Science.gov

Sample records for binds viral dna

  1. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  2. Nbs1-dependent binding of Mre11 to adenovirus E4 mutant viral DNA is important for inhibiting DNA replication

    SciTech Connect

    Mathew, Shomita S.; Bridge, Eileen

    2008-04-25

    Adenovirus (Ad) infections stimulate the activation of cellular DNA damage response and repair pathways. Ad early regulatory proteins prevent activation of DNA damage responses by targeting the MRN complex, composed of the Mre11, Rad50 and Nbs1 proteins, for relocalization and degradation. In the absence of these viral proteins, Mre11 colocalizes with viral DNA replication foci. Mre11 foci formation at DNA damage induced by ionizing radiation depends on the Nbs1 component of the MRN complex and is stabilized by the mediator of DNA damage checkpoint protein 1 (Mdc1). We find that Nbs1 is required for Mre11 localization at DNA replication foci in Ad E4 mutant infections. Mre11 is important for Mdc1 foci formation in infected cells, consistent with its role as a sensor of DNA damage. Chromatin immunoprecipitation assays indicate that both Mre11 and Mdc1 are physically bound to viral DNA, which could account for their localization in viral DNA containing foci. Efficient binding of Mre11 to E4 mutant DNA depends on the presence of Nbs1, and is correlated with a significant E4 mutant DNA replication defect. Our results are consistent with a model in which physical interaction of Mre11 with viral DNA is mediated by Nbs1, and interferes with viral DNA replication.

  3. Viral Reverse Transcriptases Show Selective High Affinity Binding to DNA-DNA Primer-Templates that Resemble the Polypurine Tract

    PubMed Central

    Nair, Gauri R.; Dash, Chandravanu; Le Grice, Stuart F. J.; DeStefano, Jeffrey J.

    2012-01-01

    Previous results using a SELEX (Systematic Evolution of Ligands by Exponential Enrichment)-based approach that selected DNA primer-template duplexes binding with high affinity to HIV reverse transcriptase (RT) showed that primers mimicking the 3′ end, and in particular the six nt terminal G tract, of the RNA polypurine tract (PPT; HIV PPT: 5′-AAAAGAAAAGGGGGG-3′) were preferentially selected. In this report, two viral (Moloney murine leukemia virus (MuLV) and avian myeloblastosis virus (AMV)) and one retrotransposon (Ty3) RTs were used for selection. Like HIV RT, both viral RTs selected duplexes with primer strands mimicking the G tract at the PPT 3′ end (AMV PPT: 5′-AGGGAGGGGGA-3′; MuLV PPT: 5′-AGAAAAAGGGGGG-3′). In contrast, Ty3, whose PPT lacks a G tract (5′-GAGAGAGAGGAA-3′) showed no selective binding to any duplex sequences. Experiments were also conducted with DNA duplexes (termed DNA PPTs) mimicking the RNA PPT-DNA duplex of each virus and a control duplex with a random DNA sequence. Retroviral RTs bound with high affinity to all viral DNA PPT constructs, with HIV and MuLV RTs showing comparable binding to the counterpart DNA PPT duplexes and reduced affinity to the AMV DNA PPT. AMV RT showed similar behavior with a modest preference for its own DNA PPT. Ty3 RT showed no preferential binding for its own or any other DNA PPT and viral RTs bound the Ty3 DNA PPT with relatively low affinity. In contrast, binding affinity of HIV RT to duplexes containing the HIV RNA PPT was less dependent on the G tract, which is known to be pivotal for efficient extension. We hypothesize that the G tract on the RNA PPT helps shift the binding orientation of RT to the 3′ end of the PPT where extension can occur. PMID:22848574

  4. Polyomavirus Large T Antigen Binds Cooperatively to Its Multiple Binding Sites in the Viral Origin of DNA Replication

    PubMed Central

    Peng, Yu-Cai; Acheson, Nicholas H.

    1998-01-01

    Polyomavirus large T antigen binds to multiple 5′-G(A/G)GGC-3′ pentanucleotide sequences in sites 1/2, A, B, and C within and adjacent to the origin of viral DNA replication on the polyomavirus genome. We asked whether the binding of large T antigen to one of these sites could influence binding to other sites. We discovered that binding to origin DNA is substantially stronger at pH 6 to 7 than at pH 7.4 to 7.8, a range often used in DNA binding assays. Large T antigen-DNA complexes formed at pH 6 to 7 were stable, but a fraction of these complexes dissociated at pH 7.6 and above upon dilution or during electrophoresis. Increased binding at low pH is therefore due at least in part to increased stability of protein-DNA complexes, and binding at higher pH values is reversible. Binding to fragments of origin DNA in which one or more sites were deleted or inactivated by point mutations was measured by nitrocellulose filter binding and DNase I footprinting. The results showed that large T antigen binds cooperatively to its four binding sites in viral DNA, suggesting that the binding of this protein to one of these sites stabilizes its binding to other sites via protein-protein contacts. Sites A, B, and C may therefore augment DNA replication by facilitating the binding of large T antigen to site 1/2 at the replication origin. ATP stabilized large T antigen-DNA complexes against dissociation in the presence, but not the absence, of site 1/2, and ATP specifically enhanced protection against DNase I digestion in the central 10 to 12 bp of site 1/2, at which hexamers are believed to form and begin unwinding DNA. We propose that large T antigen molecules bound to these multiple sites on origin DNA interact with each other to form a compact protein-DNA complex and, furthermore, that ATP stimulates their assembly into hexamers at site 1/2 by a “handover” mechanism mediated by these protein-protein contacts. PMID:9696829

  5. Small terminase couples viral DNA-binding to genome-packaging ATPase activity

    PubMed Central

    Roy, Ankoor; Bhardwaj, Anshul; Datta, Pinaki; Lander, Gabriel C.; Cingolani, Gino

    2012-01-01

    SUMMARY Packaging of viral genomes into empty procapsids is powered by a large DNA-packaging motor. In most viruses, this machine is composed of a large (L) and a small (S) terminase subunit complexed with a dodecamer of portal protein. Here, we describe the 1.75 Å crystal structure of the bacteriophage P22 S-terminase in a nonameric conformation. The structure presents a central channel ~23 Å in diameter, sufficiently large to accommodate hydrated B-DNA. The last 23 residues of S-terminase are essential for binding to DNA and assembly to L-terminase. Upon binding to its own DNA, S-terminase functions as a specific activator of L-terminase ATPase activity. The DNA-dependent stimulation of ATPase activity thus rationalizes the exclusive specificity of genome-packaging motors for viral DNA in the crowd of host DNA, ensuring fidelity of packaging and avoiding wasteful ATP hydrolysis. This posits a model for DNA-dependent activation of genome-packaging motors of general interest in virology. PMID:22771211

  6. Mutations that decrease DNA binding of the processivity factor of the herpes simplex virus DNA polymerase reduce viral yield, alter the kinetics of viral DNA replication, and decrease the fidelity of DNA replication.

    PubMed

    Jiang, Changying; Hwang, Ying T; Randell, John C W; Coen, Donald M; Hwang, Charles B C

    2007-04-01

    The processivity subunit of the herpes simplex virus DNA polymerase, UL42, is essential for viral replication and possesses both Pol- and DNA-binding activities. Previous studies demonstrated that the substitution of alanine for each of four arginine residues, which reside on the positively charged surface of UL42, resulted in decreased DNA binding affinity and a decreased ability to synthesize long-chain DNA by the polymerase. In this study, the effects of each substitution on the production of viral progeny, viral DNA replication, and DNA replication fidelity were examined. Each substitution mutant was able to complement the replication of a UL42 null mutant in transient complementation assays and to support the replication of plasmid DNA containing herpes simplex virus type 1 (HSV-1) origin sequences in transient DNA replication assays. Mutant viruses containing each substitution and a lacZ insertion in a nonessential region of the genome were constructed and characterized. In single-cycle growth assays, the mutants produced significantly less progeny virus than the control virus containing wild-type UL42. Real-time PCR assays revealed that these UL42 mutants synthesized less viral DNA during the early phase of infection. Interestingly, during the late phase of infection, the mutant viruses synthesized larger amounts of viral DNA than the control virus. The frequencies of mutations of the virus-borne lacZ gene increased significantly in the substitution mutants compared to those observed for the control virus. These results demonstrate that the reduced DNA binding of UL42 is associated with significant effects on virus yields, viral DNA replication, and replication fidelity. Thus, a processivity factor can influence replication fidelity in mammalian cells.

  7. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities.

    PubMed

    Guo, Yang; Kragelund, Birthe B; White, Malcolm F; Peng, Xu

    2015-06-19

    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5' → 3' ssDNA exonuclease activity, in addition to the previously demonstrated ssDNA endonuclease activity. Further, in vitro pull-down assay demonstrated interactions between gp17 and gp18 and between gp18 and gp19 with the former being mediated by the intrinsically disordered C-terminus of gp17. The strand-displacement replication mode proposed previously for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.

  8. EBV noncoding RNA binds nascent RNA to drive host PAX5 to viral DNA

    PubMed Central

    Lee, Nara; Moss, Walter N.; Yario, Therese A.; Steitz, Joan A.

    2015-01-01

    Summary EBER2 is an abundant nuclear noncoding RNA expressed by Epstein-Barr virus (EBV). Probing its possible chromatin localization by CHART revealed EBER2’s presence at the terminal repeats (TRs) of the latent EBV genome, overlapping previously identified binding sites for the B-cell transcription factor PAX5. EBER2 interacts with and is required for PAX5 localization to the TRs. EBER2 knockdown phenocopies PAX5 depletion in upregulating the expression of LMP2A/B and LMP1, genes nearest the TRs. Knockdown of EBER2 also decreases EBV lytic replication, underscoring the essential role of the TRs in viral replication. Recruitment of the EBER2-PAX5 complex is mediated by base-pairing between EBER2 and nascent transcripts from the TR locus. The interaction is evolutionarily conserved in the related primate herpesvirus CeHV15 despite great sequence divergence. Using base-pairing with nascent RNA to guide an interacting transcription factor to its DNA target site is a previously undescribed function for a trans-acting noncoding RNA. PMID:25662012

  9. KSHV but not MHV-68 LANA induces a strong bend upon binding to terminal repeat viral DNA

    PubMed Central

    Ponnusamy, Rajesh; Petoukhov, Maxim V.; Correia, Bruno; Custodio, Tania F.; Juillard, Franceline; Tan, Min; Pires de Miranda, Marta; Carrondo, Maria A.; Simas, J. Pedro; Kaye, Kenneth M.; Svergun, Dmitri I.; McVey, Colin E.

    2015-01-01

    Latency-associated nuclear antigen (LANA) is central to episomal tethering, replication and transcriptional regulation of γ2-herpesviruses. LANA binds cooperatively to the terminal repeat (TR) region of the viral episome via adjacent LANA binding sites (LBS), but the molecular mechanism by which LANA assembles on the TR remains elusive. We show that KSHV LANA and MHV-68 LANA proteins bind LBS DNA using strikingly different modes. Solution structure of LANA complexes revealed that while kLANA tetramer is intrinsically bent both in the free and bound state to LBS1–2 DNA, mLANA oligomers instead adopt a rigid linear conformation. In addition, we report a novel non-ring kLANA structure that displays more flexibility at its assembly interface than previously demonstrated. We identified a hydrophobic pivot point located at the dimer–dimer assembly interface, which gives rotational freedom for kLANA to adopt variable conformations to accommodate both LBS1–2 and LBS2–1–3 DNA. Alterations in the arrangement of LBS within TR or at the tetramer assembly interface have a drastic effect on the ability of kLANA binding. We also show kLANA and mLANA DNA binding functions can be reciprocated. Although KSHV and MHV-68 are closely related, the findings provide new insights into how the structure, oligomerization, and DNA binding of LANA have evolved differently to assemble on the TR DNA. PMID:26424851

  10. Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism

    PubMed Central

    Guo, Jinlei; Zhang, Xun; Song, Haiyan; Lv, Jianxin; Gao, Jimin; Wang, Yuepeng; Chen, Litian; Wang, Yue

    2013-01-01

    The accumulation of single-stranded DNA-binding (SSB) proteins is essential for organisms and has various applications. However, no study has simultaneously and systematically compared the characteristics of SSB proteins. In addition, SSB proteins may bind RNA and play an unknown biological role in RNA metabolism. Here, we expressed a novel species of SSB protein derived from Thermococcus kodakarensis KOD1 (KOD), as well as SSB proteins from Thermus thermophilus (TTH), Escherichia coli, and Sulfolobus Solfataricus P2 (SSOB), abbreviated kod, tth, bl21, and ssob, respectively. These SSB proteins could bind ssDNA and viral RNA. bl21 resisted heat treatment for more than 9 h, Ssob and kod could withstand 95°C for 10 h and retain its ssDNA- and RNA-binding ability. Four SSB proteins promoted the specificity of the DNA polymerase in PCR-based 5- and 9-kb genome fragment amplification. kod also increased the amplification of a 13-kb PCR product, and SSB protein–bound RNA resisted Benzonase digestion. The SSB proteins could also enter the host cell bound to RNA, which resulted in modulation of viral RNA metabolism, particularly ssob and bl21. PMID:23365690

  11. Binding of cationic porphyrin to isolated and encapsidated viral DNA analyzed by comprehensive spectroscopic methods.

    PubMed

    Zupán, Kristóf; Herényi, Levente; Tóth, Katalin; Majer, Zsuzsa; Csík, Gabriella

    2004-07-20

    The complexation of tetrakis(4-N-methylpyridyl)porphyrin (TMPyP) with free and encapsidated DNA of T7 bacteriophage was investigated. To identify binding modes and relative concentrations of bound TMPyP forms, the porphyrin absorption spectra at various base pair/porphyrin ratios were analyzed. Spectral decomposition, fluorescent lifetime, and circular dichroism measurements proved the presence of two main binding types of TMPyP, e.g., external binding and intercalation both in free and in encapsidated DNA. Optical melting studies revealed that TMPyP increases the strand separation temperature of both free and native phage DNA and does not change the phase transition temperature of phage capsid proteins. From these findings we concluded that TMPyP binding does not influence the protein structure and/or the protein-DNA interaction. A combined analysis of absorption spectra and fluorescence decay curves made possible the determination of concentrations of free, externally bound, and intercalated porphyrin. As a perspective, our results facilitate a qualitative analysis of the TMPyP binding process at various experimental conditions.

  12. Processivity factor of KSHV contains a nuclear localization signal and binding domains for transporting viral DNA polymerase into the nucleus

    SciTech Connect

    Chen Yali; Ciustea, Mihai; Ricciardi, Robert P. . E-mail: ricciardi@biochem.dental.upenn.edu

    2005-09-30

    Kaposi's sarcoma-associated human herpesvirus (KSHV) encodes a processivity factor (PF-8, ORF59) that forms homodimers and binds to viral DNA polymerase (Pol-8, ORF9). PF-8 is essential for stabilizing Pol-8 on template DNA so that Pol-8 can incorporate nucleotides continuously. Here, the intracellular interaction of these two viral proteins was examined by confocal immunofluorescence microscopy. When individually expressed, PF-8 was observed exclusively in the nucleus, whereas Pol-8 was found only in the cytoplasm. However, when co-expressed, Pol-8 was co-translocated with PF-8 into the nucleus. Mutational analysis revealed that PF-8 contains a nuclear localization signal (NLS) as well as domains located at the N-terminus and the C-proximal regions that are required for Pol-8 binding. This study suggests that the mechanism that enables PF-8 to transport Pol-8 into the nucleus is the first critical step required for Pol-8 and PF-8 to function processively in KSHV DNA synthesis.

  13. Catalytically-active complex of HIV-1 integrase with a viral DNA substrate binds anti-integrase drugs.

    PubMed

    Alian, Akram; Griner, Sarah L; Chiang, Vicki; Tsiang, Manuel; Jones, Gregg; Birkus, Gabriel; Geleziunas, Romas; Leavitt, Andrew D; Stroud, Robert M

    2009-05-19

    HIV-1 integration into the host cell genome is a multistep process catalyzed by the virally-encoded integrase (IN) protein. In view of the difficulty of obtaining a stable DNA-bound IN at high concentration as required for structure determination, we selected IN-DNA complexes that form disulfide linkages between 5'-thiolated DNA and several single mutations to cysteine around the catalytic site of IN. Mild reducing conditions allowed for selection of the most thermodynamically-stable disulfide-linked species. The most stable complexes induce tetramer formation of IN, as happens during the physiological integration reaction, and are able to catalyze the strand transfer step of retroviral integration. One of these complexes also binds strand-transfer inhibitors of HIV antiviral drugs, making it uniquely valuable among the mutants of this set for understanding portions of the integration reaction. This novel complex may help define substrate interactions and delineate the mechanism of action of known integration inhibitors.

  14. Binding sites for the herpes simplex virus immediate-early protein ICP4 impose an increased dependence on viral DNA replication on simple model promoters located in the viral genome.

    PubMed Central

    Koop, K E; Duncan, J; Smiley, J R

    1993-01-01

    We examined the ability of binding sites for the herpes simplex virus immediate-early protein ICP4 to alter the regulation of closely linked promoters by placing strong ICP4 binding sites upstream or downstream of simple TATA promoters in the intact viral genome. We found that binding sites strongly reduced the levels of expression at early times postinfection and that this effect was partially overcome after the onset of viral DNA replication. These data confirm that DNA-bound ICP4 can inhibit the activity of a closely linked promoter and raise the possibility that ICP4 binding sites contribute to temporal regulation during infection. Images PMID:8230448

  15. Catalytically-active complex of HIV-1 integrase with a viral DNA substrate binds anti-integrase drugs

    PubMed Central

    Alian, Akram; Griner, Sarah L.; Chiang, Vicki; Tsiang, Manuel; Jones, Gregg; Birkus, Gabriel; Geleziunas, Romas; Leavitt, Andrew D.; Stroud, Robert M.

    2009-01-01

    HIV-1 integration into the host cell genome is a multistep process catalyzed by the virally-encoded integrase (IN) protein. In view of the difficulty of obtaining a stable DNA-bound IN at high concentration as required for structure determination, we selected IN–DNA complexes that form disulfide linkages between 5′-thiolated DNA and several single mutations to cysteine around the catalytic site of IN. Mild reducing conditions allowed for selection of the most thermodynamically-stable disulfide-linked species. The most stable complexes induce tetramer formation of IN, as happens during the physiological integration reaction, and are able to catalyze the strand transfer step of retroviral integration. One of these complexes also binds strand-transfer inhibitors of HIV antiviral drugs, making it uniquely valuable among the mutants of this set for understanding portions of the integration reaction. This novel complex may help define substrate interactions and delineate the mechanism of action of known integration inhibitors. PMID:19416821

  16. Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.

    PubMed

    Saribas, A Sami; Mun, Sarah; Johnson, Jaslyn; El-Hajmoussa, Mohammad; White, Martyn K; Safak, Mahmut

    2014-01-20

    JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive. In this report, we have attempted to shed more light on this process by investigating molecular interactions between large T antigen (LT-Ag), Hsp70 and minor capsid proteins, VP2/VP3. We demonstrated that Hsp70 interacts with VP2/VP3 and LT-Ag; and accumulates heavily in the nucleus of the infected cells. We also showed that VP2/VP3 associates with LT-Ag through their DNA binding domains resulting in enhancement in LT-Ag DNA binding to Ori and induction in viral DNA replication. Altogether, our results suggest that VP2/VP3 and Hsp70 actively participate in JCV DNA replication and may play critical roles in coupling of viral DNA replication to virion encapsidation.

  17. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  18. Human T-Cell Leukemia Virus Type 1 Tax Requires Direct Access to DNA for Recruitment of CREB Binding Protein to the Viral Promoter

    PubMed Central

    Lenzmeier, Brian A.; Giebler, Holli A.; Nyborg, Jennifer K.

    1998-01-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5′-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter. PMID:9447968

  19. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

    PubMed

    Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

    2017-06-15

    African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV.IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently

  20. Efficient Induction of Nuclear Aggresomes by Specific Single Missense Mutations in the DNA-binding Domain of a Viral AP-1 Homolog*

    PubMed Central

    Park, Richard; Wang'ondu, Ruth; Heston, Lee; Shedd, Duane; Miller, George

    2011-01-01

    Nuclear aggresomes induced by proteins containing an expanded polyglutamine (polyQ) tract are pathologic hallmarks of certain neurodegenerative diseases. Some GFP fusion proteins lacking a polyQ tract may also induce nuclear aggresomes in cultured cells. Here we identify single missense mutations within the basic DNA recognition region of Bam HI Z E B virus replication activator (ZEBRA), an Epstein-Barr virus (EBV)-encoded basic zipper protein without a polyQ tract, that efficiently induced the formation of nuclear aggresomes. Wild-type (WT) ZEBRA was diffusely distributed within the nucleus. Four non-DNA-binding mutants, Z(R179E), Z(R183E), Z(R190E), and Z(K178D) localized to the periphery of large intranuclear spheres, to discrete nuclear aggregates, and to the cytoplasm. Other non-DNA-binding mutants, Z(N182K), Z(N182E), and Z(S186E), did not exhibit this phenotype. The interior of the spheres contained promyelocytic leukemia and HSP70 proteins. ZEBRA mutants directly induced the nuclear aggresome pathway in cells with and without EBV. Specific cellular proteins (SC35 and HDAC6) and viral proteins (WT ZEBRA, Rta, and BMLF1) but not other cellular or viral proteins were recruited to nuclear aggresomes. Co-transfection of WT ZEBRA with aggresome-inducing mutants Z(R183E) and Z(R179E) inhibited late lytic viral protein expression and lytic viral DNA amplification. This is the first reported instance in which nuclear aggresomes are induced by single missense mutations in a viral or cellular protein. We discuss conformational changes in the mutant viral AP-1 proteins that may lead to formation of nuclear aggresomes. PMID:21233201

  1. The AT-hook DNA binding ability of the Epstein Barr virus EBNA1 protein is necessary for the maintenance of viral genomes in latently infected cells.

    PubMed

    Chakravorty, Adityarup; Sugden, Bill

    2015-10-01

    Epstein Barr Virus (EBV) is a human tumor virus that is causally linked to malignancies such as Burkitt׳s lymphoma, and gastric and nasopharyngeal carcinomas. Tethering of EBV genomes to cellular chromosomes is required for the synthesis and persistence of viral plasmids in tumor cells. However, it is not established how EBV genomes are tethered to cellular chromosomes. We test the hypothesis that the viral protein EBNA1 tethers EBV genomes to chromosomes specifically through its N-terminal AT-hook DNA-binding domains by using a small molecule, netropsin, that has been shown to inhibit the AT-hook DNA-binding of EBNA1 in vitro. We show that netropsin forces the loss of EBV genomes from epithelial and lymphoid cells in an AT-hook dependent manner and that EBV-positive lymphoma cells are significantly more inhibited in their growth by netropsin than are corresponding EBV-negative cells.

  2. DNA binding by Kaposi's sarcoma-associated herpesvirus lytic switch protein is necessary for transcriptional activation of two viral delayed early promoters.

    PubMed

    Lukac, D M; Garibyan, L; Kirshner, J R; Palmeri, D; Ganem, D

    2001-08-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus-8) establishes latent and lytic infections in both lymphoid and endothelial cells and has been associated with diseases of both cell types. The KSHV open reading frame 50 (ORF50) protein is a transcriptional activator that plays a central role in the reactivation of lytic viral replication from latency. Here we identify and characterize a DNA binding site for the ORF50 protein that is shared by the promoters of two delayed early genes (ORF57 and K-bZIP). Transfer of this element to heterologous promoters confers on them high-level responsiveness to ORF50, indicating that the element is both necessary and sufficient for activation. The element consists of a conserved 12-bp palindromic sequence and less conserved sequences immediately 3' to it. Mutational analysis reveals that sequences within the palindrome are critical for binding and activation by ORF50, but the presence of a palindrome itself is not absolutely required. The 3' flanking sequences also play a critical role in DNA binding and transactivation. The strong concordance of DNA binding in vitro with transcriptional activation in vivo strongly implies that sequence-specific DNA binding is necessary for ORF50-mediated activation through this element. Expression of truncated versions of the ORF50 protein reveals that DNA binding is mediated by the amino-terminal 272 amino acids of the polypeptide.

  3. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication

    PubMed Central

    Spriggs, Chelsey C.

    2017-01-01

    ABSTRACT The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV. PMID:28196964

  4. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication.

    PubMed

    Spriggs, Chelsey C; Laimins, Laimonis A

    2017-02-14

    The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV.IMPORTANCE High-risk human papillomaviruses (HPVs) are the etiological agents of cervical cancer and are linked to the development of many other anogenital and oropharyngeal cancers. Identification of host cellular pathways involved in regulating the viral life cycle may be helpful in identifying treatments for HPV lesions. Mutations in genes of the Fanconi anemia (FA) DNA repair pathway lead to genomic instability in patients and a predisposition to HPV-associated malignancies. Our studies demonstrate that FA pathway component FANCD2 is recruited to HPV DNA, associates with members of the ATM DNA repair pathway, and is essential for the maintenance of viral episomes in basal

  5. Amino Acids in the Basic Domain of Epstein-Barr Virus ZEBRA Protein Play Distinct Roles in DNA Binding, Activation of Early Lytic Gene Expression, and Promotion of Viral DNA Replication

    PubMed Central

    Heston, Lee; El-Guindy, Ayman; Countryman, Jill; Dela Cruz, Charles; Delecluse, Henri-Jacques; Miller, George

    2006-01-01

    The ZEBRA protein of Epstein-Barr virus (EBV) drives the viral lytic cycle cascade. The capacity of ZEBRA to recognize specific DNA sequences resides in amino acids 178 to 194, a region in which 9 of 17 residues are either lysine or arginine. To define the basic domain residues essential for activity, a series of 46 single-amino-acid-substitution mutants were examined for their ability to bind ZIIIB DNA, a high-affinity ZEBRA binding site, and for their capacity to activate early and late EBV lytic cycle gene expression. DNA binding was obligatory for the protein to activate the lytic cascade. Nineteen mutants that failed to bind DNA were unable to disrupt latency. A single acidic replacement of a basic amino acid destroyed DNA binding and the biologic activity of the protein. Four mutants that bound weakly to DNA were defective at stimulating the expression of Rta, the essential first target of ZEBRA in lytic cycle activation. Four amino acids, R183, A185, C189, and R190, are likely to contact ZIIIB DNA specifically, since alanine or valine substitutions at these positions drastically weakened or eliminated DNA binding. Twenty-three mutants were proficient in binding to ZIIIB DNA. Some DNA binding-proficient mutants were refractory to supershift by BZ-1 monoclonal antibody (epitope amino acids 214 to 230), likely as the result of the increased solubility of the mutants. Mutants competent to bind DNA could be separated into four functional groups: the wild-type group (eight mutants), a group defective at activating Rta (five mutants, all with mutations at the S186 site), a group defective at activating EA-D (three mutants with the R179A, S186T, and K192A mutations), and a group specifically defective at activating late gene expression (seven mutants). Three late mutants, with a Y180A, Y180E, or K188A mutation, were defective at stimulating EBV DNA replication. This catalogue of point mutants reveals that basic domain amino acids play distinct functions in binding

  6. Binding of host-cell factors to DNA sequences in the long terminal repeat of human T-cell leukemia virus type I: implications for viral gene expression

    SciTech Connect

    Nyborg, J.K.; Dynan, W.S.; Chen, I.S.Y.; Wachsman, W.

    1988-03-01

    Efficient expression of human T-cell leukemia virus type I (HTLV-I) genes requires both host and viral proteins and is dependent on DNA sequences in the proviral long terminal repeats (LTRs). The authors have used DNase I-protection assays (footprinting) to construct a map of protein-DNA interactions over a 250-nucleotide region of the LTR upstream of the start site for viral RNA synthesis. They find that a host factor (host expression factor 1, or HEF-1) binds to the imperfect 21-nucleotide repeats that have previously been implicated in HTLV-I gene expression. HEF-1 binding activity is present in preparations from both lymphoid and nonlymphoid cells lines. However, the boundaries of the protected regions and the presence of a flanking DNase-hypersensitive site vary with cell type. Several regions of binding are detected in addition to the HEF-1 sites, including a complex group of sites 40-90 nucleotides upstream of the RNA start site. A comparison of HTLV-I transformed T lymphocytes that do and do not express the viral trans-activating protein p40/sup xI/ shows that none of the observed features of the DNase I footprint pattern correlate directly with the presence of this protein in the extract. These results suggest (i) that the primary recognition of promoter elements in the HTLV-I LTR involves specific interactions with host-cell proteins and (ii) that p40/sup xI/ influences the activity of one or more of these proteins, rather than interacting directly with the DNA.

  7. Apo B100 similarities to viral proteins suggest basis for LDL-DNA binding and transfection capacity.

    PubMed

    Guevara, Juan; Prashad, Nagindra; Ermolinsky, Boris; Gaubatz, John W; Kang, Dongcheul; Schwarzbach, Andrea E; Loose, David S; Guevara, Natalia Valentinova

    2010-07-01

    LDL mediates transfection with plasmid DNA in a variety of cell types in vitro and in several tissues in vivo in the rat. The transfection capacity of LDL is based on apo B100, as arginine/lysine clusters, suggestive of nucleic acid-binding domains and nuclear localization signal sequences, are present throughout the molecule. Apo E may also contribute to this capacity because of its similarity to the Dengue virus capsid proteins and its ability to bind DNA. Synthetic peptides representing two apo B100 regions with prominent Arg/Lys clusters were shown to bind DNA. Region 1 (0014Lys-Ser0160) shares sequence motifs present in DNA binding domains of Interferon Regulatory Factors and Flaviviridae capsid/core proteins. It also contains a close analog of the B/E receptor ligand of apo E. Region 1 peptides, B1-1 (0014Lys-Glu0054) and B1-2 (0055Leu-Ala0096), mediate transfection of HeLa cells but are cytotoxic. Region 2 (3313Asp-Thr3431), containing the known B/E receptor ligand, shares analog motifs with the human herpesvirus 5 immediate-early transcriptional regulator (UL122) and Flaviviridae NS3 helicases. Region 2 peptides, B2-1 (3313Asp-Glu3355), and B2-2 (3356Gly-Thr3431) are ineffective in cell transfection and are noncytotoxic. These results confirm the role of LDL as a natural transfection vector in vivo, a capacity imparted by the apo B100, and suggest a basis for Flaviviridae cell entry.

  8. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  9. The Emerging Role of Nuclear Viral DNA Sensors*

    PubMed Central

    Diner, Benjamin A.; Lum, Krystal K.; Cristea, Ileana M.

    2015-01-01

    Detecting pathogenic DNA by intracellular receptors termed “sensors” is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. PMID:26354430

  10. Multivalent counterions inhibit DNA ejection from viral capsid

    NASA Astrophysics Data System (ADS)

    Nguyen, Toan

    2008-03-01

    Viral DNA packaged inside a bacteriophage is tighly bent. This stored bending energy of DNA is believed to be the main driving force to eject viral DNA into host cell upon capsid binding. One can control the amount of ejected DNA by subjecting the virus to a solution of PEG8000 molecules. The molecules cannot penetrate the viral capsid, therefore, they exert an osmotic pressure on the virus preventing DNA ejection. Experiments showed that for a given osmotic pressure, the degree of ejection also depends on the concentration of small ions in solution. Interestingly, for multivalent ions (such as Mg2+, Spd3+ or HexCo3+), this dependence is non-monotonic. We propose a simple electrostatic theory to explain this non-monotonic behavior. This is based on the fact that DNA molecules can invert its net charge at high enough multivalent counterion concentration. In other words, as multivalent counterion concentration is increased from zero, charge of DNA molecules change from negative to positive. At the concentration where DNA net charge is zero, the DNA molecules experience an attraction between different segments and DNA ejected amount is reduced. At low or high counterion concentration, DNA segments are charged (negatively or positively), repel each other and DNA ejected amount is increased. Fitting the result of the theory to experimental data, we obtain a numerical value for Mg2+ mediated DNA - DNA attraction energy to be -0.008kT per base.

  11. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

    PubMed Central

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

    2015-01-01

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

  12. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism.

    PubMed

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y; Varnado, Brittany; Beutler, John A; Murelli, Ryan P; Le Grice, Stuart F J; Tang, Liang

    2015-12-15

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg(2+). A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg(2+) from Ca(2+). Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Calcein represses human papillomavirus 16 E1-E2 mediated DNA replication via blocking their binding to the viral origin of replication.

    PubMed

    Das, Dipon; Smith, Nathan W; Wang, Xu; Richardson, Stacie L; Hartman, Matthew C T; Morgan, Iain M

    2017-08-01

    Human papillomaviruses are causative agents in several human diseases ranging from genital warts to ano-genital and oropharyngeal cancers. Currently only symptoms of HPV induced disease are treated; there are no antivirals available that directly target the viral life cycle. Previously, we determined that the cellular protein TopBP1 interacts with the HPV16 replication/transcription factor E2. This E2-TopBP1 interaction is essential for optimal E1-E2 DNA replication and for the viral life cycle. The drug calcein disrupts the interaction of TopBP1 with itself and other host proteins to promote cell death. Here we demonstrate that calcein blocks HPV16 E1-E2 DNA replication via blocking the viral replication complex forming at the origin of replication. This occurs at non-toxic levels of calcein and demonstrates specificity as it does not block the ability of E2 to regulate transcription. We propose that calcein or derivatives could be developed as an anti-HPV therapeutic. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. HIV-1 Integrase Binds the Viral RNA Genome and Is Essential during Virion Morphogenesis.

    PubMed

    Kessl, Jacques J; Kutluay, Sebla B; Townsend, Dana; Rebensburg, Stephanie; Slaughter, Alison; Larue, Ross C; Shkriabai, Nikoloz; Bakouche, Nordine; Fuchs, James R; Bieniasz, Paul D; Kvaratskhelia, Mamuka

    2016-08-25

    While an essential role of HIV-1 integrase (IN) for integration of viral cDNA into human chromosome is established, studies with IN mutants and allosteric IN inhibitors (ALLINIs) have suggested that IN can also influence viral particle maturation. However, it has remained enigmatic as to how IN contributes to virion morphogenesis. Here, we demonstrate that IN directly binds the viral RNA genome in virions. These interactions have specificity, as IN exhibits distinct preference for select viral RNA structural elements. We show that IN substitutions that selectively impair its binding to viral RNA result in eccentric, non-infectious virions without affecting nucleocapsid-RNA interactions. Likewise, ALLINIs impair IN binding to viral RNA in virions of wild-type, but not escape mutant, virus. These results reveal an unexpected biological role of IN binding to the viral RNA genome during virion morphogenesis and elucidate the mode of action of ALLINIs.

  15. Small Molecule Inhibition of Epstein - Barr Virus Nuclear Antigen-1 DNA Binding Activity Interferes with Replication and Persistence of the Viral Genome

    PubMed Central

    Noh, Ka-Won; Joo, Eun Hye; Zhao, Bo; Kieff, Elliott; Kang, Myung-Soo

    2014-01-01

    The replication and persistence of extra chromosomal Epstein-Barr virus (EBV) episome in latently infected cells are primarily dependent on the binding of EBV-encoded nuclear antigen 1 (EBNA1) to the cognate EBV oriP element. In continuation of the previous study, herein we characterized EBNA1 small molecule inhibitors (H20, H31) and their underlying inhibitory mechanisms. In silico docking analyses predicted that H20 fits into a pocket in the EBNA1 DNA binding domain (DBD). However, H20 did not significantly affect EBNA1 binding to its cognate sequence. A limited structure-relationship study of H20 identified a hydrophobic compound H31, as an EBNA1 inhibitor. An in vitro EBNA1 EMSA and in vivo EGFP-EBNA1 confocal microscopy analysis showed that H31 inhibited EBNA1-dependent oriP sequence-specific DNA binding activity, but not sequence-nonspecific chromosomal association. Consistent with this, H31 repressed the EBNA1-dependent transcription, replication, and persistence of an EBV oriP plasmid. Furthermore, H31 induced progressive loss of EBV episome. In addition, H31 selectively retarded the growth of EBV-infected LCL or Burkitt’s lymphoma cells. These data indicate that H31 inhibition of EBNA1-dependent DNA binding decreases transcription from and persistence of EBV episome in EBV-infected cells. These new compounds might be useful probes for dissecting EBNA1 functions in vitro and in vivo. PMID:24486954

  16. The Tomato yellow leaf curl virus V2 protein forms aggregates depending on the cytoskeleton integrity and binds viral genomic DNA.

    PubMed

    Moshe, Adi; Belausov, Eduard; Niehl, Annette; Heinlein, Manfred; Czosnek, Henryk; Gorovits, Rena

    2015-05-05

    The spread of Tomato yellow leaf curl virus (TYLCV) was accompanied by the formation of coat protein (CP) aggregates of increasing size in the cytoplasm and nucleus of infected tomato (Solanum lycopersicum) cells. In order to better understand the TYLCV-host interaction, we investigated the properties and the subcellular accumulation pattern of the non-structural viral protein V2. CP and V2 are the only sense-oriented genes on the virus circular single-stranded DNA genome. Similar to CP, V2 localized to cytoplasmic aggregates of increasing size and as infection progressed was also found in nuclei, where it co-localized with CP. V2 was associated with viral genomic DNA molecules, suggesting that V2 functions as a DNA shuttling protein. The formation and the 26S proteasome-mediated degradation of V2 aggregates were dependent on the integrity of the actin and microtubule cytoskeleton. We propose that the cytoskeleton-dependent formation and growth of V2 aggregates play an important role during TYLCV infection, and that microtubules and actin filaments are important for the delivery of V2 to the 26S proteasome.

  17. The Tomato yellow leaf curl virus V2 protein forms aggregates depending on the cytoskeleton integrity and binds viral genomic DNA

    PubMed Central

    Moshe, Adi; Belausov, Eduard; Niehl, Annette; Heinlein, Manfred; Czosnek, Henryk; Gorovits, Rena

    2015-01-01

    The spread of Tomato yellow leaf curl virus (TYLCV) was accompanied by the formation of coat protein (CP) aggregates of increasing size in the cytoplasm and nucleus of infected tomato (Solanum lycopersicum) cells. In order to better understand the TYLCV-host interaction, we investigated the properties and the subcellular accumulation pattern of the non-structural viral protein V2. CP and V2 are the only sense-oriented genes on the virus circular single-stranded DNA genome. Similar to CP, V2 localized to cytoplasmic aggregates of increasing size and as infection progressed was also found in nuclei, where it co-localized with CP. V2 was associated with viral genomic DNA molecules, suggesting that V2 functions as a DNA shuttling protein. The formation and the 26S proteasome-mediated degradation of V2 aggregates were dependent on the integrity of the actin and microtubule cytoskeleton. We propose that the cytoskeleton-dependent formation and growth of V2 aggregates play an important role during TYLCV infection, and that microtubules and actin filaments are important for the delivery of V2 to the 26S proteasome. PMID:25940862

  18. Regulation of a viral proteinase by a peptide and DNA in one-dimensional space: I. binding to DNA AND to hexon of the precursor to protein VI, pVI, of human adenovirus.

    PubMed

    Graziano, Vito; McGrath, William J; Suomalainen, Maarit; Greber, Urs F; Freimuth, Paul; Blainey, Paul C; Luo, Guobin; Xie, X Sunney; Mangel, Walter F

    2013-01-18

    The precursor to adenovirus protein VI, pVI, is a multifunctional protein with different roles early and late in virus infection. Here, we focus on two roles late in infection, binding of pVI to DNA and to the major capsid protein hexon. pVI bound to DNA as a monomer independent of DNA sequence with an apparent equilibrium dissociation constant, K(d)((app)), of 46 nm. Bound to double-stranded DNA, one molecule of pVI occluded 8 bp. Upon the binding of pVI to DNA, three sodium ions were displaced from the DNA. A ΔG(0)(0) of -4.54 kcal/mol for the nonelectrostatic free energy of binding indicated that a substantial component of the binding free energy resulted from nonspecific interactions between pVI and DNA. The proteolytically processed, mature form of pVI, protein VI, also bound to DNA; its K(d)((app)) was much higher, 307 nm. The binding assays were performed in 1 mm MgCl(2) because in the absence of magnesium, the binding to pVI or protein VI to DNA was too tight to determine a K(d)((app)). Three molecules of pVI bound to one molecule of the hexon trimer with an equilibrium dissociation constant K(d)((app)) of 1.1 nm.

  19. Recombination-dependent concatemeric viral DNA replication.

    PubMed

    Lo Piano, Ambra; Martínez-Jiménez, María I; Zecchi, Lisa; Ayora, Silvia

    2011-09-01

    The initiation of viral double stranded (ds) DNA replication involves proteins that recruit and load the replisome at the replication origin (ori). Any block in replication fork progression or a programmed barrier may act as a factor for ori-independent remodelling and assembly of a new replisome at the stalled fork. Then replication initiation becomes dependent on recombination proteins, a process called recombination-dependent replication (RDR). RDR, which is recognized as being important for replication restart and stability in all living organisms, plays an essential role in the replication cycle of many dsDNA viruses. The SPP1 virus, which infects Bacillus subtilis cells, serves as a paradigm to understand the links between replication and recombination in circular dsDNA viruses. SPP1-encoded initiator and replisome assembly proteins control the onset of viral replication and direct the recruitment of host-encoded replisomal components at viral oriL. SPP1 uses replication fork reactivation to switch from ori-dependent θ-type (circle-to-circle) replication to σ-type RDR. Replication fork arrest leads to a double strand break that is processed by viral-encoded factors to generate a D-loop into which a new replisome is assembled, leading to σ-type viral replication. SPP1 RDR proteins are compared with similar proteins encoded by other viruses and their possible in vivo roles are discussed.

  20. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  1. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  2. Live cell imaging reveals the relocation of dsRNA binding proteins upon viral infection.

    PubMed

    Barton, Deborah; Roovers, Elke; Gouil, Quentin; C da Fonseca, Guilherme; Reis, Rodrigo S; Jackson, Craig; Overall, Robyn; Fusaro, Adriana; Waterhouse, Peter

    2017-03-15

    Viral infection triggers a range of plant responses such as the activation of the RNA interference (RNAi) pathway. The double-stranded RNA binding (DRB) proteins, DRB3 and DRB4, are part of this pathway and aid in defending against DNA and RNA viruses, respectively. Using live cell imaging, we show that DRB2, DRB3 and DRB5 relocate from their uniform cytoplasmic distribution to concentrated accumulation in nascent viral replication complexes (VRCs) that develop following cell invasion by viral RNA. Inactivation of the DRB3 gene in Arabidopsis, by T-DNA insertion, rendered these plants less able to repress RNA viral replication. We propose a model for the early stages of virus defense in which DRB2, DRB3 and DRB5 are invasion sensors that relocate to nascent VRCs, where they bind to viral RNA and inhibit virus replication.

  3. Targeted DNA mutagenesis for the cure of chronic viral infections.

    PubMed

    Schiffer, Joshua T; Aubert, Martine; Weber, Nicholas D; Mintzer, Esther; Stone, Daniel; Jerome, Keith R

    2012-09-01

    Human immunodeficiency virus type 1 (HIV-1), hepatitis B virus (HBV), and herpes simplex virus (HSV) have been incurable to date because effective antiviral therapies target only replicating viruses and do not eradicate latently integrated or nonreplicating episomal viral genomes. Endonucleases that can target and cleave critical regions within latent viral genomes are currently in development. These enzymes are being engineered with high specificity such that off-target binding of cellular DNA will be absent or minimal. Imprecise nonhomologous-end-joining (NHEJ) DNA repair following repeated cleavage at the same critical site may permanently disrupt translation of essential viral proteins. We discuss the benefits and drawbacks of three types of DNA cleavage enzymes (zinc finger endonucleases, transcription activator-like [TAL] effector nucleases [TALENs], and homing endonucleases [also called meganucleases]), the development of delivery vectors for these enzymes, and potential obstacles for successful treatment of chronic viral infections. We then review issues regarding persistence of HIV-1, HBV, and HSV that are relevant to eradication with genome-altering approaches.

  4. Targeted DNA Mutagenesis for the Cure of Chronic Viral Infections

    PubMed Central

    Schiffer, Joshua T.; Aubert, Martine; Weber, Nicholas D.; Mintzer, Esther; Stone, Daniel

    2012-01-01

    Human immunodeficiency virus type 1 (HIV-1), hepatitis B virus (HBV), and herpes simplex virus (HSV) have been incurable to date because effective antiviral therapies target only replicating viruses and do not eradicate latently integrated or nonreplicating episomal viral genomes. Endonucleases that can target and cleave critical regions within latent viral genomes are currently in development. These enzymes are being engineered with high specificity such that off-target binding of cellular DNA will be absent or minimal. Imprecise nonhomologous-end-joining (NHEJ) DNA repair following repeated cleavage at the same critical site may permanently disrupt translation of essential viral proteins. We discuss the benefits and drawbacks of three types of DNA cleavage enzymes (zinc finger endonucleases, transcription activator-like [TAL] effector nucleases [TALENs], and homing endonucleases [also called meganucleases]), the development of delivery vectors for these enzymes, and potential obstacles for successful treatment of chronic viral infections. We then review issues regarding persistence of HIV-1, HBV, and HSV that are relevant to eradication with genome-altering approaches. PMID:22718830

  5. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  6. Membrane-assisted viral DNA ejection.

    PubMed

    Santos-Pérez, Isaac; Oksanen, Hanna M; Bamford, Dennis H; Goñi, Felix M; Reguera, David; Abrescia, Nicola G A

    2017-03-01

    Genome packaging and delivery are fundamental steps in the replication cycle of all viruses. Icosahedral viruses with linear double-stranded DNA (dsDNA) usually package their genome into a preformed, rigid procapsid using the power generated by a virus-encoded packaging ATPase. The pressure and stored energy due to this confinement of DNA at a high density is assumed to drive the initial stages of genome ejection. Membrane-containing icosahedral viruses, such as bacteriophage PRD1, present an additional architectural complexity by enclosing their genome within an internal membrane vesicle. Upon adsorption to a host cell, the PRD1 membrane remodels into a proteo-lipidic tube that provides a conduit for passage of the ejected linear dsDNA through the cell envelope. Based on volume analyses of PRD1 membrane vesicles captured by cryo-electron tomography and modeling of the elastic properties of the vesicle, we propose that the internal membrane makes a crucial and active contribution during infection by maintaining the driving force for DNA ejection and countering the internal turgor pressure of the host. These novel functions extend the role of the PRD1 viral membrane beyond tube formation or the mere physical confinement of the genome. The presence and assistance of an internal membrane might constitute a biological advantage that extends also to other viruses that package their linear dsDNA to high density within an internal vesicle.

  7. DNA-Binding Proteins Essential for Protein-Primed Bacteriophage Φ29 DNA Replication.

    PubMed

    Salas, Margarita; Holguera, Isabel; Redrejo-Rodríguez, Modesto; de Vega, Miguel

    2016-01-01

    Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5' ends of the DNA. This protein, called terminal protein (TP), is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB) that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP) that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3'-5' exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding and localization of the

  8. DNA-Binding Proteins Essential for Protein-Primed Bacteriophage Φ29 DNA Replication

    PubMed Central

    Salas, Margarita; Holguera, Isabel; Redrejo-Rodríguez, Modesto; de Vega, Miguel

    2016-01-01

    Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5′ ends of the DNA. This protein, called terminal protein (TP), is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB) that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP) that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3′–5′ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding and

  9. Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

    PubMed Central

    Graziano, Vito; Luo, Guobin; Blainey, Paul C.; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

    2013-01-01

    Late in an adenovirus infection, the viral proteinase (AVP) becomes activated to process virion precursor proteins used in virus assembly. AVP is activated by two cofactors, the viral DNA and pVIc, an 11-amino acid peptide originating from the C terminus of the precursor protein pVI. There is a conundrum in the activation of AVP in that AVP and pVI are sequence-independent DNA-binding proteins with nm equilibrium dissociation constants such that in the virus particle, they are predicted to be essentially irreversibly bound to the viral DNA. Here, we resolve that conundrum by showing that activation of AVP takes place on the one-dimensional contour of DNA. In vitro, pVI, a substrate, slides on DNA via one-dimensional diffusion, D1 = 1.45 × 106 bp2/s, until it binds to AVP also on the same DNA molecule. AVP, partially activated by being bound to DNA, excises pVIc, which binds to the AVP molecule that cut it out. pVIc then forms a disulfide bond with AVP forming the fully active AVP-pVIc complex bound to DNA. In vivo, in heat-disrupted immature virus, AVP was also activated by pVI in DNA-dependent reactions. This activation mechanism illustrates a new paradigm for virion maturation and a new way, by sliding on DNA, for bimolecular complexes to form among proteins not involved in DNA metabolism. PMID:23043137

  10. A core viral protein binds host nucleosomes to sequester immune danger signals.

    PubMed

    Avgousti, Daphne C; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C; Blumenthal, Daniel; Paris, Andrew J; Reyes, Emigdio D; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H; Worthen, G Scott; Black, Ben E; Garcia, Benjamin A; Weitzman, Matthew D

    2016-07-07

    Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important part in innate immune responses. Viral-encoded core basic proteins compact viral genomes, but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles, it is unknown whether protein VII affects cellular chromatin. Here we show that protein VII alters cellular chromatin, leading us to hypothesize that this has an impact on antiviral responses during adenovirus infection in human cells. We find that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter the protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in the chromatin of members of the high-mobility-group protein B family (HMGB1, HMGB2 and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together, our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling.

  11. A core viral protein binds host nucleosomes to sequester immune danger signals

    PubMed Central

    Avgousti, Daphne C.; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J.; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C.; Blumenthal, Daniel; Paris, Andrew J.; Reyes, Emigdio D.; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H.; Worthen, G. Scott; Black, Ben E.; Garcia, Benjamin A.; Weitzman, Matthew D.

    2016-01-01

    Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses1. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important role in innate immune responses2. Viral encoded core basic proteins compact viral genomes but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones3. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles4,5, it is unknown whether protein VII impacts cellular chromatin. Our observation that protein VII alters cellular chromatin led us to hypothesize that this impacts antiviral responses during adenovirus infection. We found that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in chromatin of members of the high-mobility group protein B family (HMGB1, HMGB2, and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses6,7. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

  12. Viral Capsid DNA Aptamer Conjugates as Multivalent Cell Targeting Vehicles

    PubMed Central

    Tong, Gary J.; Hsiao, Sonny C.; Carrico, Zachary M.; Francis, Matthew B.

    2009-01-01

    Nucleic acid aptamers offer significant potential as convenient and evolvable targeting groups for drug delivery. To attach them to the surface of a genome-free viral capsid carrier, an efficient oxidative coupling strategy has been developed. The method involves the periodate-mediated reaction of phenylene diamine substituted oligonucleotides with aniline groups installed on the outer surface of the capsid shells. Up to 60 DNA strands can be attached to each viral capsid with no apparent loss of base-pairing capabilities or protein stability. The ability of the capsids to bind specific cellular targets was demonstrated through the attachment of a 41-nucleotide sequence that targets a tyrosine kinase receptor on Jurkat T cells. After the installation of a fluorescent dye on the capsid interior, capsids bearing the cell-targeting sequence showed significant levels of binding to the cells relative to control samples. Colocalization experiments using confocal microscopy indicated that the capsids were endocytosed and trafficked to lysosomes for degradation. These observations suggest that aptamer-labeled capsids could be used for the targeted drug delivery of acid-labile prodrugs that would be preferentially released upon lysosomal acidification. PMID:19603808

  13. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

    2017-01-01

    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  14. DNA Binding Hydroxyl Radical Probes.

    PubMed

    Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

    2012-01-01

    The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA.

  15. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  16. LL37 inhibits the inflammatory endothelial response induced by viral or endogenous DNA.

    PubMed

    Merkle, Monika; Pircher, Joachim; Mannell, Hanna; Krötz, Florian; Blüm, Philipp; Czermak, Thomas; Gaitzsch, Erik; Schneider, Christine; Köppel, Simone; Ribeiro, Andrea; Wörnle, Markus

    2015-12-01

    In viral infection, morbidity and mortality often result from extrahepatic disease manifestations such as vasculitis. We hereby show that human microvascular endothelial cells express viral receptors of the innate immune system which are induced upon ligand engagement. Furthermore, stimulation of endothelial cells with the synthetic analog of viral DNA, poly (dA:dT), human DNA and hepatitis B virus-containing immunoprecipitates from a patient with polyarteritis nodosa induces an inflammatory response including the upregulation of adhesion molecules, which is mediated exclusively by TLR9 and involves an IRF3-dependent pathway. Thus, endothelial cells are able to actively participate in immune mediated vascular inflammation caused by viral infections. Furthermore, we provide evidence for the ability of LL37 to bind and internalize viral or endogenous DNA into non-immune cells. DNA nucleotides internalized by LL37 suppress the production of proinflammatory mediators suggesting a protective effect against direct responses to viral infection or circulating DNA-fragments of endogenous origin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Effect of clustered peptide binding on DNA condensation.

    PubMed

    Haley, Jennifer; Kabiru, Paul; Geng, Yan

    2010-01-01

    DNA condensation in-vitro has been studied as a model system to reveal common principles underlying gene packaging in biology, and as the critical first step towards the development of non-viral gene delivery vectors. In this study, we use a bio-inspired approach, where small DNA-binding peptides are controllably clustered by an amphiphilic block copolymer scaffold, to reveal the effect of clustered peptide binding on the energetics, size, shape and physical properties of DNA condensation in-vitro. This provides insights into the general architectural effect of gene-binding proteins on DNA condensation process. Moreover, the versatility afforded by regulating the clustering density and composition of peptides may provide a novel design platform for gene delivery applications in the future.

  18. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    SciTech Connect

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures of IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.

  19. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    PubMed Central

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2011-01-01

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-β (IFN-β) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-β promoter elements revealed flexibility in the loops (L1–L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures of IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding. PMID:21596780

  20. New DNA-binding radioprotectors

    NASA Astrophysics Data System (ADS)

    Martin, Roger

    The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is

  1. Adenovirus DNA-binding protein forms a multimeric protein complex with double-stranded DNA and enhances binding of nuclear factor I.

    PubMed Central

    Stuiver, M H; van der Vliet, P C

    1990-01-01

    The 72-kilodalton adenovirus DNA-binding protein (DBP) binds to single-stranded DNA as well as to RNA and double-stranded DNA and is essential for the replication of viral DNA. We investigated the binding of DBP to double-stranded DNA by gel retardation analysis. By using a 114-base-pair DNA fragment, five or six different complexes were observed by gel retardation. The mobility of these complexes is dependent on the DBP concentration, suggesting that the complexes arise by sequential binding of DBP molecules to the DNA. In contrast to binding to single-stranded DNA, the binding of DBP to double-stranded DNA appears to be noncooperative. DBP binds to linear DNA as well as to circular DNA, while linear DNA containing the adenovirus terminal protein was also recognized. No specificity for adenovirus origin sequences was observed. To study whether the binding of DBP could influence initiation of DNA replication, we analyzed the effect of DBP on the binding of nuclear factor I (NFI) and NFIII, two sequence-specific origin-recognizing proteins that enhance initiation. At subsaturating levels of NFI, DBP increases the rate of binding of NFI considerably, while no effect was seen on NFIII. This stimulation of NFI binding is specific for DBP and was not observed with another protein (NFIV), which forms a similar DNA-multimeric protein complex. In agreement with enhanced NFI binding, DBP stimulates initiation of adenovirus DNA replication in vitro especially strongly at subsaturating NFI concentrations. We explain our results by assuming that DBP forms a complex with origin DNA that promotes formation of an alternative DNA structure, thereby facilitating the binding of NFI as well as the initiation of DNA replication via NFI. Images PMID:2293667

  2. DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.

    PubMed

    Rowles, Daniell L; Tsai, Yuan-Chin; Greco, Todd M; Lin, Aaron E; Li, Minghao; Yeh, Justin; Cristea, Ileana M

    2015-06-01

    Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. These changes can act to promote viral replication or host defense. Herpes simplex virus type 1 (HSV-1) is a prominent human pathogen, which relies on interactions with host factors for efficient replication and spread. Nevertheless, the knowledge regarding its modulation of epigenetic factors remains limited. Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine-5)-methyltransferase 3A (DNMT3A), which we confirmed by reciprocal isolations and microscopy. We show that drug-induced inhibition of DNA methyltransferase activity, as well as siRNA- and shRNA-mediated DNMT3A knockdowns trigger reductions in virus titers. Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection.

  3. Effect of DNA Repair Protein Rad18 on Viral Infection

    PubMed Central

    Lloyd, Aliza G; Tateishi, Satoshi; Bieniasz, Paul D; Muesing, Mark A; Yamaizumi, Masaru; Mulder, Lubbertus C. F

    2006-01-01

    Host factors belonging to the DNA repair machineries are assumed to aid retroviruses in the obligatory step of integration. Here we describe the effect of DNA repair molecule Rad18, a component of the post-replication repair pathway, on viral infection. Contrary to our expectations, cells lacking Rad18 were consistently more permissive to viral transduction as compared to Rad18+/+ controls. Remarkably, such susceptibility was integration independent, since retroviruses devoid of integration activity also showed enhancement of the initial steps of infection. Moreover, the elevated sensitivity of the Rad18−/− cells was also observed with adenovirus. These data indicate that Rad18 suppresses viral infection in a non-specific fashion, probably by targeting incoming DNA. Furthermore, considering data published recently, it appears that the interactions between DNA repair components with incoming viruses, often result in inhibition of the infection rather than cooperation toward its establishment. PMID:16710452

  4. HTLV-1 Tax Protein Stimulation of DNA Binding of bZIP Proteins by Enhancing Dimerization

    NASA Astrophysics Data System (ADS)

    Wagner, Susanne; Green, Michael R.

    1993-10-01

    The Tax protein of human T cell leukemia virus type-1 (HTLV-I) transcriptionally activates the HTLV-I promoter. This activation requires binding sites for activating transcription factor (ATF) proteins, a family of cellular proteins that contain basic region-leucine zipper (bZIP) DNA binding domains. Data are presented showing that Tax increases the in vitro DNA binding activity of multiple ATF proteins. Tax also stimulated DNA binding by other bZIP proteins, but did not affect DNA binding proteins that lack a bZIP domain. The increase in DNA binding occurred because Tax promotes dimerization of the bZIP domain in the absence of DNA, and the elevated concentration of the bZIP homodimer then facilitates the DNA binding reaction. These results help explain how Tax activates viral transcription and transforms cells.

  5. The Sunscreen Octyl Methoxycinnamate Binds to DNA

    NASA Astrophysics Data System (ADS)

    Norrell, Johannes; Vohra, Shikhar; Nordlund, T. M.

    2000-03-01

    Sunscreens are designed to prevent skin cancer by absorbing ultraviolet radiation from the sun before it gets to the DNA in skin cells. The purpose of this work is to determine whether or not octyl methoxycinnamate, an active ingredient in many sunscreens, will bind to DNA. If so, the sunscreen could transfer the energy it absorbed from the sun to the DNA and cause damage. To determine this, we prepared samples with varying concentrations of cinnamate added to herring sperm DNA, sonicating the mixture to disperse the hydrophobic sunscreen into solution. Absorption and fluorescence spectra of the mixtures showed (i) much more sunscreen was dispersed into solution when DNA was present, and (ii) the spectra of both DNA and sunscreen differed from those of the separate solutions. We conclude that the octyl methoxycinnamate can indeed bind to DNA in aqueous solution. Energy transfer experiments from DNA to sunscreen and from sunscreen to 2-aminopurine- (a fluorescent DNA base) labeled DNA will be presented.

  6. Viral manipulation of DNA repair and cell cycle checkpoints

    PubMed Central

    Chaurushiya, Mira S.; Weitzman, Matthew D.

    2009-01-01

    Recognition and repair of DNA damage is critical for maintaining genomic integrity and suppressing tumorigenesis. In eukaryotic cells, the sensing and repair of DNA damage are exquisitely coordinated with cell cycle progression and checkpoints, in order to prevent the propagation of damaged DNA. The carefully maintained cellular response to DNA damage is challenged by viruses, which produce a large amount of exogenous DNA during infection. Viruses also express proteins that perturb cellular DNA repair and cell cycle pathways, promoting tumorigenesis in their quest for cellular domination. This review presents an overview of strategies employed by viruses to manipulate DNA damage responses and cell cycle checkpoints as they commandeer the cell to maximize their own viral replication. Studies of viruses have identified key cellular regulators and revealed insights into molecular mechanisms governing DNA repair, cell cycle checkpoints, and transformation. PMID:19473887

  7. DNA binding studies of tartrazine food additive.

    PubMed

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  8. Viral Discovery and Sequence Recovery Using DNA Microarrays

    PubMed Central

    Wang, David; Urisman, Anatoly; Liu, Yu-Tsueng; Springer, Michael; Ksiazek, Thomas G; Erdman, Dean D; Mardis, Elaine R; Hickenbotham, Matthew; Magrini, Vincent; Eldred, James; Latreille, J. Phillipe; Wilson, Richard K; Ganem, Don

    2003-01-01

    Because of the constant threat posed by emerging infectious diseases and the limitations of existing approaches used to identify new pathogens, there is a great demand for new technological methods for viral discovery. We describe herein a DNA microarray-based platform for novel virus identification and characterization. Central to this approach was a DNA microarray designed to detect a wide range of known viruses as well as novel members of existing viral families; this microarray contained the most highly conserved 70mer sequences from every fully sequenced reference viral genome in GenBank. During an outbreak of severe acute respiratory syndrome (SARS) in March 2003, hybridization to this microarray revealed the presence of a previously uncharacterized coronavirus in a viral isolate cultivated from a SARS patient. To further characterize this new virus, approximately 1 kb of the unknown virus genome was cloned by physically recovering viral sequences hybridized to individual array elements. Sequencing of these fragments confirmed that the virus was indeed a new member of the coronavirus family. This combination of array hybridization followed by direct viral sequence recovery should prove to be a general strategy for the rapid identification and characterization of novel viruses and emerging infectious disease. PMID:14624234

  9. Rhodopsin targeted transcriptional silencing by DNA-binding.

    PubMed

    Botta, Salvatore; Marrocco, Elena; de Prisco, Nicola; Curion, Fabiola; Renda, Mario; Sofia, Martina; Lupo, Mariangela; Carissimo, Annamaria; Bacci, Maria Laura; Gesualdo, Carlo; Rossi, Settimio; Simonelli, Francesca; Surace, Enrico Maria

    2016-03-14

    Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations.

  10. Rhodopsin targeted transcriptional silencing by DNA-binding

    PubMed Central

    Botta, Salvatore; Marrocco, Elena; de Prisco, Nicola; Curion, Fabiola; Renda, Mario; Sofia, Martina; Lupo, Mariangela; Carissimo, Annamaria; Bacci, Maria Laura; Gesualdo, Carlo; Rossi, Settimio; Simonelli, Francesca; Surace, Enrico Maria

    2016-01-01

    Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations. DOI: http://dx.doi.org/10.7554/eLife.12242.001 PMID:26974343

  11. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  12. A Low Protein Binding Cationic Poly(2-oxazoline) as Non-Viral Vector

    PubMed Central

    He, Zhijian; Miao, Lei; Jordan, Rainer; S-Manickam, Devika; Luxenhofer, Robert; Kabanov, Alexander V

    2015-01-01

    Developing safe and efficient non-viral gene delivery systems remains a major challenge. We present a new cationic poly(2-oxazoline) (CPOx) block copolymer for gene therapy that was synthesized by sequential polymerization of non-ionic 2-methyl-2-oxazoline and a new 2-oxazoline monomer, 2-(N-methyl, N-Boc-amino)-methyl-2-oxazoline, followed by deprotection of the pendant secondary amine groups. Upon mixing with plasmid DNA (pDNA), CPOx forms small (diameter ≈ 80 nm) and narrowly dispersed polyplexes (PDI < 0.2), which are stable upon dilution in saline and against thermal challenge. These polyplexes exhibited low plasma protein binding and very low cytotoxicity in vitro compared to the polyplexes of pDNA and poly(ethylene glycol)-b-poly(l-lysine) (PEG-b-PLL). CPOx/pDNA polyplexes at N/P = 5 bound considerably less plasma protein compared to polyplexes of PEG-b-PLL at the same N/P ratio. This is a unique aspect of the developed polyplexes emphasizing their potential for systemic delivery in vivo. The transfection efficiency of the polyplexes in B16 murine melanoma cells was low after 4 h but increased significantly for 10 h exposure time, indicative of slow internalization of polyplexes. Addition of Pluronic P85 boosted the transfection using CPOx/pDNA polyplexes considerably. The low protein binding of CPOx/pDNA polyplexes is particularly interesting for the future development of targeted gene delivery. PMID:25846127

  13. Inhibition of RNA Polymerase II Transcription in Human Cells by Synthetic DNA-Binding Ligands

    NASA Astrophysics Data System (ADS)

    Dickinson, Liliane A.; Gulizia, Richard J.; Trauger, John W.; Baird, Eldon E.; Mosier, Donald E.; Gottesfeld, Joel M.; Dervan, Peter B.

    1998-10-01

    Sequence-specific DNA-binding small molecules that can permeate human cells potentially could regulate transcription of specific genes. Multiple cellular DNA-binding transcription factors are required by HIV type 1 for RNA synthesis. Two pyrrole--imidazole polyamides were designed to bind DNA sequences immediately adjacent to binding sites for the transcription factors Ets-1, lymphoid-enhancer binding factor 1, and TATA-box binding protein. These synthetic ligands specifically inhibit DNA-binding of each transcription factor and HIV type 1 transcription in cell-free assays. When used in combination, the polyamides inhibit virus replication by >99% in isolated human peripheral blood lymphocytes, with no detectable cell toxicity. The ability of small molecules to target predetermined DNA sequences located with RNA polymerase II promoters suggests a general approach for regulation of gene expression, as well as a mechanism for the inhibition of viral replication.

  14. Free-radical-mediated DNA binding.

    PubMed Central

    O'Brien, P J

    1985-01-01

    Free-radical metabolites can be generated metabolically by a one-electron reductase-catalyzed reaction or a "peroxidase" catalyzed oxidation or by photoactivation of a wide variety of aromatic xenobiotics. Radicals may also be generated during lipid peroxidation. Some radicals can react with DNA or bind covalently or noncovalently as a dismutation product or as a dimer, trimer or polymeric product. Modification to the DNA can result in single-strand breaks, loss of template activity, and crosslinking. The binding can prevent enzymic digestion. In some cases, the radicals react with oxygen, resulting before conversion to DNA reactive oxygen species. Most radicals probably do not interact with DNA. PMID:3007090

  15. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a Tm of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the Tm by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔCp ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically

  16. Binding mode and affinity studies of DNA-binding agents using topoisomerase I DNA unwinding assay.

    PubMed

    McKnight, Ruel E; Gleason, Aaron B; Keyes, James A; Sahabi, Sadia

    2007-02-15

    A topoisomerase I DNA unwinding assay has been used to determine the relative DNA-binding affinities of a model pair of homologous naphthalene diimides. Binding affinity data were corroborated using calorimetric (ITC) and spectrophotometric (titration and T(m)) studies, with substituent size playing a significant role in binding. The assay was also used to investigate the mode of binding adopted by several known DNA-binding agents, including SYBR Green and PicoGreen. Some of the compounds exhibited unexpected binding modes.

  17. Role of Single-Stranded DNA Binding Activity of T Antigen in Simian Virus 40 DNA Replication

    PubMed Central

    Wu, Chunxiao; Roy, Rupa; Simmons, Daniel T.

    2001-01-01

    We have previously mapped the single-stranded DNA binding domain of large T antigen to amino acid residues 259 to 627. By using internal deletion mutants, we show that this domain most likely begins after residue 301 and that the region between residues 501 and 550 is not required. To study the function of this binding activity, a series of single-point substitutions were introduced in this domain, and the mutants were tested for their ability to support simian virus 40 (SV40) replication and to bind to single-stranded DNA. Two replication-defective mutants (429DA and 460EA) were grossly impaired in single-stranded DNA binding. These two mutants were further tested for other biochemical activities needed for viral DNA replication. They bound to origin DNA and formed double hexamers in the presence of ATP. Their ability to unwind origin DNA and a helicase substrate was severely reduced, although they still had ATPase activity. These results suggest that the single-stranded DNA binding activity is involved in DNA unwinding. The two mutants were also very defective in structural distortion of origin DNA, making it likely that single-stranded DNA binding is also required for this process. These data show that single-stranded DNA binding is needed for at least two steps during SV40 DNA replication. PMID:11222709

  18. DNA Complementary to Viral RNA in Leukemic Cells Induced by Avian Myeloblastosis Virus*

    PubMed Central

    Baluda, M. A.; Nayak, D. P.

    1970-01-01

    Nucleic acid hybridization studies were made between 71S-AMV-RNA and DNA from leukemic myeloblasts and from normal chicken cells. There was homology between the viral RNA and chicken cell DNA and to a greater extent between viral RNA and leukemic cell DNA. Leukemic cell DNA hybridized approximately twice as much viral RNA as did normal chicken DNA. Thermal melting studies showed that the viral RNA bound to normal and leukemic cell DNA consists of long polynucleotides (Tm = 87° and 92°C, respectively, in 2× saline citrate). This suggests that the leukemic cells contain a DNA template of the viral RNA. PMID:4317913

  19. Force steps during viral DNA packaging?

    NASA Astrophysics Data System (ADS)

    Purohit, Prashant K.; Kondev, Jané; Phillips, Rob

    2003-11-01

    Biophysicists and structural biologists increasingly acknowledge the role played by the mechanical properties of macromolecules as a critical element in many biological processes. This change has been brought about, in part, by the advent of single molecule biophysics techniques that have made it possible to exert piconewton forces on key macromolecules and observe their deformations at nanometer length scales, as well as to observe the mechanical action of macromolecules such as molecular motors. This has opened up immense possibilities for a new generation of mechanical investigations that will respond to such measurements in an attempt to develop a coherent theory for the mechanical behavior of macromolecules under conditions where thermal and chemical effects are on an equal footing with deterministic forces. This paper presents an application of the principles of mechanics to the problem of DNA packaging, one of the key events in the life cycle of bacterial viruses with special reference to the nature of the internal forces that are built up during the DNA packaging process.

  20. DNA DAMAGE BINDING PROTEIN2 Shapes the DNA Methylation Landscape

    PubMed Central

    Schalk, Catherine; Kramdi, Amira; Ahmed, Ikhlak; Cognat, Valérie; Graindorge, Stéfanie; Bergdoll, Marc; Baumberger, Nicolas; Heintz, Dimitri; Bowler, Chris; Genschik, Pascal; Barneche, Fredy; Molinier, Jean

    2016-01-01

    In eukaryotes, DNA repair pathways help to maintain genome integrity and epigenomic patterns. However, the factors at the nexus of DNA repair and chromatin modification/remodeling remain poorly characterized. Here, we uncover a previously unrecognized interplay between the DNA repair factor DNA DAMAGE BINDING PROTEIN2 (DDB2) and the DNA methylation machinery in Arabidopsis thaliana. Loss-of-function mutation in DDB2 leads to genome-wide DNA methylation alterations. Genetic and biochemical evidence indicate that at many repeat loci, DDB2 influences de novo DNA methylation by interacting with ARGONAUTE4 and by controlling the local abundance of 24-nucleotide short interfering RNAs (siRNAs). We also show that DDB2 regulates active DNA demethylation mediated by REPRESSOR OF SILENCING1 and DEMETER LIKE3. Together, these findings reveal a role for the DNA repair factor DDB2 in shaping the Arabidopsis DNA methylation landscape in the absence of applied genotoxic stress. PMID:27531226

  1. N-ethylmaleimide inhibition of the DNA-binding activity of the herpes simplex virus type 1 major DNA-binding protein

    SciTech Connect

    Ruyechan, W.T. )

    1988-03-01

    The major herpes simplex virus DNA-binding protein, designated ICP8, binds tightly to single-stranded DNA and is required for replication of viral DNA. The sensitivity of the DNA-binding activity of ICP8 to the action of the sulfhydryl reagent N-ethylmaleimide has been examined by using nitrocellulose filter-binding and agarose gel electrophoresis assays. Incubation of ICP8 with N-ethylmaleimide results in a rapid loss of DNA-binding activity. Preincubation of ICP8 with single-stranded DNA markedly inhibits this loss of binding activity. These results imply that a free sulfhydryl group is involved in the interaction of ICP8 with single-stranded DNA and that this sulfhydryl group becomes less accessible to the environment upon binding. Agarose gel electrophoretic analysis of the binding interaction in the presence and absence of N-ethylmaleimide indicates that the cooperative binding exhibited by ICP8 is lost upon treatment with this reagent but that some residual noncooperative binding may remain. This last result was confirmed by equilibrium dialysis experiments with the {sup 32}P-labeled oligonucleotide dT{sub 10} and native and N-ethylmaleimide-treated ICP8.

  2. Viral receptor-binding site antibodies with diverse germline origins

    PubMed Central

    Schmidt, Aaron G.; Therkelsen, Matthew D.; Stewart, Shaun; Kepler, Thomas B.; Liao, Hua-Xin; Moody, M. Anthony; Haynes, Barton F.; Harrison, Stephen C.

    2015-01-01

    Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by eleven different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B-cell targets. PMID:25959776

  3. Viral evasion of intracellular DNA and RNA sensing.

    PubMed

    Chan, Ying Kai; Gack, Michaela U

    2016-06-01

    The co-evolution of viruses with their hosts has led to the emergence of viral pathogens that are adept at evading or actively suppressing host immunity. Pattern recognition receptors (PRRs) are key components of antiviral immunity that detect conserved molecular features of viral pathogens and initiate signalling that results in the expression of antiviral genes. In this Review, we discuss the strategies that viruses use to escape immune surveillance by key intracellular sensors of viral RNA or DNA, with a focus on RIG-I-like receptors (RLRs), cyclic GMP-AMP synthase (cGAS) and interferon-γ (IFNγ)-inducible protein 16 (IFI16). Such viral strategies include the sequestration or modification of viral nucleic acids, interference with specific post-translational modifications of PRRs or their adaptor proteins, the degradation or cleavage of PRRs or their adaptors, and the sequestration or relocalization of PRRs. An understanding of viral immune-evasion mechanisms at the molecular level may guide the development of vaccines and antivirals.

  4. DNA-binding-defective mutants of the Epstein-Barr virus lytic switch activator Zta transactivate with altered specificities.

    PubMed Central

    Flemington, E K; Lytle, J P; Cayrol, C; Borras, A M; Speck, S H

    1994-01-01

    The Epstein-Barr virus BRLF1 and BZLF1 genes are the first viral genes transcribed upon induction of the viral lytic cycle. The protein products of both genes (referred to here as Rta and Zta, respectively) activate expression of other viral genes, thereby initiating the lytic cascade. Among the viral antigens expressed upon induction of the lytic cycle, however, Zta is unique in its ability to disrupt viral latency; expression of the BZLF1 gene is both necessary and sufficient for triggering the viral lytic cascade. We have previously shown that Zta can activate its own promoter (Zp), through binding to two Zta recognition sequences (ZIIIA and ZIIIB). Here we describe mutant Zta proteins that do not bind DNA (referred to as Zta DNA-binding mutants [Zdbm]) but retain the ability to transactivate Zp. Consistent with the inability of these mutants to bind DNA, transactivation of Zp by Zdbm is not dependent on the Zta recognition sequences. Instead, transactivation by Zdbm is dependent upon promoter elements that bind cellular factors. An examination of other viral and cellular promoters identified promoters that are weakly responsive or unresponsive to Zdbm. An analysis of a panel of artificial promoters containing one copy of various promoter elements demonstrated a specificity for Zdbm activation that is distinct from that of Zta. These results suggest that non-DNA-binding forms of some transactivators retain the ability to transactivate specific target promoters without direct binding to DNA. Images PMID:8164660

  5. Direct DNA binding by Brca1

    PubMed Central

    Paull, Tanya T.; Cortez, David; Bowers, Blair; Elledge, Stephen J.; Gellert, Martin

    2001-01-01

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein–DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription. PMID:11353843

  6. An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor

    PubMed Central

    Zhao, Wei; Jardine, Paul J.

    2015-01-01

    molecular motor that translocates the viral DNA into a preformed viral shell. A key event in DNA packaging is recognition of the viral DNA among other nucleic acids in the host cell. Commonly, a DNA-binding protein mediates the interaction of viral DNA with the motor/head shell. Here we show that for the bacteriophage ϕ29, this essential step of genome recognition is mediated by a viral genome-encoded RNA rather than a protein. A domain of the prohead RNA (pRNA) imparts specificity and stringency to the motor by ensuring the correct orientation of DNA packaging and restricting initiation to a single event. Since this assembly step is unique to the virus, DNA packaging is a novel target for the development of antiviral drugs. PMID:26423956

  7. Sequence-specific binding of simian virus 40 A protein to nonorigin and cellular DNA.

    PubMed Central

    Wright, P J; DeLucia, A L; Tegtmeyer, P

    1984-01-01

    The simian virus 40 A protein (T antigen) recognized and bound to the consensus sequence 5'-GAGGC-3' in DNA from many sources. Sequence-specific binding to single pentanucleotides in randomly chosen DNA predominated over binding to nonspecific sequences. The asymmetric orientation of protein bound to nonorigin recognition sequences also resembled that of protein bound to the origin region of simian virus 40 DNA. Sequence variations in the DNA adjacent to single pentanucleotides influenced binding affinities even though methylation interference and protection studies did not reveal specific interactions outside of pentanucleotides. Thus, potential locations of A protein bound to any DNA can be predicted although the determinants of binding affinity are not yet understood. Sequence-specific binding of A protein to cellular DNA would provide a mechanism for specific alterations of host gene expression that facilitate viral function. Images PMID:6570189

  8. Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes

    PubMed Central

    Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

    2011-01-01

    Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

  9. Facilitated diffusion of DNA-binding proteins.

    PubMed

    Klenin, Konstantin V; Merlitz, Holger; Langowski, Jörg; Wu, Chen-Xu

    2006-01-13

    The diffusion-controlled limit of reaction times for site-specific DNA-binding proteins is derived from first principles. We follow the generally accepted concept that a protein propagates via two competitive modes, a three-dimensional diffusion in space and a one-dimensional sliding along the DNA. However, our theoretical treatment of the problem is new. The accuracy of our analytical model is verified by numerical simulations. The results confirm that the unspecific binding of protein to DNA, combined with sliding, is capable to reduce the reaction times significantly.

  10. Importance of DNA stiffness in protein-DNA binding specificity

    NASA Astrophysics Data System (ADS)

    Hogan, M. E.; Austin, R. H.

    1987-09-01

    From the first high-resolution structure of a repressor bound specifically to its DNA recognition sequence1 it has been shown that the phage 434 repressor protein binds as a dimer to the helix. Tight, local interactions are made at the ends of the binding site, causing the central four base pairs (bp) to become bent and overtwisted. The centre of the operator is not in contact with protein but repressor binding affinity can be reduced at least 50-fold in response to a sequence change there2. This observation might be explained should the structure of the intervening DNA segment vary with its sequence, or if DNA at the centre of the operator resists the torsional and bending deformation necessary for complex formation in a sequence dependent fashion. We have considered the second hypothesis by demonstrating that DNA stiffness is sequence dependent. A method is formulated for calculating the stiffness of any particular DNA sequence, and we show that this predicted relationship between sequence and stiffness can explain the repressor binding data in a quantitative manner. We propose that the elastic properties of DNA may be of general importance to an understanding of protein-DNA binding specificity.

  11. Two DNA aptamers against avian influenza H9N2 virus prevent viral infection in cells.

    PubMed

    Zhang, Yuewei; Yu, Ziqiang; Jiang, Fei; Fu, Ping; Shen, Junjun; Wu, Wenxue; Li, Jinxiang

    2015-01-01

    New antiviral therapy for pandemic influenza mediated by the H9N2 avian influenza virus (AIV) is increasingly in demand not only for the poultry industry but also for public health. Aptamers are confirmed to be promising candidates for treatment and prevention of influenza viral infections. Thus, we studied two DNA aptamers, A9 and B4, selected by capillary electrophoresis-based systemic evolution of ligands by exponential enrichment (CE-SELEX) procedure using H9N2 AIV purified haemagglutinin (HA) as target. Both aptamers had whole-virus binding affinity. Also, an enzyme-linked aptamer assay (ELAA) confirmed binding affinity and specificity against other AIV subtypes. Finally, we studied aptamer-inhibitory effects on H9N2 AIV infection in Madin-Darby canine kidney (MDCK) cells and quantified viral load in supernatant and in cell with quantitative PCR (qPCR). Our data provide a foundation for future development of innovative anti-influenza drugs.

  12. Excursions in polynuclear platinum DNA binding

    PubMed Central

    Mangrum, John B.; Farrell, Nicholas P.

    2011-01-01

    Polynuclear platinum agents are a structurally unique class of anti-cancer drugs, distinct from the cisplatin family. To describe the chemistry and biology of this class, it was necessary to challenge the accepted paradigms for the structure–activity relationships; design new chemotypes and delineate the structures and consequences of their DNA binding modes. This article summarizes the structural changes induced in DNA by both covalent (bond-forming) and non-covalent (ligand recognition) adducts. Solution (Nuclear Magnetic Resonance), solid state (crystallography) and gas-phase (Electrospray Ionization Mass Spectrometry) techniques have all been used to describe the new DNA structures along with molecular biological techniques. The combined approaches allow molecular description of hitherto unobserved adducts such as long-range major-groove interstrand crosslinks; directional isomers on DNA and a third class of ligand–DNA binding, the phosphate clamp. The phosphate recognition is distinct from “classic” minor-groove recognition or intercalation. PMID:20694266

  13. Mapping Viral DNA Specificity to the Central Region of Integrase by Using Functional Human Immunodeficiency Virus Type 1/Visna Virus Chimeric Proteins

    PubMed Central

    Katzman, Michael; Sudol, Malgorzata

    1998-01-01

    We previously described the construction and analysis of the first set of functional chimeric lentivirus integrases, involving exchange of the N-terminal, central, and C-terminal regions of the human immunodeficiency virus type 1 (HIV-1) and visna virus integrase (IN) proteins. Based on those results, additional HIV-1/visna virus chimeric integrases were designed and purified. Each of the chimeric enzymes was functional in at least one oligonucleotide-based IN assay. Of a total of 12 chimeric IN proteins, 3 exhibit specific viral DNA processing, 9 catalyze insertion of viral DNA ends, 12 can reverse that reaction, and 11 are active for nonspecific alcoholysis. Functional data obtained with the processing assay indicate that the central region of the protein is responsible for viral DNA specificity. Target site selection for nonspecific alcoholysis again mapped to the central domain of IN, confirming our previous data indicating that this region can position nonviral DNA for nucleophilic attack. However, the chimeric proteins created patterns of viral DNA insertion distinct from that of either wild-type IN, suggesting that interactions between regions of IN influence target site selection for viral DNA integration. The results support a new model for the functional organization of IN in which viral DNA initially binds nonspecifically to the C-terminal portion of IN but the catalytic central region of the enzyme has a prominent role both in specific recognition of viral DNA ends and in positioning the host DNA for viral DNA integration. PMID:9499023

  14. Viral evasion of DNA-stimulated innate immune responses

    PubMed Central

    Christensen, Maria H; Paludan, Søren R

    2017-01-01

    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769

  15. Synthesis of parvovirus H-1 replicative form from viral DNA by DNA polymerase gamma.

    PubMed Central

    Kollek, R; Goulian, M

    1981-01-01

    The initial event in the replication cycle of parvovirus H-1 is conversion of the single-stranded linear viral DNA to the double-stranded linear replicative form. We describe here detection of an activity in uninfected cell extracts that carries out this reaction. The activity was purified and identified as DNA polymerase gamma. Images PMID:6947222

  16. DNA Origami Seesaws as Comparative Binding Assay

    PubMed Central

    Nickels, Philipp C.; Høiberg, Hans C.; Simmel, Stephanie S.; Holzmeister, Phil; Tinnefeld, Philip

    2016-01-01

    Abstract The application of commonly used force spectroscopy in biological systems is often limited by the need for an invasive tether connecting the molecules of interest to a bead or cantilever tip. Here we present a DNA origami‐based prototype in a comparative binding assay. It has the advantage of in situ readout without any physical connection to the macroscopic world. The seesaw‐like structure has a lever that is able to move freely relative to its base. Binding partners on each side force the structure into discrete and distinguishable conformations. Model experiments with competing DNA hybridisation reactions yielded a drastic shift towards the conformation with the stronger binding interaction. With reference DNA duplexes of tuneable length on one side, this device can be used to measure ligand interactions in comparative assays. PMID:27038073

  17. Biophysical characterization of DNA binding from single molecule force measurements

    PubMed Central

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-01-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function. PMID:20576476

  18. Biophysical characterization of DNA binding from single molecule force measurements

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-09-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

  19. C60 fullerene binding to DNA

    NASA Astrophysics Data System (ADS)

    Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

    2014-09-01

    Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

  20. DBSI: DNA-binding site identifier

    PubMed Central

    Zhu, Xiaolei; Ericksen, Spencer S.; Mitchell, Julie C.

    2013-01-01

    In this study, we present the DNA-Binding Site Identifier (DBSI), a new structure-based method for predicting protein interaction sites for DNA binding. DBSI was trained and validated on a data set of 263 proteins (TRAIN-263), tested on an independent set of protein-DNA complexes (TEST-206) and data sets of 29 unbound (APO-29) and 30 bound (HOLO-30) protein structures distinct from the training data. We computed 480 candidate features for identifying protein residues that bind DNA, including new features that capture the electrostatic microenvironment within shells near the protein surface. Our iterative feature selection process identified features important in other models, as well as features unique to the DBSI model, such as a banded electrostatic feature with spatial separation comparable with the canonical width of the DNA minor groove. Validations and comparisons with established methods using a range of performance metrics clearly demonstrate the predictive advantage of DBSI, and its comparable performance on unbound (APO-29) and bound (HOLO-30) conformations demonstrates robustness to binding-induced protein conformational changes. Finally, we offer our feature data table to others for integration into their own models or for testing improved feature selection and model training strategies based on DBSI. PMID:23873960

  1. DBSI: DNA-binding site identifier.

    PubMed

    Zhu, Xiaolei; Ericksen, Spencer S; Mitchell, Julie C

    2013-09-01

    In this study, we present the DNA-Binding Site Identifier (DBSI), a new structure-based method for predicting protein interaction sites for DNA binding. DBSI was trained and validated on a data set of 263 proteins (TRAIN-263), tested on an independent set of protein-DNA complexes (TEST-206) and data sets of 29 unbound (APO-29) and 30 bound (HOLO-30) protein structures distinct from the training data. We computed 480 candidate features for identifying protein residues that bind DNA, including new features that capture the electrostatic microenvironment within shells near the protein surface. Our iterative feature selection process identified features important in other models, as well as features unique to the DBSI model, such as a banded electrostatic feature with spatial separation comparable with the canonical width of the DNA minor groove. Validations and comparisons with established methods using a range of performance metrics clearly demonstrate the predictive advantage of DBSI, and its comparable performance on unbound (APO-29) and bound (HOLO-30) conformations demonstrates robustness to binding-induced protein conformational changes. Finally, we offer our feature data table to others for integration into their own models or for testing improved feature selection and model training strategies based on DBSI.

  2. DNA Binding and Cleavage by the Human Parvovirus B19 NS1 Nuclease Domain.

    PubMed

    Sanchez, Jonathan L; Romero, Zachary; Quinones, Angelica; Torgeson, Kristiane R; Horton, Nancy C

    2016-11-29

    Infection with human parvovirus B19 (B19V) has been associated with a myriad of illnesses, including erythema infectiosum (Fifth disease), hydrops fetalis, arthropathy, hepatitis, and cardiomyopathy, and also possibly the triggering of any number of different autoimmune diseases. B19V NS1 is a multidomain protein that plays a critical role in viral replication, with predicted nuclease, helicase, and gene transactivation activities. Herein, we investigate the biochemical activities of the nuclease domain (residues 2-176) of B19V NS1 (NS1-nuc) in sequence-specific DNA binding of the viral origin of replication sequences, as well as those of promoter sequences, including the viral p6 and the human p21, TNFα, and IL-6 promoters previously identified in NS1-dependent transcriptional transactivation. NS1-nuc was found to bind with high cooperativity and with multiple (five to seven) copies to the NS1 binding elements (NSBE) found in the viral origin of replication and the overlapping viral p6 promoter DNA sequence. NS1-nuc was also found to bind cooperatively with at least three copies to the GC-rich Sp1 binding sites of the human p21 gene promoter. Only weak or nonspecific binding of NS1-nuc to the segments of the TNFα and IL-6 promoters was found. Cleavage of DNA by NS1-nuc occurred at the expected viral sequence (the terminal resolution site), but only in single-stranded DNA, and NS1-nuc was found to covalently attach to the 5' end of the DNA at the cleavage site. Off-target cleavage by NS1-nuc was also identified.

  3. Curcumin binding to DNA and RNA.

    PubMed

    Nafisi, Shohreh; Adelzadeh, Maryam; Norouzi, Zeinab; Sarbolouki, Mohammad Nabi

    2009-04-01

    Curcumin, the yellow pigment from the rhizoma of Curcuma longa, is a widely studied phytochemical with a variety of biological activities. The ongoing research and clinical trials have proved that this natural phenolic compound has great and diverse pharmacological potencies. Beside its effective antioxidant, antiinflammatory, and antimicrobial/antiviral properties, curcumin is also considered as a cancer chemopreventive agent. While the antioxidant activity of curcumin is well documented, its interaction with DNA and RNA is not fully investigated. This study was designed to examine the interactions of curcumin with calf thymus DNA and yeast RNA in aqueous solution at physiological conditions, using constant DNA and RNA concentration (6.25 mM) and various curcumin/polynucleotide (phosphate) ratios of 1/120, 1/80, 1/40, 1/20, and 1/10. Fourier transform infrared (FTIR) and UV-visible spectroscopic methods were used to determine the ligand binding modes, the binding constants, and the stability of curcumin-DNA and curcumin-RNA complexes in aqueous solution. Spectroscopic evidence showed that curcumin binds to the major and minor grooves of DNA duplex and to RNA bases as well as to the back bone phosphate group with overall binding constants of K(curcumin-DNA) = 4.255 x 10(4) M(-1) and K(curcumin-RNA) = 1.262 x 10(4) M(-1). Major DNA and RNA aggregation occurred at high pigment concentration. No conformational changes were observed upon curcumin interaction with these biopolymers; that is, DNA remains in the B, and RNA retains its A-family structure.

  4. Biological consequences of strand breaks in plasmid and viral DNA.

    PubMed Central

    Schulte-Frohlinde, D.

    1987-01-01

    Some biological consequences of strand breakage in biologically active single- and double-stranded plasmid and viral DNA are examined. A double-strand break in DNA produced by restriction-endonucleases in aqueous solution is not a 100% lethal damage. The survival depends strongly on the structure of the end groups. Evidence is presented that survival is the result of a balance between degradation and repair. The enzymatically produced double-strand break (dsb) is a potentially lethal damage similar to the irradiation-produced dsb in cells. Results with double-stranded biologically active DNA treated either with gamma-rays, heat, pancrease nuclease or UV-light in aqueous solution suggest that a single-strand damage is also a potentially lethal damage. Mechanisms for conversion of single-strand damage to lethal events are discussed. PMID:3307866

  5. A conserved binding site within the Tomato golden mosaic virus AL-1629 promoter is necessary for expression of viral genes important for pathogenesis

    SciTech Connect

    Tu Jun; Sunter, Garry

    2007-10-10

    We have identified a nine base pair sequence in Tomato golden mosaic virus that is required for binding of nuclear proteins from tobacco and Arabidopsis to viral DNA. The sequence is located within the promoter for a 0.7 kb complementary sense mRNA (AL-1629). Mutation of the binding site results in a two- to six-fold reduction in the accumulation of AL-1629 mRNA, leading to reduced AL2 and AL3 gene expression. Viral sequences located immediately adjacent to the core binding site appear to influence AL2 and AL3 expression, but retain some binding affinity to a soluble host protein(s). The ability of a nuclear protein(s) to bind sequences within the AL-1629 promoter correlates with efficient viral DNA replication, as mutation of these sequences results in reduced viral DNA levels. Analysis of begomo- and curtoviruses indicates extensive conservation of this binding site, which suggests a common mechanism regulating expression of two viral genes involved in replication and suppression of host defense responses.

  6. A conserved binding site within the Tomato Golden Mosaic Virus AL-1629 promoter is necessary for expression of viral genes important for pathogenesis

    PubMed Central

    Tu, Jun; Sunter, Garry

    2010-01-01

    We have identified a nine base pair sequence in Tomato golden mosaic virus that is required for binding of nuclear proteins from tobacco and Arabidopsis to viral DNA. The sequence is located within the promoter for a 0.7 kb complementary sense mRNA (AL-1629). Mutation of the binding site results in a two to six-fold reduction in the accumulation of AL-1629 mRNA, leading to reduced AL2 and AL3 gene expression. Viral sequences located immediately adjacent to the core binding site appear to influence AL2 and AL3 expression, but retain some binding affinity to a soluble host protein(s). The ability of a nuclear protein(s) to bind sequences within the AL-1629 promoter correlates with efficient viral DNA replication, as mutation of these sequences results in reduced viral DNA levels. Analysis of begomo- and curtoviruses indicates extensive conservation of this binding site, which suggests a common mechanism regulating expression of two viral genes involved in replication and suppression of host defense responses. PMID:17532021

  7. HTLV-I Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization.

    PubMed

    Wagner, S; Green, M R

    1993-10-15

    The Tax protein of human T cell leukemia virus type-1 (HTLV-I) transcriptionally activates the HTLV-I promoter. This activation requires binding sites for activating transcription factor (ATF) proteins, a family of cellular proteins that contain basic region-leucine zipper (bZIP) DNA binding domains. Data are presented showing that Tax increases the in vitro DNA binding activity of multiple ATF proteins. Tax also stimulated DNA binding by other bZIP proteins, but did not affect DNA binding proteins that lack a bZIP domain. The increase in DNA binding occurred because Tax promotes dimerization of the bZIP domain in the absence of DNA, and the elevated concentration of the bZIP homodimer then facilitates the DNA binding reaction. These results help explain how Tax activates viral transcription and transforms cells.

  8. The phiX174 protein J mediates DNA packaging and viral attachment to host cells.

    PubMed

    Bernal, Ricardo A; Hafenstein, Susan; Esmeralda, Raquel; Fane, Bentley A; Rossmann, Michael G

    2004-04-09

    Packaging of viral genomes into their respective capsids requires partial neutralization of the highly negatively charged RNA or DNA. Many viruses, including the Microviridae bacteriophages phiX174, G4, and alpha3, have solved this problem by coding for a highly positively charged nucleic acid-binding protein that is packaged along with the genome. The phiX174 DNA-binding protein, J, is 13 amino acid residues longer than the alpha3 and G4 J proteins by virtue of an additional nucleic acid-binding domain at the amino terminus. Chimeric phiX174 particles containing the smaller DNA-binding protein cannot be generated due to procapsid instability during DNA packaging. However, chimeric alpha3 and G4 phages, containing the phiX174 DNA-binding protein in place of the endogenous J protein, assemble and are infectious, but are less dense than the respective wild-type species. In addition, host cell attachment and native gel migration assays indicate surface variations of these viruses that are controlled by the nature of the J protein. The structure of alpha3 packaged with phiX174 J protein was determined to 3.5A resolution and compared with the previously determined structures of phiX174 and alpha3. The structures of the capsid and spike proteins in the chimeric particle remain unchanged within experimental error when compared to the wild-type alpha3 virion proteins. The amino-terminal region of the phiX174 J protein, which is missing from wild-type alpha3 virions, is mostly disordered in the alpha3 chimera. The differences observed between solution properties of wild-type phiX174, wild-type alpha3, and alpha3 chimera, including their ability to attach to host cells, correlates with the degree of order in the amino-terminal domain of the J protein. When ordered, this domain binds to the interior of the viral capsid and, thus, might control the flexibility of the capsid. In addition, the properties of the phiX174 J protein in the chimera and the results of mutational

  9. A fusion DNA vaccine that targets antigen-presenting cells increases protection from viral challenge

    NASA Astrophysics Data System (ADS)

    Deliyannis, Georgia; Boyle, Jefferey S.; Brady, Jamie L.; Brown, Lorena E.; Lew, Andrew M.

    2000-06-01

    Improving the immunological potency, particularly the Ab response, is a serious hurdle for the protective efficacy and hence broad application of DNA vaccines. We examined the immunogenicity and protective efficacy of a hemagglutinin-based influenza DNA vaccine that was targeted to antigen-presenting cells (APCs) by fusion to CTLA4. The targeted vaccine was shown to induce an accelerated and increased Ab response (as compared with those receiving the nontargeted control) that was predominated by IgG1 and recognized conformationally dependent viral epitopes. Moreover, mice receiving the APC-targeted DNA vaccine had significantly reduced viral titers (100-fold) after a nonlethal virus challenge. The increased protective efficacy was most likely because of increased Ab responses, as cytotoxic T lymphocyte responses were not enhanced. Targeting was demonstrated by direct binding studies of CTLA4 fusion proteins to the cognate ligand (B7; expressed on APCs in vivo). In addition, a targeted protein was detected at 4-fold higher levels in draining lymph nodes within 2-24 h of administration. Therefore, this study demonstrates that targeting DNA-encoded antigen to APCs results in enhanced immunity and strongly suggests that this approach may be useful in improving the protective efficacy of DNA vaccines.

  10. Thermolabile in vivo DNA-binding activity associated with a protein encoded by mutants of herpes simplex virus type 1.

    PubMed Central

    Lee, C K; Knipe, D M

    1983-01-01

    The major DNA-binding protein encoded by several temperature-sensitive mutants of herpes simplex virus type 1 was thermolabile for binding to intracellular viral DNA. The ability of DNase I to release this protein from isolated nuclei was used as a measure of the amount of protein bound to viral DNA. This assay was based upon our previous observation that the fraction of herpesviral DNA-binding protein which can be eluted from nuclei with DNase I represents proteins associated with progeny viral DNA (D. M. Knipe and A. E. Spang, J. Virol. 43:314-324, 1982). In this study, we found that several temperature-sensitive mutants encoded proteins which rapidly chased from a DNase I-sensitive to a DNase I-resistant nuclear form upon shift to the nonpermissive temperature. We interpret this change in DNase I sensitivity to represent the denaturation of the DNA-binding site at the nonpermissive temperature and the association with the nuclear framework via a second site on the protein. The DNA-binding activity measured by the DNase I sensitivity assay represents an important function of the protein in viral replication because three of five mutants tested were thermolabile for this activity. A fourth mutant encoded a protein which did not associate with the nucleus at the nonpermissive temperature and therefore would not be available for DNA binding in the nucleus. We also present supportive evidence for the binding of the wild-type protein to intracellular viral DNA by showing that a monoclonal antibody coprecipitated virus-specific DNA sequences with the major DNA-binding protein. Images PMID:6304350

  11. Possible DNA Viral Factors of Human Breast Cancer

    PubMed Central

    Hsu, Chun-Ru; Lu, Tsong-Ming; Chin, Lengsu William; Yang, Chi-Chiang

    2010-01-01

    Viruses are considered to be one of the high-risk factors closely related to human breast cancer. However, different studies of viruses in breast cancer present conflicting results and some of these works remain in dispute. DNA viruses, such as specific types of human papillomaviruses (HPV), Epstein–Barr virus (EBV), human cytomegalovirus (HCMV), herpes simplex virus (HSV), and human herpes virus type 8 (HHV-8), have emerged as causal factors of some human cancers. These respective exogenous viruses and the possibility of multiple viral factors are discussed in this review. PMID:24281079

  12. Identification and properties of the crenarchaeal single-stranded DNA binding protein from Sulfolobus solfataricus

    PubMed Central

    Wadsworth, Ross I. M.; White, Malcolm F.

    2001-01-01

    Single-stranded DNA binding proteins (SSBs) play central roles in cellular and viral processes involving the generation of single-stranded DNA. These include DNA replication, homologous recombination and DNA repair pathways. SSBs bind DNA using four ‘OB-fold’ (oligonucleotide/oligosaccharide binding fold) domains that can be organised in a variety of overall quaternary structures. Thus eubacterial SSBs are homotetrameric whilst the eucaryal RPA protein is a heterotrimer and euryarchaeal proteins vary significantly in their subunit compositions. We demonstrate that the crenarchaeal SSB protein is an abundant protein with a unique structural organisation, existing as a monomer in solution and multimerising on DNA binding. The protein binds single-stranded DNA distributively with a binding site size of ~5 nt per monomer. Sulfolobus SSB lacks the zinc finger motif found in the eucaryal and euryarchaeal proteins, possessing instead a flexible C-terminal tail, sensitive to trypsin digestion, that is not required for DNA binding. In comparison with Escherichia coli SSB, the tail may play a role in protein–protein interactions during DNA replication and repair. PMID:11160923

  13. KSHV encoded LANA recruits Nucleosome Assembly Protein NAP1L1 for regulating viral DNA replication and transcription

    PubMed Central

    Gupta, Namrata; Thakker, Suhani; Verma, Subhash C.

    2016-01-01

    The establishment of latency is an essential for lifelong persistence and pathogenesis of Kaposi’s sarcoma-associated herpesvirus (KSHV). Latency-associated nuclear antigen (LANA) is the most abundantly expressed protein during latency and is important for viral genome replication and transcription. Replication-coupled nucleosome assembly is a major step in packaging the newly synthesized DNA into chromatin, but the mechanism of KSHV genome chromatinization post-replication is not understood. Here, we show that nucleosome assembly protein 1-like protein 1 (NAP1L1) associates with LANA. Our binding assays revealed an association of LANA with NAP1L1 in KSHV-infected cells, which binds through its amino terminal domain. Association of these proteins confirmed their localization in specific nuclear compartments of the infected cells. Chromatin immunoprecipitation assays from NAP1L1-depleted cells showed LANA-mediated recruitment of NAP1L1 at the terminal repeat (TR) region of the viral genome. Presence of NAP1L1 stimulated LANA-mediated DNA replication and persistence of a TR-containing plasmid. Depletion of NAP1L1 led to a reduced nucleosome positioning on the viral genome. Furthermore, depletion of NAP1L1 increased the transcription of viral lytic genes and overexpression decreased the promoter activities of LANA-regulated genes. These results confirmed that LANA recruitment of NAP1L1 helps in assembling nucleosome for the chromatinization of newly synthesized viral DNA. PMID:27599637

  14. Low-molecular- weight Rauscher leukemia virus protein with preferential binding for single-stranded RNA and DNA.

    PubMed Central

    Davis, J; Scherer, M; Tsai, W P; Long, C

    1976-01-01

    A sensitive nitrocellulose filter assay that measures the retention of 125I single-stranded calf thymus DNA has been used to detect and purify DNA-binding proteins that retain a biological function from Rauscher murine leukemia virus. By consecutive purification on oligo (dT)- cellulose and DEAE-Bio-Gel columns and centrifugation in 10 to 30% glycerol gradients, RNA-dependent DNA polymerase has been separated from a second virion DNA-binding protein. The binding of this protein to DNA was strongly affected by NaCl concentration but showed little change in activity over a wide range of temperature or pH. After glycerol gradient purification, polyacrylamide gel electrophoresis of this protein showed one major band with a molecular weight of approximately 9,800. This protein binds about as well as to single-stranded Escherichia coli or calf thymus DNA or 70S type C viral RNA. The binding to 125I single-stranded calf thymus DNA is very efficiently inhibited by unlabeled single-stranded DNA from either E. coli or calf thymus and by 70S murine or feline viral RNA. Much larger amounts of double-stranded DNA are required to produce an equivalent percentage of inhibition. This protein, therefore, shows preferential binding to single-stranded DNA or viral RNA. Images PMID:58075

  15. Hepatitis B viral core protein disrupts human host gene expression by binding to promoter regions

    PubMed Central

    2012-01-01

    Background The core protein (HBc) of hepatitis B virus (HBV) has been implicated in the malignant transformation of chronically-infected hepatocytes and displays pleiotropic functions, including RNA- and DNA-binding activities. However, the mechanism by which HBc interacts with the human genome to exert effects on hepatocyte function remains unknown. This study investigated the distribution of HBc binding to promoters in the human genome and evaluated its effects on the related genes’ expression. Results Whole-genome chromatin immunoprecipitation microarray (ChIP-on-chip) analysis was used to identify HBc-bound human gene promoters. Gene Ontology and pathway analyses were performed on related genes. The quantitative polymerase chain reaction assay was used to verify ChIP-on-chip results. Five novel genes were selected for luciferase reporter assay evaluation to assess the influence of HBc promoter binding. The HBc antibody immunoprecipitated approximately 3100 human gene promoters. Among these, 1993 are associated with known biological processes, and 2208 regulate genes with defined molecular functions. In total, 1286 of the related genes mediate primary metabolic processes, and 1398 encode proteins with binding activity. Sixty-four of the promoters regulate genes related to the mitogen-activated protein kinase (MAPK) pathways, and 41 regulate Wnt/beta-catenin pathway genes. The reporter gene assay indicated that HBc binding up-regulates proto-oncogene tyrosine-protein kinase (SRC), type 1 insulin-like growth factor receptor (IGF1R), and neurotrophic tyrosine kinase receptor 2 (NTRK2), and down-regulates v-Ha-ras Harvey rat sarcoma viral oncogene (HRAS). Conclusion HBc has the ability to bind a large number of human gene promoters, and can disrupt normal host gene expression. Manipulation of the transcriptional profile in HBV-infected hepatocytes may represent a key pathogenic mechanism of HBV infection. PMID:23088787

  16. The DNA damage response in viral-induced cellular transformation.

    PubMed

    Nikitin, P A; Luftig, M A

    2012-01-31

    The DNA damage response (DDR) has emerged as a critical tumour suppressor pathway responding to cellular DNA replicative stress downstream of aberrant oncogene over-expression. Recent studies have now implicated the DDR as a sensor of oncogenic virus infection. In this review, we discuss the mechanisms by which tumour viruses activate and also suppress the host DDR. The mechanism of tumour virus induction of the DDR is intrinsically linked to the need for these viruses to promote an S-phase environment to replicate their nucleic acid during infection. However, inappropriate expression of viral oncoproteins can also activate the DDR through various mechanisms including replicative stress, direct interaction with DDR components and induction of reactive oxygen species. Given the growth-suppressive consequences of activating the DDR, tumour viruses have also evolved mechanisms to attenuate these pathways. Aberrant expression of viral oncoproteins may therefore promote tumourigenesis through increased somatic mutation and aneuploidy due to DDR inactivation. This review will focus on the interplay between oncogenic viruses and the DDR with respect to cellular checkpoint control and transformation.

  17. CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus.

    PubMed

    Ramanan, Vyas; Shlomai, Amir; Cox, David B T; Schwartz, Robert E; Michailidis, Eleftherios; Bhatta, Ankit; Scott, David A; Zhang, Feng; Rice, Charles M; Bhatia, Sangeeta N

    2015-06-02

    Chronic hepatitis B virus (HBV) infection is prevalent, deadly, and seldom cured due to the persistence of viral episomal DNA (cccDNA) in infected cells. Newly developed genome engineering tools may offer the ability to directly cleave viral DNA, thereby promoting viral clearance. Here, we show that the CRISPR/Cas9 system can specifically target and cleave conserved regions in the HBV genome, resulting in robust suppression of viral gene expression and replication. Upon sustained expression of Cas9 and appropriately chosen guide RNAs, we demonstrate cleavage of cccDNA by Cas9 and a dramatic reduction in both cccDNA and other parameters of viral gene expression and replication. Thus, we show that directly targeting viral episomal DNA is a novel therapeutic approach to control the virus and possibly cure patients.

  18. The p53 Protein is an Unusually Shaped Tetramer that Binds Directly to DNA

    NASA Astrophysics Data System (ADS)

    Friedman, Paula N.; Chen, Xinbin; Bargonetti, Jill; Prives, Carol

    1993-04-01

    We have analyzed the size and structure of native immunopurified human p53 protein. By using a combination of chemical crosslinking, gel filtration chromatography, and zonal velocity gradient centrifugation, we have determined that the predominant form of p53 in such preparations is a tetramer. The behavior of purified p53 in gels and sucrose gradients implies that the protein has an extended shape. Wild-type p53 has been shown to bind specifically to sites in cellular and viral DNA. We show in this study by Southwestern ligand blotting and by analysis of DNA-bound crosslinked p53 that p53 monomers, dimers, and tetramers can bind directly to DNA.

  19. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    SciTech Connect

    C Harrison; G Meinke; H Kwun; H Rogalin; P Phelan; P Bullock; Y Chang; P Moore; A Bohm

    2011-12-31

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  20. Asymmetric assembly of Merkel cell polyomavirus large T-antigen origin binding domains at the viral origin.

    PubMed

    Harrison, Celia J; Meinke, Gretchen; Kwun, Hyun Jin; Rogalin, Henry; Phelan, Paul J; Bullock, Peter A; Chang, Yuan; Moore, Patrick S; Bohm, Andrew

    2011-06-17

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 Å crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be ~740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  1. Nucleotides in the polyomavirus enhancer that control viral transcription and DNA replication.

    PubMed Central

    Tang, W J; Berger, S L; Triezenberg, S J; Folk, W R

    1987-01-01

    The polyomavirus enhancer is required in cis for high-level expression of the viral early region and for replication of the viral genome. We introduced multiple mutations in the enhancer which reduced transcription and DNA replication. Polyomaviruses with these mutant enhancers formed very small plaques in whole mouse embryo cells. Revertants of the viral mutants were isolated and characterized. Reversion occurred by any of the following events: restoration of guanosines at nucleotide (nt) 5134 and nt 5140 within the adenovirus 5 E1A enhancer core AGGAAGTGACT; acquisition of an A----G mutation at nt 5258, which is the same mutation that enables polyomavirus to grow in embryonal carcinoma F9 cells; duplication of mutated sequences between nt 5146 and 5292 (including sequences homologous with immunoglobulin G, simian virus 40, and bovine papillomavirus enhancer elements). Reversion restored both the replicative and transcriptional functions of the viruses. Revertants that acquired the F9 mutation at nt 5258 grew at least 20-fold better than the original mutant in whole mouse embryo cells, but replicated only marginally better than the original mutant in 3T6 cells. Viruses with a reversion of the mutation at nt 5140 replicated equally well in both types of cells. Since individual nucleotides in the polyomavirus enhancer simultaneously altered DNA replication and transcription in specific cell types, it is likely that these processes rely upon a common element, such as an enhancer-binding protein. Images PMID:3037332

  2. Conserved Cysteine Residue in the DNA-Binding Domain of the Bovine Papillomavirus Type 1 E2 Protein Confers Redox Regulation of the DNA- Binding Activity in Vitro

    NASA Astrophysics Data System (ADS)

    McBride, Alison A.; Klausner, Richard D.; Howley, Peter M.

    1992-08-01

    The bovine papillomavirus type 1 E2 open reading frame encodes three proteins involved in viral DNA replication and transcriptional regulation. These polypeptides share a carboxyl-terminal domain with a specific DNA-binding activity; through this domain the E2 polypeptides form dimers. In this study, we demonstrate the inhibition of E2 DNA binding in vitro by reagents that oxidize or otherwise chemically modify the free sulfydryl groups of reactive cysteine residues. However, these reagents had no effect on DNA-binding activity when the E2 polypeptide was first bound to DNA, suggesting that the free sulfydryl group(s) may be protected by DNA binding. Sensitivity to sulfydryl modification was mapped to a cysteine residue at position 340 in the E2 DNA-binding domain, an amino acid that is highly conserved among the E2 proteins of different papillomaviruses. Replacement of this residue with other amino acids abrogated the sensitivity to oxidation-reduction changes but did not affect the DNA-binding property of the E2 protein. These results suggest that papillomavirus DNA replication and transcriptional regulation could be modulated through the E2 proteins by changes in the intracellular redox environment. Furthermore, a motif consisting of a reactive cysteine residue carboxyl-terminal to a lysine residue in a basic region of the DNA-binding domain is a feature common to a number of transcriptional regulatory proteins that, like E2, are subject to redox regulation. Thus, posttranslational regulation of the activity of these proteins by the intracellular redox environment may be a general phenomenon.

  3. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    NASA Astrophysics Data System (ADS)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  4. Fabrication of Stable and RNase-Resistant RNA Nanoparticles Active in Gearing the Nanomotors for Viral DNA-Packaging

    PubMed Central

    Liu, Jing; Guo, Songchuan; Cinier, Mathieu; Shu, Yi; Chen, Chaoping; Shen, Guanxin; Guo, Peixuan

    2010-01-01

    Both DNA and RNA can serve as powerful building blocks for bottom-up fabrication of nanostructures. A pioneering concept proposed by Ned Seeman 30 years ago has led to an explosion of knowledge in DNA nanotechnology. RNA can be manipulated with simplicity characteristic of DNA, while possessing noncanonical base-pairing, versatile function and catalytic activity similar to proteins. However, standing in awe of the sensitivity of RNA to RNase degradation has made many scientists flinch away from RNA nanotechnology. Here we report the construction of stable RNA nanoparticles resistant to RNase digestion. The chemically modified RNA retained its property for correct folding in dimer formation, appropriate structure in procapsid binding, and biological activity in gearing phi29 nanomotor to package viral DNA and producing infectious viral particles. Our results demonstrate that it is practical to produce RNase resistant, biologically active and stable RNA for application in nanotechnology. PMID:21155596

  5. Strong subunit coordination drives a powerful viral DNA packaging motor

    PubMed Central

    Andrews, Benjamin T.; Catalano, Carlos Enrique

    2013-01-01

    Terminase enzymes are viral motors that package DNA into a preformed capsid and are of interest both therapeutically and as potential nano-machines. The enzymes excise a single genome from a concatemeric precursor (genome maturation) and then package the duplex to near-crystalline density (genome packaging). The functional motors are oligomers of protomeric subunits and are the most powerful motors currently known. Here, we present mechanistic studies on the terminase motor from bacteriophage λ. We identify a mutant (K76R) that is specifically deficient in packaging activity. Biochemical analysis of this enzyme provides insight into the linkage between ATP hydrolysis and motor translocation. We further use this mutant to assemble chimeric motors with WT enzyme and characterize the catalytic activity of the complexes. The data demonstrate that strong coordination between the motor protomers is required for DNA packaging and that incorporation of even a single mutant protomer poisons motor activity. Significant coordination is similarly observed in the genome maturation reaction; however, although the motor is composed of a symmetric tetramer of protomers, the maturation complex is better described as a “dimer-of-dimers” with half-site reactivity. We describe a model for how the motor alternates between a stable genome maturation complex and a dynamic genome packaging complex. The fundamental features of coordinated ATP hydrolysis, DNA movement, and tight association between the motor and the duplex during translocation are recapitulated in all of the viral motors. This work is thus of relevance to all terminase enzymes, both prokaryotic and eukaryotic. PMID:23530228

  6. Calling cards for DNA-binding proteins

    PubMed Central

    Wang, Haoyi; Johnston, Mark; Mitra, Robi David

    2007-01-01

    Identifying genomic targets of transcription factors is fundamental for understanding transcriptional regulatory networks. Current technology enables identification of all targets of a single transcription factor, but there is no realistic way to achieve the converse: identification of all proteins that bind to a promoter of interest. We have developed a method that promises to fill this void. It employs the yeast retrotransposon Ty5, whose integrase interacts with the Sir4 protein. A DNA-binding protein fused to Sir4 directs insertion of Ty5 into the genome near where it binds; the Ty5 becomes a “calling card” the DNA-binding protein leaves behind in the genome. We constructed customized calling cards for seven transcription factors of yeast by including in each Ty5 a unique DNA sequence that serves as a “molecular bar code.” Ty5 transposition was induced in a population of yeast cells, each expressing a different transcription factor–Sir4 fusion and its matched, bar-coded Ty5, and the calling cards deposited into selected regions of the genome were identified, revealing the transcription factors that visited that region of the genome. In each region we analyzed, we found calling cards for only the proteins known to bind there: In the GAL1–10 promoter we found only calling cards for Gal4; in the HIS4 promoter we found only Gcn4 calling cards; in the PHO5 promoter we found only Pho4 and Pho2 calling cards. We discuss how Ty5 calling cards might be implemented for mapping all targets of all transcription factors in a single experiment. PMID:17623806

  7. Non-DNA-binding cofactors enhance DNA-binding specificity of a transcriptional regulatory complex

    PubMed Central

    Siggers, Trevor; Duyzend, Michael H; Reddy, Jessica; Khan, Sidra; Bulyk, Martha L

    2011-01-01

    Recruitment of cofactors to specific DNA sites is integral for specificity in gene regulation. As a model system, we examined how targeting and transcriptional control of the sulfur metabolism genes in Saccharomyces cerevisiae is governed by recruitment of the transcriptional co-activator Met4. We developed genome-scale approaches to measure transcription factor (TF) DNA-binding affinities and cofactor recruitment to >1300 genomic binding site sequences. We report that genes responding to the TF Cbf1 and cofactor Met28 contain a novel ‘recruitment motif' (RYAAT), adjacent to Cbf1 binding sites, which enhances the binding of a Met4–Met28–Cbf1 regulatory complex, and that abrogation of this motif significantly reduces gene induction under low-sulfur conditions. Furthermore, we show that correct recognition of this composite motif requires both non-DNA-binding cofactors Met4 and Met28. Finally, we demonstrate that the presence of an RYAAT motif next to a Cbf1 site, rather than Cbf1 binding affinity, specifies Cbf1-dependent sulfur metabolism genes. Our results highlight the need to examine TF/cofactor complexes, as novel specificity can result from cofactors that lack intrinsic DNA-binding specificity. PMID:22146299

  8. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection.

    PubMed

    Diner, Benjamin A; Lum, Krystal K; Toettcher, Jared E; Cristea, Ileana M

    2016-11-15

    The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. How mammalian cells detect and respond to DNA viruses that replicate in the nucleus is poorly understood. Here, we decipher the distinct functions of two viral DNA sensors, IFI16 and cGAS, during active immune signaling upon infection with two herpesviruses, herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV). We show that IFI16

  9. State of hepatitis B viral DNA in a human hepatoma cell line.

    PubMed Central

    Marion, P L; Salazar, F H; Alexander, J J; Robinson, W S

    1980-01-01

    PLC/PRF/5, a tissue culture cell line isolated from a human hepatocellular carcinoma and producing hepatitis B surface antigen, was studied for the presence of hepatitis B virus (HBV)-specific DNA and RNA. PLC/PRF/5 cell DNA accelerated the rate of reassociation of HBV [32P]DNA, and quantitative experiments indicated that the cells contained approximately four copies of viral DNA per haploid, mammalian cell DNA equivalent. PLC/PRF/5 DNA accelerated the rate of reassociation of all individual restriction endonucleases HincII and HaeIII fragments of HBV [32P]DNA, indicating that DNA from all regions of the viral genome is present in the cells. This suggests that these cells contain at least most, and possibly all, of the viral genome. Digestion of PLC/PRF/5 cell DNA with restriction endonuclease HindIII (an enzyme found not to cleave the DNA of any HBV isolate so far examined) yielded only three fragments, all larger than virion DNA, which contained HBV DNA base sequences, suggesting that HBV DNA is integrated in high-molecular-weight DNA at three different sites in these cells and that there is no viral DNA in an episomal form. PLC/PRF/5 cell [32P]RNA was found to hybridize with all restriction fragments of HBV DNA adequately tested, indicating that at least most, and possibly all, of the viral DNA in these cells is transcribed. Images PMID:6251250

  10. Viral DNA Replication-Dependent DNA Damage Response Activation during BK Polyomavirus Infection

    PubMed Central

    Verhalen, Brandy; Justice, Joshua L.; Imperiale, Michael J.

    2015-01-01

    ABSTRACT BK polyomavirus (BKPyV) reactivation is associated with severe human disease in kidney and bone marrow transplant patients. The interplay between viral and host factors that regulates the productive infection process remains poorly understood. We have previously reported that the cellular DNA damage response (DDR) is activated upon lytic BKPyV infection and that its activation is required for optimal viral replication in primary kidney epithelial cells. In this report, we set out to determine what viral components are responsible for activating the two major phosphatidylinositol 3-kinase-like kinases (PI3KKs) involved in the DDR: ataxia telangiectasia mutated (ATM) kinase and ATM and Rad3-related (ATR) kinase. Using a combination of UV treatment, lentivirus transduction, and mutant virus infection experiments, our results demonstrate that neither the input virus nor the expression of large T antigen (TAg) alone is sufficient to trigger the activation of ATM or ATR in our primary culture model. Instead, our data suggest that the activation of both the ATM- and ATR-mediated DDR pathways is linked to viral DNA replication. Intriguingly, a TAg mutant virus that is unable to activate the DDR causes substantial host DNA damage. Our study provides insight into how DDRs are activated by polyomaviruses in primary cells with intact cell cycle checkpoints and how the activation might be linked to the maintenance of host genome stability. IMPORTANCE Polyomaviruses are opportunistic pathogens that are associated with several human diseases under immunosuppressed conditions. BK polyomavirus (BKPyV) affects mostly kidney and bone marrow transplant patients. The detailed replication mechanism of these viruses remains to be determined. We have previously reported that BKPyV activates the host DNA damage response (DDR), a response normally used by the host cell to combat genotoxic stress, to aid its own replication. In this study, we identified that the trigger for DDR

  11. Multiple specific binding sites for purified glucocorticoid receptors on mammary tumor virus DNA.

    PubMed

    Payvar, F; Firestone, G L; Ross, S R; Chandler, V L; Wrange, O; Carlstedt-Duke, J; Gustafsson, J A; Yamamoto, K R

    1982-01-01

    Glucocorticoid hormones selectively stimulate the rate of transcription of integrated mammary tumor virus (MTV) sequences in infected rat hepatoma cells. Using two independent assays, we find that purified rat liver glucocorticoid receptor protein binds specifically to at least four widely separated regions on pure MTV proviral DNA. One of these specific binding domains, which itself contains at least two distinct receptor binding sites, resides within a fragment of viral DNA that maps 110-449 bp upstream of the promoter for MTV RNA synthesis. Three other binding domains lie downstream of the promoter and within the MTV primary transcription unit. Restriction fragments bearing separate binding domains have been introduced into cultured cells; transformants have been recovered in which the introduced fragments are expressed under glucocorticoid control. Thus, it appears that this assay will be useful for assessing the biological significance of the receptor binding sites detected in vitro.

  12. Computational Design of DNA-Binding Proteins.

    PubMed

    Thyme, Summer; Song, Yifan

    2016-01-01

    Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering.

  13. Mechanisms for Binding between Methylene Blue and DNA

    NASA Astrophysics Data System (ADS)

    Vardevanyan, P. O.; Antonyan, A. P.; Parsadanyan, M. A.; Shahinyan, M. A.; Hambardzumyan, L. A.

    2013-09-01

    We have used absorption and fl uorimetric methods to study the interaction between methylene blue (MB) and calfthymus DNA. Based on Scatchard analysis of the experimental data, we plotted the methylene blue-DNA binding curve. This curve consists of two linear sections, which indicates two types of interaction, for which we determined the constants K and the number of binding sites n for binding of this ligand to DNA. Comparison of the data obtained with analogous values found for interaction between ethidium bromide and DNA allowed us to conclude that there are two modes of interaction between methylene blue and DNA: strong binding (semi-intercalation) and weak binding (electrostatic).

  14. Epigenetic control of viral life-cycle by a DNA-methylation dependent transcription factor.

    PubMed

    Flower, Kirsty; Thomas, David; Heather, James; Ramasubramanyan, Sharada; Jones, Susan; Sinclair, Alison J

    2011-01-01

    Epstein-Barr virus (EBV) encoded transcription factor Zta (BZLF1, ZEBRA, EB1) is the prototype of a class of transcription factor (including C/EBPalpha) that interact with CpG-containing DNA response elements in a methylation-dependent manner. The EBV genome undergoes a biphasic methylation cycle; it is extensively methylated during viral latency but is reset to an unmethylated state following viral lytic replication. Zta is expressed transiently following infection and again during the switch between latency and lytic replication. The requirement for CpG-methylation at critical Zta response elements (ZREs) has been proposed to regulate EBV replication, specifically it could aid the activation of viral lytic gene expression from silenced promoters on the methylated genome during latency in addition to preventing full lytic reactivation from the non-methylated EBV genome immediately following infection. We developed a computational approach to predict the location of ZREs which we experimentally assessed using in vitro and in vivo DNA association assays. A remarkably different binding motif is apparent for the CpG and non-CpG ZREs. Computational prediction of the location of these binding motifs in EBV revealed that the majority of lytic cycle genes have at least one and many have multiple copies of methylation-dependent CpG ZREs within their promoters. This suggests that the abundance of Zta protein coupled with the methylation status of the EBV genome act together to co-ordinate the expression of lytic cycle genes at the majority of EBV promoters.

  15. DNA binding studies of Vinca alkaloids: experimental and computational evidence.

    PubMed

    Pandya, Prateek; Gupta, Surendra P; Pandav, Kumud; Barthwal, Ritu; Jayaram, B; Kumar, Surat

    2012-03-01

    Fluorescence studies on the indole alkaloids vinblastine sulfate, vincristine sulfate, vincamine and catharanthine have demonstrated the DNA binding ability of these molecules. The binding mode of these molecules in the minor groove of DNA is non-specific. A new parameter of the purine-pyrimidine base sequence specificty was observed in order to define the non-specific DNA binding of ligands. Catharanthine had shown 'same' pattern of 'Pu-Py' specificity while evaluating its DNA binding profile. The proton resonances of a DNA decamer duplex were assigned. The models of the drug:DNA complexes were analyzed for DNA binding features. The effect of temperature on the DNA binding was also evaluated.

  16. Binding characteristics of salbutamol with DNA by spectral methods.

    PubMed

    Bi, Shuyun; Pang, Bo; Zhao, Tingting; Wang, Tianjiao; Wang, Yu; Yan, Lili

    2013-07-01

    Salbutamol interacting with deoxyribonucleic acid (DNA) was examined by fluorescence, UV absorption, viscosity measurements, and DNA melting techniques. The binding constants and binding sites were obtained at different temperatures by fluorescence quenching. The Stern-Volmer plots showed that the quenching of fluorescence of salbutamol by DNA was a static quenching. To probe the binding mode, various analytical methods were performed and the results were as follows: hyperchromic effect was shown in the absorption spectra of salbutamol upon addition of DNA; there was no appreciable increase in melting temperature of DNA when salbutamol was presented in DNA solution; the fluorescence intensity of salbutamol-DNA decrease with the increasing ionic strength; the relative viscosity of DNA did not change in the presence of salbutamol; the binding constant of salbutamol with double strand DNA (dsDNA) was much higher than that of it with single strand DNA (ssDNA). All these results indicated that the binding mode of salbutamol to DNA should be groove binding. The thermodynamic parameters suggested that hydrogen bond or van der Waals force might play an important role in salbutamol binding to DNA. According to the Förster energy transference theory, the binding distance between the acceptor and donor was 3.70 nm.

  17. Binding characteristics of salbutamol with DNA by spectral methods

    NASA Astrophysics Data System (ADS)

    Bi, Shuyun; Pang, Bo; Zhao, Tingting; Wang, Tianjiao; Wang, Yu; Yan, Lili

    2013-07-01

    Salbutamol interacting with deoxyribonucleic acid (DNA) was examined by fluorescence, UV absorption, viscosity measurements, and DNA melting techniques. The binding constants and binding sites were obtained at different temperatures by fluorescence quenching. The Stern-Volmer plots showed that the quenching of fluorescence of salbutamol by DNA was a static quenching. To probe the binding mode, various analytical methods were performed and the results were as follows: hyperchromic effect was shown in the absorption spectra of salbutamol upon addition of DNA; there was no appreciable increase in melting temperature of DNA when salbutamol was presented in DNA solution; the fluorescence intensity of salbutamol-DNA decrease with the increasing ionic strength; the relative viscosity of DNA did not change in the presence of salbutamol; the binding constant of salbutamol with double strand DNA (dsDNA) was much higher than that of it with single strand DNA (ssDNA). All these results indicated that the binding mode of salbutamol to DNA should be groove binding. The thermodynamic parameters suggested that hydrogen bond or van der Waals force might play an important role in salbutamol binding to DNA. According to the Förster energy transference theory, the binding distance between the acceptor and donor was 3.70 nm.

  18. Viral DNA Packaging: One Step at a Time

    NASA Astrophysics Data System (ADS)

    Bustamante, Carlos; Moffitt, Jeffrey R.

    During its life-cycle the bacteriophage φ29 actively packages its dsDNA genome into a proteinacious capsid, compressing its genome to near crystalline densities against large electrostatic, elastic, and entropic forces. This remarkable process is accomplished by a nano-scale, molecular DNA pump - a complex assembly of three protein and nucleic acid rings which utilizes the free energy released in ATP hydrolysis to perform the mechanical work necessary to overcome these large energetic barriers. We have developed a single molecule optical tweezers assay which has allowed us to probe the detailed mechanism of this packaging motor. By following the rate of packaging of a single bacteriophage as the capsid is filled with genome and as a function of optically applied load, we find that the compression of the genome results in the build-up of an internal force, on the order of ˜ 55 pN, due to the compressed genome. The ability to work against such large forces makes the packaging motor one of the strongest known molecular motors. By titrating the concentration of ATP, ADP, and inorganic phosphate at different opposing load, we are able to determine features of the mechanochemistry of this motor - the coupling between the mechanical and chemical cycles. We find that force is generated not upon binding of ATP, but rather upon release of hydrolysis products. Finally, by improving the resolution of the optical tweezers assay, we are able to observe the discrete increments of DNA encapsidated each cycle of the packaging motor. We find that DNA is packaged in 10-bp increments preceded by the binding of multiple ATPs. The application of large external forces slows the packaging rate of the motor, revealing that the 10-bp steps are actually composed of four 2.5-bp steps which occur in rapid succession. These data show that the individual subunits of the pentameric ring-ATPase at the core of the packaging motor are highly coordinated, with the binding of ATP and the

  19. Experimental and computational studies on the DNA translocation mechanism of the T4 viral packaging motor

    NASA Astrophysics Data System (ADS)

    Migliori, Amy; Arya, Gaurav; Smith, Douglas E.

    2012-10-01

    Bacteriophage T4 is a double stranded DNA virus that infects E.coli by injecting the viral genome through the cellular wall of a host cell. The T4 genome must be ejected from the viral capsid with sufficient force to ensure infection. To generate high ejection forces, the genome is packaged to high density within the viral capsid. A DNA translocation motor, in which the protein gp17 hydrolyzes ATP and binds to the DNA, is responsible for translocating the genome into the capsid during viral maturation of T4. This motor generates forces in excess of 60 pN and packages DNA at rates exceeding 2000 base pairs/second (bp/s)1. Understanding these small yet powerful motors is important, as they have many potential applications. Though much is known about the activity of these motors from bulk and single molecule biophysical techniques, little is known about their detailed molecular mechanism. Recently, two structures of gp17 have been obtained: a high-resolution X-ray crystallographic structure showing a monomeric compacted form of the enzyme, and a cryo-electron microscopic structure of the extended form of gp17 in complex with actively packaging prohead complexes. Comparison of these two structures indicates several key differences, and a model has been proposed to explain the translocation action of the motor2. Key to this model are a set of residues forming ion pairs across two domains of the gp17 molecule that are proposed to be involved in force generation by causing the collapse of the extended form of gp17. Using a dual optical trap to measure the rates of DNA packaging and the generated forces, we present preliminary mutational data showing that these several of these ion pairs are important to motor function. We have also performed preliminary free energy calculations on the extended and collapsed state of gp17, to confirm that these interdomain ion pairs have large contributions to the change in free energy that occurs upon the collapse of gp17 during the

  20. RNA and DNA binding properties of HIV-1 Vif protein: a fluorescence study.

    PubMed

    Bernacchi, Serena; Henriet, Simon; Dumas, Philippe; Paillart, Jean-Christophe; Marquet, Roland

    2007-09-07

    The HIV-1 viral infectivity factor (Vif) is a small basic protein essential for viral fitness and pathogenicity. Some "non-permissive" cell lines cannot sustain replication of Vif(-) HIV-1 virions. In these cells, Vif counteracts the natural antiretroviral activity of the DNA-editing enzymes APOBEC3G/3F. Moreover, Vif is packaged into viral particles through a strong interaction with genomic RNA in viral nucleoprotein complexes. To gain insights into determinants of this binding process, we performed the first characterization of Vif/nucleic acid interactions using Vif intrinsic fluorescence. We determined the affinity of Vif for RNA fragments corresponding to various regions of the HIV-1 genome. Our results demonstrated preferential and moderately cooperative binding for RNAs corresponding to the 5'-untranslated region of HIV-1 (5'-untranslated region) and gag (cooperativity parameter omega approximately 65-80, and K(d) = 45-55 nM). In addition, fluorescence spectroscopy allowed us to point out the TAR apical loop and a short region in gag as primary strong affinity binding sites (K(d) = 9.5-14 nM). Interestingly, beside its RNA binding properties, the Vif protein can also bind the corresponding DNA oligonucleotides and their complementary counterparts with an affinity similar to the one observed for the RNA sequences, while other DNA sequences displayed reduced affinity. Taken together, our results suggest that Vif binding to RNA and DNA offers several non-exclusive ways to counteract APOBEC3G/3F factors, in addition to the well documented Vif-induced degradation by the proteasome and to the Vif-mediated repression of translation of these antiviral factors.

  1. A DNA aptamer efficiently inhibits the infectivity of Bovine herpesvirus 1 by blocking viral entry.

    PubMed

    Xu, Jian; Zhang, Xixi; Zhou, Shuanghai; Shen, Junjun; Yang, Dawei; Wu, Jing; Li, Xiaoyang; Li, Meiling; Huang, Xiufen; Sealy, Joshua E; Iqbal, Munir; Li, Yongqing

    2017-09-18

    Bovine herpesvirus 1 (BoHV-1) is an important pathogen of domestic and wild cattle responsible for major economic losses in dairy and beef industries throughout the world. Inhibition of viral entry plays a crucial role in the control of BoHV-1 infection and aptamers have been reported to inhibit viral replication. In this study, nine DNA aptamers that target BoHV-1 were generated using systemic evolution of ligands by exponential enrichment. Of the nine candidates, aptamer IBRV-A4 exhibited the highest affinity and specificity for BoHV-1, which bound to BoHV-1 with a Kd value of 3.519 nM and demonstrated the greatest virus binding as shown by fluorescence imaging. The neutralizing ability of aptamer IBRV-A4 was determined using neutralization assays and real time PCR in BoHV-1 infected Madin-darby bovine kidney cells. Virus titration, immunofluorescence and confocal laser scanning microscopy showed virus replication significantly decreased when aptamer IBRV-A4 was added to BoHV-1 infected MDBK cells at 0 and 0.5 hours post-infection, whereas no change was seen when IBRV-A4 was added 2 hours post-infection. This concludes that aptamer IBRV-A4 efficiently inhibits viral entry of BoHV-1 in MDBK cells and is therefore a novel tool for diagnosis and treatment of BoHV-1 infection in cattle.

  2. Helicase binding to DnaI exposes a cryptic DNA-binding site during helicase loading in Bacillus subtilis

    PubMed Central

    Ioannou, Charikleia; Schaeffer, Patrick M.; Dixon, Nicholas E.; Soultanas, Panos

    2006-01-01

    The Bacillus subtilis DnaI, DnaB and DnaD proteins load the replicative ring helicase DnaC onto DNA during priming of DNA replication. Here we show that DnaI consists of a C-terminal domain (Cd) with ATPase and DNA-binding activities and an N-terminal domain (Nd) that interacts with the replicative ring helicase. A Zn2+-binding module mediates the interaction with the helicase and C67, C70 and H84 are involved in the coordination of the Zn2+. DnaI binds ATP and exhibits ATPase activity that is not stimulated by ssDNA, because the DNA-binding site on Cd is masked by Nd. The ATPase activity resides on the Cd domain and when detached from the Nd domain, it becomes sensitive to stimulation by ssDNA because its cryptic DNA-binding site is exposed. Therefore, Nd acts as a molecular ‘switch’ regulating access to the ssDNA binding site on Cd, in response to binding of the helicase. DnaI is sufficient to load the replicative helicase from a complex with six DnaI molecules, so there is no requirement for a dual helicase loader system. PMID:17003052

  3. Extranucleosomal DNA Binding Directs Nucleosome Sliding by Chd1 ▿

    PubMed Central

    McKnight, Jeffrey N.; Jenkins, Katherine R.; Nodelman, Ilana M.; Escobar, Thelma; Bowman, Gregory D.

    2011-01-01

    Chd1- and ISWI-type chromatin remodelers can sense extranucleosomal DNA and preferentially shift nucleosomes toward longer stretches of available DNA. The DNA-binding domains of these chromatin remodelers are believed to be responsible for sensing extranucleosomal DNA and are needed for robust sliding, but it is unclear how these domains contribute to directional movement of nucleosomes. Here, we show that the DNA-binding domain of Chd1 is not essential for nucleosome sliding but is critical for centering mononucleosomes on short DNA fragments. Remarkably, nucleosome centering was achieved by replacing the native DNA-binding domain of Chd1 with foreign DNA-binding domains of Escherichia coli AraC or Drosophila melanogaster engrailed. Introducing target DNA sequences recognized by the foreign domains enabled the remodelers to rapidly shift nucleosomes toward these binding sites, demonstrating that these foreign DNA-binding domains dictated the direction of sliding. Sequence-directed sliding occluded the target DNA sequences on the nucleosome enough to promote release of the remodeler. Target DNA sequences were highly stimulatory at multiple positions flanking the nucleosome and had the strongest influence when separated from the nucleosome by 23 or fewer base pairs. These results suggest that the DNA-binding domain's affinity for extranucleosomal DNA is the key determinant for the direction that Chd1 shifts the nucleosome. PMID:21969605

  4. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  5. Prediction of zinc finger DNA binding protein.

    PubMed

    Nakata, K

    1995-04-01

    Using the neural network algorithm with back-propagation training procedure, we analysed the zinc finger DNA binding protein sequences. We incorporated the characteristic patterns around the zinc finger motifs TFIIIA type (Cys-X2-5-Cys-X12-13-His-X2-5-His) and the steroid hormone receptor type (Cys-X2-5-Cys-X12-15-Cys-X2-5-Cys-X15-16-Cys-X4-5-Cys-X8-10- Cys-X2-3-Cys) in the neural network algorithm. The patterns used in the neural network were the amino acid pattern, the electric charge and polarity pattern, the side-chain chemical property and subproperty patterns, the hydrophobicity and hydrophilicity patterns and the secondary structure propensity pattern. Two consecutive patterns were also considered. Each pattern was incorporated in the single layer perceptron algorithm and the combinations of patterns were considered in the two-layer perceptron algorithm. As for the TFIIIA type zinc finger DNA binding motifs, the prediction results of the two-layer perceptron algorithm reached up to 96.9% discrimination, and the prediction results of the discriminant analysis using the combination of several characters reached up to 97.0%. As for the steroid hormone receptor type zinc finger, the prediction results of neural network algorithm and the discriminant analyses reached up to 96.0%.

  6. Difference in DNA-binding abilities of Fur-homolog DNA binding protein from Neisseria gonorrhoeae.

    PubMed

    Bagchi, Angshuman

    2016-10-01

    Gonorrhea is a severe disease infecting both men and women worldwide. The causative agent of the disease is Neisseria gonorrhoeae. The organism mostly affects human beings in iron restricted environments. In such an environment the organism produces a set of proteins which are mostly absent in iron rich environments. The expressions of the genes for the proteins are regulated by the transcription factor (TF) belonging to the Fur family. Interestingly, the same TF acts as the activator and repressor of genes. In this present work, an attempt has been made to analyze the molecular details of the differential DNA-binding activities of the TF from Neisseria gonorrhoeae to come up with a plausible molecular reason behind the difference DNA binding activities of the same TF. Computational modelling technique was used to build the three dimensional structure of the TF. Molecular docking and molecular dynamics simulations were employed to determine the binding interactions between the TF and the promoter DNA. With the help of the computational techniques, the biochemical reason behind the different modes of DNA binding by the TF was analyzed. Results from this analysis may be useful to future drug development endeavours to curtail the spread of Gonorrhea.

  7. The Adenovirus L4-33K Protein Regulates both Late Gene Expression Patterns and Viral DNA Packaging

    PubMed Central

    Wu, Kai; Guimet, Diana

    2013-01-01

    The adenovirus (Ad) L4-33K protein has been linked to disparate functions during infection. L4-33K is a virus-encoded alternative RNA splicing factor which activates splicing of viral late gene transcripts that contain weak 3′ splice sites. Additionally, L4-33K has been indicated to play a role in adenovirus assembly. We generated and characterized an Ad5 L4-33K mutant virus to further explore its function(s) during infection. Infectivity, viral genome replication, and most viral gene expression of the L4-33K mutant virus are comparable to those of the wild-type virus, except for a prominent decrease in the levels of the late proteins IIIa and pVI. The L4-33K mutant virus produces only empty capsids, indicating a defect in viral DNA packaging. We demonstrate that L4-33K does not preferentially bind to viral packaging sequences in vivo, and mutation of L4-33K does not interfere with the binding of the known viral packaging proteins IVa2, L4-22K, L1-52/55K, and IIIa to the packaging sequences in vivo. Collectively, these results demonstrate that the phenotype of an Ad5 L4-33K mutant virus is complex. The L4-33K protein regulates the accumulation of selective Ad late gene mRNAs and is involved in the proper transition of gene expression during the late phase of infection. The L4-33K protein also plays a role in adenovirus morphogenesis by promoting the packaging of the viral genome into the empty capsid. These results demonstrate the multifunctional nature of the L4-33K protein and its involvement in several different and critical aspects of viral infection. PMID:23552425

  8. Selective binding of single-stranded DNA-binding proteins onto DNA molecules adsorbed on single-walled carbon nanotubes.

    PubMed

    Nii, Daisuke; Hayashida, Takuya; Yamaguchi, Yuuki; Ikawa, Shukuko; Shibata, Takehiko; Umemura, Kazuo

    2014-09-01

    Single-stranded DNA-binding (SSB) proteins were treated with hybrids of DNA and single-walled carbon nanotubes (SWNTs) to examine the biological function of the DNA molecules adsorbed on the SWNT surface. When single-stranded DNA (ssDNA) was used for the hybridization, significant binding of the SSB molecules to the ssDNA-SWNT hybrids was observed by using atomic force microscopy (AFM) and agarose gel electrophoresis. When double-stranded DNA (dsDNA) was used, the SSB molecules did not bind to the dsDNA-SWNT hybrids in most of the conditions that we evaluated. A specifically modified electrophoresis procedure was used to monitor the locations of the DNA, SSB, and SWNT molecules. Our results clearly showed that ssDNA/dsDNA molecules on the SWNT surfaces retained their single-stranded/double-stranded structures.

  9. Distinct Z-DNA binding mode of a PKR-like protein kinase containing a Z-DNA binding domain (PKZ)

    PubMed Central

    Kim, Doyoun; Hur, Jeonghwan; Park, Kwangsoo; Bae, Sangsu; Shin, Donghyuk; Ha, Sung Chul; Hwang, Hye-Yeon; Hohng, Sungchul; Lee, Joon-Hwa; Lee, Sangho; Kim, Yang-Gyun; Kim, Kyeong Kyu

    2014-01-01

    Double-stranded ribonucleic acid-activated protein kinase (PKR) downregulates translation as a defense mechanism against viral infection. In fish species, PKZ, a PKR-like protein kinase containing left-handed deoxyribonucleic acid (Z-DNA) binding domains, performs a similar role in the antiviral response. To understand the role of PKZ in Z-DNA recognition and innate immune response, we performed structural and functional studies of the Z-DNA binding domain (Zα) of PKZ from Carassius auratus (caZαPKZ). The 1.7-Å resolution crystal structure of caZαPKZ:Z-DNA revealed that caZαPKZ shares the overall fold with other Zα, but has discrete structural features that differentiate its DNA binding mode from others. Functional analyses of caZαPKZ and its mutants revealed that caZαPKZ mediates the fastest B-to-Z transition of DNA among Zα, and the minimal interaction for Z-DNA recognition is mediated by three backbone phosphates and six residues of caZαPKZ. Structure-based mutagenesis and B-to-Z transition assays confirmed that Lys56 located in the β-wing contributes to its fast B-to-Z transition kinetics. Investigation of the DNA binding kinetics of caZαPKZ further revealed that the B-to-Z transition rate is positively correlated with the association rate constant. Taking these results together, we conclude that the positive charge in the β-wing largely affects fast B-to-Z transition activity by enhancing the DNA binding rate. PMID:24682817

  10. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  11. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  12. DNA cleavage enzymes for treatment of persistent viral infections: Recent advances and the pathway forward

    SciTech Connect

    Weber, Nicholas D.; Aubert, Martine; Dang, Chung H.; Stone, Daniel; Jerome, Keith R.

    2014-04-15

    Treatment for most persistent viral infections consists of palliative drug options rather than curative approaches. This is often because long-lasting viral DNA in infected cells is not affected by current antivirals, providing a source for viral persistence and reactivation. Targeting latent viral DNA itself could therefore provide a basis for novel curative strategies. DNA cleavage enzymes can be used to induce targeted mutagenesis of specific genes, including those of exogenous viruses. Although initial in vitro and even in vivo studies have been carried out using DNA cleavage enzymes targeting various viruses, many questions still remain concerning the feasibility of these strategies as they transition into preclinical research. Here, we review the most recent findings on DNA cleavage enzymes for human viral infections, consider the most relevant animal models for several human viral infections, and address issues regarding safety and enzyme delivery. Results from well-designed in vivo studies will ideally provide answers to the most urgent remaining questions, and allow continued progress toward clinical application. - Highlights: • Recent in vitro and in vivo results for DNA cleavage enzymes targeting persistent viral infections. • Analysis of the best animal models for testing enzymes for HBV, HSV, HIV and HPV. • Challenges facing in vivo delivery of therapeutic enzymes for persistent viral infections. • Safety issues to be addressed with proper animal studies.

  13. Requirement of the N-terminal residues of human cytomegalovirus UL112-113 proteins for viral growth and oriLyt-dependent DNA replication.

    PubMed

    Kim, Young-Eui; Park, Mi Young; Kang, Kyeong Jin; Han, Tae Hee; Lee, Chan Hee; Ahn, Jin-Hyun

    2015-08-01

    The UL112-113 region of the human cytomegalovirus (HCMV) genome encodes four phosphoproteins of 34, 43, 50, and 84 kDa that promote viral DNA replication. Co-transfection assays have demonstrated that self-interaction of these proteins via the shared N-termini is necessary for their intranuclear distribution as foci and for the efficient relocation of a viral DNA polymerase processivity factor (UL44) to the viral replication sites. However, the requirement of UL112-113 N-terminal residues for viral growth and DNA replication has not been fully elucidated. Here, we investigated the effect of deletion of the N-terminal regions of UL112-113 proteins on viral growth and oriLyt-dependent DNA replication. A deletion of the entire UL112 region or the region encoding the 25 N-terminal amino-acid residues from the HCMV (Towne strain) bacmid impaired viral growth in bacmid-transfected human fibroblast cells, indicating their requirement for viral growth. In co-immunoprecipitation assays using the genomic gene expressing the four UL112-113 proteins together, the 25 N-terminal amino-acid residues were found to be necessary for stable expression of UL112-113 proteins and their self-interaction. These residues were also required for efficient binding to and relocation of UL44, but not for interaction with IE2, an origin-binding transcription factor. In co-transfection/replication assays, replication of the oriLyt-containing plasmid was promoted by expression of intact UL112-113 proteins, but not by the expression of 25-amino-acid residue-deleted proteins. Our results demonstrate that the 25 N-terminal amino-acid residues of UL112-113 proteins that mediate self-interaction contribute to viral growth by promoting their binding to UL44 and the initiation of oriLyt-dependent DNA replication.

  14. An interaction between human papillomavirus 16 E2 and TopBP1 is required for optimum viral DNA replication and episomal genome establishment.

    PubMed

    Donaldson, Mary M; Mackintosh, Lorna J; Bodily, Jason M; Dornan, Edward S; Laimins, Laimonis A; Morgan, Iain M

    2012-12-01

    In human papillomavirus DNA replication, the viral protein E2 forms homodimers and binds to 12-bp palindromic DNA sequences surrounding the origin of DNA replication. Via a protein-protein interaction, it then recruits the viral helicase E1 to an A/T-rich origin of replication, whereupon a dihexamer forms, resulting in DNA replication initiation. In order to carry out DNA replication, the viral proteins must interact with host factors that are currently not all known. An attractive cellular candidate for regulating viral replication is TopBP1, a known interactor of the E2 protein. In mammalian DNA replication, TopBP1 loads DNA polymerases onto the replicative helicase after the G(1)-to-S transition, and this process is tightly cell cycle controlled. The direct interaction between E2 and TopBP1 would allow E2 to bypass this cell cycle control, resulting in DNA replication more than once per cell cycle, which is a requirement for the viral life cycle. We report here the generation of an HPV16 E2 mutant compromised in TopBP1 interaction in vivo and demonstrate that this mutant retains transcriptional activation and repression functions but has suboptimal DNA replication potential. Introduction of this mutant into a viral life cycle model results in the failure to establish viral episomes. The results present a potential new antiviral target, the E2-TopBP1 interaction, and increase our understanding of the viral life cycle, suggesting that the E2-TopBP1 interaction is essential.

  15. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  16. Mutant p53 proteins bind DNA in a DNA structure-selective mode

    PubMed Central

    Göhler, Thomas; Jäger, Stefan; Warnecke, Gabriele; Yasuda, Hideyo; Kim, Ella; Deppert, Wolfgang

    2005-01-01

    Despite the loss of sequence-specific DNA binding, mutant p53 (mutp53) proteins can induce or repress transcription of mutp53-specific target genes. To date, the molecular basis for transcriptional modulation by mutp53 is not understood, but increasing evidence points to the possibility that specific interactions of mutp53 with DNA play an important role. So far, the lack of a common denominator for mutp53 DNA binding, i.e. the existence of common sequence elements, has hampered further characterization of mutp53 DNA binding. Emanating from our previous discovery that DNA structure is an important determinant of wild-type p53 (wtp53) DNA binding, we analyzed the binding of various mutp53 proteins to oligonucleotides mimicking non-B DNA structures. Using various DNA-binding assays we show that mutp53 proteins bind selectively and with high affinity to non-B DNA. In contrast to sequence-specific and DNA structure-dependent binding of wtp53, mutp53 DNA binding to non-B DNA is solely dependent on the stereo-specific configuration of the DNA, and not on DNA sequence. We propose that DNA structure-selective binding of mutp53 proteins is the basis for the well-documented interaction of mutp53 with MAR elements and for transcriptional activities mediates by mutp53. PMID:15722483

  17. How does viral DNA find the nucleus of an infected cell?

    PubMed Central

    Widulle, Herbert

    2012-01-01

    If all locations of a living cell would have the same chemical potential, most viral infections of a cell should be abortive, even after the a penetration of the cell wall by the viral DNA-polymer or viral RNA-polymer occurred. This is obviously not the case. Therefore, there must be a mechanism which transports a viral DNA-polymer from the cell wall to the nucleus and not to any other location. A possible mechanism is proposed which is in accordance with biophysical chemistry. The presented description of the mechanism uses non equilibrium thermodynamics to find a simple solution for the problem. PMID:22558035

  18. Viral DNA Replication Orientation and hnRNPs Regulate Transcription of the Human Papillomavirus 18 Late Promoter

    PubMed Central

    Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R.; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald

    2017-01-01

    ABSTRACT The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis-acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. PMID:28559488

  19. Chemotherapy targeting by DNA capture in viral protein particles

    PubMed Central

    Agadjanian, Hasmik; Chu, David; Hwang, Jae Youn; Wachsmann-Hogiu, Sebastian; Rentsendorj, Altan; Song, Lei; Valluripalli, Vinod; Lubow, Jay; Ma, Jun; Sharifi, Behrooz; Farkas, Daniel L; Medina-Kauwe, Lali K

    2012-01-01

    Aim This study tests the hypothesis that DNA intercalation and electrophilic interactions can be exploited to noncovalently assemble doxorubicin in a viral protein nanoparticle designed to target and penetrate tumor cells through ligand-directed delivery. We further test whether this new paradigm of doxorubicin targeting shows therapeutic efficacy and safety in vitro and in vivo. Materials & methods We tested serum stability, tumor targeting and therapeutic efficacy in vitro and in vivo using biochemical, microscopy and cytotoxicity assays. Results Self-assembly formed approximately 10-nm diameter serum-stable nanoparticles that can target and ablate HER2+ tumors at >10× lower dose compared with untargeted doxorubicin, while sparing the heart after intravenous delivery. The targeted nanoparticle tested here allows doxorubicin potency to remain unaltered during assembly, transport and release into target cells, while avoiding peripheral tissue damage and enabling lower, and thus safer, drug dose for tumor killing. Conclusion This nanoparticle may be an improved alternative to chemical conjugates and signal-blocking antibodies for tumor-targeted treatment. PMID:22385197

  20. DNA synthesis determines the binding mode of the human mitochondrial single-stranded DNA-binding protein

    PubMed Central

    Morin, José A.; Cerrón, Fernando; Jarillo, Javier; Beltran-Heredia, Elena; Ciesielski, Grzegorz L.; Arias-Gonzalez, J. Ricardo

    2017-01-01

    Abstract Single-stranded DNA-binding proteins (SSBs) play a key role in genome maintenance, binding and organizing single-stranded DNA (ssDNA) intermediates. Multimeric SSBs, such as the human mitochondrial SSB (HmtSSB), present multiple sites to interact with ssDNA, which has been shown in vitro to enable them to bind a variable number of single-stranded nucleotides depending on the salt and protein concentration. It has long been suggested that different binding modes might be used selectively for different functions. To study this possibility, we used optical tweezers to determine and compare the structure and energetics of long, individual HmtSSB–DNA complexes assembled on preformed ssDNA and on ssDNA generated gradually during ‘in situ’ DNA synthesis. We show that HmtSSB binds to preformed ssDNA in two major modes, depending on salt and protein concentration. However, when protein binding was coupled to strand-displacement DNA synthesis, only one of the two binding modes was observed under all experimental conditions. Our results reveal a key role for the gradual generation of ssDNA in modulating the binding mode of a multimeric SSB protein and consequently, in generating the appropriate nucleoprotein structure for DNA synthetic reactions required for genome maintenance. PMID:28486639

  1. DNA synthesis determines the binding mode of the human mitochondrial single-stranded DNA-binding protein.

    PubMed

    Morin, José A; Cerrón, Fernando; Jarillo, Javier; Beltran-Heredia, Elena; Ciesielski, Grzegorz L; Arias-Gonzalez, J Ricardo; Kaguni, Laurie S; Cao, Francisco J; Ibarra, Borja

    2017-07-07

    Single-stranded DNA-binding proteins (SSBs) play a key role in genome maintenance, binding and organizing single-stranded DNA (ssDNA) intermediates. Multimeric SSBs, such as the human mitochondrial SSB (HmtSSB), present multiple sites to interact with ssDNA, which has been shown in vitro to enable them to bind a variable number of single-stranded nucleotides depending on the salt and protein concentration. It has long been suggested that different binding modes might be used selectively for different functions. To study this possibility, we used optical tweezers to determine and compare the structure and energetics of long, individual HmtSSB-DNA complexes assembled on preformed ssDNA and on ssDNA generated gradually during 'in situ' DNA synthesis. We show that HmtSSB binds to preformed ssDNA in two major modes, depending on salt and protein concentration. However, when protein binding was coupled to strand-displacement DNA synthesis, only one of the two binding modes was observed under all experimental conditions. Our results reveal a key role for the gradual generation of ssDNA in modulating the binding mode of a multimeric SSB protein and consequently, in generating the appropriate nucleoprotein structure for DNA synthetic reactions required for genome maintenance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection

    PubMed Central

    Diner, Benjamin A.; Lum, Krystal K.; Toettcher, Jared E.

    2016-01-01

    ABSTRACT The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. PMID:27935834

  3. Targeted Multifunctional Lipid ECO Plasmid DNA Nanoparticles as Efficient Non-viral Gene Therapy for Leber's Congenital Amaurosis.

    PubMed

    Sun, Da; Sahu, Bhubanananda; Gao, Songqi; Schur, Rebecca M; Vaidya, Amita M; Maeda, Akiko; Palczewski, Krzysztof; Lu, Zheng-Rong

    2017-06-16

    Development of a gene delivery system with high efficiency and a good safety profile is essential for successful gene therapy. Here we developed a targeted non-viral delivery system using a multifunctional lipid ECO for treating Leber's congenital amaurosis type 2 (LCA2) and tested this in a mouse model. ECO formed stable nanoparticles with plasmid DNA (pDNA) at a low amine to phosphate (N/P) ratio and mediated high gene transfection efficiency in ARPE-19 cells because of their intrinsic properties of pH-sensitive amphiphilic endosomal escape and reductive cytosolic release (PERC). All-trans-retinylamine, which binds to interphotoreceptor retinoid-binding protein (IRBP), was incorporated into the nanoparticles via a polyethylene glycol (PEG) spacer for targeted delivery of pDNA into the retinal pigmented epithelium. The targeted ECO/pDNA nanoparticles provided high GFP expression in the RPE of 1-month-old Rpe65(-/-) mice after subretinal injection. Such mice also exhibited a significant increase in electroretinographic activity, and this therapeutic effect continued for at least 120 days. A safety study in wild-type BALB/c mice indicated no irreversible retinal damage following subretinal injection of these targeted nanoparticles. All-trans-retinylamine-modified ECO/pDNA nanoparticles provide a promising non-viral platform for safe and effective treatment of RPE-specific monogenic eye diseases such as LCA2. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Viral genome packaging terminase cleaves DNA using the canonical RuvC-like two-metal catalysis mechanism.

    PubMed

    Xu, Rui-Gang; Jenkins, Huw T; Chechik, Maria; Blagova, Elena V; Lopatina, Anna; Klimuk, Evgeny; Minakhin, Leonid; Severinov, Konstantin; Greive, Sandra J; Antson, Alfred A

    2017-04-07

    Bacteriophages and large dsDNA viruses encode sophisticated machinery to translocate their DNA into a preformed empty capsid. An essential part of this machine, the large terminase protein, processes viral DNA into constituent units utilizing its nuclease activity. Crystal structures of the large terminase nuclease from the thermophilic bacteriophage G20c show that it is most similar to the RuvC family of the RNase H-like endonucleases. Like RuvC proteins, the nuclease requires either Mn2+, Mg2+ or Co2+ ions for activity, but is inactive with Zn2+ and Ca2+. High resolution crystal structures of complexes with different metals reveal that in the absence of DNA, only one catalytic metal ion is accommodated in the active site. Binding of the second metal ion may be facilitated by conformational variability, which enables the two catalytic aspartic acids to be brought closer to each other. Structural comparison indicates that in common with the RuvC family, the location of the two catalytic metals differs from other members of the RNase H family. In contrast to a recently proposed mechanism, the available data do not support binding of the two metals at an ultra-short interatomic distance. Thus we postulate that viral terminases cleave DNA by the canonical RuvC-like mechanism. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. DNA binding properties of a chemically synthesized DNA binding domain of hRFX1.

    PubMed

    Cornille, F; Emery, P; Schüler, W; Lenoir, C; Mach, B; Roques, B P; Reith, W

    1998-05-01

    The RFX DNA binding domain (DBD) is a novel highly conserved motif belonging to a large number of dimeric DNA binding proteins which have diverse regulatory functions in eukaryotic organisms, ranging from yeasts to human. To characterize this novel motif, solid phase synthesis of a 76mer polypeptide corresponding to the DBD of human hRFX1 (hRFX1/DBD), a prototypical member of the RFX family, has been optimized to yield large quantities (approximately 90 mg) of pure compound. Preliminary two-dimensional1H NMR experiments suggested the presence of helical regions in this sequence in agreement with previously reported secondary structure predictions. In gel mobility shift assays, this synthetic peptide was shown to bind in a cooperative manner the 23mer duplex oligodeoxynucleotide corresponding to the binding site of hRFX1, with a 2:1 stoichoimetry due to an inverse repeat present in the 23mer. The stoichiometry of this complex was reduced to 1:1 by decreasing the length of the DNA sequence to a 13mer oligonucleotide containing a single half-site. Surface plasmon resonance measurements were achieved using this 5'-biotylinated 13mer oligonucleotide immobilized on an avidin-coated sensor chip. Using this method an association constant (K a = 4 x 10(5)/M/s), a dissociation constant (K d = 6 x 10(-2)/s) and an equilibrium dissociation constant (K D = 153 nM) were determined for binding of hRFX1/DBD to the double-stranded 13mer oligonucleotide. In the presence of hRFX1/DBD the melting temperature of the 13mer DNA was increased by 16 degreesC, illustrating stabilization of the double-stranded conformation induced by the peptide.

  6. DNA binding properties of a chemically synthesized DNA binding domain of hRFX1.

    PubMed Central

    Cornille, F; Emery, P; Schüler, W; Lenoir, C; Mach, B; Roques, B P; Reith, W

    1998-01-01

    The RFX DNA binding domain (DBD) is a novel highly conserved motif belonging to a large number of dimeric DNA binding proteins which have diverse regulatory functions in eukaryotic organisms, ranging from yeasts to human. To characterize this novel motif, solid phase synthesis of a 76mer polypeptide corresponding to the DBD of human hRFX1 (hRFX1/DBD), a prototypical member of the RFX family, has been optimized to yield large quantities (approximately 90 mg) of pure compound. Preliminary two-dimensional1H NMR experiments suggested the presence of helical regions in this sequence in agreement with previously reported secondary structure predictions. In gel mobility shift assays, this synthetic peptide was shown to bind in a cooperative manner the 23mer duplex oligodeoxynucleotide corresponding to the binding site of hRFX1, with a 2:1 stoichoimetry due to an inverse repeat present in the 23mer. The stoichiometry of this complex was reduced to 1:1 by decreasing the length of the DNA sequence to a 13mer oligonucleotide containing a single half-site. Surface plasmon resonance measurements were achieved using this 5'-biotylinated 13mer oligonucleotide immobilized on an avidin-coated sensor chip. Using this method an association constant (K a = 4 x 10(5)/M/s), a dissociation constant (K d = 6 x 10(-2)/s) and an equilibrium dissociation constant (K D = 153 nM) were determined for binding of hRFX1/DBD to the double-stranded 13mer oligonucleotide. In the presence of hRFX1/DBD the melting temperature of the 13mer DNA was increased by 16 degreesC, illustrating stabilization of the double-stranded conformation induced by the peptide. PMID:9547272

  7. Development of Viral Capsid DNA Aptamer Conjugates as Cell-Targeted Delivery Vehicles

    NASA Astrophysics Data System (ADS)

    Tong, Gary Jen-Wei

    The ability to generate semi-synthetic DNA-protein conjugates has become increasingly important in the fields of chemical biology and nanobiotechnology. As applications in these fields become more complex, there is also an increased need for methods of attaching synthetic DNA to protein substrates in a well-defined manner. This work outlines the development of new methods for site-specific DNA-protein bioconjugation, as well as the development of novel viral capsid DNA aptamer conjugates for cell-targeting purposes. In order to generate DNA-protein conjugates in a site-specific manner, chemistries orthogonal to native functional groups present on DNA and proteins were exploited. In one method, the attachment of DNA to proteins was achieved via oxime formation. This strategy involved the in situ deprotection of an allyloxycarbonyl-protected alkoxyamine-bearing DNA in the presence of a protein containing a single ketone group. The utility of this approach was demonstrated in the synthesis of a DNA-GFP conjugate. In addition to the oxime formation route, two oxidative coupling methods were also developed for DNA-protein bioconjugation. The first reaction coupled phenylenediamine-containing DNA to anilines, which had been site-specifically incorporated into proteins, in the presence of NaIO4. These reaction conditions were demonstrated on the proteins bacteriophage MS2 and GFP, and were mild enough for the components to retain both protein structure and DNA base-pairing capabilities. The second oxidative coupling reaction conjugated aniline-containing proteins to DNA bearing an o-aminophenol moiety. This reaction occurred under similarly mild conditions; however, higher coupling yields were achieved on MS2 at shorter reaction times by using this strategy. In all three of these methods, the generation of a singly-modified product was achieved. Using one of our oxidative coupling strategies, MS2-DNA aptamer conjugates were synthesized for the development of multivalent

  8. Cooperative binding of fluorescein-labeled clupeine by DNA.

    PubMed Central

    Wehling,, K; Krauss, S; Wagner, K G

    1976-01-01

    The alpha-amino group of clupeine fraction Z from herring sperm was coupled with fluorescein. Binding of the labeled protamine by DNA is accompanied by significant fluorescence quenching up to 80%. This allowed the convenient determination of the binding behavior of protamine and DNA. Binding was found to be strongly cooperative and not be significantly affected by the size of DNA. The ionic strength dependence in the range up to 0.3 M NaCl was rather small. Binding parameters were derived according to classical unique-site treatment and to a concept which includes vagrant multi-site binding. PMID:1250694

  9. Structural Basis for Viral Late-Domain Binding to Alix

    SciTech Connect

    Lee,S.; Joshi, A.; Nagashima, K.; Freed, E.; Hurley, J.

    2007-01-01

    The modular protein Alix is a central node in endosomal-lysosomal trafficking and the budding of human immunodeficiency virus (HIV)-1. The Gag p6 protein of HIV-1 contains a LYPx{sub n}LxxL motif that is required for Alix-mediated budding and binds a region of Alix spanning residues 360-702. The structure of this fragment of Alix has the shape of the letter 'V' and is termed the V domain. The V domain has a topologically complex arrangement of 11 {alpha}-helices, with connecting loops that cross three times between the two arms of the V. The conserved residue Phe676 is at the center of a large hydrophobic pocket and is crucial for binding to a peptide model of HIV-1 p6. Overexpression of the V domain inhibits HIV-1 release from cells. This inhibition of release is reversed by mutations that block binding of the Alix V domain to p6.

  10. Uracil DNA Glycosylase BKRF3 Contributes to Epstein-Barr Virus DNA Replication through Physical Interactions with Proteins in Viral DNA Replication Complex

    PubMed Central

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei

    2014-01-01

    ABSTRACT Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmunoprecipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. IMPORTANCE Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme

  11. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.

    PubMed

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-05-06

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers.

  12. DNA Shape versus Sequence Variations in the Protein Binding Process.

    PubMed

    Chen, Chuanying; Pettitt, B Montgomery

    2016-02-02

    The binding process of a protein with a DNA involves three stages: approach, encounter, and association. It has been known that the complexation of protein and DNA involves mutual conformational changes, especially for a specific sequence association. However, it is still unclear how the conformation and the information in the DNA sequences affects the binding process. What is the extent to which the DNA structure adopted in the complex is induced by protein binding, or is instead intrinsic to the DNA sequence? In this study, we used the multiscale simulation method to explore the binding process of a protein with DNA in terms of DNA sequence, conformation, and interactions. We found that in the approach stage the protein can bind both the major and minor groove of the DNA, but uses different features to locate the binding site. The intrinsic conformational properties of the DNA play a significant role in this binding stage. By comparing the specific DNA with the nonspecific in unbound, intermediate, and associated states, we found that for a specific DNA sequence, ∼40% of the bending in the association forms is intrinsic and that ∼60% is induced by the protein. The protein does not induce appreciable bending of nonspecific DNA. In addition, we proposed that the DNA shape variations induced by protein binding are required in the early stage of the binding process, so that the protein is able to approach, encounter, and form an intermediate at the correct site on DNA. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  13. Flavonoid-DNA binding studies and thermodynamic parameters

    NASA Astrophysics Data System (ADS)

    Janjua, Naveed Kausar; Shaheen, Amber; Yaqub, Azra; Perveen, Fouzia; Sabahat, Sana; Mumtaz, Misbah; Jacob, Claus; Ba, Lalla Aicha; Mohammed, Hamdoon A.

    2011-09-01

    Interactional studies of new flavonoid derivatives (Fl) with chicken blood ds.DNA were investigated spectrophotometrically in DMSO-H 2O (9:1 v/v) at various temperatures. Spectral parameters suggest considerable binding between the flavonoid derivatives studied and ds.DNA. The binding constant values lie in the enhanced-binding range. Thermodynamic parameters obtained from UV studies also point to strong spontaneous binding of Fl with ds.DNA. Viscometric studies complimented the UV results where a small linear increase in relative viscosity of the DNA solution was observed with added optimal flavonoid concentration. An overall mixed mode of interaction (intercalative plus groove binding) is proposed between DNA and flavonoids. Conclusively, investigated flavonoid derivatives are found to be strong DNA binders and seem to be promising drug candidates like their natural analogues.

  14. DNA Repair Enzyme Uracil DNA Glycosylase Is Specifically Incorporated into Human Immunodeficiency Virus Type 1 Viral Particles through a Vpr-Independent Mechanism

    PubMed Central

    Willetts, Karen E.; Rey, Françoise; Agostini, Isabelle; Navarro, Jean-Marc; Baudat, Yves; Vigne, Robert; Sire, Joséphine

    1999-01-01

    The Vpr protein, encoded by the human immunodeficiency virus type 1 (HIV-1) genome, is one of the nonstructural proteins packaged in large amounts into viral particles. We have previously reported that Vpr associates with the DNA repair enzyme uracil DNA glycosylase (UDG). In this study, we extended these observations by investigating whether UDG is incorporated into virions and whether this incorporation requires the presence of Vpr. Our results, with highly purified viruses, show that UDG is efficiently incorporated either into wild-type virions or into Vpr-deficient HIV-1 virions, indicating that Vpr is not involved in UDG packaging. Using an in vitro protein-protein binding assay, we reveal a direct interaction between the precursor form of UDG and the viral integrase (IN). Finally, we demonstrate that IN-defective viruses fail to incorporate UDG, indicating that IN is required for packaging of UDG into virions. PMID:9882380

  15. Cleavage of Grb2-Associated Binding Protein 2 by Viral Proteinase 2A during Coxsackievirus Infection

    PubMed Central

    Deng, Haoyu; Fung, Gabriel; Qiu, Ye; Wang, Chen; Zhang, Jingchun; Jin, Zheng-Gen; Luo, Honglin

    2017-01-01

    Coxsackievirus type B3 (CV-B3), an enterovirus associated with the pathogenesis of several human diseases, subverts, or employs the host intracellular signaling pathways to support effective viral infection. We have previously demonstrated that Grb2-associated binding protein 1 (GAB1), a signaling adaptor protein that serves as a platform for intracellular signaling assembly and transduction, is cleaved upon CV-B3 infection, resulting in a gain-of-pro-viral-function via the modification of GAB1-mediated ERK1/2 pathway. GAB2 is a mammalian homolog of GAB1. In this study, we aim to address whether GAB2 plays a synergistic role with GAB1 in the regulation of CV-B3 replication. Here, we reported that GAB2 is also a target of CV-B3-encoded viral proteinase. We showed that GAB2 is cleaved at G238 during CV-B3 infection by viral proteinase 2A, generating two cleaved fragments of GAB2-N1−237 and GAB2-C238−676. Moreover, knockdown of GAB2 significantly inhibits the synthesis of viral protein and subsequent viral progeny production, accompanied by reduced levels of phosphorylated p38, suggesting a pro-viral function for GAB2 linked to p38 activation. Finally, we examined whether the cleavage of GAB2 can promote viral replication as observed for GAB1 cleavage. We showed that expression of neither GAB2-N1−237 nor GAB2-C238−676 results in enhanced viral infectivity, indicating a loss-of-function, rather than a gain-of-function of GAB2 cleavage in mediating virus replication. Taken together, our findings in this study suggest a novel host defense machinery through which CV-B3 infection is limited by the cleavage of a pro-viral protein. PMID:28361043

  16. Direct assessment of viral diversity in soils by random PCR amplification of polymorphic DNA.

    PubMed

    Srinivasiah, Sharath; Lovett, Jacqueline; Polson, Shawn; Bhavsar, Jaysheel; Ghosh, Dhritiman; Roy, Krishnakali; Fuhrmann, Jeffry J; Radosevich, Mark; Wommack, K Eric

    2013-09-01

    Viruses are the most abundant and diverse biological entities within soils, yet their ecological impact is largely unknown. Defining how soil viral communities change with perturbation or across environments will contribute to understanding the larger ecological significance of soil viruses. A new approach to examining the composition of soil viral communities based on random PCR amplification of polymorphic DNA (RAPD-PCR) was developed. A key methodological improvement was the use of viral metagenomic sequence data for the design of RAPD-PCR primers. This metagenomically informed approach to primer design enabled the optimization of RAPD-PCR sensitivity for examining changes in soil viral communities. Initial application of RAPD-PCR viral fingerprinting to soil viral communities demonstrated that the composition of autochthonous soil viral assemblages noticeably changed over a distance of meters along a transect of Antarctic soils and across soils subjected to different land uses. For Antarctic soils, viral assemblages segregated upslope from the edge of dry valley lakes. In the case of temperate soils at the Kellogg Biological Station, viral communities clustered according to land use treatment. In both environments, soil viral communities changed along with environmental factors known to shape the composition of bacterial host communities. Overall, this work demonstrates that RAPD-PCR fingerprinting is an inexpensive, high-throughput means for addressing first-order questions of viral community dynamics within environmental samples and thus fills a methodological gap between narrow single-gene approaches and comprehensive shotgun metagenomic sequencing for the analysis of viral community diversity.

  17. Direct Assessment of Viral Diversity in Soils by Random PCR Amplification of Polymorphic DNA

    PubMed Central

    Srinivasiah, Sharath; Lovett, Jacqueline; Polson, Shawn; Bhavsar, Jaysheel; Ghosh, Dhritiman; Roy, Krishnakali; Fuhrmann, Jeffry J.; Radosevich, Mark

    2013-01-01

    Viruses are the most abundant and diverse biological entities within soils, yet their ecological impact is largely unknown. Defining how soil viral communities change with perturbation or across environments will contribute to understanding the larger ecological significance of soil viruses. A new approach to examining the composition of soil viral communities based on random PCR amplification of polymorphic DNA (RAPD-PCR) was developed. A key methodological improvement was the use of viral metagenomic sequence data for the design of RAPD-PCR primers. This metagenomically informed approach to primer design enabled the optimization of RAPD-PCR sensitivity for examining changes in soil viral communities. Initial application of RAPD-PCR viral fingerprinting to soil viral communities demonstrated that the composition of autochthonous soil viral assemblages noticeably changed over a distance of meters along a transect of Antarctic soils and across soils subjected to different land uses. For Antarctic soils, viral assemblages segregated upslope from the edge of dry valley lakes. In the case of temperate soils at the Kellogg Biological Station, viral communities clustered according to land use treatment. In both environments, soil viral communities changed along with environmental factors known to shape the composition of bacterial host communities. Overall, this work demonstrates that RAPD-PCR fingerprinting is an inexpensive, high-throughput means for addressing first-order questions of viral community dynamics within environmental samples and thus fills a methodological gap between narrow single-gene approaches and comprehensive shotgun metagenomic sequencing for the analysis of viral community diversity. PMID:23793630

  18. Visualization of Surface-tethered Large DNA Molecules with a Fluorescent Protein DNA Binding Peptide.

    PubMed

    Lee, Seonghyun; Jo, Kyubong

    2016-06-23

    Large DNA molecules tethered on the functionalized glass surface have been utilized in polymer physics and biochemistry particularly for investigating interactions between DNA and its binding proteins. Here, we report a method that uses fluorescent microscopy for visualizing large DNA molecules tethered on the surface. First, glass coverslips are biotinylated and passivated by coating with biotinylated polyethylene glycol, which specifically binds biotinylated DNA via avidin protein linkers and significantly reduces undesirable binding from non-specific interactions of proteins or DNA molecules on the surface. Second, the DNA molecules are biotinylated by two different methods depending on their terminals. The blunt ended DNA is tagged with biotinylated dUTP at its 3' hydroxyl terminus, by terminal transferase, while the sticky ended DNA is hybridized with biotinylated complimentary oligonucleotides by DNA ligase. Finally, a microfluidic shear flow makes single DNA molecules stretch to their full contour lengths after being stained with fluorescent protein-DNA binding peptide (FP-DBP).

  19. MCM ring hexamerization is a prerequisite for DNA-binding

    SciTech Connect

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in the hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.

  20. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  1. Engineering large viral DNA genomes using the CRISPR-Cas9 system.

    PubMed

    Suenaga, Tadahiro; Kohyama, Masako; Hirayasu, Kouyuki; Arase, Hisashi

    2014-09-01

    Manipulation of viral genomes is essential for studying viral gene function and utilizing viruses for therapy. Several techniques for viral genome engineering have been developed. Homologous recombination in virus-infected cells has traditionally been used to edit viral genomes; however, the frequency of the expected recombination is quite low. Alternatively, large viral genomes have been edited using a bacterial artificial chromosome (BAC) plasmid system. However, cloning of large viral genomes into BAC plasmids is both laborious and time-consuming. In addition, because it is possible for insertion into the viral genome of drug selection markers or parts of BAC plasmids to affect viral function, artificial genes sometimes need to be removed from edited viruses. Herpes simplex virus (HSV), a common DNA virus with a genome length of 152 kbp, causes labialis, genital herpes and encephalitis. Mutant HSV is a candidate for oncotherapy, in which HSV is used to kill tumor cells. In this study, the clustered regularly interspaced short palindromic repeat-Cas9 system was used to very efficiently engineer HSV without inserting artificial genes into viral genomes. Not only gene-ablated HSV but also gene knock-in HSV were generated using this method. Furthermore, selection with phenotypes of edited genes promotes the isolation efficiencies of expectedly mutated viral clones. Because our method can be applied to other DNA viruses such as Epstein-Barr virus, cytomegaloviruses, vaccinia virus and baculovirus, our system will be useful for studying various types of viruses, including clinical isolates.

  2. DNA topology, not DNA sequence, is a critical determinant for Drosophila ORC–DNA binding

    PubMed Central

    Remus, Dirk; Beall, Eileen L; Botchan, Michael R

    2004-01-01

    Drosophila origin recognition complex (ORC) localizes to defined positions on chromosomes, and in follicle cells the chorion gene amplification loci are well-studied examples. However, the mechanism of specific localization is not known. We have studied the DNA binding of DmORC to investigate the cis-requirements for DmORC:DNA interaction. DmORC displays at best six-fold differences in the relative affinities to DNA from the third chorion locus and to random fragments in vitro, and chemical probing and DNase1 protection experiments did not identify a discrete binding site for DmORC on any of these fragments. The intrinsic DNA-binding specificity of DmORC is therefore insufficient to target DmORC to origins of replication in vivo. However, the topological state of the DNA significantly influences the affinity of DmORC to DNA. We found that the affinity of DmORC for negatively supercoiled DNA is about 30-fold higher than for either relaxed or linear DNA. These data provide biochemical evidence for the notion that origin specification in metazoa likely involves mechanisms other than simple replicator–initiator interactions and that in vivo other proteins must determine ORC's localization. PMID:14765124

  3. Restricted infectivity of ecotropic type C retroviruses in mouse teratocarcinoma cells: studies on viral DNA intermediates

    SciTech Connect

    Yang, W.K.; d'Auriol, L.; Yang, D.M.; Kiggans, J.O. Jr.; Ou, C.; Peries, J.; Emanoil-Ravicovitch, R.

    1980-01-01

    Replication of Gross strain N-tropic type C retrovirus was markedly restricted in a pluripotential undifferentiated embryonal cell line (PCC/sub 4/) of murine teratocarcinoma, whereas the same virus could cause productive infection in a myoblast-derived differentiated line (PCD/sub 1/) of the same tumor origin. To investigate the restriction mechanism, we compared the initial viral DNA formation in these two cell lines. Analyses by means of a modified Hirt extraction procedure and a modified Southern gel transfer method indicated that PCC/sub 4/ and PCD/sub 1/ cells supported the synthesis of viral DNA intermediates after inoculation of the Gross virus. In both cells a linear DNA duplex (form III viral DNA) appeared at 4 h, reached a maximal level at 8 to 9 h, and declined rapidly thereafter, while two closed-circular supercoiled DNA duplexes (form I viral DNA) showed their appearance, increase and decline in the 8 to 24 h period. During the period from 34 to 78 h after virus inoculation, another burst of viral DNA synthesis occurred in PCD/sub 1/ cells, presumably due to secondary virus infection, while at this period both form III and form I viral DNAs became undetectable in PCC/sub 4/ cells. The Hirt supernatant DNAs prepared from PCD/sub 1/ and PCC/sub 4/ cells 10 h after virus inoculation were equally infectious for NIH3T3 cells in a DNA transfection assay. Both PCD/sub 1/ and PCC/sub 4/ cells were very poor recipients for DNA transfection, although one positive result with PCD/sub 1/ cells might suggest a difference between the two cell types in this aspect. These results indicate that restriction of type C retrovirus in undifferentiated embryonal carcinoma cells occurs at a step subsequent to formation and maturation of viral DNA intermediates.

  4. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria

    PubMed Central

    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc

    2015-01-01

    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin. PMID:25916847

  5. A prophage-encoded actin-like protein required for efficient viral DNA replication in bacteria.

    PubMed

    Donovan, Catriona; Heyer, Antonia; Pfeifer, Eugen; Polen, Tino; Wittmann, Anja; Krämer, Reinhard; Frunzke, Julia; Bramkamp, Marc

    2015-05-26

    In host cells, viral replication is localized at specific subcellular sites. Viruses that infect eukaryotic and prokaryotic cells often use host-derived cytoskeletal structures, such as the actin skeleton, for intracellular positioning. Here, we describe that a prophage, CGP3, integrated into the genome of Corynebacterium glutamicum encodes an actin-like protein, AlpC. Biochemical characterization confirms that AlpC is a bona fide actin-like protein and cell biological analysis shows that AlpC forms filamentous structures upon prophage induction. The co-transcribed adaptor protein, AlpA, binds to a consensus sequence in the upstream promoter region of the alpAC operon and also interacts with AlpC, thus connecting circular phage DNA to the actin-like filaments. Transcriptome analysis revealed that alpA and alpC are among the early induced genes upon excision of the CGP3 prophage. Furthermore, qPCR analysis of mutant strains revealed that both AlpA and AlpC are required for efficient phage replication. Altogether, these data emphasize that AlpAC are crucial for the spatio-temporal organization of efficient viral replication. This is remarkably similar to actin-assisted membrane localization of eukaryotic viruses that use the actin cytoskeleton to concentrate virus particles at the egress sites and provides a link of evolutionary conserved interactions between intracellular virus transport and actin. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Barrier to auto integration factor becomes dephosphorylated during HSV-1 Infection and Can Act as a host defense by impairing viral DNA replication and gene expression.

    PubMed

    Jamin, Augusta; Thunuguntla, Prasanth; Wicklund, April; Jones, Clinton; Wiebe, Matthew S

    2014-01-01

    BAF (Barrier to Autointegration Factor) is a highly conserved DNA binding protein that senses poxviral DNA in the cytoplasm and tightly binds to the viral genome to interfere with DNA replication and transcription. To counteract BAF, a poxviral-encoded protein kinase phosphorylates BAF, which renders BAF unable to bind DNA and allows efficient viral replication to occur. Herein, we examined how BAF phosphorylation is affected by herpes simplex virus type 1 (HSV-1) infection and tested the ability of BAF to interfere with HSV-1 productive infection. Interestingly, we found that BAF phosphorylation decreases markedly following HSV-1 infection. To determine whether dephosphorylated BAF impacts HSV-1 productive infection, we employed cell lines stably expressing a constitutively unphosphorylated form of BAF (BAF-MAAAQ) and cells overexpressing wild type (wt) BAF for comparison. Although HSV-1 production in cells overexpressing wtBAF was similar to that in cells expressing no additional BAF, viral growth was reduced approximately 80% in the presence of BAF-MAAAQ. Experiments were also performed to determine the mechanism of the antiviral activity of BAF with the following results. BAF-MAAAQ was localized to the nucleus, whereas wtBAF was dispersed throughout cells prior to infection. Following infection, wtBAF becomes dephosphorylated and relocalized to the nucleus. Additionally, BAF was associated with the HSV-1 genome during infection, with BAF-MAAAQ associated to a greater extent than wtBAF. Importantly, unphosphorylated BAF inhibited both viral DNA replication and gene expression. For example, expression of two regulatory proteins, ICP0 and VP16, were substantially reduced in cells expressing BAF-MAAAQ. However, other viral genes were not dramatically affected suggesting that expression of certain viral genes can be differentially regulated by unphosphorylated BAF. Collectively, these results suggest that BAF can act in a phosphorylation-regulated manner to impair

  7. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA

    SciTech Connect

    Sharma A.; Heroux A.; Jenkins K. R.; Bowman G. D.

    2011-12-09

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves.

  8. A non-invasive method for studying viral DNA delivery to bacteria reveals key requirements for phage SPP1 DNA entry in Bacillus subtilis cells.

    PubMed

    Fernandes, Sofia; Labarde, Audrey; Baptista, Catarina; Jakutytè, Lina; Tavares, Paulo; São-José, Carlos

    2016-08-01

    Bacteriophages use most frequently a tail apparatus to create a channel across the entire bacterial cell envelope to transfer the viral genome to the host cell cytoplasm, initiating infection. Characterization of this critical step remains a major challenge due to the difficulty to monitor DNA entry in the bacterium and its requirements. In this work we developed a new method to study phage DNA entry that has the potential to be extended to many tailed phages. Its application to study genome delivery of bacteriophage SPP1 into Bacillus subtilis disclosed a key role of the host cell membrane potential in the DNA entry process. An energized B. subtilis membrane and a millimolar concentration of calcium ions are shown to be major requirements for SPP1 DNA entry following the irreversible binding of phage particles to the receptor YueB. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Gene expression regulation in retinal pigment epithelial cells induced by viral RNA and viral/bacterial DNA

    PubMed Central

    Brosig, Anton; Kuhrt, Heidrun; Wiedemann, Peter; Kohen, Leon; Bringmann, Andreas

    2015-01-01

    Purpose The pathogenesis of age-related macular degeneration (AMD) is associated with systemic and local inflammation. Various studies suggested that viral or bacterial infection may aggravate retinal inflammation in the aged retina. We compared the effects of synthetic viral RNA (poly(I:C)) and viral/bacterial DNA (CpG-ODN) on the expression of genes known to be involved in the development of AMD in retinal pigment epithelial (RPE) cells. Methods Cultured human RPE cells were stimulated with poly(I:C; 500 µg/ml) or CpG-ODN (500 nM). Alterations in gene expression and protein secretion were determined with real-time RT–PCR and ELISA, respectively. Phosphorylation of signal transduction molecules was revealed by western blotting. Results Poly(I:C) induced gene expression of the pattern recognition receptor TLR3, transcription factors (HIF-1α, p65/NF-κB), the angiogenic factor bFGF, inflammatory factors (IL-1β, IL-6, TNFα, MCP-1, MIP-2), and complement factors (C5, C9, CFB). Poly(I:C) also induced phosphorylation of ERK1/2 and p38 MAPK proteins, and the secretion of bFGF and TNFα from the cells. CpG-ODN induced moderate gene expression of transcription factors (p65/NF-κB, NFAT5) and complement factors (C5, C9), while it had no effect on the expression of various TLR, angiogenic factor, and inflammatory factor genes. The activities of various signal transduction pathways and transcription factors were differentially involved in mediating the poly(I:C)-induced transcriptional activation of distinct genes. Conclusions The widespread effects of viral RNA, and the restricted effects of viral/bacterial DNA, on the gene expression pattern of RPE cells may suggest that viral RNA rather than viral/bacterial DNA induces physiologic alterations of RPE cells, which may aggravate inflammation in the aged retina. The data also suggest that selective inhibition of distinct signal transduction pathways or individual transcription factors may not be effective to inhibit

  10. Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

    SciTech Connect

    Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki; Kim, Woo-Taek; Kim, Ho-Guen; Lee, Sang-Kyou

    2010-01-29

    Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS, and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.

  11. Equilibrium binding of single-stranded DNA to the secondary DNA binding site of the bacterial recombinase RecA.

    PubMed

    Gourves, A S; Defais, M; Johnson, N P

    2001-03-30

    The bacterial recombinase RecA forms a nucleoprotein filament in vitro with single-stranded DNA (ssDNA) at its primary DNA binding site, site I. This filament has a second site, site II, which binds ssDNA and double-stranded DNA. We have investigated the binding of ssDNA to the RecA protein in the presence of adenosine 5'-O-(thiotriphosphate) cofactor using fluorescence anisotropy. The RecA protein carried out DNA strand exchange with a 5'-fluorescein-labeled 32-mer oligonucleotide. The anisotropy signal was shown to measure oligonucleotide binding to RecA, and the relationship between signal and binding density was determined. Binding of ssDNA to site I of RecA was stable at high NaCl concentrations. Binding to site II could be described by a simple two-state equilibrium, K = 4.5 +/- 1.5 x 10(5) m(-1) (37 degrees C, 150 mm NaCl, pH 7.4). The reaction was enthalpy-driven and entropy-opposed. It depended on salt concentration and was sensitive to the type of monovalent anion, suggesting that anion-dependent protein conformations contribute to ssDNA binding at site II.

  12. A graph kernel method for DNA-binding site prediction.

    PubMed

    Yan, Changhui; Wang, Yingfeng

    2014-01-01

    Protein-DNA interactions play important roles in many biological processes. Computational methods that can accurately predict DNA-binding sites on proteins will greatly expedite research on problems involving protein-DNA interactions. This paper presents a method for predicting DNA-binding sites on protein structures. The method represents protein surface patches using labeled graphs and uses a graph kernel method to calculate the similarities between graphs. A new surface patch is predicted to be interface or non-interface patch based on its similarities to known DNA-binding patches and non-DNA-binding patches. The proposed method achieved high accuracy when tested on a representative set of 146 protein-DNA complexes using leave-one-out cross-validation. Then, the method was applied to identify DNA-binding sites on 13 unbound structures of DNA-binding proteins. In each of the unbound structure, the top 1 patch predicted by the proposed method precisely indicated the location of the DNA-binding site. Comparisons with other methods showed that the proposed method was competitive in predicting DNA-binding sites on unbound proteins. The proposed method uses graphs to encode the feature's distribution in the 3-dimensional (3D) space. Thus, compared with other vector-based methods, it has the advantage of taking into account the spatial distribution of features on the proteins. Using an efficient kernel method to compare graphs the proposed method also avoids the demanding computations required for 3D objects comparison. It provides a competitive method for predicting DNA-binding sites without requiring structure alignment.

  13. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Structural Investigation of a Viral Ortholog of Human NEIL2/3 DNA Glycosylases

    PubMed Central

    Prakash, Aishwarya; Eckenroth, Brian E.; Averill, April M.; Imamura, Kayo; Wallace, Susan S.; Doublié, Sylvie

    2013-01-01

    Assault to DNA that leads to oxidative base damage is repaired by the base excision repair (BER) pathway with specialized enzymes called DNA glycosylases catalyzing the first step of this pathway. These glycosylases can be categorized into two families: the HhH superfamily, which includes endonuclease III (or Nth), and the Fpg/Nei family, which comprises formamidopyrimidine DNA glycosylase (or Fpg) and endonuclease VIII (or Nei). In humans there are three Nei-like (NEIL) glycosylases: NEIL1, 2, and 3. Here we present the first crystal structure of a viral ortholog of the human NEIL2/NEIL3 proteins, Mimivirus Nei2 (MvNei2), determined at 2.04 Å resolution. The C-terminal region of the MvNei2 enzyme comprises two conserved DNA binding motifs: the helix-two-turns-helix (H2TH) motif and a C-H-C-C type zinc-finger similar to that of human NEIL2. The N-terminal region of MvNei2 is most closely related to NEIL3. Like NEIL3, MvNei2 bears a valine at position 2 instead of the usual proline and it lacks two of the three conserved void-filling residues present in other members of the Fpg/Nei family. Mutational analysis of the only conserved void-filling residue methionine 72 to alanine yields an MvNei2 variant with impaired glycosylase activity. Mutation of the adjacent His73 causes the enzyme to be more productive thereby suggesting a plausible role for this residue in the DNA lesion search process. PMID:24120312

  15. Damage-specific DNA-binding proteins from human cells

    SciTech Connect

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1% NP-40.

  16. Modulation of DNA binding by gene-specific transcription factors.

    PubMed

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  17. Structures of DNA-binding mutant zinc finger domains: implications for DNA binding.

    PubMed Central

    Hoffman, R. C.; Horvath, S. J.; Klevit, R. E.

    1993-01-01

    Studies of Cys2-His2 zinc finger domains have revealed that the structures of individual finger domains in solution determined by NMR spectroscopy are strikingly similar to the structure of fingers bound to DNA determined by X-ray diffraction. Therefore, detailed structural analyses of single finger domains that contain amino acid substitutions known to affect DNA binding in the whole protein can yield information concerning the structural ramifications of such mutations. We have used this approach to study two mutants in the N-terminal finger domain of ADR1, a yeast transcription factor that contains two Cys2-His2 zinc finger sequences spanning residues 102-159. Two point mutants at position 118 in the N-terminal zinc finger (ADR1b: 102-130) that adversely affect the DNA-binding activity of ADR1 have previously been identified: H118A and H118Y. The structures of wild-type ADR1b and the two mutant zinc finger domains were determined using two-dimensional nuclear magnetic resonance spectroscopy and distance geometry and were refined using a complete relaxation matrix method approach (REPENT) to improve agreement between the models and the nuclear Overhauser effect spectroscopy data from which they were generated. The molecular architecture of the refined wild-type ADR1b domain is presented in detail. Comparisons of wild-type ADR1b and the two mutants revealed that neither mutation causes a significant structural perturbation. The structures indicate that the DNA binding properties of the His 118 mutants are dependent on the identity of the side chain at position 118, which has been postulated to make a direct DNA contact in the wild-type ADR1 protein. The results suggest that the identity of the side chain at the middle DNA contact position in Cys2-His2 zinc fingers may be changed with impunity regarding the domain structure and can affect the affinity of the protein-DNA interaction. PMID:8318900

  18. Human Cytomegalovirus Can Procure Deoxyribonucleotides for Viral DNA Replication in the Absence of Retinoblastoma Protein Phosphorylation

    PubMed Central

    Kuny, Chad V.

    2016-01-01

    ABSTRACT Viral DNA replication requires deoxyribonucleotide triphosphates (dNTPs). These molecules, which are found at low levels in noncycling cells, are generated either by salvage pathways or through de novo synthesis. Nucleotide synthesis utilizes the activity of a series of nucleotide-biosynthetic enzymes (NBEs) whose expression is repressed in noncycling cells by complexes between the E2F transcription factors and the retinoblastoma (Rb) tumor suppressor. Rb-E2F complexes are dissociated and NBE expression is activated during cell cycle transit by cyclin-dependent kinase (Cdk)-mediated Rb phosphorylation. The DNA virus human cytomegalovirus (HCMV) encodes a viral Cdk (v-Cdk) (the UL97 protein) that phosphorylates Rb, induces the expression of cellular NBEs, and is required for efficient viral DNA synthesis. A long-held hypothesis proposed that viral proteins with Rb-inactivating activities functionally similar to those of UL97 facilitated viral DNA replication in part by inducing the de novo production of dNTPs. However, we found that dNTPs were limiting even in cells infected with wild-type HCMV in which UL97 is expressed and Rb is phosphorylated. Furthermore, we revealed that both de novo and salvage pathway enzymes contribute to viral DNA replication during HCMV infection and that Rb phosphorylation by cellular Cdks does not correct the viral DNA replication defect observed in cells infected with a UL97-deficient virus. We conclude that HCMV can obtain dNTPs in the absence of Rb phosphorylation and that UL97 can contribute to the efficiency of DNA replication in an Rb phosphorylation-independent manner. IMPORTANCE Transforming viral oncoproteins, such as adenovirus E1A and papillomavirus E7, inactivate Rb. The standard hypothesis for how Rb inactivation facilitates infection with these viruses is that it is through an increase in the enzymes required for DNA synthesis, which include nucleotide-biosynthetic enzymes. However, HCMV UL97, which functionally

  19. A role for dNTP binding of human immunodeficiency virus type 1 reverse transcriptase in viral mutagenesis.

    PubMed

    Weiss, Kellie K; Chen, Renxiang; Skasko, Mark; Reynolds, Holly M; Lee, Kwi; Bambara, Robert A; Mansky, Louis M; Kim, Baek

    2004-04-20

    HIV-1 reverse transcriptase (RT) is a highly error prone DNA polymerase. We assessed whether the ability of RT to bind nucleotide substrates affects viral mutagenesis. Structural modeling predicts that the V148 and Q151 residues influence the interaction between RT and the incoming dNTP. When we introduce either a V148I or Q151N mutation, RT fidelity increases 8.7- or 13-fold, respectively, as measured by the M13 lacZalpha forward mutation assay. Interestingly, pre-steady state kinetic studies demonstrated that these mutations do not alter polymerase fidelity during the first step of mutation synthesis, misincorporation. Rather, the V148I and Q151N mutations alter RT fidelity by weakening the ability of the polymerase to complete mismatch extension, the second step of mutation synthesis. While both these mutations minimally affect the binding of RT (K(D)) to a mismatched template-primer complex (T/P), these mutant RTs are significantly impaired in their ability to bind (K(d)) and chemically incorporate (k(pol)) nucleotide substrate onto a mismatched T/P. These differences in binding and catalysis translate into 24- and 15.9-fold increase in mismatch extension fidelity for the V148I and Q151N RT mutants, respectively. Finally, we employed a cell-based pseudotyped HIV-1 mutation assay to determine whether changes in these dNTP binding residues alter RT fidelity in vivo. We found that the V148I and Q151N mutant viruses had 3.8- and 5.7-fold higher fidelities than wild-type viruses, respectively, indicating that the molecular interaction between HIV-1 RT and the dNTP substrate contributes to viral mutagenesis.

  20. Nuclear Sensing of Viral DNA, Epigenetic Regulation of Herpes Simplex Virus Infection, and Innate Immunity

    PubMed Central

    Knipe, David M.

    2015-01-01

    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. Herpes viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. PMID:25742715

  1. A plant viral coat protein RNA binding consensus sequence contains a crucial arginine.

    PubMed Central

    Ansel-McKinney, P; Scott, S W; Swanson, M; Ge, X; Gehrke, L

    1996-01-01

    A defining feature of alfalfa mosaic virus (AMV) and ilarviruses [type virus: tobacco streak virus (TSV)] is that, in addition to genomic RNAs, viral coat protein is required to establish infection in plants. AMV and TSV coat proteins, which share little primary amino acid sequence identity, are functionally interchangeable in RNA binding and initiation of infection. The lysine-rich amino-terminal RNA binding domain of the AMV coat protein lacks previously identified RNA binding motifs. Here, the AMV coat protein RNA binding domain is shown to contain a single arginine whose specific side chain and position are crucial for RNA binding. In addition, the putative RNA binding domain of two ilarvirus coat proteins, TSV and citrus variegation virus, is identified and also shown to contain a crucial arginine. AMV and ilarvirus coat protein sequence alignment centering on the key arginine revealed a new RNA binding consensus sequence. This consensus may explain in part why heterologous viral RNA-coat protein mixtures are infectious. Images PMID:8890181

  2. Binding of globular proteins to DNA from surface tension measurement.

    PubMed

    Mitra, A; Chattoraj, D K; Chakraborty, P

    2001-10-01

    Extent of binding (gammap) of globular proteins to calf-thymus DNA have been measured in mole per mole of nucleotide as function of equilibrium protein concentration. We have exploited measurement of the surface tension of the protein solution in the presence and absence of DNA to calculate the binding ration (gammap). Interaction of bovine serum albumin with DNA has been studied at different pH. Interaction of bovine serum albumin with DNA has been studied at different pH, ionic strength and in presence of Ca2+. Interaction of BSA with denatured DNA has also been investigated. Binding isotherms for other globular proteins like beta-lactoglobulin, alpha-lactalbumin and lysozyme have been compared under identical physicochemical condition. It has been noted with considerable interest that globular form of protein is important to some extent in protein-DNA interaction. An attempt has been made to explain the significance of difference in binding ratios of these two biopolymers in aqueous medium for different systems in the light of electrostatic and hydrophobic effects. Values of maximum binding ration (gammap(m)) at saturated level for different systems have been also presented. The Gibb's free energy decrease (-deltaG0) of the binding of proteins to DNA has been compared more precisely for the saturation of binding sites in the DNA with the change of activity of protein in solution from zero to unity in the rational mole fraction scale.

  3. A protein ballet around the viral genome orchestrated by HIV-1 reverse transcriptase leads to an architectural switch: from nucleocapsid-condensed RNA to Vpr-bridged DNA.

    PubMed

    Lyonnais, Sébastien; Gorelick, Robert J; Heniche-Boukhalfa, Fatima; Bouaziz, Serge; Parissi, Vincent; Mouscadet, Jean-François; Restle, Tobias; Gatell, Jose Maria; Le Cam, Eric; Mirambeau, Gilles

    2013-02-01

    HIV-1 reverse transcription is achieved in the newly infected cell before viral DNA (vDNA) nuclear import. Reverse transcriptase (RT) has previously been shown to function as a molecular motor, dismantling the nucleocapsid complex that binds the viral genome as soon as plus-strand DNA synthesis initiates. We first propose a detailed model of this dismantling in close relationship with the sequential conversion from RNA to double-stranded (ds) DNA, focusing on the nucleocapsid protein (NCp7). The HIV-1 DNA-containing pre-integration complex (PIC) resulting from completion of reverse transcription is translocated through the nuclear pore. The PIC nucleoprotein architecture is poorly understood but contains at least two HIV-1 proteins initially from the virion core, namely integrase (IN) and the viral protein r (Vpr). We next present a set of electron micrographs supporting that Vpr behaves as a DNA architectural protein, initiating multiple DNA bridges over more than 500 base pairs (bp). These complexes are shown to interact with NCp7 bound to single-stranded nucleic acid regions that are thought to maintain IN binding during dsDNA synthesis, concurrently with nucleocapsid complex dismantling. This unexpected binding of Vpr conveniently leads to a compacted but filamentous folding of the vDNA that should favor its nuclear import. Finally, nucleocapsid-like aggregates engaged in dsDNA synthesis appear to efficiently bind to F-actin filaments, a property that may be involved in targeting complexes to the nuclear envelope. More generally, this article highlights unique possibilities offered by in vitro reconstitution approaches combined with macromolecular imaging to gain insights into the mechanisms that alter the nucleoprotein architecture of the HIV-1 genome, ultimately enabling its insertion into the nuclear chromatin.

  4. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    PubMed

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH2 groups (CONH2-SWNT) exhibited very strong interactions between the CONH2-SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  5. The quinobenzoxazines: relationship between DNA binding and biological activity.

    PubMed

    Kwok, Y; Sun, D; Clement, J J; Hurley, L H

    1999-10-01

    The quinobenzoxazine compounds, derived from antibacterial quinolones, is active in vitro and in vivo against murine and human tumors. In this contribution, we show that the relative DNA binding affinity of the quinobenzoxazine compounds correlates with their cytotoxicity, their ability to inhibit gyrase-DNA complex formation, and the decatenation of kinetoplast DNA by human topoisomerase II. DNA binding studies with the descarboxy-A-62176 analogue indicate that the beta-keto acid moiety of the quinobenzoxazine compounds plays an important role in their interaction with DNA.

  6. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    SciTech Connect

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan; Lynn, Annie; Cotmore, Susan F.; Tattersall, Peter; Zhao, Haiyan; Tang, Liang

    2015-02-15

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase active site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.

  7. Probing the binding mode of psoralen to calf thymus DNA.

    PubMed

    Zhou, Xiaoyue; Zhang, Guowen; Wang, Langhong

    2014-06-01

    The binding properties between psoralen (PSO) and calf thymus DNA (ctDNA) were predicted by molecular docking, and then determined with the use of UV-vis absorption, fluorescence, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy, coupled with DNA melting and viscosity measurements. The data matrix obtained from UV-vis spectra was resolved by multivariate curve resolution-alternating least squares (MCR-ALS) approach. The pure spectra and the equilibrium concentration profiles for PSO, ctDNA and PSO-ctDNA complex extracted from the highly overlapping composite response were obtained simultaneously to evaluate the PSO-ctDNA interaction. The intercalation mode of PSO binding to ctDNA was supported by the results from the melting studies, viscosity measurements, iodide quenching and fluorescence polarization experiments, competitive binding investigations and CD analysis. The molecular docking prediction showed that the specific binding most likely occurred between PSO and adenine bases of ctDNA. FT-IR spectra studies further confirmed that PSO preferentially bound to adenine bases, and this binding decreased right-handed helicity of ctDNA and enhanced the degree of base stacking with the preservation of native B-conformation. The calculated thermodynamic parameters indicated that hydrogen bonds and van der Waals forces played a major role in the binding process.

  8. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    SciTech Connect

    Kennedy, Edward M.; Cullen, Bryan R.

    2015-05-15

    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  9. Variola type IB DNA topoisomerase: DNA binding and supercoil unwinding using engineered DNA minicircles.

    PubMed

    Anderson, Breeana G; Stivers, James T

    2014-07-08

    Type IB topoisomerases unwind positive and negative DNA supercoils and play a key role in removing supercoils that would otherwise accumulate at replication and transcription forks. An interesting question is whether topoisomerase activity is regulated by the topological state of the DNA, thereby providing a mechanism for targeting the enzyme to highly supercoiled DNA domains in genomes. The type IB enzyme from variola virus (vTopo) has proven to be useful in addressing mechanistic questions about topoisomerase function because it forms a reversible 3'-phosphotyrosyl adduct with the DNA backbone at a specific target sequence (5'-CCCTT-3') from which DNA unwinding can proceed. We have synthesized supercoiled DNA minicircles (MCs) containing a single vTopo target site that provides highly defined substrates for exploring the effects of supercoil density on DNA binding, strand cleavage and ligation, and unwinding. We observed no topological dependence for binding of vTopo to these supercoiled MC DNAs, indicating that affinity-based targeting to supercoiled DNA regions by vTopo is unlikely. Similarly, the cleavage and religation rates of the MCs were not topologically dependent, but topoisomers with low superhelical densities were found to unwind more slowly than highly supercoiled topoisomers, suggesting that reduced torque at low superhelical densities leads to an increased number of cycles of cleavage and ligation before a successful unwinding event. The K271E charge reversal mutant has an impaired interaction with the rotating DNA segment that leads to an increase in the number of supercoils that were unwound per cleavage event. This result provides evidence that interactions of the enzyme with the rotating DNA segment can restrict the number of supercoils that are unwound. We infer that both superhelical density and transient contacts between vTopo and the rotating DNA determine the efficiency of supercoil unwinding. Such determinants are likely to be important in

  10. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

    PubMed

    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

    2009-01-01

    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  11. A DNA-binding protein from Ustilago maydis prefers duplex DNA without chain interruptions.

    PubMed Central

    Rusche, J R; Holloman, W K

    1983-01-01

    Using a nitrocellulose filter binding assay, we have partially purified a protein from mitotic cells of Ustilago maydis that binds preferentially to covalently closed circular duplex DNA. DNA containing single- or double-strand breaks is bound poorly by the protein. Once formed, the DNA-protein complex is stable, resisting dissociation in high salt. However, when a DNA strand is broken, the complex appears to dissociate. The protein binds equally well to form I DNA of phi X174 or the plasmid pBR322, but has a higher affinity for a hybrid plasmid containing a cloned region of Drosophila melanogaster satellite DNA. Images PMID:6304499

  12. Characterization of a DNA binding protein of bacteriophage PRD1 involved in DNA replication.

    PubMed Central

    Pakula, T M; Caldentey, J; Serrano, M; Gutierrez, C; Hermoso, J M; Salas, M; Bamford, D H

    1990-01-01

    Escherichia coli phage PRD1 protein P12, involved in PRD1 DNA replication in vivo, has been highly purified from E. coli cells harbouring a gene XII-containing plasmid. Protein P12 binds to single-stranded DNA as shown by gel retardation assays and nuclease protection experiments. Binding of protein P12 to single-stranded DNA increases about 14% the contour length of the DNA as revealed by electron microscopy. Binding to single-stranded DNA seems to be cooperative, and it is not sequence specific. Protein P12 also binds to double-stranded DNA although with an affinity 10 times lower than to single-stranded DNA. Using the in vitro phage phi 29 DNA replication system, it is shown that protein P12 stimulates the overall phi 29 DNA replication. Images PMID:2251117

  13. Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

    SciTech Connect

    Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; Williams, Jessica S.; Nguyen, Yvonne; Robertson, Patrick D.; Resnick, Michael A.; Williams, R. Scott

    2015-01-12

    Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficient DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.

  14. Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

    DOE PAGES

    Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; ...

    2015-01-12

    Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficientmore » DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.« less

  15. RNA recognition by the DNA end-binding Ku heterodimer

    PubMed Central

    Dalby, Andrew B.; Goodrich, Karen J.; Pfingsten, Jennifer S.; Cech, Thomas R.

    2013-01-01

    Most nucleic acid-binding proteins selectively bind either DNA or RNA, but not both nucleic acids. The Saccharomyces cerevisiae Ku heterodimer is unusual in that it has two very different biologically relevant binding modes: (1) Ku is a sequence-nonspecific double-stranded DNA end-binding protein with prominent roles in nonhomologous end-joining and telomeric capping, and (2) Ku associates with a specific stem–loop of TLC1, the RNA subunit of budding yeast telomerase, and is necessary for proper nuclear localization of this ribonucleoprotein enzyme. TLC1 RNA-binding and dsDNA-binding are mutually exclusive, so they may be mediated by the same site on Ku. Although dsDNA binding by Ku is well studied, much less is known about what features of an RNA hairpin enable specific recognition by Ku. To address this question, we localized the Ku-binding site of the TLC1 hairpin with single-nucleotide resolution using phosphorothioate footprinting, used chemical modification to identify an unpredicted motif within the hairpin secondary structure, and carried out mutagenesis of the stem–loop to ascertain the critical elements within the RNA that permit Ku binding. Finally, we provide evidence that the Ku-binding site is present in additional budding yeast telomerase RNAs and discuss the possibility that RNA binding is a conserved function of the Ku heterodimer. PMID:23610127

  16. RNA recognition by the DNA end-binding Ku heterodimer.

    PubMed

    Dalby, Andrew B; Goodrich, Karen J; Pfingsten, Jennifer S; Cech, Thomas R

    2013-06-01

    Most nucleic acid-binding proteins selectively bind either DNA or RNA, but not both nucleic acids. The Saccharomyces cerevisiae Ku heterodimer is unusual in that it has two very different biologically relevant binding modes: (1) Ku is a sequence-nonspecific double-stranded DNA end-binding protein with prominent roles in nonhomologous end-joining and telomeric capping, and (2) Ku associates with a specific stem-loop of TLC1, the RNA subunit of budding yeast telomerase, and is necessary for proper nuclear localization of this ribonucleoprotein enzyme. TLC1 RNA-binding and dsDNA-binding are mutually exclusive, so they may be mediated by the same site on Ku. Although dsDNA binding by Ku is well studied, much less is known about what features of an RNA hairpin enable specific recognition by Ku. To address this question, we localized the Ku-binding site of the TLC1 hairpin with single-nucleotide resolution using phosphorothioate footprinting, used chemical modification to identify an unpredicted motif within the hairpin secondary structure, and carried out mutagenesis of the stem-loop to ascertain the critical elements within the RNA that permit Ku binding. Finally, we provide evidence that the Ku-binding site is present in additional budding yeast telomerase RNAs and discuss the possibility that RNA binding is a conserved function of the Ku heterodimer.

  17. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  18. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    SciTech Connect

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; Chattopadhyay, Debasish

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This also represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.

  19. Differential activities of cellular and viral macro domain proteins in binding of ADP-ribose metabolites.

    PubMed

    Neuvonen, Maarit; Ahola, Tero

    2009-01-09

    Macro domain is a highly conserved protein domain found in both eukaryotes and prokaryotes. Macro domains are also encoded by a set of positive-strand RNA viruses that replicate in the cytoplasm of animal cells, including coronaviruses and alphaviruses. The functions of the macro domain are poorly understood, but it has been suggested to be an ADP-ribose-binding module. We have here characterized three novel human macro domain proteins that were found to reside either in the cytoplasm and nucleus [macro domain protein 2 (MDO2) and ganglioside-induced differentiation-associated protein 2] or in mitochondria [macro domain protein 1 (MDO1)], and compared them with viral macro domains from Semliki Forest virus, hepatitis E virus, and severe acute respiratory syndrome coronavirus, and with a yeast macro protein, Poa1p. MDO2 specifically bound monomeric ADP-ribose with a high affinity (K(d)=0.15 microM), but did not bind poly(ADP-ribose) efficiently. MDO2 also hydrolyzed ADP-ribose-1'' phosphate, resembling Poa1p in all these properties. Ganglioside-induced differentiation-associated protein 2 did not show affinity for ADP-ribose or its derivatives, but instead bound poly(A). MDO1 was generally active in these reactions, including poly(A) binding. Individual point mutations in MDO1 abolished monomeric ADP-ribose binding, but not poly(ADP-ribose) binding; in poly(ADP-ribose) binding assays, the monomer did not compete against polymer binding. The viral macro proteins bound poly(ADP-ribose) and poly(A), but had a low affinity for monomeric ADP-ribose. Thus, the viral proteins do not closely resemble any of the human proteins in their biochemical functions. The differential activity profiles of the human proteins implicate them in different cellular pathways, some of which may involve RNA rather than ADP-ribose derivatives.

  20. Development of Potent Antiviral Drugs Inspired by Viral Hexameric DNA-Packaging Motors with Revolving Mechanism.

    PubMed

    Pi, Fengmei; Zhao, Zhengyi; Chelikani, Venkata; Yoder, Kristine; Kvaratskhelia, Mamuka; Guo, Peixuan

    2016-09-15

    The intracellular parasitic nature of viruses and the emergence of antiviral drug resistance necessitate the development of new potent antiviral drugs. Recently, a method for developing potent inhibitory drugs by targeting biological machines with high stoichiometry and a sequential-action mechanism was described. Inspired by this finding, we reviewed the development of antiviral drugs targeting viral DNA-packaging motors. Inhibiting multisubunit targets with sequential actions resembles breaking one bulb in a series of Christmas lights, which turns off the entire string. Indeed, studies on viral DNA packaging might lead to the development of new antiviral drugs. Recent elucidation of the mechanism of the viral double-stranded DNA (dsDNA)-packaging motor with sequential one-way revolving motion will promote the development of potent antiviral drugs with high specificity and efficiency. Traditionally, biomotors have been classified into two categories: linear and rotation motors. Recently discovered was a third type of biomotor, including the viral DNA-packaging motor, beside the bacterial DNA translocases, that uses a revolving mechanism without rotation. By analogy, rotation resembles the Earth's rotation on its own axis, while revolving resembles the Earth's revolving around the Sun (see animations at http://rnanano.osu.edu/movie.html). Herein, we review the structures of viral dsDNA-packaging motors, the stoichiometries of motor components, and the motion mechanisms of the motors. All viral dsDNA-packaging motors, including those of dsDNA/dsRNA bacteriophages, adenoviruses, poxviruses, herpesviruses, mimiviruses, megaviruses, pandoraviruses, and pithoviruses, contain a high-stoichiometry machine composed of multiple components that work cooperatively and sequentially. Thus, it is an ideal target for potent drug development based on the power function of the stoichiometries of target complexes that work sequentially. Copyright © 2016, American Society for

  1. Development of Potent Antiviral Drugs Inspired by Viral Hexameric DNA-Packaging Motors with Revolving Mechanism

    PubMed Central

    Pi, Fengmei; Zhao, Zhengyi; Chelikani, Venkata; Yoder, Kristine; Kvaratskhelia, Mamuka

    2016-01-01

    The intracellular parasitic nature of viruses and the emergence of antiviral drug resistance necessitate the development of new potent antiviral drugs. Recently, a method for developing potent inhibitory drugs by targeting biological machines with high stoichiometry and a sequential-action mechanism was described. Inspired by this finding, we reviewed the development of antiviral drugs targeting viral DNA-packaging motors. Inhibiting multisubunit targets with sequential actions resembles breaking one bulb in a series of Christmas lights, which turns off the entire string. Indeed, studies on viral DNA packaging might lead to the development of new antiviral drugs. Recent elucidation of the mechanism of the viral double-stranded DNA (dsDNA)-packaging motor with sequential one-way revolving motion will promote the development of potent antiviral drugs with high specificity and efficiency. Traditionally, biomotors have been classified into two categories: linear and rotation motors. Recently discovered was a third type of biomotor, including the viral DNA-packaging motor, beside the bacterial DNA translocases, that uses a revolving mechanism without rotation. By analogy, rotation resembles the Earth's rotation on its own axis, while revolving resembles the Earth's revolving around the Sun (see animations at http://rnanano.osu.edu/movie.html). Herein, we review the structures of viral dsDNA-packaging motors, the stoichiometries of motor components, and the motion mechanisms of the motors. All viral dsDNA-packaging motors, including those of dsDNA/dsRNA bacteriophages, adenoviruses, poxviruses, herpesviruses, mimiviruses, megaviruses, pandoraviruses, and pithoviruses, contain a high-stoichiometry machine composed of multiple components that work cooperatively and sequentially. Thus, it is an ideal target for potent drug development based on the power function of the stoichiometries of target complexes that work sequentially. PMID:27356896

  2. The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA.

    PubMed Central

    Giraldo, R; Rhodes, D

    1994-01-01

    The protein RAP1 is essential for the maintenance of the telomeres of Saccharomyces cerevisiae and binds in vitro to multiple sites found within the TG1-3 telomeric repeats. We show here that, in addition to its known binding activity for double-stranded DNA, RAP1 binds sequence-specifically to the GT-strands. This indicates that RAP1 is the protein that binds to the telomeric terminal GT-tails. Furthermore, we have found that RAP1 binds to and promotes the formation of G-tetrads, i.e. DNA quadruplexes, in GT-strand oligonucleotides at nanomolar concentrations. The formation of DNA quadruplexes appears to involve the intermolecular association of GT-strands. The minimal DNA-binding domain of RAP1 (DBD) binds only to double-stranded DNA, so that the novel DNA-binding activity we have found involves regions of the protein located outside of the DBD. The finding that a telomeric protein promotes the formation of G-tetrads argues for the use of DNA quadruplexes in telomere association. Images PMID:8194531

  3. A viral packaging motor varies its DNA rotation and step size to preserve subunit coordination as the capsid fills.

    PubMed

    Liu, Shixin; Chistol, Gheorghe; Hetherington, Craig L; Tafoya, Sara; Aathavan, K; Schnitzbauer, Joerg; Grimes, Shelley; Jardine, Paul J; Bustamante, Carlos

    2014-04-24

    Multimeric, ring-shaped molecular motors rely on the coordinated action of their subunits to perform crucial biological functions. During these tasks, motors often change their operation in response to regulatory signals. Here, we investigate a viral packaging machine as it fills the capsid with DNA and encounters increasing internal pressure. We find that the motor rotates the DNA during packaging and that the rotation per base pair increases with filling. This change accompanies a reduction in the motor's step size. We propose that these adjustments preserve motor coordination by allowing one subunit to make periodic, specific, and regulatory contacts with the DNA. At high filling, we also observe the downregulation of the ATP-binding rate and the emergence of long-lived pauses, suggesting a throttling-down mechanism employed by the motor near the completion of packaging. This study illustrates how a biological motor adjusts its operation in response to changing conditions, while remaining highly coordinated.

  4. TAL Effector DNA-Binding Principles and Specificity.

    PubMed

    Richter, Annekatrin; Streubel, Jana; Boch, Jens

    2016-01-01

    Transcription activator-like effectors (TALEs) are proteins with a unique DNA-binding domain that confers both a predictable and programmable specificity. The DNA-binding domain consists typically of 34-amino acid near-identical repeats. The repeats form a right-handed superhelical structure that wraps around the DNA double helix and exposes the variable amino acids at position 13 of each repeat to the sense strand DNA bases. Each repeat binds one base in a highly specific, non-overlapping, and comma-free fashion. Although TALE specificities are encoded in a simple way, sophisticated rules can be taken into account to build highly efficient DNA-binding modules for biotechnological use.

  5. Extended HSR/CARD domain mediates AIRE binding to DNA

    SciTech Connect

    Maslovskaja, Julia Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-12-25

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  6. CRISPR-Cas systems exploit viral DNA injection to establish and maintain adaptive immunity.

    PubMed

    Modell, Joshua W; Jiang, Wenyan; Marraffini, Luciano A

    2017-04-06

    Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems provide protection against viral and plasmid infection by capturing short DNA sequences from these invaders and integrating them into the CRISPR locus of the prokaryotic host. These sequences, known as spacers, are transcribed into short CRISPR RNA guides that specify the cleavage site of Cas nucleases in the genome of the invader. It is not known when spacer sequences are acquired during viral infection. Here, to investigate this, we tracked spacer acquisition in Staphylococcus aureus cells harbouring a type II CRISPR-Cas9 system after infection with the staphylococcal bacteriophage ϕ12. We found that new spacers were acquired immediately after infection preferentially from the cos site, the viral free DNA end that is first injected into the cell. Analysis of spacer acquisition after infection with mutant phages demonstrated that most spacers are acquired during DNA injection, but not during other stages of the viral cycle that produce free DNA ends, such as DNA replication or packaging. Finally, we showed that spacers acquired from early-injected genomic regions, which direct Cas9 cleavage of the viral DNA immediately after infection, provide better immunity than spacers acquired from late-injected regions. Our results reveal that CRISPR-Cas systems exploit the phage life cycle to generate a pattern of spacer acquisition that ensures a successful CRISPR immune response.

  7. Nuclear sensing of viral DNA, epigenetic regulation of herpes simplex virus infection, and innate immunity

    SciTech Connect

    Knipe, David M.

    2015-05-15

    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. HSV viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. - Highlights: • HSV lytic and latent gene expression is regulated differentially by epigenetic processes. • The sensors of foreign DNA have not been defined fully. • IFI16 and cGAS cooperate to sense viral DNA in HSV-infected cells. • IFI16 plays a role in both innate sensing of HSV DNA and in restricting its expression.

  8. Binding specificity of a monoclonal anti-DNA antibody.

    PubMed

    Pisetsky, D S; Caster, S A

    1982-05-01

    To investigate the interaction of DNA and anti-DNA antibodies in the immune complex disease of systemic lupus erythematosus, the fine specificity of binding of a monoclonal anti-DNA antibody was determined. This antibody, termed Cll, was derived from the fusion of spleen cells from an autoimmune MRL-lpr/lpr mouse with the myeloma cell line M45. In a solid-phase ELISA assay to measure anti-DNA activity, Cll showed preference for single stranded compared to double stranded DNA of animal origin. The Cll antibody also bound some deoxyribohomopolymers as well as ribohomopolymers, but failed to bind synthetic DNA duplexes. Defined size oligonucleotides with a size range of 2-(12-18) failed to inhibit the binding of Cll to single stranded DNA. This pattern of binding is consistent with the recognition of a unique structural determinant that can be represented by a variety of nucleic acids. The absence of antigenic activity among the oligonucleotides suggests that an extended polynucleotide structure is required for antibody binding, possibly because of a bivalent or 'monogamous' mode of interaction. The binding properties of Cll further suggest that its ability to participate in immune complex formation may be limited by the nature of the available DNA antigen.

  9. Quantitative analysis of the binding of simian virus 40 large T antigen to DNA.

    PubMed

    Fradet-Turcotte, Amélie; Vincent, Caroline; Joubert, Simon; Bullock, Peter A; Archambault, Jacques

    2007-09-01

    SV40 large T antigen (T-ag) is a multifunctional protein that successively binds to 5'-GAGGC-3' sequences in the viral origin of replication, melts the origin, unwinds DNA ahead of the replication fork, and interacts with host DNA replication factors to promote replication of the simian virus 40 genome. The transition of T-ag from a sequence-specific binding protein to a nonspecific helicase involves its assembly into a double hexamer whose formation is likely dictated by the propensity of T-ag to oligomerize and its relative affinities for the origin as well as for nonspecific double- and single-stranded DNA. In this study, we used a sensitive assay based on fluorescence anisotropy to measure the affinities of wild-type and mutant forms of the T-ag origin-binding domain (OBD), and of a larger fragment containing the N-terminal domain (N260), for different DNA substrates. We report that the N-terminal domain does not contribute to binding affinity but reduces the propensity of the OBD to self-associate. We found that the OBD binds with different affinities to its four sites in the origin and determined a consensus binding site by systematic mutagenesis of the 5'-GAGGC-3' sequence and of the residue downstream of it, which also contributes to affinity. Interestingly, the OBD also binds to single-stranded DNA with an approximately 10-fold higher affinity than to nonspecific duplex DNA and in a mutually exclusive manner. Finally, we provide evidence that the sequence specificity of full-length T-ag is lower than that of the OBD. These results provide a quantitative basis onto which to anchor our understanding of the interaction of T-ag with the origin and its assembly into a double hexamer.

  10. Crystal structure of the adenovirus DNA binding protein reveals a hook-on model for cooperative DNA binding.

    PubMed Central

    Tucker, P A; Tsernoglou, D; Tucker, A D; Coenjaerts, F E; Leenders, H; van der Vliet, P C

    1994-01-01

    The adenovirus single-stranded DNA binding protein (Ad DBP) is a multifunctional protein required, amongst other things, for DNA replication and transcription control. It binds to single- and double-stranded DNA, as well as to RNA, in a sequence-independent manner. Like other single-stranded DNA binding proteins, it binds ssDNA, cooperatively. We report the crystal structure, at 2.6 A resolution, of the nucleic acid binding domain. This domain is active in DNA replication. The protein contains two zinc atoms in different, novel coordinations. The zinc atoms appear to be required for the stability of the protein fold rather than being involved in direct contacts with the DNA. The crystal structure shows that the protein contains a 17 amino acid C-terminal extension which hooks onto a second molecule, thereby forming a protein chain. Deletion of this C-terminal arm reduces cooperativity in DNA binding, suggesting a hook-on model for cooperativity. Based on this structural work and mutant studies, we propose that DBP forms a protein core around which the single-stranded DNA winds. Images PMID:8039495

  11. DNA-binding small molecules as inhibitors of transcription factors.

    PubMed

    Leung, Chung-Hang; Chan, Daniel Shiu-Hin; Ma, Victor Pui-Yan; Ma, Dik-Lung

    2013-07-01

    Accumulating evidence implicating the role of aberrant transcription factor signaling in the pathogenesis of various human diseases such as cancer and inflammation has stimulated the development of small molecule ligands capable of targeting transcription factor activity and modulating gene expression. The use of DNA-binding small molecules to selectively inhibit transcription factor-DNA interactions represents one possible approach toward this goal. In this review, we summarize the development of DNA-binding small molecule inhibitors of transcription factors from 2004 to 2011, and their binding mode and therapeutic potential will be discussed. © 2012 Wiley Periodicals, Inc.

  12. DNA-Based Nanostructures: Changes of Mechanical Properties of DNA upon Ligand Binding

    NASA Astrophysics Data System (ADS)

    Nechipurenko, Yury; Grokhovsky, Sergey; Gursky, Georgy; Nechipurenko, Dmitry; Polozov, Robert

    The formation of DNA-based nanostructures involves the binding of different kinds of ligands to DNA as well as the interaction of DNA molecules with each other. Complex formation between ligand and DNA can alter physicochemical properties of the DNA molecule. In the present work, the accessibility of DNA-ligand complexes to cleavage by DNase I are considered, and the exact algorithms for analysis of diagrams of DNase I footprinting for ligand-DNA complexes are obtained. Changes of mechanical properties of the DNA upon ligand binding are also demonstrated by the cleavage patterns generated upon ultrasound irradiation of cis-platin-DNA complexes. Propagation of the mechanical perturbations along DNA in the presence of bound ligands is considered in terms of a string model with a heterogeneity corresponding to the position of a bound ligand on DNA. This model can reproduce qualitatively the cleavage patterns obtained upon ultrasound irradiation of cis-platin-DNA complexes.

  13. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    PubMed

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes

    PubMed Central

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-01-01

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. PMID:27112572

  15. Restricted infectivity of ecotropic type C retroviruses in mouse teratocarcinoma cells: studies on viral DNA intermediates

    SciTech Connect

    Yang, W.K.; d'Auriol, L.; Yang, D.M.; Kiggans, J.O. Jr.; Ou, C.Y.; Peries, J.; Emanoil-Ravicovitch, R.

    1980-01-01

    Infectivity of retroviruses in cultured murine teratocarcinoma cells was found to be affected by the state of cellular differentiation. Present studies utilize two kinds of cell cultures from teratocarcinomas of mouse strain 129, an undifferentiated pluriopotential cell line (PCC/sub 4/) and a myoblast-derived cell line (PCD/sub 1/) which are respectively resistant and susceptible to the infection of Gross strain N-tropic type C retrovirus. Analyses of the appearance of free viral DNA intermediates in these cells from 4 to 78 h after virus inoculation were made. In both PCD/sub 1/ and PCC/sub 4/ cells, virus inoculation induced the formation of one linear form (III) and two covalently-closed supercoiled circular forms (I) of viral DNA duplexes; the linear form showing its appearance, increase, and decline in the 4 to 18 h period, and the circular forms in the 8 to 24 h period. In the period of 56 to 78 h after virus inoculation, a secondary burst of viral DNA synthesis occurred in PCD/sub 1/ cells, whereas both linear and supercoiled viral DNA duplexes became undetectable in PCC/sub 4/ cells. Free and unintegrated viral DNA preparations from PCD/sub 1/ and PCC/sub 4/ cells 10 h after virus inoculation were both infectious for N3T3 cells in a DNA transfection assay. Both PCD/sub 1/ and PCC/sub 4/ cells were very poor recipients for DNA transfection. These results indicate that restriction of retrovirus in undifferentiated teratocarcinoma cells occurs at a step beyond formation and maturation of viral DNA intermediates. (ERB)

  16. A filter microplate assay for quantitative analysis of DNA binding proteins using fluorescent DNA.

    PubMed

    Yang, William C; Swartz, James R

    2011-08-15

    We present a rapid method for quantifying the apparent DNA binding affinity and capacity of recombinant transcription factors (TFs). We capture His6-tagged TFs using nickel-nitrilotriacetic acid (Ni-NTA) agarose and incubate the immobilized TFs with fluorescently labeled cognate DNA probes. After washing, the strength of the fluorescence signal indicates the extent of DNA binding. The assay was validated using two pluripotency-regulating TFs: SOX2 and NANOG. Using competitive binding analysis with nonlabeled competitor DNA, we show that SOX2 and NANOG specifically bind to their consensus sequences. We also determined the apparent affinity of SOX2 and NANOG for their consensus sequences to be 54.2±9 and 44.0±6nM, respectively, in approximate agreement with literature values. Our assay does not require radioactivity, but radioactively labeling the TFs enables the measurement of absolute amounts of immobilized SOX2 and NANOG and, hence, a DNA-to-protein binding ratio. SOX2 possesses a 0.95 DNA-to-protein binding ratio, whereas NANOG possesses a 0.44 ratio, suggesting that most of the SOX2 and approximately half of the NANOG are competent for DNA binding. Alternatively, the NANOG dimer may be capable of binding only one DNA target. This flexible DNA binding assay enables the analysis of crude or purified samples with or without radioactivity.

  17. Measuring Equilibrium Binding Constants for the WT1-DNA Interaction Using a Filter Binding Assay.

    PubMed

    Romaniuk, Paul J

    2016-01-01

    Equilibrium binding of WT1 to specific sites in DNA and potentially RNA molecules is central in mediating the regulatory roles of this protein. In order to understand the functional effects of mutations in the nucleic acid-binding domain of WT1 proteins and/or mutations in the DNA- or RNA-binding sites, it is necessary to measure the equilibrium constant for formation of the protein-nucleic acid complex. This chapter describes the use of a filter binding assay to make accurate measurements of the binding of the WT1 zinc finger domain to the consensus WT1-binding site in DNA. The method described is readily adapted to the measurement of the effects of mutations in either the WT1 zinc finger domain or the putative binding sites within a promoter element or cellular RNA.

  18. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    PubMed

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  19. Translational regulation of viral secretory proteins by the 5' coding regions and a viral RNA-binding protein.

    PubMed

    Nordholm, Johan; Petitou, Jeanne; Östbye, Henrik; da Silva, Diogo V; Dou, Dan; Wang, Hao; Daniels, Robert

    2017-08-07

    A primary function of 5' regions in many secretory protein mRNAs is to encode an endoplasmic reticulum (ER) targeting sequence. In this study, we show how the regions coding for the ER-targeting sequences of the influenza glycoproteins NA and HA also function as translational regulatory elements that are controlled by the viral RNA-binding protein (RBP) NS1. The translational increase depends on the nucleotide composition and 5' positioning of the ER-targeting sequence coding regions and is facilitated by the RNA-binding domain of NS1, which can associate with ER membranes. Inserting the ER-targeting sequence coding region of NA into different 5' UTRs confirmed that NS1 can promote the translation of secretory protein mRNAs based on the nucleotides within this region rather than the resulting amino acids. By analyzing human protein mRNA sequences, we found evidence that this mechanism of using 5' coding regions and particular RBPs to achieve gene-specific regulation may extend to human-secreted proteins. © 2017 Nordholm et al.

  20. Self-entanglement of long linear DNA vectors using transient non-B-DNA attachment points: a new concept for improvement of non-viral therapeutic gene delivery.

    PubMed

    Tolmachov, Oleg E

    2012-05-01

    The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II

  1. Hydroxyapatite-mediated separation of double-stranded DNA, single-stranded DNA, and RNA genomes from natural viral assemblages.

    PubMed

    Andrews-Pfannkoch, Cynthia; Fadrosh, Douglas W; Thorpe, Joyce; Williamson, Shannon J

    2010-08-01

    Metagenomics can be used to determine the diversity of complex, often unculturable, viral communities with various nucleic acid compositions. Here, we report the use of hydroxyapatite chromatography to efficiently fractionate double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), dsRNA, and ssRNA genomes from known bacteriophages. Linker-amplified shotgun libraries were constructed to generate sequencing reads from each hydroxyapatite fraction. Greater than 90% of the reads displayed significant similarity to the expected genomes at the nucleotide level. These methods were applied to marine viruses collected from the Chesapeake Bay and the Dry Tortugas National Park. Isolated nucleic acids were fractionated using hydroxyapatite chromatography followed by linker-amplified shotgun library construction and sequencing. Taxonomic analysis demonstrated that the majority of environmental sequences, regardless of their source nucleic acid, were most similar to dsDNA viruses, reflecting the bias of viral metagenomic sequence databases.

  2. Identification of novel DNA binding proteins using DNA affinity chromatography-pulldown

    PubMed Central

    Jutras, Brandon L; Verma, Ashutosh

    2012-01-01

    Methods are presented through which one may isolate and identify novel bacterial DNA-binding proteins. Briefly, the DNA sequence of interest is affixed to beads, then incubated with bacterial cytoplasmic extract. Washes with buffers containing non-specific DNA and low salt concentrations will remove non-adhering and low-specificity DNA-binding proteins, while subsequent washes with higher salt concentrations will elute more specific DNA-binding proteins. Eluted proteins may then be identified by standard proteomic techniques. PMID:22307548

  3. Cellular proteins bind to the downstream component of the lytic origin of DNA replication of Epstein-Barr virus.

    PubMed Central

    Gruffat, H; Renner, O; Pich, D; Hammerschmidt, W

    1995-01-01

    The lytic origin of DNA replication of Epstein-Barr virus, oriLyt, is a complex eukaryotic origin which is activated during the lytic phase of the viral life cycle. It consists of at least two independent cis-acting components, one of which plays a dual role in transcription and DNA replication. The binding of the viral factor BZLF1, a member of the AP1 family of transcription factors, to this upstream component is crucial for oriLyt function (A. Schepers, D. Pich, and W. Hammerschmidt, EMBO J. 12:3921-3929, 1993). The second cis-acting element, the downstream component of oriLyt, is equally indispensable; however, its function is unknown. In this study, the downstream component was found to be the binding target of several cellular proteins. One could be identified as Sp1 or as a related protein which binds twice to the downstream component of oriLyt. Mutational analysis indicated that Sp1 alone is not directly involved in mediating DNA replication; however, other factors which share the same binding sequence or bind closely to one of the Sp1 binding sites are likely candidates to contribute to a replication protein complex at the downstream component of oriLyt. The sequence requirements for the downstream component are remarkably stringent, indicating that at least one of the putative factors is a sequence-specific DNA-binding protein which is required for the activation of oriLyt. PMID:7853529

  4. Consistent detection of Felis domesticus papillomavirus 2 DNA sequences within feline viral plaques.

    PubMed

    Munday, John S; Peters-Kennedy, Jeanine

    2010-11-01

    Viral plaques are well recognized skin lesions of cats. They are thought to be caused by papillomavirus infection; however, the causative papillomavirus is uncertain. In the current study, polymerase chain reaction using 2 consensus primer sets and 1 primer set specific for Felis domesticus papillomavirus 2 (FdPV-2) was used to amplify DNA from a series of 14 feline viral plaques. The FdPV-2 sequences were detected in all 14 viral plaques by the specific primers but in only 1 of 14 feline cutaneous trichoblastomas. Papillomavirus DNA was amplified from 8 plaques using the consensus primers. Sequences from FdPV-2 were amplified using the consensus primers from 4 plaques. In addition, 3 plaques contained papillomavirus DNA sequences from Felis domesticus papillomavirus sequence MY1, and a previously unreported papillomavirus DNA sequence was amplified from 1 plaque. As FdPV-2 was consistently present within the plaques, this suggests that this papillomavirus is the likely etiologic agent. Feline viral plaques can undergo neoplastic transformation to Bowenoid in situ carcinomas (BISCs). As FdPV-2 DNA is frequently present within BISCs, this suggests that FdPV-2 induces viral plaque formation and then remains detectible after neoplastic transformation.

  5. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    PubMed

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10(9) m(-1) s(-1)) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Evidence for and Localization of Vegetative Viral DNA Replication by Autoradiographic Detection of RNA·DNA Hybrids in Sections of Tumors Induced by Shope Papilloma Virus

    PubMed Central

    Orth, Gérard; Jeanteur, Philippe; Croissant, Odile

    1971-01-01

    The occurrence and localization of vegetative viral DNA replication was studied in sections of tumors induced by the rabbit Shope papilloma virus, in cottontail and domestic rabbit papillomas, in primary domestic rabbit carcinoma, and in transplantable VX2 carcinoma, by in situ hybridization of radioactive RNA complementary to viral DNA. Vegetative viral DNA replication and viral protein synthesis were compared by means of cytological hybridization and immunofluorescence techniques on adjacent frozen sections. Vegetative viral DNA replication is completely repressed in the proliferating cellular layers of these tumors, which suggests a provirus state of the viral genome, as in other cells transformed by oncogenic DNA viruses. Vegetative viral DNA replication is induced, after initiation of the keratinization, in cells of cottonail rabbit papillomas, where it is usually followed by viral protein synthesis; this illustrates the influence of the physiological state of the host cell on the control of viral functions. Vegetative viral DNA replication is deteced only in a few cells of domestic rabbit papillomas, at the end of the keratinization process; this observation provides indirect evidence that the DNA synthesis specifically induced in these tumors after the onset of keratinization reflects mostly the induction of cellular DNA synthesis. Images PMID:4331563

  7. Molecular Genetic and Biochemical Characterization of the Vaccinia Virus I3 Protein, the Replicative Single-Stranded DNA Binding Protein

    PubMed Central

    Greseth, Matthew D.; Boyle, Kathleen A.; Bluma, Matthew S.; Unger, Bethany; Wiebe, Matthew S.; Soares-Martins, Jamaria A.; Wickramasekera, Nadi T.; Wahlberg, James

    2012-01-01

    Vaccinia virus, the prototypic poxvirus, efficiently and faithfully replicates its ∼200-kb DNA genome within the cytoplasm of infected cells. This intracellular localization dictates that vaccinia virus encodes most, if not all, of its own DNA replication machinery. Included in the repertoire of viral replication proteins is the I3 protein, which binds to single-stranded DNA (ssDNA) with great specificity and stability and has been presumed to be the replicative ssDNA binding protein (SSB). We substantiate here that I3 colocalizes with bromodeoxyuridine (BrdU)-labeled nascent viral genomes and that these genomes accumulate in cytoplasmic factories that are delimited by membranes derived from the endoplasmic reticulum. Moreover, we report on a structure/function analysis of I3 involving the isolation and characterization of 10 clustered charge-to-alanine mutants. These mutants were analyzed for their biochemical properties (self-interaction and DNA binding) and biological competence. Three of the mutant proteins, encoded by the I3 alleles I3-4, -5, and -7, were deficient in self-interaction and unable to support virus viability, strongly suggesting that the multimerization of I3 is biologically significant. Mutant I3-5 was also deficient in DNA binding. Additionally, we demonstrate that small interfering RNA (siRNA)-mediated depletion of I3 causes a significant decrease in the accumulation of progeny genomes and that this reduction diminishes the yield of infectious virus. PMID:22438556

  8. Nucleic acid sensing with enzyme-DNA binding protein conjugates cascade and simple DNA nanostructures.

    PubMed

    Aktas, Gülsen Betül; Skouridou, Vasso; Masip, Lluis

    2017-03-22

    A versatile and universal DNA sensing platform is presented based on enzyme-DNA binding protein tags conjugates and simple DNA nanostructures. Two enzyme conjugates were thus prepared, with horseradish peroxidase linked to the dimeric single-chain bacteriophage Cro repressor protein (HRP-scCro) and glucose oxidase linked to the dimeric headpiece domain of Escherichia coli LacI repressor protein (GOx-dHP), and used in conjunction with a hybrid ssDNA-dsDNA detection probe. This probe served as a simple DNA nanostructure allowing first for target recognition through its target-complementary single-stranded DNA (ssDNA) part and then for signal generation after conjugate binding on the double-stranded DNA (dsDNA) containing the specific binding sites for the dHP and scCro DNA binding proteins. The DNA binding proteins chosen in this work have different sequence specificity, high affinity, and lack of cross-reactivity. The proposed sensing system was validated for the detection of model target ssDNA from high-risk human papillomavirus (HPV16) and the limits of detection of 45, 26, and 21 pM were achieved using the probes with scCro/dHP DNA binding sites ratio of 1:1, 2:1, and 1:2, respectively. The performance of the platform in terms of limit of detection was comparable to direct HRP systems using target-specific oligonucleotide-HRP conjugates. The ratio of the two enzymes can be easily manipulated by changing the number of binding sites on the detection probe, offering further optimization possibilities of the signal generation step. Moreover, since the signal is obtained in the absence of externally added hydrogen peroxide, the described platform is compatible with paper-based assays for molecular diagnostics applications. Finally, just by changing the ssDNA part of the detection probe, this versatile nucleic acid platform can be used for the detection of different ssDNA target sequences or in a multiplex detection configuration without the need to change any of the

  9. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  10. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  11. Mechanochemical regulations of RPA's binding to ssDNA

    NASA Astrophysics Data System (ADS)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie

    2015-03-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  12. MHF complex senses branched DNA via binding a pair of crossover DNA duplexes

    PubMed Central

    Zhao, Qi; Saro, Dorina; Sachpatzidis, Aristidis; Singh, Thiyam Ramsing; Schlingman, Daniel; Zheng, Xiao-Feng; Mack, Andrew; Tsai, Miaw-Sheue; Mochrie, Simon; Regan, Lynne; Meetei, Amom Ruhikanta; Sung, Patrick; Xiong, Yong

    2014-01-01

    The conserved MHF1-MHF2 (MHF) complex functions in the activation of the Fanconi anemia (FA) pathway of DNA damage response, in regulating homologous recombination, and in DNA replication fork maintenance. MHF facilitates the processing of multiple types of branched DNAs by the FA DNA translocase FANCM. Here we report the crystal structure of a human MHF-DNA complex that reveals the DNA binding mode of MHF. The structure suggests an MHF preference for branched DNA over double stranded DNA through engaging two duplex arms, which is supported by single molecule studies. Biochemical analyses verify that MHF preferentially engage DNA forks or various four-way junctions independent of the junction-site structure. Genetic experiments provide evidence that the observed DNA-binding interface of MHF is important for cellular resistance to DNA damage. These results provide insights into how the MHF complex recognizes branched DNA and stimulates FANCM activity at such a structure to promote genome maintenance. PMID:24390579

  13. Quantitative Determination of DNA-Ligand Binding Using Fluorescence Spectroscopy

    ERIC Educational Resources Information Center

    Healy, Eamonn F.

    2007-01-01

    The effective use of fluorescence spectroscopy for determining the binding of the intercalcating agent crhidium bromide to DNA is being described. The analysis used simple measurement techniques and hence can be easily adopted by the students for a better understanding.

  14. Quantitative Determination of DNA-Ligand Binding Using Fluorescence Spectroscopy

    ERIC Educational Resources Information Center

    Healy, Eamonn F.

    2007-01-01

    The effective use of fluorescence spectroscopy for determining the binding of the intercalcating agent crhidium bromide to DNA is being described. The analysis used simple measurement techniques and hence can be easily adopted by the students for a better understanding.

  15. Structure Dependent Binding of Arylimidamides to the DNA Minor Groove

    PubMed Central

    Chai, Yun; Munde, Manoj; Kumar, Arvind; Mickelson, Leah; Lin, Sen; Campbell, Nancy H.; Banerjee, Moloy; Akay, Senol; Liu, Zongying; Farahat, Abdelbasset A.; Nhili, Raja; Depauw, Sabine; David-Cordonnier, Marie-Hélène; Neidle, Stephen

    2014-01-01

    Heterocyclic diamidines are strong DNA minor groove binders and have excellent antiparasitic activity. To extend the biological activity of these compounds, a series of arylimidamides (AIAs) analogs, which have better uptake properties in Leishmania and T. cruizi than diamidines, was prepared. The binding of the AIAs to DNA was investigated by Tm, fluorescence displacement titration, circular dichroism, DNase I footprinting, biosensor surface plasmon resonance, X-ray Crystallography and molecular modeling. These compounds form 1:1 complexes with AT sequences in the DNA minor groove and the binding strength varies with substituent size, charge and polarity. This substituent dependent structure and properties provide a SAR that can be used to estimate K values for binding to DNA in this series. The structural results and molecular modeling studies provide an explanation for the differences in binding affinities for AIAs. PMID:24323836

  16. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  17. Polycomb silencing mediated by specific DNA-binding recruiters.

    PubMed

    March, Eduardo; Farrona, Sara

    2017-09-27

    Regulation of epigenetic factors through their recruitment to specific genomic regions is still poorly understood. A recent study demonstrates a global mechanism of tethering Polycomb group (PcG) proteins through sequence-specific DNA-binding factors.

  18. Structural basis for DNA binding by replication initiator Mcm10

    SciTech Connect

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin; Greer, Briana; Bielinsky, Anja-Katrin; Chazin, Walter J.; Eichman, Brandt F.

    2009-06-30

    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae result in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.

  19. Nitropyrene: DNA binding and adduct formation in respiratory tissues.

    PubMed Central

    Jackson, M A; King, L C; Ball, L M; Ghayourmanesh, S; Jeffrey, A M; Lewtas, J

    1985-01-01

    Binding of 1-nitro (14C)pyrene (NP) or its metabolites to cellular DNA and protein in cultures of rabbit alveolar macrophages, lung tissue, and tracheal tissue was examined. DNA binding in tracheal tissue (136 +/- 18.3 pmole NP/mg DNA) was four to five times the levels measured in either lung tissue (38 +/- 9.4 pmole NP/mg DNA) or macrophages (26 +/- 7.5 pmole NP/mg DNA). Adduct analysis of DNA isolated from lung tissue incubated with 1-nitro[H3]pyrene in vitro resulted in the identification of 2 to 5% of the NP adducts as C8-deoxyguanosine 1-aminopyrene. NP was also bound to cellular protein in tracheal tissue and lung tissue, and at a lower level in macrophages. Cocultivation of the macrophages with lung and tracheal tissue decreased the DNA binding in tracheal tissue by 45%. Following intratracheal instillation of diesel particles (5 mg) vapor-coated with 14C-NP (380 ppm, 0.085 muCi/mg) particles into rats, 5-8% of the radioactivity remained in the lungs after 20 hr. Most of the diesel particles were also deposited in the lung. Examination of DNA and protein binding in this tissue showed 5 to 12% of the pulmonary 14C bound to protein and no detectable levels of 14C bound to DNA. PMID:3841313

  20. A molecular modeling study of inhibitors of nuclear factor kappa-B (p50)--DNA binding.

    PubMed

    Pande, Vineet; Sharma, Rakesh K; Inoue, Jun-Ichiro; Otsuka, Masami; Ramos, Maria J

    2003-12-01

    Nuclear Factor-kappa B (NF-kappaB) is an inducible transcription factor of the Rel family, and is sequestered in the cytoplasm by the IkappaB family of proteins. NF-kappaB can exist in several dimeric forms, but the p50/p65 heterodimer is the predominant one. Activation of NF-kappaB by a range of stimuli including viral products, and oxidative stress, leads to phosphorylation and proteasome dependent degradation of IkappaB, leading to the release of free NF-kappaB. This free NF-kappaB then binds to its target sites (KB sites in the DNA) to initiate transcription. These kappaB sites are also present in the Long Terminal Repeat (LTR) of HIV-1, and hence NF-kappaB (p50 subunit) binding to LTR-DNA is critical in viral replication. Targeting direct p50-DNA binding, in this regard, is a novel approach to design anti-HIV gene expression inhibitors, which do not have the problem of resistance unlike in other anti-HIV strategies. The present study is a part of our search for leads for the specific inhibition of p50-DNA binding. We have been experimentally studying different types of these inhibitors, and in this work, we attempted to get a common definition of their structural mechanism onto p50-DNA binding. Using three different classes of inhibitors, we modelled their association with the DNA-Binding Region (DBR) of the p50 subunit of NF-kappaB. Docking studies were carried out using a genetic algorithm based program (GOLD). Further, to compare electrostatic complementarity in the association of the inhibitors with the DBR, Molecular Electrostatic Potentials (MEPs) were generated for the DBR and each inhibitor. The results of docking revealed a strong network of hydrogen bonding interactions for every active inhibitor, and the contrary for the less active ones. Further, the MEPs revealed that the DBR of p50 represents a surface of electropositive potential, and the active inhibitors represent a complementary electronegative surface. With the present modelling study we

  1. A molecular modeling study of inhibitors of nuclear factor kappa-B (p50) DNA binding

    NASA Astrophysics Data System (ADS)

    Pande, Vineet; Sharma, Rakesh K.; Inoue, Jun-Ichiro; Otsuka, Masami; Ramos, Maria J.

    2003-12-01

    Nuclear Factor-kappa B (NF-κB) is an inducible transcription factor of the Rel family, and is sequestered in the cytoplasm by the IκB family of proteins. NF-κB can exist in several dimeric forms, but the p50/p65 heterodimer is the predominant one. Activation of NF-κB by a range of stimuli including viral products, and oxidative stress, leads to phosphorylation and proteasome dependent degradation of IκB, leading to the release of free NF-κB. This free NF-κB then binds to its target sites (κB sites in the DNA) to initiate transcription. These κB sites are also present in the Long Terminal Repeat (LTR) of HIV-1, and hence NF-κB (p50 subunit) binding to LTR-DNA is critical in viral replication. Targeting direct p50-DNA binding, in this regard, is a novel approach to design anti-HIV gene expression inhibitors, which do not have the problem of resistance unlike in other anti-HIV strategies. The present study is a part of our search for leads for the specific inhibition of p50-DNA binding. We have been experimentally studying different types of these inhibitors, and in this work, we attempted to get a common definition of their structural mechanism onto p50-DNA binding. Using three different classes of inhibitors, we modelled their association with the DNA-Binding Region (DBR) of the p50 subunit of NF-κB. Docking studies were carried out using a genetic algorithm based program (GOLD). Further, to compare electrostatic complementarity in the association of the inhibitors with the DBR, Molecular Electrostatic Potentials (MEPs) were generated for the DBR and each inhibitor. The results of docking revealed a strong network of hydrogen bonding interactions for every active inhibitor, and the contrary for the less active ones. Further, the MEPs revealed that the DBR of p50 represents a surface of electropositive potential, and the active inhibitors represent a complementary electronegative surface. With the present modelling study we conclude that the principal

  2. Host Tissue and Glycan Binding Specificities of Avian Viral Attachment Proteins Using Novel Avian Tissue Microarrays

    PubMed Central

    Ambepitiya Wickramasinghe, Iresha N.; de Vries, Robert P.; Eggert, Amber M.; Wandee, Nantaporn; de Haan, Cornelis A. M.; Gröne, Andrea; Verheije, Monique H.

    2015-01-01

    The initial interaction between viral attachment proteins and the host cell is a critical determinant for the susceptibility of a host for a particular virus. To increase our understanding of avian pathogens and the susceptibility of poultry species, we developed novel avian tissue microarrays (TMAs). Tissue binding profiles of avian viral attachment proteins were studied by performing histochemistry on multi-species TMA, comprising of selected tissues from ten avian species, and single-species TMAs, grouping organ systems of each species together. The attachment pattern of the hemagglutinin protein was in line with the reported tropism of influenza virus H5N1, confirming the validity of TMAs in profiling the initial virus-host interaction. The previously believed chicken-specific coronavirus (CoV) M41 spike (S1) protein displayed a broad attachment pattern to respiratory tissues of various avian species, albeit with lower affinity than hemagglutinin, suggesting that other avian species might be susceptible for chicken CoV. When comparing tissue-specific binding patterns of various avian coronaviral S1 proteins on the single-species TMAs, chicken and partridge CoV S1 had predominant affinity for the trachea, while pigeon CoV S1 showed marked preference for lung of their respective hosts. Binding of all coronaviral S1 proteins was dependent on sialic acids; however, while chicken CoV S1 preferred sialic acids type I lactosamine (Gal(1-3)GlcNAc) over type II (Gal(1-4)GlcNAc), the fine glycan specificities of pigeon and partridge CoVs were different, as chicken CoV S1-specific sialylglycopolymers could not block their binding to tissues. Taken together, TMAs provide a novel platform in the field of infectious diseases to allow identification of binding specificities of viral attachment proteins and are helpful to gain insight into the susceptibility of host and organ for avian pathogens. PMID:26035584

  3. Structural framework for DNA translocation via the viral portal protein

    PubMed Central

    Lebedev, Andrey A; Krause, Margret H; Isidro, Anabela L; Vagin, Alexei A; Orlova, Elena V; Turner, Joanne; Dodson, Eleanor J; Tavares, Paulo; Antson, Alfred A

    2007-01-01

    Tailed bacteriophages and herpesviruses load their capsids with DNA through a tunnel formed by the portal protein assembly. Here we describe the X-ray structure of the bacteriophage SPP1 portal protein in its isolated 13-subunit form and the pseudoatomic structure of a 12-subunit assembly. The first defines the DNA-interacting segments (tunnel loops) that pack tightly against each other forming the most constricted part of the tunnel; the second shows that the functional dodecameric state must induce variability in the loop positions. Structural observations together with geometrical constraints dictate that in the portal–DNA complex, the loops form an undulating belt that fits and tightly embraces the helical DNA, suggesting that DNA translocation is accompanied by a ‘mexican wave' of positional and conformational changes propagating sequentially along this belt. PMID:17363899

  4. Mechanisms of Unphosphorylated STAT3 Transcription Factor Binding to DNA*

    PubMed Central

    Timofeeva, Olga A.; Chasovskikh, Sergey; Lonskaya, Irina; Tarasova, Nadya I.; Khavrutskii, Lyuba; Tarasov, Sergey G.; Zhang, Xueping; Korostyshevskiy, Valeriy R.; Cheema, Amrita; Zhang, Lihua; Dakshanamurthy, Sivanesan; Brown, Milton L.; Dritschilo, Anatoly

    2012-01-01

    Phosphorylation of signal transducer and activator of transcription 3 (STAT3) on a single tyrosine residue in response to growth factors, cytokines, interferons, and oncogenes activates its dimerization, translocation to the nucleus, binding to the interferon γ (gamma)-activated sequence (GAS) DNA-binding site and activation of transcription of target genes. STAT3 is constitutively phosphorylated in various cancers and drives gene expression from GAS-containing promoters to promote tumorigenesis. Recently, roles for unphosphorylated STAT3 (U-STAT3) have been described in response to cytokine stimulation, in cancers, and in maintenance of heterochromatin stability. However, the mechanisms underlying U-STAT3 binding to DNA has not been fully investigated. Here, we explore STAT3-DNA interactions by atomic force microscopy (AFM) imaging. We observed that U-STAT3 molecules bind to the GAS DNA-binding site as dimers and monomers. In addition, we observed that U-STAT3 binds to AT-rich DNA sequence sites and recognizes specific DNA structures, such as 4-way junctions and DNA nodes, within negatively supercoiled plasmid DNA. These structures are important for chromatin organization and our data suggest a role for U-STAT3 as a chromatin/genome organizer. Unexpectedly, we found that a C-terminal truncated 67.5-kDa STAT3 isoform recognizes single-stranded spacers within cruciform structures that also have a role in chromatin organization and gene expression. This isoform appears to be abundant in the nuclei of cancer cells and, therefore, may have a role in regulation of gene expression. Taken together, our data highlight novel mechanisms by which U-STAT3 binds to DNA and supports U-STAT3 function as a transcriptional activator and a chromatin/genomic organizer. PMID:22378781

  5. DNA binding and transcription activation by chicken interferon regulatory factor-3 (chIRF-3)

    PubMed Central

    Grant, Caroline E.; May, Donna L.; Deeley, Roger G.

    2000-01-01

    Interferon regulatory factors (IRFs) are a family of transcription factors involved in the cellular response to interferons and viral infection. Previously we isolated an IRF from a chicken embryonic liver cDNA library. Using a PCR-based binding site selection assay, we have characterised the binding specificity of chIRF-3. The optimal binding site (OBS) fits within the consensus interferon-stimulated response element (ISRE) but the specificity of chIRF-3 binding allows less variation in nucleotides outside the core IRF-binding sequence. A comparison of IRF-1 and chIRF-3 binding to ISREs in electrophoretic mobility shift assays confirmed that the binding specificity of chIRF-3 was clearly distinguishable from IRF-1. The selection assay also showed that chIRF-3 is capable of binding an inverted repeat of two half OBSs separated by 10–13 nt. ChIRF-3 appears to bind both the OBS and inverted repeat sites as a dimer with the protein–protein interaction requiring a domain between amino acids 117 and 311. In transfection experiments expression of chIRF-3 strongly activated a promoter containing the OBS. The activation domain was mapped to between amino acids 138 and 221 and a domain inhibitory to activation was also mapped to the C-terminal portion of chIRF-3. PMID:11095692

  6. Quantitative determination of binding of ISWI to nucleosomes and DNA shows allosteric regulation of DNA binding by nucleotides.

    PubMed

    Al-Ani, Gada; Briggs, Koan; Malik, Shuja Shafi; Conner, Michael; Azuma, Yoshiaki; Fischer, Christopher J

    2014-07-15

    The regulation of chromatin structure is controlled by a family of molecular motors called chromatin remodelers. The ability of these enzymes to remodel chromatin structure is dependent on their ability to couple ATP binding and hydrolysis into the mechanical work that drives nucleosome repositioning. The necessary first step in determining how these essential enzymes perform this function is to characterize both how they bind nucleosomes and how this interaction is regulated by ATP binding and hydrolysis. With this goal in mind, we monitored the interaction of the chromatin remodeler ISWI with fluorophore-labeled nucleosomes and DNA through associated changes in fluorescence anisotropy of the fluorophore upon binding of ISWI to these substrates. We determined that one ISWI molecule binds to a 20 bp double-stranded DNA substrate with an affinity of 18 ± 2 nM. In contrast, two ISWI molecules can bind to the core nucleosome with short linker DNA with stoichiometric macroscopic equilibrium constants: 1/β1 = 1.3 ± 0.6 nM, and 1/β2 = 13 ± 7 nM(2). Furthermore, to improve our understanding of the mechanism of DNA translocation by ISWI, and hence nucleosome repositioning, we determined the effect of nucleotide analogues on substrate binding by ISWI. While the affinity of ISWI for the nucleosome substrate with short lengths of flanking DNA was not affected by the presence of nucleotides, the affinity of ISWI for the DNA substrate is weakened in the presence of nonhydrolyzable ATP analogues but not by ADP.

  7. Rapid Time Scale Analysis of T4 DNA Ligase-DNA Binding.

    PubMed

    Bauer, Robert J; Jurkiw, Thomas J; Evans, Thomas C; Lohman, Gregory J S

    2017-02-28

    DNA ligases, essential to both in vivo genome integrity and in vitro molecular biology, catalyze phosphodiester bond formation between adjacent 3'-OH and 5'-phosphorylated termini in dsDNA. This reaction requires enzyme self-adenylylation, using ATP or NAD(+) as a cofactor, and AMP release concomitant with phosphodiester bond formation. In this study, we present the first fast time scale binding kinetics of T4 DNA ligase to both nicked substrate DNA (nDNA) and product-equivalent non-nicked dsDNA, as well as binding and release kinetics of AMP. The described assays utilized a fluorescein-dT labeled DNA substrate as a reporter for ligase·DNA interactions via stopped-flow fluorescence spectroscopy. The analysis revealed that binding to nDNA by the active adenylylated ligase occurs in two steps, an initial rapid association equilibrium followed by a transition to a second bound state prior to catalysis. Furthermore, the ligase binds and dissociates from nicked and nonsubstrate dsDNA rapidly with initial association affinities on the order of 100 nM regardless of enzyme adenylylation state. DNA binding occurs through a two-step mechanism in all cases, confirming prior proposals of transient binding followed by a transition to a productive ligase·nDNA (Lig·nDNA) conformation but suggesting that weaker nonproductive "closed" complexes are formed as well. These observations demonstrate the mechanistic underpinnings of competitive inhibition by rapid binding of nonsubstrate DNA, and of substrate inhibition by blocking of the self-adenylylation reaction through nick binding by deadenylylated ligase. Our analysis further reveals that product release is not the rate-determining step in turnover.

  8. Viral DNA-Dependent Induction of Innate Immune Response to Hepatitis B Virus in Immortalized Mouse Hepatocytes

    PubMed Central

    Cui, Xiuji; Clark, Daniel N.; Liu, Kuancheng; Xu, Xiao-Dong; Guo, Ju-Tao

    2015-01-01

    ABSTRACT Hepatitis B virus (HBV) infects hundreds of millions of people worldwide and causes acute and chronic hepatitis, cirrhosis, and hepatocellular carcinoma. HBV is an enveloped virus with a relaxed circular (RC) DNA genome. In the nuclei of infected human hepatocytes, conversion of RC DNA from the incoming virion or cytoplasmic mature nucleocapsid (NC) to the covalently closed circular (CCC) DNA, which serves as the template for producing all viral transcripts, is essential to establish and sustain viral replication. A prerequisite for CCC DNA formation is the uncoating (disassembly) of NCs to expose their RC DNA content for conversion to CCC DNA. We report here that in an immortalized mouse hepatocyte cell line, AML12HBV10, in which RC DNA exposure is enhanced, the exposed viral DNA could trigger an innate immune response that was able to modulate viral gene expression and replication. When viral gene expression and replication were low, the innate response initially stimulated these processes but subsequently acted to shut off viral gene expression and replication after they reached peak levels. Inhibition of viral DNA synthesis or cellular DNA sensing and innate immune signaling diminished the innate response. These results indicate that HBV DNA, when exposed in the host cell cytoplasm, can function to trigger an innate immune response that, in turn, modulates viral gene expression and replication. IMPORTANCE Chronic infection by hepatitis B virus (HBV) afflicts hundreds of millions worldwide and is sustained by the episomal covalently closed circular (CCC) DNA in the nuclei of infected hepatocytes. Release of viral genomic DNA from cytoplasmic nucleocapsids (NCs) (NC disassembly or uncoating) is a prerequisite for its conversion to CCC DNA, which can also potentially expose the viral DNA to host DNA sensors and trigger an innate immune response. We have found that in an immortalized mouse hepatocyte cell line in which efficient CCC DNA formation was

  9. Variables influencing DNA-binding in mouse liver.

    PubMed

    Neumann, H G

    1987-01-01

    The suitability of certain mouse strains for carcinogenicity testing has been questioned. Some chemicals increase the incidence of liver tumors above a relatively high background, an effect not seen in rats. This raises the question whether species and tissue specific effects are involved which are reflected in the DNA binding of metabolites. DNA binding indices in mouse liver have been determined in only a few instances. They are comparable to those found for rat liver DNA with aniline, benzo(a)-pyrene, butadiene, dimethylnitrosamine, methylnitrosourea and they are lower in the mouse with aflatoxin B1, trans-4-acetylaminostilbene and 2-aminofluorene derivatives. The available data on DNA binding in mouse liver suggest that the same adducts are formed as in rats but that metabolism and repair are variables which can modify the extent of DNA damage. However, the extent of DNA binding does not always correlate with the susceptibility of this tissue to carcinogenesis. But mouse liver is no exception in this respect. It is concluded that the formation of mouse liver tumors in long term studies with genotoxic chemicals indicates tumor initiating potential. In contrast, there are other chemicals such as chlorinated hydrocarbon insecticides which do not bind to DNA to any extent and which are not genotoxic in common short term tests and yet give rise to liver tumors in mice but not in rats. Positive results in long term studies are suggested to indicate promoting properties of such compounds.

  10. Oligomerization of Baculovirus LEF-11 Is Involved in Viral DNA Replication

    PubMed Central

    Dong, Zhan-Qi; Hu, Nan; Zhang, Jun; Chen, Ting-Ting; Cao, Ming-Ya; Li, Hai-Qing; Lei, Xue-Jiao; Chen, Peng; Lu, Cheng; Pan, Min-Hui

    2015-01-01

    We have previously reported that baculovirus Bombyx mori nucleopolyhedrovirus (BmNPV) late expression factor 11 (lef-11) is associated with viral DNA replication and have demonstrated that it potentially interacts with itself; however, whether LEF-11 forms oligomers and the impact of LEF-11 oligomerization on viral function have not been substantiated. In this study, we first demonstrated that LEF-11 is capable of forming oligomers. Additionally, a series of analyses using BmNPV LEF-11 truncation mutants indicated that two distinct domains control LEF-11 oligomerization (aa 42–61 and aa 72–101). LEF-11 truncation constructs were inserted into a lef-11-knockout BmNPV bacmid, which was used to demonstrate that truncated LEF-11 lacking either oligomerization domain abrogates viral DNA replication. Finally, site-directed mutagenesis was used to determine that the conserved hydrophobic residues Y58&I59 (representing Y58 and I59), I85 and L88&L89 (representing L88 and L89) are required for LEF-11 oligomerization and viral DNA replication. Collectively, these data indicate that BmNPV LEF-11 oligomerization influences viral DNA replication. PMID:26660313

  11. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  12. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

    PubMed

    Pessler, Frank; Hernandez, Nouria

    2003-08-01

    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  13. HMGB Binding to DNA: Single and Double Box Motifs

    PubMed Central

    McCauley, Micah J.; Zimmerman, Jeff; Maher, L. James; C.Williams, Mark

    2007-01-01

    High Mobility Group (HMG) proteins are nuclear proteins believed to significantly affect DNA interactions by altering nucleic acid flexibility. HMG group B proteins contain HMG box domains known to bind into the DNA minor groove without sequence specificity, slightly intercalating base pairs and inducing a strong bend in the DNA helix axis. A dual beam optical tweezers is used to extend double–stranded DNA (dsDNA) in the absence and presence of a single box derivative of human HMGB2 [HMGB2(box A)] and a double box derivative of rat HMGB1 [HMGB1(box A+B)]. The single box domain is observed to reduce the persistence length of the double helix, generating sharp DNA bends with an average bend angle of 99 ± 9°, and at very high concentrations also stabilizing dsDNA against denaturation. The double box protein contains two consecutive HMG box domains joined by a flexible tether. This protein also reduces the DNA persistence length, induces an average bending angle of 77 ± 7° and stabilizes dsDNA at significantly lower concentrations. These results suggest that the single and double box proteins increase DNA flexibility and stability, but both effects are achieved at much lower protein concentrations for the double box. In addition, at low concentrations the single box protein can alter DNA flexibility without stabilizing dsDNA, while stabilization at higher concentration is likely achieved through a cooperative binding mode. PMID:17964600

  14. DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

    PubMed

    Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

    2017-01-01

    Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Tetrameric ZBRK1 DNA binding domain has affinity towards cognate DNA in absence of zinc ions.

    PubMed

    Yadav, Lumbini R; Biswal, Mahamaya N; Vikrant; Hosur, M V; Varma, Ashok K

    2014-07-18

    Zinc finger transcription regulatory proteins play crucial roles in cell-cycle regulation, DNA damage response and tumor genesis. Human ZBRK1 is a zinc-finger transcription repressor protein, which recognizes double helical DNA containing consensus sequences of 5'GGGXXXCAGXXXTTT3'. In the present study, we have purified recombinant DNA binding domain of ZBRK1, and studied binding with zinc ions and DNA, using biophysical techniques. The elution profile of the purified protein suggests that this ZBRK1 forms a homotetramer in solution. Dissociation and pull down assays also suggest that this domain forms a higher order oligomer. The ZBRK1-DNA binding domain acquires higher stability in the presence of zinc ions and DNA. The secondary structure of the ZBRK1-DNA complex is found to be significantly altered from the standard B-DNA conformation. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Thermodynamics of cationic lipid binding to DNA and DNA condensation: roles of electrostatics and hydrophobicity.

    PubMed

    Matulis, Daumantas; Rouzina, Ioulia; Bloomfield, Victor A

    2002-06-26

    Alkylammonium binding to DNA was studied by isothermal titration calorimetry. Experimental data, obtained as functions of alkyl chain length, salt concentration, DNA concentration, and temperature, provided a detailed thermodynamic description of lipid-DNA binding reactions leading to DNA condensation. Lipid binding, counterion displacement, and DNA condensation were highly cooperative processes, driven by a large increase in entropy and opposed by a relatively small endothermic enthalpy at room temperature. Large negative heat capacity change indicated a contribution from hydrophobic interactions between aliphatic tails. An approximation of lipid-DNA binding as dominated by two factors-ionic and hydrophobic interactions-yielded a model that was consistent with experimental data. Chemical group contributions to the energetics of binding were determined and could be used to predict energetics of other lipid binding to DNA. Electrostatic and hydrophobic contributions to Gibbs free energy, enthalpy, entropy, and heat capacity could be distinguished by applying additivity principles. Binding of lipids with two, three, and four aliphatic tails was investigated and compared to single-tailed lipid binding. Structurally, the model suggests that lipid cationic headgroups and aliphatic tails distribute evenly and lay down on DNA surface without the formation of micelles.

  17. Isohelical DNA-Binding Oligomers: Antiviral Activity and Application for the Design of Nanostructured Devices

    NASA Astrophysics Data System (ADS)

    Gursky, Georgy; Nikitin, Alexei; Surovaya, Anna; Grokhovsky, Sergey; Andronova, Valeria; Galegov, Georgy

    We performed a systematic search for new structural motifs isohelical to double-stranded DNA and found five motifs that can be used for the design and synthesis of new DNA-binding oligomers. Some of the DNA-binding oligomers can be equipped with fluorescence chromophores and metal-chelating groups and may serve as conductive wires in nano-scaled electric circuits. A series of new DNA-binding ligands were synthesized by a modular assembly of pyrrole carboxamides and novel pseudopeptides of the form (XY)n. Here, Y is a glycine residue; n is the degree of polymerization. X is an unusual amino acid residue containing a five-membered aromatic ring. Antiviral activity of bis-linked netropsin derivatives is studied. Bis-netropsins containing 15 and 31 lysine residues at the N-termini inhibit most effectively reproduction of the herpes virus type 1 in the Vero cell culture, including virus variants resistant to acyclovir and its analogues. Antiviral activity of bis-linked netropsin derivatives is correlated with their ability to interact with long clusters of AT-base pairs in the origin of replication of the viral DNA.

  18. ssDNA binding reveals the atomic structure of graphene.

    PubMed

    Husale, By Sudhir; Sahoo, Sangeeta; Radenovic, Aleksandra; Traversi, Floriano; Annibale, Paolo; Kis, Andras

    2010-12-07

    We used AFM to investigate the interaction of polyelectrolytes such as ssDNA and dsDNA molecules with graphene as a substrate. Graphene is an appropriate substrate due to its planarity, relatively large surfaces that are detectable via an optical microscope, and straightforward identification of the number of layers. We observe that in the absence of the screening ions deposited ssDNA will bind only to the graphene and not to the SiO(2) substrate, confirming that the binding energy is mainly due to the π-π stacking interaction. Furthermore, deposited ssDNA will map the graphene underlying structure. We also quantify the π-π stacking interaction by correlating the amount of deposited DNA with the graphene layer thickness. Our findings agree with reported electrostatic force microscopy (EFM) measurements. Finally, we inspected the suitability of using a graphene as a substrate for DNA origami-based nanostructures.

  19. Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

    PubMed Central

    Graziano, Vito; McGrath, William J.; Suomalainen, Maarit; Greber, Urs F.; Freimuth, Paul; Blainey, Paul C.; Luo, Guobin; Xie, X. Sunney; Mangel, Walter F.

    2013-01-01

    The precursor to adenovirus protein VI, pVI, is a multifunctional protein with different roles early and late in virus infection. Here, we focus on two roles late in infection, binding of pVI to DNA and to the major capsid protein hexon. pVI bound to DNA as a monomer independent of DNA sequence with an apparent equilibrium dissociation constant, Kd(app), of 46 nm. Bound to double-stranded DNA, one molecule of pVI occluded 8 bp. Upon the binding of pVI to DNA, three sodium ions were displaced from the DNA. A ΔG00 of −4.54 kcal/mol for the nonelectrostatic free energy of binding indicated that a substantial component of the binding free energy resulted from nonspecific interactions between pVI and DNA. The proteolytically processed, mature form of pVI, protein VI, also bound to DNA; its Kd(app) was much higher, 307 nm. The binding assays were performed in 1 mm MgCl2 because in the absence of magnesium, the binding to pVI or protein VI to DNA was too tight to determine a Kd(app). Three molecules of pVI bound to one molecule of the hexon trimer with an equilibrium dissociation constant Kd(app) of 1.1 nm. PMID:23043136

  20. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  1. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    PubMed

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  2. Antineoplastic DNA-binding compounds: intercalating and minor groove binding drugs.

    PubMed

    Mišković, Katarina; Bujak, Maro; Baus Lončar, Mirela; Glavaš-Obrovac, Ljubica

    2013-12-01

    DNA intercalating and minor groove binding compounds are new weapons in the battle against malignant diseases. These antineoplastic agents target the DNA molecule and interfere with the cell cycle leading to rapidly proliferating cell death. They are mainly derivates of a naturally occurring organic compound derived from a microorganism or plant. Intercalators usually act as topoisomerase I and/or II poisons, while the mechanisms of DNA minor groove binders are a combination of several steps including topoisomerase poisoning. This paper gives an overview of some of the developed DNA intercalating and minor groove binding compounds, as well as an explanation of their chemical structures, origins, and application in chemotherapy.

  3. Defining a minimal estrogen receptor DNA binding domain.

    PubMed Central

    Mader, S; Chambon, P; White, J H

    1993-01-01

    The estrogen receptor (ER) is a transcriptional regulator which binds to cognate palindromic DNA sequences known as estrogen response elements (EREs). A 66 amino acid core region which contains two zinc fingers and is highly conserved among the nuclear receptors is essential for site specific DNA recognition. However, it remains unclear how many flanking amino acids in addition to the zinc finger core are required for DNA binding. Here, we have characterized the minimal DNA binding region of the human ER by analysing the DNA binding properties of a series of deletion mutants expressed in bacteria. We find that the 66 amino acid zinc finger core of the DBD fails to bind DNA, and that the C-terminal end of the minimal ER DBD required for binding to perfectly palindromic EREs corresponds to the limit of 100% amino acid homology between the chicken and human receptors, which represents the boundary between regions C and D in the ER. Moreover, amino acids of region D up to 30 residues C-terminal to the zinc fingers greatly stabilize DNA binding by the DBD to perfectly palindromic EREs and are absolutely required for formation of gel retardation complexes by the DBD on certain physiological imperfectly palindromic EREs. These results indicate that in addition to the zinc finger core, amino acids C-terminal to the core in regions C and D play a key role in DNA binding by the ER, particularly to imperfectly palindromic response elements. The ER DBD expressed in E. coli binds as a dimer to ERE palindromes in a highly cooperative manner and forms only low levels of monomeric protein-DNA complexes on either palindromic or half-palindromic response elements. Conversion of ER amino acids 222 to 226, which lie within region C, to the corresponding residues of the human RAR alpha abolishes formation of dimeric protein-DNA complexes. Conversely, replacement of the same region of RAR alpha with ER residues 222 to 226 creates a derivative that, unlike the RAR alpha DBD, binds

  4. DNA Conforming Dynamics and Protein Binding

    DTIC Science & Technology

    2006-12-01

    spectroscopy". We repeat this Introduction here for completeness. The Watson - Crick double- helix is the thermodynamically stable configuration of a DNA ...molecule under physiological conditions (normal salt and room/body temperature). This stability is effected (a) by Watson - Crick H-bonding, that is...contribution to DNA helix stability comes from base-stacking between neighboring base pairs: through hydrophobic interactions between the planar aromatic

  5. Total HIV-1 DNA, a Marker of Viral Reservoir Dynamics with Clinical Implications

    PubMed Central

    Hocqueloux, Laurent; Ghosn, Jade; Cheret, Antoine; Frange, Pierre; Melard, Adeline; Viard, Jean-Paul; Rouzioux, Christine

    2016-01-01

    SUMMARY HIV-1 DNA persists in infected cells despite combined antiretroviral therapy (cART), forming viral reservoirs. Recent trials of strategies targeting latent HIV reservoirs have rekindled hopes of curing HIV infection, and reliable markers are thus needed to evaluate viral reservoirs. Total HIV DNA quantification is simple, standardized, sensitive, and reproducible. Total HIV DNA load influences the course of the infection and is therefore clinically relevant. In particular, it is predictive of progression to AIDS and death, independently of HIV RNA load and the CD4 cell count. Baseline total HIV DNA load is predictive of the response to cART. It declines during cART but remains quantifiable, at a level that reflects both the history of infection (HIV RNA zenith, CD4 cell count nadir) and treatment efficacy (residual viremia, cumulative viremia, immune restoration, immune cell activation). Total HIV DNA load in blood is also predictive of the presence and severity of some HIV-1-associated end-organ disorders. It can be useful to guide individual treatment, notably, therapeutic de-escalation. Although it does not distinguish between replication-competent and -defective latent viruses, the total HIV DNA load in blood, tissues, and cells provides insights into HIV pathogenesis, probably because all viral forms participate in host cell activation and HIV pathogenesis. Total HIV DNA is thus a biomarker of HIV reservoirs, which can be defined as all infected cells and tissues containing all forms of HIV persistence that participate in pathogenesis. This participation may occur through the production of new virions, creating new cycles of infection and disseminating infected cells; maintenance or amplification of reservoirs by homeostatic cell proliferation; and viral transcription and synthesis of viral proteins without new virion production. These proteins can induce immune activation, thus participating in the vicious circle of HIV pathogenesis. PMID:27559075

  6. The Paradoxical Effects of Different Hepatitis C Viral Loads on Host DNA Damage and Repair Abilities

    PubMed Central

    Li, Chia-Yang; Chiang, Chi-Shiun; Yu, Guann-Yi; Sakamoto, Naoya; Tu, Wen-Yu; Hsieh, Meng-Hsuan; Huang, Jee-Fu; Chuang, Wan-Long; Dai, Chia-Yen

    2017-01-01

    Hepatitis C virus (HCV)-induced hepatic stress is associated with increased oxidative DNA damage and has been implicated in hepatic inflammation. However, HCV infection and replication are uneven and vary among individual hepatocytes. To investigate the effect of the viral load on host DNA damage, we used an Enhanced Yellow Fluorescent Protein gene (EYFP)-tagged HCV virus to distinguish between HCV intracellular high viral load (HVL) cells and low viral load (LVL) cells. The cell sorting efficiency was confirmed by the high expression of the HCV polyprotein. We found DNA damage γ-H2AX foci in the HVL population. Comet assays demonstrated that HVL was related to the extent of the DNA strand breaks. Surprisingly, the DNA qPCR arrays and western blotting showed that the damage-related genes GPX2, MRE11, phospho-ATM, and OGG1 were significantly up-regulated in LVL cells but inversely down-regulated or consistently expressed in HVL cells. The colony survival assay to examine the repair abilities of these cells in response to irradiation showed that the LVL cells were more resistant to irradiation and had an increased ability to repair radiation-induced damage. This study found that intracellular viral loads drove cellular DNA damage levels but suppressed damage-related gene expression. However, the increase in damage-related gene expression in the LVL cells may be affected by ROS from the HVL cells. These findings provide new insights into the distinct DNA damage and repair responses resulting from different viral loads in HCV-infected cells. PMID:28052067

  7. The Paradoxical Effects of Different Hepatitis C Viral Loads on Host DNA Damage and Repair Abilities.

    PubMed

    Wang, Shu-Chi; Lai, Kuan-Ru; Li, Chia-Yang; Chiang, Chi-Shiun; Yu, Guann-Yi; Sakamoto, Naoya; Tu, Wen-Yu; Hsieh, Meng-Hsuan; Huang, Jee-Fu; Chuang, Wan-Long; Dai, Chia-Yen; Yu, Ming-Lung

    2017-01-01

    Hepatitis C virus (HCV)-induced hepatic stress is associated with increased oxidative DNA damage and has been implicated in hepatic inflammation. However, HCV infection and replication are uneven and vary among individual hepatocytes. To investigate the effect of the viral load on host DNA damage, we used an Enhanced Yellow Fluorescent Protein gene (EYFP)-tagged HCV virus to distinguish between HCV intracellular high viral load (HVL) cells and low viral load (LVL) cells. The cell sorting efficiency was confirmed by the high expression of the HCV polyprotein. We found DNA damage γ-H2AX foci in the HVL population. Comet assays demonstrated that HVL was related to the extent of the DNA strand breaks. Surprisingly, the DNA qPCR arrays and western blotting showed that the damage-related genes GPX2, MRE11, phospho-ATM, and OGG1 were significantly up-regulated in LVL cells but inversely down-regulated or consistently expressed in HVL cells. The colony survival assay to examine the repair abilities of these cells in response to irradiation showed that the LVL cells were more resistant to irradiation and had an increased ability to repair radiation-induced damage. This study found that intracellular viral loads drove cellular DNA damage levels but suppressed damage-related gene expression. However, the increase in damage-related gene expression in the LVL cells may be affected by ROS from the HVL cells. These findings provide new insights into the distinct DNA damage and repair responses resulting from different viral loads in HCV-infected cells.

  8. Potency of carcinogens derived from covalent DNA binding and stimulation of DNA synthesis in rat liver

    SciTech Connect

    Lutz, W.K.; Buesser, M.T.; Sagelsdorff, P.

    1984-01-01

    In order to investigate the role of the stimulation of cell division for the initiation (and possibly promotion) of liver tumors by chemical carcinogens, the incorporation of radiolabelled thymidine into liver DNA was determined in male rats. Single doses of various levels of aflatoxin B1, benzidine and carbon tetrachloride (all known to be genotoxic via DNA binding) did not affect cell division, whereas several hepatocarcinogens known not to bind to DNA (alpha-HCH, clofibrate, and 2,3,7,8-tetrachlorodibenzo-p-dioxin) gave rise to a dose-dependent stimulation of liver DNA synthesis within 24 h. An equation combining the influences of mitotic stimulation, expressed as dose required to double the control level of DNA synthesis, and DNA binding potency, expressed as the Covalent Binding Index, correlated well with the carcinogenic potency for both classes of hepatocarcinogens.

  9. Subgenomic viral DNA species synthesized in simian cells by human and simian adenoviruses.

    PubMed Central

    Daniell, E

    1981-01-01

    DNA synthesized after infection of simian tissue culture cells (BSC-1 or CV-1) with human adenovirus type 2 or 5 or with simian adenovirus 7 was characterized. It was demonstrated that as much as 40% of the virus-specific DNA in nuclei of infected monkey cells consists of subgenomic pieces. No subgenomic viral DNA species were detected in the nuclei of human (HeLa) cells infected with these adenovirus types. Restriction analysis showed that these short viral DNA molecules contain normal amounts of the sequences from the ends of the viral genome, whereas internal regions are underrepresented. The production of subgenomic DNAs is not correlated with semipermissive infection. Although adenovirus types 2 and 5 are restricted in monkey cells, these cells are fully permissive for simian adenovirus 7. HR404, an adenovirus type 5 mutant which is not restricted in monkey cells, produced the same percentage of subgenomic DNAs as did its wild type (restricted) parent, and coinfection of monkey cells with adenovirus type 5 DNAs. The array of predominant size classes among the heterogeneously sized short DNAs is serotype specific. Extensive plaque purification and comparison of wild-type adenovirus type 5 with several viral mutants indicated that the distribution of aberrant sizes of DNA is characteristic of the virus and not a result of random replicative errors and then enrichment of particular species. Images PMID:6261009

  10. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  11. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence.

    PubMed

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J Pedro; Carrondo, Maria A; McVey, Colin E; Kaye, Kenneth M

    2015-11-20

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes.

  12. Protein-DNA binding in high-resolution.

    PubMed

    Mahony, Shaun; Pugh, B Franklin

    2015-01-01

    Recent advances in experimental and computational methodologies are enabling ultra-high resolution genome-wide profiles of protein-DNA binding events. For example, the ChIP-exo protocol precisely characterizes protein-DNA cross-linking patterns by combining chromatin immunoprecipitation (ChIP) with 5' → 3' exonuclease digestion. Similarly, deeply sequenced chromatin accessibility assays (e.g. DNase-seq and ATAC-seq) enable the detection of protected footprints at protein-DNA binding sites. With these techniques and others, we have the potential to characterize the individual nucleotides that interact with transcription factors, nucleosomes, RNA polymerases and other regulatory proteins in a particular cellular context. In this review, we explain the experimental assays and computational analysis methods that enable high-resolution profiling of protein-DNA binding events. We discuss the challenges and opportunities associated with such approaches.

  13. Protein-DNA binding in high-resolution

    PubMed Central

    Mahony, Shaun; Pugh, B. Franklin

    2015-01-01

    Recent advances in experimental and computational methodologies are enabling ultra-high resolution genome-wide profiles of protein-DNA binding events. For example, the ChIP-exo protocol precisely characterizes protein-DNA crosslinking patterns by combining chromatin immunoprecipitation (ChIP) with 5′ → 3′ exonuclease digestion. Similarly, deeply sequenced chromatin accessibility assays (e.g. DNase-seq and ATACseq) enable the detection of protected footprints at protein-DNA binding sites. With these techniques and others, we have the potential to characterize the individual nucleotides that interact with transcription factors, nucleosomes, RNA polymerases, and other regulatory proteins in a particular cellular context. In this review, we explain the experimental assays and computational analysis methods that enable high-resolution profiling of protein-DNA binding events. We discuss the challenges and opportunities associated with such approaches. PMID:26038153

  14. DNA-binding proteins in plant mitochondria: implications for transcription.

    PubMed

    Gualberto, José M; Kühn, Kristina

    2014-11-01

    The structural complexity of plant mitochondrial genomes correlates with the variety of single-strand DNA-binding proteins found in plant mitochondria. Most of these are plant-specific and have roles in homologous recombination and genome maintenance. Mitochondrial nucleoids thus differ fundamentally between plants and yeast or animals, where the principal nucleoid protein is a DNA-packaging protein that binds double-stranded DNA. Major transcriptional cofactors identified in mitochondria of non-plant species are also seemingly absent from plants. This article reviews current knowledge on plant mitochondrial DNA-binding proteins and discusses that those may affect the accessibility and conformation of transcription start sites, thus functioning as transcriptional modulators without being dedicated transcription factors. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  15. Orientational binding modes of reporters in a viral-nanoparticle lateral flow assay.

    PubMed

    Kim, Jinsu; Poling-Skutvik, Ryan; Trabuco, João R C; Kourentzi, Katerina; Willson, Richard C; Conrad, Jacinta C

    2016-12-19

    Using microscopy and image analysis, we characterize binding of filamentous viral nanoparticles to a fibrous affinity matrix as models for reporter capture in a lateral flow assay (LFA). M13 bacteriophage (M13) displaying an in vivo-biotinylated peptide (AviTag) genetically fused to the M13 tail protein p3 are functionalized with fluorescent labels. We functionalize glass fiber LFA membranes with antibodies to M13, which primarily capture M13 on the major p8 coat proteins, or with avidin, which captures M13 at the biotin-functionalized tail, and compare orientational modes of reporter capture for the side- versus tip-binding recognition interactions. The number of captured M13 is greater for side-binding than for tip-binding, as expected from the number of recognition groups. Whereas two-thirds of side-bound M13 captured by an anti-M13 antibody bind immediately after colliding with the membrane, tip-bound M13 prominently exhibit three additional orientational modes that require M13 to reorient to enable binding. These results are consistent with the idea that the elongated M13 shape couples with the complex flow field in an open and disordered fibrous LFA membrane to enhance capture.

  16. DNA binding, DNA cleavage, and cytotoxicity studies of two new copper (II) complexes.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Roshanfekr, Hamideh; Shahabadi, Nahid; Rezvani, Alireza; Mansouri, Ghobad

    2011-05-01

    The DNA binding behavior of [Cu(phen)(phen-dione)Cl]Cl (1) and [Cu(bpy)(phen-dione)Cl]Cl (2) was studied with a series of techniques including UV-vis absorption, circular dichroism spectroscopy, and viscometric methods. Cytotoxicity effect and DNA unwinding properties were also investigated. The results indicate that the Cu(II) complexes interact with calf-thymus DNA by both partially intercalative and hydrogen binding. These findings have been further substantiated by the determination of intrinsic binding constants spectrophotometrically, 12.5 × 10(5) and 5 × 10(5) for 1 and 2, respectively. Our findings suggest that the type of ligands and structure of complexes have marked effect on the binding affinity of complexes involving CT-DNA. Circular dichroism results show that complex 1 causes considerable increase in base stacking of DNA, whereas 2 decreases the base stacking, which is related to more extended aromatic area of 1,10-phenanthroline in 1 rather than bipyridine in 2. Slow decrease in DNA viscosity indicates partially intercalative binding in addition to hydrogen binding on the surface of DNA. The second binding mode was also confirmed by additional tests: interaction in denaturation condition and acidic pH. Also, these new complexes induced cleavage in pUC18 plasmid DNA as indicated in gel electrophoresis and showed excellent antitumor activity against K562 (human chronic myeloid leukemia) cells.

  17. Structure-based analysis of HU-DNA binding.

    PubMed

    Swinger, Kerren K; Rice, Phoebe A

    2007-01-26

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from approximately 10-14.5 kcal/mol, representing K(d) values in the nanomolar to low picomolar range, and a maximum stabilization of at least approximately 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  18. Structure-based Analysis to Hu-DNA Binding

    SciTech Connect

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  19. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  20. Effects of DNA-binding drugs on T4 DNA ligase.

    PubMed Central

    Montecucco, A; Pedrali-Noy, G; Spadari, S; Lestingi, M; Ciarrocchi, G

    1990-01-01

    A number of DNA intercalating and externally binding drugs have been found to inhibit nick sealing, cohesive and blunt end ligation, AMP-dependent DNA topoisomerization and EDTA-induced DNA nicking mediated by bacteriophage T4 DNA ligase. The inhibition seems to arise from drug-substrate interaction so that formation of active DNA-Mg2(+)-AMP-enzyme complex is impaired while assembled and active complexes are not disturbed by drug binding to the substrate. Images Fig. 2. Fig. 4. Fig. 5. PMID:2156493

  1. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment.

    PubMed

    Kennedy, Edward M; Cullen, Bryan R

    2015-05-01

    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  2. Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

    PubMed Central

    Kennedy, Edward M.; Cullen, Bryan R.

    2015-01-01

    CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called single guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes

  3. Competition for DNA binding sites using Promega DNA IQ™ paramagnetic beads.

    PubMed

    Frégeau, Chantal J; De Moors, Anick

    2012-09-01

    The Promega DNA IQ™ system is easily amenable to automation and has been an integral part of standard operating procedures for many forensic laboratories including those of the Royal Canadian Mounted Police (RCMP) since 2004. Due to some failure to extract DNA from samples that should have produced DNA using our validated automated DNA IQ™-based protocol, the competition for binding sites on the DNA IQ™ magnetic beads was more closely examined. Heme from heavily blooded samples interfered slightly with DNA binding. Increasing the concentration of Proteinase K during lysis of these samples did not enhance DNA recovery. However, diluting the sample lysate following lysis prior to DNA extraction overcame the reduction in DNA yield and preserved portions of the lysates for subsequent manual or automated extraction. Dye/chemicals from black denim lysates competed for binding sites on the DNA IQ™ beads and significantly reduced DNA recovery. Increasing the size or number of black denim cuttings during lysis had a direct adverse effect on DNA yield from various blood volumes. The dilution approach was successful on these samples and permitted the extraction of high DNA yields. Alternatively, shortening the incubation time for cell lysis to 30 min instead of the usual overnight at 56 °C prevented competition from black denim dye/chemicals and increased DNA yields. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

  4. Viral hemorrhagic fevers of animals caused by DNA viruses

    USDA-ARS?s Scientific Manuscript database

    Here we outline serious diseases of food and fiber animals that cause damaging economic effects on producers all over the world. The only vector-borne DNA virus is included here (i.e., African swine fever virus), and the herpesviruses discussed have a complex epidemiology characterized by outbreaks ...

  5. Viral hemorrhagic fevers of animals caused by DNA viruses

    USDA-ARS?s Scientific Manuscript database

    Here we outline serious diseases of food and fiber animals that cause damaging economic effect on products all over the world. The only vector-borne DNA virus is included here, such as African swine fever virus, and the herpes viruses discussed have a complex epidemiology characterized by outbreak...

  6. Novel DNA-binding properties of the RNA-binding protein TIAR.

    PubMed

    Suswam, Esther A; Li, Yan Yan; Mahtani, Harry; King, Peter H

    2005-01-01

    TIA-1 related protein binds avidly to uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes, including interleukin (IL)-8 and vascular endothelial growth factor (VEGF). The protein has diverse regulatory roles, which in part depend on the locus of binding within the transcript, including translational control, splicing and apoptosis. Here, we observed selective and potent inhibition of TIAR-RNP complex formation with IL-8 and VEGF 3'-untranslated regions (3'-UTRs) using thymidine-rich deoxyoligonucleotide (ODN) sequences derived from the VEFG 3'-UTR. We show by ultraviolet crosslinking and electrophoretic mobility shift assays that TIAR can bind directly to single-stranded, thymidine-rich ODNs but not to double-stranded ODNs containing the same sequence. TIAR had a nearly 6-fold greater affinity for DNA than RNA (K(d)app = 1.6x10(-9) M versus 9.4 x 10(-9) M). Truncation of TIAR indicated that the high affinity DNA-binding site overlaps with the RNA-binding site involving RNA recognition motif 2 (RRM2). However, RRM1 alone could also bind to DNA. Finally, we show that TIAR can be displaced from single-stranded DNA by active transcription through the binding site. These results provide a potential mechanism by which TIAR can shuttle between RNA and DNA ligands.

  7. Genetic Determinants of Symptoms on Viral DNA Satellites ▿

    PubMed Central

    Ding, Chenjun; Qing, Ling; Li, Zhenghe; Liu, Yi; Qian, Yajuan; Zhou, Xueping

    2009-01-01

    Begomovirus-DNA-β disease complexes induce different symptom phenotypes in their hosts. To investigate the genetic determinants of the phenotypic differences, Nicotiana spp. and tomato plants were inoculated with infectious clones of Tobacco curly shoot virus (TbCSV)/TbCSV DNA-β (TbCSB) and Tomato yellow leaf curl China virus (TYLCCNV)/TYLCCNV DNA-β (TYLCCNB) pseudorecombinants and showed that TYLCCNB induced characteristic vein-thickening and enation symptoms, while TbCSB only slightly exacerbated the leaf-curling symptoms, regardless of the helper virus being used. The roles of DNA-β-encoded βC1 and a 430-nucleotide fragment containing the A-rich region and the putative βC1 promoter region of the βC1 gene (referred to as AP) in symptom development were further investigated by constructing hybrid satellites in which the βC1 coding region or AP was exchanged between the two satellite molecules. A TYLCCNB hybrid with TbCSB βC1 lost the ability to elicit the vein-thickening and enation phenotypes. TbCSB hybrids containing the TYLCCNB βC1 or AP fragment failed to induce the characteristic vein thickening and enations. A TYLCCNB hybrid having the TbCSB AP fragment produced the enations, but the number of enations was less and their sizes were reduced. Differently from the phloem-specific pattern of the TYLCCNB promoter, a full-length fragment upstream of the TbCSB βC1 gene confers a constitutive β-glucuronidase expression pattern in transgenic tobacco plants. The above results indicate that the DNA-β-encoded βC1 protein is the symptom determinant, but the promoter of the βC1 gene has influence on symptom production. PMID:19542327

  8. Purified JC virus T antigen derived from insect cells preferentially interacts with binding site II of the viral core origin under replication conditions.

    PubMed

    Bollag, B; Mackeen, P C; Frisque, R J

    1996-04-01

    The human polyomavirus JC virus (JCV) establishes persistent, asymptomatic infections in most individuals, but in severely immunocompromised hosts it may cause the fatal demyelinating brain disease progressive multifocal leukoencephalopathy. In cell culture JCV multiplies inefficiently and exhibits a narrow host range. This restricted behavior occurs, in part, at the level of DNA replication, which is regulated by JCV's multifunctional large tumor protein (TAg). To prepare purified JCV TAg (JCT) for biochemical analyses, the recombinant baculovirus B-JCT was generated by cotransfection of insect cells with wild-type baculovirus and the vector pVL-JCT(Int-) containing the JCT-coding sequence downstream of the efficient polyhedrin promoter. JCT expressed in infected cells was immunoaffinity purified using the anti-JCT monoclonal antibody PAb 2000. Characterization of the viral oncoprotein indicated that it exists in solution as a mixture of monomeric and oligomeric species. With the addition of ATP, the population of monomers decreased and that of hexamers and double hexamers increased. A DNA mobility shift assay indicated that origin binding occurred primarily with the double-hexamer form. A comparison of the specific DNA-binding activities of JCT and SV40 TAg (SVT) revealed that JCT generally exhibited greater affinity for binding site II relative to binding site I (B.S. I) of both viral origin regions, whereas SVT preferentially bound B.S. I. Furthermore, JCT bound nonviral DNA more efficiently than did SVT. These functional differences between the two TAgs may contribute to the reduced DNA replication potential of JCV in vitro, and to the virus' ability to establish persistent infections in vivo.

  9. High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein.

    PubMed

    Morten, Michael J; Gamsjaeger, Roland; Cubeddu, Liza; Kariawasam, Ruvini; Peregrina, Jose; Penedo, J Carlos; White, Malcolm F

    2017-03-01

    Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.

  10. Dynamics of nucleosome invasion by DNA binding proteins.

    PubMed

    Tims, Hannah S; Gurunathan, Kaushik; Levitus, Marcia; Widom, Jonathan

    2011-08-12

    Nucleosomes sterically occlude their wrapped DNA from interacting with many large protein complexes. How proteins gain access to nucleosomal DNA target sites in vivo is not known. Outer stretches of nucleosomal DNA spontaneously unwrap and rewrap with high frequency, providing rapid and efficient access to regulatory DNA target sites located there; however, rates for access to the nucleosome interior have not been measured. Here we show that for a selected high-affinity nucleosome positioning sequence, the spontaneous DNA unwrapping rate decreases dramatically with distance inside the nucleosome. The rewrapping rate also decreases, but only slightly. Our results explain the previously known strong position dependence on the equilibrium accessibility of nucleosomal DNA, which is characteristic of both selected and natural sequences. Our results point to slow nucleosome conformational fluctuations as a potential source of cell-cell variability in gene activation dynamics, and they reveal the dominant kinetic path by which multiple DNA binding proteins cooperatively invade a nucleosome.

  11. Sendai virus assembly: M protein binds to viral glycoproteins in transit through the secretory pathway.

    PubMed Central

    Sanderson, C M; McQueen, N L; Nayak, D P

    1993-01-01

    We have examined the relative ability of Sendai virus M (matrix) protein to associate with membranes containing viral glycoproteins at three distinct stages of the exocytic pathway prior to cell surface appearance. By the use of selective low-temperature incubations or the ionophore monensin, the transport of newly synthesized viral glycoproteins was restricted to either the pre-Golgi intermediate compartment (by incubation at 15 degrees C), the medial Golgi (in the presence of monensin), or the trans-Golgi network (by incubation at 20 degrees C). All three of these treatments resulted in a marked accumulation of the M protein on perinuclear Golgi-like membranes which in each case directly reflected the distribution of the viral F protein. Subsequent redistribution of the F protein to the plasma membrane by removal of the low-temperature (20 degrees C) block resulted in a concomitant redistribution of the M protein, thus implying association of the two components during intracellular transit. The extent of M protein-glycoprotein association was further examined by cell fractionation studies performed under each of the three restrictive conditions. Following equilibrium sedimentation of membranes derived from monensin-treated cells, approximately 40% of the recovered M protein was found to cofractionate with membranes containing the viral glycoproteins. Also, by flotation analyses, a comparable subpopulation of M protein was found to be membrane associated whether viral glycoproteins were restricted to the trans-Golgi network, the medial Golgi, or the pre-Golgi intermediate compartment. Additionally, transient expression of M protein alone from cloned cDNA showed that neither membrane association nor Golgi localization occurs in the absence of Sendai virus glycoproteins. Images PMID:8380460

  12. Impact of DNA vector topology on non-viral gene therapeutic safety and efficacy.

    PubMed

    Sum, Chi H; Wettig, Shawn; Slavcev, Roderick A

    2014-01-01

    Gene therapy continues to grow as an emerging treatment strategy toward numerous diseases. However, such prospects are hindered by the use of viral vectors prompting significant safety concerns along with limitations concerning repeat administrations, size of delivered gene construct, scale-up, high production costs, contamination during production, and lack of desired tissue selectivity. Non-viral gene delivery demonstrates the potential to address the abovementioned limitations, but itself generally suffers from low efficacy. Continuing efforts have been made to develop innovative delivery systems, synthetic gene carriers, and DNA vectors in a concerted attempt to enhance gene delivery suitable for clinical applications. In this review, we focus on the advances in the design of novel DNA vectors catered to enhance transfection and transgene expression and their influences on the efficacy and safety of existing and emerging delivery systems and synthetic vectors for non viral gene delivery.

  13. Viral nanomotors for packaging of dsDNA and dsRNA

    PubMed Central

    Guo, Peixuan; Lee, Tae Jin

    2007-01-01

    While capsid proteins are assembled around single-stranded genomic DNA or RNA in rod-shaped viruses, the lengthy double-stranded genome of other viruses is packaged forcefully within a preformed protein shell. This entropically unfavourable DNA or RNA packaging is accomplished by an ATP-driven viral nanomotor, which is mainly composed of two components, the oligomerized channel and the packaging enzymes. This intriguing DNA or RNA packaging process has provoked interest among virologists, bacteriologists, biochemists, biophysicists, chemists, structural biologists and computational scientists alike, especially those interested in nanotechnology, nanomedicine, AAA+ family proteins, energy conversion, cell membrane transport, DNA or RNA replication and antiviral therapy. This review mainly focuses on the motors of double-stranded DNA viruses, but double-stranded RNA viral motors are also discussed due to interesting similarities. The novel and ingenious configuration of these nanomotors has inspired the development of biomimetics for nanodevices. Advances in structural and functional studies have increased our understanding of the molecular basis of biological movement to the point where we can begin thinking about possible applications of the viral DNA packaging motor in nanotechnology and medical applications. PMID:17501915

  14. Predicting DNA-Binding Specificities of Eukaryotic Transcription Factors

    PubMed Central

    Schröder, Adrian; Eichner, Johannes; Supper, Jochen; Eichner, Jonas; Wanke, Dierk; Henneges, Carsten; Zell, Andreas

    2010-01-01

    Today, annotated amino acid sequences of more and more transcription factors (TFs) are readily available. Quantitative information about their DNA-binding specificities, however, are hard to obtain. Position frequency matrices (PFMs), the most widely used models to represent binding specificities, are experimentally characterized only for a small fraction of all TFs. Even for some of the most intensively studied eukaryotic organisms (i.e., human, rat and mouse), roughly one-sixth of all proteins with annotated DNA-binding domain have been characterized experimentally. Here, we present a new method based on support vector regression for predicting quantitative DNA-binding specificities of TFs in different eukaryotic species. This approach estimates a quantitative measure for the PFM similarity of two proteins, based on various features derived from their protein sequences. The method is trained and tested on a dataset containing 1 239 TFs with known DNA-binding specificity, and used to predict specific DNA target motifs for 645 TFs with high accuracy. PMID:21152420

  15. pH-dependent specific binding and combing of DNA.

    PubMed Central

    Allemand, J F; Bensimon, D; Jullien, L; Bensimon, A; Croquette, V

    1997-01-01

    Recent developments in the rapid sequencing, mapping, and analysis of DNA rely on the specific binding of DNA to specially treated surfaces. We show here that specific binding of DNA via its unmodified extremities can be achieved on a great variety of surfaces by a judicious choice of the pH. On hydrophobic surfaces the best binding efficiency is reached at a pH of approximately 5.5. At that pH a approximately 40-kbp DNA is 10 times more likely to bind by an extremity than by a midsegment. A model is proposed to account for the differential adsorption of the molecule extremities and midsection as a function of pH. The pH-dependent specific binding can be used to align anchored DNA molecules by a receding meniscus, a process called molecular combing. The resulting properties of the combed molecules will be discussed. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 7 PMID:9336201

  16. DNA Methylation Reduces Binding and Cleavage by Bleomycin

    PubMed Central

    2015-01-01

    In a recent study, we described the enhanced double-strand cleavage of hairpin DNAs by Fe·bleomycin (Fe·BLM) that accompanies increasingly strong binding of this antitumor agent and suggested that this effect may be relevant to the mechanism by which BLM mediates its antitumor effects. Because the DNA in tumor cells is known to be hypomethylated on cytidine relative to that in normal cells, it seemed of interest to study the possible effects of methylation status on BLM-induced double-strand DNA cleavage. Three hairpin DNAs found to bind strongly to bleomycin, and their methylated counterparts, were used to study the effect of methylation on bleomycin-induced DNA degradation. Under conditions of limited DNA cleavage, there was a significant overall decrease in the cleavage of methylated hairpin DNAs. Cytidine methylation was found to result in decreased BLM-induced cleavage at the site of methylation and to result in enhanced cleavage at adjacent nonmethylated sites. For two of the three hairpin DNAs studied, methylation was accompanied by a dramatic decrease in the binding affinity for Fe·BLM, suggesting the likelihood of diminished double-strand cleavage. The source of the persistent binding of BLM by the third hairpin DNA was identified. Also identified was the probable molecular mechanism for diminished binding and cleavage of the methylated DNAs by BLM. The possible implications of these findings for the antitumor selectivity of bleomycin are discussed. PMID:25187079

  17. De novo reconstruction of plant RNA and DNA virus genomes from viral siRNAs

    USDA-ARS?s Scientific Manuscript database

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  18. Evaluation of the presence of equine viral herpesvirus 1 (EHV-1) and equine viral herpesvirus 4 (EHV-4) DNA in stallion semen using polymerase chain reaction (PCR).

    PubMed

    Hebia-Fellah, Imen; Léauté, Anne; Fiéni, Francis; Zientara, Stéphan; Imbert-Marcille, Berthe-Marie; Besse, Bernard; Fortier, Guillaume; Pronost, Stephane; Miszczak, Fabien; Ferry, Bénédicte; Thorin, Chantal; Pellerin, Jean-Louis; Bruyas, Jean-François

    2009-06-01

    In the horse, the risk of excretion of two major equine pathogens (equine herpesvirus types 1 (EHV-1) and 4 (EHV-4)) in semen is unknown. The objective of our study was to assess the possible risks for the horizontal transmission of equine rhinopneumonitis herpesviruses via the semen and the effect of the viruses on stallion fertility. Samples of stallion semen (n=390) were gathered from several different sources. Examination of the semen involved the detection of viral DNA using specific PCR. The mean fertility of the stallions whose sperm tested positive for viral DNA and the mean fertility of stallions whose sperm did not contain viral DNA, were compared using the Student's t-test. EHV-4 viral DNA was not detected in any of the semen samples. EHV-1 DNA was identified in 51 of the 390 samples, (13%). One hundred and eighty-two samples came from 6 studs and there was significant difference (p<0.05) among the proportion of stallions whose semen tested positive for viral DNA from 0 to 55% between the studs. There was a significant difference (p<0.014) between the fertility of stallions whose semen tested positive for viral DNA and those whose semen was free from viral DNA. The stallions that excreted the EHV-1 virus in their semen appeared to be more fertile than the non-excretors, but this difference was in fact related to the breeding technique since higher proportion of excretors were found among those whose semen was used fresh rather than preserved by cooling or freezing. In conclusion, this study suggests that the EHV-1 virus may be transmitted via the semen at mating or by artificial insemination as demonstrated with other herpes viruses in other species.

  19. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  20. NAD+ Modulates p53 DNA Binding Specificity and Function

    PubMed Central

    McLure, Kevin G.; Takagi, Masatoshi; Kastan, Michael B.

    2004-01-01

    DNA damage induces p53 DNA binding activity, which affects tumorigenesis, tumor responses to therapies, and the toxicities of cancer therapies (B. Vogelstein, D. Lane, and A. J. Levine, Nature 408:307-310, 2000; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Both transcriptional and transcription-independent activities of p53 contribute to DNA damage-induced cell cycle arrest, apoptosis, and aneuploidy prevention (M. B. Kastan et al., Cell 71:587-597, 1992; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Small-molecule manipulation of p53 DNA binding activity has been an elusive goal, but here we show that NAD+ binds to p53 tetramers, induces a conformational change, and modulates p53 DNA binding specificity in vitro. Niacinamide (vitamin B3) increases the rate of intracellular NAD+ synthesis, alters radiation-induced p53 DNA binding specificity, and modulates activation of a subset of p53 transcriptional targets. These effects are likely due to a direct effect of NAD+ on p53, as a molecule structurally related to part of NAD+, TDP, also inhibits p53 DNA binding, and the TDP precursor, thiamine (vitamin B1), inhibits intracellular p53 activity. Niacinamide and thiamine affect two p53-regulated cellular responses to ionizing radiation: rereplication and apoptosis. Thus, niacinamide and thiamine form a novel basis for the development of small molecules that affect p53 function in vivo, and these results suggest that changes in cellular energy metabolism may regulate p53. PMID:15509798

  1. Comparison of DNA extraction methods from small samples of newborn screening cards suitable for retrospective perinatal viral research.

    PubMed

    McMichael, Gai L; Highet, Amanda R; Gibson, Catherine S; Goldwater, Paul N; O'Callaghan, Michael E; Alvino, Emily R; MacLennan, Alastair H

    2011-04-01

    Reliable detection of viral DNA in stored newborn screening cards (NSC) would give important insight into possible silent infection during pregnancy and around birth. We sought a DNA extraction method with sufficient sensitivity to detect low copy numbers of viral DNA from small punch samples of NSC. Blank NSC were spotted with seronegative EDTA-blood and seropositive EBV EDTA-blood. DNA was extracted with commercial and noncommercial DNA extraction methods and quantified on a spectrofluorometer using a PicoGreen dsDNA quantification kit. Serial dilutions of purified viral DNA controls determined the sensitivity of the amplification protocol, and seropositive EBV EDTA-blood amplified by nested PCR (nPCR) validated the DNA extraction methods. There were considerable differences between the commercial and noncommercial DNA extraction methods (P=0.014; P=0.016). Commercial kits compared favorably, but the QIamp DNA micro kit with an added forensic filter step was marginally more sensitive. The mean DNA yield from this method was 3 ng/μl. The limit of detection was 10 viral genome copies in a 50-μl reaction. EBV nPCR detection in neat and 1:10 diluted DNA extracts could be replicated reliably. We conclude that the QIamp Micro DNA extraction method with the added forensic spin-filter step was suitable for retrospective DNA viral assays from NSC.

  2. Determination of HIV-1 coreceptor tropism using proviral DNA in women before and after viral suppression.

    PubMed

    Baumann, Russell E; Rogers, Amy A; Hamdan, Hasnah B; Burger, Harold; Weiser, Barbara; Gao, Wei; Anastos, Kathryn; Young, Mary; Meyer, William A; Pesano, Rick L; Kagan, Ron M

    2015-01-01

    An HIV-1 tropism test is recommended prior to CCR5 antagonist administration to exclude patients harboring non-R5 virus from treatment with this class of antiretrovirals. HIV-1 tropism determination based on proviral DNA (pvDNA) may be useful in individuals with plasma viral RNA suppression. We developed a genotypic tropism assay for pvDNA and assessed its performance in a retrospective analysis of samples collected longitudinally. We randomly selected paired plasma/PBMC samples from the Women's Interagency HIV Study with plasma viral load ≥5,000 cp/mL at time 1 (T1), undetectable viral load maintained for ≥1 year and CD4+ >200 cells/μL at time 2 (T2). pvDNA was isolated from cryopreserved PBMCs. Sequences were analyzed in triplicate from 49/50 women, with tropism assigned using the geno2pheno (g2p) algorithm. The median time between T1 and T2 was 4.1 years. CXCR4-using virus was detected in 24% of the RNA samples and 33% of the pvDNA samples at T1, compared to 37% of the pvDNA samples at T2. Concordance between plasma RNA and pvDNA tropism was 88% at T1 and 80% at T2. The g2p scores for RNA (T1) vs DNA (T1, T2) were strongly correlated (Spearman rho: 0.85 (T1); 0.78 (T2)). In women with evidence of tropism switch at T2 (either R5 to non-R5 or non-R5 to R5), there was a correlation between change in tropism and time. Mean pvDNA viral load decreased by 0.4 log10 copies/106 cells between T1 and T2 (p < 0.0001), but this decrease was not significantly associated with tropism status. We demonstrated that pvDNA tropism in women with HIV-1 suppression is concordant with prior RNA tropism results, even after a median time of >4 years. pvDNA tropism testing may be useful to determine eligibility of patients with viral suppression to switch to a CCR5-antagonist based regimen as well as for research purposes.

  3. Recombinant covalently closed circular hepatitis B virus DNA induces prolonged viral persistence in immunocompetent mice.

    PubMed

    Qi, Zhihua; Li, Gaiyun; Hu, Hao; Yang, Chunhui; Zhang, Xiaoming; Leng, Qibin; Xie, Youhua; Yu, Demin; Zhang, Xinxin; Gao, Yueqiu; Lan, Ke; Deng, Qiang

    2014-07-01

    It remains crucial to develop a laboratory model for studying hepatitis B virus (HBV) chronic infection. We hereby produced a recombinant covalently closed circular DNA (rcccDNA) in view of the key role of cccDNA in HBV persistence. A loxP-chimeric intron was engineered into a monomeric HBV genome in a precursor plasmid (prcccDNA), which was excised using Cre/loxP-mediated DNA recombination into a 3.3-kb rcccDNA in the nuclei of hepatocytes. The chimeric intron was spliced from RNA transcripts without interrupting the HBV life cycle. In cultured hepatoma cells, cotransfection of prcccDNA and pCMV-Cre (encoding Cre recombinase) resulted in accumulation of nuclear rcccDNA that was heat stable and epigenetically organized as a minichromosome. A mouse model of HBV infection was developed by hydrodynamic injection of prcccDNA. In the presence of Cre recombinase, rcccDNA was induced in the mouse liver with effective viral replication and expression, triggering a compromised T-cell response against HBV. Significant T-cell hyporesponsiveness occurred in mice receiving 4 μg prcccDNA, resulting in prolonged HBV antigenemia for up to 9 weeks. Persistent liver injury was observed as elevated alanine transaminase activity in serum and sustained inflammatory infiltration in the liver. Although a T-cell dysfunction was induced similarly, mice injected with a plasmid containing a linear HBV replicon showed rapid viral clearance within 2 weeks. Collectively, our study provides an innovative approach for producing a cccDNA surrogate that established HBV persistence in immunocompetent mice. It also represents a useful model system in vitro and in vivo for evaluating antiviral treatments against HBV cccDNA. Importance: (i) Unlike plasmids that contain a linear HBV replicon, rcccDNA established HBV persistence with sustained liver injury in immunocompetent mice. This method could be a prototype for developing a mouse model of chronic HBV infection. (ii) An exogenous intron was

  4. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    PubMed Central

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  5. The herpes simplex virus 1 UL15 gene encodes two proteins and is required for cleavage of genomic viral DNA.

    PubMed Central

    Baines, J D; Poon, A P; Rovnak, J; Roizman, B

    1994-01-01

    Previous studies have shown that a ts mutant [herpes simplex virus 1 (mP)ts66.4] in the UL15 gene fails to package viral DNA into capsids (A. P. W. Poon and B. Roizman, J. Virol. 67:4497-4503, 1993) and that although the intron separating the first and second exons of the UL15 gene contains UL16 and UL17 open reading frames, replacement of the first exon with a cDNA copy of the entire gene does not affect viral replication (J.D. Baines, and B. Roizman, J. Virol. 66:5621-5626, 1992). We report that (i) a polyclonal rabbit antiserum generated against a chimeric protein consisting of the bacterial maltose-binding protein fused in frame to the majority of sequences contained in the second exon of the UL15 gene reacted with two proteins with M(r) of 35,000 and 75,000, respectively, in cells infected with a virus containing the authentic gene yielding a spliced mRNA or with a virus in which the authentic UL15 gene was replaced with a cDNA copy. (ii) Insertion of 20 additional codons into the C terminus of UL15 exon II caused a reduction in the electrophoretic mobility of both the apparently 35,000- and 75,000-M(r) proteins, unambiguously demonstrating that both share the carboxyl terminus of the UL15 exon II. (iii) Accumulation of the 35,000-M(r) protein was reduced in cells infected and maintained in the presence of phosphonoacetate, an inhibitor of viral DNA synthesis. (iv) The UL15 proteins were localized in the perinuclear space at 6 h after infection and largely in the nucleus at 12 h after infection. (v) Viral DNA accumulating in cells infected with herpes simplex virus 1(mP)ts66.4 and maintained at the nonpermissive temperature was in an endless (concatemeric) form, and therefore UL15 is required for the cleavage of mature, unit-length molecules for packaging into capsids. Images PMID:7966602

  6. Mechanistic insight into ligand binding to G-quadruplex DNA

    PubMed Central

    Di Leva, Francesco Saverio; Novellino, Ettore; Cavalli, Andrea; Parrinello, Michele; Limongelli, Vittorio

    2014-01-01

    Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadruplexes, which regulate many relevant biological processes. For instance, the formation of G-quadruplex at telomeres can alter cellular functions, inducing apoptosis. Thus, developing small molecules that are able to bind and stabilize the telomeric G-quadruplexes represents an attractive strategy for antitumor therapy. An example is 3-(benzo[d]thiazol-2-yl)-7-hydroxy-8-((4-(2-hydroxyethyl)piperazin-1-yl)methyl)-2H-chromen-2-one (compound 1), recently identified as potent ligand of the G-quadruplex [d(TGGGGT)]4 with promising in vitro antitumor activity. The experimental observations are suggestive of a complex binding mechanism that, despite efforts, has defied full characterization. Here, we provide through metadynamics simulations a comprehensive understanding of the binding mechanism of 1 to the G-quadruplex [d(TGGGGT)]4. In our calculations, the ligand explores all the available binding sites on the DNA structure and the free-energy landscape of the whole binding process is computed. We have thus disclosed a peculiar hopping binding mechanism whereas 1 is able to bind both to the groove and to the 3’ end of the G-quadruplex. Our results fully explain the available experimental data, rendering our approach of great value for further ligand/DNA studies. PMID:24753420

  7. Chitosan-graft-polyethylenimine/DNA nanoparticles as novel non-viral gene delivery vectors targeting osteoarthritis.

    PubMed

    Lu, Huading; Dai, Yuhu; Lv, Lulu; Zhao, Huiqing

    2014-01-01

    The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes.

  8. High Serum Lipopolysaccharide-Binding Protein Level in Chronic Hepatitis C Viral Infection Is Reduced by Anti-Viral Treatments

    PubMed Central

    Nien, Hsiao-Ching; Hsu, Shih-Jer; Su, Tung-Hung; Yang, Po-Jen; Sheu, Jin-Chuan; Wang, Jin-Town; Chow, Lu-Ping; Chen, Chi-Ling

    2017-01-01

    Background Lipopolysaccharide-binding protein (LBP) has been reported to associate with metabolic diseases, such as obesity, diabetes, and non-alcoholic fatty liver disease. Since chronic hepatitis C virus (HCV) infection is associated with metabolic derangements, the relationship between LBP and HCV deserves additional studies. This study aimed to determine the serum LBP level in subjects with or without HCV infection and investigate the change of its level after anti-viral treatments with or without interferon. Methods and Findings We recruited 120 non-HCV subjects, 42 and 17 HCV-infected subjects respectively treated with peginterferon α-2a/ribavirin and direct-acting antiviral drugs. Basic information, clinical data, serum LBP level and abdominal ultrasonography were collected. All the subjects provided written informed consent before being enrolled approved by the Research Ethics Committee of the National Taiwan University Hospital. Serum LBP level was significantly higher in HCV-infected subjects than non-HCV subjects (31.0 ± 8.8 versus 20.0 ± 6.4 μg/mL; p-value < 0.001). After multivariate analyses, LBP at baseline was independently associated with body mass index, hemoglobin A1c, alanine aminotransferase (ALT) and HCV infection. Moreover, the baseline LBP was only significantly positively associated with ALT and inversely with fatty liver in HCV-infected subjects. The LBP level significantly decreased at sustained virologic response (27.4 ± 6.6 versus 34.6 ± 7.3 μg/mL, p-value < 0.001; 15.9 ± 4.4 versus 22.2 ± 5.7 μg/mL, p-value = 0.001), regardless of interferon-based or -free therapy. Conclusions LBP, an endotoxemia associated protein might be used as an inflammatory biomarker of both infectious and non-infectious origins in HCV-infected subjects. PMID:28107471

  9. Effect of sodium butyrate on induction of cellular and viral DNA syntheses in polyoma virus-infected mouse kidney cells.

    PubMed Central

    Wawra, E; Pöckl, E; Müllner, E; Wintersberger, E

    1981-01-01

    Sodium butyrate inhibited initiation of viral and cellular DNA replication in polyoma virus-infected mouse kidney cells. Ongoing viral or cellular DNA replication, however, was not affected by the presence of the substance. Butyrate had no effect on T-antigen synthesis and on the stimulation of transcription, one of the earliest reactions of the infected cells to the appearance of T-antigen, nor did it inhibit expression of late viral genes (synthesis of viral capsid proteins). In addition to blocking the onset of DNA synthesis, butyrate also inhibited stimulation of the activities of enzymes involved in DNA synthesis. When butyrate was removed, viral and cellular DNA syntheses were induced in parallel after a lag period of approximately 4 h. At the same time, the activities of enzymes involved in DNA synthesis increase. If protein synthesis was inhibited during part of the lag period, the initiation of DNA synthesis was retarded for the same time interval, suggesting that the proteins involved in the initiation of DNA replication had to be made. We have developed an in vitro system for measuring DNA synthesis in crude nuclear preparations which mimics the status of DNA replication in intact cells and may help in future experiments to study the requirements for initiation of cellular and viral DNA synthesis and the possible involvement of T-antigens in this reaction. Images PMID:6264167

  10. Asymmetric DNA binding by a homodimeric bHLH protein.

    PubMed

    Winston, R L; Ehley, J A; Baird, E E; Dervan, P B; Gottesfeld, J M

    2000-08-08

    Protein-DNA interactions that lie outside of the core recognition sequence for the Drosophila bHLH transcription factor Deadpan (Dpn) were investigated using minor groove binding pyrrole-imidazole polyamides. Electrophoretic mobility shift assays and DNase I footprinting demonstrate that hairpin polyamides bound immediately upstream, but not immediately downstream of the Dpn homodimer selectively inhibit protein-DNA complex formation. Mutation of the Dpn consensus binding site from the asymmetric sequence 5'-CACGCG-3' to the palindromic sequence 5'-CACGTG-3' abolishes asymmetric inhibition. A Dpn mutant containing the unnatural amino acid norleucine in place of lysine at position 80 in the bHLH loop region is not inhibited by the polyamide, suggesting that the epsilon amino group at this position is responsible for DNA contacts outside the major groove. We conclude that the nonpalindromic Dpn recognition site imparts binding asymmetry by providing unique contacts to the basic region of each monomer in the bHLH homodimer.

  11. Prediction of DNA-binding proteins from relational features

    PubMed Central

    2012-01-01

    Background The process of protein-DNA binding has an essential role in the biological processing of genetic information. We use relational machine learning to predict DNA-binding propensity of proteins from their structures. Automatically discovered structural features are able to capture some characteristic spatial configurations of amino acids in proteins. Results Prediction based only on structural relational features already achieves competitive results to existing methods based on physicochemical properties on several protein datasets. Predictive performance is further improved when structural features are combined with physicochemical features. Moreover, the structural features provide some insights not revealed by physicochemical features. Our method is able to detect common spatial substructures. We demonstrate this in experiments with zinc finger proteins. Conclusions We introduced a novel approach for DNA-binding propensity prediction using relational machine learning which could potentially be used also for protein function prediction in general. PMID:23146001

  12. Stage specific kinetoplast DNA-binding proteins in Trypanosoma cruzi.

    PubMed

    Zavala-Castro, J E; Acosta-Viana, K; Guzmán-Marín, E; Rosado-Barrera, M E; Rosales-Encina, J L

    2000-09-18

    Knowledge regarding kinetoplast DNA organization in all members of the Trypanosomatid family is incomplete. Recently, the presence of kinetoplast-associated proteins in condensing kDNA networks in Crithidia fasciculata has been described and a role for these proteins in the maintenance of these complex structures was suggested. To investigate the presence of protein components in Trypanosoma cruzi kinetoplast, we previously described seven epimastigote kinetoplast-associated proteins. We report here the existence of kinetoplast binding proteins in amastigote and trypomastigote stages of T. cruzi, which could bind both mini and maxicircles components with a stage specific elements for every infective form of the parasite. We propose three major classes of kinetoplast-associated proteins related to the basic processes of this intricate disc structure and suggest a possible function of these binding proteins in the T. cruzi mitochondrial DNA organization.

  13. Solution structure and binding specificity of the p63 DNA binding domain

    PubMed Central

    Enthart, Andreas; Klein, Christian; Dehner, Alexander; Coles, Murray; Gemmecker, Gerd; Kessler, Horst; Hagn, Franz

    2016-01-01

    p63 is a close homologue of p53 and, together with p73, is grouped into the p53 family of transcription factors. p63 is known to be involved in the induction of controlled apoptosis important for differentiation processes, germ line integrity and development. Despite its high homology to p53, especially within the DNA binding domain (DBD), p63-DBD does not show cooperative DNA binding properties and is significantly more stable against thermal and chemical denaturation. Here, we determined the solution structure of p63-DBD and show that it is markedly less dynamic than p53-DBD. In addition, we also investigate the effect of a double salt bridge present in p53-DBD, but not in p63-DBD on the cooperative binding behavior and specificity to various DNA sites. Restoration of the salt bridges in p63-DBD by mutagenesis leads to enhanced binding affinity to p53-specific, but not p63-specific response elements. Furthermore, we show that p63-DBD is capable of binding to anti-apoptotic BclxL via its DNA binding interface, a feature that has only been shown for p53 so far. These data suggest that all p53 family members - despite alterations in the specificity and binding affinity - are capable of activating pro-apoptotic pathways in a tissue specific manner. PMID:27225672

  14. Learning to Translate Sequence and Structure to Function: Identifying DNA Binding and Membrane Binding Proteins

    PubMed Central

    Langlois, Robert E; Carson, Matthew B; Bhardwaj, Nitin; Lu, Hui

    2009-01-01

    A protein's function depends in a large part on interactions with other molecules. With an increasing number of protein structures becoming available every year, a corresponding structural annotation approach identifying such interactions grows more expedient. At the same time, machine learning has gained popularity in bioinformatics because it provides robust annotation of genes and proteins without depending solely on sequence similarity. Here we developed a machine learning protocol to identify DNA-binding proteins and membrane-binding proteins. In general, there is no theory or even rule of thumb to pick the best machine learning algorithm. Thus, a systematic comparison of several classification algorithms known to perform well was investigated. Indeed, the boosted tree classifier was found to give the best performance, achieving 93% and 88% accuracy to discriminate non-homologous DNA-binding proteins and membrane-binding proteins respectively from non-binding proteins, significantly outperforming all previously published works. We also explored the importance of a protein's attributes in function prediction and the relationships between relevant attributes. A graphical model based on boosted trees was applied to study the important features in discriminating DNA-binding proteins. In summary, the current protocol identified physical features important in DNA- and membrane-binding, rather than annotating function through sequence similarity. PMID:17436108

  15. Solution structure and binding specificity of the p63 DNA binding domain.

    PubMed

    Enthart, Andreas; Klein, Christian; Dehner, Alexander; Coles, Murray; Gemmecker, Gerd; Kessler, Horst; Hagn, Franz

    2016-05-26

    p63 is a close homologue of p53 and, together with p73, is grouped into the p53 family of transcription factors. p63 is known to be involved in the induction of controlled apoptosis important for differentiation processes, germ line integrity and development. Despite its high homology to p53, especially within the DNA binding domain (DBD), p63-DBD does not show cooperative DNA binding properties and is significantly more stable against thermal and chemical denaturation. Here, we determined the solution structure of p63-DBD and show that it is markedly less dynamic than p53-DBD. In addition, we also investigate the effect of a double salt bridge present in p53-DBD, but not in p63-DBD on the cooperative binding behavior and specificity to various DNA sites. Restoration of the salt bridges in p63-DBD by mutagenesis leads to enhanced binding affinity to p53-specific, but not p63-specific response elements. Furthermore, we show that p63-DBD is capable of binding to anti-apoptotic BclxL via its DNA binding interface, a feature that has only been shown for p53 so far. These data suggest that all p53 family members - despite alterations in the specificity and binding affinity - are capable of activating pro-apoptotic pathways in a tissue specific manner.

  16. Quantitative Determination of Binding of ISWI to Nucleosomes and DNA Shows Allosteric Regulation of DNA Binding by Nucleotides

    PubMed Central

    2015-01-01

    The regulation of chromatin structure is controlled by a family of molecular motors called chromatin remodelers. The ability of these enzymes to remodel chromatin structure is dependent on their ability to couple ATP binding and hydrolysis into the mechanical work that drives nucleosome repositioning. The necessary first step in determining how these essential enzymes perform this function is to characterize both how they bind nucleosomes and how this interaction is regulated by ATP binding and hydrolysis. With this goal in mind, we monitored the interaction of the chromatin remodeler ISWI with fluorophore-labeled nucleosomes and DNA through associated changes in fluorescence anisotropy of the fluorophore upon binding of ISWI to these substrates. We determined that one ISWI molecule binds to a 20 bp double-stranded DNA substrate with an affinity of 18 ± 2 nM. In contrast, two ISWI molecules can bind to the core nucleosome with short linker DNA with stoichiometric macroscopic equilibrium constants: 1/β1 = 1.3 ± 0.6 nM, and 1/β2 = 13 ± 7 nM2. Furthermore, to improve our understanding of the mechanism of DNA translocation by ISWI, and hence nucleosome repositioning, we determined the effect of nucleotide analogues on substrate binding by ISWI. While the affinity of ISWI for the nucleosome substrate with short lengths of flanking DNA was not affected by the presence of nucleotides, the affinity of ISWI for the DNA substrate is weakened in the presence of nonhydrolyzable ATP analogues but not by ADP. PMID:24898734

  17. Chromatin landscape dictates HSF binding to target DNA elements.

    PubMed

    Guertin, Michael J; Lis, John T

    2010-09-09

    Sequence-specific transcription factors (TFs) are critical for specifying patterns and levels of gene expression, but target DNA elements are not sufficient to specify TF binding in vivo. In eukaryotes, the binding of a TF is in competition with a constellation of other proteins, including histones, which package DNA into nucleosomes. We used the ChIP-seq assay to examine the genome-wide distribution of Drosophila Heat Shock Factor (HSF), a TF whose binding activity is mediated by heat shock-induced trimerization. HSF binds to 464 sites after heat shock, the vast majority of which contain HSF Sequence-binding Elements (HSEs). HSF-bound sequence motifs represent only a small fraction of the total HSEs present in the genome. ModENCODE ChIP-chip datasets, generated during non-heat shock conditions, were used to show that inducibly bound HSE motifs are associated with histone acetylation, H3K4 trimethylation, RNA Polymerase II, and coactivators, compared to HSE motifs that remain HSF-free. Furthermore, directly changing the chromatin landscape, from an inactive to an active state, permits inducible HSF binding. There is a strong correlation of bound HSEs to active chromatin marks present prior to induced HSF binding, indicating that an HSE's residence in "active" chromatin is a primary determinant of whether HSF can bind following heat shock.

  18. Ultrasound enhances the transfection of plasmid DNA by non-viral vectors.

    PubMed

    Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko

    2003-04-01

    Increasing attention has been paid to technology used for the delivery of genetic materials into cells for gene therapy and the generation of genetically engineered cells. So far, viral vectors have been mainly used because of their inherently high transfection efficiency of gene. However, there are some problems to be resolved for the clinical applications, such as the pathogenicity and immunogenicity of viral vectors themselves. Therefore, many research trials with non-viral vectors have been performed to enhance their efficiency to a level comparable to the viral vector. Two directions of these trials exist: material improvement of non-viral vectors and their combination with various external physical stimuli. This paper reviews the latter research trials, with special attention paid to the enhancement of gene expression by ultrasound (US). The expression level of plasmid DNA by various cationized polymers and liposomes is promoted by US irradiation in vitro as well as in vivo. This US-enhanced expression of plasmid DNA will be discussed to emphasize the technical feasibility of US in gene therapy and biotechnology.

  19. The crystal structure of the DNA-binding domain of vIRF-1 from the oncogenic KSHV reveals a conserved fold for DNA binding and reinforces its role as a transcription factor

    PubMed Central

    Hew, Kelly; Venkatachalam, Rajakannan; Nasertorabi, Fariborz; Lim, Bee Ting; Cornvik, Tobias; Nordlund, Pär

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus encodes four viral homologues to cellular interferon regulatory factors (IRFs), where the most studied is vIRF-1. Even though vIRF-1 shows sequence homology to the N-terminal DNA-binding domain (DBD) of human IRFs, a specific role for this domain in vIRF-1’s function has remained uncertain. To provide insights into the function of the vIRF-1 DBD, we have determined the crystal structure of it in complex with DNA and in its apo-form. Using a thermal stability shift assay (TSSA), we show that the vIRF-1 DBD binds DNA, whereas full-length vIRF-1 does not, suggesting a cis-acting regulatory mechanism in similarity to human IRFs. The complex structure of vIRF-1 DBD reveals interactions with the DNA backbone and the positioning of two arginines for specific recognition in the major grove. A superimposition with human IRF-3 reveals a similar positioning of the two specificity-determining arginines, and additional TSSAs indicate binding of vIRF-1 to an IRF-3 operator consensus sequence. The results from this study, therefore, provide support that vIRF-1 has evolved to bind DNA and plays a role in DNA binding in the context of transcriptional regulation and might act on some of the many operator sequences controlled by human IRF-3. PMID:23435230

  20. Portal control of viral prohead expansion and DNA packaging

    SciTech Connect

    Ray, Krishanu; Oram, Mark; Ma, Jinxia; Black, Lindsay W.

    2009-08-15

    Bacteriophage T4 terminase packages DNA in vitro into empty small or large proheads (esps or elps). In vivo maturation of esps yields the more stable and voluminous elps required to contain the 170 kb T4 genome. Functional proheads can be assembled containing portal-GFP fusion proteins. In the absence of terminase activity these accumulated in esps in vivo, whereas wild-type portals were found in elps. By nuclease protection assay dsDNAs of lengths 0.1, 0.2, 0.5, 5, 11, 20, 40 or 170 kb were efficiently packaged into wild-type elps in vitro, but less so into esps and gp20-GFP elps; particularly with DNAs shorter than 11 kb. However, 0.1 kb substrates were equally efficiently packaged into all types of proheads as judged by fluorescence correlation spectroscopy. These data suggest the portal controls the expansion of the major capsid protein lattice during prohead maturation, and that this expansion is necessary for DNA protection but not for packaging.

  1. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L

    1995-01-01

    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  2. DNA Mutagenic Activity and Capacity for HIV-1 Restriction of the Cytidine Deaminase APOBEC3G Depends on Whether DNA or RNA Binds to Tyrosine 315.

    PubMed

    Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E; Bennett, Ryan P; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A; Smith, Harold C

    2017-04-05

    APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. RNA and ssDNA bind to the same three A3G tryptic peptides (amino acids 181-194, 314-320, and 345-374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C-terminus of A3G to its N-terminus. We show here that the A3G tyrosines 181 and 315 directly cross-link ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an E. coli DNA mutator reporter, while Y181A and Y182A mutants retained ~50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Y315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Y315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity.

  3. Exploring the DNA-binding specificities of zinc fingers with DNA microarrays

    PubMed Central

    Bulyk, Martha L.; Huang, Xiaohua; Choo, Yen; Church, George M.

    2001-01-01

    A key step in the regulation of networks that control gene expression is the sequence-specific binding of transcription factors to their DNA recognition sites. A more complete understanding of these DNA–protein interactions will permit a more comprehensive and quantitative mapping of the regulatory pathways within cells, as well as a deeper understanding of the potential functions of individual genes regulated by newly identified DNA-binding sites. Here we describe a DNA microarray-based method to characterize sequence-specific DNA recognition by zinc-finger proteins. A phage display library, prepared by randomizing critical amino acid residues in the second of three fingers of the mouse Zif268 domain, provided a rich source of zinc-finger proteins with variant DNA-binding specificities. Microarrays containing all possible 3-bp binding sites for the variable zinc fingers permitted the quantitation of the binding site preferences of the entire library, pools of zinc fingers corresponding to different rounds of selection from this library, as well as individual Zif268 variants that were isolated from the library by using specific DNA sequences. The results demonstrate the feasibility of using DNA microarrays for genome-wide identification of putative transcription factor-binding sites. PMID:11404456

  4. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products.

    PubMed

    Sowd, Gregory A; Mody, Dviti; Eggold, Joshua; Cortez, David; Friedman, Katherine L; Fanning, Ellen

    2014-12-01

    Simian virus 40 (SV40) and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PK(cs) kinase activity, facilitates some aspects of double strand break (DSB) repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR) and do not colocalize with non-homologous end joining (NHEJ) factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PK(cs) and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5' to 3' end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication.

  5. SV40 Utilizes ATM Kinase Activity to Prevent Non-homologous End Joining of Broken Viral DNA Replication Products

    PubMed Central

    Sowd, Gregory A.; Mody, Dviti; Eggold, Joshua; Cortez, David; Friedman, Katherine L.; Fanning, Ellen

    2014-01-01

    Simian virus 40 (SV40) and cellular DNA replication rely on host ATM and ATR DNA damage signaling kinases to facilitate DNA repair and elicit cell cycle arrest following DNA damage. During SV40 DNA replication, ATM kinase activity prevents concatemerization of the viral genome whereas ATR activity prevents accumulation of aberrant genomes resulting from breakage of a moving replication fork as it converges with a stalled fork. However, the repair pathways that ATM and ATR orchestrate to prevent these aberrant SV40 DNA replication products are unclear. Using two-dimensional gel electrophoresis and Southern blotting, we show that ATR kinase activity, but not DNA-PKcs kinase activity, facilitates some aspects of double strand break (DSB) repair when ATM is inhibited during SV40 infection. To clarify which repair factors associate with viral DNA replication centers, we examined the localization of DSB repair proteins in response to SV40 infection. Under normal conditions, viral replication centers exclusively associate with homology-directed repair (HDR) and do not colocalize with non-homologous end joining (NHEJ) factors. Following ATM inhibition, but not ATR inhibition, activated DNA-PKcs and KU70/80 accumulate at the viral replication centers while CtIP and BLM, proteins that initiate 5′ to 3′ end resection during HDR, become undetectable. Similar to what has been observed during cellular DSB repair in S phase, these data suggest that ATM kinase influences DSB repair pathway choice by preventing the recruitment of NHEJ factors to replicating viral DNA. These data may explain how ATM prevents concatemerization of the viral genome and promotes viral propagation. We suggest that inhibitors of DNA damage signaling and DNA repair could be used during infection to disrupt productive viral DNA replication. PMID:25474690

  6. Xenopus interspersed RNA families, Ocr and XR, bind DNA-binding proteins.

    PubMed

    Guttridge, K L; Smith, L D

    1995-05-01

    Interspersed RNA makes up two-thirds of cytoplasmic polyadenylated RNA in Xenopus and sea urchin eggs. Although it has no known function, previous work has suggested that at least one family of interspersed RNA, XR, binds Xenopus oocyte proteins, and can influence the rate of translation. We have used two Xenopus repeat families, Ocr and XR, to explore their protein binding abilities. Ocr RNA binds the same pattern of highly abundant oocyte proteins that XR RNA binds, which are believed to be messenger ribonucleoprotein (mRNP) particle proteins. In addition, we show that Ocr RNA binds the Oct-60 protein, a member of the POU-domain family of transcription factors found in Xenopus oocytes. Using a 32 base pair sequence from the XR repeat in a DNA affinity column two proteins were isolated, 66 kDa and 92 kDa, that together form a complex with XR DNA. One of these proteins (92 kDa) also binds XR RNA. We suggest that the role of at least a subset of interspersed RNAs in development may be to bind, and sequester in the cytoplasm, DNA-binding proteins until the end of oogenesis.

  7. Sendai virus-erythrocyte membrane interaction: quantitative and kinetic analysis of viral binding, dissociation, and fusion.

    PubMed

    Hoekstra, D; Klappe, K

    1986-04-01

    A kinetic and quantitative analysis of the binding and fusion of Sendai virus with erythrocyte membranes was performed by using a membrane fusion assay based on the relief of fluorescence self-quenching. At 37 degrees C, the process of virus association displayed a half time of 2.5 min; at 4 degrees C, the half time was 3.0 min. The fraction of the viral dose which became cell associated was independent of the incubation temperature and increased with increasing target membrane concentration. On the average, one erythrocyte ghost can accommodate ca. 1,200 Sendai virus particles. The stability of viral attachment was sensitive to a shift in temperature: a fraction of the virions (ca. 30%), attached at 4 degrees C, rapidly (half time, ca. 2.5 min) eluted from the cell surface at 37 degrees C, irrespective of the presence of free virus in the medium. The elution can be attributed to a spontaneous, temperature-induced release, rather than to viral neuraminidase activity. Competition experiments with nonlabeled virus revealed that viruses destined to fuse do not exchange with free particles in the medium but rather bind in a rapid and irreversible manner. The fusion rate of Sendai virus was affected by the density of the virus particles on the cell surface and became restrained when more than 170 virus particles were attached per ghost. In principle, all virus particles added displayed fusion activity. However, at high virus-to-ghost ratios, only a fraction actually fused, indicating that a limited number of fusion sites exist on the erythrocyte membrane. We estimate that ca. 180 virus particles maximally can fuse with one erythrocyte ghost.

  8. Intercalative DNA binding of the marine anticancer drug variolin B

    PubMed Central

    Canals, Albert; Arribas-Bosacoma, Raquel; Albericio, Fernando; Álvarez, Mercedes; Aymamí, Joan; Coll, Miquel

    2017-01-01

    Variolin B is a rare marine alkaloid that showed promising anti-cancer activity soon after its isolation. It acts as a cyclin-dependent kinase inhibitor, although the precise mechanism through which it exerts the cytotoxic effects is still unknown. The crystal structure of a variolin B bound to a DNA forming a pseudo-Holliday junction shows that this compound can also contribute, through intercalative binding, to either the formation or stabilization of multi-stranded DNA forms. PMID:28051169

  9. β -Cyclodextrin polymer binding to DNA: Modulating the physicochemical parameters

    NASA Astrophysics Data System (ADS)

    Rocha, J. C. B.; Silva, E. F.; Oliveira, M. F.; Sousa, F. B.; Teixeira, A. V. N. C.; Rocha, M. S.

    2017-05-01

    Cyclodextrins and cyclodextrins-modified molecules have interesting and appealing properties due to their capacity to host components that are normally insoluble or poorly soluble in water. In this work, we investigate the interaction of a β -cyclodextrin polymer (poly-β -CD) with λ -DNA. The polymers are obtained by the reaction of β -CD with epichlorohydrin in alkaline conditions. We have used optical tweezers to characterize the changes of the mechanical properties of DNA molecules by increasing the concentration of poly-β -CD in the sample. The physical chemistry of the interaction is then deduced from these measurements by using a recently developed quenched-disorder statistical model. It is shown that the contour length of the DNA does not change in the whole range of poly-β -CD concentration (<300 μ M ). On the other hand, significant alterations were observed in the persistence length that identifies two binding modes corresponding to the clustering of ˜2.6 and ˜14 polymer molecules along the DNA double helix, depending on the polymer concentration. Comparing these results with the ones obtained for monomeric β -CD, it was observed that the concentration of CD that alters the DNA persistence length is considerably smaller when in the polymeric form. Also, the binding constant of the polymer-DNA interaction is three orders of magnitude higher than the one found for native (monomeric) β -CD. These results show that the polymerization of the β -CD strongly increases its binding affinity to the DNA molecule. This property can be wisely used to modulate the binding of cyclodextrins to the DNA double helix.

  10. Estimation of biologically damaging UV levels in marine surface waters with DNA and viral dosimeters.

    PubMed

    Wilhelm, Steven W; Jeffrey, Wade H; Suttle, Curtis A; Mitchell, David L

    2002-09-01

    We have surveyed the biologically harmful radiation penetrating the water column along a transect in the western Gulf of Mexico using dosimeters consisting of intact viruses or naked calf-thymus DNA (ctDNA). The indigenous marine bacteriophage PWH3a-P1, which lytically infects the heterotrophic bacterium Vibrio natriegens (strain PWH3a), displayed decay rates for infectivity approaching 1.0 h(-1) in surface waters when deployed in a seawater-based dosimeter. The accumulation of pyrimidine dimers in ctDNA dosimeters provided a strong correlation to these results, with pyrimidine dimers representing more than 0.3% (up to ca 3800 dimers Mb(-1) DNA) of the total DNA in dosimeters exposed to sea surface levels of solar radiation. The results demonstrate a strong correlation between the dimer formation in the DNA dosimeters, the decay rates of viral infectivity and the penetration of UVB radiation into the water column. The decay of viral infectivity attenuated with depth in a manner similar to the decay of solar radiation and was still significant at 10 m in offshore oligotrophic water and at dimer frequencies less than 0.1% (ca 200-300 dimers Mb(-1) DNA).

  11. Inhibition of DNA Methylation Suppresses Intestinal Tumor Organoids by Inducing an Anti-Viral Response.

    PubMed

    Saito, Yoshimasa; Nakaoka, Toshiaki; Sakai, Kasumi; Muramatsu, Toshihide; Toshimitsu, Kohta; Kimura, Masaki; Kanai, Takanori; Sato, Toshiro; Saito, Hidetsugu

    2016-05-04

    Recent studies have proposed that the major anti-tumor effect of DNA methylation inhibitors is induction of interferon-responsive genes via dsRNAs-containing endogenous retroviruses. Recently, a 3D culture system for stem cells known as organoid culture has been developed. Lgr5-positive stem cells form organoids that closely recapitulate the properties of original tissues. To investigate the effect of DNA demethylation on tumor organoids, we have established organoids from intestinal tumors of Apc(Min/+) (Min) mice and subjected them to 5-aza-2'-deoxycytidine (5-Aza-CdR) treatment and Dnmt1 knockdown. DNA demethylation induced by 5-Aza-CdR treatment and Dnmt1 knockdown significantly reduced the cell proliferation of the tumor organoids. Microarray analyses of the tumor organoids after 5-Aza-CdR treatment and Dnmt1 knockdown revealed that interferon-responsive genes were activated by DNA demethylation. Gene ontology and pathway analyses clearly demonstrated that these genes activated by DNA demethylation are involved in the anti-viral response. These findings indicate that DNA demethylation suppresses the proliferation of intestinal tumor organoids by inducing an anti-viral response including activation of interferon-responsive genes. Treatment with DNA methylation inhibitors to activate a growth-inhibiting immune response may be an effective therapeutic approach for colon cancers.

  12. DNA scissors device used to measure MutS binding to DNA mis-pairs.

    PubMed

    Gu, Hongzhou; Yang, Wei; Seeman, Nadrian C

    2010-03-31

    MutS is a DNA repair protein that recognizes unpaired and bulged bases. When it binds to DNA, it bends the double helix. We have developed a novel DNA-based nanomechanical device that measures the amount of work that a DNA-bending protein can do when it binds to the double helix. The device we report here is a scissors-like device consisting of two double-crossover (DX) molecules connected to each other by a flexible Holliday junction. The two DX components are connected by a double helix that contains the binding site for MutS; when the binding site duplex is bent, the scissors contracts. The two DX molecules are also joined by sticky ends on an edge adjacent to the binding site; the sticky ends can be disrupted if the protein binds with sufficient free energy. Those sticky ends are flanked by a pair of dyes; when the sticky ends are disrupted, the dyes separate, and the fluorescence resonance energy transfer signal can monitor the disruption. The strength of the sticky ends is readily varied, so that the ability of the protein to disrupt them can be quantitated. We use this device to measure work in conjunction with a second device that measures the bending angle resulting from protein binding, so as to calibrate the system. Our data are in good agreement with previous measurements of MutS binding, indicating that this device is able to measure the strength of binding correctly.

  13. The MSG1 non-DNA-binding transactivator binds to the p300/CBP coactivators, enhancing their functional link to the Smad transcription factors.

    PubMed

    Yahata, T; de Caestecker, M P; Lechleider, R J; Andriole, S; Roberts, A B; Isselbacher, K J; Shioda, T

    2000-03-24

    The MSG1 nuclear protein has a strong transcriptional activating activity but does not bind directly to DNA. When cotransfected, MSG1 enhances transcription mediated by the Smad transcription factors in mammalian cells in a manner dependent on ligand-induced Smad hetero-oligomerization. However, the mechanism of this MSG1 effect has been unknown. We now show that MSG1 directly binds to the p300/cAMP-response element-binding protein-binding protein (CBP) transcriptional coactivators, which in turn bind to the Smads, and enhances Smad-mediated transcription in a manner dependent on p300/CBP. The C-terminal transactivating domain of MSG1 is required for binding to p300/CBP and enhancement of Smad-mediated transcription; the viral VP16 transactivating domain could not substitute for it. In the N-terminal region of MSG1, we identified a domain that is necessary and sufficient to direct the specific interaction of MSG1 with Smads. We also found that the Hsc70 heat-shock cognate protein also forms complex with MSG1 in vivo, suppressing both binding of MSG1 to p300/CBP and enhancement of Smad-mediated transcription by MSG1. These results indicate that MSG1 interacts with both the DNA-binding Smad proteins and the p300/CBP coactivators through its N- and C-terminal regions, respectively, and enhances the functional link between Smads and p300/CBP.

  14. ATP Binding and Hydrolysis by Mcm2 Regulate DNA Binding by Mcm Complexes

    PubMed Central

    Stead, Brent E.; Sorbara, Catherine D.; Brandl, Christopher J.; Davey, Megan J.

    2016-01-01

    The essential minichromosome maintenance (Mcm) proteins Mcm2 through Mcm7 likely comprise the replicative helicase in eukaryotes. In addition to Mcm2–7, other subcomplexes, including one comprising Mcm4, Mcm6, and Mcm7, unwind DNA. Using Mcm4/6/7 as a tool, we reveal a role for nucleotide binding by Saccharomyces cerevisiae Mcm2 in modulating DNA binding by Mcm complexes. Previous studies have shown that Mcm2 inhibits DNA unwinding by Mcm4/6/7. Here, we show that interaction of Mcm2 and Mcm4/6/7 is not sufficient for inhibition; rather, Mcm2 requires nucleotides for its regulatory role. An Mcm2 mutant that is defective for ATP hydrolysis (K549A), as well as ATP analogues, was used to show that ADP binding by Mcm2 is required to inhibit DNA binding and unwinding by Mcm4/6/7. This Mcm2-mediated regulation of Mcm4/6/7 is independent of Mcm3/5. Furthermore, the importance of ATP hydrolysis by Mcm2 to the regulation of the native complex was apparent from the altered DNA binding properties of Mcm2KA–7. Moreover, together with the finding that Mcm2K549A does not support yeast viability, these results indicate that the nucleotide-bound state of Mcm2 is critical in regulating the activities of Mcm4/6/7 and Mcm2–7 complexes. PMID:19540846

  15. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  16. Annexin II binds to capsid protein VP1 of enterovirus 71 and enhances viral infectivity.

    PubMed

    Yang, Su-Lin; Chou, Ying-Ting; Wu, Cheng-Nan; Ho, Mei-Shang

    2011-11-01

    Enterovirus type 71 (EV71) causes hand, foot, and mouth disease (HFMD), which is mostly self-limited but may be complicated with a severe to fatal neurological syndrome in some children. Understanding the molecular basis of virus-host interactions might help clarify the largely unknown neuropathogenic mechanisms of EV71. In this study, we showed that human annexin II (Anx2) protein could bind to the EV71 virion via the capsid protein VP1. Either pretreatment of EV71 with soluble recombinant Anx2 or pretreatment of host cells with an anti-Anx2 antibody could result in reduced viral attachment to the cell surface and a reduction of the subsequent virus yield in vitro. HepG2 cells, which do not express Anx2, remained permissive to EV71 infection, though the virus yield was lower than that for a cognate lineage expressing Anx2. Stable transfection of plasmids expressing Anx2 protein into HepG2 cells (HepG2-Anx2 cells) could enhance EV71 infectivity, with an increased virus yield, especially at a low infective dose, and the enhanced infectivity could be reversed by pretreating HepG2-Anx2 cells with an anti-Anx2 antibody. The Anx2-interacting domain was mapped by yeast two-hybrid analysis to VP1 amino acids 40 to 100, a region different from the known receptor binding domain on the surface of the picornavirus virion. Our data suggest that binding of EV71 to Anx2 on the cell surface can enhance viral entry and infectivity, especially at a low infective dose.

  17. Cell specificity in DNA binding and repair of chemical carcinogens.

    PubMed Central

    Swenberg, J A; Rickert, D E; Baranyi, B L; Goodman, J I

    1983-01-01

    Many animal models for organ specific neoplasia have been developed and used to study the pathogenesis of cancer. Morphologic studies have usually concentrated on the response of target cells, whereas biochemical investigations have usually employed whole organ homogenates. Since hepatocytes comprise nearly 90% of the liver's mass and 70-80% of its DNA, alterations in DNA replication, covalent binding and DNA repair of nonparenchymal cells are usually obscured when whole organ homogenates are used. By utilizing cell separation methods, we have been able to demonstrate differences between hepatocyte and nonparenchymal cell replication. DNA damage and repair following exposure to a variety of hepatocarcinogen. Differences in removal of simple O6-alkylguanine and DNA replication correlate with cell specific carcinogenesis of simply alkylating agents. For several other procarcinogens, including 2-acetylaminofluorene and dinitroluene, cell specificity appears to reside primarily in the differential metabolic competence of hepatocytes and nonparenchymal cells. This results in greater covalent binding of the carcinogen to hepatocyte DNA, although the DNA adducts are removed at a similar rate in both cell types. Images FIGURE 1. PMID:6832089

  18. Preparation of (32)P-end-labeled DNA fragments for performing DNA-binding experiments.

    PubMed

    Carey, Michael F; Peterson, Craig L; Smale, Stephen T

    2013-05-01

    The generation of a uniquely (32)P-end-labeled DNA fragment is essential for DNA-binding experiments such as DNase I footprinting and ethylation interference. We describe here a protocol for end-labeling a restriction fragment. For a plasmid DNA bearing a region containing the binding site of interest, cleaving with a single restriction endonuclease generates a 5' overhang containing a phosphate. This is generally necessary for both common forms of fragment end-labeling: phosphorylation with polynucleotide kinase and "filling in the end" with DNA polymerases (e.g., Klenow fragment). For the phosphorylation reaction, as described here, the phosphate is removed with calf intestinal phosphatase or bacterial alkaline phosphatase, and the resulting free 5'-OH is phosphorylated with polynucleotide kinase and [γ-(32)P]ATP. This generates a plasmid labeled at each end with γ-(32)P. The molar amount of plasmid DNA must be below the amount of ATP added to the reaction and the ATP must be of sufficiently high specific activity to generate a fragment labeled to the extent necessary for many DNA-binding experiments. To generate a uniquely end-labeled DNA fragment, the labeled plasmid is heat-treated to inactivate any remaining kinase and recleaved with a second endonuclease, releasing a short DNA fragment and a longer vector fragment. The DNA fragment is purified from the labeled vector on a 5%-8% native polyacrylamide gel. The preparation and labeling of DNA restriction fragments typically takes 1-2 d.

  19. Effect of knots on binding of intercalators to DNA

    NASA Astrophysics Data System (ADS)

    Medalion, Shlomi; Rabin, Yitzhak

    2014-05-01

    We study the effect of knots in circular dsDNA molecules on the binding of intercalating ligands. Using Monte Carlo simulations we show that depending on their handedness, the presence of knots can either suppress or enhance intercalation in supercoiled DNA. When the occupancy of intercalators on DNA is low, the effect of knots on intercalation can be captured by introducing a shift in the mean writhe of the chain that accounts for the writhe of the corresponding ideal knot. In the limit of high intercalator occupancy, the writhe distribution of different knots is strongly affected by excluded volume effects and therefore by salt concentration. Based on the finding that different knots yield well-separated probability distributions of bound intercalators, we propose a new experimental approach to determine DNA topology by monitoring the intensity of fluorescence emitted by dye molecules intercalated into knotted DNA molecules.

  20. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

  1. Transcriptional activation and repression by cellular DNA-binding protein C/EBP.

    PubMed Central

    Pei, D Q; Shih, C H

    1990-01-01

    A putative transcription factor, C/EBP, isolated from rat liver nuclei, has been shown to bind to at least two different sequence motifs: the CCAAT promoter domain and a core sequence [GTGG(T/A)(T/A)(T/A)G] common to many viral enhancers, including simian virus 40 and human hepatitis B virus. It has been proposed that C/EBP might function as a positive transcription factor by facilitating the communication between promoter and enhancer elements through its dual binding activities to DNA. Surprisingly, results from three different approaches suggest that C/EBP functions as a transcriptional repressor to hepatitis B virus and simian virus 40. Further investigation indicated that C/EBP can function as both a transcriptional activator and a repressor, depending on the reporter gene system. Images PMID:2157040

  2. Looking into DNA recognition: zinc finger binding specificity

    PubMed Central

    Paillard, Guillaume; Deremble, Cyril; Lavery, Richard

    2004-01-01

    We present a quantitative, theoretical analysis of the recognition mechanisms used by two zinc finger proteins: Zif268, which selectively binds to GC-rich sequences, and a Zif268 mutant, which binds to a TATA box site. This analysis is based on a recently developed method (ADAPT), which allows binding specificity to be analyzed via the calculation of complexation energies for all possible DNA target sequences. The results obtained with the zinc finger proteins show that, although both mainly select their targets using direct, pairwise protein–DNA interactions, they also use sequence-dependent DNA deformation to enhance their selectivity. A new extension of our methodology enables us to determine the quantitative contribution of these two components and also to measure the contributions of individual residues to overall specificity. The results show that indirect recognition is particularly important in the case of the TATA box binding mutant, accounting for 30% of the total selectivity. The residue-by-residue analysis of the protein–DNA interaction energy indicates that the existence of amino acid–base contacts does not necessarily imply sequence selectivity, and that side chains without contacts can nevertheless contribute to defining the protein's target sequence. PMID:15613596

  3. Viral cyclin-cyclin-dependent kinase 6 complexes initiate nuclear DNA replication.

    PubMed

    Laman, H; Coverley, D; Krude, T; Laskey, R; Jones, N

    2001-01-01

    The cyclins encoded by Kaposi sarcoma-associated herpesvirus and herpesvirus saimiri are homologs of human D-type cyclins. However, when complexed to cdk6, they have several activities that distinguish them from D-type cyclin-cdk6 complexes, including resistance to cyclin-dependent kinase inhibitors and an enhanced substrate range. We find that viral cyclins interact with and phosphorylate proteins involved in replication initiation. Using mammalian in vitro replication systems, we show that viral cyclin-cdk6 complexes can directly trigger the initiation of DNA synthesis in isolated late-G(1)-phase nuclei. Viral cyclin-cdk6 complexes share this capacity with cyclin A-cdk2, demonstrating that in addition to functioning as G(1)-phase cyclin-cdk complexes, they function as S-phase cyclin-cdk complexes.

  4. Viral Cyclin–Cyclin-Dependent Kinase 6 Complexes Initiate Nuclear DNA Replication

    PubMed Central

    Laman, Heike; Coverley, Dawn; Krude, Torsten; Laskey, Ronald; Jones, Nic

    2001-01-01

    The cyclins encoded by Kaposi sarcoma-associated herpesvirus and herpesvirus saimiri are homologs of human D-type cyclins. However, when complexed to cdk6, they have several activities that distinguish them from D-type cyclin-cdk6 complexes, including resistance to cyclin-dependent kinase inhibitors and an enhanced substrate range. We find that viral cyclins interact with and phosphorylate proteins involved in replication initiation. Using mammalian in vitro replication systems, we show that viral cyclin-cdk6 complexes can directly trigger the initiation of DNA synthesis in isolated late-G1-phase nuclei. Viral cyclin-cdk6 complexes share this capacity with cyclin A-cdk2, demonstrating that in addition to functioning as G1-phase cyclin-cdk complexes, they function as S-phase cyclin-cdk complexes. PMID:11134348

  5. Modeling Spatial Correlation of DNA Deformation: DNA Allostery in Protein Binding

    PubMed Central

    Xu, Xinliang; Ge, Hao; Gu, Chan; Gao, Yi Qin; Wang, Siyuan S.; Thio, Beng Joo Reginald; Hynes, James T.; Xie, X. Sunney; Cao, Jianshu

    2013-01-01

    We report a study of DNA deformations using a coarse-grained mechanical model and quantitatively interpret the allosteric effects in protein-DNA binding affinity. A recent single molecule study (Kim et al. (2013) Science, 339, 816) showed that when a DNA molecule is deformed by specific binding of a protein, the binding affinity of a second protein separated from the first protein is altered. Experimental observations together with molecular dynamics simulations suggested that the origin of the DNA allostery is related to the observed deformation of DNA’s structure, in particular the major groove width. In order to unveil and quantify the underlying mechanism for the observed major groove deformation behavior related to the DNA allostery, here we provide a simple but effective analytical model where DNA deformations upon protein binding are analyzed and spatial correlations of local deformations along the DNA are examined. The deformation of the DNA base orientations, which directly affect the major groove width, is found in both an analytical derivation and coarse-grained Monte Carlo simulations. This deformation oscillates with a period of 10 base pairs with an amplitude decaying exponentially from the binding site with a decay length lD~10 base pairs, as a result of the balance between two competing terms in DNA base stacking energy. This length scale is in agreement with that reported from the single molecule experiment. Our model can be reduced to the worm-like chain form at length scales larger than lP but is able to explain DNA’s mechanical properties on shorter length scales, in particular the DNA allostery of protein-DNA interactions. PMID:23795567

  6. Structural modeling for DNA binding to antioxidants resveratrol, genistein and curcumin.

    PubMed

    N'soukpoé-Kossi, C N; Bourassa, P; Mandeville, J S; Bekale, L; Tajmir-Riahi, H A

    2015-10-01

    Several models are presented here for the bindings of the antioxidant polyphenols resveratrol, genistein and curcumin with DNA in aqueous solution at physiological conditions. Multiple spectroscopic methods and molecular modeling were used to locate the binding sites of these polyphenols with DNA duplex. Structural models showed that intercalation is more stable for resveratrol and genistein than groove bindings, while curcumin interaction is via DNA grooves. Docking showed more stable complexes formed with resveratrol and genistein than curcumin with the free binding energies of -4.62 for resveratrol-DNA (intercalation), -4.28 for resveratrol-DNA (groove binding), -4.54 for genistein-DNA (intercalation), -4.38 for genistein-DNA (groove binding) and -3.84 kcal/mol for curcumin-DNA (groove binding). The free binding energies show polyphenol-DNA complexation is spontaneous at room temperature. At high polyphenol concentration a major DNA aggregation occurred, while biopolymer remained in B-family structure.

  7. Conversion of bacteriophage G4 single-stranded viral DNA to double-stranded replicative form in dna mutants of Escherichia coli.

    PubMed

    Kodaira, K I; Taketo, A

    1977-05-17

    Host functions involved in synthesis of parental replicative form of bacteriophage G4 were investigated using various replication mutants of Escheria coli. In dna+ bacteria, conversion of single-stranded viral DNA to replicative form DNA was insensitive to 200 microng/ml of rifampicin or 25 microng/ml of chloramphenicol. At high temperature, synthesis of parental replicative form was unaffected in mutants thermosensitive for dnaA, dnaB, dnaC(D), dnaE or dnaH. In dnaG or dnaZ mutants, however, parental replicative from DNA synthesis was clearly thermosensitive at 43 degrees C. Although the host rep product was essential for viral multiplication, the conversion of single stranded to replicative form was independent of the rep function.

  8. Fluoroquinolone-gyrase-DNA complexes: two modes of drug binding.

    PubMed

    Mustaev, Arkady; Malik, Muhammad; Zhao, Xilin; Kurepina, Natalia; Luan, Gan; Oppegard, Lisa M; Hiasa, Hiroshi; Marks, Kevin R; Kerns, Robert J; Berger, James M; Drlica, Karl

    2014-05-02

    DNA gyrase and topoisomerase IV control bacterial DNA topology by breaking DNA, passing duplex DNA through the break, and then resealing the break. This process is subject to reversible corruption by fluoroquinolones, antibacterials that form drug-enzyme-DNA complexes in which the DNA is broken. The complexes, called cleaved complexes because of the presence of DNA breaks, have been crystallized and found to have the fluoroquinolone C-7 ring system facing the GyrB/ParE subunits. As expected from x-ray crystallography, a thiol-reactive, C-7-modified chloroacetyl derivative of ciprofloxacin (Cip-AcCl) formed cross-linked cleaved complexes with mutant GyrB-Cys(466) gyrase as evidenced by resistance to reversal by both EDTA and thermal treatments. Surprisingly, cross-linking was also readily seen with complexes formed by mutant GyrA-G81C gyrase, thereby revealing a novel drug-gyrase interaction not observed in crystal structures. The cross-link between fluoroquinolone and GyrA-G81C gyrase correlated with exceptional bacteriostatic activity for Cip-AcCl with a quinolone-resistant GyrA-G81C variant of Escherichia coli and its Mycobacterium smegmatis equivalent (GyrA-G89C). Cip-AcCl-mediated, irreversible inhibition of DNA replication provided further evidence for a GyrA-drug cross-link. Collectively these data establish the existence of interactions between the fluoroquinolone C-7 ring and both GyrA and GyrB. Because the GyrA-Gly(81) and GyrB-Glu(466) residues are far apart (17 Å) in the crystal structure of cleaved complexes, two modes of quinolone binding must exist. The presence of two binding modes raises the possibility that multiple quinolone-enzyme-DNA complexes can form, a discovery that opens new avenues for exploring and exploiting relationships between drug structure and activity with type II DNA topoisomerases.

  9. An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA.

    PubMed

    Matsuo, K; Silke, J; Georgiev, O; Marti, P; Giovannini, N; Rungger, D

    1998-03-02

    In vertebrates, transcriptionally active promoters are undermethylated. Since the transcription factor Sp1, and more recently NF-kappaB, have been implicated in the demethylation process, we examined the effect of transcription factors on demethylation by injecting in vitro methylated plasmid DNA into Xenopus fertilized eggs. We found that various transactivation domains, including a strong acidic activation domain from the viral protein VP16, can enhance demethylation of a promoter region when fused to a DNA binding domain which recognizes the promoter. Furthermore, demethylation occurs only after the midblastula transition, when the general transcription machinery of the host embryo becomes available. Nevertheless, transcription factor binding need not be followed by actual transcription, since demethylation is not blocked by alpha-amanitin treatment. Finally, replication of the target DNA is a prerequisite for efficient demethylation since only plasmids that carry the bovine papilloma virus sequences which support plasmid replication after the midblastula transition are demethylated. No demethylation is detectable in the oocyte system where DNA is not replicated. These results suggest that, in the Xenopus embryo, promoters for which transcription factors are available are demethylated by a replication-dependent, possibly passive mechanism.

  10. p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner

    SciTech Connect

    Miller, S.D.; Farmer, G.; Prives, C.

    1995-12-01

    This report discusses new findings that the tumor supressor gene product p53 may play a role as a DNA-binding-dependent regulator of DNA replication. The results were obtained using polyomavirus in replication assays. Details regarding effects on cell growth arrest and transcriptional activation are discussed. 61 refs., 7 figs.

  11. RecO Protein Initiates DNA Recombination and Strand Annealing through Two Alternative DNA Binding Mechanisms*

    PubMed Central

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey

    2014-01-01

    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. PMID:25170075

  12. Quinolone binding to DNA is mediated by magnesium ions.

    PubMed Central

    Palù, G; Valisena, S; Ciarrocchi, G; Gatto, B; Palumbo, M

    1992-01-01

    The binding of plasmid DNA to norfloxacin, a quinolone antibacterial agent, was investigated by fluorescence, electrophoretic DNA unwinding, and affinity chromatography techniques. The amount of quinolone bound to DNA was modulated by the concentration of Mg2+. No interaction was evident in the absence of Mg2+ or in the presence of an excess of Mg2+, whereas maximum binding was observed at a Mg2+ concentration of 1-2 mM. The experimental data can be fitted to the formation of three types of Mg adducts: a binary adduct with norfloxacin and Mg2+, a binary adduct with DNA and Mg2+, and a ternary adduct with quinolone, plasmid, and Mg2+. We propose a model for the ternary complex, in which Mg acts as a bridge between the phosphate groups of the nucleic acid and the carbonyl and carboxyl moieties of norfloxacin. Additional stabilization may arise from stacking interactions between the condensed rings of the drug and DNA bases (especially guanine and adenine), which may account for the preference exhibited by quinolones for single-stranded and purine-rich regions of nucleic acids. Other possible biochemical pathways of drug action are suggested by the observation that norfloxacin binds Mg2+ under conditions that are close to physiological. Images PMID:1409681

  13. Homologous recombinational repair factors are recruited and loaded onto the viral DNA genome in Epstein-Barr virus replication compartments.

    PubMed

    Kudoh, Ayumi; Iwahori, Satoko; Sato, Yoshitaka; Nakayama, Sanae; Isomura, Hiroki; Murata, Takayuki; Tsurumi, Tatsuya

    2009-07-01

    Homologous recombination is an important biological process that facilitates genome rearrangement and repair of DNA double-strand breaks (DSBs). The induction of Epstein-Barr virus (EBV) lytic replication induces ataxia telangiectasia-mutated (ATM)-dependent DNA damage checkpoint signaling, leading to the clustering of phosphorylated ATM and Mre11/Rad50/Nbs1 (MRN) complexes to sites of viral genome synthesis in nuclei. Here we report that homologous recombinational repair (HRR) factors such as replication protein A (RPA), Rad51, and Rad52 as well as MRN complexes are recruited and loaded onto the newly synthesized viral genome in replication compartments. The 32-kDa subunit of RPA is extensively phosphorylated at sites in accordance with those with ATM. The hyperphosphorylation of RPA32 causes a change in RPA conformation, resulting in a switch from the catalysis of DNA replication to the participation in DNA repair. The levels of Rad51 and phosphorylated RPA were found to increase with the progression of viral productive replication, while that of Rad52 proved constant. Furthermore, biochemical fractionation revealed increases in levels of DNA-bound forms of these HRRs. Bromodeoxyuridine-labeled chromatin immunoprecipitation and PCR analyses confirmed the loading of RPA, Rad 51, Rad52, and Mre11 onto newly synthesized viral DNA, and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling analysis demonstrated DSBs in the EBV replication compartments. HRR factors might be recruited to repair DSBs on the viral genome in viral replication compartments. RNA interference knockdown of RPA32 and Rad51 prevented viral DNA synthesis remarkably, suggesting that homologous recombination and/or repair of viral DNA genome might occur, coupled with DNA replication to facilitate viral genome synthesis.

  14. Insight into the cooperative DNA binding of the O⁶-alkylguanine DNA alkyltransferase.

    PubMed

    Tessmer, Ingrid; Fried, Michael G

    2014-08-01

    The O(6)-alkylguanine DNA alkyltransferase (AGT) is a highly conserved protein responsible for direct repair of alkylated guanine and to a lesser degree thymine bases. While specific DNA lesion-bound complexes in crystal structures consist of monomeric AGT, several solution studies have suggested that cooperative DNA binding plays a role in the physiological activities of AGT. Cooperative AGT-DNA complexes have been described by theoretical models, which can be tested by atomic force microscopy (AFM). Direct access to structural features of AGT-DNA complexes at the single molecule level by AFM imaging revealed non-specifically bound, cooperative complexes with limited cluster length. Implications of cooperative binding in AGT-DNA interactions are discussed.

  15. Development of a protein microarray using sequence-specific DNA binding domain on DNA chip surface

    SciTech Connect

    Choi, Yoo Seong; Pack, Seung Pil; Yoo, Young Je . E-mail: yjyoo@snu.ac.kr

    2005-04-22

    A protein microarray based on DNA microarray platform was developed to identify protein-protein interactions in vitro. The conventional DNA chip surface by 156-bp PCR product was prepared for a substrate of protein microarray. High-affinity sequence-specific DNA binding domain, GAL4 DNA binding domain, was introduced to the protein microarray as fusion partner of a target model protein, enhanced green fluorescent protein. The target protein was oriented immobilized directly on the DNA chip surface. Finally, monoclonal antibody of the target protein was used to identify the immobilized protein on the surface. This study shows that the conventional DNA chip can be used to make a protein microarray directly, and this novel protein microarray can be applicable as a tool for identifying protein-protein interactions.

  16. Association of Human Papillomavirus 16 E2 with Rad50-Interacting Protein 1 Enhances Viral DNA Replication

    PubMed Central

    Campos-León, Karen; Wijendra, Kalpanee; Siddiqa, Abida; Pentland, Ieisha; Feeney, Katherine M.; Knapman, Alison; Davies, Rachel

    2016-01-01

    ABSTRACT Rad50-interacting protein 1 (Rint1) associates with the DNA damage response protein Rad50 during the transition from the S phase to the G2/M phase and functions in radiation-induced G2 checkpoint control. It has also been demonstrated that Rint1 is essential in vesicle trafficking from the Golgi apparatus to the endoplasmic reticulum (ER) through an interaction with Zeste-White 10 (ZW10). We have isolated a novel interaction between Rint1 and the human papillomavirus 16 (HPV16) transcription and replication factor E2. E2 binds to Rint1 within its ZW10 interaction domain, and we show that in the absence of E2, Rint1 is localized to the ER and associates with ZW10. E2 expression results in a disruption of the Rint1-ZW10 interaction and an accumulation of nuclear Rint1, coincident with a significant reduction in vesicle movement from the ER to the Golgi apparatus. Interestingly, nuclear Rint1 and members of the Mre11/Rad50/Nbs1 (MRN) complex were found in distinct E2 nuclear foci, which peaked during mid-S phase, indicating that the recruitment of Rint1 to E2 foci within the nucleus may also result in the recruitment of this DNA damage-sensing protein complex. We show that exogenous Rint1 expression enhances E2-dependent virus replication. Conversely, the overexpression of a truncated Rint1 protein that retains the E2 binding domain but not the Rad50 binding domain acts as a dominant negative inhibitor of E2-dependent HPV replication. Put together, these experiments demonstrate that the interaction between Rint1 and E2 has an important function in HPV replication. IMPORTANCE HPV infections are an important driver of many epithelial cancers, including those within the anogenital and oropharyngeal tracts. The HPV life cycle is tightly regulated and intimately linked to the differentiation of the epithelial cells that it infects. HPV replication factories formed in the nucleus are locations where viral DNA is copied to support virus persistence and amplification

  17. Association of Human Papillomavirus 16 E2 with Rad50-Interacting Protein 1 Enhances Viral DNA Replication.

    PubMed

    Campos-León, Karen; Wijendra, Kalpanee; Siddiqa, Abida; Pentland, Ieisha; Feeney, Katherine M; Knapman, Alison; Davies, Rachel; Androphy, Elliot J; Parish, Joanna L

    2017-03-01

    Rad50-interacting protein 1 (Rint1) associates with the DNA damage response protein Rad50 during the transition from the S phase to the G2/M phase and functions in radiation-induced G2 checkpoint control. It has also been demonstrated that Rint1 is essential in vesicle trafficking from the Golgi apparatus to the endoplasmic reticulum (ER) through an interaction with Zeste-White 10 (ZW10). We have isolated a novel interaction between Rint1 and the human papillomavirus 16 (HPV16) transcription and replication factor E2. E2 binds to Rint1 within its ZW10 interaction domain, and we show that in the absence of E2, Rint1 is localized to the ER and associates with ZW10. E2 expression results in a disruption of the Rint1-ZW10 interaction and an accumulation of nuclear Rint1, coincident with a significant reduction in vesicle movement from the ER to the Golgi apparatus. Interestingly, nuclear Rint1 and members of the Mre11/Rad50/Nbs1 (MRN) complex were found in distinct E2 nuclear foci, which peaked during mid-S phase, indicating that the recruitment of Rint1 to E2 foci within the nucleus may also result in the recruitment of this DNA damage-sensing protein complex. We show that exogenous Rint1 expression enhances E2-dependent virus replication. Conversely, the overexpression of a truncated Rint1 protein that retains the E2 binding domain but not the Rad50 binding domain acts as a dominant negative inhibitor of E2-dependent HPV replication. Put together, these experiments demonstrate that the interaction between Rint1 and E2 has an important function in HPV replication.IMPORTANCE HPV infections are an important driver of many epithelial cancers, including those within the anogenital and oropharyngeal tracts. The HPV life cycle is tightly regulated and intimately linked to the differentiation of the epithelial cells that it infects. HPV replication factories formed in the nucleus are locations where viral DNA is copied to support virus persistence and amplification of

  18. Cooperative binding of Ets-1 and core binding factor to DNA.

    PubMed Central

    Wotton, D; Ghysdael, J; Wang, S; Speck, N A; Owen, M J

    1994-01-01

    Two phorbol ester-inducible elements (beta E2 and beta E3) within the human T-cell receptor beta gene enhancer each contain consensus binding sites for the Ets and core binding factor (CBF) transcription factor families. Recombinant Ets-1 and purified CBF bound individually to beta E2 and beta E3, in which the Ets and core sites are directly adjacent. In this report, we show that CBF and Ets-1 bind together to beta E2 and beta E3 and that Ets-1-CBF-DNA complexes are favored over the binding of either protein alone to beta E2. Formation of Ets-1-CBF-DNA complexes increased the affinity of Ets-1-DNA interactions and decreased the rate of dissociation of CBF from DNA. Ets-1-CBF-DNA complexes were not observed when either the Ets or core site was mutated. The spatial requirements for the cooperative interaction of Ets-1 and CBF were analyzed by oligonucleotide mutagenesis and binding site selection experiments. Core and Ets sites were coselected, and there appeared to be little constraint on the relative orientation and spacing of the two sites. These results demonstrate that CBF and Ets-1 form a high-affinity DNA-binding complex when both of their cognate sites are present and that the relative spacing and orientation of the two sites are unimportant. Ets and core sites are found in several T-cell-specific enhancers, suggesting that this interaction is of general importance in T-cell-specific transcription. Images PMID:8264651

  19. Extended HSR/CARD domain mediates AIRE binding to DNA.

    PubMed

    Maslovskaja, Julia; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-12-25

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. RNA binding protein CPEB1 remodels host and viral RNA landscapes

    PubMed Central

    Batra, Ranjan; Stark, Thomas J.; Clark, Elizabeth; Belzile, Jean-Philippe; Wheeler, Emily C.; Yee, Brian A.; Huang, Hui; Gelboin-Burkhart, Chelsea; Huelga, Stephanie C.; Aigner, Stefan; Roberts, Brett T.; Bos, Tomas J.; Sathe, Shashank; Donohue, John Paul; Rigo, Frank; Ares, Manuel; Spector, Deborah H.; Yeo, Gene W.

    2016-01-01

    Host and virus interactions at the post-transcriptional level are critical for infection but remain poorly understood. Human cytomegalovirus (HCMV) is a prevalent herpesvirus family member that causes severe complications in immunocompromised patients and newborns. Here, we perform comprehensive transcriptome-wide analyses revealing that HCMV infection results in widespread alternative splicing (AS), shorter 3′-untranslated regions (3′UTRs) and polyA tail lengthening in host genes. The host RNA binding protein cytoplasmic polyadenylation element binding protein 1 (CPEB1) is highly induced upon infection and ectopic expression of CPEB1 in non-infected cells recapitulates infection-related post-transcriptional changes. CPEB1 is also required for polyA-tail lengthening of viral RNAs important for productive infection. Strikingly, depletion of CPEB1 reverses infection-related cytopathology and post-transcriptional changes, and decreases productive HCMV titers. Host RNA processing is also altered in herpes simplex virus-2 (HSV-2) infected cells, indicating a common theme among herpesvirus infections. Our work is a starting point for therapeutic targeting of host RNA binding proteins in herpesvirus infections. PMID:27775709

  1. DNA-binding specificities of human transcription factors.

    PubMed

    Jolma, Arttu; Yan, Jian; Whitington, Thomas; Toivonen, Jarkko; Nitta, Kazuhiro R; Rastas, Pasi; Morgunova, Ekaterina; Enge, Martin; Taipale, Mikko; Wei, Gonghong; Palin, Kimmo; Vaquerizas, Juan M; Vincentelli, Renaud; Luscombe, Nicholas M; Hughes, Timothy R; Lemaire, Patrick; Ukkonen, Esko; Kivioja, Teemu; Taipale, Jussi

    2013-01-17

    Although the proteins that read the gene regulatory code, transcription factors (TFs), have been largely identified, it is not well known which sequences TFs can recognize. We have analyzed the sequence-specific binding of human TFs using high-throughput SELEX and ChIP sequencing. A total of 830 binding profiles were obtained, describing 239 distinctly different binding specificities. The models represent the majority of human TFs, approximately doubling the coverage compared to existing systematic studies. Our results reveal additional specificity determinants for a large number of factors for which a partial specificity was known, including a commonly observed A- or T-rich stretch that flanks the core motifs. Global analysis of the data revealed that homodimer orientation and spacing preferences, and base-stacking interactions, have a larger role in TF-DNA binding than previously appreciated. We further describe a binding model incorporating these features that is required to understand binding of TFs to DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.

    PubMed

    Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R

    2005-11-01

    The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

  3. Uracil DNA glycosylase initiates degradation of HIV-1 cDNA containing misincorporated dUTP and prevents viral integration

    PubMed Central

    Weil, Amy F.; Ghosh, Devlina; Zhou, Yan; Seiple, Lauren; McMahon, Moira A.; Spivak, Adam M.; Siliciano, Robert F.; Stivers, James T.

    2013-01-01

    HIV-1 reverse transcriptase discriminates poorly between dUTP and dTTP, and accordingly, viral DNA products become heavily uracilated when viruses infect host cells that contain high ratios of dUTP:dTTP. Uracilation of invading retroviral DNA is thought to be an innate immunity barrier to retroviral infection, but the mechanistic features of this immune pathway and the cellular fate of uracilated retroviral DNA products is not known. Here we developed a model system in which the cellular dUTP:dTTP ratio can be pharmacologically increased to favor dUTP incorporation, allowing dissection of this innate immunity pathway. When the virus-infected cells contained elevated dUTP levels, reverse transcription was found to proceed unperturbed, but integration and viral protein expression were largely blocked. Furthermore, successfully integrated proviruses lacked detectable uracil, suggesting that only nonuracilated viral DNA products were integration competent. Integration of the uracilated proviruses was restored using an isogenic cell line that had no detectable human uracil DNA glycosylase (hUNG2) activity, establishing that hUNG2 is a host restriction factor in cells that contain high dUTP. Biochemical studies in primary cells established that this immune pathway is not operative in CD4+ T cells, because these cells have high dUTPase activity (low dUTP), and only modest levels of hUNG activity. Although monocyte-derived macrophages have high dUTP levels, these cells have low hUNG activity, which may diminish the effectiveness of this restriction pathway. These findings establish the essential elements of this pathway and reconcile diverse observations in the literature. PMID:23341616

  4. Viral Contribution to Dissolved DNA in the Marine Environment as Determined by Differential Centrifugation and Kingdom Probing

    PubMed Central

    Jiang, S. C.; Paul, J. H.

    1995-01-01

    Dissolved or filterable (<0.2-(mu)m-pore-size filter) DNA is a ubiquitous component of the dissolved organic matter in the surface waters of this planet. In an effort to understand the composition and possible sources, we subjected dissolved DNA concentrated by vortex flow filtration from offshore and coastal environments to differential centrifugation and probing with 16S rRNA-targeted kingdom oligonucleotide probes. Initial studies with calf thymus soluble DNA and T2 phage particles indicated that high-speed ultracentrifugation (201,000 x g for 90 min), a method to separate viral particles from soluble DNA used by other investigators, resulted in pelleting of nearly all the DNA and virus particles. Lower-speed centrifugation (11,200 to 25,800 x g for 90 min) resulted in >99% of the virus particles being collected in the pellet and (equiv)65% of the calf thymus DNA remaining in the supernatant. Employing this approach, we estimate that approximately 50% of the filterable DNA from marine environments is truly soluble or free DNA and that the other half is composed of bound forms (viral particles and, potentially, colloids). Of the bound form, 17 to 30% could be accounted for by viral particles, by calculating the amount of viral DNA on the basis of viral abundance, leaving a portion of the bound form uncharacterized. Kingdom probing with universal, eubacterial, and eucaryotic probes indicated that dissolved DNA hybridized with all of these probes, while purified standard viral DNAs did not, or hybridized only slightly with the universal probe (tailed oligonucleotide only). Collectively, these data indicate that DNA in viral particles is a small component of the dissolved DNA, the majority being of eubacterial and eucaryotic origin. PMID:16534913

  5. Nanoparticles inhibit DNA replication by binding to DNA: modeling and experimental validation.

    PubMed

    Li, Kungang; Zhao, Xiaonan; K Hammer, Brian; Du, Songyan; Chen, Yongsheng

    2013-11-26

    Predictive models are beneficial tools for researchers to use in prioritizing nanoparticles (NPs) for toxicological tests, but experimental evaluation can be time-consuming and expensive, and thus, priority should be given to tests that identify the NPs most likely to be harmful. For characterization of NPs, the physical binding of NPs to DNA molecules is important to measure, as interference with DNA function may be one cause of toxicity. Here, we determined the interaction energy between 12 types of NPs and DNA based on the Derjaguin-Landau-Verwey-Overbeek (DLVO) model and then predicted the affinity of the NPs for DNA. Using the single-molecule imaging technique known as atomic force microscopy (AFM), we experimentally determined the binding affinity of those NPs for DNA. Theoretical predictions and experimental observations of the binding affinity agreed well. Furthermore, the effect of NPs on DNA replication in vitro was investigated with the polymerase chain reaction (PCR) technique. The results showed that NPs with a high affinity for DNA strongly inhibited DNA replication, whereas NPs with low affinity had no or minimal effects on DNA replication. The methodology here is expected to benefit the genotoxicological testing of NPs as well as the design of safe NPs.

  6. Universal protein binding microarrays for the comprehensive characterization of the DNA binding specificities of transcription factors

    PubMed Central

    Berger, Michael F.; Bulyk, Martha L.

    2010-01-01

    Protein binding microarray (PBM) technology provides a rapid, high-throughput means of characterizing the in vitro DNA binding specificities of transcription factors (TFs). Using high-density, custom-designed microarrays containing all 10-mer sequence variants, one can obtain comprehensive binding site measurements for any TF, regardless of its structural class or species of origin. Here, we present a protocol for the examination and analysis of TF binding specificities at high resolution using such ‘all 10-mer’ universal PBMs. This procedure involves double-stranding a commercially synthesized DNA oligonucleotide array, binding a TF directly to the double-stranded DNA microarray, and labeling the protein-bound microarray with a fluorophore-conjugated antibody. We describe how to computationally extract the relative binding preferences of the examined TF for all possible contiguous and gapped 8-mers over the full range of affinities, from highest affinity sites to nonspecific sites. Multiple proteins can be tested in parallel in separate chambers on a single microarray, enabling the processing of a dozen or more TFs in a single day. PMID:19265799

  7. Z-DNA binding protein from chicken blood nuclei

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.

    1993-01-01

    A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.

  8. Determinants of Bacteriophage 933W Repressor DNA Binding Specificity

    PubMed Central

    Bullwinkle, Tammy J.; Samorodnitsky, Daniel; Rosati, Rayna C.; Koudelka, Gerald B.

    2012-01-01

    We reported previously that 933W repressor apparently does not cooperatively bind to adjacent sites on DNA and that the relative affinities of 933W repressor for its operators differ significantly from that of any other lambdoid bacteriophage. These findings indicate that the operational details of the lysis-lysogeny switch of bacteriophage 933W are unique among lambdoid bacteriophages. Since the functioning of the lysis-lysogeny switch in 933W bacteriophage uniquely and solely depends on the order of preference of 933W repressor for its operators, we examined the details of how 933W repressor recognizes its DNA sites. To identify the specificity determinants, we first created a molecular model of the 933W repressor-DNA complex and tested the predicted protein-DNA interactions. These results of these studies provide a picture of how 933W repressor recognizes its DNA sites. We also show that, opposite of what is normally observed for lambdoid phages, 933W operator sequences have evolved in such a way that the presence of the most commonly found base sequences at particular operator positions serves to decrease, rather than increase, the affinity of the protein for the site. This finding cautions against assuming that a consensus sequence derived from sequence analysis defines the optimal, highest affinity DNA binding site for a protein. PMID:22509323

  9. DNA binding studies of a solvatochromic fluorescence probe 3-methoxybenzanthrone

    NASA Astrophysics Data System (ADS)

    Yang, Xin; Liu, Wan-Hui; Jin, Wei-Jun; Shen, Guo-Li; Yu, Ru-Qin

    1999-11-01

    A fluorescence probe of 3-methoxybenzanthrone (MBA) exhibits significant solvatochromic characteristics correlated with the polarity of solvents. The interaction of the solvatochromic fluorescence probe with calf thymus DNA (ct-DNA) has been investigated. In the presence of ct-DNA the fluorescence of MBA is strongly quenched with a blue-shift of emission peak and a hypochromism in absorption spectra. The absorption spectra, fluorescence quenching and fluorescence polarization experiments show that the MBA molecule as an intercalator is inserted into the base-stacking domain of the ct-DNA double helix, and the interaction of the nucleobases with the MBA molecule causes quenching of fluorescence and hypochromism in the absorption spectra. The intrinsic binding constant and the binding site number were determined to be 1.70×10 5 mol l -1 in base pairs and six, respectively. The I0/ I versus [ct-DNA] plot shows linear relationship in the range covering 4.3×10 -7-1.02×10 -4 mol l -1 in base pairs which can be used for ct-DNA determination. The limit of detection was found to be 4.3×10 -7 mol l -1 in base pairs (0.5 μg ml -1).

  10. Recognition rules for binding of homeodomains to operator DNA.

    PubMed

    Chirgadze, Yu N; Sivozhelezov, V S; Polozov, R V; Stepanenko, V A; Ivanov, V V

    2012-01-01

    The spatial arrangement of interfaces between homeodomain transcription factors and operator DNA has been considered. We analyzed the binding contacts for a representative set of 22 complexes of homeodomain transcription factors with a double-stranded operator DNA in the region of the major groove. It was shown that the recognition of DNA by the recognizing _-helix of protein is governed by two contact groups. Invariant protein-DNA group of contacts includes six contacts, formed by atomic groups of coding and non-coding DNA chains with the groups of amino acids. The recognizing _-helix forms contacts by polar groups of residues Trp2 (NE1), Asn5, and Lys9 with the canonical sequence T(1)A(2)A(3)T(4) of the coding DNA chain, and contacts by residues Lys0, Arg7 and Lys11 with the sequence A(4)X(5)X(6)X(7) of a non-coding DNA chain, where X is any nucleotide. Variable protein-DNA group of contacts comprises two groups bound with the sequence T(3)A(4)X(5)X(6) of the non- coding DNA-chain. These contacts are mainly with the bases and specify the binding pattern of individual homeodomains. The invariant contact group represents a recognition pattern for transcription factors of the homeodomain family: multiple adenine-asparagine contact and six position-specific phosphate contacts mainly with lysine or arginine. Within this group, we have found three most significant invariant contacts which allow deducing the recognition rules for homeodomains. These rules are inherent for different taxonomic groups of the homeodomain family and can distinguishing members of this family from any other family of transcription factors.

  11. Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure.

    PubMed Central

    Thayer, M M; Ahern, H; Xing, D; Cunningham, R P; Tainer, J A

    1995-01-01

    The 1.85 A crystal structure of endonuclease III, combined with mutational analysis, suggests the structural basis for the DNA binding and catalytic activity of the enzyme. Helix-hairpin-helix (HhH) and [4Fe-4S] cluster loop (FCL) motifs, which we have named for their secondary structure, bracket the cleft separating the two alpha-helical domains of the enzyme. These two novel DNA binding motifs and the solvent-filled pocket in the cleft between them all lie within a positively charged and sequence-conserved surface region. Lys120 and Asp138, both shown by mutagenesis to be catalytically important, lie at the mouth of this pocket, suggesting that this pocket is part of the active site. The positions of the HhH motif and protruding FCL motif, which contains the DNA binding residue Lys191, can accommodate B-form DNA, with a flipped-out base bound within the active site pocket. The identification of HhH and FCL sequence patterns in other DNA binding proteins suggests that these motifs may be a recurrent structural theme for DNA binding proteins. Images PMID:7664751

  12. The dual CCR5 and CCR2 inhibitor cenicriviroc does not redistribute HIV into extracellular space: implications for plasma viral load and intracellular DNA decline.

    PubMed

    Kramer, Victor G; Hassounah, Said; Colby-Germinario, Susan P; Oliveira, Maureen; Lefebvre, Eric; Mesplède, Thibault; Wainberg, Mark A

    2015-03-01

    Cenicriviroc is a potent antagonist of the chemokine coreceptors 5 and 2 (CCR5/CCR2) and blocks HIV-1 entry. The CCR5 inhibitor maraviroc has been shown in tissue culture to be able to repel cell-free virions from the cell surface into extracellular space. We hypothesized that cenicriviroc might exhibit a similar effect, and tested this using clinical samples from the Phase IIb study 652-2-202, by measuring rates of intracellular DNA decline. We also monitored viral RNA levels in culture fluids. We infected PM-1 cells with CCR5-tropic HIV-1 BaL in the presence or absence of inhibitory concentrations of cenicriviroc (20 nM) or maraviroc (50 nM) or controls. Viral load levels and p24 were measured by ELISA, quantitative PCR and quantitative real-time reverse transcription PCR at 4 h post-infection. Frozen PBMC DNA samples from 30 patients with virological success in the Phase IIb study were studied, as were early and late reverse transcript levels. Docking studies compared binding between cenicriviroc/CCR5 and maraviroc/CCR5. Unlike maraviroc, cenicriviroc did not cause an increase in the amount of virus present in culture fluids at 4 h compared with baseline. The use of cenicriviroc did, however, result in lower levels of intracellular viral DNA after 4 h. Structural modelling indicates that cenicriviroc binds more deeply than maraviroc to the hydrophobic pocket of CCR5, providing an explanation for the absence of viral rebound with cenicriviroc. In contrast to maraviroc, cenicriviroc does not repel virus back into extracellular space. Differences in results may be due to superior binding of cenicriviroc to CCR5 compared with maraviroc. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Cooperative DNA binding of the bovine papillomavirus E2 transcriptional activator is antagonized by truncated E2 polypeptides.

    PubMed Central

    Monini, P; Blitz, I L; Cassai, E

    1993-01-01

    Cooperative DNA binding of the bovine papillomavirus type 1 (BPV-1) E2 transcriptional activator (E2-TA) is thought to play a role in the transcriptional synergism of multiple E2-responsive DNA elements (J. Ham, N. Dostatni, J.-M. Gauthier, and M. Yaniv, Trends Biochem. Sci. 16:440-444, 1991). Binding-equilibrium considerations show that such involvement is unlikely, thereby suggesting that the E2-TA cooperative capacity may have evolved to play other, different roles. The role of cooperative interactions in the antagonistic activity of BPV-1-positive and BPV-1-negative E2 regulatory proteins was investigated by an in vitro quantitative gel shift assay. Viral repressor E2-TR, a truncated peptide encompassing the activator DNA-binding domain, possesses a small but measurable cooperative capacity. Furthermore, the minimal E2 DNA-binding domain interacts with the activator in a positive, heterocooperative manner. As a result, the in vitro competition of full-length and truncated E2 peptides appears to be (macroscopically) noncooperative. This heterocooperative effect is probably dominant in latently infected G0-G1 cells, in which repressor E2-TR is 10- to 20-fold more abundant than the activator. The data are discussed considering the possible role of homo- and heterocooperative DNA binding in E2-conditional gene expression. Images PMID:8394466

  14. Independent versus Cooperative Binding in Polyethylenimine–DNA and Poly(L-lysine)–DNA Polyplexes

    PubMed Central

    Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J.; Green, Jordan J.; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina

    2013-01-01

    The mechanism of polyethylenimine–DNA and poly(L-lysine)–DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

  15. Polyomavirus Large T Antigen Binds Symmetrical Repeats at the Viral Origin in an Asymmetrical Manner

    PubMed Central

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M.; Schaffhausen, Brian

    2013-01-01

    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication. PMID:24109229

  16. Polyomavirus large T antigen binds symmetrical repeats at the viral origin in an asymmetrical manner.

    PubMed

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M; Schaffhausen, Brian; Bohm, Andrew

    2013-12-01

    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication.

  17. Predicting DNA-binding proteins and binding residues by complex structure prediction and application to human proteome.

    PubMed

    Zhao, Huiying; Wang, Jihua; Zhou, Yaoqi; Yang, Yuedong

    2014-01-01

    As more and more protein sequences are uncovered from increasingly inexpensive sequencing techniques, an urgent task is to find their functions. This work presents a highly reliable computational technique for predicting DNA-binding function at the level of protein-DNA complex structures, rather than low-resolution two-state prediction of DNA-binding as most existing techniques do. The method first predicts protein-DNA complex structure by utilizing the template-based structure prediction technique HHblits, followed by binding affinity prediction based on a knowledge-based energy function (Distance-scaled finite ideal-gas reference state for protein-DNA interactions). A leave-one-out cross validation of the method based on 179 DNA-binding and 3797 non-binding protein domains achieves a Matthews correlation coefficient (MCC) of 0.77 with high precision (94%) and high sensitivity (65%). We further found 51% sensitivity for 82 newly determined structures of DNA-binding proteins and 56% sensitivity for the human proteome. In addition, the method provides a reasonably accurate prediction of DNA-binding residues in proteins based on predicted DNA-binding complex structures. Its application to human proteome leads to more than 300 novel DNA-binding proteins; some of these predicted structures were validated by known structures of homologous proteins in APO forms. The method [SPOT-Seq (DNA)] is available as an on-line server at http://sparks-lab.org.

  18. Synthetic sialylphosphatidylethanolamine derivatives bind to human influenza A viruses and inhibit viral infection.

    PubMed

    Guo, C T; Wong, C H; Kajimoto, T; Miura, T; Ida, Y; Juneja, L R; Kim, M J; Masuda, H; Suzuki, T; Suzuki, Y

    1998-11-01

    We synthesized the sialylphosphatidylethanolamine (sialyl PE) derivatives Neu5Ac-PE, (Neu5Ac)2-PE, Neu5Ac-PE (amide) and Neu5Ac-PE (methyl). We examined the anti-viral effects of the derivatives on human influenza A virus infection by ELISA/virus-binding, hemagglutination inhibition, hemolysis inhibition and neutralization assays. The sialyl PE derivatives that we examined bound to A/Aichi/2/68, A/Singapore/1/57 and A/Memphis/1/71 strains of H3N2 subtype, but not to A/PR/8/34 strain of H1N1 subtype. The derivatives inhibited viral hemagglutination and hemolysis of human erythrocytes with A/Aichi/2/68 and A/Singapore/1/57 (H3N2), but not with A/PR/8/34 (H1N1). The inhibitory activity of the (Neu5Ac)2-PE derivative was the strongest of all sialyl PE derivatives (IC50, 35 microM to 40 microM). Sialyl PE derivatives also inhibited the infection of A/Aichi/2/68 in MDCK cells. Complete inhibition was observed at a concentration between 0.3 to 1.3 mM. IC50 of (Neu5Ac)2-PE was 15 microM in A/Aichi/2/68 strain. Taken together, the synthetic sialyl PE derivatives may be effective reagents against infection of some types of influenza A viruses.

  19. Analysis of dsDNA and RNA viromes in methanogenic digesters reveals novel viral genetic diversity.

    PubMed

    Calusinska, Magdalena; Marynowska, Martyna; Goux, Xavier; Lentzen, Esther; Delfosse, Philippe

    2016-04-01

    Although viruses are not the key players of the anaerobic digestion process, they may affect the dynamics of bacterial and archaeal populations involved in biogas production. Until now viruses have received very little attention in this specific habitat; therefore, as a first step towards their characterization, we optimized a virus filtration protocol from anaerobic sludge. Afterwards, to assess dsDNA and RNA viral diversity in sludge samples from nine different reactors fed either with waste water, agricultural residues or solid municipal waste plus agro-food residues, we performed metagenomic analyses. As a result we showed that, while the dsDNA viromes (21 assigned families in total) were dominated by dsDNA phages of the order Caudovirales, RNA viruses (14 assigned families in total) were less diverse and were for the main part plant-infecting viruses. Interestingly, less than 2% of annotated contigs were assigned as putative human and animal pathogens. Our study greatly extends the existing view of viral genetic diversity in methanogenic reactors and shows that these viral assemblages are distinct not only among the reactor types but also from nearly 30 other environments already studied, including the human gut, fermented food, deep sea sediments and other aquatic habitats. © 2015 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Mobile elements and viral integrations prompt considerations for bacterial DNA integration as a novel carcinogen

    PubMed Central

    Robinson, Kelly M.; Hotopp, Julie C. Dunning

    2014-01-01

    Insertional mutagenesis has been repeatedly demonstrated in cancer genomes and has a role in oncogenesis. Mobile genetic elements can induce cancer development by random insertion into cancer related genes or by inducing translocations. L1s are typically implicated in cancers of an epithelial cell origin, while Alu elements have been implicated in leukemia as well as epithelial cell cancers. Likewise, viral infections have a significant role in cancer development predominantly through integration into the human genome and mutating or deregulating cancer related genes. Human papilloma virus is the best-known example of viral integrations contributing to carcinogenesis. However, hepatitis B virus, Epstein-Barr virus, and Merkel cell polyomavirus also integrate into the human genome and disrupt cancer related genes. Thus far, the role of microbes in cancer has primarily been attributed to mutations induced through chronic inflammation or toxins, as is the case with Helicobacter pylori and enterotoxigenic Bacteroides fragilis. We hypothesize that like mobile elements and viral DNA, bacterial and parasitic DNA may also integrate into the human somatic genome and be oncogenic. Until recently it was believed that bacterial DNA could not integrate into the human genome, but new evidence demonstrates that bacterial insertional mutagenesis may occur in cancer cells. Although this work does not show causation between bacterial insertions and cancer, it prompts more research in this area. Promising new sequencing technologies may reduce the risk of artifactual chimeric sequences, thus diminishing some of the challenges of identifying novel insertions in the somatic human genome. PMID:24956175

  1. Cellular DNA ligase I is recruited to cytoplasmic vaccinia virus factories and masks the role of the vaccinia ligase in viral DNA replication.

    PubMed

    Paran, Nir; De Silva, Frank S; Senkevich, Tatiana G; Moss, Bernard

    2009-12-17

    Vaccinia virus (VACV) encodes DNA polymerase and additional proteins that enable cytoplasmic replication. We confirmed the ability of VACV DNA ligase mutants to replicate and tested the hypothesis that cellular ligases compensate for loss of viral gene expression. RNA silencing of human DNA ligase I expression and a small molecule inhibitor of human DNA ligase I [corrected] severely reduced replication of viral DNA in cells infected with VACV ligase-deficient mutants, indicating that the cellular enzyme plays a complementary role. Replication of ligase-deficient VACV was greatly reduced and delayed in resting primary cells, correlating with initial low levels of ligase I and subsequent viral induction and localization of ligase I in virus factories. These studies indicate that DNA ligation is essential for poxvirus replication and explain the ability of ligase deletion mutants to replicate in dividing cells but exhibit decreased pathogenicity in mice. Encoding its own ligase might allow VACV to "jump-start" DNA synthesis.

  2. Mg NMR in DNA solutions: Dominance of site binding effects.

    PubMed

    Rose, D M; Bleam, M L; Record, M T; Bryant, R G

    1980-11-01

    (25)Mg NMR spectroscopy is applied to a study of magnesium ion interactions with DNA, which is considered as a model for a linear polyelectrolyte. It is demonstrated that the magnesium ion spectrum is complicated by a non-Lorent-zian line shape and is dominated by the effects of chemical exchange with macromolecule binding sites. A distinction is made between specific-site interactions in which the magnesium ion loses a water molecule from the first coordination sphere on binding and those interactions, referred to as territorial binding, in which the ion maintains its first coordination sphere complement of solvent. The first type of site-binding interactions are shown to dominate the magnesium ion NMR spectrum, based on a consideration of the magnitudes of the observed (25)Mg relaxation rates compared with (23)Na relaxation rates, the clear contributions of chemical exchange-limited relaxation, and an ion displacement experiment employing sodium.

  3. Purified glucocorticoid receptors bind selectively in vitro to a cloned DNA fragment whose transcription is regulated by glucocorticoids in vivo.

    PubMed

    Payvar, F; Wrange, O; Carlstedt-Duke, J; Okret, S; Gustafsson, J A; Yamamoto, K R

    1981-11-01

    Activated glucocorticoid receptor protein, purified to 40-60% homogeneity from rat liver extracts, binds selectively in vitro to a cloned fragment of murine mammary tumor virus (MTV) DNA. The DNA fragment tested contains about half of the sequences present in intact MTV DNA, and its rate of transcription, like that of the intact viral element, is strongly stimulated by glucocorticoids when it is introduced into the genome of a receptor-containing cell. In contrast, the receptor fails to bind selectively to DNA restriction fragments from E. coli plasmids pBR322 and RSF2124 or from bacteriophages lambda and T4. Preliminary experiments to localize regions within MTV DNA responsible for selective binding have revealed thus far one subfragment that fails to bind the receptor and one selectively bound subfragment that maps far downstream from the 5' terminus of the normal RNA transcript. These studies are consistent with the notion that steroid receptors may modulate rates of transcription by recognizing specific DNA sequences within or near the regulated genes.

  4. Quantitative keratinocyte assay detects two biological activities of human papillomavirus DNA and identifies viral types associated with cervical carcinoma.

    PubMed Central

    Schlegel, R; Phelps, W C; Zhang, Y L; Barbosa, M

    1988-01-01

    Keratinocytes electroporated with human papillomavirus (HPV) DNA (HPV-6, 11, 16 and 18) exhibited an increased cellular proliferation which was quantitated as microcolony and macrocolony formation. However, only macrocolonies induced by HPV-16 or HPV-18 DNA (the two viral types most commonly found in human cervical carcinomas) gave rise to proliferating, poorly-stratified colonies when grown in the presence of serum and calcium. Hydrocortisone increased the frequency of these differentiation-resistant colonies, and studies showed that they were immortalized, contained one copy of viral DNA per cell, expressed three discrete species of viral RNA and synthesized the viral E7 protein. HPV-induced cellular proliferation and altered differentiation are therefore separable events and may represent the activity of different viral genes. Images PMID:2460337

  5. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding.

    PubMed

    Bradshaw, Elizabeth M; Sanford, David G; Luo, Xuelian; Sudmeier, James L; Gurard-Levin, Zachary A; Bullock, Peter A; Bachovchin, William W

    2004-06-08

    To better understand origin recognition and initiation of DNA replication, we have examined by NMR complexes formed between the origin-binding domain of SV40 T antigen (T-ag-obd), the initiator protein of the SV40 virus, and cognate and noncognate DNA oligomers. The results reveal two structural effects associated with "origin-specific" binding that are absent in nonspecific DNA binding. The first is the formation of a hydrogen bond (H-bond) involving His 203, a residue that genetic studies have previously identified as crucial to both specific and nonspecific DNA binding in full-length T antigen. In free T-ag-obd, the side chain of His 203 has a pK(a) value of approximately 5, titrating to the N(epsilon)(1)H tautomer at neutral pH (Sudmeier, J. L., et al. (1996) J. Magn. Reson., Ser. B 113, 236-247). In complexes with origin DNA, His 203 N(delta)(1) becomes protonated and remains nontitrating as the imidazolium cation at all pH values from 4 to 8. The H-bonded N(delta1)H resonates at 15.9 ppm, an unusually large N-H proton chemical shift, of a magnitude previously observed only in the catalytic triad of serine proteases at low pH. The formation of this H-bond requires the middle G/C base pair of the recognition pentanucleotide, GAGGC. The second structural effect is a selective distortion of the A/T base pair characterized by a large (0.6 ppm) upfield chemical-shift change of its Watson-Crick proton, while nearby H-bonded protons remain relatively unaffected. The results indicate that T antigen, like many other DNA-binding proteins, may employ "catalytic" or "transition-state-like" interactions in binding its cognate DNA (Jen-Jacobson, L. (1997) Biopolymers 44, 153-180), which may be the solution to the well-known paradox between the relatively modest DNA-binding specificity exhibited by initiator proteins and the high specificity of initiation.

  6. Methyl-CpG binding protein 2, receptors of innate immunity and receptor for advanced glycation end-products in human viral meningoencephalitis.

    PubMed

    Maslinska, Danuta; Laure-Kamionowska, Milena; Maslinski, Sławomir

    2014-01-01

    Inflammation is a normal host defense reaction to infections and tissue injury. In pathology, the process of inflammation is deregulated by various environmental factors, prolonged activation of Toll-like receptors (TLRs), induction of epigenetic machinery or expression of receptors for advanced glycation end-products (RAGE). In the present study, we examined immunoexpression of proteins participating in the above-mentioned mechanisms, in the brain of patients with viral meningoencephalitis. The results showed that depending on the period of the disease, the process of inflammation is deregulated in different ways. In an early period of viral meningoencephalitis, we found numerous so-called microglial nodules which were strongly immunopositive to methyl-CpG protein 2 (MeCP2). This protein is an epigenetic factor important for methylation of DNA; therefore, our results suggest that cells collected in the nodules may participate in modification of the host defense reaction. Moreover, in the early period of viral meningoencephalitis, we found that Purkinje cells of the cerebellum contain TLR3 or TLR9 receptors that can recognize viral pathogens and may activate a self-destructive mechanism in these neurons. In the later (advanced) period of viral meningoencephalitis, despite some of the above observations, RAGE protein was detected in the brain of adult and aging patients. It means that in this period of the disease, the inflammatory process may be deregulated by numerous post-translationally modified proteins that are transported to the brain after binding with activated RAGE. In addition, young patients appeared more susceptible to viral infections than adult and aging patients, because most of them died during the early period of meningoencephalitis.

  7. DNA-AuNP networks on cell membranes as a protective barrier to inhibit viral attachment, entry and budding.

    PubMed

    Li, Chun Mei; Zheng, Lin Ling; Yang, Xiao Xi; Wan, Xiao Yan; Wu, Wen Bi; Zhen, Shu Jun; Li, Yuan Fang; Luo, Ling Fei; Huang, Cheng Zhi

    2016-01-01

    Viral infections have caused numerous diseases and deaths worldwide. Due to the emergence of new viruses and frequent virus variation, conventional antiviral strategies that directly target viral or cellular proteins are limited because of the specificity, drug resistance and rapid clearance from the human body. Therefore, developing safe and potent antiviral agents with activity against viral infection at multiple points in the viral life cycle remains a major challenge. In this report, we propose a new modality to inhibit viral infection by fabricating DNA conjugated gold nanoparticle (DNA-AuNP) networks on cell membranes as a protective barrier. The DNA-AuNPs networks were found, via a plaque formation assay and viral titers, to have potent antiviral ability and protect host cells from human respiratory syncytial virus (RSV). Confocal immunofluorescence image analysis showed 80 ± 3.8% of viral attachment, 91.1 ± 0.9% of viral entry and 87.9 ± 2.8% of viral budding were inhibited by the DNA-AuNP networks, which were further confirmed by real-time fluorescence imaging of the RSV infection process. The antiviral activity of the networks may be attributed to steric effects, the disruption of membrane glycoproteins and limited fusion of cell membrane bilayers, all of which play important roles in viral infection. Therefore, our results suggest that the DNA-AuNP networks have not only prophylactic effects to inhibit virus attachment and entry, but also therapeutic effects to inhibit viral budding and cell-to-cell spread. More importantly, this proof-of-principle study provides a pathway for the development of a universal, broad-spectrum antiviral therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Roles of RNA-Binding Proteins in DNA Damage Response.

    PubMed

    Kai, Mihoko

    2016-02-27

    Living cells experience DNA damage as a result of replication errors and oxidative metabolism, exposure to environmental agents (e.g., ultraviolet light, ionizing radiation (IR)), and radiation therapies and chemotherapies for cancer treatments. Accumulation of DNA damage can lead to multiple diseases such as neurodegenerative disorders, cancers, immune deficiencies, infertility, and also aging. Cells have evolved elaborate mechanisms to deal with DNA damage. Networks of DNA damage response (DDR) pathways are coordinated to detect and repair DNA damage, regulate cell cycle and transcription, and determine the cell fate. Upstream factors of DNA damage checkpoints and repair, "sensor" proteins, detect DNA damage and send the signals to downstream factors in order to maintain genomic integrity. Unexpectedly, we have discovered that an RNA-processing factor is involved in DNA repair processes. We have identified a gene that contributes to glioblastoma multiforme (GBM)'s treatment resistance and recurrence. This gene, RBM14, is known to function in transcription and RNA splicing. RBM14 is also required for maintaining the stem-like state of GBM spheres, and it controls the DNA-PK-dependent non-homologous end-joining (NHEJ) pathway by interacting with KU80. RBM14 is a RNA-binding protein (RBP) with low complexity domains, called intrinsically disordered proteins (IDPs), and it also physically interacts with PARP1. Furthermore, RBM14 is recruited to DNA double-strand breaks (DSBs) in a poly(ADP-ribose) (PAR)-dependent manner (unpublished data). DNA-dependent PARP1 (poly-(ADP) ribose polymerase 1) makes key contributions in the DNA damage response (DDR) network. RBM14 therefore plays an important role in a PARP-dependent DSB repair process. Most recently, it was shown that the other RBPs with intrinsically disordered domains are recruited to DNA damage sites in a PAR-dependent manner, and that these RBPs form liquid compartments (also known as "liquid-demixing"). Among the

  9. Temporal order of evolution of DNA replication systems inferred by comparison of cellular and viral DNA polymerases

    PubMed Central

    Koonin, Eugene V

    2006-01-01

    Background The core enzymes of the DNA replication systems show striking diversity among cellular life forms and more so among viruses. In particular, and counter-intuitively, given the central role of DNA in all cells and the mechanistic uniformity of replication, the core enzymes of the replication systems of bacteria and archaea (as well as eukaryotes) are unrelated or extremely distantly related. Viruses and plasmids, in addition, possess at least two unique DNA replication systems, namely, the protein-primed and rolling circle modalities of replication. This unexpected diversity makes the origin and evolution of DNA replication systems a particularly challenging and intriguing problem in evolutionary biology. Results I propose a specific succession for the emergence of different DNA replication systems, drawing argument from the differences in their representation among viruses and other selfish replicating elements. In a striking pattern, the DNA replication systems of viruses infecting bacteria and eukaryotes are dominated by the archaeal-type B-family DNA polymerase (PolB) whereas the bacterial replicative DNA polymerase (PolC) is present only in a handful of bacteriophage genomes. There is no apparent mechanistic impediment to the involvement of the bacterial-type replication machinery in viral DNA replication. Therefore, I hypothesize that the observed, markedly unequal distribution of the replicative DNA polymerases among the known cellular and viral replication systems has a historical explanation. I propose that, among the two types of DNA replication machineries that are found in extant life forms, the archaeal-type, PolB-based system evolved first and had already given rise to a variety of diverse viruses and other selfish elements before the advent of the bacterial, PolC-based machinery. Conceivably, at that stage of evolution, the niches for DNA-viral reproduction have been already filled with viruses replicating with the help of the archaeal

  10. Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein

    SciTech Connect

    Ryzhikov, Mikhail; Koroleva, Olga; Postnov, Dmitri; Tran, Andrew; Korolev, Sergey

    2011-08-25

    RecO is a recombination mediator protein (RMP) important for homologous recombination, replication repair and DNA annealing in bacteria. In all pathways, the single-stranded (ss) DNA binding protein, SSB, plays an inhibitory role by protecting ssDNA from annealing and recombinase binding. Conversely, SSB may stimulate each reaction through direct interaction with RecO. We present a crystal structure of Escherichia coli RecO bound to the conserved SSB C-terminus (SSB-Ct). SSB-Ct binds the hydrophobic pocket of RecO in a conformation similar to that observed in the ExoI/SSB-Ct complex. Hydrophobic interactions facilitate binding of SSB-Ct to RecO and RecO/RecR complex in both low and moderate ionic strength solutions. In contrast, RecO interaction with DNA is inhibited by an elevated salt concentration. The SSB mutant lacking SSB-Ct also inhibits RecO-mediated DNA annealing activity in a salt-dependent manner. Neither RecO nor RecOR dissociates SSB from ssDNA. Therefore, in E. coli, SSB recruits RMPs to ssDNA through SSB-Ct, and RMPs are likely to alter the conformation of SSB-bound ssDNA without SSB dissociation to initiate annealing or recombination. Intriguingly, Deinococcus radiodurans RecO does not bind SSB-Ct and weakly interacts with the peptide in the presence of RecR, suggesting the diverse mechanisms of DNA repair pathways mediated by RecO in different organisms.

  11. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  12. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  13. Membrane vesicles in sea water: heterogeneous DNA content and implications for viral abundance estimates.

    PubMed

    Biller, Steven J; McDaniel, Lauren D; Breitbart, Mya; Rogers, Everett; Paul, John H; Chisholm, Sallie W

    2017-02-01

    Diverse microbes release membrane-bound extracellular vesicles from their outer surfaces into the surrounding environment. Vesicles are found in numerous habitats including the oceans, where they likely have a variety of functional roles in microbial ecosystems. Extracellular vesicles are known to contain a range of biomolecules including DNA, but the frequency with which DNA is packaged in vesicles is unknown. Here, we examine the quantity and distribution of DNA associated with vesicles released from five different bacteria. The average quantity of double-stranded DNA and size distribution of DNA fragments released within vesicles varies among different taxa. Although some vesicles contain sufficient DNA to be visible following staining with the SYBR fluorescent DNA dyes typically used to enumerate viruses, this represents only a small proportion (<0.01-1%) of vesicles. Thus DNA is packaged heterogeneously within vesicle populations, and it appears that vesicles are likely to be a minor component of SYBR-visible particles in natural sea water compared with viruses. Consistent with this hypothesis, chloroform treatment of coastal and offshore seawater samples reveals that vesicles increase epifluorescence-based particle (viral) counts by less than an order of magnitude and their impact is variable in space and time.

  14. Host DNA Damage Response Factors Localize to Merkel Cell Polyomavirus DNA Replication Sites To Support Efficient Viral DNA Replication

    PubMed Central

    Tsang, Sabrina H.; Wang, Xin; Li, Jing; Buck, Christopher B.

    2014-01-01

    ABSTRACT Accumulating evidence indicates a role for Merkel cell polyomavirus (MCPyV) in the development of Merkel cell carcinoma (MCC), making MCPyV the first polyomavirus to be clearly associated with human cancer. With the high prevalence of MCPyV infection and the increasing amount of MCC diagnosis, there is a need to better understand the virus and its oncogenic potential. In this study, we examined the relationship between the host DNA damage response (DDR) and MCPyV replication. We found that components of the ATM- and ATR-mediated DDR pathways accumulate in MCPyV large T antigen (LT)-positive nuclear foci in cells infected with native MCPyV virions. To further study MCPyV replication, we employed our previously established system, in which recombinant MCPyV episomal DNA is autonomously replicated in cultured cells. Similar to native MCPyV infection, where both MCPyV origin and LT are present, the host DDR machinery colocalized with LT in distinct nuclear foci. Immunofluorescence in situ hybridization and bromodeoxyuridine (BrdU) incorporation analysis showed that these DDR proteins and MCPyV LT in fact colocalized at the actively replicating MCPyV replication complexes, which were absent when a replication-defective LT mutant or an MCPyV-origin mutant was introduced in place of wild-type LT or wild-type viral origin. Inhibition of DDR kinases using chemical inhibitors and ATR/ATM small interfering RNA (siRNA) knockdown reduced MCPyV DNA replication without significantly affecting LT expression or the host cell cycle. This study demonstrates that these host DDR factors are important for MCPyV DNA replication, providing new insight into the host machinery involved in the MCPyV life cycle. IMPORTANCE MCPyV is the first polyomavirus to be clearly associated with human cancer. However, the MCPyV life cycle and its oncogenic mechanism remain poorly understood. In this report, we show that, in cells infected with native MCPyV virions, components of the ATM- and ATR

  15. Dendritic star polymers for efficient DNA binding and stimulus-dependent DNA release.

    PubMed

    Yin, Meizhen; Ding, Ke; Gropeanu, Radu A; Shen, Jie; Berger, Rüdiger; Weil, Tanja; Müllen, Klaus

    2008-11-01

    Water-soluble core-shell star polymers consisting of a dendritic polyphenylene core and an outer shell containing a defined number of amino groups have been synthesized via atom transfer radical polymerization (ATRP). All macromolecules efficiently interacted with a diverse set of DNA fragments, and stable complexes were formed and visualized by atomic force microscopy. The observed tight binding of DNA, which was found in the sub-nanomolar range, was mainly attributed to strong electrostatic interactions. Complex stoichiometries between the polyelectrolytes were controlled via the number of amino groups of the star polymers, and well-defined nanoscopic architectures were formed. DNA was released from the complexes after treatment with high concentrations of sodium chloride in aqueous solution. Such star polymers, which allow the binding and release of DNA, represent attractive candidates for the development of novel anion-exchange resins for DNA purification or as nonviral vector systems for gene delivery.

  16. Eukaryotic damaged DNA-binding proteins: DNA repair proteins or transcription factors?

    SciTech Connect

    Protic, M.

    1994-12-31

    Recognition and removal of structural defects in the genome, caused by diverse physical and chemical agents, are among the most important cell functions. Proteins that recognize and bind to modified DNA, and thereby initiate damage-induced recovery processes, have been identified in prokaryotic and eukaryotic cells. Damaged DNA-binding (DDB) proteins from prokaryotes are either DNA repair enzymes or noncatalytic subunits of larger DNA repair complexes that participate in excision repair, or in recombinational repair and SOS-mutagenesis. Although the methods employed may not have allowed detection of all eukaryotic DDB proteins and identification of their functions, it appears that during evolution cells have developed a wide array of DDB proteins that can discriminate among the diversity of DNA conformations found in the eukaryotic nucleus, as well as a gene-sharing feature found in DDB proteins that also act as transcription factors.

  17. Antitumor drug nogalamycin binds DNA in both grooves simultaneously: molecular structure of nogalamycin-DNA complex.

    PubMed

    Liaw, Y C; Gao, Y G; Robinson, H; van der Marel, G A; van Boom, J H; Wang, A H

    1989-12-26

    The three-dimensional molecular structures of the complexes between an interesting antitumor drug, nogalamycin, and two DNA hexamers, d[CGT(pS)ACG] and d[m5CGT(pS)Am5CG], were determined at high resolution by X-ray diffraction analyses. Two nogalamycins bind to the DNA double helix in a 2:1 ratio with the aglycon chromophore intercalated between the CpG steps at both ends of the helix. The nogalose and aminoglucose sugars lie in the minor and major grooves, respectively, of the distorted B-DNA double helix. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through. Specific hydrogen bonds are found in the complex between the drug and guanine bases. We suggest that nogalamycin may prefer GC sequences embedded in a stretch of AT sequences.

  18. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  19. Cooperative binding of Sox10 to DNA: requirements and consequences

    PubMed Central

    Schlierf, Beate; Ludwig, Andreas; Klenovsek, Karin; Wegner, Michael

    2002-01-01

    The high-mobility-group (HMG) domain containing transcription factor Sox10 is an important regulator of various processes including the development of neural crest cells and glial cells. Target gene promoters contain multiple Sox10-binding sites, which either support monomeric or cooperative, dimeric binding. The latter is unusual for Sox proteins and might contribute to functional specificity of Sox10. We find that specific amino acid residues in a conserved region immediately preceding the HMG domain of Sox10 are required for cooperative binding. These residues cooperate with the HMG domain during dimeric binding in a manner dependent on specific determinants within the first two α-helices of the HMG domain. Cooperativity of DNA binding is surprisingly refractory to changes in the overall conformation of the DNA-bound dimer. Whereas maintenance of cooperativity is essential for full activation of the promoter of the myelin protein zero target gene, dimer-dependent conformational changes such as the exact bending angle introduced into the promoter appear to be less important, shedding new light on the architectural function of Sox proteins. PMID:12490719

  20. Differential DNA binding of Ku antigen determines its involvement in DNA replication.

    PubMed

    Schild-Poulter, Caroline; Matheos, Diamanto; Novac, Olivia; Cui, Bo; Giffin, Ward; Ruiz, Marcia T; Price, Gerald B; Zannis-Hadjopoulos, Maria; Haché, Robert J G

    2003-02-01

    Ku antigen (Ku70/Ku80) is a regulatory subunit of DNA-dependent protein kinase, which participates in the regulation of DNA replication and gene transcription through specific DNA sequences. In this study, we have compared the mechanism of action of Ku from A3/4, a DNA sequence that appears in mammalian origins of DNA replication, and NRE1, a transcriptional regulatory element in the long terminal repeat of mouse mammary tumor virus through which Ku antigen and its associated kinase, DNA-dependent protein kinase (DNA-PK(cs)), act to repress steroid-induced transcription. Our results indicate that replication from a minimal replication origin of ors8 is independent of DNA-PK(cs) and that Ku interacts with A3/4-like sequences and NRE1 in fundamentally different ways. UV crosslinking experiments revealed differential interactions of the Ku subunits with A3/4, NRE1, and two other proposed Ku transcriptional regulatory elements. In vitro footprinting experiments showed direct contact of Ku on A3/4 and over the region of ors8 homologous to A3/4. In vitro replication assays using ors8 templates bearing mutations in the A3/4-like sequence suggested that Ku binding to this element was necessary for replication. By contrast, in vitro replication experiments revealed that NRE1 was not involved in DNA replication. Our results establish A3/4 as a new class of Ku DNA binding site. Classification of Ku DNA binding into eight categories of interaction based on recognition and DNA crosslinking experiments is discussed.

  1. Specific enrichment of prokaryotic DNA using a recombinant DNA-binding protein.

    PubMed

    Sandetskaya, Natalia; Naumann, Andreas; Hennig, Katharina; Kuhlmeier, Dirk

    2014-06-01

    Targeted enrichment of DNA is often necessary for its detection and characterization in complex samples. We describe the development and application of the novel molecular tool for the specific enrichment of prokaryotic DNA. A fused protein comprising the DNA-binding subunit of the bacterial topoisomerase II, gyrase, was expressed, purified, and immobilized on magnetic particles. We demonstrated the specific affinity of the immobilized protein towards bacterial DNA and investigated its efficiency in the samples with high background of eukaryotic DNA. The reported approach allowed for the selective isolation and further detection of as few as 5 pg Staphylococcus aureus DNA from the sample with 4 × 10(6)-fold surplus of human DNA. This method is a promising approach for the preparation of such type of samples, for example in molecular diagnostics of sepsis.

  2. Metagenomic Characterization of Airborne Viral DNA Diversity in the Near-Surface Atmosphere

    PubMed Central

    Whon, Tae Woong; Kim, Min-Soo; Roh, Seong Woon; Shin, Na-Ri; Lee, Hae-Won

    2012-01-01

    Airborne viruses are expected to be ubiquitous in the atmosphere but they still remain poorly understood. This study investigated the temporal and spatial dynamics of airborne viruses and their genotypic characteristics in air samples collected from three distinct land use types (a residential district [RD], a forest [FR], and an industrial complex [IC]) and from rainwater samples freshly precipitated at the RD site (RD-rain). Viral abundance exhibited a seasonal fluctuation in the range between 1.7 × 106 and 4.0 × 107 viruses m−3, which increased from autumn to winter and decreased toward spring, but no significant spatial differences were observed. Temporal variations in viral abundance were inversely correlated with seasonal changes in temperature and absolute humidity. Metagenomic analysis of air viromes amplified by rolling-circle phi29 polymerase-based random hexamer priming indicated the dominance of plant-associated single-stranded DNA (ssDNA) geminivirus-related viruses, followed by animal-infecting circovirus-related sequences, with low numbers of nanoviruses and microphages-related genomes. Particularly, the majority of the geminivirus-related viruses were closely related to ssDNA mycoviruses that infect plant-pathogenic fungi. Phylogenetic analysis based on the replication initiator protein sequence indicated that the airborne ssDNA viruses were distantly related to known ssDNA viruses, suggesting that a high diversity of viruses were newly discovered. This research is the first to report the seasonality of airborne viruses and their genetic diversity, which enhances our understanding of viral ecology in temperate regions. PMID:22623790

  3. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions

    PubMed Central

    Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko

    2016-01-01

    The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

  4. Molecular spectroscopy evidence of berberine binding to DNA: comparative binding and thermodynamic profile of intercalation.

    PubMed

    Li, Xiao-Ling; Hu, Yan-Jun; Wang, Hong; Yu, Bing-Qiong; Yue, Hua-Li

    2012-03-12

    Berberine (BH) is an important traditional medicinal herb endowed with diverse pharmacological and biological activities. In this work, the binding characteristics and molecular mechanism of the interaction between the BH and herring sperm DNA were explored by UV-vis absorbance and fluorescence spectroscopy. In the mechanism discussion, fluorescence quenching, absorption spectra, competition experiment, and iodide quenching experiment studies hinted at an intercalative mode of binding for BH to DNA. Fluorescence studies revealed the binding constant (K) of BH-DNA was ∼10(4) L·mol(-1). The effects of temperature, chemical denaturants, thermal denaturation, and pH were studied to show the factors of the interaction and provided further support for the intercalative binding mode. The results of thermodynamic parameters ΔG, ΔH, and ΔS at different temperatures indicated that the hydrogen bonds and van der Waals interactions played major roles in the reaction, and the effect of ionic strength indicated that electrostatic attraction between the BH and DNA was also a component of the interaction.

  5. Facile dimer synthesis for DNA-binding polyamide ligands.

    PubMed

    Wetzler, Modi; Wemmer, David E

    2010-08-06

    Pyrrole-imidazole polyamide ligands are highly sequence specific synthetic DNA-binding ligands that bind with high affinity. To counter the synthetic difficulties associated with coupling the electron-rich heterocyclic acids to the electron-deficient nucleophilic imidazole amine, a novel approach is described for synthesis of Fmoc-protected dimers for solid-phase peptide synthesis (SPPS). This method produces the dimers in high yields, is broadly applicable to other heterocyclic-containing polyamides, and results in improved ligand yields and synthesis times.

  6. DNA-binding and fluorescence properties of the DNA bisintercalating purple oxazole dimer POPO-1

    NASA Astrophysics Data System (ADS)

    Winter, Stefan; Loeber, Gunter

    1997-01-01

    Dimers of the fluorescent DNA intercalators oxazole yellow and thiazole orange are used for high-sensitivity DNA detection due to their excellent fluorescence properties. Fluorescence lifetime techniques and absorption spectroscopy were used to investigate the DNA binding properties of POPO- 1 [4,4,8,8-tetramethyl-4,8-diazaundecamethylene)bis-4-(3- methyl-2,3-dihydrobenzo-1,3-oxazolyl)-2-methylidene] with the double-stranded homopurine-homopyrimidine polynucleotides poly(dA(DOT)dT), poly(dG(DOT)dC) and calf thymus DNA. The coexistence of different binding modes of POPO-1 with polynucleotides such as bisintercalation and monointercalation was found in connection with minor groove binding as well as electrostatic attachment. At high excess of polynucleotides, bisintercalation is the only existing form of binding whereas an increasing amount of POPO-1 leads to the coexistence of bis- and monointercalated dye molecules. The amount of bound dye increases with decreasing ionic strength of the buffer and is dependent on the polynucleotide itself. The best binding conditions were found with calf thymus DNA, followed by poly(dA(DOT)dT) and poly(dG(DOT)dC).

  7. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    NASA Astrophysics Data System (ADS)

    Shokri, Leila; Rouzina, Ioulia; Williams, Mark C.

    2009-06-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork.

  8. DBD2BS: connecting a DNA-binding protein with its binding sites

    PubMed Central

    Chien, Ting-Ying; Lin, Chih-Kang; Lin, Chih-Wei; Weng, Yi-Zhong; Chen, Chien-Yu; Chang, Darby Tien-Hao

    2012-01-01

    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes can be summarized as a PWM. This technique provides an effective alternative when the chromatin immunoprecipitation data are unavailable for PWM inference. To facilitate the procedure of predicting PWMs based on protein–DNA complexes or even structures of the unbound state, the web server, DBD2BS, is presented in this study. The DBD2BS uses an atom-level knowledge-based potential function to predict PWMs characterizing the sequences to which the query DBD structure can bind. For unbound queries, a list of 1066 DBD–DNA complexes (including 1813 protein chains) is compiled for use as templates for synthesizing bound structures. The DBD2BS provides users with an easy-to-use interface for visualizing the PWMs predicted based on different templates and the spatial relationships of the query protein, the DBDs and the DNAs. The DBD2BS is the first attempt to predict PWMs of DBDs from unbound structures rather than from bound ones. This approach increases the number of existing protein structures that can be exploited when analyzing protein–DNA interactions. In a recent study, the authors showed that the kernel adopted by the DBD2BS can generate PWMs consistent with those obtained from the experimental data. The use of DBD2BS to predict PWMs can be incorporated with sequence-based methods to discover binding sites in genome-wide studies. Available at: http://dbd2bs.csie.ntu.edu.tw/, http://dbd2bs.csbb.ntu.edu.tw/, and http://dbd2bs.ee.ncku.edu.tw. PMID:22693214

  9. DBD2BS: connecting a DNA-binding protein with its binding sites.

    PubMed

    Chien, Ting-Ying; Lin, Chih-Kang; Lin, Chih-Wei; Weng, Yi-Zhong; Chen, Chien-Yu; Chang, Darby Tien-Hao

    2012-07-01

    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes can be summarized as a PWM. This technique provides an effective alternative when the chromatin immunoprecipitation data are unavailable for PWM inference. To facilitate the procedure of predicting PWMs based on protein-DNA complexes or even structures of the unbound state, the web server, DBD2BS, is presented in this study. The DBD2BS uses an atom-level knowledge-based potential function to predict PWMs characterizing the sequences to which the query DBD structure can bind. For unbound queries, a list of 1066 DBD-DNA complexes (including 1813 protein chains) is compiled for use as templates for synthesizing bound structures. The DBD2BS provides users with an easy-to-use interface for visualizing the PWMs predicted based on different templates and the spatial relationships of the query protein, the DBDs and the DNAs. The DBD2BS is the first attempt to predict PWMs of DBDs from unbound structures rather than from bound ones. This approach increases the number of existing protein structures that can be exploited when analyzing protein-DNA interactions. In a recent study, the authors showed that the kernel adopted by the DBD2BS can generate PWMs consistent with those obtained from the experimental data. The use of DBD2BS to predict PWMs can be incorporated with sequence-based methods to discover binding sites in genome-wide studies. Available at: http://dbd2bs.csie.ntu.edu.tw/, http://dbd2bs.csbb.ntu.edu.tw/, and http://dbd2bs.ee.ncku.edu.tw.

  10. Genomic DNA binding to ZnO microrods

    NASA Astrophysics Data System (ADS)