clinical trial, have no theoretical limitation on plasmid size, do not provoke immune responses, and can be highly concentrated. Methods and Findings Here we show that these nanoparticles can be targeted to different tissues within the eye by varying the site of injection. Almost all cell types of the eye were capable of transfection by the nanoparticle and produced robust levels of gene expression that were dose-dependent. Most impressively, subretinal delivery of these nanoparticles transfected nearly all of the photoreceptor population and produced expression levels almost equal to that of rod opsin, the highest expressed gene in the retina. Conclusions As no deleterious effects on retinal function were observed, this treatment strategy appears to be clinically viable and provides a highly efficient non-viral technology to safely deliver and express nucleic acids in the retina and other ocular tissues. PMID:17183666

  6. DNA Vaccination Partially Protects Muskellunge against Viral Hemorrhagic Septicemia Virus (VHSV-IVb).


    Millard, Elena V; Bourke, Ashley M; LaPatra, Scott E; Brenden, Travis O; Fitzgerald, Scott D; Faisal, Mohamed


    A DNA vaccine containing the glycoprotein (G) gene of the North American viral hemorrhagic septicemia virus (VHSV) genotype IVb was developed to evaluate the immune response of fish following vaccination and evaluate its efficacy in protecting a susceptible species, the Muskellunge Esox masquinongy, against VHSV-IVb challenge. Seven weeks (539 degree-days) following vaccination with 10 μg of either pVHSivb-G or a control plasmid, Muskellunge were challenged by immersion with 10(5) plaque-forming units (pfu)/mL of VHSV-IVb. Fish vaccinated with pVHSivb-G had a relative percent survival (RPS) of 45%. Vaccinated fish also had significantly lower mean viral titers in tissues (4.2 × 10(2) pfu/g) and viral prevalence (4%) than fish receiving the plasmid control vaccine (3.3 × 10(5) pfu/g; 82%). Neutralizing antibodies were detected 28 d (308 degree-days) postchallenge (11 weeks postvaccination) in 100% of Muskellunge vaccinated with pVHSivb-G compared with only 12% of plasmid-control-vaccinated Muskellunge, suggesting robust induction of a secondary, adaptive immune response. In addition, pVHSivb-G-vaccinated Rainbow Trout Oncorhynchus mykiss challenged 7 d (100 degree-days) postvaccination with the heterologous novirhabdovirus, infectious hematopoietic necrosis virus (IHNV), experienced an RPS of 61%, compared to control fish, suggesting induction of an early and transient nonspecific antiviral immune response. This study provides an important starting point for VHSV-IVb vaccine development and useful information about the antiviral immune response elicited by DNA vaccination in a nondomesticated fish species. Received May 1, 2016; accepted September 1, 2016.

  7. Identification of amino acids essential for DNA binding and dimerization in p67SRF: implications for a novel DNA-binding motif.

    PubMed Central

    Sharrocks, A D; Gille, H; Shaw, P E


    The serum response factor (p67SRF) binds to a palindromic sequence in the c-fos serum response element (SRE). A second protein, p62TCF binds in conjunction with p67SRF to form a ternary complex, and it is through this complex that growth factor-induced transcriptional activation of c-fos is thought to take place. A 90-amino-acid peptide, coreSRF, is capable for dimerizing, binding DNA, and recruiting p62TCF. By using extensive site-directed mutagenesis we have investigated the role of individual coreSRF amino acids in DNA binding. Mutant phenotypes were defined by gel retardation and cross-linking analyses. Our results have identified residues essential for either DNA binding or dimerization. Three essential basic amino acids whose conservative mutation severely reduced DNA binding were identified. Evidence which is consistent with these residues being on the face of a DNA binding alpha-helix is presented. A phenylalanine residue and a hexameric hydrophobic box are identified as essential for dimerization. The amino acid phasing is consistent with the dimerization interface being presented as a continuous region on a beta-strand. A putative second alpha-helix acts as a linker between these two regions. This study indicates that p67SRF is a member of a protein family which, in common with many DNA binding proteins, utilize an alpha-helix for DNA binding. However, this alpha-helix is contained within a novel domain structure. Images PMID:8417320

  8. Dynamical DNA accessibility induced by chromatin remodeling and protein binding

    NASA Astrophysics Data System (ADS)

    Montel, F.; Faivre-Moskalenko, C.; Castelnovo, M.


    Chromatin remodeling factors are enzymes being able to alter locally chromatin structure at the nucleosomal level and they actively participate in the regulation of gene expression. Using simple rules for individual nucleosome motion induced by a remodeling factor, we designed simulations of the remodeling of oligomeric chromatin, in order to address quantitatively collective effects in DNA accessibility upon nucleosome mobilization. Our results suggest that accessibility profiles are inhomogeneous thanks to borders effects like protein binding. Remarkably, we show that the accessibility lifetime of DNA sequence is roughly doubled in the vicinity of borders as compared to its value in bulk regions far from the borders. These results are quantitatively interpreted as resulting from the confined diffusion of a large nucleosome depleted region.

  9. Methyl-binding DNA capture Sequencing for Patient Tissues

    PubMed Central

    Jadhav, Rohit R.; Wang, Yao V.; Hsu, Ya-Ting; Liu, Joseph; Garcia, Dawn; Lai, Zhao; Huang, Tim H. M.; Jin, Victor X.


    Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System). PMID:27842364

  10. How hormone receptor-DNA binding affects nucleosomal DNA: the role of symmetry.

    PubMed Central

    Bishop, T C; Kosztin, D; Schulten, K


    Molecular dynamics simulations have been employed to determine the optimal conformation of an estrogen receptor DNA binding domain dimer bound to a consensus response element, ds(AGGTCACAGTGACCT), and to a nonconsensus response element, ds(AGAACACAGTGACCT). The structures simulated were derived from a crystallographic structure and solvated by a sphere (45-A radius) of explicit water and counterions. Long-range electrostatic interactions were accounted for during 100-ps simulations by means of a fast multipole expansion algorithm combined with a multiple time-step scheme in the molecular dynamics package NAMD. The simulations demonstrate that the dimer induces a bent and underwound (10.7 bp/turn) conformation in the DNA. The bending reflects the dyad symmetry of the receptor dimer and can be described as an S-shaped curve in the helical axis of DNA when projected onto a plane. A similar bent and underwound conformation is observed for nucleosomal DNA near the nucleosome's dyad axis that reflects the symmetry of the histone octamer. We propose that when a receptor dimer binds to a nucleosome, the most favorable dimer-DNA and histone-DNA interactions are achieved if the respective symmetry axes are aligned. Such positioning of a receptor dimer over the dyad of nucleosome B in the mouse mammary tumor virus promoter is in agreement with experiment. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 9 FIGURE 11 PMID:9129808

  11. Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps.


    Martinez, A; Kolter, R


    Reactive oxygen species can damage most cellular components, but DNA appears to be the most sensitive target of these agents. Here we present the first evidence of DNA protection against the toxic and mutagenic effects of oxidative damage in metabolically active cells: direct protection of DNA by Dps, an inducible nonspecific DNA-binding protein from Escherichia coli. We demonstrate that in a recA-deficient strain, expression of Dps from an inducible promoter prior to hydrogen peroxide challenge increases survival and reduces the number of chromosomal single-strand breaks. dps mutants exhibit increased levels of the G x C-->T x A mutations characteristic of oxidative damage after treatment with hydrogen peroxide. In addition, expression of Dps from the inducible plasmid reduces the frequency of spontaneous G x C-->T x A and A x T-->T x A mutations and can partially suppress the mutator phenotype of mutM (fpg) and mutY alleles. In a purified in vitro system, Dps reduces the number of DNA single-strand breaks and Fpg-sensitive sites introduced by hydrogen peroxide treatment, indicating that the protection observed in vivo is a direct effect of DNA binding by Dps. The widespread conservation of Dps homologs among prokaryotes suggests that this may be a general strategy for coping with oxidative stress.

  12. The genome of the brown alga Ectocarpus siliculosus contains a series of viral DNA pieces, suggesting an ancient association with large dsDNA viruses

    PubMed Central


    Background Ectocarpus siliculosus virus-1 (EsV-1) is a lysogenic dsDNA virus belonging to the super family of nucleocytoplasmic large DNA viruses (NCLDV) that infect Ectocarpus siliculosus, a marine filamentous brown alga. Previous studies indicated that the viral genome is integrated into the host DNA. In order to find the integration sites of the viral genome, a genomic library from EsV-1-infected algae was screened using labelled EsV-1 DNA. Several fragments were isolated and some of them were sequenced and analyzed in detail. Results Analysis revealed that the algal genome is split by a copy of viral sequences that have a high identity to EsV-1 DNA sequences. These fragments are interspersed with DNA repeats, pseudogenes and genes coding for products involved in DNA replication, integration and transposition. Some of these gene products are not encoded by EsV-1 but are present in the genome of other members of the NCLDV family. Further analysis suggests that the Ectocarpus algal genome contains traces of the integration of a large dsDNA viral genome; this genome could be the ancestor of the extant NCLDV genomes. Furthermore, several lines of evidence indicate that the EsV-1 genome might have originated in these viral DNA pieces, implying the existence of a complex integration and recombination system. A protein similar to a new class of tyrosine recombinases might be a key enzyme of this system. Conclusion Our results support the hypothesis that some dsDNA viruses are monophyletic and evolved principally through genome reduction. Moreover, we hypothesize that phaeoviruses have probably developed an original replication system. PMID:18405387

  13. Two Subclasses of Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle Promoters Distinguished by Open Reading Frame 50 Mutant Proteins That Are Deficient in Binding to DNA

    PubMed Central

    Chang, Pey-Jium; Shedd, Duane; Miller, George


    A transcriptional activator encoded in open reading frame 50 (ORF50) of the Kaposi's sarcoma-associated herpesvirus (KSHV) genome initiates the viral lytic cycle. Here we classify four lytic cycle genes on the basis of several characteristics of the ORF50 response elements (ORF50 REs) in their promoters: nucleotide sequence homology, the capacity to bind ORF50 protein in vitro, the ability to bind the cellular protein RBP-Jκ in vitro, and the capacity to confer activation by DNA binding-deficient mutants of ORF50 protein. ORF50 expressed in human cells binds the promoters of PAN and K12 but does not bind ORF57 or vMIP-1 promoters. Conversely, the RBP-Jκ protein binds ORF57 and vMIP-1 but not PAN or K12 promoters. DNA binding-deficient mutants of ORF50 protein differentiate these two subclasses of promoters in reporter assays; the PAN and K12 promoters cannot be activated, while the ORF57 and vMIP-1 promoters are responsive. Although DNA binding-deficient mutants of ORF50 protein are defective in activating direct targets, they are nonetheless capable of activating the lytic cascade of KSHV. Significantly, DNA binding-deficient ORF50 mutants are competent to autostimulate expression of endogenous ORF50 and to autoactivate ORF50 promoter reporters. The experiments show that ORF50 protein activates downstream targets by at least two distinct mechanisms: one involves direct binding of ORF50 REs in promoter DNA; the other mechanism employs interactions with the RBP-Jκ cellular protein bound to promoter DNA in the region of the ORF50 RE. The DNA binding-deficient mutants allow classification of ORF50-responsive genes and will facilitate study of the several distinct mechanisms of activation of KSHV lytic cycle genes that are under the control of ORF50 protein. PMID:15994769

  14. Two subclasses of Kaposi's sarcoma-associated herpesvirus lytic cycle promoters distinguished by open reading frame 50 mutant proteins that are deficient in binding to DNA.


    Chang, Pey-Jium; Shedd, Duane; Miller, George


    A transcriptional activator encoded in open reading frame 50 (ORF50) of the Kaposi's sarcoma-associated herpesvirus (KSHV) genome initiates the viral lytic cycle. Here we classify four lytic cycle genes on the basis of several characteristics of the ORF50 response elements (ORF50 REs) in their promoters: nucleotide sequence homology, the capacity to bind ORF50 protein in vitro, the ability to bind the cellular protein RBP-Jkappa in vitro, and the capacity to confer activation by DNA binding-deficient mutants of ORF50 protein. ORF50 expressed in human cells binds the promoters of PAN and K12 but does not bind ORF57 or vMIP-1 promoters. Conversely, the RBP-Jkappa protein binds ORF57 and vMIP-1 but not PAN or K12 promoters. DNA binding-deficient mutants of ORF50 protein differentiate these two subclasses of promoters in reporter assays; the PAN and K12 promoters cannot be activated, while the ORF57 and vMIP-1 promoters are responsive. Although DNA binding-deficient mutants of ORF50 protein are defective in activating direct targets, they are nonetheless capable of activating the lytic cascade of KSHV. Significantly, DNA binding-deficient ORF50 mutants are competent to autostimulate expression of endogenous ORF50 and to autoactivate ORF50 promoter reporters. The experiments show that ORF50 protein activates downstream targets by at least two distinct mechanisms: one involves direct binding of ORF50 REs in promoter DNA; the other mechanism employs interactions with the RBP-Jkappa cellular protein bound to promoter DNA in the region of the ORF50 RE. The DNA binding-deficient mutants allow classification of ORF50-responsive genes and will facilitate study of the several distinct mechanisms of activation of KSHV lytic cycle genes that are under the control of ORF50 protein.

  15. Duplex structural differences and not 2'-hydroxyls explain the more stable binding of HIV-reverse transcriptase to RNA-DNA versus DNA-DNA.


    Olimpo, Jeffrey T; DeStefano, Jeffrey J


    Human immunodeficiency virus reverse transcriptase (HIV-RT) binds more stably in binary complexes with RNA-DNA versus DNA-DNA. Current results indicate that only the -2 and -4 RNA nucleotides (-1 hybridized to the 3' recessed DNA base) are required for stable binding to RNA-DNA, and even a single RNA nucleotide conferred significantly greater stability than DNA-DNA. Replacing 2'- hydroxyls on pivotal RNA bases with 2'-O-methyls did not affect stability, indicating that interactions between hydroxyls and RT amino acids do not stabilize binding. RT's K(d) (k(off)/k(on)) for DNA-DNA and RNA-DNA were similar, although k(off) differed almost 40-fold, suggesting a faster k(on) for DNA-DNA. Avian myeloblastosis and Moloney murine leukemia virus RTs also bound more stably to RNA-DNA, but the difference was less pronounced than with HIV-RT. We propose that the H- versus B-form structures of RNA-DNA and DNA-DNA, respectively, allow the former to conform more easily to HIV-RT's binding cleft, leading to more stable binding. Biologically, the ability of RT to form a more stable complex on RNA-DNA may aid in degradation of RNA fragments that remain after DNA synthesis.

  16. Ubiquitous cyanobacterial podoviruses in the global oceans unveiled through viral DNA polymerase gene sequences.


    Huang, Sijun; Wilhelm, Steven W; Jiao, Nianzhi; Chen, Feng


    As a major cyanophage group, cyanobacterial podoviruses are important in regulating the biomass and population structure of picocyanobacteria in the ocean. However, little is known about their biogeography in the open ocean. This study represents the first survey of the biodiversity of cyanopodoviruses in the global oceans based on the viral encoded DNA polymerase (pol) gene. A total of 303 DNA pol sequences were amplified by PCR from 10 virus communities collected in the Atlantic and Pacific oceans and the South China Sea. At least five subclusters of cyanopodoviruses were identified in these samples, and one subcluster (subcluster VIII) was found in all sampling sites and comprised approximately 50% of total sequences. The diversity index based on the DNA pol gene sequences recovered through PCR suggests that cyanopodoviruses are less diverse in these oceanic samples than in a previously studied estuarine environment. Although diverse podoviruses were present in the global ocean, each sample was dominated by one major group of cyanopodoviruses. No clear biogeographic patterns were observed using statistical analysis. A metagenomic analysis based on the Global Ocean Sampling database indicates that other types of cyanopodovirus-like DNA pol sequences were present in the global ocean. Together, our study results suggest that cyanopodoviruses are widely distributed in the ocean but their community composition varies with local environments.

  17. Recombinant human MDM2 oncoprotein shows sequence composition selectivity for binding to both RNA and DNA.


    Challen, Christine; Anderson, John J; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N; Lunec, John


    MDM2 is a 90 kDa nucleo-phosphoprotein that binds p53 and other proteins contributing to its oncogenic properties. Its structure includes an amino proximal p53 binding site, a central acidic domain and a carboxy region which incorporates Zinc and Ring Finger domains suggestive of nucleic acid binding or transcription factor function. It has previously been reported that a bacculovirus expressed MDM2 protein binds RNA in a sequence-specific manner through the Ring Finger domain, however, its ability to bind DNA has yet to be examined. We report here that a bacterially expressed human MDM2 protein binds both DNA as well as the previously defined RNA consensus sequence. DNA binding appears selective and involves the carboxy-terminal domain of the molecule. RNA binding is inhibited by an MDM2 specific antibody, which recognises an epitope within the carboxy region of the protein. Selection cloning and sequence analysis of MDM2 DNA binding sequences, unlike RNA binding sequences, revealed no obvious DNA binding consensus sequence, but preferential binding to oligopurine:pyrimidine-rich stretches. Our results suggest that the observed preferential DNA binding may occur through the Zinc Finger or in a charge-charge interaction through the Ring Finger, thereby implying potentially different mechanisms for DNA and RNA MDM2 binding.

  18. Novel approach for selecting the best predictor for identifying the binding sites in DNA binding proteins.


    Nagarajan, R; Ahmad, Shandar; Gromiha, M Michael


    Protein-DNA complexes play vital roles in many cellular processes by the interactions of amino acids with DNA. Several computational methods have been developed for predicting the interacting residues in DNA-binding proteins using sequence and/or structural information. These methods showed different levels of accuracies, which may depend on the choice of data sets used in training, the feature sets selected for developing a predictive model, the ability of the models to capture information useful for prediction or a combination of these factors. In many cases, different methods are likely to produce similar results, whereas in others, the predictors may return contradictory predictions. In this situation, a priori estimates of prediction performance applicable to the system being investigated would be helpful for biologists to choose the best method for designing their experiments. In this work, we have constructed unbiased, stringent and diverse data sets for DNA-binding proteins based on various biologically relevant considerations: (i) seven structural classes, (ii) 86 folds, (iii) 106 superfamilies, (iv) 194 families, (v) 15 binding motifs, (vi) single/double-stranded DNA, (vii) DNA conformation (A, B, Z, etc.), (viii) three functions and (ix) disordered regions. These data sets were culled as non-redundant with sequence identities of 25 and 40% and used to evaluate the performance of 11 different methods in which online services or standalone programs are available. We observed that the best performing methods for each of the data sets showed significant biases toward the data sets selected for their benchmark. Our analysis revealed important data set features, which could be used to estimate these context-specific biases and hence suggest the best method to be used for a given problem. We have developed a web server, which considers these features on demand and displays the best method that the investigator should use. The web server is freely available at

  19. Characterization of a mitochondrial protein binding to single-stranded DNA.

    PubMed Central

    Mignotte, B; Barat, M; Mounolou, J C


    A DNA-binding protein from Xenopus laevis oocyte mitochondria which has been found associated with the D-loop also shows a strong preference for single-stranded DNA. The binding to polynucleotides is dependent on the base composition, but no sequence specificity was found. This protein, called mtSSB, binds tightly and cooperatively to single-stranded DNA. By its amino-acid composition and its binding properties it appears to be similar to the single-stranded DNA-binding proteins found in prokaryotes. PMID:4039816

  20. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.


    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  1. Structural identification of DnaK binding sites within bovine and sheep bactenecin Bac7.


    Zahn, Michael; Kieslich, Bjorn; Berthold, Nicole; Knappe, Daniel; Hoffmann, Ralf; Strater, Norbert


    Bacterial resistance against common antibiotics is an increasing health problem. New pharmaceuticals for the treatment of infections caused by resistant pathogens are needed. Small proline-rich antimicrobial peptides (PrAMPs) from insects are known to bind intracellularly to the conventional substrate binding cleft of the E. coli Hsp70 chaperone DnaK. Furthermore, bactenecins from mammals, members of the cathelicidin family, also contain potential DnaK binding sites. Crystal structures of bovine and sheep Bac7 in complex with the DnaK substrate binding domain show that the peptides bind in the forward binding mode with a leucine positioned in the central hydrophobic pocket. In most structures, proline and arginine residues preceding leucine occupy the hydrophobic DnaK binding sites -1 and -2. Within bovine Bac7, four potential DnaK binding sites were identified.

  2. Electron microscopic mapping of wheat germ RNA polymerase II binding sites on cloned CaMV DNA.

    PubMed Central

    Grellet, F; Cooke, R; Teissere, M; Delseny, M; Xech, J; Penon, P


    The binding sites of wheat germ RNA polymerase II were mapped on the cloned CaMV genome by observation of enzyme-linear DNA complexes by electron microscopy. Twelve sites are observed. Three of them are relatively stable in the presence of heparin and are found at positions 8-9, 21-23, and 41-44 map units on the physical map of the genome. These positions correspond to AT-rich regions of the viral genome which contain potential promoter sites. These results are discussed with reference to current information on the structure and expression of the CaMV genome. Images PMID:7301575

  3. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.


    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A


    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  4. Methylated DNA-binding protein is present in various mammalian cell types

    SciTech Connect

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. ); Ehrlich, K.C. )


    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  5. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.


    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay


    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  6. Proficient Replication of the Yeast Genome by a Viral DNA Polymerase.


    Stodola, Joseph L; Stith, Carrie M; Burgers, Peter M


    DNA replication in eukaryotic cells requires minimally three B-family DNA polymerases: Pol α, Pol δ, and Pol ϵ. Pol δ replicates and matures Okazaki fragments on the lagging strand of the replication fork. Saccharomyces cerevisiae Pol δ is a three-subunit enzyme (Pol3-Pol31-Pol32). A small C-terminal domain of the catalytic subunit Pol3 carries both iron-sulfur cluster and zinc-binding motifs, which mediate interactions with Pol31, and processive replication with the replication clamp proliferating cell nuclear antigen (PCNA), respectively. We show that the entire N-terminal domain of Pol3, containing polymerase and proofreading activities, could be effectively replaced by those from bacteriophage RB69, and could carry out chromosomal DNA replication in yeast with remarkable high fidelity, provided that adaptive mutations in the replication clamp PCNA were introduced. This result is consistent with the model that all essential interactions for DNA replication in yeast are mediated through the small C-terminal domain of Pol3. The chimeric polymerase carries out processive replication with PCNA in vitro; however, in yeast, it requires an increased involvement of the mutagenic translesion DNA polymerase ζ during DNA replication.

  7. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: gp32 monomer binding

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; von Hippel, Peter H.


    Combining biophysical measurements on T4 bacteriophage replication complexes with detailed structural information can illuminate the molecular mechanisms of these ‘macromolecular machines’. Here we use the low energy circular dichroism (CD) and fluorescent properties of site-specifically introduced base analogues to map and quantify the equilibrium binding interactions of short (8 nts) ssDNA oligomers with gp32 monomers at single nucleotide resolution. We show that single gp32 molecules interact most directly and specifically near the 3′-end of these ssDNA oligomers, thus defining the polarity of gp32 binding with respect to the ssDNA lattice, and that only 2–3 nts are directly involved in this tight binding interaction. The loss of exciton coupling in the CD spectra of dimer 2-AP (2-aminopurine) probes at various positions in the ssDNA constructs, together with increases in fluorescence intensity, suggest that gp32 binding directly extends the sugar-phosphate backbone of this ssDNA oligomer, particularly at the 3′-end and facilitates base unstacking along the entire 8-mer lattice. These results provide a model (and ‘DNA map’) for the isolated gp32 binding to ssDNA targets, which serves as the nucleation step for the cooperative binding that occurs at transiently exposed ssDNA sequences within the functioning T4 DNA replication complex. PMID:26275775

  8. The DNA-remodelling activity of DnaD is the sum of oligomerization and DNA-binding activities on separate domains

    PubMed Central

    Carneiro, Maria J. V. M.; Zhang, Wenke; Ioannou, Charikleia; Scott, David J.; Allen, Stephanie; Roberts, Clive J.; Soultanas, Panos


    Summary The Bacillus subtilis DnaD protein is an essential protein that has been implicated in the primosomal step of DNA replication, and recently in global DNA remodelling. Here we show that DnaD consists of two domains with distinct activities; an N-terminal domain (Nd) with oligomerization activity, and a C-terminal domain (Cd) with DNA-binding activity and a second DNA-induced oligomerization activity. Although Cd can bind to DNA and form large nucleoprotein complexes, it does not exhibit global DNA-remodelling activity. The presence of separate Nd does not restore this activity. Our data suggest that the global DNA-remodelling activity of DnaD is the sum of three separate oligomerization and DNA-binding activities residing on two distinct but linked domains. PMID:16677303

  9. R248Q mutation--Beyond p53-DNA binding.


    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L


    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants.

  10. Interaction between adenovirus DNA-binding protein and single-stranded polynucleotides studied by circular dichroism and ultraviolet absorption.


    van Amerongen, H; van Grondelle, R; van der Vliet, P C


    The adenovirus DNA-binding protein (AdDBP) is a multifunctional protein required for viral DNA replication and control of transcription. We have studied the binding of AdDBP to single-stranded M13 DNA and to the homopolynucleotides poly(rA), poly(dA), and poly(dT) by means of circular dichroism (CD) and optical density (OD) measurements. The binding to all these polynucleotides was strong and nearly stoichiometric. Titration experiments showed that the size of the binding site is 9-11 nucleotides long for M13 DNA, poly(dA), and poly(rA). A higher value (15.0 +/- 0.8) was found for poly(dT). Pronounced changes in the circular dichroism and optical density spectra were observed upon binding of AdDBP. In general, both the positive peak around 260-270 nm and the negative peak around 240-250 nm in the CD spectra decreased in intensity, and a shift of the crossover point to longer wavelengths was found. The OD spectra observed upon binding of AdDBP are remarkably similar to those obtained with prokaryotic helix-destabilizing proteins like bacteriophage T4 gene 32 protein and fd gene 5 protein. The data can best be interpreted by assuming that the AdDBP-polynucleotide complex has a regular, rigid, and extended configuration that satifies two criteria: (1) a considerable tilt of the bases in combination with (2) a small rotation per base and/or a shift of the bases closer to the helix axis.

  11. A systematic survey of the Cys2His2 zinc finger DNA-binding landscape

    PubMed Central

    Persikov, Anton V.; Wetzel, Joshua L.; Rowland, Elizabeth F.; Oakes, Benjamin L.; Xu, Denise J.; Singh, Mona; Noyes, Marcus B.


    Cys2His2 zinc fingers (C2H2-ZFs) comprise the largest class of metazoan DNA-binding domains. Despite this domain's well-defined DNA-recognition interface, and its successful use in the design of chimeric proteins capable of targeting genomic regions of interest, much remains unknown about its DNA-binding landscape. To help bridge this gap in fundamental knowledge and to provide a resource for design-oriented applications, we screened large synthetic protein libraries to select binding C2H2-ZF domains for each possible three base pair target. The resulting data consist of >160 000 unique domain–DNA interactions and comprise the most comprehensive investigation of C2H2-ZF DNA-binding interactions to date. An integrated analysis of these independent screens yielded DNA-binding profiles for tens of thousands of domains and led to the successful design and prediction of C2H2-ZF DNA-binding specificities. Computational analyses uncovered important aspects of C2H2-ZF domain–DNA interactions, including the roles of within-finger context and domain position on base recognition. We observed the existence of numerous distinct binding strategies for each possible three base pair target and an apparent balance between affinity and specificity of binding. In sum, our comprehensive data help elucidate the complex binding landscape of C2H2-ZF domains and provide a foundation for efforts to determine, predict and engineer their DNA-binding specificities. PMID:25593323

  12. Interaction of 6 Mercaptopurine with Calf Thymus DNA – Deciphering the Binding Mode and Photoinduced DNA Damage

    PubMed Central

    Rehman, Sayeed Ur; Yaseen, Zahid; Husain, Mohammed Amir; Sarwar, Tarique; Ishqi, Hassan Mubarak; Tabish, Mohammad


    DNA is one of the major intracellular targets for a wide range of anticancer and antibiotic drugs. Elucidating the binding between small molecules and DNA provides great help in understanding drug-DNA interactions and in designing of new and promising drugs for clinical use. The ability of small molecules to bind and interfere with DNA replication and transcription provides further insight into how the drugs control the expression of genes. Interaction of an antimetabolite anticancer drug 6mercaptopurine (6MP) with calf thymus DNA was studied using various approaches like UV-visible spectroscopy, fluorescence spectroscopy, CD, viscosity and molecular docking. UV-visible spectroscopy confirmed 6MP-DNA interaction. Steady state fluorescence experiments revealed a moderate binding constant of 7.48×103 M−1 which was consistent with an external binding mode. Competitive displacement assays further confirmed a non-intercalative binding mode of 6MP which was further confirmed by CD and viscosity experiments. Molecular docking further revealed the minimum energy conformation (−119.67 kJ/mole) of the complex formed between DNA and 6MP. Hence, the biophysical techniques and in-silico molecular docking approaches confirmed the groove binding/electrostatic mode of interaction between 6MP and DNA. Further, photo induced generation of ROS by 6MP was studied spectrophotometrically and DNA damage was assessed by plasmid nicking and comet assay. There was a significant increase in ROS generation and consequent DNA damage in the presence of light. PMID:24718609

  13. DNA and redox state induced conformational changes in the DNA-binding domain of the Myb oncoprotein.

    PubMed Central

    Myrset, A H; Bostad, A; Jamin, N; Lirsac, P N; Toma, F; Gabrielsen, O S


    The DNA-binding domain of the oncoprotein Myb comprises three imperfect repeats, R1, R2 and R3. Only R2 and R3 are required for sequence-specific DNA-binding. Both are assumed to contain helix-turn-helix (HTH)-related motifs, but multidimensional heteronuclear NMR spectroscopy revealed a disordered structure in R2 where the second HTH helix was predicted [Jamin et al. (1993) Eur. J. Biochem., 216, 147-154]. We propose that the disordered region folds into a 'recognition' helix and generates a full HTH-related motif upon binding to DNA. This would move Cys43 into the hydrophobic core of R2. We observed that Cys43 was accessible to N-ethylmaleimide alkylation in the free protein, but inaccessible in the DNA complex. Mutant proteins with charged (C43D) or polar (C43S) side chains in position 43 bound DNA with reduced affinity, while hydrophobic replacements (C43A, C43V and C43I) gave unaltered or improved DNA-binding. Specific DNA-binding enhanced protease resistance dramatically. Fluorescence emission spectra and quenching experiments supported a DNA-induced conformational change. Moreover, reversible oxidation of Cys43 had an effect similar to the inactivating C43D mutation. The highly oxidizable Cys43 could function as a molecular sensor for a redox regulatory mechanism turning specific DNA-binding on or off by controlling the DNA-induced conformational change in R2. Images PMID:8223472

  14. Dihedral angle preferences of DNA and RNA binding amino acid residues in proteins.


    Ponnuraj, Karthe; Saravanan, Konda Mani


    A protein can interact with DNA or RNA molecules to perform various cellular processes. Identifying or analyzing DNA/RNA binding site amino acid residues is important to understand molecular recognition process. It is quite possible to accurately model DNA/RNA binding amino acid residues in experimental protein-DNA/RNA complex by using the electron density map whereas, locating/modeling the binding site amino acid residues in the predicted three dimensional structures of DNA/RNA binding proteins is still a difficult task. Considering the above facts, in the present work, we have carried out a comprehensive analysis of dihedral angle preferences of DNA and RNA binding site amino acid residues by using a classical Ramachandran map. We have computed backbone dihedral angles of non-DNA/RNA binding residues and used as control dataset to make a comparative study. The dihedral angle preference of DNA and RNA binding site residues of twenty amino acid type is presented. Our analysis clearly revealed that the dihedral angles (φ, ψ) of DNA/RNA binding amino acid residues prefer to occupy (-89° to -60°, -59° to -30°) bins. The results presented in this paper will help to model/locate DNA/RNA binding amino acid residues with better accuracy.

  15. Effect of DNA modifications on DNA processing by HIV-1 integrase and inhibitor binding: role of DNA backbone flexibility and an open catalytic site.


    Johnson, Allison A; Sayer, Jane M; Yagi, Haruhiko; Patil, Sachindra S; Debart, Françoise; Maier, Martin A; Corey, David R; Vasseur, Jean-Jacques; Burke, Terrence R; Marquez, Victor E; Jerina, Donald M; Pommier, Yves


    Integration of the viral cDNA into host chromosomes is required for viral replication. Human immunodeficiency virus integrase catalyzes two sequential reactions, 3'-processing (3'-P) and strand transfer (ST). The first integrase inhibitors are undergoing clinical trial, but interactions of inhibitors with integrase and DNA are not well understood in the absence of a co-crystal structure. To increase our understanding of integrase interactions with DNA, we examined integrase catalysis with oligonucleotides containing DNA backbone, base, and groove modifications placed at unique positions surrounding the 3'-processing site. 3'-Processing was blocked with substrates containing constrained sugars and alpha-anomeric residues, suggesting that integrase requires flexibility of the phosphodiester backbone at the 3'-P site. Of several benzo[a]pyrene 7,8-diol 9,10-epoxide (BaP DE) adducts tested, only the adduct in the minor groove at the 3'-P site inhibited 3'-P, suggesting the importance of the minor groove contacts for 3'-P. ST occurred in the presence of bulky BaP DE DNA adducts attached to the end of the viral DNA suggesting opening of the active site for ST. Position-specific effects of these BaP DE DNA adducts were found for inhibition of integrase by diketo acids. Together, these results demonstrate the importance of DNA structure and specific contacts with the viral DNA processing site for inhibition by integrase inhibitors.

  16. Induction of a Cellular DNA Damage Response by Porcine Circovirus Type 2 Facilitates Viral Replication and Mediates Apoptotic Responses

    PubMed Central

    Wei, Li; Zhu, Shanshan; Wang, Jing; Quan, Rong; Yan, Xu; Li, Zixue; Hou, Lei; Wang, Naidong; Yang, Yi; Jiang, Haijun; Liu, Jue


    Cellular DNA damage response (DDR) triggered by infection of DNA viruses mediate cell cycle checkpoint activation, DNA repair, or apoptosis induction. In the present study, infection of porcine circovirus type 2 (PCV2), which serves as a major etiological agent of PCV2-associated diseases (PCVAD), was found to elicit a DNA damage response (DDR) as observed by the phosphorylation of H2AX and RPA32 following infection. The response requires active viral replication, and all the ATM (ataxia telangiectasia-mutated kinase), ATR (ATM- and Rad3-related kinase), and DNA-PK (DNA-dependent protein kinase) are the transducers of the DDR signaling events in the PCV2-infected cells as demonstrated by the phosphorylation of ATM, ATR, and DNA-PK signalings as well as reductions in their activations after treatment with specific kinase inhibitors. Inhibitions of ATM, ATR, and DNA-PK activations block viral replication and prevent apoptotic responses as observed by decreases in cleaved poly-ADP ribose polymerase (PARP) and caspase-3 as well as fragmented DNA following PCV2 infection. These results reveal that PCV2 is able to exploit the cellular DNA damage response machinery for its own efficient replication and for apoptosis induction, further extending our understanding for the molecular mechanism of PCV2 infection. PMID:27982097

  17. Histones and DNA Compete for Binding Polyphosphoinositides in Bilayers

    PubMed Central

    Lete, Marta G.; Sot, Jesús; Ahyayauch, Hasna; Fernández-Rivero, Noelia; Prado, Adelina; Goñi, Félix M.; Alonso, Alicia


    Recent discoveries on the presence and location of phosphoinositides in the eukaryotic cell nucleoplasm and nuclear membrane prompted us to study the putative interaction of chromatin components with these lipids in model membranes (liposomes). Turbidimetric studies revealed that a variety of histones and histone combinations (H1, H2AH2B, H3H4, octamers) caused a dose-dependent aggregation of phosphatidylcholine vesicles (large unilamellar vesicle or small unilamellar vesicle) containing negatively charged phospholipids. 5 mol % phosphatidylinositol-4-phosphate (PIP) was enough to cause extensive aggregation under our conditions, whereas with phosphatidylinositol (PI) at least 20 mol % was necessary to obtain a similar effect. Histone binding to giant unilamellar vesicle and vesicle aggregation was visualized by confocal microscopy. Histone did not cause vesicle aggregation in the presence of DNA, and the latter was able to disassemble the histone-vesicle aggregates. At DNA/H1 weight ratios 0.1–0.5 DNA- and PIP-bound H1 appear to coexist. Isothermal calorimetry studies revealed that the PIP-H1 association constant was one order of magnitude higher than that of PI-H1, and the corresponding lipid/histone stoichiometries were ∼0.5 and ∼1, respectively. The results suggest that, in the nucleoplasm, a complex interplay of histones, DNA, and phosphoinositides may be taking place, particularly at the nucleoplasmic reticula that reach deep within the nucleoplasm, or during somatic and nonsomatic nuclear envelope assembly. The data described here provide a minimal model for analyzing and understanding the mechanism of these interactions. PMID:24606933

  18. An Improved Method for Identifying Specific DNA-Protein-Binding Sites In Vitro.


    Wang, Liangyan; Lu, Huizhi; Wang, Yunguang; Yang, Su; Xu, Hong; Cheng, Kaiying; Zhao, Ye; Tian, Bing; Hua, Yuejin


    Binding of proteins to specific DNA sequences is essential for a variety of cellular processes such as DNA replication, transcription and responses to external stimuli. Chromatin immunoprecipitation is widely used for determining intracellular DNA fragments bound by a specific protein. However, the subsequent specific or accurate DNA-protein-binding sequence is usually determined by DNA footprinting. Here, we report an alternative method for identifying specific sites of DNA-protein-binding (designated SSDP) in vitro. This technique is mainly dependent on antibody-antigen immunity, simple and convenient, while radioactive isotope labeling and optimization of partial degradation by deoxyribonuclease (DNase) are avoided. As an example, the specific binding sequence of a target promoter by DdrO (a DNA damage response protein from Deinococcus radiodurans) in vitro was determined by the developed method. The central sequence of the binding site could be easily located using this technique.

  19. Design of Sequence-Specific DNA Binding Molecules for DNA Methyltransferase Inhibition

    PubMed Central


    The CpG dyad, an important genomic feature in DNA methylation and transcriptional regulation, is an attractive target for small molecules. To assess the utility of minor groove binding oligomers for CpG recognition, we screened a small library of hairpin pyrrole-imidazole polyamides targeting the sequence 5′-CGCG-3′ and assessed their sequence specificity using an unbiased next-generation sequencing assay. Our findings indicate that hairpin polyamide of sequence PyImβIm-γ-PyImβIm (1), previously identified as a high affinity 5′-CGCG-3′ binder, favors 5′-GCGC-3′ in an unanticipated reverse binding orientation. Replacement of one β alanine with Py to afford PyImPyIm-γ-PyImβIm (3) restores the preference for 5′-CGCG-3′ binding in a forward orientation. The minor groove binding hairpin 3 inhibits DNA methyltransferase activity in the major groove at its target site more effectively than 1, providing a molecular basis for design of sequence-specific antagonists of CpG methylation. PMID:24502234

  20. Integrase residues that determine nucleotide preferences at sites of HIV-1 integration: implications for the mechanism of target DNA binding

    PubMed Central

    Serrao, Erik; Krishnan, Lavanya; Shun, Ming-Chieh; Li, Xiang; Cherepanov, Peter; Engelman, Alan; Maertens, Goedele N.


    Retroviruses favor target-DNA (tDNA) distortion and particular bases at sites of integration, but the mechanism underlying HIV-1 selectivity is unknown. Crystal structures revealed a network of prototype foamy virus (PFV) integrase residues that distort tDNA: Ala188 and Arg329 interact with tDNA bases, while Arg362 contacts the phosphodiester backbone. HIV-1 integrase residues Ser119, Arg231, and Lys258 were identified here as analogs of PFV integrase residues Ala188, Arg329 and Arg362, respectively. Thirteen integrase mutations were analyzed for effects on integrase activity in vitro and during virus infection, yielding a total of 1610 unique HIV-1 integration sites. Purine (R)/pyrimidine (Y) dinucleotide sequence analysis revealed HIV-1 prefers the tDNA signature (0)RYXRY(4), which accordingly favors overlapping flexible dinucleotides at the center of the integration site. Consistent with roles for Arg231 and Lys258 in sequence specific and non-specific binding, respectively, the R231E mutation altered integration site nucleotide preferences while K258E had no effect. S119A and S119T integrase mutations significantly altered base preferences at positions −3 and 7 from the site of viral DNA joining. The S119A preference moreover mimicked wild-type PFV selectivity at these positions. We conclude that HIV-1 IN residue Ser119 and PFV IN residue Ala188 contact analogous tDNA bases to effect virus integration. PMID:24520116

  1. An aromatic-rich loop couples DNA binding and ATP hydrolysis in the PriA DNA helicase.


    Windgassen, Tricia A; Keck, James L


    Helicases couple ATP hydrolysis to nucleic acid binding and unwinding via molecular mechanisms that remain poorly defined for most enzyme subfamilies within the superfamily 2 (SF2) helicase group. A crystal structure of the PriA SF2 DNA helicase, which governs restart of prematurely terminated replication processes in bacteria, revealed the presence of an aromatic-rich loop (ARL) on the presumptive DNA-binding surface of the enzyme. The position and sequence of the ARL was similar to loops known to couple ATP hydrolysis with DNA binding in a subset of other SF2 enzymes, however, the roles of the ARL in PriA had not been investigated. Here, we show that changes within the ARL sequence uncouple PriA ATPase activity from DNA binding. In vitro protein-DNA crosslinking experiments define a residue- and nucleotide-specific interaction map for PriA, showing that the ARL binds replication fork junctions whereas other sites bind the leading or lagging strands. We propose that DNA binding to the ARL allosterically triggers ATP hydrolysis in PriA. Additional SF2 helicases with similarly positioned loops may also couple DNA binding to ATP hydrolysis using related mechanisms.

  2. An aromatic-rich loop couples DNA binding and ATP hydrolysis in the PriA DNA helicase

    PubMed Central

    Windgassen, Tricia A.; Keck, James L.


    Helicases couple ATP hydrolysis to nucleic acid binding and unwinding via molecular mechanisms that remain poorly defined for most enzyme subfamilies within the superfamily 2 (SF2) helicase group. A crystal structure of the PriA SF2 DNA helicase, which governs restart of prematurely terminated replication processes in bacteria, revealed the presence of an aromatic-rich loop (ARL) on the presumptive DNA-binding surface of the enzyme. The position and sequence of the ARL was similar to loops known to couple ATP hydrolysis with DNA binding in a subset of other SF2 enzymes, however, the roles of the ARL in PriA had not been investigated. Here, we show that changes within the ARL sequence uncouple PriA ATPase activity from DNA binding. In vitro protein-DNA crosslinking experiments define a residue- and nucleotide-specific interaction map for PriA, showing that the ARL binds replication fork junctions whereas other sites bind the leading or lagging strands. We propose that DNA binding to the ARL allosterically triggers ATP hydrolysis in PriA. Additional SF2 helicases with similarly positioned loops may also couple DNA binding to ATP hydrolysis using related mechanisms. PMID:27484483

  3. Characterization of How DNA Modifications Affect DNA Binding by C2H2 Zinc Finger Proteins

    PubMed Central

    Patel, A.; Hashimoto, H.; Zhang, X.; Cheng, X.


    Much is known about vertebrate DNA methylation and oxidation; however, much less is known about how modified cytosine residues within particular sequences are recognized. Among the known methylated DNA-binding domains, the Cys2-His2 zinc finger (ZnF) protein superfamily is the largest with hundreds of members, each containing tandem ZnFs ranging from 3 to >30 fingers. We have begun to biochemically and structurally characterize these ZnFs not only on their sequence specificity but also on their sensitivity to various DNA modifications. Rather than following published methods of refolding insoluble ZnF arrays, we have expressed and purified soluble forms of ZnFs, ranging in size from a tandem array of two to six ZnFs, from seven different proteins. We also describe a fluorescence polarization assay to measure ZnFs affinity with oligonucleotides containing various modifications and our approaches for cocrystallization of ZnFs with oligonucleotides. PMID:27372763

  4. Structural basis for cooperative DNA binding by two dimers of the multidrug-binding protein QacR

    PubMed Central

    Schumacher, Maria A.; Miller, Marshall C.; Grkovic, Steve; Brown, Melissa H.; Skurray, Ronald A.; Brennan, Richard G.


    The Staphylococcus aureus multidrug-binding protein QacR represses transcription of the qacA multidrug transporter gene and is induced by multiple structurally dissimilar drugs. QacR is a member of the TetR/CamR family of transcriptional regulators, which share highly homologous N-terminal DNA-binding domains connected to seemingly non-homologous ligand-binding domains. Unlike other TetR members, which bind ∼15 bp operators, QacR recognizes an unusually long 28 bp operator, IR1, which it appears to bind cooperatively. To elucidate the DNA-binding mechanism of QacR, we determined the 2.90 Å resolution crystal structure of a QacR–IR1 complex. Strikingly, our data reveal that the DNA recognition mode of QacR is distinct from TetR and involves the binding of a pair of QacR dimers. In this unique binding mode, recognition at each IR1 half-site is mediated by a complement of DNA contacts made by two helix–turn–helix motifs. The inferred cooperativity does not arise from cross-dimer protein–protein contacts, but from the global undertwisting and major groove widening elicited by the binding of two QacR dimers. PMID:11867549

  5. Noncovalent Binding to DNA: Still a Target in Developing Anticancer Agents.


    Portugal, José; Barceló, Francisca


    DNA-binding compounds are of extraordinary importance in medicine, accounting for a substantial portion of antitumor drugs in clinical usage. However, their mechanisms of action remain sometimes incompletely understood. This review critically examines two broad classes of molecules that bind noncovalently to DNA: intercalators and groove binders. Intercalators bind to DNA by inserting their chromophore moiety between two consecutive base pairs, whereas groove binders fit into the grooves of DNA. Noncovalent DNAinteractive drugs can recognize certain supramolecular DNA structures such as the Gquadruplexes found in telomeres and in numerous gene promoters, and they can act as topoisomerase I and II poisons. We discuss how DNA-binding compounds affect transcription and compete with protein factors for binding to consensus binding sites in gene promoters both in vitro and in cultured cancer cells. Moreover, we comment on the design of molecules that can tightly and specifically bind to any desired target DNA, such as various hairpin polyamides which efficacy as chemotherapeutic agents is being evaluated. At present, genome-wide studies, which provide details of events that may influence both cancer progression and therapeutic outcome, are a common way used to analyze the effects of DNA-binding compounds. A conclusive feature that emerges from reviewing the information on DNA-binding compounds is that both natural sources and chemical approaches can be productively used to obtain drugs to manipulate gene expression in cancer cells.

  6. Artificial zinc finger DNA binding domains: versatile tools for genome engineering and modulation of gene expression.


    Hossain, Mir A; Barrow, Joeva J; Shen, Yong; Haq, Md Imdadul; Bungert, Jörg


    Genome editing and alteration of gene expression by synthetic DNA binding activities gained a lot of momentum over the last decade. This is due to the development of new DNA binding molecules with enhanced binding specificity. The most commonly used DNA binding modules are zinc fingers (ZFs), TALE-domains, and the RNA component of the CRISPR/Cas9 system. These binding modules are fused or linked to either nucleases that cut the DNA and induce DNA repair processes, or to protein domains that activate or repress transcription of genes close to the targeted site in the genome. This review focuses on the structure, design, and applications of ZF DNA binding domains (ZFDBDs). ZFDBDs are relatively small and have been shown to penetrate the cell membrane without additional tags suggesting that they could be delivered to cells without a DNA or RNA intermediate. Advanced algorithms that are based on extensive knowledge of the mode of ZF/DNA interactions are used to design the amino acid composition of ZFDBDs so that they bind to unique sites in the genome. Off-target binding has been a concern for all synthetic DNA binding molecules. Thus, increasing the specificity and affinity of ZFDBDs will have a significant impact on their use in analytical or therapeutic settings.

  7. New Insights into Cooperative Binding of Homeodomain Transcription Factors PREP1 and PBX1 to DNA

    PubMed Central

    Zucchelli, Chiara; Ferrari, Elena; Blasi, Francesco; Musco, Giovanna; Bruckmann, Chiara


    PREP1 and PBX1 are homeodomain (HD) transcription factors that play crucial roles in embryonic development. Here, we present the first biophysical characterization of a PREP1 HD, and the NMR spectroscopic study of its DNA binding pocket. The data show that residues flanking the HD participate in DNA binding. The kinetic parameters for DNA binding of individual PREP1 and PBX1 HDs, and of their combination, show that isolated PREP1 and PBX1 HDs bind to DNA in a cooperative manner. A novel PREP1 motif, flanking the HD at the C-terminus, is required for cooperativity. PMID:28094776

  8. Redox regulation of c-Jun DNA binding by reversible S-glutathiolation.


    Klatt, P; Molina, E P; De Lacoba, M G; Padilla, C A; Martinez-Galesteo, E; Barcena, J A; Lamas, S


    Redox control of the transcription factor c-Jun maps to a single cysteine in its DNA binding domain. However, the nature of the oxidized state of this cysteine and, thus, the potential molecular mechanisms accounting for the redox regulation of c-Jun DNA binding remain unclear. To address this issue, we have analyzed the purified recombinant c-Jun DNA binding domain for redox-dependent thiol modifications and concomitant changes in DNA binding activity. We show that changes in the ratio of reduced to oxidized glutathione provide the potential to oxidize c-Jun sulfhydryls by mechanisms that include both protein disulfide formation and S-glutathiolation. We provide evidence that S-glutathiolation, which is specifically targeted to the cysteine residue located in the DNA binding site of the protein, may account for the reversible redox regulation of c-Jun DNA binding. Furthermore, based on a molecular model of the S-glutathiolated protein, we discuss the structural elements facilitating S-glutathiolation and how this modification interferes with DNA binding. Given the structural similarities between the positively charged cysteine-containing DNA binding motif of c-Jun and the DNA binding site of related oxidant-sensitive transcriptional activators, the unprecedented phenomenon of redox-triggered S-thiolation of a transcription factor described in this report suggests a novel role for protein thiolation in the redox control of transcription.

  9. NonO enhances the association of many DNA-binding proteins to their targets.


    Yang, Y S; Yang, M C; Tucker, P W; Capra, J D


    NonO is an unusual nucleic acid binding protein not only in that it binds both DNA and RNA but that it does so via functionally separable domains. Here we document that NonO enhances the binding of some (E47, OTF-1 and OTF-2) but not all (PEA3) conventional sequence-specific transcription factors to their recognition sites in artificial substrates as well as in an immunoglobulin VHpromoter. We also show that NonO induces the binding of the Ku complex to DNA ends. Ku has no known DNA sequence specificity. These enhancement of binding effects are NonO concentration dependent. Using the E box activity of E47 as a model, kinetic studies demonstrate that the association rate of the protein-DNA complex increases in the presence of NonO while the dissociation rate remains the same, thereby increasing the sum total of the interaction. Oligo competition experiments indicate that NonO does not contact the target DNA in order to enhance the binding activity of DNA binding proteins. Rather, methylation interference analysis reveals that the induced E47 binding-activity has the same DNA-binding sequence specificity as the normal binding. This result suggests that one of the effects of NonO is to induce a true protein-DNA interaction. In this way, it might be possible for NonO to play a crucial role in gene regulation.

  10. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.


    Morris, Gavin; Fanucchi, Sylvia


    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  11. Analyses of the interaction between the origin binding domain from simian virus 40 T antigen and single-stranded DNA provide insights into DNA unwinding and initiation of DNA replication.


    Reese, Danielle K; Meinke, Gretchen; Kumar, Anuradha; Moine, Stephanie; Chen, Kathleen; Sudmeier, James L; Bachovchin, William; Bohm, Andrew; Bullock, Peter A


    DNA helicases are essential for DNA metabolism; however, at the molecular level little is known about how they assemble or function. Therefore, as a model for a eukaryotic helicase, we are analyzing T antigen (T-ag) the helicase encoded by simian virus 40. In this study, nuclear magnetic resonance (NMR) methods were used to investigate the transit of single-stranded DNA (ssDNA) through the T-ag origin-binding domain (T-ag OBD). When the residues that interact with ssDNA are viewed in terms of the structure of a hexamer of the T-ag OBD, comprised of residues 131 to 260, they indicate that ssDNA passes over one face of the T-ag OBD and then transits through a gap in the open ring structure. The NMR-based conclusions are supported by an analysis of previously described mutations that disrupt critical steps during the initiation of DNA replication. These and related observations are discussed in terms of the threading of DNA through T-ag hexamers and the initiation of viral DNA replication.

  12. Analyses of the Interaction between the Origin Binding Domain from Simian Virus 40 T Antigen and Single-Stranded DNA Provide Insights into DNA Unwinding and Initiation of DNA Replication▿

    PubMed Central

    Reese, Danielle K.; Meinke, Gretchen; Kumar, Anuradha; Moine, Stephanie; Chen, Kathleen; Sudmeier, James L.; Bachovchin, William; Bohm, Andrew; Bullock, Peter A.


    DNA helicases are essential for DNA metabolism; however, at the molecular level little is known about how they assemble or function. Therefore, as a model for a eukaryotic helicase, we are analyzing T antigen (T-ag) the helicase encoded by simian virus 40. In this study, nuclear magnetic resonance (NMR) methods were used to investigate the transit of single-stranded DNA (ssDNA) through the T-ag origin-binding domain (T-ag OBD). When the residues that interact with ssDNA are viewed in terms of the structure of a hexamer of the T-ag OBD, comprised of residues 131 to 260, they indicate that ssDNA passes over one face of the T-ag OBD and then transits through a gap in the open ring structure. The NMR-based conclusions are supported by an analysis of previously described mutations that disrupt critical steps during the initiation of DNA replication. These and related observations are discussed in terms of the threading of DNA through T-ag hexamers and the initiation of viral DNA replication. PMID:17005644

  13. Light-activated DNA binding in a designed allosteric protein

    SciTech Connect

    Strickland, Devin; Moffat, Keith; Sosnick, Tobin R.


    An understanding of how allostery, the conformational coupling of distant functional sites, arises in highly evolvable systems is of considerable interest in areas ranging from cell biology to protein design and signaling networks. We reasoned that the rigidity and defined geometry of an {alpha}-helical domain linker would make it effective as a conduit for allosteric signals. To test this idea, we rationally designed 12 fusions between the naturally photoactive LOV2 domain from Avena sativa phototropin 1 and the Escherichia coli trp repressor. When illuminated, one of the fusions selectively binds operator DNA and protects it from nuclease digestion. The ready success of our rational design strategy suggests that the helical 'allosteric lever arm' is a general scheme for coupling the function of two proteins.

  14. Recognition of DNA sequencing through binding of nucleobases to graphene

    NASA Astrophysics Data System (ADS)

    Zaffino, Valentina

    Graphene is one of the most promising materials in nanotechnology. Its large surface to volume ratio, high conductivity and electron mobility at room temperature are outstanding properties for use in DNA sensors. For this study, we used Density Functional Theory (DFT), ?with and without the inclusion of van der Waals (vdW) interactions, ?to investigate the adsorption of nucleobases (cytosine, guanine, adenine, thymine, and uracil) on pristine graphene and graphene with defects (Divacancy and Stone-Wales). We investigated the performance of two types of vdW-DF functional (optB86b-vdW and rPW86-vdW), as well as the PBE functional, and their description of the adsorption geometry and electronic structure of the nucleobase-graphene systems.The inclusion of defects results in an increase in binding energy, closer adsorption of the molecule to graphene and greater buckling in both the graphene structure and nucleobase.

  15. DNA sequencing using polymerase substrate-binding kinetics

    PubMed Central

    Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min


    Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

  16. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    SciTech Connect

    Sweeney, C.; Cutroneo, K.R.


    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with /sup 32/P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of /sup 32/P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined.

  17. Determination of the drug-DNA binding modes using fluorescence-based assays.


    Williams, Alicia K; Dasilva, Sofia Cheliout; Bhatta, Ankit; Rawal, Baibhav; Liu, Melinda; Korobkova, Ekaterina A


    Therapeutic drugs and environmental pollutants may exhibit high reactivity toward DNA bases and backbone. Understanding the mechanisms of drug-DNA binding is crucial for predicting their potential genotoxicity. We developed a fluorescence analytical method for the determination of the preferential binding mode for drug-DNA interactions. Two nucleic acid dyes were employed in the method: TO-PRO-3 iodide (TP3) and 4',6-diamidino-2-phenylindole (DAPI). TP3 binds DNA by intercalation, whereas DAPI exhibits minor groove binding. Both dyes exhibit significant fluorescence magnification on binding to DNA. We evaluated the DNA binding constant, K(b), for each dye. We also performed fluorescence quenching experiments with 11 molecules of various structures and measured a C(50) value for each compound. We determined preferential binding modes for the aforementioned molecules and found that they bound to DNA consistently, as indicated by other studies. The values of the likelihood of DNA intercalation were correlated with the partition coefficients of the molecules. In addition, we performed nuclear magnetic resonance (NMR) studies of the interactions with calf thymus DNA for the three molecules. The results were consistent with the fluorescence method described above. Thus, we conclude that the fluorescence method we developed provides a reliable determination of the likelihoods of the two different DNA binding modes.

  18. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition.


    Wienk, Hans; Slootweg, Jack C; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E


    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition.

  19. Actin-binding Protein Drebrin Regulates HIV-1-triggered Actin Polymerization and Viral Infection*

    PubMed Central

    Gordón-Alonso, Mónica; Rocha-Perugini, Vera; Álvarez, Susana; Ursa, Ángeles; Izquierdo-Useros, Nuria; Martinez-Picado, Javier; Muñoz-Fernández, María A.; Sánchez-Madrid, Francisco


    HIV-1 contact with target cells triggers F-actin rearrangements that are essential for several steps of the viral cycle. Successful HIV entry into CD4+ T cells requires actin reorganization induced by the interaction of the cellular receptor/co-receptor complex CD4/CXCR4 with the viral envelope complex gp120/gp41 (Env). In this report, we analyze the role of the actin modulator drebrin in HIV-1 viral infection and cell to cell fusion. We show that drebrin associates with CXCR4 before and during HIV infection. Drebrin is actively recruited toward cell-virus and Env-driven cell to cell contacts. After viral internalization, drebrin clustering is retained in a fraction of the internalized particles. Through a combination of RNAi-based inhibition of endogenous drebrin and GFP-tagged expression of wild-type and mutant forms, we establish drebrin as a negative regulator of HIV entry and HIV-mediated cell fusion. Down-regulation of drebrin expression promotes HIV-1 entry, decreases F-actin polymerization, and enhances profilin local accumulation in response to HIV-1. These data underscore the negative role of drebrin in HIV infection by modulating viral entry, mainly through the control of actin cytoskeleton polymerization in response to HIV-1. PMID:23926103

  20. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike


    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  1. A cytomegalovirus DNA vaccine induces antibodies that block viral entry into fibroblasts and epithelial cells.


    McVoy, Michael A; Lee, Ronzo; Saccoccio, Frances M; Hartikka, Jukka; Smith, Larry R; Mahajan, Rohit; Wang, Jian Ben; Cui, Xiaohong; Adler, Stuart P


    A vaccine to prevent congenital cytomegalovirus (CMV) infections is a national priority. Investigational vaccines have targeted the viral glycoprotein B (gB) as an inducer of neutralizing antibodies and phosphoprotein 65 (pp65) as an inducer of cytotoxic T cells. Antibodies to gB neutralize CMV entry into all cell types but their potency is low compared to antibodies that block epithelial cell entry through targeting the pentameric complex (gH/gL/UL128/UL130/UL131). Hence, more potent overall neutralizing responses may result from a vaccine that combines gB with pentameric complex-derived antigens. To assess the ability of pentameric complex subunits to generate epithelial entry neutralizing antibodies, DNA vaccines encoding UL128, UL130, and/or UL131 were formulated with Vaxfectin(®), an adjuvant that enhances antibody responses to DNA vaccines. Mice were immunized with individual DNA vaccines or with pair-wise or trivalent combinations. Only the UL130 vaccine induced epithelial entry neutralizing antibodies and no synergy was observed from bi- or trivalent combinations. In rabbits the UL130 vaccine again induced epithelial entry neutralizing antibodies while UL128 or UL131 vaccines did not. To evaluate compatibility of the UL130 vaccine with DNA vaccines encoding gB or pp65, mono-, bi-, or trivalent combinations were evaluated. Fibroblast and epithelial entry neutralizing titers did not differ between rabbits immunized with gB alone vs. gB/UL130, gB/pp65, or gB/UL130/pp65 combinations, indicating a lack of antagonism from coadministration of DNA vaccines. Importantly, gB-induced epithelial entry neutralizing titers were substantially higher than activities induced by UL130, and both fibroblast and epithelial entry neutralizing titers induced by gB alone as well as gB/pp65 or gB/UL130/pp65 combinations were comparable to those observed in sera from humans with naturally-acquired CMV infections. These findings support further development of Vaxfectin

  2. Flow cytometric fluorescence lifetime analysis of DNA binding fluorochromes

    SciTech Connect

    Crissman, Harry A.; Cui, H. H.; Steinkamp, J. A.


    Most flow cytometry (FCM) applications monitor fluorescence intensity to quantitate the various cellular parameters; however, the fluorescence emission also contains information relative to the fluorescence lifetime. Recent developments in FCM (Pinsky et al., 1993; Steinkamp & Crissman, 1993; Steinkamp et al., 1993), provide for the measurement of fluorescence lifetime which is also commonly referred to as fluorescence decay, or the time interval in which a fluorochrome remains in the excited state. Many unbound fluorochromes have characteristic lifetime values that are determined by their molecular structure; however, when the probe becomes bound, the lifetime value is influenced by a number of factors that affect the probe interaction with a target molecule. Monitoring the changes in the lifetime of the probe yields information relating to the molecular conformation, the functional state or activity of the molecular target. In addition, the lifetime values can be used as signatures to resolve the emissions of multiple fluorochrome labels with overlapping emission spectra that cannot be resolved by conventional FCM methodology. Such strategies can increase the number of fluorochrome combinations used in a flow cytometer with a single excitation source. Our studies demonstrate various applications of lifetime measurements for the analysis of the binding of different fluorochromes to DNA in single cells. Data presented in this session will show the utility of lifetime measurements for monitoring changes in chromatin structure associated with cell cycle progression, cellular differentiation, or DNA damage, such as induced during apoptosis. Several studies show that dyes with specificity for nucleic acids display different lifetime values when bound to DNA or to dsRNA. The Phase Sensitive Flow Cytometer is a multiparameter instrument, capable of performing lifetime measurements in conjunction with all the conventional FCM measurements. Future modifications of this

  3. Characterization of single stranded telomeric DNA-binding proteins in cultured soybean (Glycine max) cells.


    Kwon, Chian; Kwon, Kisang; Chung, In Kwon; Kim, Soon Young; Cho, Myeon Haeng; Kang, Bin Goo


    We have identified and characterized a protein factor in soybean (Glycine max) nuclear extracts that binds to plant single stranded telomeric DNA repeats. A single DNA-protein complex was detected in gel retardation assays using synthetic telomeres and nuclear extracts. The protein forming this complex was designated soy-bean (Glycine max) single stranded telomeric DNA-binding protein (Gm-STBP). Gm-STBP binds to single stranded telomeric DNA containing more than two repeats. It does not bind to Tetrahymena, human or mutated plant telomere sequences, and its binding activity is not affected by RNase treatment. Gm-STBP activity gradually decreased after suspension cultures entered stationary phase. A slower migrating band was formed with extracts of earlier and later phases of soybean suspension cultures. Our findings suggest that binding of Gm-STBP to plant single stranded telomeric DNA may play a role in the proper functioning of telomeres during development.

  4. Survey of variation in human transcription factors reveals prevalent DNA binding changes

    PubMed Central

    Barrera, Luis A.; Rogers, Julia M.; Gisselbrecht, Stephen S.; Rossin, Elizabeth J.; Woodard, Jaie; Mariani, Luca; Kock, Kian Hong; Inukai, Sachi; Siggers, Trevor; Shokri, Leila; Gordân, Raluca; Sahni, Nidhi; Cotsapas, Chris; Hao, Tong; Yi, Song; Kellis, Manolis; Daly, Mark J.; Vidal, Marc; Hill, David E.; Bulyk, Martha L.


    Sequencing of exomes and genomes has revealed abundant genetic variation affecting the coding sequences of human transcription factors (TFs), but the consequences of such variation remain largely unexplored. We developed a computational, structure-based approach to evaluate TF variants for their impact on DNA-binding activity and used universal protein binding microarrays to assay sequence-specific DNA-binding activity across 41 reference and 117 variant alleles found in individuals of diverse ancestries and families with Mendelian diseases. We found 77 variants in 28 genes that affect DNA-binding affinity or specificity and identified thousands of rare alleles likely to alter the DNA-binding activity of human sequence-specific TFs. Our results suggest that most individuals have unique repertoires of TF DNA-binding activities, which may contribute to phenotypic variation. PMID:27013732

  5. Structure and assembly of the essential RNA ring component of a viral DNA packaging motor

    SciTech Connect

    Ding, Fang; Lu, Changrui; Zhao, Wei; Rajashankar, Kanagalaghatta R.; Anderson, Dwight L.; Jardine, Paul J.; Grimes, Shelley; Ke, Ailong


    Prohead RNA (pRNA) is an essential component in the assembly and operation of the powerful bacteriophage {psi}29 DNA packaging motor. The pRNA forms a multimeric ring via intermolecular base-pairing interactions between protomers that serves to guide the assembly of the ring ATPase that drives DNA packaging. Here we report the quaternary structure of this rare multimeric RNA at 3.5 {angstrom} resolution, crystallized as tetrameric rings. Strong quaternary interactions and the inherent flexibility helped rationalize how free pRNA is able to adopt multiple oligomerization states in solution. These characteristics also allowed excellent fitting of the crystallographic pRNA protomers into previous prohead/pRNA cryo-EM reconstructions, supporting the presence of a pentameric, but not hexameric, pRNA ring in the context of the DNA packaging motor. The pentameric pRNA ring anchors itself directly to the phage prohead by interacting specifically with the fivefold symmetric capsid structures that surround the head-tail connector portal. From these contacts, five RNA superhelices project from the pRNA ring, where they serve as scaffolds for binding and assembly of the ring ATPase, and possibly mediate communication between motor components. Construction of structure-based designer pRNAs with little sequence similarity to the wild-type pRNA were shown to fully support the packaging of {psi}29 DNA.

  6. Micromethod for phosphonoformate inhibition assay of hepatitis B viral DNA polymerase.


    Lin, H J; Wu, P C; Lai, C L; Chak, W


    A micromethod for the specific measurement of hepatitis B viral DNA polymerase in serum is presented, based on the phosphonoformate inhibition assay (J Med Virol 12: 61-70, 1983). In the micromethod, sample volume is reduced to 120 microL and the ultracentrifugation step is eliminated. The method allows good discrimination between serum infected with hepatitis B virus and uninfected serum. The cutoff value for rate of nucleotide incorporation, based on assays of 41 serum specimens negative for hepatitis B serological markers, was about 15 nU/L (90th percentile). Serum containing hepatitis B surface and antigens exhibited rates of phosphonoformate-inhibitive nucleotide incorporation of 150 (SD 150) nU/L, with an upper 90th percentile range of 17 to 667 nU/L (n = 41). The micromethod makes use of commercially available [32P]dCTP (specific activity about 7000 kCi/mol). 125I-labeled dCTP was found to be unsuitable for this assay. Human DNA polymerases in serum are detected by this method but are excluded from the phosphonoformate-inhibitive fraction.

  7. Theoretical studies on binding modes of copper-based nucleases with DNA.


    Liu, Chunmei; Zhu, Yanyan; Tang, Mingsheng


    In the present work, molecular simulations were performed for the purpose of predicting the binding modes of four types of copper nucleases (a total 33 compounds) with DNA. Our docking results accurately predicted the groove binding and electrostatic interaction for some copper nucleases with B-DNA. The intercalation modes were also reproduced by "gap DNA". The obtained results demonstrated that the ligand size, length, functional groups and chelate ring size bound to the copper center could influence the binding affinities of copper nucleases. The binding affinities obtained from the docking calculations herein also replicated results found using MM-PBSA approach. The predicted DNA binding modes of copper nucleases with DNA will ultimately help us to better understand the interaction of copper compounds with DNA.

  8. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors.


    He, Gaofei; Tolic, Ana; Bashkin, James K; Poon, Gregory M K


    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs' binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs.

  9. Quercetin-Iron Complex: Synthesis, Characterization, Antioxidant, DNA Binding, DNA Cleavage, and Antibacterial Activity Studies.


    Raza, Aun; Xu, Xiuquan; Xia, Li; Xia, Changkun; Tang, Jian; Ouyang, Zhen


    Quercetin-iron (II) complex was synthesized and characterized by elemental analysis, ultraviolet-visible spectrophotometry, fourier transform infrared spectroscopy, mass spectrometry, proton nuclear magnetic resonance spectroscopy, thermogravimetry and differential scanning calorimetry, scanning electron micrography and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal:ligand) of the complex. Antioxidant study of the quercetin and its metal complex against 2, 2-di-phenyl-1-picryl hydrazyl radical showed that the complex has much more radical scavenging activity than free quercetin. The interaction of quercetin-iron (II) complex with DNA was determined using ultraviolet visible spectra, fluorescence spectra and agarose gel electrophoresis. The results showed that quercetin-iron (II) complex can intercalate moderately with DNA, quench a strong intercalator ethidium bromide and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form to nicked circular form and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was an oxidative cleavage pathway. These results revealed the potential nuclease activity of complex to cleave DNA. In addition, antibacterial activity of complex on E.coli and S. aureus was also investigated. The results showed that complex has higher antibacterial activity than ligand.

  10. Rutin-Nickel Complex: Synthesis, Characterization, Antioxidant, DNA Binding, and DNA Cleavage Activities.


    Raza, Aun; Bano, Shumaila; Xu, Xiuquan; Zhang, Rong Xian; Khalid, Haider; Iqbal, Furqan Muhammad; Xia, Changkun; Tang, Jian; Ouyang, Zhen


    The rutin-nickel (II) complex (RN) was synthesized and characterized by elemental analysis, UV-visible spectroscopy, IR, mass spectrometry, (1)H NMR, TG-DSC, SEM, and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal/ligand) of the complex. An antioxidant study of rutin and its metal complex against DPPH radical showed that the complex has more radical scavenging activity than free rutin. The interaction of complex RN with DNA was determined using fluorescence spectra and agarose gel electrophoresis. The results showed that RN can intercalate moderately with DNA, quench a strong intercalator ethidium bromide (EB), and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form (SC) to nicked circular form (NC), and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was a hydrolytic cleavage pathway. These results revealed the potential nuclease activity of the complex to cleave DNA.

  11. Enantiopure copper(II) complex of natural product rosin derivative: DNA binding, DNA cleavage and cytotoxicity.


    Fei, Bao-Li; Yin, Bin; Li, Dong-Dong; Xu, Wu-Shuang; Lu, Yang


    To develop chiral anticancer drug candidates for molecular target DNA, the synthesis and characterization of a novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1) was carried out. The coordination geometry of the copper center is a distorted square-planar arrangement. The interactions of 1 and 2 with salmon sperm DNA were investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. All the results reveal that 1 and 2 interacted with DNA through intercalation and 2 exhibited a higher DNA binding ability. Further, 1 and 2 could cleave supercoiled pBR322 DNA by single strand and 2 displayed stronger cleavage ability in the presence of ascorbic acid. In vitro cytotoxicity of 1 and 2 against HeLa, SiHa, HepG-2 and A431 cancer cell lines was studied using CCK-8 assay. The results indicate that 2 had a superior cytotoxicity than 1 and the widely used drug cisplatin under identical conditions. Flow cytometry analysis demonstrates 2 produced death of HeLa cancer cells through an apoptotic pathway. Cell cycle analysis shows that 2 mainly arrested HeLa cells at the S phase. A novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1), based on natural product rosin has been synthesized. 2 has the potential to act as effective anticancer drug.

  12. Mutations that affect phosphorylation of the adenovirus DNA-binding protein alter its ability to enhance its own synthesis.

    PubMed Central

    Morin, N; Delsert, C; Klessig, D F


    The multifunctional adenovirus single-strand DNA-binding protein (DBP) is highly phosphorylated. Its phosphorylation sites are located in the amino-terminal domain of the protein, and its DNA- and RNA-binding activity resides in the carboxy-terminal half of the polypeptide. We have substituted cysteine or alanine for up to 10 of these potential phosphorylation sites by using oligonucleotide-directed mutagenesis. Alteration of one or a few of these sites had little effect on the viability of virus containing the mutated DBP. However, when eight or more sites were altered, viral growth decreased significantly. This suggests that the overall phosphorylation state of the protein was more important than whether any particular site was modified. The reduction in growth correlated with both depressed DNA replication and expression of late genes. This reduction was probably the result of lower DBP accumulation in mutant-infected cells. Interestingly, although the stability of the mutated DBP was not affected, DBP synthesis and the level of its mRNA were depressed 5- to 10-fold for the underphosphorylated protein. These results suggest that DBP enhances its own expression and imply that phosphorylation of the DBP may be important for this function. Similarities to several eucaryotic transcriptional activators, which are composed of negatively charged activating domains and separate binding domains, are discussed. Images PMID:2585602

  13. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo


    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  14. A Positive Cooperativity Binding Model between Ly49 Natural Killer Cell Receptors and the Viral Immunoevasin m157

    PubMed Central

    Romasanta, Pablo N.; Curto, Lucrecia M.; Urtasun, Nicolas; Sarratea, María B.; Chiappini, Santiago; Miranda, María V.; Delfino, José M.; Mariuzza, Roy A.; Fernández, Marisa M.; Malchiodi, Emilio L.


    Natural killer (NK) cells discriminate between healthy and virally infected or transformed cells using diverse surface receptors that are both activating and inhibitory. Among them, the homodimeric Ly49 NK receptors, which can adopt two distinct conformations (backfolded and extended), are of particular importance for detecting cells infected with mouse cytomegalovirus (CMV) via recognition of the viral immunoevasin m157. The interaction of m157 with activating (Ly49H) and inhibitory (Ly49I) receptors governs the spread of mouse CMV. We carried out kinetic and thermodynamic experiments to elucidate the Ly49/m157 binding mechanism. Combining surface plasmon resonance, fluorescence anisotropy, and circular dichroism (CD), we determined that the best model to describe both the Ly49H/m157 and Ly49I/m157 interactions is a conformational selection mechanism where only the extended conformation of Ly49 (Ly49*) is able to bind the first m157 ligand followed by binding of the Ly49*/m157 complex to the second m157. The interaction is characterized by strong positive cooperativity such that the second m157 binds the Ly49 homodimer with a 1000-fold higher sequential constant than the first m157 (∼108 versus ∼105 m−1). Using far-UV CD, we obtained evidence for a conformational change in Ly49 upon binding m157 that could explain the positive cooperativity. The rate-limiting step of the overall mechanism is a conformational transition in Ly49 from its backfolded to extended form. The global thermodynamic parameters from the initial state (backfolded Ly49 and m157) to the final state (Ly49*/(m157)2) are characterized by an unfavorable enthalpy that is compensated by a favorable entropy, making the interaction spontaneous. PMID:24379405

  15. Duplex structural differences and not 2′-hydroxyls explain the more stable binding of HIV-reverse transcriptase to RNA-DNA versus DNA-DNA

    PubMed Central

    Olimpo, Jeffrey T.; DeStefano, Jeffrey J.


    Human immunodeficiency virus reverse transcriptase (HIV-RT) binds more stably in binary complexes with RNA–DNA versus DNA–DNA. Current results indicate that only the -2 and -4 RNA nucleotides (-1 hybridized to the 3′ recessed DNA base) are required for stable binding to RNA–DNA, and even a single RNA nucleotide conferred significantly greater stability than DNA–DNA. Replacing 2′- hydroxyls on pivotal RNA bases with 2′-O-methyls did not affect stability, indicating that interactions between hydroxyls and RT amino acids do not stabilize binding. RT’s Kd (koff/kon) for DNA–DNA and RNA–DNA were similar, although koff differed almost 40-fold, suggesting a faster kon for DNA–DNA. Avian myeloblastosis and Moloney murine leukemia virus RTs also bound more stably to RNA–DNA, but the difference was less pronounced than with HIV-RT. We propose that the H- versus B-form structures of RNA–DNA and DNA–DNA, respectively, allow the former to conform more easily to HIV-RT’s binding cleft, leading to more stable binding. Biologically, the ability of RT to form a more stable complex on RNA–DNA may aid in degradation of RNA fragments that remain after DNA synthesis. PMID:20338878

  16. PTB Binds to the 3’ Untranslated Region of the Human Astrovirus Type 8: A Possible Role in Viral Replication

    PubMed Central

    Espinosa-Hernández, Wendy; Velez-Uriza, Dora; Valdés, Jesús; Vélez-Del Valle, Cristina; Salas-Benito, Juan; Martínez-Contreras, Rebeca; García-Espítia, Matilde; Salas-Benito, Mariana; Vega-Almeida, Tania; De Nova-Ocampo, Mónica


    The 3′ untranslated region (3′UTR) of human astroviruses (HAstV) consists of two hairpin structures (helix I and II) joined by a linker harboring a conserved PTB/hnRNP1 binding site. The identification and characterization of cellular proteins that interact with the 3′UTR of HAstV-8 virus will help to uncover cellular requirements for viral functions. To this end, mobility shift assays and UV cross-linking were performed with uninfected and HAstV-8-infected cell extracts and HAstV-8 3′UTR probes. Two RNA-protein complexes (CI and CII) were recruited into the 3′UTR. Complex CII formation was compromised with cold homologous RNA, and seven proteins of 35, 40, 45, 50, 52, 57/60 and 75 kDa were cross-linked to the 3′UTR. Supermobility shift assays indicated that PTB/hnRNP1 is part of this complex, and 3′UTR-crosslinked PTB/hnRNP1 was immunoprecipitated from HAstV-8 infected cell-membrane extracts. Also, immunofluorescence analyses revealed that PTB/hnRNP1 is distributed in the nucleus and cytoplasm of uninfected cells, but it is mainly localized perinuclearly in the cytoplasm of HAstV-8 infected cells. Furthermore, the minimal 3′UTR sequences recognized by recombinant PTB are those conforming helix I, and an intact PTB/hnRNP1-binding site. Finally, small interfering RNA-mediated PTB/hnRNP1 silencing reduced synthesis viral genome and virus yield in CaCo2 cells, suggesting that PTB/hnRNP1 is required for HAstV replication. In conclusion, PTB/hnRNP1 binds to the 3′UTR HAstV-8 and is required or participates in viral replication. PMID:25406089

  17. Heterogeneity of genetic loci in chickens: analysis of endogenous viral and nonviral genes by cleavage of DNA with restriction endonucleases.


    Hughes, S H; Payvar, F; Spector, D; Schimke, R T; Robinson, H L; Payne, G S; Bishop, J M; Varmus, H E


    Restriction endonucleases can be used to define the structure and position of genetic loci for which specific molecular hybridization reagents are available. We have used this approach to compare 18 chicken embryos with respect to several cellular genes; endogenous viral DNA related to the replicative genes of avian sarcoma virus (ASV) or to RAV-O, an endogenous virus of chickens; and sequences related to the transforming (src) gene of ASV. Each cellular gene eas remarkably homogeneous within our test population. We found little or no variation in globin and ovomucoid genes; ovalbumin and transferrin (with one exception) showed variation which is probably allelic in nature. The endogenous viral DNA which has homology with RAV-O was found at several different positions in host DNA and its structure resembled that of proviruses acquired by experimental infection, with sequences from both ends of viral RNA repeated near both ends of viral DNA. Within the population of 18 chickens, one endogenous provirus was always present, whereas the several other proviruses were each found in only a few members of this group. However, screening of additional chickens identified individuals lacking the provirus common to the initial 18 animals surveyed; in at least one embryo no RAV-O-related DNA was detected. These findings suggest that the endogenous RAV-O-related sequences have entered the germ line by relatively recent infection and are still segregating in several contemporary chicken flocks. The sequences in the chicken genome which have homology with the src gene of ASV are invariant from bird to bird and in this sense resemble a cellular gene rather than a viral sequence.

  18. Extracellular DNA can preserve the genetic signatures of present and past viral infection events in deep hypersaline anoxic basins

    PubMed Central

    Corinaldesi, C.; Tangherlini, M.; Luna, G. M.; Dell'Anno, A.


    Deep hypersaline anoxic basins (DHABs) of the Mediterranean Sea are among the most extreme ecosystems on Earth and host abundant, active and diversified prokaryotic assemblages. However, factors influencing biodiversity and ecosystem functioning are still largely unknown. We investigated, for the first time, the impact of viruses on the prokaryotic assemblages and dynamics of extracellular DNA pool in the sediments of La Medee, the largest DHAB found on Earth. We also compared, in La Medee and L'Atalante sediments, the diversity of prokaryotic 16S rDNA sequences contained in the extracellular DNA released by virus-induced prokaryotic mortality. We found that DHAB sediments are hot-spots of viral infections, which largely contribute to the release of high amounts of extracellular DNA. DNase activities in DHAB sediments were much higher than other extracellular enzymatic activities, suggesting that extracellular DNA released from killed prokaryotes can be the most suitable trophic resource for benthic prokaryotes. Preserved extracellular DNA pools, which contained novel and diversified gene sequences, were very similar between the DHABs but dissimilar from the respective microbial DNA pools. We conclude that the strong viral impact in DHAB sediments influences the genetic composition of extracellular DNA, which can preserve the signatures of present and past infections. PMID:24523277

  19. A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses.


    Gorbalenya, A E; Koonin, E V; Wolf, Y I


    Statistically significant similarity was revealed between amino acid sequences of NTP-binding pattern-containing domains which are among the most conserved protein segments in dissimilar groups of ss and dsDNA viruses (papova-, parvo-, geminiviruses and P4 bacteriophage), and RNA viruses (picorna-, como- and nepoviruses) with small genomes. Within the aligned domains of 100-120 amino acid residues, three highly conserved sequence segments have been identified, i.e. 'A' and 'B' motifs of the NTP-binding pattern, and a third, C-terminal motif 'C', not described previously. The sequence of the 'B' motif in the proteins of the new superfamily is unusually variable, with substitutions, in some of the members, of the Asp residue conserved in other NTP-binding proteins. The 'C' motif is characterized by an invariant Asn residue preceded by a stretch of hydrophobic residues. As the new superfamily included a well studied DNA and RNA helicase, T antigen of SV40, helicase function could be tentatively assigned also to the other related viral putative NTP-binding proteins. On the other hand, the possibility of different and/or multiple functions for some of these proteins is discussed.

  20. Increased Stability and DNA Site Discrimination of Single Chain Variants of the Dimeric beta-Barrel DNA Binding Domain of the Human Papillomavirus E2 Transcriptional Regulator

    SciTech Connect

    Dellarole,M.; Sanchez, I.; Freire, E.; de Prat-Gay, G.


    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric {beta}-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  1. DNA and Protein Footprinting Analysis of the Modulation of DNA Binding by the N-Terminal Domain of the Saccharomyces cervisiae TATA Binding Protein

    SciTech Connect

    Gupta,S.; Cheng, H.; Mollah, A.; Jamison, E.; Morris, S.; Chance, M.; Khrapunov, S.; Brenowitz, M.


    Recombinant full-length Saccharomyces cerevisiae TATA binding protein (TBP) and its isolated C-terminal conserved core domain (TBPc) were prepared with measured high specific DNA-binding activities. Direct, quantitative comparison of TATA box binding by TBP and TBPc reveals greater affinity by TBPc for either of two high-affinity sequences at several different experimental conditions. TBPc associates more rapidly than TBP to TATA box bearing DNA and dissociates more slowly. The structural origins of the thermodynamic and kinetic effects of the N-terminal domain on DNA binding by TBP were explored in comparative studies of TBPc and TBP by 'protein footprinting' with hydroxyl radical ({center_dot}OH) side chain oxidation. Some residues within TBPc and the C-terminal domain of TBP are comparably protected by DNA, consistent with solvent accessibility changes calculated from core domain crystal structures. In contrast, the reactivity of some residues located on the top surface and the DNA-binding saddle of the C-terminal domain differs between TBP and TBPc in both the presence and absence of bound DNA; these results are not predicted from the crystal structures. A strikingly different pattern of side chain oxidation is observed for TBP when a nonionic detergent is present. Taken together, these results are consistent with the N-terminal domain actively modulating TATA box binding by TBP and nonionic detergent modulating the interdomain interaction.

  2. Cooperative DnaA Binding to the Negatively Supercoiled datA Locus Stimulates DnaA-ATP Hydrolysis.


    Kasho, Kazutoshi; Tanaka, Hiroyuki; Sakai, Ryuji; Katayama, Tsutomu


    Timely initiation of replication in Escherichia coli requires functional regulation of the replication initiator, ATP-DnaA. The cellular level of ATP-DnaA increases just before initiation, after which its level decreases through hydrolysis of DnaA-bound ATP, yielding initiation-inactive ADP-DnaA. Previously, we reported a novel DnaA-ATP hydrolysis system involving the chromosomal locus datA and named it datA-dependent DnaA-ATP hydrolysis (DDAH). The datA locus contains a binding site for a nucleoid-associating factor integration host factor (IHF) and a cluster of three known DnaA-binding sites, which are important for DDAH. However, the mechanisms underlying the formation and regulation of the datA-IHF·DnaA complex remain unclear. We now demonstrate that a novel DnaA box within datA is essential for ATP-DnaA complex formation and DnaA-ATP hydrolysis. Specific DnaA residues, which are important for interaction with bound ATP and for head-to-tail inter-DnaA interaction, were also required for ATP-DnaA-specific oligomer formation on datA Furthermore, we show that negative DNA supercoiling of datA stabilizes ATP-DnaA oligomers, and stimulates datA-IHF interaction and DnaA-ATP hydrolysis. Relaxation of DNA supercoiling by the addition of novobiocin, a DNA gyrase inhibitor, inhibits datA function in cells. On the basis of these results, we propose a mechanistic model of datA-IHF·DnaA complex formation and DNA supercoiling-dependent regulation for DDAH.

  3. The Role of Nuclear Antiviral Factors against Invading DNA Viruses: The Immediate Fate of Incoming Viral Genomes

    PubMed Central

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald


    In recent years, it has been suggested that host cells exert intrinsic mechanisms to control nuclear replicating DNA viruses. This cellular response involves nuclear antiviral factors targeting incoming viral genomes. Herpes simplex virus-1 (HSV-1) is the best-studied model in this context, and it was shown that upon nuclear entry HSV-1 genomes are immediately targeted by components of promyelocytic leukemia nuclear bodies (PML-NBs) and the nuclear DNA sensor IFI16 (interferon gamma inducible protein 16). Based on HSV-1 studies, together with limited examples in other viral systems, these phenomena are widely believed to be a common cellular response to incoming viral genomes, although formal evidence for each virus is lacking. Indeed, recent studies suggest that the case may be different for adenovirus infection. Here we summarize the existing experimental evidence for the roles of nuclear antiviral factors against incoming viral genomes to better understand cellular responses on a virus-by-virus basis. We emphasize that cells seem to respond differently to different incoming viral genomes and discuss possible arguments for and against a unifying cellular mechanism targeting the incoming genomes of different virus families. PMID:27782081

  4. Quantitation of Viral DNA by Real-Time PCR Applying Duplex Amplification, Internal Standardization, and Two-Color Fluorescence Detection

    PubMed Central

    Gruber, Franz; Falkner, Falko G.; Dorner, Friedrich; Hämmerle, Thomas


    A real-time PCR method was developed to quantitate viral DNA that includes duplex amplification, internal standardization, and two-color fluorescence detection without the need to generate an external standardization curve. Applied to human parvovirus B19 DNA, the linear range was from 102 to at least 5 × 106 copies per ml of sample. The coefficient of variation was 0.29 using a run control of 2,876 copies per ml. The method reduces the risk of false-negative results, yields high precision, and is applicable for other DNA targets. PMID:11375203

  5. Surface-enhanced Raman scattering spectroscopy of topotecan-DNA complexes: Binding to DNA induces topotecan dimerization

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Strel'Tsov, S. A.; Ermishov, M. A.; Grokhovskii, S. L.; Zhuze, A. L.; Ustinova, O. A.; Sukhanova, A. V.; Nabiev, I. R.; Oleinikov, V. A.


    The interaction of topotecan (TPT), antitumor inhibitor of human DNA topoisomerase I, with calf thymus DNA was studied by surface-enhanced Raman scattering (SERS) spectroscopy. The SERS spectra of TPT are found to depend on its concentration in solution, which is associated with the dimerization of TPT. The spectral signatures of dimerization are identified. It is shown that binding to DNA induces the formation of TPT dimers. The formation of DNA-TPT-TPT-DNA complexes is considered as one of the possible mechanisms of human DNA topoisomerase I inhibition.

  6. De-novo protein function prediction using DNA binding and RNA binding proteins as a test case

    PubMed Central

    Peled, Sapir; Leiderman, Olga; Charar, Rotem; Efroni, Gilat; Shav-Tal, Yaron; Ofran, Yanay


    Of the currently identified protein sequences, 99.6% have never been observed in the laboratory as proteins and their molecular function has not been established experimentally. Predicting the function of such proteins relies mostly on annotated homologs. However, this has resulted in some erroneous annotations, and many proteins have no annotated homologs. Here we propose a de-novo function prediction approach based on identifying biophysical features that underlie function. Using our approach, we discover DNA and RNA binding proteins that cannot be identified based on homology and validate these predictions experimentally. For example, FGF14, which belongs to a family of secreted growth factors was predicted to bind DNA. We verify this experimentally and also show that FGF14 is localized to the nucleus. Mutating the predicted binding site on FGF14 abrogated DNA binding. These results demonstrate the feasibility of automated de-novo function prediction based on identifying function-related biophysical features. PMID:27869118

  7. De-novo protein function prediction using DNA binding and RNA binding proteins as a test case.


    Peled, Sapir; Leiderman, Olga; Charar, Rotem; Efroni, Gilat; Shav-Tal, Yaron; Ofran, Yanay


    Of the currently identified protein sequences, 99.6% have never been observed in the laboratory as proteins and their molecular function has not been established experimentally. Predicting the function of such proteins relies mostly on annotated homologs. However, this has resulted in some erroneous annotations, and many proteins have no annotated homologs. Here we propose a de-novo function prediction approach based on identifying biophysical features that underlie function. Using our approach, we discover DNA and RNA binding proteins that cannot be identified based on homology and validate these predictions experimentally. For example, FGF14, which belongs to a family of secreted growth factors was predicted to bind DNA. We verify this experimentally and also show that FGF14 is localized to the nucleus. Mutating the predicted binding site on FGF14 abrogated DNA binding. These results demonstrate the feasibility of automated de-novo function prediction based on identifying function-related biophysical features.

  8. Human cytomegalovirus miR-US33-5p inhibits viral DNA synthesis and viral replication by down-regulating expression of the host Syntaxin3.


    Guo, Xin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Ma, Yanping; Shao, Yaozhong; Jiang, Shujuan; Sun, Zhengrong; Ruan, Qiang


    During infection with human cytomegalovirus (HCMV), overexpression of hcmv-miR-US33 can inhibit the lytic viral replication and down-regulate US29 mRNA. However, it remains unknown whether inhibition of viral replication by miR-US33 is mediated by down-regulation of expression of US29 or another host gene. Here, we identified the host gene Syntaxin3 (STX3) to be a direct target of hcmv-miR-US33-5p using Hybrid-PCR and luciferase-reporter assays. It was further demonstrated that the levels of STX3 protein were down-regulated in hcmv-miR-US33-5p-overexpressing cells. Experiments with STX3-specific siRNA, or with an inhibitor of hcmv-miR-US33-5p confirmed that hcmv-miR-US33-5p-mediated inhibition of HCMV DNA synthesis and of viral replication are specifically mediated by down-regulation of STX3 expression.

  9. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly


    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  10. Binding interaction between sorafenib and calf thymus DNA: Spectroscopic methodology, viscosity measurement and molecular docking

    NASA Astrophysics Data System (ADS)

    Shi, Jie-Hua; Chen, Jun; Wang, Jing; Zhu, Ying-Yao


    The binding interaction of sorafenib with calf thymus DNA (ct-DNA) was studied using UV-vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism (CD), viscosity measurement and molecular docking methods. The experimental results revealed that there was obvious binding interaction between sorafenib and ct-DNA. The binding constant (Kb) of sorafenib with ct-DNA was 5.6 × 103 M-1 at 298 K. The enthalpy and entropy changes (ΔH0 and ΔS0) in the binding process of sorafenib with ct-DNA were -27.66 KJ mol-1 and -21.02 J mol-1 K-1, respectively, indicating that the main binding interaction forces were van der Waals force and hydrogen bonding. The docking results suggested that sorafenib preferred to bind on the minor groove of A-T rich DNA and the binding site of sorafenib was 4 base pairs long. The conformation change of sorafenib in the sorafenib-DNA complex was obviously observed and the change was close relation with the structure of DNA, implying that the flexibility of sorafenib molecule played an important role in the formation of the stable sorafenib-ct-DNA complex.

  11. SPRTN is a mammalian DNA-binding metalloprotease that resolves DNA-protein crosslinks

    PubMed Central

    Lopez-Mosqueda, Jaime; Maddi, Karthik; Prgomet, Stefan; Kalayil, Sissy; Marinovic-Terzic, Ivana; Terzic, Janos; Dikic, Ivan


    Ruijs-Aalfs syndrome is a segmental progeroid syndrome resulting from mutations in the SPRTN gene. Cells derived from patients with SPRTN mutations elicit genomic instability and people afflicted with this syndrome developed hepatocellular carcinoma. Here we describe the molecular mechanism by which SPRTN contributes to genome stability and normal cellular homeostasis. We show that SPRTN is a DNA-dependent mammalian protease required for resolving cytotoxic DNA-protein crosslinks (DPCs)— a function that had only been attributed to the metalloprotease Wss1 in budding yeast. We provide genetic evidence that SPRTN and Wss1 function distinctly in vivo to resolve DPCs. Upon DNA and ubiquitin binding, SPRTN can elicit proteolytic activity; cleaving DPC substrates and itself. SPRTN null cells or cells derived from patients with Ruijs-Aalfs syndrome are impaired in the resolution of covalent DPCs in vivo. Collectively, SPRTN is a mammalian protease required for resolving DNA-protein crosslinks in vivo whose function is compromised in Ruijs-Aalfs syndrome patients. DOI: PMID:27852435

  12. Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme.

    PubMed Central

    Bouhamdan, M; Benichou, S; Rey, F; Navarro, J M; Agostini, I; Spire, B; Camonis, J; Slupphaug, G; Vigne, R; Benarous, R; Sire, J


    The role of the accessory gene product Vpr during human immunodeficiency virus type 1 infection remains unclear. We have used the yeast two-hybrid system to identify cellular proteins that interact with Vpr and could be involved in its function. A cDNA clone which encodes the human uracil DNA glycosylase (UNG), a DNA repair enzyme involved in removal of uracil in DNA, has been isolated. Interaction between Vpr and UNG has been demonstrated by in vitro protein-protein binding assays using translated, radiolabeled Vpr and UNG recombinant proteins expressed as a glutathione S-transferase fusion protein. Conversely, purified UNG has been demonstrated to interact with Vpr recombinant protein expressed as a glutathione S-transferase fusion protein. Coimmunoprecipitation experiments confirmed that Vpr and UNG are associated within cells expressing Vpr. By using a panel of C- and N-terminally deleted Vpr mutants, we have determined that the core protein of Vpr, spanning amino acids 15 to 77, is involved in the interaction with UNG. We also demonstrate by in vitro experiments that the enzymatic activity of UNG is retained upon interaction with Vpr. PMID:8551605


    PubMed Central

    Richards, Jodi; Johnson, Ken; Liu, Huanting; Oke, Stephen McMahon. Muse; Carter, Lester; Naismith, James H; White, Malcolm F


    Hel308 is a superfamily 2 helicase conserved in eukaryotes and archaea. It is thought to function in the early stages of recombination following replication fork arrest, and has a specificity for removal of the lagging strand in model replication forks. A homologous helicase constitutes the N-terminal domain of human DNA polymerase Q. The Drosophila homologue mus301 is implicated in double strand break repair and meiotic recombination. We have solved the high-resolution crystal structure of Hel308 from the crenarchaeon Sulfolobus solfataricus, revealing a five-domain structure with a central pore lined with essential DNA binding residues. The fifth domain is shown to act as a molecular brake, clamping the ssDNA extruded through the central pore of the helicase structure to limit the enzyme’s helicase activity. This provides an elegant mechanism to tune the enzyme’s processivity to its functional role. Hel308 can displace streptavidin from a biotinylated DNA molecule, suggesting that one function of the enzyme may be in the removal of bound proteins at stalled replication forks and recombination intermediates. PMID:18056710

  14. Functional interplay between SA1 and TRF1 in telomeric DNA binding and DNA–DNA pairing

    PubMed Central

    Lin, Jiangguo; Countryman, Preston; Chen, Haijiang; Pan, Hai; Fan, Yanlin; Jiang, Yunyun; Kaur, Parminder; Miao, Wang; Gurgel, Gisele; You, Changjiang; Piehler, Jacob; Kad, Neil M.; Riehn, Robert; Opresko, Patricia L.; Smith, Susan; Tao, Yizhi Jane; Wang, Hong


    Proper chromosome alignment and segregation during mitosis depend on cohesion between sister chromatids. Cohesion is thought to occur through the entrapment of DNA within the tripartite ring (Smc1, Smc3 and Rad21) with enforcement from a fourth subunit (SA1/SA2). Surprisingly, cohesin rings do not play a major role in sister telomere cohesion. Instead, this role is replaced by SA1 and telomere binding proteins (TRF1 and TIN2). Neither the DNA binding property of SA1 nor this unique telomere cohesion mechanism is understood. Here, using single-molecule fluorescence imaging, we discover that SA1 displays two-state binding on DNA: searching by one-dimensional (1D) free diffusion versus recognition through subdiffusive sliding at telomeric regions. The AT-hook motif in SA1 plays dual roles in modulating non-specific DNA binding and subdiffusive dynamics over telomeric regions. TRF1 tethers SA1 within telomeric regions that SA1 transiently interacts with. SA1 and TRF1 together form longer DNA–DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy imaging. These results suggest that at telomeres cohesion relies on the molecular interplay between TRF1 and SA1 to promote DNA–DNA pairing, while along chromosomal arms the core cohesin assembly might also depend on SA1 1D diffusion on DNA and sequence-specific DNA binding. PMID:27298259

  15. Binding of disparate transcriptional activators to nucleosomal DNA is inherently cooperative.

    PubMed Central

    Adams, C C; Workman, J L


    To investigate mechanisms by which multiple transcription factors access complex promoters and enhancers within cellular chromatin, we have analyzed the binding of disparate factors to nucleosome cores. We used a purified in vitro system to analyze binding of four activator proteins, two GAL4 derivatives, USF, and NF-kappa B (KBF1), to reconstituted nucleosome cores containing different combinations of binding sites. Here we show that binding of any two or all three of these factors to nucleosomal DNA is inherently cooperative. Thus, the binuclear Zn clusters of GAL4, the helix-loop-helix/basic domains of USF, and the rel domain of NF-kappa B all participated in cooperative nucleosome binding, illustrating that this effect is not restricted to a particular DNA-binding domain. Simultaneous binding by two factors increased the affinity of individual factors for nucleosomal DNA by up to 2 orders of magnitude. Importantly, cooperative binding resulted in efficient nucleosome binding by factors (USF and NF-kappa B) which independently possess little nucleosome-binding ability. The participation of GAL4 derivatives in cooperative nucleosome binding required only DNA-binding and dimerization domains, indicating that disruption of histone-DNA contacts by factor binding was responsible for the increased affinity of additional factors. Cooperative nucleosome binding required sequence-specific binding of all transcription factors, appeared to have spatial constraints, and was independent of the orientation of the binding sites on the nucleosome. These results indicate that cooperative nucleosome binding is a general mechanism that may play a significant role in loading complex enhancer and promoter elements with multiple diverse factors in chromatin and contribute to the generation of threshold responses and transcriptional synergy by multiple activator sites in vivo. PMID:7862134

  16. FANCI-FANCD2 stabilizes the RAD51-DNA complex by binding RAD51 and protects the 5'-DNA end.


    Sato, Koichi; Shimomuki, Mayo; Katsuki, Yoko; Takahashi, Daisuke; Kobayashi, Wataru; Ishiai, Masamichi; Miyoshi, Hiroyuki; Takata, Minoru; Kurumizaka, Hitoshi


    The FANCI-FANCD2 (I-D) complex is considered to work with RAD51 to protect the damaged DNA in the stalled replication fork. However, the means by which this DNA protection is accomplished have remained elusive. In the present study, we found that the I-D complex directly binds to RAD51, and stabilizes the RAD51-DNA filament. Unexpectedly, the DNA binding activity of FANCI, but not FANCD2, is explicitly required for the I-D complex-mediated RAD51-DNA filament stabilization. The RAD51 filament stabilized by the I-D complex actually protects the DNA end from nucleolytic degradation by an FA-associated nuclease, FAN1. This DNA end protection is not observed with the RAD51 mutant from FANCR patient cells. These results clearly answer the currently enigmatic question of how RAD51 functions with the I-D complex to prevent genomic instability at the stalled replication fork.

  17. High-resolution mapping of architectural DNA binding protein facilitation of a DNA repression loop in Escherichia coli.


    Becker, Nicole A; Maher, L James


    Double-stranded DNA is a locally inflexible polymer that resists bending and twisting over hundreds of base pairs. Despite this, tight DNA bending is biologically important for DNA packaging in eukaryotic chromatin and tight DNA looping is important for gene repression in prokaryotes. We and others have previously shown that sequence nonspecific DNA kinking proteins, such as Escherichia coli heat unstable and Saccharomyces cerevisiae non-histone chromosomal protein 6A (Nhp6A), facilitate lac repressor (LacI) repression loops in E. coli. It has been unknown if this facilitation involves direct protein binding to the tightly bent DNA loop or an indirect effect promoting global negative supercoiling of DNA. Here we adapt two high-resolution in vivo protein-mapping techniques to demonstrate direct binding of the heterologous Nhp6A protein at a LacI repression loop in living E. coli cells.

  18. Human Ku70 protein binds hairpin RNA and double stranded DNA through two different sites.


    Anisenko, Andrey N; Knyazhanskaya, Ekaterina S; Zatsepin, Timofey S; Gottikh, Marina B


    Human protein Ku usually functions in the cell as a complex of two subunits, Ku70 and Ku80. The Ku heterodimer plays a key role in the non-homologous end joining DNA repair pathway by specifically recognizing the DNA ends at the site of the lesion. The binding of the Ku heterodimer to DNA has been well-studied, and its interactions with RNA have been also described. However, Ku70 subunit is known to have independent DNA binding capability, which is less characterized. RNA binding properties of Ku70 have not been yet specially studied. We have prepared recombinant full-length Ku70 and a set of its truncated mutants in E. coli, and studied their interactions with nucleic acids of various structures: linear single- and double-stranded DNA and RNA, as well as closed circular DNA and hairpin RNA. Ku70 has demonstrated a high affinity binding to double stranded DNA and hairpin RNA with a certain structure only. Interestingly, in contrast to the Ku heterodimer, Ku70 is found to interact with closed circular DNA. We also show for the first time that Ku70 employs two different sites for DNA and RNA binding. The double-stranded DNA is recognized by the C-terminal part of Ku70 including SAP domain as it has been earlier demonstrated, whereas hairpin RNA binding is provided by amino acids 251-438.

  19. Molecular dynamics study of DNA binding by INT-DBD under a polarized force field.


    Yao, Xue X; Ji, Chang G; Xie, Dai Q; Zhang, John Z H


    The DNA binding domain of transposon Tn916 integrase (INT-DBD) binds to DNA target site by positioning the face of a three-stranded antiparallel β-sheet within the major groove. As the negatively charged DNA directly interacts with the positively charged residues (such as Arg and Lys) of INT-DBD, the electrostatic interaction is expected to play an important role in the dynamical stability of the protein-DNA binding complex. In the current work, the combined use of quantum-based polarized protein-specific charge (PPC) for protein and polarized nucleic acid-specific charge (PNC) for DNA were employed in molecular dynamics simulation to study the interaction dynamics between INT-DBD and DNA. Our study shows that the protein-DNA structure is stabilized by polarization and the calculated protein-DNA binding free energy is in good agreement with the experimental data. Furthermore, our study revealed a positive correlation between the measured binding energy difference in alanine mutation and the occupancy of the corresponding residue's hydrogen bond. This correlation relation directly relates the contribution of a specific residue to protein-DNA binding energy to the strength of the hydrogen bond formed between the specific residue and DNA.

  20. A new protein domain for binding to DNA through the minor groove.

    PubMed Central

    Freire, R; Salas, M; Hermoso, J M


    Protein p6 of the Bacillus subtilis phage phi 29 binds with low sequence specificity to DNA through the minor groove, forming a multimeric nucleoprotein complex that activates the initiation of phi 29 DNA replication. Deletion analysis suggested that the N-terminal part of protein p6, predicted to form an amphipathic alpha-helix, is involved in DNA binding. We have constructed site-directed mutants at the polar side of the putative alpha-helix. DNA binding and activation of initiation of phi 29 DNA replication were impaired in most of the mutant proteins obtained. A 19 amino acid peptide comprising the N-terminus of protein p6 interacted with a DNA fragment containing high-affinity signals for protein p6 binding with approximately 50-fold higher affinity than the peptide corresponding to an inactive mutant. Both wild-type peptide and protein p6 recognized the same sequences in this DNA fragment. This result, together with distamycin competition experiments, suggested that the wild-type peptide also binds to DNA through the minor groove. In addition, CD spectra of the wild-type peptide showed an increase in the alpha-helical content when bound to DNA. All these results indicate that an alpha-helical structure located in the N-terminal region of protein p6 is involved in DNA binding through the minor groove. Images PMID:7925279

  1. Guiding the design of synthetic DNA-binding molecules with massively parallel sequencing.


    Meier, Jordan L; Yu, Abigail S; Korf, Ian; Segal, David J; Dervan, Peter B


    Genomic applications of DNA-binding molecules require an unbiased knowledge of their high affinity sites. We report the high-throughput analysis of pyrrole-imidazole polyamide DNA-binding specificity in a 10(12)-member DNA sequence library using affinity purification coupled with massively parallel sequencing. We find that even within this broad context, the canonical pairing rules are remarkably predictive of polyamide DNA-binding specificity. However, this approach also allows identification of unanticipated high affinity DNA-binding sites in the reverse orientation for polyamides containing β/Im pairs. These insights allow the redesign of hairpin polyamides with different turn units capable of distinguishing 5'-WCGCGW-3' from 5'-WGCGCW-3'. Overall, this study displays the power of high-throughput methods to aid the optimal targeting of sequence-specific minor groove binding molecules, an essential underpinning for biological and nanotechnological applications.

  2. Differential sensitivity to methylated DNA by ETS-family transcription factors is intrinsically encoded in their DNA-binding domains.


    Stephens, Dominique C; Poon, Gregory M K


    Transactivation by the ETS family of transcription factors, whose members share structurally conserved DNA-binding domains, is variably sensitive to methylation of their target genes. The mechanism by which DNA methylation controls ETS proteins remains poorly understood. Uncertainly also pervades the effects of hemi-methylated DNA, which occurs following DNA replication and in response to hypomethylating agents, on site recognition by ETS proteins. To address these questions, we measured the affinities of two sequence-divergent ETS homologs, PU.1 and Ets-1, to DNA sites harboring a hemi- and fully methylated CpG dinucleotide. While the two proteins bound unmethylated DNA with indistinguishable affinity, their affinities to methylated DNA are markedly heterogeneous and exhibit major energetic coupling between the two CpG methylcytosines. Analysis of simulated DNA and existing co-crystal structures revealed that hemi-methylation induced non-local backbone and groove geometries that were not conserved in the fully methylated state. Indirect readout of these perturbations was differentially achieved by the two ETS homologs, with the distinctive interfacial hydration in PU.1/DNA binding moderating the inhibitory effects of DNA methylation on binding. This data established a biophysical basis for the pioneering properties associated with PU.1, which robustly bound fully methylated DNA, but not Ets-1, which was substantially inhibited.

  3. Novel signal amplification approach for HRP-based colorimetric genosensors using DNA binding protein tags.


    Aktas, Gülsen Betül; Skouridou, Vasso; Masip, Lluis


    The need for sensitive detection of DNA is growing as more specific DNA sequences are being correlated to gene markers for disease diagnosis, food safety and other security related applications. Detection in hybridization-based assays is usually achieved with target-specific ssDNA probes conjugated directly to enzyme labels like HRP that provide signal amplification or with nanoparticles functionalized with DNA and multiple HRP molecules. In order to overcome some of the drawbacks presented by these approaches, we developed a unique DNA sensing platform based on an HRP-DNA binding protein tag conjugate and a hybrid ssDNA-dsDNA detection probe. Specifically, in this work we describe the preparation and characterization of an HRP conjugate with scCro DNA binding protein tag and its application for the detection of a model ssDNA target sequence. By using the HRP-scCro conjugate together with a hybrid detection probe containing three scCro-specific dsDNA binding sites, we demonstrate an improvement by over 3-fold in both sensitivity and limit of detection of high-risk human papillomavirus (HPV16), compared to the standard ssDNA-HRP conjugate. These results show that the HRP-DNA binding protein tag conjugate can be used as an alternative and universal tool for signal enhancement in enzyme-linked assays suitable for integration in point-of-care systems.

  4. Quantum dot binding to DNA: single-molecule imaging with atomic force microscopy.


    Li, Kungang; Zhang, Wen; Chen, Yongsheng


    The interaction between nanoparticles (NPs) and DNA is of significance for both application and implication research of NPs. In this study, a single-molecule imaging technique based on atomic force microscopy (AFM) was employed to probe the NP-DNA interactions with quantum dots (QDs) as model NPs. Reproducible high-quality images of single DNA molecules in air and in liquids were acquired on mica by optimizing sample preparation conditions. Furthermore, the binding of QDs to DNA was explored using AFM. The DNA concentration was found to be a key factor influencing AFM imaging quality. In air and liquids, the optimal DNA concentration for imaging DNA molecules was approximately 2.5 and 0.25 μg/mL, and that for imaging DNA binding with QDs was 0.5 and 0.25 μg/mL, respectively. In the presence of QDs, the DNA conformation was altered with the formation of DNA condensates. Finally, the fine conformation of QD-DNA binding sites was examined to analyze the binding mechanisms. This work will benefit investigations of NP-DNA interactions and the understanding of the structure of NP-DNA bioconjugates. See accompanying article by Wang DOI: 10.1002/biot.201200309.

  5. Mechanistic aspects of thioflavin-T self-aggregation and DNA binding: evidence for dimer attack on DNA grooves.


    Biancardi, A; Biver, T; Burgalassi, A; Mattonai, M; Secco, F; Venturini, M


    Thioflavin-T (TFT) is a fluorescent marker widely employed in biomedical research but the mechanism of its binding to polynucleotides has been poorly understood. This paper presents a study of the mechanisms of TFT self-aggregation and binding to DNA. Relaxation kinetics of TFT solutions show that the cyanine undergoes dimerization followed by dimer isomerisation. The interaction of TFT with DNA has been investigated using static methods, such as spectrophotometric and spectrofluorometric titrations under different conditions (salt content, temperature), fluorescence quenching, viscometric experiments and the T-jump relaxation method. The combined use of these techniques enabled us to show that the TFT monomer undergoes intercalation between the DNA base pairs and external binding according to a branched mechanism. Moreover, it has also been observed that, under dye excess conditions, the TFT dimer binds to the DNA grooves. The molecular structures of intercalated TFT and the groove-bound TFT dimer are obtained by performing QM/MM MD simulations.

  6. Viral Proteins That Bind Double-Stranded RNA: Countermeasures Against Host Antiviral Responses

    PubMed Central


    Several animal viruses encode proteins that bind double-stranded RNA (dsRNA) to counteract host dsRNA-dependent antiviral responses. This article discusses the structure and function of the dsRNA-binding proteins of influenza A virus and Ebola viruses (EBOVs). PMID:24905203

  7. [Comparison of two commercial molecular assays for quantitative measurement of hepatitis B viral DNA].


    Zalewska, Małgorzata; Domagała, Małgorzata; Gładysz, Andrzej


    The detection and quantification of hepatitis B virus (HBV) genomes appear to be the most reliable method for monitoring HBV infection and assessing responses to antiviral treatment. For quantitative determination of HBV viremia molecular biology-based assays are used. The aim of this study was to compare and evaluate the performance of two HBV DNA detection and quantification commercial assays: hybrid-capture Digene Hybrid Capture HBV DNA assays and based on competitive polymerase chain reaction (PCR) Cobas Amplicor HBV Monitor Roche Diagnostics. Reproducibility, linearity, sensitivity were determined with 2-fold dilution series of high-titers samples and with 113 sera samples from patients with chronic HBV infection. Within-run and between-run coefficients of variation ranged from 2.4-9.7% for hybrid-capture and from 3.7-15% for PCR-based Monitor. The hybrid-capture and PCR Monitor assays appeared to be linear throughout their range of quantification: 5-2000 pg/ml and 2 x 10(2)-2 x 10(5) copies/ml respectively. The HBV DNA units used in the two assays were not comparable. Hybrid-capture and Monitor gave concordant results with 87 (82.1%) of 106 samples. The assays were both positive with 79 (74.5%) samples and were negative in 7 (7.5%) cases. Hybrid-capture and Monitor gave discordant results in 17 (17.9%) cases. The Monitor Assay was positive in 13 (61.9%) of the 21 samples negative in hybrid-capture. The competitive PCR-based Monitor assay appear to be significantly more sensitive but slightly less reproducible than the hybrid-capture. In the group of patients with seroconversion to anti-HBe PCR method should be used for measurement of viral load. In the presence of HBe antigen concentration of HBV DNA may be tested by hybrid-capture assay. Also these two assays may be used in complementary fashion in the management of HBV infected patients. It seems reasonable to use a hybrid-capture assay first, because its linear range of quantification is extended to high

  8. Characterization of DNA binding and pairing activities associated with the native SFPQ·NONO DNA repair protein complex.


    Udayakumar, Durga; Dynan, William S


    Nonhomologous end joining (NHEJ) is a major pathway for repair of DNA double-strand breaks. We have previously shown that a complex of SFPQ (PSF) and NONO (p54(nrb)) cooperates with Ku protein at an early step of NHEJ, forming a committed preligation complex and stimulating end-joining activity by 10-fold or more. SFPQ and NONO show no resemblance to other repair factors, and their mechanism of action is uncertain. Here, we use an optimized microwell-based assay to characterize the in vitro DNA binding behavior of the native SFPQ·NONO complex purified from human (HeLa) cells. SFPQ·NONO and Ku protein bind independently to DNA, with little evidence of cooperativity and only slight mutual interference at high concentration. Whereas Ku protein requires free DNA ends for binding, SFPQ·NONO does not. Both Ku and SFPQ·NONO have pairing activity, as measured by the ability of DNA-bound protein to capture a second DNA fragment in a microwell-based assay. Additionally, SFPQ·NONO stimulates DNA-dependent protein kinase autophosphorylation, consistent with the ability to promote formation of a synaptic complex formation without occluding the DNA termini proper. These findings suggest that SFPQ·NONO promotes end joining by binding to internal DNA sequences and cooperating with other repair proteins to stabilize a synaptic pre-ligation complex.

  9. Synthesis of bifunctional molecules containing [12]aneN3 and coumarin moieties as effective DNA condensation agents and new non-viral gene vectors.


    Yue, Pan; Zhang, Ying; Guo, Zhi-Fo; Cao, Ao-Cheng; Lu, Zhong-Lin; Zhai, Yong-Gong


    A series of bifunctional molecules with different combinations of macrocyclic polyamine [12]aneN3 and coumarin moieties, 4a/b and 5a/b, were synthesized by a two-step copper(I)-mediated alkyne–azide click reactions between 1,3,5-tris(azidomethyl)benzene and Boc-protected N-propynyl-[12]aneN3/7-propynyloxycoumarins. Agarose gel electrophoresis experiments indicated that bifunctional molecules 4b and 5b effectively induced complete plasmid DNA condensation at concentrations up to 40 μM. It was found that the structural variation had a major impact on the condensation behavior of these compounds. The electrostatic interaction involving the [12]aneN3 moiety can be compensated by the binding contribution of the coumarin units during the DNA condensation process. These two types of interaction showed different effects on the reversibility of DNA condensation. Results from studies using dynamic laser scattering, atomic force microscopy, and EB replacement assay further supported the above conclusion. Cytotoxicity assays on bifunctional compounds 4a/b and 5a/b indicated their low cytotoxicity. Results from cellular uptake and cell transfection experiments proved that bifunctional compounds 4b and 5b successfully served as non-viral gene vectors. Furthermore, methyl substituents attached to the coumarin unit (4b and 5b) greatly enhanced their DNA condensation capability and gene transfection. These bifunctional molecules, with the advantages of lower cytotoxicity, good water solubility, and potential structural modification, will have great potential for the development of new non-viral gene delivery agents.

  10. Luminescence and binding properties of two isoquinoline alkaloids chelerythrine and sanguinarine with ctDNA

    NASA Astrophysics Data System (ADS)

    Li, Junfen; Li, Baohong; Wu, Yanbo; Shuang, Shaomin; Dong, Chuan; Choi, Martin M. F.


    The binding mode and mechanism of the interactions between two planar cationic alkaloids chelerythrine (Che) and sanguinarine (San) with calf thymus DNA (ctDNA) were systematically investigated at pH 5.40 using UV-vis absorption spectroscopy, fluorescence spectroscopy and cyclic voltammetry. Che and San show strong fluorescence at 570 and 589 nm, respectively. Che displays fluorescence enhancement with ctDNA whereas the fluorescence of San is quenched on interaction with ctDNA. In addition, UV-vis spectra of both alkaloids show apparent hypochromicity and are bathochromic shifted, indicating that they could intercalate into ctDNA bases. The fluorescence polarization of Che and San increases in the presence of ctDNA, again implying the intercalation of two alkaloids with ctDNA. This conclusion was also supported by the results obtained from anion quenching and cyclic voltammetry. The binding constants of both alkaloids with ctDNA were calculated in the order of 105 L/mol. San binds with ctDNA 3-fold stronger than Che. The stoichiometric bindings are five nucleotides per Che or San. Electrostatic binding also exists between the alkaloids and DNA helix. Finally, theoretical calculations show that only certain parts of Che and San molecules intercalate into the DNA helix.

  11. Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA.


    Yoshida, Hiroyuki; Nishikawa, Makiya; Yasuda, Sachiyo; Toyota, Hiroyasu; Kiyota, Tsuyoshi; Takahashi, Yuki; Takakura, Yoshinobu


    Fibronectin (FN) is known to have four DNA-binding domains although their physiological significance is unknown. Primary murine peritoneal macrophages have been shown to exhibit markedly lower responsiveness to CpG motif-replete plasmid DNA (pDNA), Toll-like receptor-9 (TLR9) ligand, compared with murine macrophage-like cell lines. The present study was conducted to examine whether FN having DNA-binding domains is involved in this phenomenon. The expression of FN was significantly higher in primary macrophages than in a macrophage-like cell line, RAW264.7, suggesting that abundant FN might suppress the responsiveness in the primary macrophages. However, electrophoretic analysis revealed that FN did not bind to pDNA in the presence of a physiological concentration of divalent cations. Surprisingly, marked tumor necrosis factor - (TNF-)α production from murine macrophages upon CpG DNA stimulation was significantly reduced by exogenously added FN in a concentration-dependent manner but not by BSA, laminin or collagen. FN did not affect apparent pDNA uptake by the cells. Moreover, FN reduced TNF-α production induced by polyI:C (TLR3 ligand), and imiquimod (TLR7 ligand), but not by LPS (TLR4 ligand), or a non-CpG pDNA/cationic liposome complex. The confocal microscopic study showed that pDNA was co-localized with FN in the same intracellular compartment in RAW264.7, suggesting that FN inhibits cytokine signal transduction in the endosomal/lysosomal compartment. Taken together, the results of the present study has revealed, for the first time, a novel effect of FN whereby the glycoprotein modulates cytokine signal transduction via CpG-DNA/TLR9 interaction in macrophages without direct binding to DNA through its putative DNA-binding domains.

  12. Determination of the cationic amphiphilic drug-DNA binding mode and DNA-assisted fluorescence resonance energy transfer amplification

    NASA Astrophysics Data System (ADS)

    Yaseen, Zahid; Banday, Abdul Rouf; Hussain, Mohammed Aamir; Tabish, Mohammad; Kabir-ud-Din


    Understanding the mechanism of drug-DNA binding is crucial for predicting the potential genotoxicity of drugs. Agarose gel electrophoresis, absorption, steady state fluorescence, and circular dichroism have been used in exploring the interaction of cationic amphiphilic drugs (CADs) such as amitriptyline hydrochloride (AMT), imipramine hydrochloride (IMP), and promethazine hydrochloride (PMT) with calf thymus or pUC19 DNA. Agarose gel electrophoresis assay, along with absorption and steady state fluorescence studies, reveal interaction between the CADs and DNA. A comparative study of the drugs with respect to the effect of urea, iodide induced quenching, and ethidium bromide (EB) exclusion assay reflects binding of CADs to the DNA primarily in an intercalative fashion. Circular dichroism data also support the intercalative mode of binding. Besides quenching, there is fluorescence exchange energy transfer (FRET) in between CADs and EB using DNA as a template.

  13. Rifampin and vaccinia DNA.

    PubMed Central

    Esteban, M


    The effect of rifampin on the replication of vaccinia DNA was studied in mouse L cells by a cyto