Laccase engineering: from rational design to directed evolution.

PubMed

Mate, Diana M; Alcalde, Miguel

2015-01-01

Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.

Engineering Thermostable Microbial Xylanases Toward its Industrial Applications.

PubMed

Kumar, Vishal; Dangi, Arun Kumar; Shukla, Pratyoosh

2018-03-01

Xylanases are one of the important hydrolytic enzymes which hydrolyze the β-1, 4 xylosidic linkage of the backbone of the xylan polymeric chain which consists of xylose subunits. Xylanases are mainly found in plant cell walls and are produced by several kinds of microorganisms such as fungi, bacteria, yeast, and some protozoans. The fungi are considered as most potent xylanase producers than that of yeast and bacteria. There is a broad series of industrial applications for the thermostable xylanase as an industrial enzyme. Thermostable xylanases have been used in a number of industries such as paper and pulp industry, biofuel industry, food and feed industry, textile industry, etc. The present review explores xylanase-substrate interactions using gene-editing tools toward the comprehension in improvement in industrial stability of xylanases. The various protein-engineering and metabolic-engineering methods have also been explored to improve operational stability of xylanase. Thermostable xylanases have also been used for improvement in animal feed nutritional value. Furthermore, they have been used directly in bakery and breweries, including a major use in paper and pulp industry as a biobleaching agent. This present review envisages some of such applications of thermostable xylanases for their bioengineering.

Performance of an alkalophilic and halotolerant laccase from gamma-proteobacterium JB in the presence of industrial pollutants.

PubMed

Singh, Gursharan; Sharma, Prince; Capalash, Neena

2009-08-01

An alkalophilic and halotolerant laccase from gamma-proteobacterium JB catalyzed in high concentrations of organic solvents and various salts. The enzyme retained 80-100% activity in 10% concentration of dimethylsulfoxide (DMSO), ethanol, acetone or methanol; 100, 85 and 50% activity in 20 mM MgCl(2), 5.0 mM MnCl(2) and 0.1 mM CuCl(2); 140, 120 and 110% activity in 5.0 mM MnSO(4), 10 mM MgSO(4) and 1mM CaSO(4), respectively. Sodium halides inhibited the enzyme in the order: F(-)> Br(-)> I(-)> Cl(-). In 0.5 M NaCl, pH 6.0, laccase was approximately 60% active. Decolorization of indigo carmine by laccase at pH 9.0 was not inhibited even in the presence of 0.5 M NaCl. Release of chromophoric, reducing and hydrophobic compounds during biobleaching of straw rich-soda pulp by laccase was not inhibited when the enzyme was applied in the presence of 1 M NaCl at pH 8.0. Laccase retained 50% residual activity even when incubated with 5% calcium hypochlorite for 30 min.

Ethanol/water pulps from sugar cane straw and their biobleaching with xylanase from Bacillus pumilus.

PubMed

Moriya, Regina Y; Gonçalves, Adilson R; Duarte, Marta C T

2007-04-01

The influence of independent variables (temperature and time) on the cooking of sugar cane straw with ethanol/water mixtures was studied to determine operating conditions that obtain pulp with high cellulose contents and a low lignin content. An experimental 2(2) design was applied for temperatures of 185 and 215 degrees C, and time of 1 and 2.5 h with the ethanol/water mixture concentration and constant straw-to-solvent ratio. The system was scaled-up at 200 degrees C cooking temperature for 2 h with 50% ethanol-water concentration, and 1:10 (w/v) straw-to-solvent ratio to obtain a pulp with 3.14 cP viscosity, 58.09 kappa-number, and the chemical composition of the pulps were 3.2% pentosan and 31.5% lignin. Xylanase from Bacillus pumilus was then applied at a loading of 5-150 IU/g dry pulp in the sugar cane straw ethanol/water pulp at 50 degrees C for 2 and 20 h. To ethanol/water pulps, the best enzyme dosage was found to be 20 IU/g dry pulp at 20 h, and a high enzyme dosage of 150 IU/g dry pulp did not decrease the kappa-number of the pulp.

Biobleaching of industrial important dyes with peroxidase partially purified from garlic.

PubMed

Osuji, Akudo Chigozirim; Eze, Sabinus Oscar O; Osayi, Emmanuel Emeka; Chilaka, Ferdinand Chiemeka

2014-01-01

An acidic peroxidase was extracted from garlic (Allium sativum) and was partially purified threefold by ammonium sulphate precipitation, dialysis, and gel filtration chromatography using sephadex G-200. The specific activity of the enzyme increased from 4.89 U/mg after ammonium sulphate precipitation to 25.26 U/mg after gel filtration chromatography. The optimum temperature and pH of the enzyme were 50°C and 5.0, respectively. The Km and V max for H2O2 and o-dianisidine were 0.026 mM and 0.8 U/min, and 25 mM and 0.75 U/min, respectively. Peroxidase from garlic was effective in decolourizing Vat Yellow 2, Vat Orange 11, and Vat Black 27 better than Vat Green 9 dye. For all the parameters monitored, the decolourization was more effective at a pH range, temperature, H2O2 concentration, and enzyme concentration of 4.5-5.0, 50°C, 0.6 mM, and 0.20 U/mL, respectively. The observed properties of the enzyme together with its low cost of extraction (from local sources) show the potential of this enzyme for practical application in industrial wastewater treatment especially with hydrogen peroxide. These Vat dyes also exhibited potentials of acting as peroxidase inhibitors at alkaline pH range.

Production and Characterization of Trametes versicolor Mutants Unable To Bleach Hardwood Kraft Pulp

PubMed Central

Addleman, K.; Dumonceaux, T.; Paice, M. G.; Bourbonnais, R.; Archibald, F. S.

1995-01-01

Protoplasts of the monokaryotic strain 52J of Trametes versicolor were treated with UV light and screened for the inability to produce a colored precipitate on guaiacol-containing agar plates. Mutants unable to oxidize guaiacol had absent or very low secretion of laccase and manganese peroxidase (MnP) proteins. All isolates unable to secrete MnP were also unable to bleach or delignify kraft pulp. One mutant strain, M49, which grew normally but did not oxidize guaiacol, was tested further with a number of other substrates whose degradation has been associated with delignification by white rot fungi. Compared with the parent, 52J, mutant M49, secreting no MnP and low laccase, could not brighten or delignify kraft pulp, produced less ethylene from 2-keto methiolbutyric acid, released much less (sup14)CO(inf2) from [(sup14)C]DHP (a synthetic lignin-like polymerizate), and produced much less methanol from pulp. This mutant also displayed decreased abilities to oxidize the dyes poly B-411, poly R-478, and phenol red compared with the wild-type strain and was also unable to decolorize kraft bleachery effluent or mineralize its organochlorine. Addition of purified MnP in conjunction with H(inf2)O(inf2), MnSO(inf4), and an Mn(III) chelator to M49 cultures partially restored methanol production, pulp delignification, and biobleaching in some cases. PMID:16535150

Biobleaching of Industrial Important Dyes with Peroxidase Partially Purified from Garlic

PubMed Central

Osuji, Akudo Chigozirim; Eze, Sabinus Oscar O.; Osayi, Emmanuel Emeka; Chilaka, Ferdinand Chiemeka

2014-01-01

An acidic peroxidase was extracted from garlic (Allium sativum) and was partially purified threefold by ammonium sulphate precipitation, dialysis, and gel filtration chromatography using sephadex G-200. The specific activity of the enzyme increased from 4.89 U/mg after ammonium sulphate precipitation to 25.26 U/mg after gel filtration chromatography. The optimum temperature and pH of the enzyme were 50°C and 5.0, respectively. The Km and V max for H2O2 and o-dianisidine were 0.026 mM and 0.8 U/min, and 25 mM and 0.75 U/min, respectively. Peroxidase from garlic was effective in decolourizing Vat Yellow 2, Vat Orange 11, and Vat Black 27 better than Vat Green 9 dye. For all the parameters monitored, the decolourization was more effective at a pH range, temperature, H2O2 concentration, and enzyme concentration of 4.5–5.0, 50°C, 0.6 mM, and 0.20 U/mL, respectively. The observed properties of the enzyme together with its low cost of extraction (from local sources) show the potential of this enzyme for practical application in industrial wastewater treatment especially with hydrogen peroxide. These Vat dyes also exhibited potentials of acting as peroxidase inhibitors at alkaline pH range. PMID:25401128

Effect of Residual Lignin Type and Amount on Bleaching of Kraft Pulp by Trametes versicolor

PubMed Central

Reid, Ian D.; Paice, Michael G.

1994-01-01

The white rot fungus Trametes (Coriolus) versicolor can delignify and brighten unbleached hardwood kraft pulp within a few days, but softwood kraft pulps require longer treatment. To determine the contributions of higher residual lignin contents (kappa numbers) and structural differences in lignins to the recalcitrance of softwood kraft pulps to biobleaching, we tested softwood and hardwood pulps cooked to the same kappa numbers, 26 and 12. A low-lignin-content (overcooked) softwood pulp resisted delignification by T. versicolor, but a high-lignin-content (lightly cooked) hardwood pulp was delignified at the same rate as a normal softwood pulp. Thus, the longer time taken by T. versicolor to brighten softwood kraft pulp than hardwood pulp results from the higher residual lignin content of the softwood pulp; possible differences in the structures of the residual lignins are important only when the lignin becomes highly condensed. Under the conditions used in this study, when an improved fungal inoculum was used, six different softwood pulps were all substantially brightened by T. versicolor. Softwood pulps whose lignin contents were decreased by extended modified continuous cooking or oxygen delignification to kappa numbers as low as 15 were delignified by T. versicolor at the same rate as normal softwood pulp. More intensive O2 delignification, like overcooking, decreased the susceptibility of the residual lignin in the pulps to degradation by T. versicolor. PMID:16349246

Relationship between Fungal Biomass Production and the Brightening of Hardwood Kraft Pulp by Coriolus versicolor

PubMed Central

Kirkpatrick, Neil; Reid, Ian D.; Ziomek, Edmund; Ho, Christopher; Paice, Michael G.

1989-01-01

The white-rot fungus Coriolus versicolor increased the brightness of hardwood kraft pulp by two mechanisms depending on the concentration of available nitrogen. In low-nitrogen conditions, the brightening process was a chemical effect mediated by the fungus, associated with the removal of residual lignin in the pulp; kappa number was used as an indicator of lignin concentration. A five-day treatment in low-nitrogen conditions increased the brightness of hardwood kraft pulp from 36.2 to 54.5%, with a corresponding decrease in kappa number from 12.0 to 8.5, equivalent to a reduction in the lignin concentration from ca. 2.0% (wt/wt) to ca. 1.4% (wt/wt). Under these conditions, we concluded that the brightening of the pulp was a secondary metabolic event initiated after the depletion of available nitrogen. This method of brightening has been described as bleaching or biobleaching. By contrast, in high-nitrogen conditions, the brightening was a physical effect associated with the dilution of the dark pulp fibers by the relatively high levels of brighter fungal mycelium produced. Since this method of brightening was not evidently associated with lignin removal, it cannot be described as bleaching. In pulp samples brightened in high-nitrogen conditions, as brightness increased, there was a corresponding increase in kappa number. This observation was explained by the consumption of potassium permanganate by the fungal mycelium, which interfered with kappa number determinations at high fungal biomass levels. PMID:16347907

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

PubMed

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

Determination of some significant batch culture conditions affecting acetyl-xylan esterase production by Penicillium notatum NRRL-1249

PubMed Central

2011-01-01

Background Acetyl-xylan esterase (AXE, EC 3.1.1.72) hydrolyses acetate group from the linear chain of xylopyranose residues bound by β-1,4-linkage. The enzyme finds commercial applications in bio-bleaching of wood pulp, treating animal feed to increase digestibility, processing food to increase clarification and converting lignocellulosics to feedstock and fuel. In the present study, we report on the production of an extracellular AXE from Penicillium notatum NRRL-1249 by solid state fermentation (SSF). Results Wheat bran at a level of 10 g (with 4 cm bed height) was optimized as the basal substrate for AXE production. An increase in enzyme activity was observed when 7.5 ml of mineral salt solution (MSS) containing 0.1% KH2PO4, 0.05% KCl, 0.05% MgSO4.7H2O, 0.3% NaNO3, 0.001% FeSO4.2H2O and 0.1% (v/w) Tween-80 as an initial moisture content was used. Various nitrogen sources including ammonium sulphate, urea, peptone and yeast extract were compared for enzyme production. Maximal enzyme activity of 760 U/g was accomplished which was found to be highly significant (p ≤ 0.05). A noticeable enhancement in enzyme activity was observed when the process parameters including incubation period (48 h), initial pH (5), 0.2% (w/w) urea as nitrogen source and 0.5% (v/w) Tween-80 as a stimulator were further optimized using a 2-factorial Plackett-Burman design. Conclusion From the results it is clear that an overall improvement of more than 35% in terms of net enzyme activity was achieved compared to previously reported studies. This is perhaps the first report dealing with the use of P. notatum for AXE production under batch culture SSF. The Plackett-Burman model terms were found highly significant (HS), suggesting the potential commercial utility of the culture used (df = 3, LSD = 0.126). PMID:21575210

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications.

Improvement for enhanced xylanase production by Cellulosimicrobium cellulans CKMX1 using central composite design of response surface methodology.

PubMed

Walia, Abhishek; Mehta, Preeti; Guleria, Shiwani; Shirkot, Chand Karan

2015-12-01

The effects of yeast extract (X 1 ), NH 4 NO 3 (X 2 ), peptone (X 3 ), urea (X 4 ), CMC (X 5 ), Tween 20 (X 6 ), MgSO 4 (X 7 ), and CaCO 3 (X 8 ) on production of xylanase from Cellulosimicrobium cellulans CKMX1 were optimized by statistical analysis using response surface methodology (RSM). The RSM was used to optimize xylanase production by implementing the Central composite design. Statistical analysis of the results showed that the linear, interaction and quadric terms of these variables had significant effects. However, only the linear effect of X 4 , X 5 , interaction effect of X 1 X 7 , X 1 X 8 , X 2 X 3 , X 2 X 8 , X 3 X 6 , X 3 X 8 , X 4 X 6 , X 4 X 7 , X 5 X 7 , X 5 X 8 and quadratic effect of X 3 2 , X 5 2 and X 7 2 found to be insignificant terms in the quadratic model and had no response at significant level. The minimum and maximum xylanase production obtained was 331.50 U/g DBP and 1027.65 U/g DBP, respectively. The highest xylanase activity was obtained from Run No. 30, which consisted of yeast extract (X 1 ), 1.00 g (%); NH 4 NO 3 (X 2 ), 0.20 g (%); peptone (X 3 ), 1.00 g (%); urea (X 4 ), 10 mg (%); CMC (X 5 ), 1.00 g (%); Tween 20 (X 6 ), 0.02 mL (%); CaCO 3 (X 7 ), 0.50 g (%) and MgSO 4 (X 8 ), 9.0 g (%). The optimization resulted in 3.1-fold increase of xylanase production, compared with the lowest xylanase production of 331.50 U/g DBP after 72 h of incubation in stationary flask experiment. Application of cellulase-free xylanase in pulp biobleaching from C. cellulans CKMX1 under C-E P -D sequence has been shown to bring about a 12.5 % reduction of chlorine, decrease of 0.8 kappa points (40 %), and gain in brightness was 1.42 % ISO points in 0.5 % enzyme treated pulp as compared to control.

Structure determination of the extracellular xylanase from Geobacillus stearothermophilus by selenomethionyl MAD phasing.

PubMed

Teplitsky, A; Mechaly, A; Stojanoff, V; Sainz, G; Golan, G; Feinberg, H; Gilboa, R; Reiland, V; Zolotnitsky, G; Shallom, D; Thompson, A; Shoham, Y; Shoham, G

2004-05-01

Xylanases are hemicellulases that hydrolyze the internal beta-1,4-glycoside bonds of xylan. The extracellular thermostable endo-1,4-beta-xylanase (EC 3.2.1.8; XT6) produced by the thermophilic bacterium Geobacillus stearothermophilus T-6 was shown to bleach pulp optimally at pH 9 and 338 K and was successfully used in a large-scale biobleaching mill trial. The xylanase gene was cloned and sequenced. The mature enzyme consists of 379 amino acids, with a calculated molecular weight of 43 808 Da and a pI of 9.0. Crystallographic studies of XT6 were performed in order to study the mechanism of catalysis and to provide a structural basis for the rational introduction of enhanced thermostability by site-specific mutagenesis. XT6 was crystallized in the primitive trigonal space group P3(2)21, with unit-cell parameters a = b = 112.9, c = 122.7 A. A full diffraction data set for wild-type XT6 has been measured to 2.4 A resolution on flash-frozen crystals using synchrotron radiation. A fully exchanged selenomethionyl XT6 derivative (containing eight Se atoms per XT6 molecule) was also prepared and crystallized in an isomorphous crystal form, providing full selenium MAD data at three wavelengths and enabling phase solution and structure determination. The structure of wild-type XT6 was refined at 2.4 A resolution to a final R factor of 15.6% and an R(free) of 18.6%. The structure demonstrates that XT6 is made up of an eightfold TIM-barrel containing a deep active-site groove, consistent with its 'endo' mode of action. The two essential catalytic carboxylic residues (Glu159 and Glu265) are located at the active site within 5.5 A of each other, as expected for 'retaining' glycoside hydrolases. A unique subdomain was identified in the carboxy-terminal part of the enzyme and was suggested to have a role in xylan binding. The three-dimensional structure of XT6 is of great interest since it provides a favourable starting point for the rational improvement of its already high thermal and pH stabilities, which are required for a number of biotechnological and industrial applications.

Strategies for decolorization and detoxification of pulp and paper mill effluent.

PubMed

Garg, Satyendra K; Tripathi, Manikant

2011-01-01

The potential hazards associated with industrial effluents, coupled with increasing awareness of environment problems, have prompted many countries to limit the indiscriminate discharge of untreated wastewaters. The pulp and paper industry has been among the most significant of industrial polluters of the waterways, and therefore has been one of the industries of concern. The pulp and paper industry produces large quantities of brown/black effluent that primarily result from pulping, bleaching, and paper-making production stages. The dark color and toxicity of pulp-paper mill effluent comes primarily from lignin and its chlorinated derivatives (e.g., lignosulphonic acid, resins, phenols, and hydrocarbons) that are released during various processing steps of lignocellulosic materials. The color originates from pulping and pulp bleaching stages, while adsorbable organic halides (AOX) originates exclusively from chlorine bleaching. Discharge of untreated effluent results in increased BOD/COD, slime growth, thermal problems, scum formation, discoloration, loss of aesthetic quality and toxicity to the aquatic life, in the receiving waterbodies. The dark brow color of pulp-paper effluent is not only responsible for aesthetic unacceptability, but also prevents the passage of sunlight through colored waterbodies. This reduces the photosynthetic activity of aquatic flora, ultimately causing depletion of dissolved oxygen. The pulp-paper organic waste, coupled with the presence of chlorine, results in the generation of highly chlorinated organic compounds. These toxic constituents of wastewater pose a human health risk through long term exposure. via drinking water and\\or through consumption of fish that can bioaccumulate certain pollutants from the food chain. Therefore, considerable attention has been focused by many countries on decolorization of paper mill effluents , along with reduction in the contaminants that pose human health or other environmental hazards. Various physicochemical remediation treatments in the pulp-paper industry are now used, or have been suggested, but often are not implemented, because of the high cost involved. More recently, the paper and pulp industry has been investigating the use of biological remediation steps to replace or augment current treatment strategies. Certain biological treatments offer opportunities to reduce cost (both capital and operating), reduce energy consumption, and minimize environmental impact. Two primary approaches may be effective to curtail release of toxic effluents: first, development of pulping and bleaching processes that emphasize improved oxygen delignification or biopulping, plus partial or complete replacement of chlorine treatment with hydrogen peroxide or with biobleaching; second, implementation of biological processing that involves sequential two-step anaerobic-aerobic or three-step aerobic-anaerobic treatment technologies at end of pipe. The selection of the specific process will depend upon the type of pollutants/toxicants/mutagens present in the effluent. The use of environmental-friendly technologies in the pulp and paper industry is becoming more popular, partly because of increasing regulation, and partly because of the availability of new techniques that can be used to economically deal with pollutants in the effluents. Moreover, biotechnology research methods are offering promise for even greater improvements in the future. The obvious ultimate goal of the industry and the regulators should be zero emission through recycling of industrial wastewater, or discharge of the bare minimum amount of toxicants or color.

Mill Designed Bio bleaching Technologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Institute of Paper Science Technology

2004-01-30

A key finding of this research program was that Laccase Mediator Systems (LMS) treatments on high-kappa kraft could be successfully accomplished providing substantial delignification (i.e., > 50%) without detrimental impact on viscosity and significantly improved yield properties. The efficiency of the LMS was evident since most of the lignin from the pulp was removed in less than one hour at 45 degrees C. Of the mediators investigated, violuric acid was the most effective vis-a-vis delignification. A comparative study between oxygen delignification and violuric acid revealed that under relatively mild conditions, a single or a double LMS{sub VA} treatment is comparablemore » to a single or a double O stage. Of great notability was the retention of end viscosity of LMS{sub VA} treated pulps with respect to the end viscosity of oxygen treated pulps. These pulps could then be bleached to full brightness values employing conventional ECF bleaching technologies and the final pulp physical properties were equal and/or better than those bleached in a conventional ECF manner employing an aggressively O or OO stage initially. Spectral analyses of residual lignins isolated after LMS treated high-kappa kraft pulps revealed that similar to HBT, VA and NHA preferentially attack phenolic lignin moieties. In addition, a substantial decrease in aliphatic hydroxyl groups was also noted, suggesting side chain oxidation. In all cases, an increase in carboxylic acid was observed. Of notable importance was the different selectivity of NHA, VA and HBT towards lignin functional groups, despite the common N-OH moiety. C-5 condensed phenolic lignin groups were overall resistant to an LMS{sub NHA, HBT} treatments but to a lesser extent to an LMS{sub VA}. The inactiveness of these condensed lignin moieties was not observed when low-kappa kraft pulps were biobleached, suggesting that the LMS chemistry is influenced by the extent of delignification. We have also demonstrated that the current generation of laccase has a broad spectrum of operating parameters. Nonetheless, the development of future genetically engineered laccases with enhanced temperature, pH and redox potentials will dramatically improve the overall process. A second challenge for LMS bleaching technologies is the need to develop effective, catalytic mediators. From the literature we already know this is feasible since ABTS and some inorganic mediators are catalytic. Unfortunately, the mediators that exhibit catalytic properties do not exhibit significant delignification properties and this is a challenge for future research studies. Potential short-term mill application of laccase has been recently reported by Felby132 and Chandra133 as they have demonstrated that the physical properties of linerboard can be improved when exposed to laccase without a chemical mediator. In addition, xxx has shown that the addition of laccase to the whitewater of the paper machine has several benefits for the removal of colloidal materials. Finally, this research program has presented important features on the delignification chemistry of LMS{sub NHA} and LMS{sub VA} that, in the opinion of the author, are momentous contributions to the overall LMS chemistry/biochemistry knowledge base which will continue to have future benefits.« less

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less