Sample records for biological damage induced

  1. Pressure pulse induced-damage in live biological samples

    NASA Astrophysics Data System (ADS)

    Bo, C.; Balzer, J.; Godfrey, S.; Francois, M.; Saffell, J. L.; Rankin, S. M.; Proud, W. G.; Brown, K. A.


    Developing a cellular and molecular understanding of the nature of traumatic and post-traumatic effects of blast on live biological samples is critical for improving clinical outcomes. To analyze the effects of blast waves upon the cellular structures and the underlying physiological and biochemical changes, we have constructed an experimental platform capable of delivering compression waves, of amplitudes relevant to blast, to cell suspensions in a contained environment. Initial characterization of the system shows that cell cultures can be subjected to high-intensity compression waves up to 15 MPa in pressure and duration of 80 ± 10μs. Studies of mouse mesenchymal stem cells subjected to two different pressure impulses were analysed by cell counting, cell viability assays and microscopic evaluation: the experiments present evidence suggestive of increased levels of damage and loss of cellular integrity compared to uncompressed cell cultures.

  2. Effects of carotenoids on damage of biological lipids induced by gamma irradiation

    NASA Astrophysics Data System (ADS)

    Saito, Takeshi; Fujii, Noriko


    Carotenoids are considered to be involved in the radioresistant mechanisms of radioresistant bacteria. In these bacterial cells, carotenoids are present in biological lipids, and therefore may be related to the radiation-induced damage of lipids. However, only limited data are available for the role of carotenoids in such damage. In this study, we irradiated an α-linolenic acid-benzene solution with gamma rays and analyzed the resulting oxidative degradation and peroxidation damage in the presence or absence of two typical carotenoids: β-carotene and astaxanthin. The analyses revealed that oxidative degradation and peroxidation of α-linolenic acid, as evaluated by the amount of malondialdehyde and conjugated diene formed, respectively, increased in a dose-dependent manner. Moreover, 8.5×10-3 M β-carotene inhibited gamma radiation-induced oxidative degradation of α-linolenic acid, whereas 5.0×10-5 and 5.0×10-6 M β-carotene, and 5.0×10-7 and 5.0×10-8 M astaxanthin promoted degradation. In contrast, neither β-carotene nor astaxanthin affected peroxidation of α-linolenic acid. These results suggest that an optimum concentration of carotenoids in radioresistant bacteria protects biological lipid structures from radiation-induced damage.

  3. Cellular characterization of compression induced-damage in live biological samples

    NASA Astrophysics Data System (ADS)

    Bo, Chiara; Balzer, Jens; Hahnel, Mark; Rankin, Sara M.; Brown, Katherine A.; Proud, William G.


    Understanding the dysfunctions that high-intensity compression waves induce in human tissues is critical to impact on acute-phase treatments and requires the development of experimental models of traumatic damage in biological samples. In this study we have developed an experimental system to directly assess the impact of dynamic loading conditions on cellular function at the molecular level. Here we present a confinement chamber designed to subject live cell cultures in liquid environment to compression waves in the range of tens of MPa using a split Hopkinson pressure bars system. Recording the loading history and collecting the samples post-impact without external contamination allow the definition of parameters such as pressure and duration of the stimulus that can be related to the cellular damage. The compression experiments are conducted on Mesenchymal Stem Cells from BALB/c mice and the damage analysis are compared to two control groups. Changes in Stem cell viability, phenotype and function are assessed flow cytometry and with in vitro bioassays at two different time points. Identifying the cellular and molecular mechanisms underlying the damage caused by dynamic loading in live biological samples could enable the development of new treatments for traumatic injuries.

  4. Biological damage induced by ionizing cosmic rays in dry Arabidopsis seeds.


    Kranz, A R; Bork, U; Bucker, H; Reitz, G


    In September 1987 dry seeds containing embryos of the crucifer plant Arabidopsis thaliana (L.) Heynh, were flown in orbit for 13 days on the Kosmos 1887 satellite. The seeds were fixed on CNd detectors and stored in units of Biorack type I/O. One unit was exposed inside, another one outside the satellite. The temperature profile of the flown seeds inside the satellite was simulated on earth in an identical backup control sample (BC). An additional control (SC) was studied with the original seeds sample. By use of the CNd-detector, HZE-tracks were measured with a PC-assisted microscope. The biological damages were investigated by growing the seeds under controlled climatic conditions. The following biological endpoints of the cosmic radiation damage were studied: germination, radicle length, sublethality, morphological aberrations, flower development, tumorization, embryo lethality inside the siliques. The summarized damage (D) and the mutation frequencies of embyronic lethal genes were calculated. The following results were obtained: the damages increase significantly in orbit at all biological endpoints; germination and fiowerings especially, as well as embryo lethality of fruits and lethal mutation frequency, were maximum mostly for HZE-hit seeds. Additionally, an increase of damage was observed for the seeds of the outside-exposed Biorack in comparison to the inside ones, which was probably caused by less radiation shielding and free space vacuum. The significance of the results obtained is discussed with respect to stress and risk and, thus, the quality of the RBE-factors and heavy ionizing radiation all needed for the very definition of radiation protection standards in space. PMID:11537515

  5. Role of cellular communication in the pathways of radiation-induced biological damage

    NASA Astrophysics Data System (ADS)

    Ballarini, Francesca; Facoetti, Angelica; Mariotti, Luca; Nano, Rosanna; Ottolenghi, Andrea

    During the last decade, a large number of experimental studies on the so-called "non-targeted effects", in particular bystander effects, outlined that cellular communication plays a signifi- cant role in the pathways leading to radiation-induced biological damage. This might imply a paradigm shift in (low-dose) radiobiology, according to which one has to consider the response of groups of cells behaving like a population rather than single cells behaving as individuals. Furthermore, bystander effects, which are observed both for lethal endpoints (e.g. clonogenic inactivation and apoptosis) and for non-lethal ones (e.g. mutations and neoplastic transformation), tend to show non-linear dose responses characterized by a sharp increase followed by a plateau. This might have significant consequences in terms of low-dose risk, which is generally calculated on the basis of the "Linear No Threshold" hypothesis. Although it is known that two types of cellular communication (i.e. via gap junctions and/or molecular messengers diffusing in the extra-cellular environment, such as cytokines) play a major role, it is of utmost importance to better understand the underlying mechanisms, and how such mechanisms can be modulated by ionizing radiation. Though the "final" goal is to elucidate the in vivo scenario, in the meanwhile also in vitro studies can provide useful insights. In the present paper we will discuss key issues on the mechanisms underlying non-targeted effects and, more generally, cell communication, with focus on candidate molecular signals. Theoretical models and simulation codes can be of help in elucidating such mechanisms. In this framework, we will present a model and Monte Carlo code, under development at the University of Pavia, simulating the release, diffusion and internalization of candidate signals (typically cytokines) travelling in the extra-cellular environment, both by unirradiated (i.e., control) cells and by irradiated cells. The focus will be on the

  6. Protective Effect of Selected Medicinal Plants against Hydrogen Peroxide Induced Oxidative Damage on Biological Substrates

    PubMed Central

    Pai Kotebagilu, Namratha; Reddy Palvai, Vanitha


    Oxidative stress is developed due to susceptibility of biological substrates to oxidation by generation of free radicals. In degenerative diseases, oxidative stress level can be reduced by antioxidants which neutralize free radicals. Primary objective of this work was to screen four medicinal plants, namely, Andrographis paniculata, Costus speciosus, Canthium parviflorum, and Abrus precatorius, for their antioxidant property using two biological substrates—RBC and microsomes. The antioxidative ability of three solvent extracts, methanol (100% and 80%) and aqueous leaf extracts, was studied at different concentrations by thiobarbituric acid reactive substances method using Fenton's reagent to induce oxidation in the substrates. The polyphenol and flavonoid content were analyzed to relate with the observed antioxidant effect of the extracts. The phytochemical screening indicated the presence of flavonoids, polyphenols, tannins, and β-carotene in the samples. In microsomes, 80% methanol extract of Canthium and Costus and, in RBC, 80% methanol extract of Costus showed highest inhibition of oxidation and correlated well with the polyphenol and flavonoid content. From the results it can be concluded that antioxidants from medicinal plants are capable of inhibiting oxidation in biological systems, suggesting scope for their use as nutraceuticals. PMID:25436152

  7. Protective Effect of Selected Medicinal Plants against Hydrogen Peroxide Induced Oxidative Damage on Biological Substrates.


    Pai Kotebagilu, Namratha; Reddy Palvai, Vanitha; Urooj, Asna


    Oxidative stress is developed due to susceptibility of biological substrates to oxidation by generation of free radicals. In degenerative diseases, oxidative stress level can be reduced by antioxidants which neutralize free radicals. Primary objective of this work was to screen four medicinal plants, namely, Andrographis paniculata, Costus speciosus, Canthium parviflorum, and Abrus precatorius, for their antioxidant property using two biological substrates-RBC and microsomes. The antioxidative ability of three solvent extracts, methanol (100% and 80%) and aqueous leaf extracts, was studied at different concentrations by thiobarbituric acid reactive substances method using Fenton's reagent to induce oxidation in the substrates. The polyphenol and flavonoid content were analyzed to relate with the observed antioxidant effect of the extracts. The phytochemical screening indicated the presence of flavonoids, polyphenols, tannins, and β-carotene in the samples. In microsomes, 80% methanol extract of Canthium and Costus and, in RBC, 80% methanol extract of Costus showed highest inhibition of oxidation and correlated well with the polyphenol and flavonoid content. From the results it can be concluded that antioxidants from medicinal plants are capable of inhibiting oxidation in biological systems, suggesting scope for their use as nutraceuticals. PMID:25436152

  8. Radiation-induced DNA damage and the relative biological effectiveness of 18F-FDG in wild-type mice


    Taylor, Kristina; Lemon, Jennifer A.; Boreham, Douglas R.


    Clinically, the most commonly used positron emission tomography (PET) radiotracer is the glucose analog 2-[18F] fluoro-2-deoxy-d-glucose (18F-FDG), however little research has been conducted on the biological effects of 18F-FDG injections. The induction and repair of DNA damage and the relative biological effectiveness (RBE) of radiation from 18F-FDG relative to 662 keV γ-rays were investigated. The study also assessed whether low-dose radiation exposure from 18F-FDG was capable of inducing an adaptive response. DNA damage to the bone marrow erythroblast population was measured using micronucleus formation and lymphocyte γH2A.X levels. To test the RBE of 18F-FDG, mice were injected with a rangemore » of activities of 18F-FDG (0–14.80 MBq) or irradiated with Cs-137 γ-rays (0–100 mGy). The adaptive response was investigated 24 h after the 18F-FDG injection by 1 Gy in vivo challenge doses for micronucleated reticulocyte (MN-RET) formation or 1, 2 and 4 Gy in vitro challenges doses for γH2A.X formation. A significant increase in MN-RET formation above controls occurred following injection activities of 3.70, 7.40 or 14.80 MBq (P < 0.001) which correspond to bone marrow doses of ~35, 75 and 150 mGy, respectively. Per unit dose, the Cs-137 radiation exposure induced significantly more damage than the 18F-FDG injections (RBE = 0.79 ± 0.04). A 20% reduction in γH2A.X fluorescence was observed in mice injected with a prior adapting low dose of 14.80 MBq 18F-FDG relative to controls (P < 0.019). A 0.74 MBq 18F-FDG injection, which gives mice a dose approximately equal to a typical human PET scan, did not cause a significant increase in DNA damage nor did it generate an adaptive response. Typical 18F-FDG injection activities used in small animal imaging (14.80 MBq) resulted in a decrease in DNA damage, as measured by γH2A.X formation, below spontaneous levels observed in control mice. Lastly, the 18F-FDG RBE was <1.0, indicating that the mixed radiation quality

  9. Laser-induced damage in biological tissue: Role of complex and dynamic optical properties of the medium

    NASA Astrophysics Data System (ADS)

    Ahmed, Elharith M.

    Since its invention in the early 1960's, the laser has been used as a tool for surgical, therapeutic, and diagnostic purposes. To achieve maximum effectiveness with the greatest margin of safety it is important to understand the mechanisms of light propagation through tissue and how that light affects living cells. Lasers with novel output characteristics for medical and military applications are too often implemented prior to proper evaluation with respect to tissue optical properties and human safety. Therefore, advances in computational models that describe light propagation and the cellular responses to laser exposure, without the use of animal models, are of considerable interest. Here, a physics-based laser-tissue interaction model was developed to predict the spatial and temporal temperature and pressure rise during laser exposure to biological tissues. Our new model also takes into account the dynamic nature of tissue optical properties and their impact on the induced temperature and pressure profiles. The laser-induced retinal damage is attributed to the formation of microbubbles formed around melanosomes in the retinal pigment epithelium (RPE) and the damage mechanism is assumed to be photo-thermal. Selective absorption by melanin creates these bubbles that expand and collapse around melanosomes, destroying cell membranes and killing cells. The Finite Element (FE) approach taken provides suitable ground for modeling localized pigment absorption which leads to a non-uniform temperature distribution within pigmented cells following laser pulse exposure. These hot-spots are sources for localized thermo-elastic stresses which lead to rapid localized expansions that manifest themselves as microbubbles and lead to microcavitations. Model predictions for the interaction of lasers at wavelengths of 193, 694, 532, 590, 1314, 1540, 2000, and 2940 nm with biological tissues were generated and comparisons were made with available experimental data for the retina

  10. Radiation-induced DNA damage and the relative biological effectiveness of 18F-FDG in wild-type mice

    SciTech Connect

    Taylor, Kristina; Lemon, Jennifer A.; Boreham, Douglas R.


    Clinically, the most commonly used positron emission tomography (PET) radiotracer is the glucose analog 2-[18F] fluoro-2-deoxy-d-glucose (18F-FDG), however little research has been conducted on the biological effects of 18F-FDG injections. The induction and repair of DNA damage and the relative biological effectiveness (RBE) of radiation from 18F-FDG relative to 662 keV γ-rays were investigated. The study also assessed whether low-dose radiation exposure from 18F-FDG was capable of inducing an adaptive response. DNA damage to the bone marrow erythroblast population was measured using micronucleus formation and lymphocyte γH2A.X levels. To test the RBE of 18F-FDG, mice were injected with a range of activities of 18F-FDG (0–14.80 MBq) or irradiated with Cs-137 γ-rays (0–100 mGy). The adaptive response was investigated 24 h after the 18F-FDG injection by 1 Gy in vivo challenge doses for micronucleated reticulocyte (MN-RET) formation or 1, 2 and 4 Gy in vitro challenges doses for γH2A.X formation. A significant increase in MN-RET formation above controls occurred following injection activities of 3.70, 7.40 or 14.80 MBq (P < 0.001) which correspond to bone marrow doses of ~35, 75 and 150 mGy, respectively. Per unit dose, the Cs-137 radiation exposure induced significantly more damage than the 18F-FDG injections (RBE = 0.79 ± 0.04). A 20% reduction in γH2A.X fluorescence was observed in mice injected with a prior adapting low dose of 14.80 MBq 18F-FDG relative to controls (P < 0.019). A 0.74 MBq 18F-FDG injection, which gives mice a dose approximately equal to a typical human PET scan, did not cause a significant increase in DNA damage nor did it generate an adaptive response. Typical 18F-FDG injection activities used in small animal imaging (14.80 MBq) resulted in a decrease in DNA damage, as measured by γH2A.X formation

  11. Design, synthesis and biological evaluation of novel chiral oxazino-indoles as potential and selective neuroprotective agents against Aβ25-35-induced neuronal damage.


    Chen, Jing; Tao, Ling-Xue; Xiao, Wei; Ji, Sha-Sha; Wang, Jian-Rong; Li, Xu-Wen; Zhang, Hai-Yan; Guo, Yue-Wei


    A series of chiral oxazino-indoles have been synthesized via a key intermolecular oxa-Pictet-Spengler reaction. These compounds exhibited significant and selective neuroprotective effects against Aβ25-35-induced neuronal damage. This is the first report of evaluating the influence of chiral diversity of oxazino-indoles on their neuroprotective activities, with the structure-activity relationship been analyzed. The highly active compounds 3f, 3g, 4g, 4h, and 6b all performed over 90% cell protection, providing a new direction for the development of neuroprotective agents against Alzheimer's disease. PMID:27301369

  12. Chemistry and Structural Biology of DNA Damage and Biological Consequences

    PubMed Central

    Stone, Michael P.; Huang, Hai; Brown, Kyle L.; Shanmugam, Ganesh


    The formation of adducts by the reaction of chemicals with DNA is a critical step for the initiation of carcinogenesis. The structural analysis of various DNA adducts reveals that conformational and chemical rearrangements and interconversions are a common theme. Conformational changes are modulated both by the nature of adduct and the base sequences neighboring the lesion sites. Equilibria between conformational states may modulate both DNA repair and error-prone replication past these adducts. Likewise, chemical rearrangements of initially formed DNA adducts are also modulated both by the nature of adducts and the base sequences neighboring the lesion sites. In this review, we focus on DNA damage caused by a number of environmental and endogenous agents, and biological consequences. PMID:21922653

  13. Prevention of chemotherapy-induced ovarian damage.


    Roness, Hadassa; Kashi, Oren; Meirow, Dror


    Recent advances in our understanding of the mechanisms underlying the impact of cytotoxic drugs on the ovary have opened up new directions for the protection of the ovary from chemotherapy-induced damage. These advances have spurred the investigation of pharmacological agents to prevent ovarian damage at the time of treatment. Prevention of ovarian damage and follicle loss would provide significant advantages over existing fertility preservation techniques. This manuscript reviews new methods for the prevention of chemotherapy-induced ovarian damage, including agents that act on the PI3K/PTEN/Akt follicle activation pathway, apoptotic pathways, the vascular system, and other potential methods of reducing chemotherapy-induced ovotoxicity. PMID:26677788

  14. The loss of ATP2C1 impairs the DNA damage response and induces altered skin homeostasis: Consequences for epidermal biology in Hailey-Hailey disease

    PubMed Central

    Cialfi, Samantha; Le Pera, Loredana; De Blasio, Carlo; Mariano, Germano; Palermo, Rocco; Zonfrilli, Azzurra; Uccelletti, Daniela; Palleschi, Claudio; Biolcati, Gianfranco; Barbieri, Luca; Screpanti, Isabella; Talora, Claudio


    Mutation of the Golgi Ca2+-ATPase ATP2C1 is associated with deregulated calcium homeostasis and altered skin function. ATP2C1 mutations have been identified as having a causative role in Hailey-Hailey disease, an autosomal-dominant skin disorder. Here, we identified ATP2C1 as a crucial regulator of epidermal homeostasis through the regulation of oxidative stress. Upon ATP2C1 inactivation, oxidative stress and Notch1 activation were increased in cultured human keratinocytes. Using RNA-seq experiments, we found that the DNA damage response (DDR) was consistently down-regulated in keratinocytes derived from the lesions of patients with Hailey-Hailey disease. Although oxidative stress activates the DDR, ATP2C1 inactivation down-regulates DDR gene expression. We showed that the DDR response was a major target of oxidative stress-induced Notch1 activation. Here, we show that this activation is functionally important because early Notch1 activation in keratinocytes induces keratinocyte differentiation and represses the DDR. These results indicate that an ATP2C1/NOTCH1 axis might be critical for keratinocyte function and cutaneous homeostasis, suggesting a plausible model for the pathological features of Hailey-Hailey disease. PMID:27528123

  15. The loss of ATP2C1 impairs the DNA damage response and induces altered skin homeostasis: Consequences for epidermal biology in Hailey-Hailey disease.


    Cialfi, Samantha; Le Pera, Loredana; De Blasio, Carlo; Mariano, Germano; Palermo, Rocco; Zonfrilli, Azzurra; Uccelletti, Daniela; Palleschi, Claudio; Biolcati, Gianfranco; Barbieri, Luca; Screpanti, Isabella; Talora, Claudio


    Mutation of the Golgi Ca(2+)-ATPase ATP2C1 is associated with deregulated calcium homeostasis and altered skin function. ATP2C1 mutations have been identified as having a causative role in Hailey-Hailey disease, an autosomal-dominant skin disorder. Here, we identified ATP2C1 as a crucial regulator of epidermal homeostasis through the regulation of oxidative stress. Upon ATP2C1 inactivation, oxidative stress and Notch1 activation were increased in cultured human keratinocytes. Using RNA-seq experiments, we found that the DNA damage response (DDR) was consistently down-regulated in keratinocytes derived from the lesions of patients with Hailey-Hailey disease. Although oxidative stress activates the DDR, ATP2C1 inactivation down-regulates DDR gene expression. We showed that the DDR response was a major target of oxidative stress-induced Notch1 activation. Here, we show that this activation is functionally important because early Notch1 activation in keratinocytes induces keratinocyte differentiation and represses the DDR. These results indicate that an ATP2C1/NOTCH1 axis might be critical for keratinocyte function and cutaneous homeostasis, suggesting a plausible model for the pathological features of Hailey-Hailey disease. PMID:27528123

  16. Corrosion-induced damage raises serious implications

    SciTech Connect

    Kane, R.D.; Cayard, M.S.


    One of the most difficult and often underestimated aspects of pipeline rehabilitation is the assessment of corrosion-induced damage. This question involves evaluation of damage from prior service as well as consideration of conditions which may pose additional time-dependent degradation which could affect the future serviceability of the pipeline. The present study examines the assessment of pipeline damage and rehabilitation requirements through knowledge of materials of construction, operating conditions, field inspection and service records.

  17. Quantifying pulsed laser induced damage to graphene

    SciTech Connect

    Currie, Marc; Caldwell, Joshua D.; Bezares, Francisco J.; Robinson, Jeremy; Anderson, Travis; Chun, Hayden; Tadjer, Marko


    As an emerging optical material, graphene's ultrafast dynamics are often probed using pulsed lasers yet the region in which optical damage takes place is largely uncharted. Here, femtosecond laser pulses induced localized damage in single-layer graphene on sapphire. Raman spatial mapping, SEM, and AFM microscopy quantified the damage. The resulting size of the damaged area has a linear correlation with the optical fluence. These results demonstrate local modification of sp{sup 2}-carbon bonding structures with optical pulse fluences as low as 14 mJ/cm{sup 2}, an order-of-magnitude lower than measured and theoretical ablation thresholds.


    ERIC Educational Resources Information Center



  19. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik


    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  20. Autophagy in light-induced retinal damage.


    Chen, Yu; Perusek, Lindsay; Maeda, Akiko


    Vision is reliant upon converting photon signals to electrical information which is interpreted by the brain and therefore allowing us to receive information about our surroundings. However, when exposed to excessive light, photoreceptors and other types of cells in the retina can undergo light-induced cell death, termed light-induced retinal damage. In this review, we summarize our current knowledge regarding molecular events in the retina after excessive light exposure and mechanisms of light-induced retinal damage. We also introduce works which investigate potential roles of autophagy, an essential cellular mechanism required for maintaining homeostasis under stress conditions, in the illuminated retina and animal models of light-induced retinal damage. PMID:26325327

  1. Calcium signaling in UV-induced damage

    NASA Astrophysics Data System (ADS)

    Sun, Dan; Zhang, Su-juan; Li, Yuan-yuan; Qu, Ying; Ren, Zhao-Yu


    Hepa1-6 cells were irradiated with UV and incubated for varying periods of time. [Ca 2+] i (intracellular calcium concentration) of UV-irradiated cell was measured by ratio fluorescence imaging system. The comet assay was used to determine DNA damage. During the UVB-irradiation, [Ca 2+] i had an ascending tendency from 0.88 J/m2 to 92.4J/m2. Comet assay instant test indicated that when the irradiation dosage was above 0.88J/m2, DNA damage was observed. Even after approximate 2 h of incubation, DNA damage was still not detected by 0.88J/m2 of UVB irradiation. During UVA-irradiation, the elevation of [Ca 2+] i was not dose-dependent in a range of 1200 J/m2-6000J/m2 and DNA damage was not observed by comet assay. These results suggested that several intracellular UV receptors might induce [Ca 2+] i rising by absorption of the UV energy. Just [Ca 2+] i rising can't induce DNA damage certainly, it is very likely that the breakdown of calcium steady state induces DNA damage.u

  2. Chemical genoprotection: reducing biological damage to as low as reasonably achievable levels

    PubMed Central

    Alcaraz, M; Armero, D; Martínez-Beneyto, Y; Castillo, J; Benavente-García, O; Fernandez, H; Alcaraz-Saura, M; Canteras, M


    Objectives The aim of this study was to evaluate the antioxidant substances present in the human diet with an antimutagenic protective capacity against genotoxic damage induced by exposure to X-rays in an attempt to reduce biological damage to as low a level as reasonably possible. Methods Ten compounds were assessed using the lymphocyte cytokinesis-block micronucleus (MN) cytome test. The compounds studied were added to human blood at 25 μM 5 min before exposure to irradiation by 2 Gy of X-rays. Results The protective capacity of the antioxidant substances assessed was from highest to lowest according to the frequency of the MN generated by X-ray exposure: rosmarinic acid = carnosic acid = δ-tocopherol = l-acid ascorbic = apigenin = amifostine (P < 0.001) > green tea extract = diosmine = rutin = dimetylsulfoxide (P < 0.05) > irradiated control. The reduction in genotoxic damage with the radiation doses administered reached 58%, which represents a significant reduction in X-ray-induced chromosomal damage (P < 0.001). This degree of protection is greater than that obtained with amifostine, a radioprotective compound used in radiotherapy and which is characterised by its high toxicity. Conclusion Several antioxidant substances, common components of the human diet and lacking toxicity, offer protection from the biological harm induced by ionizing radiation. Administering these protective substances to patients before radiological exploration should be considered, even in the case of small radiation doses and regardless of the biological damage expected. PMID:21697157

  3. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.


    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  4. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  5. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.


    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  6. LET analyses of biological damage during solar particle events

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Wilson, John W.; Townsend, Lawrence W.; Shinn, Judy L.; Katz, Robert


    The effects of nuclear reactions on integral low-linear-energy-transfer (LET) protons spectra are studied, behind typical levels of spacecraft and body shielding, for the historically largest flares using the high-energy transport code BRYNTRN in conjunction with several biological damage models. The cellular track model of Katz provides an accurate description of cellular damage from heavy ion exposure. The track model is applied with BRYNTRN to provide a LET decomposition of survival and transformation rates for solar proton events. In addition, a fluence-based risk coefficient formalism is used to estimate Harderian gland-tumor induction in rodents and cataractogenesis in rabbits from solar flares, and a LET analysis is used to assess the relative contribution from target fragments on these biological endpoints.

  7. Laser-Induced Damage of Calcium Fluoride

    SciTech Connect

    Espana, A.; Joly, A.G.; Hess, W.P.; Dickinson, J.T.


    As advances continue to be made in laser technology there is an increasing demand for materials that have high thresholds for laser-induced damage. Laser damage occurs when light is absorbed, creating defects in the crystal lattice. These defects can lead to the emission of atoms, ions and molecules from the sample. One specific field where laser damage is of serious concern is semiconductor lithography, which is beginning to use light at a wavelength of 157 nm. CaF2 is a candidate material for use in this new generation of lithography. In order to prevent unnecessary damage of optical components, it is necessary to understand the mechanisms for laser damage and the factors that serve to enhance it. In this research, we study various aspects of laser interactions with CaF2, including impurity absorbance and various forms of damage caused by incident laser light. Ultraviolet (UV) laser light at 266 nm with both femtosecond (fs) and nanosecond (ns) pulse widths is used to induce ion and neutral particle emission from cleaved samples of CaF2. The resulting mass spectra show significant differences suggesting that different mechanisms for desorption occur following excitation using the different pulse durations. Following irradiation by ns pulses at 266 nm, multiple single-photon absorption from defect states is likely responsible for ion emission whereas the fs case is driven by a multi-photon absorption process. This idea is further supported by the measurements made of the transmission and reflection of fs laser pulses at 266 nm, the results of which reveal a non-linear absorption process in effect at high incident intensities. In addition, the kinetic energy profiles of desorbed Ca and K contaminant atoms are different indicating that a different mechanism is responsible for their emission as well. Overall, these results show that purity plays a key role in the desorption of atoms from CaF2 when using ns pulses. On the other hand, once the irradiance reaches high

  8. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.


    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  9. Laser-Induced Damage of Calcium Fluoride

    SciTech Connect

    Espana, Aubrey L.; Joly, Alan G.; Hess, Wayne P.; Dickinson, J T.


    Radiation damage of materials has long been of fundamental interest, especially since the growth of laser technology. One such source of damage comes from UV laser light. Laser systems continue to move into shorter wavelength ranges, but unfortunately are limited by the damage threshold of their optical components. For example, semiconductor lithography is making its way into the 157nm range and requires a material that can not only transmit this light (air cannot), but also withstand the highly energetic photons present at this shorter wavelength. CaF2, an alkaline earth halide, is the chosen material for vacuum UV 157 nm excimer radiation. It can transmit light down to 120 nm and is relatively inexpensive. Although it is readily available through natural and synthetic sources, it is often times difficult to find in high purity. Impurities in the crystal can result in occupied states in the band gap that induce photon absorption [2] and ultimately lead to the degradation of the material. In order to predict how well CaF2 will perform under irradiation of short wavelength laser light, one must understand the mechanisms for laser-induced damage. Laser damage is often a two-step process: initial photons create new defects in the lattice and subsequent photons excite these defects. When laser light is incident on a solid surface there is an initial production of electron-hole (e-h) pairs, a heating of free electrons and a generation of local heating around optically absorbing centers [3]. Once this initial excitation converts to the driving energy for nuclear motion, the result is an ejection of atoms, ions and molecules from the surface, known as desorption or ablation [3]. Secondary processes further driving desorption are photoabsorption, successive excitations of self-trapped excitons (STE's) and defects, and ionization of neutrals by incident laser light [3]. The combination of laser-induced desorption and the alterations to the electronic and geometrical

  10. A Mathematical Model for Estimating Biological Damage Caused by Radiation

    NASA Astrophysics Data System (ADS)

    Manabe, Yuichiro; Ichikawa, Kento; Bando, Masako


    We propose a mathematical model for estimating biological damage caused by low-dose irradiation. We understand that the linear non threshold (LNT) hypothesis is realized only in the case of no recovery effects. In order to treat the realistic living objects, our model takes into account various types of recovery as well as proliferation mechanism, which may change the resultant damage, especially for the case of lower dose rate irradiation. It turns out that the lower the radiation dose rate, the safer the irradiated system of living object (which is called symbolically ``tissue'' hereafter) can have chances to survive, which can reproduce the so-called dose and dose-rate effectiveness factor (DDREF).

  11. Correlation of polishing-induced shallow subsurface damages with laser-induced gray haze damages in fused silica optics

    NASA Astrophysics Data System (ADS)

    He, Xiang; Zhao, Heng; Wang, Gang; Zhou, Peifan; Ma, Ping


    Laser-induced damage in fused silica optics greatly restricts the performances of laser facilities. Gray haze damage, which is always initiated on ceria polished optics, is one of the most important damage morphologies in fused silica optics. In this paper, the laser-induced gray haze damages of four fused silica samples polished with CeO2, Al2O3, ZrO2, and colloidal silica slurries are investigated. Four samples all present gray haze damages with much different damage densities. Then, the polishing-induced contaminant and subsurface damages in four samples are analyzed. The results reveal that the gray haze damages could be initiated on the samples without Ce contaminant and are inclined to show a tight correlation with the shallow subsurface damages.

  12. [Galactic heavy charged particles damaging effect on biological structures].


    Grigor'ev, A I; Krasavin, E A; Ostrovskiĭ, M A


    A concept of the radiation risk of the manned interplanetary flights is proposed and substantiated. Heavy charged particles that are a component of the galactic cosmic rays (GCR) have a high damaging effect on the biological structures as great amount of energy is deposited in heavy particle tracks. The high biological effectiveness of heavy ions is observed in their action on cell genetic structures and the whole organism, including the brain structures. The hippocampus is the part of the central nervous system that is the most sensitive to radiation--first of all, to heavy charged particles. Irradiation of animals with accelerated iron ions at doses corresponding to the real fluxes of GCR heavy nuclei, to which Mars mission crews can be exposed, leads to marked behavioral function disorders in the post-irradiation period. To evaluate the radiation risk for the interplanetary flight crews, the concept of successful mission accomplishment is introduced. In these conditions, the central nervous system structures can be the critical target of GCR heavy nuclei. Their damage can modify the higher integrative functions of the brain and cause disorders in the crew members' operator performances. PMID:23789432

  13. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F


    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  14. Valsartan inhibits amylin-induced podocyte damage.


    Huang, Fengjuan; Wang, Qingzhu; Ma, Xiaojun; Wu, Lina; Guo, Feng; Qin, Guijun


    Previous studies have described the deposition of amylin in the kidney of patients with type 2 diabetes mellitus (T2DM). These deposits play a critical role in the pathogenesis of diabetic nephropathy (DN), although the mechanism underlying this effect is unknown. Thus, this study was undertaken to investigate whether amylin aggregation stimulates the local angiotensin II type 1 receptor (AT1R) in podocytes, and to examine its role in podocyte apoptosis. Amylin-induced apoptosis was investigated in vitro in differentiated, conditionally immortalized mouse podocytes and in vivo in KM mice. Expression of genes including nephrin, podocin, AT1R and desmin was measured through quantitative real time PCR, western blot and immunohistochemistry. Apoptosis was determined by flow cytometry, while the cellular distribution of podocin and nephrin was investigated by immunofluorescence. The ultra-structure of glomeruli was examined by transmission electron microscopy (TEM). Amylin enhanced apoptosis in a dose-dependent manner in vitro. The peptide also suppressed podocin and nephrin expression, but enhanced that of AT1R and desmin. Both effects were significantly blocked by valsartan, which inhibits angiotensin II type 1 receptor. These findings suggest that amylin activates a local intracellular RAS in podocytes and induces damage and apoptosis. PMID:27102209

  15. Track Structure and the Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage

    NASA Technical Reports Server (NTRS)

    George, K.; Hada, M.; Chappell, L.; Cucinotta, F. A.


    Track structure models predict that at a fixed value of LET, particles with lower charge number, Z will have a higher biological effectiveness compared to particles with a higher Z. In this report we investigated how track structure effects induction of chromosomal aberration in human cells. Human lymphocytes were irradiated in vitro with various energies of accelerated iron, silicon, neon, or titanium ions and chromosome damage was assessed in using three color FISH chromosome painting in chemically induced PCC samples collected a first cell division post irradiation. The LET values for these ions ranged from 30 to195 keV/micron. Of the particles studied, Neon ions have the highest biological effectiveness for induction of total chromosome damage, which is consistent with track structure model predictions. For complex-type exchanges 64 MeV/ u Neon and 450 MeV/u Iron were equally effective and induced the most complex damage. In addition we present data on chromosomes exchanges induced by six different energies of protons (5 MeV/u to 2.5 GeV/u). The linear dose response term was similar for all energies of protons suggesting that the effect of the higher LET at low proton energies is balanced by the production of nuclear secondaries from the high energy protons.

  16. Opportunities for nutritional amelioration of radiation-induced cellular damage.


    Turner, Nancy D; Braby, Leslie A; Ford, John; Lupton, Joanne R


    The closed environment and limited evasive capabilities inherent in space flight cause astronauts to be exposed to many potential harmful agents (chemical contaminants in the environment and cosmic radiation exposure). Current power systems used to achieve space flight are prohibitively expensive for supporting the weight requirements to fully shield astronauts from cosmic radiation. Therefore, radiation poses a major, currently unresolvable risk for astronauts, especially for long-duration space flights. The major detrimental radiation effects that are of primary concern for long-duration space flights are damage to the lens of the eye, damage to the immune system, damage to the central nervous system, and cancer. In addition to the direct damage to biological molecules in cells, radiation exposure induces oxidative damage. Many natural antioxidants, whether consumed before or after radiation exposure, are able to confer some level of radioprotection. In addition to achieving beneficial effects from long-known antioxidants such as vitamins E and C and folic acid, some protection is conferred by several recently discovered antioxidant molecules, such as flavonoids, epigallocatechin, and other polyphenols. Somewhat counterintuitive is the protection provided by diets containing elevated levels of omega-3 polyunsaturated fatty acids, considering they are thought to be prone to peroxidation. Even with the information we have at our disposal, it will be difficult to predict the types of dietary modifications that can best reduce the risk of radiation exposure to astronauts, those living on Earth, or those enduring diagnostic or therapeutic radiation exposure. Much more work must be done in humans, whether on Earth or, preferably, in space, before we are able to make concrete recommendations. PMID:12361786

  17. Opportunities for nutritional amelioration of radiation-induced cellular damage

    NASA Technical Reports Server (NTRS)

    Turner, Nancy D.; Braby, Leslie A.; Ford, John; Lupton, Joanne R.


    The closed environment and limited evasive capabilities inherent in space flight cause astronauts to be exposed to many potential harmful agents (chemical contaminants in the environment and cosmic radiation exposure). Current power systems used to achieve space flight are prohibitively expensive for supporting the weight requirements to fully shield astronauts from cosmic radiation. Therefore, radiation poses a major, currently unresolvable risk for astronauts, especially for long-duration space flights. The major detrimental radiation effects that are of primary concern for long-duration space flights are damage to the lens of the eye, damage to the immune system, damage to the central nervous system, and cancer. In addition to the direct damage to biological molecules in cells, radiation exposure induces oxidative damage. Many natural antioxidants, whether consumed before or after radiation exposure, are able to confer some level of radioprotection. In addition to achieving beneficial effects from long-known antioxidants such as vitamins E and C and folic acid, some protection is conferred by several recently discovered antioxidant molecules, such as flavonoids, epigallocatechin, and other polyphenols. Somewhat counterintuitive is the protection provided by diets containing elevated levels of omega-3 polyunsaturated fatty acids, considering they are thought to be prone to peroxidation. Even with the information we have at our disposal, it will be difficult to predict the types of dietary modifications that can best reduce the risk of radiation exposure to astronauts, those living on Earth, or those enduring diagnostic or therapeutic radiation exposure. Much more work must be done in humans, whether on Earth or, preferably, in space, before we are able to make concrete recommendations.

  18. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage.

    PubMed Central

    Li, Ning; Sioutas, Constantinos; Cho, Arthur; Schmitz, Debra; Misra, Chandan; Sempf, Joan; Wang, Meiying; Oberley, Terry; Froines, John; Nel, Andre


    The objectives of this study were to determine whether differences in the size and composition of coarse (2.5-10 micro m), fine (< 2.5 microm), and ultrafine (< 0.1 microm) particulate matter (PM) are related to their uptake in macrophages and epithelial cells and their ability to induce oxidative stress. The premise for this study is the increasing awareness that various PM components induce pulmonary inflammation through the generation of oxidative stress. Coarse, fine, and ultrafine particles (UFPs) were collected by ambient particle concentrators in the Los Angeles basin in California and used to study their chemical composition in parallel with assays for generation of reactive oxygen species (ROS) and ability to induce oxidative stress in macrophages and epithelial cells. UFPs were most potent toward inducing cellular heme oxygenase-1 (HO-1) expression and depleting intracellular glutathione. HO-1 expression, a sensitive marker for oxidative stress, is directly correlated with the high organic carbon and polycyclic aromatic hydrocarbon (PAH) content of UFPs. The dithiothreitol (DTT) assay, a quantitative measure of in vitro ROS formation, was correlated with PAH content and HO-1 expression. UFPs also had the highest ROS activity in the DTT assay. Because the small size of UFPs allows better tissue penetration, we used electron microscopy to study subcellular localization. UFPs and, to a lesser extent, fine particles, localize in mitochondria, where they induce major structural damage. This may contribute to oxidative stress. Our studies demonstrate that the increased biological potency of UFPs is related to the content of redox cycling organic chemicals and their ability to damage mitochondria. PMID:12676598

  19. Detection of DNA damage induced by heavy ion irradiation in the individual cells with comet assay

    NASA Astrophysics Data System (ADS)

    Wada, S.; Natsuhori, M.; Ito, N.; Funayama, T.; Kobayashi, Y.


    Investigating the biological effects of high-LET heavy ion irradiation at low fluence is important to evaluate the risk of charged particles. Especially it is important to detect radiation damage induced by the precise number of heavy ions in the individual cells. Thus we studied the relationship between the number of ions traversing the cell and DNA damage produced by the ion irradiation. We applied comet assay to measure the DNA damage in the individual cells. Cells attached on the ion track detector CR-39 were irradiated with ion beams at TIARA, JAERI-Takasaki. After irradiation, the cells were stained with ethidium bromide and the opposite side of the CR-39 was etched. We observed that the heavy ions with higher LET values induced the heavier DNA damage. The result indicated that the amount of DNA damage induced by one particle increased with the LET values of the heavy ions.

  20. Hydrogen Induced Damage in Pipeline Steels

    NASA Astrophysics Data System (ADS)

    Angus, Garrett R.

    The hydrogen induced cracking (HIC) resistance of several grades of plate steels was investigated using electrolytic hydrogen charging. HIC generated by electrolytic charging was also compared to the industrial standard test for HIC, the NACE standard TM0284. The electrolytic charging (EC) apparatus was designed to optimize the reproducibility of the HIC results and the robustness of the components during long charging times. A characterization study on the EC apparatus was undertaken. Alterations to applied current density and charging time were conducted on a highly susceptible plate steel, 100XF, to assess HIC damage as a function of charging conditions. Intermediate current densities of 10 to 15 mA/cm2 produced the greatest extent of cracking without significant corrosion related surface damage. The hydrogen charging time did not greatly affect the extent and depth of cracking for test times between 24 to 48 hours. Thus, for subsequent experiments, the applied current density was set to 15 mA/cm2 and the charging time was set to 24 hours. Plate steel grades X52, X60, X70, and 100XF were prestrained in tension to various levels and then electrolytically charged with hydrogen or tested with the NACE standard TM0284 test (solution A) saturated with H2S(g) to induce HIC. Prestrain was introduced to assess its impact on HIC. Hydrogen damage was quantified with the crack ratios defined in the NACE Standard TM0284. The results from the EC and NACE methods were very comparable to one, with respect to the magnitude of cracking and the trends between alloy and pre-strain conditions observed. Both methods showed that HIC substantially increased for the high strength 100XF steel compared to the lower strength alloys. This is consistent with NACE recommendations for HIC resistance steels, which suggests that alloy strength should be less than 116 ksi (800 MPa) or 248 HV (22 HRC). The HIC results were largely independent of the pre-strain levels imposed within the

  1. Chemical and Biological Consequences of Oxidatively Damaged Guanine in DNA

    PubMed Central

    Delaney, Sarah; Jarem, Daniel A.; Volle, Catherine B.; Yennie, Craig J.


    Of the four native nucleosides, 2′-deoxyguanosine (dGuo) is most easily oxidized. Two lesions derived from dGuo are 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodGuo) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy)·dGuo. Furthermore, while steady-state levels of 8-oxodGuo can be detected in genomic DNA, it is also known that 8-oxodGuo is more easily oxidized than dGuo. Thus, 8-oxodGuo is susceptible to further oxidation to form several hyperoxidized dGuo products. This review addresses the structural impact, the mutagenic and genotoxic potential, and biological implications of oxidatively damaged DNA, in particular 8-oxodGuo, Fapy·dGuo, and the hyperoxidized dGuo products. PMID:22239655

  2. Damage and failure mechanisms associated with photoablation of biological tissues

    SciTech Connect

    Antoun, T.; Seaman, L.; Curran, D.; Glinsky, M.


    This paper aims to examine the processes associated with failure of the cornea and other collagenous tissues during photoablation. Two different constitutive models are applied to simulate a series of laser deposition experiments into porcine reticular dermis (1), a biological tissue similar to the cornea in composition and photoablation characteristics. The first of our constitutive models, DFRACT, is a physically motivated, micromechanical model based on the nucleation and growth of spherical voids (2). The second is a relatively simple model that allows the material to vaporize and thermally soften. The simulation results reproduce the prominent features observed experimentally thereby shedding a new light on the operative mechanisms during photoablation. The good qualitative agreement between the simulated stress histories and the stress histories measured during the experiments also demonstrates the effectiveness of micromechanical damage and failure modeling as a viable tool for optimizing existing laser surgery procedures and designing new ones. {copyright} {ital 1996 American Institute of Physics.}

  3. GUI to Facilitate Research on Biological Damage from Radiation

    NASA Technical Reports Server (NTRS)

    Cucinotta, Frances A.; Ponomarev, Artem Lvovich


    A graphical-user-interface (GUI) computer program has been developed to facilitate research on the damage caused by highly energetic particles and photons impinging on living organisms. The program brings together, into one computational workspace, computer codes that have been developed over the years, plus codes that will be developed during the foreseeable future, to address diverse aspects of radiation damage. These include codes that implement radiation-track models, codes for biophysical models of breakage of deoxyribonucleic acid (DNA) by radiation, pattern-recognition programs for extracting quantitative information from biological assays, and image-processing programs that aid visualization of DNA breaks. The radiation-track models are based on transport models of interactions of radiation with matter and solution of the Boltzmann transport equation by use of both theoretical and numerical models. The biophysical models of breakage of DNA by radiation include biopolymer coarse-grained and atomistic models of DNA, stochastic- process models of deposition of energy, and Markov-based probabilistic models of placement of double-strand breaks in DNA. The program is designed for use in the NT, 95, 98, 2000, ME, and XP variants of the Windows operating system.

  4. Kinetic Modeling of the X-ray-induced Damage to a Metalloprotein

    PubMed Central

    Davis, Katherine M.; Kosheleva, Irina; Henning, Robert W.; Seidler, Gerald T.; Pushkar, Yulia


    It is well known that biological samples undergo x-ray-induced degradation. One of the fastest occurring x-ray-induced processes involves redox modifications (reduction or oxidation) of redox-active cofactors in proteins. Here we analyze room temperature data on the photoreduction of Mn ions in the oxygen evolving complex (OEC) of photosystem II, one of the most radiation damage sensitive proteins and a key constituent of natural photosynthesis in plants, green algae and cyanobacteria. Time-resolved x-ray emission spectroscopy with wavelength-dispersive detection was used to collect data on the progression of x-ray-induced damage. A kinetic model was developed to fit experimental results, and the rate constant for the reduction of OEC MnIII/IV ions by solvated electrons was determined. From this model, the possible kinetics of x-ray-induced damage at variety of experimental conditions, such as different rates of dose deposition as well as different excitation wavelengths, can be inferred. We observed a trend of increasing dosage threshold prior to the onset of x-ray-induced damage with increasing rates of damage deposition. This trend suggests that experimentation with higher rates of dose deposition is beneficial for measurements of biological samples sensitive to radiation damage, particularly at pink beam and x-ray FEL sources. PMID:23815809

  5. A continuum damage model of fatigue-induced damage in laminated composites

    NASA Technical Reports Server (NTRS)

    Harris, Charles E.; Allen, David H.


    A model is presented which predicts the stress-strain behavior of continuous fiber reinforced laminated composites in the presence of microstructural damage. The model is based on the concept of continuum damage mechanics and uses internal state variables to characterize the various damage modes. The associated internal state variable growth laws are mathematical models of the loading history induced development of microstructural damage. The model is demonstrated by using it to predict the response of damaged AS-4/3502 graphite/epoxy laminate panels.

  6. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  7. Spaceflight environment induces mitochondrial oxidative damage in ocular tissue.


    Mao, Xiao W; Pecaut, Michael J; Stodieck, Louis S; Ferguson, Virginia L; Bateman, Ted A; Bouxsein, Mary; Jones, Tamako A; Moldovan, Maria; Cunningham, Christopher E; Chieu, Jenny; Gridley, Daila S


    A recent report shows that more than 30% of the astronauts returning from Space Shuttle missions or the International Space Station (ISS) were diagnosed with eye problems that can cause reduced visual acuity. We investigate here whether spaceflight environment-associated retinal damage might be related to oxidative stress-induced mitochondrial apoptosis. Female C57BL/6 mice were flown in the space shuttle Atlantis (STS-135), and within 3-5 h of landing, the spaceflight and ground-control mice, similarly housed in animal enclosure modules (AEMs) were euthanized and their eyes were removed for analysis. Changes in expression of genes involved in oxidative stress, mitochondrial and endothelial cell biology were examined. Apoptosis in the retina was analyzed by caspase-3 immunocytochemical analysis and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay. Levels of 4-hydroxynonenal (4-HNE) protein, an oxidative specific marker for lipid peroxidation were also measured. Evaluation of spaceflight mice and AEM ground-control mice showed that expression of several genes playing central roles in regulating the mitochondria-associated apoptotic pathway were significantly altered in mouse ocular tissue after spaceflight compared to AEM ground-control mice. In addition, the mRNA levels of several genes, which are responsible for regulating the production of reactive oxygen species were also significantly up-regulated in spaceflight samples compared to AEM ground-control mice. Further more, the level of HNE protein was significantly elevated in the retina after spaceflight compared to controls. Our results also revealed that spaceflight conditions induced significant apoptosis in the retina especially inner nuclear layer (INL) and ganglion cell layer (GCL) compared to AEM ground controls. The data provided the first evidence that spaceflight conditions induce oxidative damage that results in mitochondrial apoptosis in the retina. This data suggest


    EPA Science Inventory

    Rapid and cost-effective indicator assays are being developed which may be used as a rapid screen to assess the potential for exposure to hazardous compounds that can be related to a biological target (e.g., DNA). Chemically-induced DNA damage will be measured using surrogate DN...

  9. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.


    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  10. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.


    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T


    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  11. Mechanisms of Diabetes-Induced Liver Damage

    PubMed Central

    Mohamed, Jamaludin; Nazratun Nafizah, A. H.; Zariyantey, A. H.; Budin, S. B.


    Diabetes mellitus is a non-communicable disease that occurs in both developed and developing countries. This metabolic disease affects all systems in the body, including the liver. Hyperglycaemia, mainly caused by insulin resistance, affects the metabolism of lipids, carbohydrates and proteins and can lead to non-alcoholic fatty liver disease, which can further progress to non-alcoholic steatohepatitis, cirrhosis and, finally, hepatocellular carcinomas. The underlying mechanism of diabetes that contributes to liver damage is the combination of increased oxidative stress and an aberrant inflammatory response; this activates the transcription of pro-apoptotic genes and damages hepatocytes. Significant involvement of pro-inflammatory cytokines—including interleukin (IL)-1β, IL-6 and tumour necrosis factor-α—exacerbates the accumulation of oxidative damage products in the liver, such as malondialdehyde, fluorescent pigments and conjugated dienes. This review summarises the biochemical, histological and macromolecular changes that contribute to oxidative liver damage among diabetic individuals. PMID:27226903

  12. Relationship of gonadal activity and chemotherapy-induced gonadal damage

    SciTech Connect

    Rivkees, S.A.; Crawford, J.D.


    The authors tested the hypothesis that chemotherapy-induced gonadal damage is proportional to the degree of gonadal activity during treatment. Thirty studies that evaluated gonadal function after cyclophosphamide therapy for renal disease or combination chemotherapy for Hodgkin's disease or acute lymphocytic leukemia provided data for analysis. Data were stratified according to sex, illness, chemotherapeutic regimen and dose, and pubertal stage at the time of treatment. Chemotherapy-induced damage was more likely to occur in patients who were treated when sexually mature compared with those who were treated when prepubertal. Males were significantly more frequently affected than females when treated for renal disease of Hodgkin's disease. Chemotherapy-induced damage was also more likely to occur when patients were treated with large doses of alkylating agents. These data suggest that chemotherapy-induced damage is proportional to gonadal activity. Further efforts are needed to test whether induced gonadal quiescence during chemotherapy will reduce the strikingly high incidence of gonadal failure following chemotherapy.

  13. Laser induced damage testing: Equipment and techniques

    NASA Astrophysics Data System (ADS)

    Morelli, G. L.


    A laser damage test station was designed and built at the AlliedSignal Inc., Kansas City Division (KCD). The purpose of this effort was to establish the capability for testing polished optical fibers for high energy laser transmission to support the Direct Optical Initiation (DOI), optical firing-set program. A single shot, conditioned threshold type laser damage test was implemented. A flashlamp pumped, multimode, Q-switched, Nd:YAG laser was utilized as the test source. The test laser's operational parameters were extensively characterized. The pulse width, beam divergence, and polarization state of the laser were all held constant throughout the tests. A single plano-convex lens was utilized to focus the laser beam energy into the optical fibers. A focusing geometry was utilized which avoided bulk damage and minimized damage at the fiber's core/cladding interface. A special holding fixture was fabricated, which minimized the mechanical stresses on the fiber during testing. Several uncoated, step-index, multimode, optical fibers were damage tested to verify the functionality of the test station. The fibers all had a 400 micron diameter core of pure fused silica, a 440 micron diameter fluorine doped fused silica cladding, and a 15 micron thick polyimide buffer layer. The fibers were tested up to a fluence level greater than 55.7 J/cm(exp 2) or until damage was observed. Cleaning, inspection, and testing procedures were developed and documented.

  14. Damage-induced nonassociated inelastic flow in rock salt

    SciTech Connect

    Chan, K.S.; Bodner, S.R.; Brodsky, N.S.; Fossum, A.F.


    The multi-mechanism deformation coupled fracture model recently developed by CHAN, et al. (1992), for describing time-dependent, pressure-sensitive inelastic flow and damage evolution in crystalline solids was evaluated against triaxial creep experiments on rock salt. Guided by experimental observations, the kinetic equation and the flow law for damage-induced inelastic flow in the model were modified to account for the development of damage and inelastic dilatation in the transient creep regime. The revised model was then utilized to obtain the creep response and damage evolution in rock salt as a function of confining pressure and stress difference. Comparison between model calculation and experiment revealed that damage-induced inelastic flow is nonassociated, dilatational, and contributes significantly to the macroscopic strain rate observed in rock salt deformed at low confining pressures. The inelastic strain rate and volumetric strain due to damage decrease with increasing confining pressures, and all are suppressed at sufficiently high confining pressures.

  15. DNA damage profiles induced by sunlight at different latitudes.


    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins


    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  16. Lowering evaluation uncertainties in laser-induced damage testing

    NASA Astrophysics Data System (ADS)

    Jensen, Lars O.; Mrohs, Marius; Gyamfi, Mark; Mädebach, Heinrich; Ristau, Detlev


    As a consequence of the statistical nature of laser-induced damage threshold measurements in the nanosecond regime, the evaluation method plays a vital role. Within the test procedure outlined in the corresponding ISO standard, several steps of data reduction are required, and the resulting damage probability distribution as a function of laser fluence needs to be fitted either based on an empirical regression function or described by models for the respective damage mechanism.

  17. Preventing Ultraviolet Light-Induced Damage: The Benefits of Antioxidants

    ERIC Educational Resources Information Center

    Yip, Cheng-Wai


    Extracts of fruit peels contain antioxidants that protect the bacterium "Escherichia coli" against damage induced by ultraviolet light. Antioxidants neutralise free radicals, thus preventing oxidative damage to cells and deoxyribonucleic acid. A high survival rate of UV-exposed cells was observed when grapefruit or grape peel extract was added,…

  18. Effects of Ionizing Radiation on Biological Molecules—Mechanisms of Damage and Emerging Methods of Detection

    PubMed Central

    Reisz, Julie A.; Bansal, Nidhi; Qian, Jiang; Zhao, Weiling


    Abstract Significance: The detrimental effects of ionizing radiation (IR) involve a highly orchestrated series of events that are amplified by endogenous signaling and culminating in oxidative damage to DNA, lipids, proteins, and many metabolites. Despite the global impact of IR, the molecular mechanisms underlying tissue damage reveal that many biomolecules are chemoselectively modified by IR. Recent Advances: The development of high-throughput “omics” technologies for mapping DNA and protein modifications have revolutionized the study of IR effects on biological systems. Studies in cells, tissues, and biological fluids are used to identify molecular features or biomarkers of IR exposure and response and the molecular mechanisms that regulate their expression or synthesis. Critical Issues: In this review, chemical mechanisms are described for IR-induced modifications of biomolecules along with methods for their detection. Included with the detection methods are crucial experimental considerations and caveats for their use. Additional factors critical to the cellular response to radiation, including alterations in protein expression, metabolomics, and epigenetic factors, are also discussed. Future Directions: Throughout the review, the synergy of combined “omics” technologies such as genomics and epigenomics, proteomics, and metabolomics is highlighted. These are anticipated to lead to new hypotheses to understand IR effects on biological systems and improve IR-based therapies. Antioxid. Redox Signal. 21: 260–292. PMID:24382094

  19. New insights in photoaging, UVA induced damage and skin types.


    Battie, Claire; Jitsukawa, Setsuko; Bernerd, Françoise; Del Bino, Sandra; Marionnet, Claire; Verschoore, Michèle


    UVA radiation is the most prevalent component of solar UV radiation; it deeply penetrates into the skin and induces profound alterations of the dermal connective tissue. In recent years, the detrimental effects of UVA radiation were more precisely demonstrated at cellular and molecular levels, using adequate methods to identify biological targets of UVA radiation and the resulting cascade impairment of cell functions and tissue degradation. In particular gene expression studies recently revealed that UVA radiation induces modulation of several genes confirming the high sensitivity of dermal fibroblasts to UVA radiation. The major visible damaging effects of UVA radiation only appear after years of exposure: it has been clearly evidenced that they are responsible for more or less early signs of photoageing and photocarcinogenesis. UVA radiation appears to play a key role in pigmented changes occurring with age, the major sign of skin photoaging in Asians. Skin susceptibility to photoaging alterations also depends on constitutive pigmentation. The skin sensitivity to UV light has been demonstrated to be linked to skin color type. PMID:25234829

  20. Quercitrin protects skin from UVB-induced oxidative damage

    SciTech Connect

    Yin, Yuanqin; Li, Wenqi; Son, Young-Ok; Sun, Lijuan; Lu, Jian; Kim, Donghern; Wang, Xin; Yao, Hua; Wang, Lei; Pratheeshkumar, Poyil; Hitron, Andrew J.; Luo, Jia; Gao, Ning; Shi, Xianglin; Zhang, Zhuo


    Exposure of the skin to ultraviolet B (UVB) radiation causes oxidative damage to skin, resulting in sunburn, photoaging, and skin cancer. It is generally believed that the skin damage induced by UV irradiation is a consequence of generation of reactive oxygen species (ROS). Recently, there is an increased interest in the use of natural products as chemopreventive agents for non-melanoma skin cancer (NMSC) due to their antioxidants and anti-inflammatory properties. Quercitrin, glycosylated form of quercetin, is the most common flavonoid in nature with antioxidant properties. The present study investigated the possible beneficial effects of quercitrin to inhibit UVB irradiation-induced oxidative damage in vitro and in vivo. Our results showed that quercitrin decreased ROS generation induced by UVB irradiation in JB6 cells. Quercitrin restored catalase expression and GSH/GSSG ratio reduced by UVB exposure, two major antioxidant enzymes, leading to reductions of oxidative DNA damage and apoptosis and protection of the skin from inflammation caused by UVB exposure. The present study demonstrated that quercitrin functions as an antioxidant against UVB irradiation-induced oxidative damage to skin. - Highlights: • Oxidative stress plays a key role in UV-induced cell and tissue injuries. • Quercitrin decreases ROS generation and restores antioxidants irradiated by UVB. • Quercitrin reduces UVB-irradiated oxidative DNA damage, apoptosis, and inflammation. • Quercitrin functions as an antioxidant against UVB-induced skin injuries.

  1. DNA damage in cells exhibiting radiation-induced genomic instability


    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  2. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.


    SciTech Connect

    Mayer, John; Brisbin, I. Lehr


    about anything; and, they can live just about anywhere. On top of that, wild pigs are both very difficult to control and, with the possible exception of island ecosystems, almost impossible to eradicate (Dickson et al. 2001, Sweeney et al. 2003). The solution to the wild pig problem has not been readily apparent. The ultimate answer as to how to control these animals has not been found to date. In many ways, wild pigs are America's most successful large invasive species. All of which means that wild pigs are a veritable nightmare for land and resource managers trying to keep the numbers of these animals and the damage that they do under control. Since the more that one knows about an invasive species, the easier it is to deal with and hopefully control. For wild pigs then, it is better to 'know thy enemy' than to not, especially if one expects to be able to successfully control them. In an effort to better 'know thy enemy,' a two-day symposium was held in Augusta, Georgia, on April 21-22, 2004. This symposium was organized and sponsored by U.S.D.A. Forest Service-Savannah River (USFS-SR), U. S. Department of Energy-Savannah River Operations Office (DOE-SR), the Westinghouse Savannah River Company (WSRC), the South Carolina Chapter of the Soil & Water Conservation Society, and the Savannah River Ecology Laboratory (SREL). The goal of this symposium was to assemble researchers and land managers to first address various aspects of the biology and damage of wild pigs, and then review the control techniques and management of this invasive species. The result would then be a collected synopsis of what is known about wild pigs in the United States. Although the focus of the symposium was primarily directed toward federal agencies, presenters also included professionals from academic institutions, and private-sector control contractors and land managers. Most of the organizations associated with implementing this symposium were affiliated with the Savannah River Site (SRS), a

  4. Polymer-induced compression of biological hydrogels

    NASA Astrophysics Data System (ADS)

    Datta, Sujit; Preska Steinberg, Asher; Ismagilov, Rustem

    Hydrogels - such as mucus, blood clots, and the extracellular matrix - provide critical functions in biological systems. However, little is known about how their structure is influenced by many of the polymeric materials they come into contact with regularly. Here, we focus on one critically important biological hydrogel: colonic mucus. While several biological processes are thought to potentially regulate the mucus hydrogel structure, the polymeric composition of the gut environment has been ignored. We use Flory-Huggins solution theory to characterize polymer-mucus interactions. We find that gut polymers, including those small enough to penetrate the mucus hydrogel, can in fact alter mucus structure, changing its equilibrium degree of swelling and forcing it to compress. The extent of compression increases with increasing polymer concentration and size. We use experiments on mice to verify these predictions with common dietary and therapeutic gut polymers. Our results provide a foundation for investigating similar, previously overlooked, polymer-induced effects in other biological hydrogels.

  5. Ionization induced damage in crystalline silicon

    NASA Technical Reports Server (NTRS)

    Meulenberg, A., Jr.


    Close examination of the interaction of the energetic knock-on atoms with the local lattice environment reveals a damage mechanism which does satisfy the experimental data on proton irradiation of silicon. A proton-atom interaction with high energy transfer is considered where the proton path is delineated by a trail of ionization, and the silicon ion path is characterized by much heavier ionization terminating in a dense displacement cluster. At collision, many of the silicon electrons are stripped off, and the resulting energetic ion subsequently loses energy rapidly by Coulomb interaction with bound electrons. The rate of energy loss depends on the charge state and velocity of the knock-on ion. For ion energies in excess of 1 MeV, the intensity of ionization is sufficient to permit lattice atoms, stripped of their binding electrons, to reorient randomly before having an opportunity to recombine with electrons and re-establish the lattice. The path of a knock-on ion thus becomes a thin cylinder of amorphous material within the crystal. Amorphous silicon has a Fermi level closer to mid-band than does single crystal silicon, and a strong field therefore, results around this damaged region. The field produces a large depletion region, representing a very large capture cross section for minority carriers.

  6. Glimepiride protects neurons against amyloid-β-induced synapse damage.


    Osborne, Craig; West, Ewan; Nolan, William; McHale-Owen, Harriet; Williams, Alun; Bate, Clive


    Alzheimer's disease is associated with the accumulation within the brain of amyloid-β (Aβ) peptides that damage synapses and affect memory acquisition. This process can be modelled by observing the effects of Aβ on synapses in cultured neurons. The addition of picomolar concentrations of soluble Aβ derived from brain extracts triggered the loss of synaptic proteins including synaptophysin, synapsin-1 and cysteine string protein from cultured neurons. Glimepiride, a sulphonylurea used for the treatment of diabetes, protected neurons against synapse damage induced by Aβ. The protective effects of glimepiride were multi-faceted. Glimepiride treatment was associated with altered synaptic membranes including the loss of specific glycosylphosphatidylinositol (GPI)-anchored proteins including the cellular prion protein (PrP(C)) that acts as a receptor for Aβ42, increased synaptic gangliosides and altered cell signalling. More specifically, glimepiride reduced the Aβ-induced increase in cholesterol and the Aβ-induced activation of cytoplasmic phospholipase A2 (cPLA2) in synapses that occurred within cholesterol-dense membrane rafts. Aβ42 binding to glimepiride-treated neurons was not targeted to membrane rafts and less Aβ42 accumulated within synapses. These studies indicate that glimepiride modified the membrane micro-environments in which Aβ-induced signalling leads to synapse damage. In addition, soluble PrP(C), released from neurons by glimepiride, neutralised Aβ-induced synapse damage. Such observations raise the possibility that glimepiride may reduce synapse damage and hence delay the progression of cognitive decline in Alzheimer's disease. PMID:26432105

  7. [The role of the biological damaging factor in the explosive injury].


    Popov, V L; Kadochnikov, D S; Minaeva, P V


    This article describes the specific features of the action of the biological damaging factors on the human organism associated with the explosive injury. Both the direct action of the damaging agents contained in the biological weapons and their secondary effects in the form of systemic and local infectious complications of the inflicted wounds are considered. The criteria for the evaluation of the degree of harm to the health of the victims of explosion attributable to the action of the biological damaging factor are proposed. PMID:26856054


    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  9. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.


    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  10. Effects of vitamins on chromium(VI)-induced damage

    SciTech Connect

    Sugiyama, Masayasu )


    The effects of vitamin E and vitamin B{sub 2} on DNA damage and cellular reduction of chromium (VI) were investigated using Chinese hamster V-79 cells. pretreatment with {alpha}-tocopherol succinate (vitamin E) resulted in a decrease of DNA single-strand breaks produced by Na{sub 2}CrO{sub 4}, while similar treatment with riboflavin (vitamin B{sub 2}) enhanced levels of DNA breaks. Electron spin resonance (ESR) studies showed that incubation of cells with Na{sub 2}CrO{sub 4} resulted in the formation of both chromium (V) and chromium (III) complexes, and cellular pretreatment with vitamin E reduced the level of the chromium (V) complex, whereas pretreatment with vitamin B{sub 2} enhanced the level of this intermediate. ESR studies demonstrated that a chromium (V) species was formed by the reaction of Na{sub 2}CrO{sub 4} with vitamin B{sub 2} and that vitamin B{sub 2} enhanced the formation of hydroxyl radicals during the reaction of Na{sub 2}CrO{sub 4} and hydrogen peroxide. These results indicate that vitamin E and vitamin B{sub 2} are capable of altering the biological effects of carcinogenic chromium (VI) compounds, possibly through their abilities to modify levels of chromium (V) in cells. The results also suggest that chromate-induced cytotoxicity may not be directly correlated with the genotoxic effects of this metal. The importance of the role of vitamins in chromate-induced toxicity is discussed.

  11. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  12. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.


    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A


    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions. PMID:26030182

  13. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  14. Quercitrin Protects Skin from UVB-induced Oxidative Damage

    PubMed Central

    Yin, Yuanqin; Li, Wenqi; Son, Yong-Ok; Sun, Lijuan; Lu, Jian; Kim, Donghern; Wang, Xin; Yao, Hua; Wang, Lei; Pratheeshkumar, Poyil; Hitron, Andrew J; Luo, Jia; Gao, Ning; Shi, Xianglin; Zhang, Zhuo


    Exposure of the skin to ultraviolet B (UVB) radiation causes oxidative damage to skin, resulting in sunburn, photoaging, and skin cancer. It is generally believed that the skin damage induced by UV irradiation is a consequence of generation of reactive oxygen species (ROS). Recently, there is an increased interest in the use of natural products as chemopreventive agents for non-melanoma skin cancer (NMSC) due to their antioxidants and anti-inflammatory properties. Quercitrin, glycosylated form of quercetin, is the most common flavonoid in nature with antioxidant properties. The present study investigated the possible beneficial effects of quercitrin to inhibit UVB irradiation-induced oxidative damage in vitro and in vivo. Our results showed that quercitrin decreased ROS generation induced by UVB irradiation in JB6 cells. Quercitrin restored catalase expression and GSH/GSSG ratio reduced by UVB exposure, two major antioxidant enzymes, leading to reductions of oxidative DNA damage and apoptosis and protection of the skin from inflammation caused by UVB exposure. The present study demonstrated that quercitrin functions as an antioxidant against UVB irradiation-induced oxidative damage to skin. PMID:23545178

  15. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.


    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K


    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  16. Modulation of irinotecan-induced genomic DNA damage by theanine.


    Attia, Sabry


    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  17. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.


    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  18. Modeling of Laser Induced Damage in NIF UV Optics

    SciTech Connect

    Feit, M D; Rubenchik, A M


    Controlling damage to nominally transparent optical elements such as lenses, windows and frequency conversion crystals on high power lasers is a continuing technical problem. Scientific understanding of the underlying mechanisms of laser energy absorption, material heating and vaporization and resultant mechanical damage is especially important for UV lasers with large apertures such as NIF. This LDRD project was a single year effort, in coordination with associated experimental projects, to initiate theoretical descriptions of several of the relevant processes. In understanding laser damage, we distinguish between damage initiation and the growth of existent damage upon subsequent laser irradiation. In general, the effect of damage could be ameliorated by either preventing its initiation or by mitigating its growth. The distinction comes about because initiation is generally due to extrinsic factors such as contaminants, which provide a means of local laser energy absorption. Thus, initiation tends to be local and stochastic in nature. On the other hand, the initial damaging event appears to modify the surrounding material in such a way that multiple pulse damage grows more or less regularly. More exactly, three ingredients are necessary for visible laser induced damage. These are adequate laser energy, a mechanism of laser energy absorption and mechanical weakness. For damage growth, the material surrounding a damage site is already mechanically weakened by cracks and probably chemically modified as well. The mechanical damage can also lead to electric field intensification due to interference effects, thus increasing the available laser energy density. In this project, we successfully accounted for the pulselength dependence of damage threshold in bulk DKDP crystals with the hypothesis of small absorbers with a distribution of sizes. We theoretically investigated expected scaling of damage initiation craters both to baseline detailed numerical simulations

  19. Exercise-induced oxidatively damaged DNA in humans: evaluation in plasma or urine?


    Karpouzi, Christina; Nikolaidis, Stefanos; Kabasakalis, Athanasios; Tsalis, George; Mougios, Vassilis


    Physical exercise can induce oxidative damage in humans. 8-Hydroxy-2'-deoxyguanosine (8-OHdG) is a widely known biomarker of DNA oxidation, which can be determined in blood and urine. The aim of the present study was to compare these two biological fluids in terms of which is more suitable for the estimation of the oxidative damage of DNA by measuring the concentration of 8-OHdG one hour after maximal exercise by enzyme immunoassay. The concentration of 8-OHdG increased with exercise only in plasma (p < 0.001), and values differed between exercise tests in both plasma and urine (p < 0.05). In conclusion, plasma appears to be more sensitive to exercise-induced 8-OHdG changes than urine and, hence, a more appropriate medium for assessing oxidative damage of DNA, although the poor repeatability of the measurement needs to be addressed in future studies. PMID:26849281

  20. Cold-induced thermoregulation and biological aging.


    Florez-Duquet, M; McDonald, R B


    Aging is associated with diminished cold-induced thermoregulation (CIT). The mechanisms accounting for this phenomenon have yet to be clearly elucidated but most likely reflect a combination of increased heat loss and decreased metabolic heat production. The inability of the aged subject to reduce heat loss during cold exposure is associated with diminished reactive tone of the cutaneous vasculature and, to a lesser degree, alterations in the insulative properties of body fat. Cold-induced metabolic heat production via skeletal muscle shivering thermogenesis and brown adipose tissue nonshivering thermogenesis appears to decline with age. Few investigations have directly linked diminished skeletal muscle shivering thermogenesis with the age-related reduction in cold-induced thermoregulatory capacity. Rather, age-related declines in skeletal muscle mass and metabolic activity are cited as evidence for decreased heat production via shivering. Reduced mass, GDP binding to brown fat mitochondria, and uncoupling protein (UCP) levels are cited as evidence for attenuated brown adipose tissue cold-induced nonshivering thermogenic capacity during aging. The age-related reduction in brown fat nonshivering thermogenic capacity most likely reflects altered cellular signal transduction rather than changes in neural and hormonal signaling. The discussion in this review focuses on how alterations in CIT during the life span may offer insight into possible mechanisms of biological aging. Although the preponderance of evidence presented here demonstrates that CIT declines with chronological time, the mechanism reflecting this attenuated function remains to be elucidated. The inability to draw definitive conclusions regarding biological aging and CIT reflects the lack of a clear definition of aging. It is unlikely that the mechanisms accounting for the decline in cold-induced thermoregulation during aging will be determined until biological aging is more precisely defined. PMID

  1. Blasting-induced damage in coal

    SciTech Connect

    Kabongo, K.K.


    The paper is drawn from a project intended to explore a technique of prediction, control and optimization of fracture in coal induced by blasting. It evaluates the fines generated in coal submitted to dynamic loading stresses in an impact stamp mortar. The aim is to analyze a complex phenomenon of coal response to blast-generated stresses from a series of discrete simulations of shock and gas actions in controllable processes. It is learned that despite the nucleation of primary crushing and fractures to originate from the point of impact energy in coal, a secondary crushing appears to depart from within the burden progressing towards the free boundaries. The extension of the secondary crushing zone appears to be influenced by the magnitude of the breaking stresses generated and the coal burden distance. A strong dependence of fines on the coal`s innate discontinuities (strength) and the energy input is highlighted.

  2. Biology and damage of an undescribed baridine weevil on amryllis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The weevil subfamily Baridinae is comprised of several economically important species that cause damage to the roots and fruits of plants. In the early 1990's, a baradine weevil was observed feeding on and occasionally killing amaryllis (Hippeastrum Herb) plants in Florida. A survey was conducted to...

  3. Genetic damage induced by organic extract of coke oven emissions on human bronchial epithelial cells.


    Zhai, Qingfeng; Duan, Huawei; Wang, Yadong; Huang, Chuanfeng; Niu, Yong; Dai, Yufei; Bin, Ping; Liu, Qingjun; Chen, Wen; Ma, Junxiang; Zheng, Yuxin


    Coke oven emissions are known as human carcinogen, which is a complex mixture of polycyclic aromatic hydrocarbon. In this study, we aimed to clarify the mechanism of action of coke oven emissions induced carcinogenesis and to identify biomarkers of early biological effects in a human bronchial epithelial cell line with CYP1A1 activity (HBE-CYP1A1). Particulate matter was collected in the oven area on glass filter, extracted and analyzed by GC/MS. DNA breaks and oxidative damage were evaluated by alkaline and endonucleases (FPG, hOGG1 and ENDO III)-modified comet assays. Cytotoxicity and chromosomal damage were assessed by the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. The cells were treated with organic extract of coke oven emissions (OE-COE) representing 5, 10, 20, 40μg/mL extract for 24h. We found that there was a dose-effect relationship between the OE-COE and the direct DNA damage presented by tail length, tail intensity and Olive tail moment in the comet assay. The presence of lesion-specific endonucleases in the assays increased DNA migration after OE-COE treatment when compared to those without enzymes, which indicated that OE-COE produced oxidative damage at the level of pyrimidine and purine bases. The dose-dependent increase of micronuclei, nucleoplasmic bridges and nuclear buds in exposed cells was significant, indicating chromosomal and genomic damage induced by OE-COE. Based on the cytotoxic biomarkers in CBMN-Cyt assay, OE-COE may inhibit nuclear division, interfere with apoptosis, or induce cell necrosis. This study indicates that OE-COE exposure can induce DNA breaks/oxidative damage and genomic instability in HBE-CYP1A1 cells. The FPG-comet assay appears more specific for detecting oxidative DNA damage induced by complex mixtures of genotoxic substances. PMID:22522113

  4. Modification of high LET radiation-induced damage and its repair in yeast by hypoxia.


    Subrahmanyam, P; Rao, B S; Reddy, N M; Murthy, M S; Madhvanath, U


    The lethal response of a diploid yeast strain BZ34 to densely ionizing radiations from the reaction 10B(n, alpha)7 Li was studied. The values for relative biological effectiveness (r.b.e.) and oxygen enhancement ratio (o.e.r.) for this radiation compare favourably with the data obtained with charged particles on the same strain of yeast. Recovery from potentially lethal damage was also studied by post-irradiation holding under non-nutrient conditions. In order to understand the role of oxygen in the recovery process, the investigation covered the following treatment regimens: (a) aerobic irradiation and aerobic holding (A-A), (b) aerobic irradiation and hypoxic holding (A-H), (c) hypoxic irradiation and hypoxic holding (H-H) and (d) hypoxic irradiation and aerobic holding (H-A). It has been found that the presence of oxygen is essential for recovery from the damage induced by both gamma rays and high linear energy transfer (LET) radiations. The extent of recovery was larger for gamma-induced damage than for damage induced by high LET radiation (alpha + 7Li) for the A-A condition. In the H-H condition, while only a slight recovery was seen for gamma-induced damage, it was totally absent for high LET damage. For the modality A-H, it was found that there is not recovery from the sparsely ionising gamma radiation-induced damage. The implications of these results for the treatment of malignant tumours by radiotherapy are briefly discussed. PMID:397200

  5. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.


    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  6. Hardening measures for bipolar transistors against microwave-induced damage

    NASA Astrophysics Data System (ADS)

    Chai, Chang-Chun; Ma, Zhen-Yang; Ren, Xing-Rong; Yang, Yin-Tang; Zhao, Ying-Bo; Yu, Xin-Hai


    In the present paper we study the influences of the bias voltage and the external components on the damage progress of a bipolar transistor induced by high-power microwaves. The mechanism is presented by analyzing the variation in the internal distribution of the temperature in the device. The findings show that the device becomes less vulnerable to damage with an increase in bias voltage. Both the series diode at the base and the relatively low series resistance at the emitter, Re, can obviously prolong the burnout time of the device. However, Re will aid damage to the device when the value is sufficiently high due to the fact that the highest hot spot shifts from the base-emitter junction to the base region. Moreover, the series resistance at the base Rb will weaken the capability of the device to withstand microwave damage.

  7. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  8. Potential role of punicalagin against oxidative stress induced testicular damage

    PubMed Central

    Rao, Faiza; Tian, Hui; Li, Wenqing; Hung, Helong; Sun, Fei


    Punicalagin is isolated from pomegranate and widely used for the treatment of different diseases in Chinese traditional medicine. This study aimed to evaluate the effect of Punicalagin (purity ≥98%) on oxidative stress induced testicular damage and its effect on fertility. We detected the antioxidant potential of punicalagin in lipopolysaccharide (LPS) induced oxidative stress damage in testes, also tried to uncover the boosting fertility effect of Punicalagin (PU) against oxidative stress-induced infertility. Results demonstrated that 9 mg kg−1 for 7 days treatment significantly decreases LPS induced oxidative damage in testes and nitric oxide production. The administration of oxidative stress resulted in a significant reduction in testes antioxidants GSH, T-SOD, and CAT raised LPO, but treatment with punicalagin for 7 days increased antioxidant defense GSH, T-SOD, and CAT by the end of the experiment and reduced LPO level as well. PU also significantly activates Nrf2, which is involved in regulation of antioxidant defense systems. Hence, the present research categorically elucidates the protective effect of punicalagin against LPS induced oxidative stress induced perturbation in the process of spermatogenesis and significantly increased sperm health and number. Moreover, fertility success significantly decreased in LPS-injected mice compared to controls. Mice injected with LPS had fertility indices of 12.5%, while others treated with a combination of PU + LPS exhibited 75% indices. By promoting fertility and eliminating oxidative stress and inflammation, PU may be a useful nutrient for the treatment of infertility. PMID:26763544

  9. Potential role of punicalagin against oxidative stress induced testicular damage.


    Rao, Faiza; Tian, Hui; Li, Wenqing; Hung, Helong; Sun, Fei


    Punicalagin is isolated from pomegranate and widely used for the treatment of different diseases in Chinese traditional medicine. This study aimed to evaluate the effect of Punicalagin (purity ≥98%) on oxidative stress induced testicular damage and its effect on fertility. We detected the antioxidant potential of punicalagin in lipopolysaccharide (LPS) induced oxidative stress damage in testes, also tried to uncover the boosting fertility effect of Punicalagin (PU) against oxidative stress-induced infertility. Results demonstrated that 9 mg kg-1 for 7 days treatment significantly decreases LPS induced oxidative damage in testes and nitric oxide production. The administration of oxidative stress resulted in a significant reduction in testes antioxidants GSH, T-SOD, and CAT raised LPO, but treatment with punicalagin for 7 days increased antioxidant defense GSH, T-SOD, and CAT by the end of the experiment and reduced LPO level as well. PU also significantly activates Nrf2, which is involved in regulation of antioxidant defense systems. Hence, the present research categorically elucidates the protective effect of punicalagin against LPS induced oxidative stress induced perturbation in the process of spermatogenesis and significantly increased sperm health and number. Moreover, fertility success significantly decreased in LPS-injected mice compared to controls. Mice injected with LPS had fertility indices of 12.5%, while others treated with a combination of PU + LPS exhibited 75% indices. By promoting fertility and eliminating oxidative stress and inflammation, PU may be a useful nutrient for the treatment of infertility. PMID:26763544


    EPA Science Inventory

    Dichloromethane (DCM) is a widely used industrial solvent which has been determined to be a carcinogen in rats and mice. n vitro and in vivo analyses of chromosome damage induced by this agent have provided conflicting results. n order to further investigate the clastogenic poten...

  11. Autophagy Induced by Calcium Phosphate Precipitates Targets Damaged Endosomes*

    PubMed Central

    Chen, Xi; Khambu, Bilon; Zhang, Hao; Gao, Wentao; Li, Min; Chen, Xiaoyun; Yoshimori, Tamotsu; Yin, Xiao-Ming


    Calcium phosphate precipitates (CPPs) form complexes with DNA, which enter cells via endocytosis. Under this condition CPPs induce autophagy via the canonic autophagy machinery. Here we showed that CPP-induced autophagy was also dependent on endocytosis as the process was significantly inhibited by methyl-β-cyclodextrin and dynasore, which suppress clathrin-dependent endocytosis. Consistently, CPP treatment triggered the formation of filipin-positive intracellular vesicles whose membranes are rich in cholesterol. Unexpectedly, these vesicles were also positive for galectin 3, suggesting that they were damaged and the membrane glycans became accessible to galectins to bind. Endosome damage was caused by endocytosis of CPPs and was reversed by calcium chelators or by endocytosis inhibitors. Notably, CPP-induced LC3-positive autophagosomes were colocalized with galectin 3, ubiquitin, and p62/SQSTM1. Inhibition of galectin 3 reduced p62 puncta and autophagosome formation. Knockdown of p62 additionally inhibited the colocalization of autophagosomes with galectins. Furthermore, most of the galectin 3-positive vesicles were colocalized with Rab7 or LAMP1. Agents that affect endosome/lysosome maturation and function, such as bafilomycin A1, also significantly affected CPP-induced tubulovesicular autophagosome formation. These findings thus indicate that endocytosed CPPs caused endosome damage and recruitment of galectins, particularly at the later endosome stage, which led to the interaction of the autophagosomal membranes with the damaged endosome in the presence of p62. PMID:24619419

  12. NBQX and TCP prevent soman-induced hippocampal damage

    SciTech Connect

    Lallement, G.; Carpentier, P.; Pernot-Marino, I.; Baubichon, D.; Blanchet, G.


    In a previous investigation we demonstrated that the measurement of w3 (peripheral-type benzodiazepine) binding site densities could be of widespread applicability in the localization and quantification of soman-induced damage in the central nervous system. We thus used this marker to assess, in mouse hippocampus, the neuroprotective activity against soman-induced brain damage of NBQX and TCP which are respective antagonists of non-NMDA and NMDA glutamatergic receptors. Injection of NBQX at 20 or 40 mg/kg 5 min prior to soman totally prevented the neuronal damage. Comparatively, TCP had neuroprotective efficacy when administered at l mg/kg 5 min prior to soman followed by a reinjection 1 hour after. These results demonstrate that both NBQX and TCP afford a satisfactory neuroprotection against soman-induced brain damage. Since it is known that the neuropathology due to soman is closely seizure-related, it is likely that the neuroprotective activities of NBQX and TCP are related to the respective roles of non-NMDA and NMDA receptors in the onset and maintenance of soman-induced seizures.

  13. Inflammation-induced DNA damage and damage-induced inflammation: a vicious cycle.


    Pálmai-Pallag, Timea; Bachrati, Csanád Z


    Inflammation is the ultimate response to the constant challenges of the immune system by microbes, irritants or injury. The inflammatory cascade initiates with the recognition of microorganism-derived pathogen associated molecular patterns (PAMPs) and host cell-derived damage associated molecular patterns (DAMPs) by the pattern recognition receptors (PRRs). DNA as a molecular PAMP or DAMP is sensed directly or via specific binding proteins to instigate pro-inflammatory response. Some of these DNA binding proteins also participate in canonical DNA repair pathways and recognise damaged DNA to initiate DNA damage response. In this review we aim to capture the essence of the complex interplay between DNA damage response and the pro-inflammatory signalling through representative examples. PMID:25449753

  14. Multiscale physics of ion-induced radiation damage

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Solov'yov, Andrey V.


    A multiscale approach to the physics of ion-beam cancer therapy, an approach suggested in order to understand the interplay of a large number of phenomena involved in radiation damage scenario occurring on a range of temporal, spatial, and energy scales, is being reviewed. The scenario is described along with a variety of effects that take place on different temporal, spatial, and energy scales and play major roles in the scenario of interaction of ions with tissue. The understanding of these effects leads to a quantitative assessment of relative biological effectiveness that relates the physical quantities, such as dose, to the biological values, such as the probability of cell survival.

  15. Biological Therapy-Induced Systemic Vasculitis.


    Gutiérrez-González, Luis Arturo


    The use of biologics has been associated with the paradoxical development of biologics-induced autoimmune diseases. The purpose of this review was to describe the key immunopathogenic mechanisms involved in the development of these conditions, and to discuss the clinical and laboratory characteristics usually described in the medical literature, reviewing case reports as well as records on national biologic therapies (BIOGEAS, RABBIT, BSRBR-RA, BIOBADAVEN). More than 200 cases have so far been reported, all of them diagnosed on the basis of the histopathology or meeting the ACR/Chapel Hill criteria. Over 75 % of the cases were females with a mean age of 48 ± 5 years. More than 50 % had rheumatoid arthritis. Most of the biologics-associated vasculitis developed in 90 ± 31 days. Complete resolution in almost 75 % of the cases was observed upon treatment discontinuation; however, steroid therapy was indicated for all patients and one death was recorded. The use of cyclophosphamide, rituximab or plasma exchange was reserved for the most severe cases. PMID:27165496

  16. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    NASA Astrophysics Data System (ADS)

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar


    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  17. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.


    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong


    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  18. Tissue damage negatively regulates LPS-induced macrophage necroptosis.


    Li, Z; Scott, M J; Fan, E K; Li, Y; Liu, J; Xiao, G; Li, S; Billiar, T R; Wilson, M A; Jiang, Y; Fan, J


    Infection is a common clinical complication following tissue damage resulting from surgery and severe trauma. Studies have suggested that cell pre-activation by antecedent trauma/tissue damage profoundly impacts the response of innate immune cells to a secondary infectious stimulus. Cell necroptosis, a form of regulated inflammatory cell death, is one of the mechanisms that control cell release of inflammatory mediators from important innate immune executive cells such as macrophages (Mφ), which critically regulate the progress of inflammation. In this study, we investigated the mechanism and role of trauma/tissue damage in the regulation of LPS-induced Mφ necroptosis using a mouse model simulating long-bone fracture. We demonstrate that LPS acting through Toll-like receptor (TLR) 4 promotes Mφ necroptosis. However, necroptosis is ameliorated by high-mobility group box 1 (HMGB1) release from damaged tissue. We show that HMGB1 acting through cell surface receptor for advanced glycation end products (RAGE) upregulates caveolin-1 expression, which in turn induces caveolae-mediated TLR4 internalization and desensitization to decrease Mφ necroptosis. We further show that RAGE-MyD88 activation of Cdc42 and subsequent activation of transcription factor Sp1 serves as a mechanism underlying caveolin-1 transcriptional upregulation. These results reveal a previous unidentified protective role of damage-associated molecular pattern (DAMP) molecules in restricting inflammation in response to exogenous pathogen-associated molecular pattern molecules. PMID:26943325

  19. Zebrafish fin regeneration after cryoinjury-induced tissue damage

    PubMed Central

    Chassot, Bérénice; Pury, David


    ABSTRACT Although fin regeneration following an amputation procedure has been well characterized, little is known about the impact of prolonged tissue damage on the execution of the regenerative programme in the zebrafish appendages. To induce histolytic processes in the caudal fin, we developed a new cryolesion model that combines the detrimental effects of freezing/thawing and ischemia. In contrast to the common transection model, the damaged part of the fin was spontaneously shed within two days after cryoinjury. The remaining stump contained a distorted margin with a mixture of dead material and healthy cells that concomitantly induced two opposing processes of tissue debris degradation and cellular proliferation, respectively. Between two and seven days after cryoinjury, this reparative/proliferative phase was morphologically featured by displaced fragments of broken bones. A blastemal marker msxB was induced in the intact mesenchyme below the damaged stump margin. Live imaging of epithelial and osteoblastic transgenic reporter lines revealed that the tissue-specific regenerative programmes were initiated after the clearance of damaged material. Despite histolytic perturbation during the first week after cryoinjury, the fin regeneration resumed and was completed without further alteration in comparison to the simple amputation model. This model reveals the powerful ability of the zebrafish to restore the original appendage architecture after the extended histolysis of the stump. PMID:27215324

  20. Zebrafish fin regeneration after cryoinjury-induced tissue damage.


    Chassot, Bérénice; Pury, David; Jaźwińska, Anna


    Although fin regeneration following an amputation procedure has been well characterized, little is known about the impact of prolonged tissue damage on the execution of the regenerative programme in the zebrafish appendages. To induce histolytic processes in the caudal fin, we developed a new cryolesion model that combines the detrimental effects of freezing/thawing and ischemia. In contrast to the common transection model, the damaged part of the fin was spontaneously shed within two days after cryoinjury. The remaining stump contained a distorted margin with a mixture of dead material and healthy cells that concomitantly induced two opposing processes of tissue debris degradation and cellular proliferation, respectively. Between two and seven days after cryoinjury, this reparative/proliferative phase was morphologically featured by displaced fragments of broken bones. A blastemal marker msxB was induced in the intact mesenchyme below the damaged stump margin. Live imaging of epithelial and osteoblastic transgenic reporter lines revealed that the tissue-specific regenerative programmes were initiated after the clearance of damaged material. Despite histolytic perturbation during the first week after cryoinjury, the fin regeneration resumed and was completed without further alteration in comparison to the simple amputation model. This model reveals the powerful ability of the zebrafish to restore the original appendage architecture after the extended histolysis of the stump. PMID:27215324

  1. Pattern Learning, Damage and Repair within Biological Neural Networks

    NASA Astrophysics Data System (ADS)

    Siu, Theodore; Fitzgerald O'Neill, Kate; Shinbrot, Troy


    Traumatic brain injury (TBI) causes damage to neural networks, potentially leading to disability or even death. Nearly one in ten of these patients die, and most of the remainder suffer from symptoms ranging from headaches and nausea to convulsions and paralysis. In vitro studies to develop treatments for TBI have limited in vivo applicability, and in vitro therapies have even proven to worsen the outcome of TBI patients. We propose that this disconnect between in vitro and in vivo outcomes may be associated with the fact that in vitro tests assess indirect measures of neuronal health, but do not investigate the actual function of neuronal networks. Therefore in this talk, we examine both in vitro and in silico neuronal networks that actually perform a function: pattern identification. We allow the networks to execute genetic, Hebbian, learning, and additionally, we examine the effects of damage and subsequent repair within our networks. We show that the length of repaired connections affects the overall pattern learning performance of the network and we propose therapies that may improve function following TBI in clinical settings.

  2. Induced swelling in radiation damaged ZrSiO 4

    NASA Astrophysics Data System (ADS)

    Exarhos, G. J.


    A hydrothermal gelation method was used to prepare phase pure polycrystalline ZrSiO 4 which was sintered to 95% theoretical density. Actinide doped samples containing 10 wt% 238Pu were prepared by an analogous procedure and incurred bulk radiation damage through internal alpha-decay processes. Undoped samples were subjected to external irradiation from 5.5 MeV alpha sources, and from a 60Co gamma source. Actinide doped ZrSiO 4 exhibits dose dependent swelling caused by displacement processes leading to ingrowth of amorphous regions. Bulk density and XRD measurements, as a function of dose, showed first order exponential ingrowth behavior similar to that observed in other actinide doped materials. Results are compared with reported data for naturally damaged crystals subjected to significantly lower alpha decay rates. No significant dose rate dependence on damage ingrowth has been observed. Kinetic models for the observed dose dependent swelling are proposed and rate constants for damage ingrowth in synthetic and natural crystals are compared. To study localized damage induced by both external alpha and gamma irradiation, vibrational Raman measurements were obtained for several accumulated doses. Results indicate that the initial stage of damage ingrowth is confined to the silicate sublattice. Vibrational results will be discussed in terms of microstructural changes which result from irradiation.

  3. The stochastic nature of growth of laser-induced damage

    NASA Astrophysics Data System (ADS)

    Carr, C. W.; Cross, David A.; Liao, Zhi M.; Norton, Mary A.; Negres, Raluca A.


    Laser fluence and operational tempo of ICF systems operating in the UV are typically limited by the growth of laser- induced damage on their final optics (primarily silica optics). In the early 2000 time frame, studies of laser damage growth with relevant large area beams revealed that for some laser conditions damage sites located on the exit surface of a fused silica optic grew following an exponential growth rule: D(n) = D0 exp (n α(φ)), where D is final site diameter, D0 is the initial diameter of the site, φ is the laser fluence, α(φ) is the growth coefficient, and n is the number of exposures. In general α is a linear function of φ, with a threshold of φTH. In recent years, it has been found that that growth behavior is actually considerably more complex. For example, it was found that α is not a constant for a given fluence but follows a probability distribution with a mean equal to α(φ). This is complicated by observations that these distributions are actually functions of the pulse shape, damage site size, and initial morphology of damage initiation. In addition, there is not a fixed fluence threshold for damage sites growth, which is better described by a probability of growth which depends on site size, morphology and laser fluence. Here will review these findings and discuss implications for the operation of large laser systems.

  4. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.


    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  5. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  6. Stress-induced DNA damage biomarkers: applications and limitations.


    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  7. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  8. Contribution of endogenous and exogenous damage to the total radiation-induced damage in the bacterial spore

    SciTech Connect

    Jacobs, G.P.; Samuni, A.; Czapski, G.


    Radical scavengers such as polyethylene glycol 4000 and bovine albumin have been used to define the contribution of exogenous and endogenous damage to the total radiation-induced damage in aqueous buffered suspensions of Bacillus pumilus spores. The results indicate that this damage in the bacterial spore is predominantly endogenous.

  9. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  10. Ketamine/Xylazine-Induced Corneal Damage in Mice

    PubMed Central

    Syed, Nasreen A.; Anderson, Michael G.


    Purpose We have observed that the commonly used ketamine/xylazine anesthesia mix can induce a focally severe and permanent corneal opacity. The purpose of this study was to establish the clinical and histological features of this deleterious side effect, its sensitivity with respect to age and anesthesia protocol, and approaches for avoiding it. Methods Young C57BL/6J, C57BLKS/J, and SJL/J mice were treated with permutations of anesthesia protocols and compared using slit-lamp exams, optical coherence tomography, histologic analyses, and telemetric measurements of body temperature. Results Ketamine/xylazine induces corneal damage in mice with a variable frequency. Among 12 experimental cohorts, corneal damage associated with ketamine/xylazine was observed in 9 of them. Despite various treatments to avoid corneal dehydration during anesthesia, the frequency of corneas experiencing damage among responding cohorts was 42% (26% inclusive of all cohorts), which is significantly greater than the natural prevalence (5%). The damage was consistent with band keratopathy. It appeared as a white or gray horizontal band located proximal to the pupil and was positive for subepithelial calcium deposition with von Kossa stain. Conclusions The sum of our clinical and histological observations is consistent with ketamine/xylazine-induced band keratopathy in mice. This finding is relevant for mouse studies involving the eye and/or vision-dependent behavioral assays, which would both be prone to artifact without appreciation of the damage caused by ketamine/xylazine anesthesia. Use of yohimbine is suggested as a practical means of avoiding this complication. PMID:26222692

  11. Systems Biology of HBOC-Induced Vasoconstriction

    PubMed Central

    Hai, Chi-Ming


    Vasoconstriction is a major adverse effect of HBOCs. The use of a single drug for attenuating HBOC-induced vasoconstriction has been tried with limited success. Since HBOC causes disruptions at multiple levels of organization in the vascular system, a systems approach is helpful to explore avenues to counteract the effects of HBOC at multiple levels by targeting multiple sites in the system. A multi-target approach is especially appropriate for HBOC-induced vasoconstriction, because HBOC disrupts the cascade of amplification by NO-cGMP signaling and protein phosphorylation, ultimately resulting in vasoconstriction. Targeting multiple steps in the cascade may alter the overall gain of amplification, thereby limiting the propagation of disruptive effects through the cascade. As a result, targeting multiple sites may accomplish a relatively high overall efficacy at submaximal drug doses. Identifying targets and doses for developing a multi-target combination HBOC regimen for oxygen therapeutics requires a detailed understanding of the systems biology and phenotypic heterogeneity of the vascular system at multiple layers of organization, which can be accomplished by successive iterations between experimental studies and mathematical modeling at multiple levels of vascular systems and organ systems. Towards this goal, this article addresses the following topics: a) NO-scavenging by HBOC, b) HBOC autoxidation-induced reactive oxygen species generation and endothelial barrier dysfunction, c) NO- cGMP signaling in vascular smooth muscle cells, d) NO and cGMP-dependent regulation of contractile filaments in vascular smooth muscle cells, e) phenotypic heterogeneity of vascular systems, f) systems biology as an approach to developing a multi-target HBOC regimen. PMID:21726185

  12. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis.


    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue


    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform "EasyMF" and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then "EasyMF" is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  13. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis

    PubMed Central

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue


    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform “EasyMF” and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then “EasyMF” is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  14. Reformulated meat products protect against ischemia-induced cardiac damage.


    Asensio-Lopez, M C; Lax, A; Sanchez-Mas, J; Avellaneda, A; Planes, J; Pascual-Figal, D A


    The protective effects of the antioxidants present in food are of great relevance for cardiovascular health. This study evaluates whether the extracts from reformulated meat products with a reduction in fat and/or sodium content exert a cardioprotective effect against ischemia-induced oxidative stress in cardiomyocytes, compared with non-meat foods. Ischemic damage caused loss of cell viability, increased reactive oxygen species and lipid peroxidation and decreased the antioxidant activity. Pretreatment for 24 h with digested or non-digested extracts from reformulated meat products led to protection against ischemia-induced oxidative damage: increased cell viability, reduced oxidative stress and restored the antioxidant activity. Similar results were obtained using extracts from tuna fish, but not with the extracts of green peas, salad or white beans. These results suggest that reformulated meat products have a beneficial impact in protecting cardiac cells against ischemia, and they may represent a source of natural antioxidants with benefits for cardiovascular health. PMID:26751429

  15. Mechanisms for microvascular damage induced by ultrasound-activated microbubbles

    SciTech Connect

    Chen Hong; Brayman, Andrew A.; Evan, Andrew P.; Matula, Thomas J.


    To provide insight into the mechanisms of microvascular damage induced by ultrasound-activated microbubbles, experimental studies were performed to correlate microvascular damage to the dynamics of bubble-vessel interactions. High-speed photomicrography was used to record single microbubbles interacting with microvessels in ex vivo tissue, under the exposure of short ultrasound pulses with a center frequency of 1 MHz and peak negative pressures (PNP) ranging from 0.8-4 MPa. Vascular damage associated with observed bubble-vessel interactions was either indicated directly by microbubble extravasation or examined by transmission electron microscopy (TEM) analyses. As observed previously, the high-speed images revealed that ultrasound-activated microbubbles could cause distention and invagination of adjacent vessel walls, and could form liquid jets in microvessels. Vessel distention, invagination, and liquid jets were associated with the damage of microvessels whose diameters were smaller than those of maximally expanded microbubbles. However, vessel invagination appeared to be the dominant mechanism for the damage of relative large microvessels.

  16. Mechanisms for microvascular damage induced by ultrasound-activated microbubbles

    NASA Astrophysics Data System (ADS)

    Chen, Hong; Brayman, Andrew A.; Evan, Andrew P.; Matula, Thomas J.


    To provide insight into the mechanisms of microvascular damage induced by ultrasound-activated microbubbles, experimental studies were performed to correlate microvascular damage to the dynamics of bubble-vessel interactions. High-speed photomicrography was used to record single microbubbles interacting with microvessels in ex vivo tissue, under the exposure of short ultrasound pulses with a center frequency of 1 MHz and peak negative pressures (PNP) ranging from 0.8-4 MPa. Vascular damage associated with observed bubble-vessel interactions was either indicated directly by microbubble extravasation or examined by transmission electron microscopy (TEM) analyses. As observed previously, the high-speed images revealed that ultrasound-activated microbubbles could cause distention and invagination of adjacent vessel walls, and could form liquid jets in microvessels. Vessel distention, invagination, and liquid jets were associated with the damage of microvessels whose diameters were smaller than those of maximally expanded microbubbles. However, vessel invagination appeared to be the dominant mechanism for the damage of relative large microvessels.

  17. Role of paramagnetic chromium in chromium(VI)-induced damage in cultured mammalian cells.


    Sugiyama, M


    Chromium(VI) compounds are known to be potent toxic and carcinogenic agents. Because chromium(VI) is easily taken up by cells and is subsequently reduced to chromium(III), the formation of paramagnetic chromium such as chromium(V) and chromium(III) is believed to play a role in the adverse biological effects of chromium(VI) compounds. The present report, uses electron spin resonance (ESR) spectroscopy; the importance of the role of paramagnetic chromium in chromium(VI)-induced damage in intact cultured cells is discussed, based upon our studies with antioxidants including vitamin E (alpha-tocopherol), B2 (riboflavin), C (ascorbic acid), and so on. These studies appear to confirm the participation of paramagnetic Cr such as chromium(V) and Chromium(III) in chromium(VI)-induced cellular damage. PMID:7843124

  18. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.


    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth


    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound. PMID:22828439

  19. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.


    Lundqvist, J; Hellman, B; Oskarsson, A


    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  20. PARP-1 modulates amyloid beta peptide-induced neuronal damage.


    Martire, Sara; Fuso, Andrea; Rotili, Dante; Tempera, Italo; Giordano, Cesare; De Zottis, Ivana; Muzi, Alessia; Vernole, Patrizia; Graziani, Grazia; Lococo, Emanuela; Faraldi, Martina; Maras, Bruno; Scarpa, Sigfrido; Mosca, Luciana; d'Erme, Maria


    Amyloid beta peptide (Aβ) causes neurodegeneration by several mechanisms including oxidative stress, which is known to induce DNA damage with the consequent activation of poly (ADP-ribose) polymerase (PARP-1). To elucidate the role of PARP-1 in the neurodegenerative process, SH-SY5Y neuroblastoma cells were treated with Aβ25-35 fragment in the presence or absence of MC2050, a new PARP-1 inhibitor. Aβ25-35 induces an enhancement of PARP activity which is prevented by cell pre-treatment with MC2050. These data were confirmed by measuring PARP-1 activity in CHO cells transfected with amylod precursor protein and in vivo in brains specimens of TgCRND8 transgenic mice overproducing the amyloid peptide. Following Aβ25-35 exposure a significant increase in intracellular ROS was observed. These data were supported by the finding that Aβ25-35 induces DNA damage which in turn activates PARP-1. Challenge with Aβ25-35 is also able to activate NF-kB via PARP-1, as demonstrated by NF-kB impairment upon MC2050 treatment. Moreover, Aβ25-35 via PARP-1 induces a significant increase in the p53 protein level and a parallel decrease in the anti-apoptotic Bcl-2 protein. These overall data support the hypothesis of PARP-1 involvment in cellular responses induced by Aβ and hence a possible rationale for the implication of PARP-1 in neurodegeneration is discussed. PMID:24086258

  1. PARP-1 Modulates Amyloid Beta Peptide-Induced Neuronal Damage

    PubMed Central

    Martire, Sara; Fuso, Andrea; Rotili, Dante; Tempera, Italo; Giordano, Cesare; De Zottis, Ivana; Muzi, Alessia; Vernole, Patrizia; Graziani, Grazia; Lococo, Emanuela; Faraldi, Martina; Maras, Bruno; Scarpa, Sigfrido; Mosca, Luciana; d'Erme, Maria


    Amyloid beta peptide (Aβ) causes neurodegeneration by several mechanisms including oxidative stress, which is known to induce DNA damage with the consequent activation of poly (ADP-ribose) polymerase (PARP-1). To elucidate the role of PARP-1 in the neurodegenerative process, SH-SY5Y neuroblastoma cells were treated with Aβ25–35 fragment in the presence or absence of MC2050, a new PARP-1 inhibitor. Aβ25–35 induces an enhancement of PARP activity which is prevented by cell pre-treatment with MC2050. These data were confirmed by measuring PARP-1 activity in CHO cells transfected with amylod precursor protein and in vivo in brains specimens of TgCRND8 transgenic mice overproducing the amyloid peptide. Following Aβ25–35 exposure a significant increase in intracellular ROS was observed. These data were supported by the finding that Aβ25–35 induces DNA damage which in turn activates PARP-1. Challenge with Aβ25–35 is also able to activate NF-kB via PARP-1, as demonstrated by NF-kB impairment upon MC2050 treatment. Moreover, Aβ25–35 via PARP-1 induces a significant increase in the p53 protein level and a parallel decrease in the anti-apoptotic Bcl-2 protein. These overall data support the hypothesis of PARP-1 involvment in cellular responses induced by Aβ and hence a possible rationale for the implication of PARP-1 in neurodegeneration is discussed. PMID:24086258

  2. A stochastic model of radiation-induced bone marrow damage

    SciTech Connect

    Cotlet, G.; Blue, T.E.


    A stochastic model, based on consensus principles from radiation biology, is used to estimate bone-marrow stem cell pool survival (CFU-S and stroma cells) after irradiation. The dose response model consists of three coupled first order linear differential equations which quantitatively describe time dependent cellular damage, repair, and killing of red bone marrow cells. This system of differential equations is solved analytically through the use of a matrix approach for continuous and fractionated irradiations. The analytic solutions are confirmed through the dynamical solution of the model equations using SIMULINK. Rate coefficients describing the cellular processes of radiation damage and repair, extrapolated to humans from animal data sets and adjusted for neutron-gamma mixed fields, are employed in a SIMULINK analysis of criticality accidents. The results show that, for the time structures which may occur in criticality accidents, cell survival is established mainly by the average dose and dose rate.

  3. Bacterial Genotoxins: Merging the DNA Damage Response into Infection Biology.


    Grasso, Francesca; Frisan, Teresa


    Bacterial genotoxins are unique among bacterial toxins as their molecular target is DNA. The consequence of intoxication or infection is induction of DNA breaks that, if not properly repaired, results in irreversible cell cycle arrest (senescence) or death of the target cells. At present, only three bacterial genotoxins have been identified. Two are protein toxins: the cytolethal distending toxin (CDT) family produced by a number of Gram-negative bacteria and the typhoid toxin produced by Salmonella enterica serovar Typhi. The third member, colibactin, is a peptide-polyketide genotoxin, produced by strains belonging to the phylogenetic group B2 of Escherichia coli. This review will present the cellular effects of acute and chronic intoxication or infection with the genotoxins-producing bacteria. The carcinogenic properties and the role of these effectors in the context of the host-microbe interaction will be discussed. We will further highlight the open questions that remain to be solved regarding the biology of this unusual family of bacterial toxins. PMID:26270677

  4. Bacterial Genotoxins: Merging the DNA Damage Response into Infection Biology

    PubMed Central

    Grasso, Francesca; Frisan, Teresa


    Bacterial genotoxins are unique among bacterial toxins as their molecular target is DNA. The consequence of intoxication or infection is induction of DNA breaks that, if not properly repaired, results in irreversible cell cycle arrest (senescence) or death of the target cells. At present, only three bacterial genotoxins have been identified. Two are protein toxins: the cytolethal distending toxin (CDT) family produced by a number of Gram-negative bacteria and the typhoid toxin produced by Salmonella enterica serovar Typhi. The third member, colibactin, is a peptide-polyketide genotoxin, produced by strains belonging to the phylogenetic group B2 of Escherichia coli. This review will present the cellular effects of acute and chronic intoxication or infection with the genotoxins-producing bacteria. The carcinogenic properties and the role of these effectors in the context of the host-microbe interaction will be discussed. We will further highlight the open questions that remain to be solved regarding the biology of this unusual family of bacterial toxins. PMID:26270677

  5. Evidence for DNA Damage as a Biological Link Between Diabetes and Cancer

    PubMed Central

    Lee, Shao Chin; Chan, Juliana CN


    Objective: This review examines the evidence that: Diabetes is a state of DNA damage; pathophysiological factors in diabetes can cause DNA damage; DNA damage can cause mutations; and DNA mutation is linked to carcinogenesis. Data Sources: We retrieved information from the PubMed database up to January, 2014, using various search terms and their combinations including DNA damage, diabetes, cancer, high glucose, hyperglycemia, free fatty acids, palmitic acid, advanced glycation end products, mutation and carcinogenesis. Study Selection: We included data from peer-reviewed journals and a textbook printed in English on relationships between DNA damage and diabetes as well as pathophysiological factors in diabetes. Publications on relationships among DNA damage, mutagenesis, and carcinogenesis, were also reviewed. We organized this information into a conceptual framework to explain the possible causal relationship between DNA damage and carcinogenesis in diabetes. Results: There are a large amount of data supporting the view that DNA mutation is a typical feature in carcinogenesis. Patients with type 2 diabetes have increased production of reactive oxygen species, reduced levels of antioxidant capacity, and increased levels of DNA damage. The pathophysiological factors and metabolic milieu in diabetes can cause DNA damage such as DNA strand break and base modification (i.e., oxidation). Emerging experimental data suggest that signal pathways (i.e., Akt/tuberin) link diabetes to DNA damage. This collective evidence indicates that diabetes is a pathophysiological state of oxidative stress and DNA damage which can lead to various types of mutation to cause aberration in cells and thereby increased cancer risk. Conclusions: This review highlights the interrelationships amongst diabetes, DNA damage, DNA mutation and carcinogenesis, which suggests that DNA damage can be a biological link between diabetes and cancer. PMID:26021514

  6. Effect of Picroliv on cadmium induced testicular damage in rat.


    Yadav, Neelam; Khandelwal, Shashi


    Ameliorative potential of Picroliv, a standardized extract of Picrorhiza kurroa on Cd induced early and advanced testicular damage was investigated in male rats. In the former experiment, the rats were administered Cd as CdCl(2) (0.5mg/kg, s.c.) 5days/week for 18 weeks and Picroliv at two doses (6 and 12 mg/kg, p.o.) was given for the last 4 weeks i.e. from week 15 to 18, to the Cd administered group. In the latter experiment, the Cd administration continued for 24 weeks and Picroliv was given from week 21 to 24. At 18 weeks, Cd caused alterations in oxidative stress indices like increased lipid peroxidation (MDA) and reduced levels of non protein sulphydryls (NPSH). They were found close to the control values by Picroliv treatment, suggesting its antioxidant potential. The increased levels of Zn and Ca were reduced by Picroliv, the Cd levels remained unaltered. The Cd induced testicular damage was also mitigated by Picroliv. The higher dose (12 mg/kg) being more effective than the lower dose. However, at 24 weeks of Cd exposure, the oxidative stress indicators in testis were more pronounced along with the morphological alterations. These parameters remained unaffected by Picroliv treatment. On comparative evaluation of the two studies, 18 weeks Cd exposure caused moderate testicular damage, which could be reversed significantly by Picroliv administration and correlated well with oxidative stress markers. Our results clearly demonstrate the ameliorative potential of Picroliv in Cd induced early testicular damage. PMID:17928123

  7. Enhancement of ultrasonically induced cell damage by phthalocyanines in vitro.


    Milowska, Katarzyna; Gabryelak, Teresa


    In this work, erythrocytes from carp were used as a nucleated cell model to test the hypothesis that the phthalocyanines (zinc--ZnPc and chloroaluminium -AlClPc) enhance ultrasonically induced damage in vitro. In order to confirm and complete our earlier investigation, the influence of ultrasound (US) and phthalocyanines (Pcs) on unresearched cellular components, was studied. Red blood cells were exposed to 1 MHz continuous ultrasound wave (0.61 and/or 2.44 W/cm(2)) in the presence or absence of phthalocyanines (3 microM). To identify target cell damage, we studied hemolysis, membrane fluidity and morphology of erythrocytes. To demonstrate the changes in the fluidity of plasma membrane we used the spectrofluorimetric methods using two fluorescence probes: 1-[4-(trimethylamino)phenyl]-6-phenyl-1,3,5,-hexatriene (TMA-DPH) and 1,6-diphenyl-1,3,5-hexatriene (DPH). The effect of US and Pcs on nucleated erythrocytes morphology was estimated on the basis of microscopic observation. The enhancement of ultrasonically induced membrane damage by both phthalocyanines was observed in case of hemolysis, and membrane surface fluidity, in comparison to ultrasound. The authors also observed changes in the morphology of erythrocytes. The obtained results support the hypothesis that the Pcs enhance ultrasonically induced cell damage in vitro. Furthermore, the influence of ultrasound on phthalocyanines (Pcs) in medium and in cells was tested. The authors observed changes in the phthalocyanines absorption spectra in the medium and the increase in the intensity of phthalocyanines fluorescence in the cells. These data can suggest changes in the structure of phthalocyanines after ultrasound action. PMID:18495194

  8. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.


    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  9. Microscopic studies of cellular damage induced by compression waves in different environments

    NASA Astrophysics Data System (ADS)

    Bo, Chiara; Balzer, Jens; Brown, Katherine A.; Proud, William G.


    The cellular basis of induced-damage in biological samples under dynamic loading conditions is largely uncharacterized. In this study we propose a new approach to investigate the effects of compression waves on in-vitro grown Stem cells extracted from BALB/c mice. A modified split Hopkinson pressure bar system is used to simulate damage in the biological samples: the cells are inserted in a confinement chamber either in their growing media or on a 3D scaffold, they are subjected to compression waves and finally recovered for further analysis. The difference in mechanical impedance between the cells and the hosting environments is believed to be a key point in the generation of damage. To discriminate the effects of the different mechanical supports on cell morphology pre and after compression, membrane and cytoskeletal proteins disruptions are investigated using fluorescence confocal microscopy. Understanding the underlying mechanism of damage at the microscopic scale could set the basis for the development of therapeutic applications at the cellular level.

  10. Proton-induced radiation damage in germanium detectors

    NASA Technical Reports Server (NTRS)

    Brueckner, J.; Koerfer, M.; Waenke, H.; Schroeder, A. N. F.; Filges, D.; Dragovitsch, P.; Englert, P. A. J.; Starr, R.; Trombka, J. I.


    High-purity germanium (HPGe) detectors will be used in future space missions for gamma-ray measurements and will be subject to interactions with energetic particles. To simulate this process, several large-volume n-type HPGe detectors were incrementally exposed to a particle fluence of up to 10 to the 8th protons/sq cm (proton energy: 1.5 GeV) at different operating temperatures (90 to 120 K) to induce radiation damage. Basic scientific and engineering data on detector performance were collected. During the incremental irradiation, the peak shape produced by the detectors showed a significant change from a Gaussian shape to a broad complex structure. After the irradiation, all detectors were thoroughly characterized by measuring many parameters. To remove the accumulated radiation damage, the detectors were stepwise-annealed at temperatures below 110 C, while kept in their specially designed cryostats. This study shows that n-type HPGe detectors can be used in charged-particle environments as high-energy resolution devices until a certain level of radiation damage is accumulated and that the damage can be removed at moderate annealing temperatures and the detector returned to operating condition.

  11. Proton-induced radiation damage in germanium detectors

    SciTech Connect

    Bruckner, J.; Korfer, M.; Wanke, H. , Mainz ); Schroeder, A.N.F. ); Figes, D.; Dragovitsch, P. ); Englert, P.A.J. ); Starr, R.; Trombka, J.I. . Goddard Space Flight Center); Taylor, I. ); Drake, D.M.; Shunk, E.R. )


    High-purity germanium (HPGe) detectors will be used in future space missions for gamma-ray measurements and will be subject to interactions with energetic particles. To simulate this process several large-volume n-type HPGe detectors were incrementally exposed to a particle fluence of up to 10{sub 8} protons cm{sup {minus}2} (proton energy: 1.5 GeV) at different operating temperatures (90 to 120 K) to induce radiation damage. Basic scientific as well as engineering data on detector performance were collected. During the incremental irradiation, the peak shape produced by the detectors showed a significant change from a Gaussian shape to a broad complex structure. After the irradiation all detectors were thoroughly characterized by measuring many parameters. To remove the accumulated radiation damage the detectors were stepwise annealed at temperatures T {le} 110{degrees}C while staying specially designed cryostats. This paper shows that n-type HPGe detectors can be used in charged particles environments as high-energy resolution devices until a certain level of radiation damage is accumulated and that the damage can be removed at moderate annealing temperatures and the detector returned to operating condition.

  12. Retinal damage induced by commercial light emitting diodes (LEDs).


    Jaadane, Imene; Boulenguez, Pierre; Chahory, Sabine; Carré, Samuel; Savoldelli, Michèle; Jonet, Laurent; Behar-Cohen, Francine; Martinsons, Christophe; Torriglia, Alicia


    Spectra of "white LEDs" are characterized by an intense emission in the blue region of the visible spectrum, absent in daylight spectra. This blue component and the high intensity of emission are the main sources of concern about the health risks of LEDs with respect to their toxicity to the eye and the retina. The aim of our study was to elucidate the role of blue light from LEDs in retinal damage. Commercially available white LEDs and four different blue LEDs (507, 473, 467, and 449nm) were used for exposure experiments on Wistar rats. Immunohistochemical stain, transmission electron microscopy, and Western blot were used to exam the retinas. We evaluated LED-induced retinal cell damage by studying oxidative stress, stress response pathways, and the identification of cell death pathways. LED light caused a state of suffering of the retina with oxidative damage and retinal injury. We observed a loss of photoreceptors and the activation of caspase-independent apoptosis, necroptosis, and necrosis. A wavelength dependence of the effects was observed. Phototoxicity of LEDs on the retina is characterized by a strong damage of photoreceptors and by the induction of necrosis. PMID:25863264

  13. Metabolic consequences of exercise-induced muscle damage.


    Tee, Jason C; Bosch, Andrew N; Lambert, Mike I


    Exercise-induced muscle damage (EIMD) is commonly experienced following either a bout of unaccustomed physical activity or following physical activity of greater than normal duration or intensity. The mechanistic factor responsible for the initiation of EIMD is not known; however, it is hypothesised to be either mechanical or metabolic in nature. The mechanical stress hypothesis states that EIMD is the result of physical stress upon the muscle fibre. In contrast, the metabolic stress model predicts that EIMD is the result of metabolic deficiencies, possibly through the decreased action of Ca(2+)-adenosine triphosphatase. Irrespective of the cause of the damage, EIMD has a number of profound metabolic effects. The most notable metabolic effects of EIMD are decreased insulin sensitivity, prolonged glycogen depletion and an increase in metabolic rate both at rest and during exercise. Based on current knowledge regarding the effects that various types of damaging exercise have on muscle metabolism, a new model for the initiation of EIMD is proposed. This model states that damage initiation may be either metabolic or mechanical, or a combination of both, depending on the mode, intensity and duration of exercise and the training status of the individual. PMID:17887809

  14. Nanoparticle-Mediated Mitochondrial Damage Induces Apoptosis in Cancer.


    Mallick, Abhik; More, Piyush; Syed, Muhammed Muazzam Kamil; Basu, Sudipta


    Detouring of conventional DNA damaging anticancer drugs into mitochondria to damage mitochondrial DNA is evolving as a promising strategy in chemotherapy. Inhibiting single target in mitochondria would eventually lead to the emergence of drug resistance. Moreover, targeting mitochondria selectively in cancer cells, keeping them intact in healthy cells, remains a major challenge. Herein, triphenylphosphine (TPP)-coated positively charged 131.6 nm spherical nanoparticles (NPs) comprised of α-tocopheryl succinate (TOS, inhibitor of complex II in electron transport chain) and obatoclax (Obt, inhibitor of Bcl-2) were engineered. The TOS-TPP-Obt-NPs entered into acidic lysosomes via macropinocytosis, followed by lysosomal escape and finally homed into mitochondria over a period of 24 h. Subsequently, these TOS-TPP-Obt-NPs triggered mitochondrial outer membrane permeabilization (MOMP) by inhibiting antiapoptotic Bcl-2, leading to Cytochrome C release. These TOS-TPP-Obt-NPs mediated mitochondrial damage induced cellular apoptosis through caspase-9 and caspase-3 cleavage to show improved efficacy in HeLa cells. Moreover, TOS-TPP-Obt-NPs induced MOMP in drug-resistant triple negative breast cancer cells (MDA-MB-231), leading to remarkable efficacy, compared to the combination of free drugs in higher drug concentrations. Results presented here clearly stimulate the usage of multiple drugs to perturb simultaneously diverse targets, selectively in mitochondria, as next-generation cancer therapeutics. PMID:27160664

  15. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope


    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  16. Morphological studies of laser-induced photoacoustic damage

    NASA Astrophysics Data System (ADS)

    Flotte, Thomas J.; Yashima, Yutaka; Watanabe, Shinichi; McAuliffe, Daniel J., Sr.; Jacques, Steven L.


    Argon-fluoride excimer laser ablation of stratum comeum causes deeper tissue damage than expected for thermal or photochemical mechanisms, suggesting thatphotoacoustic waves have arole in tissue damage. Laserirradiation (193 nm, 14 ns pulses, 1-2 Hz) attworadiantexposures, 60 and 160 mJ/cm2perpulse was usedto ablate the stratumcomeumofskin. Light and electron microscopy ofimmediate biopsies demonstrated damage to fibroblasts as deep as 88 and 220 jun, respectively, below the ablation site. Ablation throughwaterwas usedtoinertially confine the ablation zone. Partial ablationofs.c. through airproducedno damage, whereas partial ablation through water damaged skin to amean depth of 1 14.5 8.8( Full thickness ablation of s.c. through air and water produced damage zones measuring 192.2 16.2 and 293.0 71.6 rim, respectively (p <0.05). The increased depth ofdamage in the presence ofinertial confinementprovided by the layer of water strongly supports a photoacoustic mechanism ofdamage. The depths ofdamage for thelarge spot, line, and small spots were 43 1 164 urn, 269 96xni, andno damage. The spot size dependence ofthedepthofdamage is consistentwiththe geometric attenuation one would expect to be present from a pressure wave related phenomena. Sequential biopsies were taken over a 7 day period for light and transmission electron microscopy. At 24 hours, there was necrosis of the epidermis and papillary dermis subjacent to the ablation site, with neutrophils surrounding and demarcating the affected area. The necrotic zone sloughedby48 hours. Thereepithelializationwas completeby7 days. The sequenceofrepairis similartoknife wound healing which we have previously studied, and is analogous to other wound healing processes. We have used an experimental model of ArF excimer laser ablation of stratum corneum to investigate laser-induced photoacoustic damage. The evidence for the injury being due to pressure transients is indirectbutcompelling. Whether these pressuretransients are

  17. Laser pointer induced macular damage: case report and mini review.


    Turaka, Kiran; Bryan, J Shepard; Gordon, Alan J; Reddy, Rahul; Kwong, Henry M; Sell, Clive H


    To report laser pointer induced damage to retina and choroid and briefly review literature. A case report of a 13-year old Caucasian boy developed blurry central vision and central scotoma in right eye (OD). He was exposed for one minute to class IIIA green laser pointer of 650 nm wavelength and 5 mW power. Clinical examination showed a grayish lesion in foveal region. Ancillary testing revealed disruption of the retinal pigment epithelial (RPE) layer in foveal region and indocyanine green angiography demonstrated evidence of choroidal hypofluorescence suggestive of choroidal infarction in OD. Visual acuity improved from 20/100 to 20/60 in one day and he was treated with tapering doses of oral prednisolone (40 mg) for 3 weeks. Laser pointer with a power of >5 mW caused damage to RPE in the macula. Children should not be given laser pointers as toys especially those with label of danger instructions. PMID:22466425

  18. Proton-induced direct and indirect damage of plasmid DNA.


    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie


    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  19. Antigenotoxic effect of allicin against methyl methanesulphonate induced genotoxic damage.


    Siddique, Yasir Hasan; Afzal, Mohammad


    Allicin, one of the sulfur compounds especially thiosulphonates of garlic (Allium sativum), possesses antioxidant and thioldisulphide exchange activity and is also shown to cause a variety of actions potentially useful for human health. In this investigation we determined its antigenotoxic potential using chromosomal aberrations (CAs) and sister chromatid exchanges (SCEs) induced by methyl methanesulphonate (MMS) as genotoxic end points both in the presence as well as absence of rat liver microsomal activation system (S9 mix) in cultured human lymphocytes. We tested the effect of 5, 10 and 20 microM of allicin on the damage exerted by 60 microM of MMS. The levels of CAs and SCEs were lowered suggesting an antigenotoxic role of allicin against genotoxic damage both in the presence as well as absence of metabolic activation. PMID:16334295

  20. Trophic Complexity and the Adaptive Value of Damage-Induced Plant Volatiles

    PubMed Central

    Kaplan, Ian


    Indirect plant defenses are those facilitating the action of carnivores in ridding plants of their herbivorous consumers, as opposed to directly poisoning or repelling them. Of the numerous and diverse indirect defensive strategies employed by plants, inducible volatile production has garnered the most fascination among plant-insect ecologists. These volatile chemicals are emitted in response to feeding by herbivorous arthropods and serve to guide predators and parasitic wasps to their prey. Implicit in virtually all discussions of plant volatile-carnivore interactions is the premise that plants “call for help” to bodyguards that serve to boost plant fitness by limiting herbivore damage. This, by necessity, assumes a three-trophic level food chain where carnivores benefit plants, a theoretical framework that is conceptually tractable and convenient, but poorly depicts the complexity of food-web dynamics occurring in real communities. Recent work suggests that hyperparasitoids, top consumers acting from the fourth trophic level, exploit the same plant volatile cues used by third trophic level carnivores. Further, hyperparasitoids shift their foraging preferences, specifically cueing in to the odor profile of a plant being damaged by a parasitized herbivore that contains their host compared with damage from an unparasitized herbivore. If this outcome is broadly representative of plant-insect food webs at large, it suggests that damage-induced volatiles may not always be beneficial to plants with major implications for the evolution of anti-herbivore defense and manipulating plant traits to improve biological control in agricultural crops. PMID:23209381

  1. The Protecting Effect of Deoxyschisandrin and Schisandrin B on HaCaT Cells against UVB-Induced Damage.


    Hou, Wei; Gao, Wei; Wang, Datao; Liu, Qingxiu; Zheng, Siwen; Wang, Yingping


    Schisandra chinensis is a traditional Chinese medicine that has multiple biological activities, including antioxidant, anticancer, tonic, and anti-aging effects. Deoxyschisandrin (SA) and schisandrin B (SB), the two major lignans isolated from S. chinensis, exert high antioxidant activities in vitro and in vivo by scavenging free radicals, such as reactive oxygen species (ROS). Ultraviolet B-ray (UVB) radiation induces the production of ROS and DNA damage, which eventually leads to cell death by apoptosis. However, it is unknown whether SA or SB protects cells against UVB-induced cellular DNA damage. Our study showed that both SA and SB effectively protected HaCaT cells from UVB-induced cell death by antagonizing UVB-mediated production of ROS and induction of DNA damage. Our results showed that both SA and SB significantly prevented UVB-induced loss of cell viability using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assays. Dichloro-dihydro-fluorescein diacetate (DCFH-DA) assays showed that the production of ROS following UVB exposure was inhibited by treatment with SA and SB. Moreover, SA and SB decreased the UVB-induced DNA damage in HaCaT cells by comet assays. In addition, SA and SB also prevented UVB-induced cell apoptosis and the cleavage of caspase-3, caspase-8 and caspase-9. In a word, our results imply that the antioxidants SA and SB could protect cells from UVB-induced cell damage via scavenging ROS. PMID:25978330

  2. Revision of laser-induced damage threshold evaluation from damage probability data

    SciTech Connect

    Bataviciute, Gintare; Grigas, Povilas; Smalakys, Linas; Melninkaitis, Andrius


    In this study, the applicability of commonly used Damage Frequency Method (DFM) is addressed in the context of Laser-Induced Damage Threshold (LIDT) testing with pulsed lasers. A simplified computer model representing the statistical interaction between laser irradiation and randomly distributed damage precursors is applied for Monte Carlo experiments. The reproducibility of LIDT predicted from DFM is examined under both idealized and realistic laser irradiation conditions by performing numerical 1-on-1 tests. A widely accepted linear fitting resulted in systematic errors when estimating LIDT and its error bars. For the same purpose, a Bayesian approach was proposed. A novel concept of parametric regression based on varying kernel and maximum likelihood fitting technique is introduced and studied. Such approach exhibited clear advantages over conventional linear fitting and led to more reproducible LIDT evaluation. Furthermore, LIDT error bars are obtained as a natural outcome of parametric fitting which exhibit realistic values. The proposed technique has been validated on two conventionally polished fused silica samples (355 nm, 5.7 ns).

  3. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.


    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  4. Radiation-induced lung damage: dose-time-fractionation considerations.


    Van Dyk, J; Mah, K; Keane, T J


    The comparison of different dose-time-fractionation schedules requires the use of an isoeffect formula. In recent years, the NSD isoeffect formula has been heavily criticized. In this report, we consider an isoeffect formula which is specifically developed for radiation-induced lung damage. The formula is based on the linear-quadratic model and includes a factor for overall treatment time. The proposed procedures allow for the simultaneous derivation of an alpha/beta ratio and a gamma/beta time factor. From animal data in the literature, the derived alpha/beta and gamma/beta ratios for acute lung damage are 5.0 +/- 1.0 Gy and 2.7 +/- 1.4 Gy2/day respectively, while for late damage the suggested values are 2.0 Gy and 0.0 Gy2/day. Data from two clinical studies, one prospective and the other retrospective, were also analysed and corresponding alpha/beta and gamma/beta ratios were determined. For the prospective clinical study, with a limited range of doses per fraction, the resultant alpha/beta and gamma/beta ratios were 0.9 +/- 2.6 Gy and 2.6 +/- 2.5 Gy2/day. The combination of the retrospective and prospective data yielded alpha/beta and gamma/beta ratios of 3.3 +/- 1.5 Gy and 2.4 +/- 1.5 Gy2/day, respectively. One potential advantage of this isoeffect formalism is that it might possibly be applied to both acute and late lung damage. The results of this formulation for acute lung damage indicate that time-dependent effects such as slow repair or proliferation might be more important in determining isoeffect doses than previously predicted by the estimated single dose (ED) formula. Although we present this as an alternative approach, we would caution against its clinical use until its applicability has been confirmed by additional clinical data. PMID:2928557

  5. Damage-free vibrational spectroscopy of biological materials in the electron microscope

    PubMed Central

    Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L.; Dellby, Niklas; Lovejoy, Tracy C.; Wolf, Sharon G.; Cohen, Hagai


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an ‘aloof' electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies <1 eV can be ‘safely' investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C–H, N–H and C=O vibrational signatures with no observable radiation damage. The technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ∼10 nm, simultaneously combined with imaging in the electron microscope. PMID:26961578

  6. Damage-free vibrational spectroscopy of biological materials in the electron microscope

    NASA Astrophysics Data System (ADS)

    Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L.; Dellby, Niklas; Lovejoy, Tracy C.; Wolf, Sharon G.; Cohen, Hagai


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an `aloof' electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies <1 eV can be `safely' investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C-H, N-H and C=O vibrational signatures with no observable radiation damage. The technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ~10 nm, simultaneously combined with imaging in the electron microscope.

  7. Induction and repair of HZE induced cytogenetic damage

    NASA Technical Reports Server (NTRS)

    Brooks, A. L.; Bao, S.; Rithidech, K.; Chrisler, W. B.; Couch, L. A.; Braby, L. A.


    Wistar rats were exposed to high-mass, high energy (HZE) 56Fe particles (1000 GeV/AMU) using the Alternating Gradient Synchrotron (AGS). The animals were sacrificed at 1-5 hours or after a 30-day recovery period. The frequency of micronuclei in the tracheal and the deep lung epithelial cells were evaluated. The relative effectiveness of 56Fe, for the induction of initial chromosome damage in the form of micronuclei, was compared to damage produced in the same biological system exposed to other types of high and low-LET radiation. It was demonstrated that for animals sacrificed at short times after exposure, the tracheal and lung epithelial cells, the 56Fe particles were 3.3 and 1.3 times as effective as 60Co in production of micronuclei, respectively. The effectiveness was also compared to that for exposure to inhaled radon. With this comparison, the 56Fe exposure of the tracheal epithelial cells and the lung epithelial cells were only 0.18 and 0.20 times as effective as radon in the production of the initial cytogenetic damage. It was suggested that the low relative effectiveness was related to potential for 'wasted energy' from the core of the 56Fe particles. When the animals were sacrificed after 30 days, the slopes of the dose-response relationships, which reflect the remaining level of damage, decreased by a factor of 10 for both the tracheal and lung epithelial cells. In both cases, the slope of the dose-response lines were no longer significantly different from zero, and the r2 values were very high. Lung epithelial cells, isolated from the animals sacrificed hours after exposure, were maintained in culture, and the micronuclei frequency evaluated after 4 and 6 subcultures. These cells were harvested at 24 and 36 days after the exposure. There was no dose-response detected in these cultures and no signs of genomic instability at either sample time.

  8. Oxidative damage and neurodegeneration in manganese-induced neurotoxicity

    SciTech Connect

    Milatovic, Dejan; Yu, Yingchun


    Exposure to excessive manganese (Mn) levels results in neurotoxicity to the extrapyramidal system and the development of Parkinson's disease (PD)-like movement disorder, referred to as manganism. Although the mechanisms by which Mn induces neuronal damage are not well defined, its neurotoxicity appears to be regulated by a number of factors, including oxidative injury, mitochondrial dysfunction and neuroinflammation. To investigate the mechanisms underlying Mn neurotoxicity, we studied the effects of Mn on reactive oxygen species (ROS) formation, changes in high-energy phosphates (HEP), neuroinflammation mediators and associated neuronal dysfunctions both in vitro and in vivo. Primary cortical neuronal cultures showed concentration-dependent alterations in biomarkers of oxidative damage, F{sub 2}-isoprostanes (F{sub 2}-IsoPs) and mitochondrial dysfunction (ATP), as early as 2 h following Mn exposure. Treatment of neurons with 500 {mu}M Mn also resulted in time-dependent increases in the levels of the inflammatory biomarker, prostaglandin E{sub 2} (PGE{sub 2}). In vivo analyses corroborated these findings, establishing that either a single or three (100 mg/kg, s.c.) Mn injections (days 1, 4 and 7) induced significant increases in F{sub 2}-IsoPs and PGE{sub 2} in adult mouse brain 24 h following the last injection. Quantitative morphometric analyses of Golgi-impregnated striatal sections from mice exposed to single or three Mn injections revealed progressive spine degeneration and dendritic damage of medium spiny neurons (MSNs). These findings suggest that oxidative stress, mitochondrial dysfunction and neuroinflammation are underlying mechanisms in Mn-induced neurodegeneration.

  9. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.


    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D


    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  10. Ion beam induced fluorescence imaging in biological systems

    NASA Astrophysics Data System (ADS)

    Bettiol, Andrew A.; Mi, Zhaohong; Vanga, Sudheer Kumar; Chen, Ce-belle; Tao, Ye; Watt, Frank


    Imaging fluorescence generated by MeV ions in biological systems such as cells and tissue sections requires a high resolution beam (<100 nm), a sensitive detection system and a fluorescent probe that has a high quantum efficiency and low bleaching rate. For cutting edge applications in bioimaging, the fluorescence imaging technique needs to break the optical diffraction limit allowing for sub-cellular structure to be visualized, leading to a better understanding of cellular function. In a nuclear microprobe this resolution requirement can be readily achieved utilizing low beam current techniques such as Scanning Transmission Ion Microscopy (STIM). In recent times, we have been able to extend this capability to fluorescence imaging through the development of a new high efficiency fluorescence detection system, and through the use of new novel fluorescent probes that are resistant to ion beam damage (bleaching). In this paper we demonstrate ion beam induced fluorescence imaging in several biological samples, highlighting the advantages and challenges associated with using this technique.

  11. Proton induced radiation damage in fast crystal scintillators

    NASA Astrophysics Data System (ADS)

    Yang, Fan; Zhang, Liyuan; Zhu, Ren-Yuan; Kapustinsky, Jon; Nelson, Ron; Wang, Zhehui


    This paper reports proton induced radiation damage in fast crystal scintillators. A 20 cm long LYSO crystal, a 15 cm long CeF3 crystal and four liquid scintillator based sealed quartz capillaries were irradiated by 800 MeV protons at Los Alamos up to 3.3 ×1014 p /cm2. Four 1.5 mm thick LYSO plates were irradiated by 24 GeV protons at CERN up to 6.9 ×1015 p /cm2. The results show an excellent radiation hardness of LYSO crystals against charged hadrons.

  12. Alleviation of cytotoxic therapy-induced normal tissue damage.


    Loprinzi, C L; Foote, R L; Michalak, J


    Cytotoxic chemotherapy and radiation therapy damage normal body tissues, resulting in stomatitis, conjunctivitis, esophagitis, proctitis, and dermatitis. Pursuant to this, the North Central Cancer Treatment Group has developed a series of clinical trials designed to study antidotes for these pathologic processes. These trials have demonstrated clinically helpful therapies (eg, oral cryotherapy for decreasing mucositis induced by 5-fluorouracil) and also have demonstrated lack of benefit for other proposed treatments. Results from several ongoing clinical trials should become available in the near future. PMID:7740323

  13. Protective Effect of Acacia nilotica (L.) against Acetaminophen-Induced Hepatocellular Damage in Wistar Rats

    PubMed Central

    Kannan, Narayanan; Sakthivel, Kunnathur Murugesan; Guruvayoorappan, Chandrasekaran


    The potential biological functions of A. nilotica have long been described in traditional system of medicine. However, the protective effect of A. nilotica on acetaminophen-induced hepatotoxicity is still unknown. The present study attempted to investigate the protective effect of A. nilotica against acetaminophen-induced hepatic damage in Wistar rats. The biochemical liver functional tests Alanine transaminase (ALT), Aspartate transaminase (AST), Alkaline phosphatase (ALP), total bilirubin, total protein, oxidative stress test (Lipid peroxidation), antioxidant parameter glutathione (GSH), and histopathological changes were examined. Our results show that the pretreatment with A. nilotica (250 mg/kg·bw) orally revealed attenuation of serum activities of ALT, AST, ALP, liver weight, and total bilirubin levels that were enhanced by administration of acetaminophen. Further, pretreatment with extract elevated the total protein and GSH level and decreased the level of LPO. Histopathological analysis confirmed the alleviation of liver damage and reduced lesions caused by acetaminophen. The present study undoubtedly provides a proof that hepatoprotective action of A. nilotica extract may rely on its effect on reducing the oxidative stress in acetaminophen-induced hepatic damage in rat model. PMID:23864853

  14. Cellular track model of biological damage to mammalian cell cultures from galactic cosmic rays

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Katz, Robert; Wilson, John W.; Townsend, Lawrence W.; Nealy, John E.; Shinn, Judy L.


    The assessment of biological damage from the galactic cosmic rays (GCR) is a current interest for exploratory class space missions where the highly ionizing, high-energy, high-charge ions (HZE) particles are the major concern. The relative biological effectiveness (RBE) values determined by ground-based experiments with HZE particles are well described by a parametric track theory of cell inactivation. Using the track model and a deterministic GCR transport code, the biological damage to mammalian cell cultures is considered for 1 year in free space at solar minimum for typical spacecraft shielding. Included are the effects of projectile and target fragmentation. The RBE values for the GCR spectrum which are fluence-dependent in the track model are found to be more severe than the quality factors identified by the International Commission on Radiological Protection publication 26 and seem to obey a simple scaling law with the duration period in free space.

  15. Biological effects of pyrroloquinoline quinone on liver damage in Bmi-1 knockout mice

    PubMed Central



    Pyrroloquinoline quinone (PQQ) has been demonstrated to function as an antioxidant by scavenging free radicals and subsequently protecting the mitochondria from oxidative stress-induced damage. The aim of the present study was to investigate whether PQQ is able to rescue premature senescence in the liver, induced by the deletion of B cell-specific Moloney MLV insertion site-1 (Bmi-1), by inhibiting oxidative stress. In vivo, the mice were allocated into three groups that underwent the following treatment protocols. WT mice received a normal diet, while BKO mice also received a normal diet. An additional group of BKO mice were fed a PQQ-supplemented diet (BKO + PQQ; 4 mg PQQ/kg in the normal diet). The results indicated that PQQ partially rescued the liver damage induced by the deletion of Bmi-1. PQQ was demonstrated to exhibit these therapeutic effects on liver damage through multiple aspects, including the promotion of proliferation, antiapoptotic effects, the inhibition of senescence, the upregulation of antioxidant ability, the downregulation of cell cycle protein expression, the scavenging of reactive oxygen species and the reduction of DNA damage. The results of these experiments indicated that treatment of BKO mice with a moderate dose of PQQ significantly protected the liver from deleterious effects by inhibiting oxidative stress and participating in DNA damage repair. Therefore, PQQ has great potential as a therapeutic agent against oxidative stress during liver damage. PMID:26622336

  16. Bee Products Prevent Agrichemical-Induced Oxidative Damage in Fish

    PubMed Central

    Ferreira, Daiane; Rocha, Helio Carlos; Kreutz, Luiz Carlos; Loro, Vania Lucia; Marqueze, Alessandra; Koakoski, Gessi; Santos da Rosa, João Gabriel; Gusso, Darlan; Oliveira, Thiago Acosta; de Abreu, Murilo Sander; Barcellos, Leonardo José Gil


    In southern South America and other parts of the world, aquaculture is an activity that complements agriculture. Small amounts of agrichemicals can reach aquaculture ponds, which results in numerous problems caused by oxidative stress in non-target organisms. Substances that can prevent or reverse agrichemical-induced oxidative damage may be used to combat these effects. This study includes four experiments. In each experiment, 96 mixed-sex, 6-month-old Rhamdia quelen (118±15 g) were distributed into eight experimental groups: a control group that was not exposed to contaminated water, three groups that were exposed to various concentrations of bee products, three groups that were exposed to various concentrations of bee products plus tebuconazole (TEB; Folicur 200 CE™) and a group that was exposed to 0.88 mg L−1 of TEB alone (corresponding to 16.6% of the 96-h LC50). We show that waterborne bee products, including royal jelly (RJ), honey (H), bee pollen (BP) and propolis (P), reversed the oxidative damage caused by exposure to TEB. These effects were likely caused by the high polyphenol contents of these bee-derived compounds. The most likely mechanism of action for the protective effects of bee products against tissue oxidation and the resultant damage is that the enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST) are increased. PMID:24098336

  17. Dietary Nickel Chloride Induces Oxidative Intestinal Damage in Broilers

    PubMed Central

    Wu, Bangyuan; Cui, Hengmin; Peng, Xi; Fang, Jing; Zuo, Zhicai; Deng, Junliang; Huang, Jianying


    The purpose of this study was to investigate the oxidative damage induced by dietary nickel chloride (NiCl2) in the intestinal mucosa of different parts of the intestine of broilers, including duodenum, jejunum and ileum. A total of 240 one-day-old broilers were divided into four groups and fed on a corn-soybean basal diet as control diet or the same basal diet supplemented with 300, 600 or 900 mg/kg NiCl2 during a 42-day experimental period. The results showed that the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px), and the ability to inhibit hydroxy radical and glutathione (GSH) content were significantly (p < 0.05 or p < 0.01) decreased in the 300, 600 and 900 mg/kg groups in comparison with those of the control group. In contrast, malondialdehyde (MDA) content was significantly (p < 0.05 or p < 0.01) higher in the 300, 600 and 900 mg/kg groups than that in the control group. It was concluded that dietary NiCl2 in excess of 300 mg/kg could cause oxidative damage in the intestinal mucosa in broilers, which finally impaired the intestinal functions including absorptive function and mucosal immune function. The oxidative damage might be a main mechanism on the effects of NiCl2 on the intestinal health of broilers. PMID:23702803

  18. Thermally Induced Osteocyte Damage Initiates a Remodelling Signaling Cascade

    PubMed Central

    Dolan, Eimear B.; McNamara, Laoise M.


    Thermal elevations experienced by bone during orthopaedic procedures, such as cutting and drilling, exothermal reactions from bone cement, and thermal therapies such as tumor ablation, can result in thermal damage leading to death of native bone cells (osteocytes, osteoblasts, osteoclasts and mesenchymal stem cells). Osteocytes are believed to be the orchestrators of bone remodeling, which recruit nearby osteoclast and osteoblasts to control resorption and bone growth in response to mechanical stimuli and physical damage. However, whether heat-induced osteocyte damage can directly elicit bone remodelling has yet to be determined. This study establishes the link between osteocyte thermal damage and the remodeling cascade. We show that osteocytes directly exposed to thermal elevations (47°C for 1 minute) become significantly apoptotic and alter the expression of osteogenic genes (Opg and Cox2). The Rankl/Opg ratio is consistently down-regulated, at days 1, 3 and 7 in MLO-Y4s heat-treated to 47°C for 1 minute. Additionally, the pro-osteoblastogenic signaling marker Cox2 is significantly up-regulated in heat-treated MLO-Y4s by day 7. Furthermore, secreted factors from heat-treated MLO-Y4s administered to MSCs using a novel co-culture system are shown to activate pre-osteoblastic MSCs to increase production of the pro-osteoblastic differentiation marker, alkaline phosphatase (day 7, 14), and calcium deposition (day 21). Most interestingly, an initial pro-osteoclastogenic signaling response (increase Rankl and Rankl/Opg ratio at day 1) followed by later stage pro-osteoblastogenic signaling (down-regulation in Rankl and the Rankl/Opg ratio and an up-regulation in Opg and Cox2 by day 7) was observed in non-heat-treated MLO-Y4s in co-culture when these were exposed to the biochemicals produced by heat-treated MLO-Y4s. Taken together, these results elucidate the vital role of osteocytes in detecting and responding to thermal damage by means of thermally induced apoptosis

  19. Thermally induced osteocyte damage initiates a remodelling signaling cascade.


    Dolan, Eimear B; Haugh, Matthew G; Voisin, Muriel C; Tallon, David; McNamara, Laoise M


    Thermal elevations experienced by bone during orthopaedic procedures, such as cutting and drilling, exothermal reactions from bone cement, and thermal therapies such as tumor ablation, can result in thermal damage leading to death of native bone cells (osteocytes, osteoblasts, osteoclasts and mesenchymal stem cells). Osteocytes are believed to be the orchestrators of bone remodeling, which recruit nearby osteoclast and osteoblasts to control resorption and bone growth in response to mechanical stimuli and physical damage. However, whether heat-induced osteocyte damage can directly elicit bone remodelling has yet to be determined. This study establishes the link between osteocyte thermal damage and the remodeling cascade. We show that osteocytes directly exposed to thermal elevations (47°C for 1 minute) become significantly apoptotic and alter the expression of osteogenic genes (Opg and Cox2). The Rankl/Opg ratio is consistently down-regulated, at days 1, 3 and 7 in MLO-Y4s heat-treated to 47°C for 1 minute. Additionally, the pro-osteoblastogenic signaling marker Cox2 is significantly up-regulated in heat-treated MLO-Y4s by day 7. Furthermore, secreted factors from heat-treated MLO-Y4s administered to MSCs using a novel co-culture system are shown to activate pre-osteoblastic MSCs to increase production of the pro-osteoblastic differentiation marker, alkaline phosphatase (day 7, 14), and calcium deposition (day 21). Most interestingly, an initial pro-osteoclastogenic signaling response (increase Rankl and Rankl/Opg ratio at day 1) followed by later stage pro-osteoblastogenic signaling (down-regulation in Rankl and the Rankl/Opg ratio and an up-regulation in Opg and Cox2 by day 7) was observed in non-heat-treated MLO-Y4s in co-culture when these were exposed to the biochemicals produced by heat-treated MLO-Y4s. Taken together, these results elucidate the vital role of osteocytes in detecting and responding to thermal damage by means of thermally induced apoptosis

  20. Anchor-induced chondral damage in the hip

    PubMed Central

    Matsuda, Dean K.; Bharam, Srino; White, Brian J.; Matsuda, Nicole A.; Safran, Marc


    The purpose of this study is to investigate the outcomes from anchor-induced chondral damage of the hip, both with and without frank chondral penetration. A multicenter retrospective case series was performed of patients with chondral deformation or penetration during initial hip arthroscopic surgery. Intra-operative findings, post-surgical clinical courses, hip outcome scores and descriptions of arthroscopic treatment in cases requiring revision surgery and anchor removal are reported. Five patients (three females) of mean age 32 years (range, 16–41 years) had documented anchor-induced chondral damage with mean 3.5 years (range, 1.5–6.0 years) follow-up. The 1 o'clock position (four cases) and anterior and mid-anterior portals (two cases each) were most commonly implicated. Two cases of anchor-induced acetabular chondral deformation without frank penetration had successful clinical and radiographic outcomes, while one case progressed from deformation to chondral penetration with clinical worsening. Of the cases that underwent revision hip arthroscopy, all three had confirmed exposed hard anchors which were removed. Two patients have had clinical improvement and one patient underwent early total hip arthroplasty. Anchor-induced chondral deformation without frank chondral penetration may be treated with close clinical and radiographic monitoring with a low threshold for revision surgery and anchor removal. Chondral penetration should be treated with immediate removal of offending hard anchor implants. Preventative measures include distal-based portals, small diameter and short anchors, removable hard anchors, soft suture-based anchors, curved drill and anchor insertion instrumentation and attention to safe trajectories while visualizing the acetabular articular surface. PMID:27011815

  1. Anchor-induced chondral damage in the hip.


    Matsuda, Dean K; Bharam, Srino; White, Brian J; Matsuda, Nicole A; Safran, Marc


    The purpose of this study is to investigate the outcomes from anchor-induced chondral damage of the hip, both with and without frank chondral penetration. A multicenter retrospective case series was performed of patients with chondral deformation or penetration during initial hip arthroscopic surgery. Intra-operative findings, post-surgical clinical courses, hip outcome scores and descriptions of arthroscopic treatment in cases requiring revision surgery and anchor removal are reported. Five patients (three females) of mean age 32 years (range, 16-41 years) had documented anchor-induced chondral damage with mean 3.5 years (range, 1.5-6.0 years) follow-up. The 1 o'clock position (four cases) and anterior and mid-anterior portals (two cases each) were most commonly implicated. Two cases of anchor-induced acetabular chondral deformation without frank penetration had successful clinical and radiographic outcomes, while one case progressed from deformation to chondral penetration with clinical worsening. Of the cases that underwent revision hip arthroscopy, all three had confirmed exposed hard anchors which were removed. Two patients have had clinical improvement and one patient underwent early total hip arthroplasty. Anchor-induced chondral deformation without frank chondral penetration may be treated with close clinical and radiographic monitoring with a low threshold for revision surgery and anchor removal. Chondral penetration should be treated with immediate removal of offending hard anchor implants. Preventative measures include distal-based portals, small diameter and short anchors, removable hard anchors, soft suture-based anchors, curved drill and anchor insertion instrumentation and attention to safe trajectories while visualizing the acetabular articular surface. PMID:27011815

  2. Tumor necrosis factor induces glomerular damage in the rabbit.

    PubMed Central

    Bertani, T.; Abbate, M.; Zoja, C.; Corna, D.; Perico, N.; Ghezzi, P.; Remuzzi, G.


    Tumor necrosis factor (TNF) is a polypeptide hormone produced by activated macrophages detectable in the circulation of experimental animals given endotoxin. Recent evidence strongly suggests that many of the deleterious effects of endotoxin in experimental animals are mediated by TNF. Because endotoxemia in experimental animals and humans is associated with glomerular damage the present investigation was designed to establish whether TNF directly induces glomerular functional and structural changes. Twenty-three rabbits were given human recombinant TNF at the doses of 0.08, 0.8, and 8.0 micrograms/kg/h as a continuous 5-hour intravenous infusion. Animals were killed at the end of the infusion. All rabbits given 0.8 and 8.0 micrograms/kg/h TNF developed anemia (Ht value decrease at 5 hours: 0.8 microgram/kg/h, 15%; 8.0 micrograms/kg/h, 16%); leukopenia (leukocyte count decrease at 5 hours: 0.8 micrograms/kg/h, 47%; 8.0 micrograms/kg/h, 59%); thrombocytopenia (platelet count decrease at 5 hours; 0.8 micrograms/kg/h, 45%; 8.0 micrograms/kg/h, 57%). Rabbits given 8.0 micrograms/kg/h also had renal failure (serum creatinine from 1.02 +/- 0.15 to 1.64 +/- 0.34 mg/dl). By light microscopy only occasional polymorphonuclear leukocytes in the glomerular capillaries were detectable in rabbits infused with 0.08 micrograms/kg/h TNF, whereas with 0.8 micrograms/kg/h TNF the presence of inflammatory cells in the glomerular capillaries was the prominent finding. With 8.0 micrograms/kg/h TNF beside leukocyte accumulation, fibrin was detected in the glomerular capillary lumens of two of eight animals. Electron microscopy found dose-dependent glomerular endothelial cell damage in animals given TNF with fibrinlike material in the capillary lumens. Glomerular changes induced by TNF were remarkably similar to those previously found in animals given endotoxin. Thus, TNF is likely to be the mediator of endotoxin-induced glomerular damage and can be regarded as a new mediator of

  3. Laser induced damage in optical materials: tenth ASTM symposium.


    Glass, A J; Guenther, A H


    The tenth annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 12-14 September 1978. The symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy, and the Office of Naval Research. About 175 scientists attended, including representatives of the United Kingdom, France, Canada, Japan, West Germany, and the Soviet Union. The symposium was divided into sessions concerning the measurement of absorption characteristics, bulk material properties, mirrors and surfaces, thin film damage, coating materials and design, and breakdown phenomena. As in previous years, the emphasis of the papers presented was directed toward new frontiers and new developments. Particular emphasis was given to materials for use from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was also discussed. In commemoration of the tenth symposium in this series, a number of comprehensive review papers were presented to assess the state of the art in various facets of laser induced damage in optical materials. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons. The eleventh annual symposium is scheduled for 30-31 October 1979 at the National Bureau of Standards, Boulder, Colorado. PMID:20212622

  4. Investigation of possible fs-LASIK induced retinal damage

    NASA Astrophysics Data System (ADS)

    Schumacher, S.; Sander, M.; Stolte, A.; Doepke, C.; Baumgaertner, W.; Lubatschowski, H.


    Rapid development of new laser technologies enabled the application of ultra short lasers in refractive surgery. Focused ultra short laser pulses in near-infrared spectral range can generate a laser induced breakdown (LIB) in the cornea, which will disrupt the tissue. Cutting depth and position can be established by varying the laser focus. The fs-LASIK technique allows both flap and lenticule to be formed by using fs-pulses without the presence of any mechanical impact. During the cutting process not all of the pulse energy is deposited into the cornea; approximately half of the remaining energy propagates through the eye and reaches the retina. Though defocused, the transmitted energy can still induce damage to the retina due to absorption by the retinal pigment epithelium and the transfer of thermal energy to surrounding tissue. The fs-LASIK process was simulated with two laser systems; one continous-wave and one in the fs-regime. For the simulation the exposure time and focusing numerical aperature which defines the retinal spot size were varied. The Damage thresholds of the laser beam exposed eyes were determined in terms of ophthalmoscopic and histopathologic observations.

  5. Ligustrazine effect on lipopolysaccharide-induced pulmonary damage in rats.


    Wang, Huiqi; Chen, Yuanzhuo; Li, Wenjie; Li, Congye; Zhang, Xiangyu; Peng, Hu; Gao, Chengjin


    We investigated the effectiveness of ligustrazine (tetramethylpyrazine, TMP) in alleviating pulmonary damage induced by lipopolysaccharide (LPS). Twenty-four healthy male Sprague-Dawley rats were randomly divided into three groups: the blank group, LPS group, and TMP treatment group (TMP group). The LPS group was intraperitoneally injected with LPS (20mg/kg), and the TMP group was intraperitoneally injected with LPS (20mg/kg) and ligustrazine (80mg/kg). Blood gas analysis, hematoxylin-eosin staining dye extravasation and diffuse alveolar damage (DAD) score, the wet/dry lung tissue (W/D) ratios, the expression of CD31+ vascular endothelial microparticles (EMPs), tumor necrosis factor alpha (TNF-α) levels, and the protein expression of Rho-associated coiled-coil-forming protein kinase (ROCK) II and Toll-like receptor 4 (TLR4) were analyzed. Compared with the blank group, the arterial partial pressure of oxygen (PaO2) declined in both 1 and 4h (P<0.01), the W/D ratio and DAD score increased (P<0.01), and the TNF-α levels in serum, CD31+ EMPs, and protein expression of ROCK II and TLR4 were significantly increased (P<0.01) in the LPS group. Compared with the LPS group, PaO2 significantly increased in the TMP group at 4h (P<0.05), while the W/D ratio and DAD score were significantly decreased in the TMP group (P<0.01). TNF-α levels, CD31+ EMPs, and protein expression of ROCK II and TLR4 were significantly decreased in the TMP group compared with the LPS group (P<0.01). This study demonstrated that TMP can alleviate LPS-induced pulmonary damage by attenuating pulmonary vascular permeability and CD31+ EMP levels in the plasma, reducing the release of the inflammatory mediator TNF-α and inhibiting the protein expression of ROCK II and TLR4. PMID:26088147

  6. Immunosuppressive treatment protects against angiotensin II-induced renal damage.


    Muller, Dominik N; Shagdarsuren, Erdenechimeg; Park, Joon-Keun; Dechend, Ralf; Mervaala, Eero; Hampich, Franziska; Fiebeler, Anette; Ju, Xinsheng; Finckenberg, Piet; Theuer, Jürgen; Viedt, Christiane; Kreuzer, Joerg; Heidecke, Harald; Haller, Hermann; Zenke, Martin; Luft, Friedrich C


    Angiotensin (Ang) II promotes renal infiltration by immunocompetent cells in double-transgenic rats (dTGRs) harboring both human renin and angiotensinogen genes. To elucidate disease mechanisms, we investigated whether or not dexamethasone (DEXA) immunosuppression ameliorates renal damage. Untreated dTGRs developed hypertension, renal damage, and 50% mortality at 7 weeks. DEXA reduced albuminuria, renal fibrosis, vascular reactive oxygen stress, and prevented mortality, independent of blood pressure. In dTGR kidneys, p22phox immunostaining co-localized with macrophages and partially with T cells. dTGR dendritic cells expressed major histocompatibility complex II and CD86, indicating maturation. DEXA suppressed major histocompatibility complex II+, CD86+, dendritic, and T-cell infiltration. In additional experiments, we treated dTGRs with mycophenolate mofetil to inhibit T- and B-cell proliferation. Reno-protective actions of mycophenolate mofetil and its effect on dendritic and T cells were similar to those obtained with DEXA. We next investigated whether or not Ang II directly promotes dendritic cell maturation in vitro. Ang II did not alter CD80, CD83, and MHC II expression, but increased CCR7 expression and cell migration. To explore the role of tumor necrosis factor (TNF)-alpha on dendritic cell maturation in vivo, we treated dTGRs with the soluble TNF-alpha receptor etanercept. This treatment had no effect on blood pressure, but decreased albuminuria, nuclear factor-kappaB activation, and infiltration of all immunocompetent cells. These data suggest that immunosuppression prevents dendritic cell maturation and T-cell infiltration in a nonimmune model of Ang II-induced renal damage. Ang II induces dendritic migration directly, whereas in vivo TNF-alpha is involved in dendritic cell infiltration and maturation. Thus, Ang II may initiate events leading to innate and acquired immune response. PMID:12414515

  7. Immunosuppressive Treatment Protects Against Angiotensin II-Induced Renal Damage

    PubMed Central

    Muller, Dominik N.; Shagdarsuren, Erdenechimeg; Park, Joon-Keun; Dechend, Ralf; Mervaala, Eero; Hampich, Franziska; Fiebeler, Anette; Ju, Xinsheng; Finckenberg, Piet; Theuer, Jürgen; Viedt, Christiane; Kreuzer, Joerg; Heidecke, Harald; Haller, Hermann; Zenke, Martin; Luft, Friedrich C.


    Angiotensin (Ang) II promotes renal infiltration by immunocompetent cells in double-transgenic rats (dTGRs) harboring both human renin and angiotensinogen genes. To elucidate disease mechanisms, we investigated whether or not dexamethasone (DEXA) immunosuppression ameliorates renal damage. Untreated dTGRs developed hypertension, renal damage, and 50% mortality at 7 weeks. DEXA reduced albuminuria, renal fibrosis, vascular reactive oxygen stress, and prevented mortality, independent of blood pressure. In dTGR kidneys, p22phox immunostaining co-localized with macrophages and partially with T cells. dTGR dendritic cells expressed major histocompatibility complex II and CD86, indicating maturation. DEXA suppressed major histocompatibility complex II+, CD86+, dendritic, and T-cell infiltration. In additional experiments, we treated dTGRs with mycophenolate mofetil to inhibit T- and B-cell proliferation. Reno-protective actions of mycophenolate mofetil and its effect on dendritic and T cells were similar to those obtained with DEXA. We next investigated whether or not Ang II directly promotes dendritic cell maturation in vitro. Ang II did not alter CD80, CD83, and MHC II expression, but increased CCR7 expression and cell migration. To explore the role of tumor necrosis factor (TNF)-α on dendritic cell maturation in vivo, we treated dTGRs with the soluble TNF-α receptor etanercept. This treatment had no effect on blood pressure, but decreased albuminuria, nuclear factor-κB activation, and infiltration of all immunocompetent cells. These data suggest that immunosuppression prevents dendritic cell maturation and T-cell infiltration in a nonimmune model of Ang II-induced renal damage. Ang II induces dendritic migration directly, whereas in vivo TNF-α is involved in dendritic cell infiltration and maturation. Thus, Ang II may initiate events leading to innate and acquired immune response. PMID:12414515

  8. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.


    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke


    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  9. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.


    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  10. Relative biological damage and electron fluence in and out of a 6 MV photon field

    NASA Astrophysics Data System (ADS)

    Syme, A.; Kirkby, C.; Mirzayans, R.; Mac Kenzie, M.; Field, C.; Fallone, B. G.


    Scattered radiation in the penumbra of a megavoltage radiation therapy beam can deposit a non-negligible dose in the healthy tissue around a target volume. The lower energy of the radiation in this region suggests that its biological effectiveness might not be the same as that of the open beam. In this work, we determined the relative biological damage in normal human fibroblasts after megavoltage irradiation in two geometries. The first was an open-beam irradiation and the second was a blocked configuration in which only scattered radiation could reach the target cells. The biological damage was evaluated by the γ-H2AX immunofluorescence assay, which is capable of detecting DNA double-strand breaks in individual cells. We report that the scattered radiation is more effective at producing biological damage than the open beam radiation. We found a 27% enhancement in the net mean nuclear γ-H2AX fluorescence intensity at 2 Gy and a 48% enhancement at 4 Gy. These findings are of interest due to the increased doses of penumbral radiation close to target volumes both in dose escalation studies and in IMRT treatment deliveries where high dose gradients exist for the purpose of conformal avoidance of healthy tissues.

  11. TRPM2 channels mediate acetaminophen-induced liver damage.


    Kheradpezhouh, Ehsan; Ma, Linlin; Morphett, Arthur; Barritt, Greg J; Rychkov, Grigori Y


    Acetaminophen (paracetamol) is the most frequently used analgesic and antipyretic drug available over the counter. At the same time, acetaminophen overdose is the most common cause of acute liver failure and the leading cause of chronic liver damage requiring liver transplantation in developed countries. Acetaminophen overdose causes a multitude of interrelated biochemical reactions in hepatocytes including the formation of reactive oxygen species, deregulation of Ca(2+) homeostasis, covalent modification and oxidation of proteins, lipid peroxidation, and DNA fragmentation. Although an increase in intracellular Ca(2+) concentration in hepatocytes is a known consequence of acetaminophen overdose, its importance in acetaminophen-induced liver toxicity is not well understood, primarily due to lack of knowledge about the source of the Ca(2+) rise. Here we report that the channel responsible for Ca(2+) entry in hepatocytes in acetaminophen overdose is the Transient Receptor Potential Melanostatine 2 (TRPM2) cation channel. We show by whole-cell patch clamping that treatment of hepatocytes with acetaminophen results in activation of a cation current similar to that activated by H2O2 or the intracellular application of ADP ribose. siRNA-mediated knockdown of TRPM2 in hepatocytes inhibits activation of the current by either acetaminophen or H2O2. In TRPM2 knockout mice, acetaminophen-induced liver damage, assessed by the blood concentration of liver enzymes and liver histology, is significantly diminished compared with wild-type mice. The presented data strongly suggest that TRPM2 channels are essential in the mechanism of acetaminophen-induced hepatocellular death. PMID:24569808

  12. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central


    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  13. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes

    PubMed Central


    Background Clarifying the physicochemical properties of nanomaterials is crucial for hazard assessment and the safe application of these substances. With this in mind, we analyzed the relationship between particle size and the in vitro effect of amorphous nanosilica (nSP). Specifically, we evaluated the relationship between particle size of nSP and the in vitro biological effects using human keratinocyte cells (HaCaT). Results Our results indicate that exposure to nSP of 70 nm diameter (nSP70) induced an elevated level of reactive oxygen species (ROS), leading to DNA damage. A markedly reduced response was observed using submicron-sized silica particles of 300 and 1000 nm diameter. In addition, cytochalasin D-treatment reduced nSP70-mediated ROS generation and DNA damage, suggesting that endocytosis is involved in nSP70-mediated cellular effects. Conclusions Thus, particle size affects amorphous silica-induced ROS generation and DNA damage of HaCaT cells. We believe clarification of the endocytosis pathway of nSP will provide useful information for hazard assessment as well as the design of safer forms of nSPs. PMID:21235812

  14. Effects of Lipoic Acid on Acrylamide Induced Testicular Damage

    PubMed Central

    Lebda, Mohamed; Gad, Shereen; Gaafar, Hossam


    Introduction: Acrylamide is very toxic to various organs and associated with significant increase of oxidative stress and depletion of antioxidants. Alpha-lipoic acid enhances cellular antioxidant defense capacity, thereby protecting cells from oxidative stress. Aim of the study: This study aimed to evaluate the protective role of alpha-lipoic acid on the oxidative damage induced by acrylamide in testicular and epididymal tissues. Material and methods: Forty adult male rats were divided into four groups (10 rats each). Control group; acrylamide treated group administered acrylamide 0.05% (w/v) in drinking water for 21 days; alpha-lipoic acid group received basal diet supplemented with 1% alpha-lipoic acid and forth group was exposed to acrylamide and treated with alpha-lipoic acid at the same doses and treatment regimen mentioned before. Results: The administration of acrylamide resulted in significant elevation in testicular and epididymal malondialdehyde level (MDA) and significant reduction in the level of reduced glutathione (GSH) and the activities of glutathione-S-transferase (GST), glutathione peroxidase (GPX) and glutathione reductase (GR). Also, acrylamide significantly reduced serum total testosterone and progesterone but increased estradiol (E2) levels. Treatment with alpha-lipoic acid prior to acrylamide induced protective effects and attenuated these biochemical changes. Conclusion: Alpha-lipoic acid has been shown to possess antioxidant properties offering promising efficacy against oxidative stress induced by acrylamide administration. PMID:25126019

  15. Do hyperbaric oxygen-induced seizures cause brain damage?


    Domachevsky, Liran; Pick, Chaim G; Arieli, Yehuda; Krinsky, Nitzan; Abramovich, Amir; Eynan, Mirit


    It is commonly accepted that hyperbaric oxygen-induced seizures, the most severe manifestation of central nervous system oxygen toxicity, are harmless. However, this hypothesis has not been investigated in depth. We used apoptotic markers to determine whether cells in the cortex and hippocampus were damaged by hyperbaric oxygen-induced seizures in mice. Experimental animals were exposed to a pressure of 6 atmospheres absolute breathing oxygen, and were randomly assigned to two groups sacrificed 1h after the appearance of seizures or 7 days later. Control groups were not exposed to hyperbaric oxygen. Caspase 9, caspase 3, and cytochrome c were used as apoptotic markers. These were measured in the cortex and the hippocampus, and compared between the groups. Levels of caspase 3, cytochrome c, and caspase 9 in the hippocampus were significantly higher in the hyperbaric oxygenexposed groups compared with the control groups 1 week after seizures (p<0.01). The levels of two fragments of caspase 9 in the cortex were higher in the control group compared with the hyperbaric oxygen-exposed group 1h after seizures (p<0.01). Hyperbaric oxygen-induced seizures activate apoptosis in the mouse hippocampus. The reason for the changes in the cortex is not understood. Further investigation is necessary to elucidate the mechanism underlying these findings and their significance. PMID:22293507

  16. Ebselen attenuates cadmium-induced testicular damage in mice.


    Ardais, Ana P; Santos, Francielli W; Nogueira, Cristina W


    This study was designed to examine if ebselen, an organoselenium compound with antioxidant and glutathione peroxidase-mimetic properties, attenuates testicular injury caused by intraperitoneal administration of CdCl(2). A number of toxicological parameters were evaluated in the testes of mice, such as delta-aminolevulinic acid dehydratase (delta-ALA-D) activity, lipid peroxidation, ascorbic acid levels and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities. Ebselen attenuated lipid peroxidation levels altered by CdCl(2). delta-ALA-D activity inhibited by the highest dose of CdCl(2) was attenuated by ebselen. A significant negative correlation between lipid peroxidation levels and delta-ALA-D activity was observed. Ebselen restored ascorbic acid levels reduced by CdCl(2). A significant negative correlation between ascorbic acid levels and delta-ALA-D activity reinforces the idea that ebselen attenuated the damage induced by CdCl(2) via its antioxidant property. The significant correlation between ALT and delta-ALA-D activity supports the assumption that ebselen prevented damage caused by CdCl(2). The results show that ebselen attenuated oxidative stress, a process important for CdCl(2) toxicity. PMID:17624921

  17. Liposomal Antioxidants for Protection against Oxidant-Induced Damage

    PubMed Central

    Suntres, Zacharias E.


    Reactive oxygen species (ROS), including superoxide anion, hydrogen peroxide, and hydroxyl radical, can be formed as normal products of aerobic metabolism and can be produced at elevated rates under pathophysiological conditions. Overproduction and/or insufficient removal of ROS result in significant damage to cell structure and functions. In vitro studies showed that antioxidants, when applied directly and at relatively high concentrations to cellular systems, are effective in conferring protection against the damaging actions of ROS, but results from animal and human studies showed that several antioxidants provide only modest benefit and even possible harm. Antioxidants have yet to be rendered into reliable and safe therapies because of their poor solubility, inability to cross membrane barriers, extensive first-pass metabolism, and rapid clearance from cells. There is considerable interest towards the development of drug-delivery systems that would result in the selective delivery of antioxidants to tissues in sufficient concentrations to ameliorate oxidant-induced tissue injuries. Liposomes are biocompatible, biodegradable, and nontoxic artificial phospholipid vesicles that offer the possibility of carrying hydrophilic, hydrophobic, and amphiphilic molecules. This paper focus on the use of liposomes for the delivery of antioxidants in the prevention or treatment of pathological conditions related to oxidative stress. PMID:21876690

  18. Laser-induced damage measurements with 266-nm pulses

    NASA Astrophysics Data System (ADS)

    Deaton, T. F.; Smith, W. L.


    Results of a survey of laser-induced damage thresholds for optical components at 266-nm are reported. The thresholds were measured at two pulse durations; 0.150 ns and 1.0 ns. The 30 samples tested include four commercial dielectric reflectors, three metallic reflectors, two anti-reflection films, a series of eight half-wave oxide and fluoride films, and twelve bare surfaces (fluoride crystals, silica, sapphire, BK-7 glass, cesium dideuterium arsenate and potassium dihydrogen phosphate). The 266-nm pulses were obtained by frequency-quadrupling a Nd:YAG, glass laser. Equivalent plane imagery and calorimetry were used to measure the peak fluence of each of the UV pulses with an accuracy of + or - of 15%; the uncertainty in the threshold determinations is typically + or - 30%.

  19. Sonic-boom-induced building structure responses including damage.

    NASA Technical Reports Server (NTRS)

    Clarkson, B. L.; Mayes, W. H.


    Concepts of sonic-boom pressure loading of building structures and the associated responses are reviewed, and results of pertinent theoretical and experimental research programs are summarized. The significance of sonic-boom load time histories, including waveshape effects, are illustrated with the aid of simple structural elements such as beams and plates. Also included are discussions of the significance of such other phenomena as three-dimensional loading effects, air cavity coupling, multimodal responses, and structural nonlinearities. Measured deflection, acceleration, and strain data from laboratory models and full-scale building tests are summarized, and these data are compared, where possible, with predicted values. Damage complaint and claim experience due both to controlled and uncontrolled supersonic flights over communities are summarized with particular reference to residential, commercial, and historic buildings. Sonic-boom-induced building responses are compared with those from other impulsive loadings due to natural and cultural events and from laboratory simulation tests.

  20. Role of Oxidative Damage in Radiation-Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    Schreurs, Ann-Sofie; Alwood, Joshua S.; Limoli, Charles L.; Globus, Ruth K.


    used an array of countermeasures (Antioxidant diets and injections) to prevent the radiation-induced bone loss, although these did not prevent bone loss, analysis is ongoing to determine if these countermeasure protected radiation-induced damage to other tissues.

  1. Oxidant conditioning protects cartilage from mechanically induced damage.


    Ramakrishnan, Prem; Hecht, Benjamin A; Pedersen, Douglas R; Lavery, Matthew R; Maynard, Jerry; Buckwalter, Joseph A; Martin, James A


    Articular cartilage degeneration in osteoarthritis has been linked to abnormal mechanical stresses that are known to cause chondrocyte apoptosis and metabolic derangement in in vitro models. Evidence implicating oxidative damage as the immediate cause of these harmful effects suggests that the antioxidant defenses of chondrocytes might influence their tolerance for mechanical injury. Based on evidence that antioxidant defenses in many cell types are stimulated by moderate oxidant exposure, we hypothesized that oxidant preconditioning would reduce acute chondrocyte death and proteoglycan depletion in cartilage explants after exposure to abnormal mechanical stresses. Porcine cartilage explants were treated every 48 h with tert-butyl hydrogen peroxide (tBHP) at nonlethal concentrations (25, 100, 250, and 500 microM) for a varying number of times (one, two, or four) prior to a bout of unconfined axial compression (5 MPa, 1 Hz, 1800 cycles). When compared with untreated controls, tBHP had significant positive effects on post-compression viability, lactate production, and proteoglycan losses. Overall, the most effective regime was 100 microM tBHP applied four times. RNA analysis revealed significant effects of 100 microM tBHP on gene expression. Catalase, hypoxia-inducible factor-1alpha (HIF-1alpha), and glyceraldehyde 6-phosphate dehydrogenase (GAPDH) were significantly increased relative to untreated controls in explants treated four times with 100 microM tBHP, a regime that also resulted in a significant decrease in matrix metalloproteinase-3 (MMP-3) expression. These findings demonstrate that repeated exposure of cartilage to sublethal concentrations of peroxide can moderate the acute effects of mechanical stress, a conclusion supported by evidence of peroxide-induced changes in gene expression that could render chondrocytes more resistant to oxidative damage. PMID:20058262

  2. Comparison of Model Calculations of Biological Damage from Exposure to Heavy Ions with Measurements

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee Y.; Hada, Megumi; Cucinotta, Francis A.; Wu, Honglu


    The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET gamma or X rays, the presence of shielding does not always reduce the radiation risks for energetic charged-particle exposure. Dose delivered by the charged particle increases sharply at the Bragg peak. However, the Bragg curve does not necessarily represent the biological damage along the particle path since biological effects are influenced by the track structures of both primary and secondary particles. Therefore, the ''biological Bragg curve'' is dependent on the energy and the type of the primary particle and may vary for different biological end points. Measurements of the induction of micronuclei (MN) have made across the Bragg curve in human fibroblasts exposed to energetic silicon and iron ions in vitro at two different energies, 300 MeV/nucleon and 1 GeV/nucleon. Although the data did not reveal an increased yield of MN at the location of the Bragg peak, the increased inhibition of cell progression, which is related to cell death, was found at the Bragg peak location. These results are compared to the calculations of biological damage using a stochastic Monte-Carlo track structure model, Galactic Cosmic Ray Event-based Risk Model (GERM) code (Cucinotta, et al., 2011). The GERM code estimates the basic physical properties along the passage of heavy ions in tissue and shielding materials, by which the experimental set-up can be interpreted. The code can also be used to describe the biophysical events of interest in radiobiology, cancer therapy, and space exploration. The calculation has shown that the severely damaged cells at the Bragg peak are more likely to go through reproductive death, the so called "overkill".

  3. Depth position recognition-related laser-induced damage test method based on initial transient damage features.


    Ma, Bin; Lu, Menglei; Wang, Ke; Zhang, Li; Jiao, Hongfei; Cheng, Xinbin; Wang, Zhanshan


    Even absorptive defects or inner cracks hiding several micrometers to a few dozen micrometers beneath the top surface can induce damage to transmission elements in the ultraviolet band. The extremely small size and disordered state of such defects or cracks hinder their detection using conventional methods. Therefore, the diagnosis of factors that limit damage resistance performance is a key technique for improving the fabrication technology of optical elements. With a focus on laser damage to third-harmonic transmission elements, this study establishes a micron space-resolved and nanosecond time-resolved imaging system on the basis of the pump-probe detection technique. The changes in the properties of defect-induced laser damage in the time domain are clarified. A diagnostic method for original damage depth in micron precision is proposed according to damage behaviors. This method can retrieve initial information on damage inducement and depth position. The recognition and diagnostic capabilities of such a technique are calibrated with artificial samples and then used to analyze real samples. PMID:27505738

  4. Exposure to 50Hz-sinusoidal electromagnetic field induces DNA damage-independent autophagy.


    Shen, Yunyun; Xia, Ruohong; Jiang, Hengjun; Chen, Yanfeng; Hong, Ling; Yu, Yunxian; Xu, Zhengping; Zeng, Qunli


    As electromagnetic field (EMF) is commonly encountered within our daily lives, the biological effects of EMF are of great concern. Autophagy is a key process for maintaining cellular homeostasis, and it can also reveal cellular responses to environmental stimuli. In this study, we aim to investigate the biological effects of a 50Hz-sinusoidal electromagnetic field on autophagy and we identified its mechanism of action in Chinese Hamster Lung (CHL) cells. CHL cells were exposed to a 50Hz sinusoidal EMF at 0.4mT for 30min or 24h. In this study, we found that a 0.4mT EMF resulted in: (i) an increase in LC3-II expression and increased autophagosome formation; (ii) no significant difference in the incidence of γH2AX foci between the sham and exposure groups; (iii) reorganized actin filaments and increased pseudopodial extensions without promoting cell migration; and (iv) enhanced cell apoptosis when autophagy was blocked by Bafilomycin A1. These results implied that DNA damage was not directly involved in the autophagy induced by a 0.4mT 50Hz EMF. In addition, an EMF induced autophagy balanced the cellular homeostasis to protect the cells from severe adverse biological consequences. PMID:27177844

  5. Acute radiation-induced pulmonary damage: a clinical study on the response to fractionated radiation therapy.


    Mah, K; Van Dyk, J; Keane, T; Poon, P Y


    Acute radiation-induced pulmonary damage can be a significant cause of morbidity in radiation therapy of the thorax. A prospective, clinical study was conducted to obtain dose-response data on acute pulmonary damage caused by fractionated radiation therapy. The endpoint was a visible increase in lung density within the irradiated volume on a computed tomographic (CT) examination as observed independently by three diagnostic radiologists. Fifty-four patients with various malignancies of the thorax completed the study. CT chest scans were taken before and at preselected times following radiotherapy. To represent different fractionation schedules of equivalent biological effect, the estimated single dose (ED) model, ED = D X N-0.377 X T-0.058 was used in which D was the average lung dose within the high dose region in cGy, N was the number of fractions, and T was the overall treatment time in days. Patients were grouped according to ED and the percent incidence of pulmonary damage for each group was determined. Total average lung doses ranged from 29.8 Gy to 53.6 Gy given in 10 to 30 fractions over a range of 12 to 60 days. Five patient groups with incidence ranging from 30% (ED of 930) to 90% (ED of 1150) were obtained. The resulting dose-response curve predicted a 50% incidence level at an ED value (ED50) of 1000 +/- 40 ED units. This value represents fractionation schedules equivalent to a total average lung dose of 32.9 Gy given in 15 fractions over 19 days. Over the linear portion of the dose-response curve, a 5% increase in ED (or total dose if N and T remain constant), predicts a 12% increase in the incidence of acute radiation-induced pulmonary damage. PMID:3818385

  6. Repair and misrepair of heavy-ion-induced chromosomal damage

    NASA Astrophysics Data System (ADS)

    Goodwin, E.; Blakely, E.; Ivery, G.; Tobias, C.

    The premature chromosome condensation (PCC) technique was used to investigate chromosomal damage, repair, and misrepair in the G1 phase of a human/hamster hybrid cell line that contains a single human chromosome. Plateau-phase cell cultures were exposed to either x-rays or a 425 MeV/u beam of neon ions near the Bragg peak where the LET is 183 keV/μm. An in situ hybridization technique coupled to fluorescent staining of PCC spreads confirmed the linearity of the dose response for initial chromatin breakage in the human chromosome to high doses (1600 cGy x-ray or 1062 cGy Ne). On Giemsa-stained slides, initial chromatin breakage in the total genome and the rejoining kinetics of these breaks were determined. As a measure of chromosomal misrepair, ring PCC aberrations were also scored. Ne ions were about 1.5 x more effective per unit dose compared to x-rays at producing the initially measured chromatin breakage. 90% of the x-ray-induced breaks rejoined in cells incubated at 37°C after exposure. In contrast, only 50% of Ne-ion-induced breaks rejoined. In the irradiated G1 cells, ring PCC aberrations increased with time apparently by first order kinetics after either x-ray or Ne exposures. However, far fewer rings formed in Ne-irradiated cells after a dose giving a comparable initial number of chromatin breaks. Following x-ray exposures, the yield of rings formed after long repair times (6 to 9 hrs) fit a quadratic dose-response curve. These results indicate quantitative and qualitative differences in the chromosomal lesions induced by low- and high-LET radiations.

  7. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.


    Background Spontaneous reports from patients able to report vascular sequelae in real time, and recognition that serum non transferrin bound iron may reach or exceed 10μmol/L in the blood stream after iron tablets or infusions, led us to hypothesize that conventional iron treatments may provoke acute vascular injury. This prompted us to examine whether a phenotype could be observed in normal human endothelial cells treated with low dose iron. Methodology Confluent primary human endothelial cells (EC) were treated with filter-sterilized iron (II) citrate or fresh media for RNA sequencing and validation studies. RNA transcript profiles were evaluated using directional RNA sequencing with no pre-specification of target sequences. Alignments were counted for exons and junctions of the gene strand only, blinded to treatment types. Principal Findings Rapid changes in RNA transcript profiles were observed in endothelial cells treated with 10μmol/L iron (II) citrate, compared to media-treated cells. Clustering for Gene Ontology (GO) performed on all differentially expressed genes revealed significant differences in biological process terms between iron and media-treated EC, whereas 10 sets of an equivalent number of randomly selected genes from the respective EC gene datasets showed no significant differences in any GO terms. After 1 hour, differentially expressed genes clustered to vesicle mediated transport, protein catabolism, and cell cycle (Benjamini p = 0.0016, 0.0024 and 0.0032 respectively), and by 6 hours, to cellular response to DNA damage stimulus most significantly through DNA repair genes FANCG, BLM, and H2AFX. Comet assays demonstrated that 10μM iron treatment elicited DNA damage within 1 hour. This was accompanied by a brisk DNA damage response pulse, as ascertained by the development of DNA damage response (DDR) foci, and p53 stabilization. Significance These data suggest that low dose iron treatments are sufficient to modify the vascular endothelium

  8. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun


    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  9. Damage-free vibrational spectroscopy of biological materials in the electron microscope


    Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L.; Dellby, Niklas; Lovejoy, Tracy C.; Wolf, Sharon G.; Cohen, Hagai


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an ‘aloof’ electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies o1 eV can be ‘safely’ investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C–H, N–H and C=O vibrational signatures with nomore » observable radiation damage. Furthermore, the technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ~10nm, simultaneously combined with imaging in the electron microscope.« less

  10. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.


    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S


    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. PMID:26447197

  11. Mediators of Inflammation-Induced Bone Damage in Arthritis and Their Control by Herbal Products

    PubMed Central

    Nanjundaiah, Siddaraju M.; Astry, Brian; Moudgil, Kamal D.


    Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic inflammation of the synovial joints leading to bone and cartilage damage. Untreated inflammatory arthritis can result in severe deformities and disability. The use of anti-inflammatory agents and biologics has been the mainstay of treatment of RA. However, the prolonged use of such agents may lead to severe adverse reactions. In addition, many of these drugs are quite expensive. These limitations have necessitated the search for newer therapeutic agents for RA. Natural plant products offer a promising resource for potential antiarthritic agents. We describe here the cellular and soluble mediators of inflammation-induced bone damage (osteoimmunology) in arthritis. We also elaborate upon various herbal products that possess antiarthritic activity, particularly mentioning the specific target molecules. As the use of natural product supplements by RA patients is increasing, this paper presents timely and useful information about the mechanism of action of promising herbal products that can inhibit the progression of inflammation and bone damage in the course of arthritis. PMID:23476694

  12. Methylphenidate and Amphetamine Do Not Induce Cytogenetic Damage in Lymphocytes of Children with ADHD

    ERIC Educational Resources Information Center

    Witt, Kristine L.; Shelby, Michael D.; Itchon-Ramos, Nilda; Faircloth, Melissa; Kissling, Grace E.; Chrisman, Allan K.; Ravi, Hima; Murli, Hemalatha; Mattison, Donald R.; Kollins, Scott H.


    The inducement of chromosomal damage in lymphocytes among children with attention deficit hyperactivity disorder receiving treatment with methylphenidate- or amphetamine-based drugs is investigated. Findings did not reveal significant increases in cytogenetic damage related to the treatment. The risk for cytogenetic damage posed by such products…

  13. Role of creatine supplementation in exercise-induced muscle damage: A mini review.


    Kim, Jooyoung; Lee, Joohyung; Kim, Seungho; Yoon, Daeyoung; Kim, Jieun; Sung, Dong Jun


    Muscle damage is induced by both high-intensity resistance and endurance exercise. Creatine is a widely used dietary supplement to improve exercise performance by reducing exercise-induced muscle damage. Many researchers have suggested that taking creatine reduces muscle damage by decreasing the inflammatory response and oxidative stress, regulating calcium homeostasis, and activating satellite cells. However, the underlying mechanisms of creatine and muscle damage have not been clarified. Therefore, this review discusses the regulatory effects of creatine on muscle damage by compiling the information collected from basic science and sports science research. PMID:26535213

  14. Laser-induced damage threshold of silicon in millisecond, nanosecond, and picosecond regimes

    SciTech Connect

    Wang, X.; Shen, Z. H.; Lu, J.; Ni, X. W.


    Millisecond, nanosecond, and picosecond laser pulse induced damage thresholds on single-crystal are investigated in this study. The thresholds of laser-induced damage on silicon are calculated theoretically for three pulse widths based on the thermal damage model. An axisymmetric mathematical model is established for the transient temperature field of the silicon. Experiments are performed to test the damage thresholds of silicon at various pulse widths. The results indicate that the damage thresholds obviously increase with the increasing of laser pulse width. Additionally, the experimental results agree well with theoretical calculations and numerical simulation results.

  15. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.


    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  16. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.


    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  17. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.


    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  18. Mass spectrometric analysis of HOCl- and free-radical-induced damage to lipids and proteins.


    Pitt, Andrew R; Spickett, Corinne M


    In inflammatory diseases, release of oxidants leads to oxidative damage to biomolecules. HOCl (hypochlorous acid), released by the myeloperoxidase/H2O2/Cl- system, can cause formation of phospholipid chlorohydrins, or alpha-chloro-fatty aldehydes from plasmalogens. It can attack several amino acid residues in proteins, causing post-translational oxidative modifications of proteins, but the formation of 3-chlorotyrosine is one of the most stable markers of HOCl-induced damage. Soft-ionization MS has proved invaluable for detecting the occurrence of oxidative modifications to both phospholipids and proteins, and characterizing the products generated by HOCl-induced attack. For both phospholipids and proteins, the application of advanced mass spectrometric methods such as product or precursor ion scanning and neutral loss analysis can yield information both about the specific nature of the oxidative modification and the biomolecule modified. The ideal is to be able to apply these methods to complex biological or clinical samples, to determine the site-specific modifications of particular cellular components. This is important for understanding disease mechanisms and offers potential for development of novel biomarkers of inflammatory diseases. In the present paper, we review some of the progress that has been made towards this goal. PMID:18793192

  19. Liver-specific microRNAs as biomarkers of nanomaterial-induced liver damage

    NASA Astrophysics Data System (ADS)

    Nagano, Takashi; Higashisaka, Kazuma; Kunieda, Akiyoshi; Iwahara, Yuki; Tanaka, Kota; Nagano, Kazuya; Abe, Yasuhiro; Kamada, Haruhiko; Tsunoda, Shin-ichi; Nabeshi, Hiromi; Yoshikawa, Tomoaki; Yoshioka, Yasuo; Tsutsumi, Yasuo


    Although nanomaterials are being used in various fields, their safety is not yet sufficiently understood. We have been attempting to establish a nanomaterials safety-assessment system by using biomarkers to predict nanomaterial-induced adverse biological effects. Here, we focused on microRNAs (miRNAs) because of their tissue-specific expression and high degree of stability in the blood. We previously showed that high intravenous doses of silica nanoparticles of 70 nm diameter (nSP70) induced liver damage in mice. In this study, we compared the effectiveness of serum levels of liver-specific or -enriched miRNAs (miR-122, miR-192, and miR-194) with that of conventional hepatic biomarkers (alanine aminotransferase (ALT) and aspartate aminotransferase (AST)) as biomarkers for nSP70. After mice had been treated with nSP70, their serum miRNAs levels were measured by using quantitative RT-PCR. Serum levels of miR-122 in nSP70-treated mice were the highest among the three miRNAs. The sensitivity of miR-122 for liver damage was at least as good as those of ALT and AST. Like ALT and AST, miR-122 may be a useful biomarker of nSP70. We believe that these findings will help in the establishment of a nanomaterials safety-assessment system.

  20. Chemical modification of normal tissue damage induced by photodynamic therapy.

    PubMed Central

    Sigdestad, C. P.; Fingar, V. H.; Wieman, T. J.; Lindberg, R. D.


    One of the limitations of successful use of photodynamic therapy (PDT) employing porphyrins is the acute and long-term cutaneous photosensitivity. This paper describes results of experiments designed to test the effects of two radiation protective agents (WR-2721, 500 mg kg-1 or WR-3689, 700 mg kg-1) on murine skin damage induced by PDT. C3H mice were shaved and depilated three days prior to injection with the photosensitiser, Photofrin (5 or 10 mg kg-1). Twenty-four hours later, the mice were injected intraperitoneally with a protector 30 min prior to Argon dye laser (630 nm) exposure. The skin response was followed for two weeks post irradiation using an arbitrary response scale. A light dose response as well as a drug dose response was obtained. The results indicate that both protectors reduced the skin response to PDT, however WR-2721 was demonstrated to be the most effective. The effect of the protectors on vascular stasis after PDT was determined using a fluorescein dye exclusion assay. In mice treated with Photofrin (5 mg kg-1), and 630 nm light (180 J cm-2) pretreatment with either WR-2721 or WR-3689 resulted in significant protection of the vascular effects of PDT. These studies document the ability of the phosphorothioate class of radiation protective agents to reduce the effects of light on photosensitized skin. They do so in a drug dose-dependent fashion with maximum protection at the highest drug doses. PMID:8763855

  1. Incretin attenuates diabetes-induced damage in rat cardiac tissue.


    AbdElmonem Elbassuoni, Eman


    Glucagon-like peptide-1 (GLP-1), as a member of the incretin family, has a role in glucose homeostasis, its receptors distributed throughout the body, including the heart. The aim was to investigate cardiac lesions following diabetes induction, and the potential effect of GLP-1 on this type of lesions and the molecular mechanism driving this activity. Adult male rats were classified into: normal, diabetic, 4-week high-dose exenatide-treated diabetic rats, 4-week low-dose exenatide-treated diabetic rats, and 1-week exenatide-treated diabetic rats. The following parameters were measured: in blood: glucose, insulin, lactate dehydrogenase (LDH), total creatine kinase (CK), creatine kinase MB isoenzyme (CK-MB), and CK-MB relative index; in cardiac tissue: lipid peroxide (LPO) and some antioxidant enzymes. The untreated diabetic group displayed significant increases in blood level of glucose, LDH, and CK-MB, and cardiac tissue LPO, and a significant decrease in cardiac tissue antioxidant enzymes. GLP-1 supplementation in diabetic rats definitely decreased the hyperglycemia and abolished the detrimental effects of diabetes on the cardiac tissue. The effect of GLP-1 on blood glucose and on the heart also appeared after a short supplementation period (1 week). It can be concluded that GLP-1 has beneficial effects on diabetes-induced oxidative cardiac tissue damage, most probably via its antioxidant effect directly acting on cardiac tissue and independent of its hypoglycemic effect. PMID:25011640

  2. Retinal Damage Induced by Internal Limiting Membrane Removal

    PubMed Central

    Gelman, Rachel; Stevenson, William; Prospero Ponce, Claudia; Agarwal, Daniel; Christoforidis, John Byron


    The internal limiting membrane (ILM), the basement membrane of the Müller cells, serves as the interface between the vitreous body and the retinal nerve fiber layer. It has a fundamental role in the development, structure, and function of the retina, although it also is a pathologic component in the various vitreoretinal disorders, most notably in macular holes. It was not until understanding of the evolution of idiopathic macular holes and the advent of idiopathic macular hole surgery that the idea of adjuvant ILM peeling in the treatment of tractional maculopathies was explored. Today intentional ILM peeling is a commonly applied surgical technique among vitreoretinal surgeons as it has been found to increase the rate of successful macular hole closure and improve surgical outcomes in other vitreoretinal diseases. Though ILM peeling has refined surgery for tractional maculopathies, like all surgical procedures it is not immune to perioperative risk. The essential role of the ILM to the integrity of the retina and risk of trauma to retinal tissue spurs suspicion with regard to its routine removal. Several authors have investigated the retinal damage induced by ILM peeling and these complications have been manifested across many different diagnostic studies. PMID:26425355

  3. Laser induced damage of fused silica polished optics due to a droplet forming organic contaminant.


    Bien-Aimé, Karell; Néauport, Jérome; Tovena-Pecault, Isabelle; Fargin, Evelyne; Labrugère, Christine; Belin, Colette; Couzi, Michel


    We report on the effect of organic molecular contamination on single shot laser induced damage density at the wavelength of 351 nm, with a 3 ns pulse length. Specific contamination experiments were made with dioctylphthalate (DOP) in liquid or gaseous phase, on the surface of fused silica polished samples, bare or solgel coated. Systematic laser induced damage was observed only in the case of liquid phase contamination. Different chemical and morphological characterization methods were used to identify and understand the damage process. We demonstrate that the contaminant morphology, rather than its physicochemical nature, can be responsible for the decrease of laser induced damage threshold of optics. PMID:19381171

  4. Does rosmarinic acid treatment have protective role against sepsis-induced oxidative damage in Wistar Albino rats?


    Bacanlı, M; Aydın, S; Taner, G; Göktaş, H G; Şahin, T; Başaran, A A; Başaran, N


    Reactive oxygen species are believed to be involved in the development of sepsis. Plant-derived phenolic compounds are thought to be possible therapeutic agents against sepsis because of their antioxidant properties. Rosmarinic acid (RA) is a phenolic compound commonly found in various plants, which has many biological activities including antioxidant activity. The aim of this study was to investigate the effects of RA on sepsis-induced DNA damage in the lymphocytes and liver and kidney cells of Wistar albino rats by alkaline comet assay with and without formamidopyrimidine DNA glycosylase protein. The oxidative stress parameters such as superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities and total glutathione (GSH) and malondialdehyde (MDA) levels in the liver and kidney tissues and an inflammatory cytokine, tumor necrosis factor α (TNF-α) level in plasma were also evaluated. It is found that DNA damage in the lymphocytes, livers, and kidneys of the RA-treated rats was significantly lower than that in the sepsis-induced rats. RA treatment also decreased the MDA levels and increased the GSH levels and SOD and GSH-Px activities in the livers and kidneys of the sepsis-induced rats. Plasma TNF-α level was found to be decreased in the RA-treated rats. It seems that RA might have a role in the attenuation of sepsis-induced oxidative damage not only by decreasing the DNA damage but also by increasing the antioxidant status and DNA repair capacity of the animals. PMID:26429925

  5. Comparison of Model Calculations of Biological Damage from Exposure to Heavy Ions with Measurements

    NASA Astrophysics Data System (ADS)

    Kim, Myung-Hee Y.; Wu, Honglu; Hada, Megumi; Cucinotta, Francis

    The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET g or X rays, the presence of shielding does not always reduce the radiation risks for energetic charged-particle exposure. Dose delivered by the charged particle increases sharply at the Bragg peak. However, the Bragg curve does not necessarily represent the biological damage along the particle path since biological effects are influenced by the track structures of both primary and secondary particles. Therefore, the ‘‘biological Bragg curve’’ is dependent on the energy and the type of the primary particle and may vary for different biological end points. Measurements of the induction of micronuclei (MN) have made across the Bragg curve in human fibroblasts exposed to energetic silicon and iron ions in vitro at two different energies, 300 MeV/nucleon and 1 GeV/nucleon. Although the data did not reveal an increased yield of MN at the location of the Bragg peak, the increased inhibition of cell progression, which is related to cell death, was found at the Bragg peak location. These results are compared to the calculations of biological damage using a stochastic Monte-Carlo track structure model, Galactic Cosmic Ray Event-based Risk Model (GERM) code (Cucinotta et al., 2011). The GERM code estimates the basic physical properties along the passage of heavy ions in tissue and shielding materials, by which the experimental set-up can be interpreted. The code can also be used to describe the biophysical events of interest in radiobiology, cancer therapy, and space exploration. The calculation has shown that the severely damaged cells at the Bragg peak are more likely to go through reproductive death, the so called “overkill”. F. A. Cucinotta, I. Plante, A. L. Ponomarev, and M. Y. Kim, Nuclear Interactions in Heavy Ion Transport and Event

  6. Advances and New Concepts in Alcohol-Induced Organelle Stress, Unfolded Protein Responses and Organ Damage

    PubMed Central

    Ji, Cheng


    Alcohol is a simple and consumable biomolecule yet its excessive consumption disturbs numerous biological pathways damaging nearly all organs of the human body. One of the essential biological processes affected by the harmful effects of alcohol is proteostasis, which regulates the balance between biogenesis and turnover of proteins within and outside the cell. A significant amount of published evidence indicates that alcohol and its metabolites directly or indirectly interfere with protein homeostasis in the endoplasmic reticulum (ER) causing an accumulation of unfolded or misfolded proteins, which triggers the unfolded protein response (UPR) leading to either restoration of homeostasis or cell death, inflammation and other pathologies under severe and chronic alcohol conditions. The UPR senses the abnormal protein accumulation and activates transcription factors that regulate nuclear transcription of genes related to ER function. Similarly, this kind of protein stress response can occur in other cellular organelles, which is an evolving field of interest. Here, I review recent advances in the alcohol-induced ER stress response as well as discuss new concepts on alcohol-induced mitochondrial, Golgi and lysosomal stress responses and injuries. PMID:26047032

  7. Damage proneness induced by genomic DNA demethylation in mammalian cells cultivated in vitro.


    Perticone, P; Gensabella, G; Cozzi, R


    Variations in the genomic DNA methylation level have been shown to be an epigenetic inheritable modification affecting, among other targets, the sister chromatid exchange (SCE) rate in mammalian cells in vitro. The inheritable increase in SCE rate in affected cell populations appears as a puzzling phenomenon in view of the well established relation between SCE and both mutagenesis and carcinogenesis. In the present work we demonstrate that, in a treated cell population, demethylation could be responsible for the inheritable induction of damage proneness affecting both damage induction and repair. Normal and ethionine or azacytidine treated Chinese hamster ovary cells, subclone K1 (CHO-K1), were challenged with UV light (UV) or mitomycin-C (MMC) at different times from the demethylating treatment. The SCE rate was measured with two main objects in view: (i) the induction of synergism or additivity in combined treatments, where mutagen (UV or MMC) pulse is supplied from 0 to 48 h after the end of the demethylating treatment; and (ii) the pattern of damage extinction, for the duration of up to six cell cycles after the end of the combined (demethylating agent + mutagen) treatment. Results indicate both a synergism in SCE induction by mutagens in demethylated cells even if supplied up to four cell cycles after the end of the demethylation treatment and a delay in recovery of induced damage, compared with normally methylated cells. These data are discussed in the light of the supposed mechanism of SCE increase and of the possible biological significance in terms of mutagenesis and carcinogenesis. PMID:9237771

  8. Eucalyptus globulus extract protects upon acetaminophen-induced kidney damages in male rat

    PubMed Central

    Dhibi, Sabah; Mbarki, Sakhria; Elfeki, Abdelfettah; Hfaiedh, Najla


    Plants have historically been used in treating many diseases. Eucalyptus globules, a rich source of bioactive compounds, and have been shown to possess antioxidative properties. The purpose of this study, carried out on male Wistar rats, was to evaluate the beneficial effects of Eucalyptus globulus extract upon acetaminophen-induced damages in kidney. Our study is realized in the Department of Biology, Faculty of Sciences of Sfax (Tunisia). 32 Wistar male rats; were divided into 4 batches: a control group (n=8), a group of rats treated with acetaminophen (goomg/kg) by intraperitoneal injection during 4 days (n=8), a group receiving Eucalyptus globulus extract (130 mg of dry leaves/kg/day) in drinking water during 42 days after 2 hours of acetaminophen administration (during 4 days) (n=8) and group received only Eucalyptus (n=8) during 42 days. After 6 weeks, animals from each group were rapidly sacrificed by decapitation. Blood serum was obtained by centrifugation. Under our experimental conditions, acetaminophen poisoning resulted in an oxidative stress evidenced by statistically significant losses in the activities of catalase (CAT), superoxide-dismutase (SOD), glutathione-peroxidase (GPX) activities and an increase in lipids peroxidation level in renal tissue of acetaminophen-treated group compared with the control group. Acetaminophen also caused kidney damage as evident by statistically significant (p<0.05) increase in levels of creatinine and urea and decreased levels of uric acid and proteins in blood. Histological analysis demonstrated alteration of proximal tubules, atrophy of the glomerule and dilatation of urinary space. Previous administration of plant extract is found to alleviate this acetaminophen-induced damage. PMID:24856382

  9. Eucalyptus globulus extract protects upon acetaminophen-induced kidney damages in male rat.


    Dhibi, Sabah; Mbarki, Sakhria; Elfeki, Abdelfettah; Hfaiedh, Najla


    Plants have historically been used in treating many diseases. Eucalyptus globules, a rich source of bioactive compounds, and have been shown to possess antioxidative properties. The purpose of this study, carried out on male Wistar rats, was to evaluate the beneficial effects of Eucalyptus globulus extract upon acetaminophen-induced damages in kidney. Our study is realized in the Department of Biology, Faculty of Sciences of Sfax (Tunisia). 32 Wistar male rats; were divided into 4 batches: a control group (n=8), a group of rats treated with acetaminophen (900 mg/kg) by intraperitoneal injection during 4 days (n=8), a group receiving Eucalyptus globulus extract (130 mg of dry leaves/kg/day) in drinking water during 42 days after 2 hours of acetaminophen administration (during 4 days) (n=8) and group received only Eucalyptus (n=8) during 42 days. After 6 weeks, animals from each group were rapidly sacrificed by decapitation. Blood serum was obtained by centrifugation. Under our experimental conditions, acetaminophen poisoning resulted in an oxidative stress evidenced by statistically significant losses in the activities of catalase (CAT), superoxide-dismutase (SOD), glutathione-peroxidase (GPX) activities and an increase in lipids peroxidation level in renal tissue of acetaminophen-treated group compared with the control group. Acetaminophen also caused kidney damage as evident by statistically significant (p<0.05) increase in levels of creatinine and urea and decreased levels of uric acid and proteins in blood. Histological analysis demonstrated alteration of proximal tubules, atrophy of the glomerule and dilatation of urinary space. Previous administration of plant extract is found to alleviate this acetaminophen-induced damage. PMID:24856382

  10. High and Low LET Radiation Differentially Induce Normal Tissue Damage Signals

    SciTech Connect

    Niemantsverdriet, Maarten; Goethem, Marc-Jan van; Bron, Reinier; Hogewerf, Wytse; Brandenburg, Sytze; Langendijk, Johannes A.; Luijk, Peter van; Coppes, Robert P.


    Purpose: Radiotherapy using high linear energy transfer (LET) radiation is aimed at efficiently killing tumor cells while minimizing dose (biological effective) to normal tissues to prevent toxicity. It is well established that high LET radiation results in lower cell survival per absorbed dose than low LET radiation. However, whether various mechanisms involved in the development of normal tissue damage may be regulated differentially is not known. Therefore the aim of this study was to investigate whether two actions related to normal tissue toxicity, p53-induced apoptosis and expression of the profibrotic gene PAI-1 (plasminogen activator inhibitor 1), are differentially induced by high and low LET radiation. Methods and Materials: Cells were irradiated with high LET carbon ions or low LET photons. Cell survival assays were performed, profibrotic PAI-1 expression was monitored by quantitative polymerase chain reaction, and apoptosis was assayed by annexin V staining. Activation of p53 by phosphorylation at serine 315 and serine 37 was monitored by Western blotting. Transfections of plasmids expressing p53 mutated at serines 315 and 37 were used to test the requirement of these residues for apoptosis and expression of PAI-1. Results: As expected, cell survival was lower and induction of apoptosis was higher in high -LET irradiated cells. Interestingly, induction of the profibrotic PAI-1 gene was similar with high and low LET radiation. In agreement with this finding, phosphorylation of p53 at serine 315 involved in PAI-1 expression was similar with high and low LET radiation, whereas phosphorylation of p53 at serine 37, involved in apoptosis induction, was much higher after high LET irradiation. Conclusions: Our results indicate that diverse mechanisms involved in the development of normal tissue damage may be differentially affected by high and low LET radiation. This may have consequences for the development and manifestation of normal tissue damage.

  11. Molecular responses of radiation-induced liver damage in rats

    PubMed Central



    The aim of the present study was to investigate the molecular responses involved in radiation-induced liver damage (RILD). Sprague-Dawley rats (6-weeks-old) were irradiated once at a dose of 20 Gy to the right upper quadrant of the abdomen. The rats were then sacrificed 3 days and 1, 2, 4, 8 and 12 weeks after irradiation and rats, which were not exposed to irradiation were used as controls. Weight measurements and blood was obtained from the rats and liver tissues were collected for histological and apoptotic analysis. Immunohistochemistry, reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis were performed to measure the expression levels of mRNAs and proteins, respectively. The serum levels of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase were increased significantly in the RILD rats. Histological investigation revealed the proliferation of collagen and the formation of fibrotic tissue 12 weeks after irradiation. Apoptotic cells were observed predominantly 2 and 4 weeks after irradiation. The immunohistochemistry, RT-qPCR and western blot analysis all revealed the same pattern of changes in the expression levels of the molecules assessed. The expression levels of transforming growth factor-β1 (TGF-β1), nuclear factor (NF)-κB65, mothers against decapentaplegic homolog 3 (Smad3) and Smad7 and connective tissue growth factor were increased during the recovery period following irradiation up to 12 weeks. The expression levels of tumor necrosis factor-α, Smad7 and Smad4 were only increased during the early phase (first 4 weeks) of recovery following irradiation. In the RILD rat model, the molecular responses indicated that the TGF-β1/Smads and NF-κB65 signaling pathways are involved in the mechanism of RILD recovery. PMID:25483171


    SciTech Connect

    Hawkins, S; Lucile Teague, L; Martine Duff, M; Eliel Villa-Aleman, E


    Semi-conducting CdZnTe (or CZT) crystals can be used in a variety of detector-type applications. CZT shows great promise for use as a gamma radiation spectrometer. However, its performance is adversely affected by point defects, structural and compositional heterogeneities within the crystals, such as twinning, pipes, grain boundaries (polycrystallinity), secondary phases and in some cases, damage caused by external forces. One example is damage that occurs during characterization of the surface by a laser during Raman spectroscopy. Even minimal laser power can cause Te enriched areas on the surface to appear. The Raman spectra resulting from measurements at moderate intensity laser power show large increases in peak intensity that is attributed to Te. Atomic Force Microscopy (AFM) was used to characterize the extent of damage to the CZT crystal surface following exposure to the Raman laser. AFM data reveal localized surface damage in the areas exposed to the Raman laser beam. The degree of surface damage to the crystal is dependent on the laser power, with the most observable damage occurring at high laser power. Moreover, intensity increases in the Te peaks of the Raman spectra are observed even at low laser power with little to no visible damage observed by AFM. AFM results also suggest that exposure to the same amount of laser power yields different amounts of surface damage depending on whether the exposed surface is the Te terminating face or the Cd terminating face of CZT.

  13. SPATA12 and Its Possible Role in DNA Damage Induced by Ultraviolet-C

    PubMed Central

    Lin, Yiting; Rong, Zhuoxian; Liu, Xiaowen; Li, Dan


    Our previous studies indicated that SPATA12, a novel spermatogenesis-associated gene, might be an inhibitor involved in spermatogenesis and tumorigenesis. To obtain a better understanding of the functions of SPATA12, a yeast two-hybrid screening system was used to search for interacting proteins, and chromodomain helicase DNA binding protein 2 (CHD2) was successfully identified. Bimolecular fluorescence complementation (BiFC) and subcellular co-localization assays further suggested a possible interaction between SPATA12 and CHD2 in the nuclei. CHD2 is known to be involved in the later stage of the DNA damage response pathway by influencing the transcriptional activity of p53. Thus, our hypothesis is that SPATA12 might play a role in DNA damage signaling. Western blotting results showed that SPATA12 expression could be induced in ultraviolet-C (UV-C) irradiated cells. Through reporter gene assays and the activator protein-1 (AP-1) decoy oligodeoxynucleotide method, we demonstrated that SPATA12 promoter activity could be up-regulated in response to UV-C radiation exposure and an AP-1 binding site in the SPATA12 promoter may have a role in transcriptional regulation of SPATA12. Using colony formation and host cell reactivation assays, it was demonstrated that SPATA12 might lead to inhibition of cellular proliferation in UV-C-irradiated DNA damage. Furthermore, SPATA12 was transfected into H1299, MCF-7 and HeLa cells, and flow cytometry (FCM) results suggested that there are some biological association between SPATA12 and p53 in UV-C-irradiated DNA damage. In addition, we investigated whether SPATA12 could up-regulate the expression of p53. Taken together, these findings indicate that SPATA12 could be induced under UV-C stress. During DNA damage process, AP-1 involves in the transcriptional up-regulation of SPATA12 in response to UV-C radiation and p53 involves in growth inhibitory effects of SPATA12 on UV-C irradiated cells. PMID:24205157

  14. The effect of multiple wavelengths on Laser-induced damage in DKDP crystals

    SciTech Connect

    Carr, C W; Auerbach, J M


    Laser-induced damage is a key factor that constrains how optical materials are used in high-power laser systems. In this work the size and density of bulk laser-induced damage sites formed during frequency tripling in a DKDP crystal are studied. The characteristics of the damage sites formed during tripling, where 1053-nm, 526-nm, and 351-nm light is simultaneously present, are compared to damage sites formed by 351-nm light alone. The fluence of each wavelength is calculated as a function of depth with a full 4D(x,y,z,t) frequency conversion code and compared to measured damage density and size distributions. The density of damage is found be predominantly governed by 351-nm light with some lesser, though non-negligible contribution from 526-nm light. The morphology of the damage sites, however, is seen to be relatively insensitive to wavelength and depend only on total fluence of all wavelengths present.

  15. Heavy ion induced DNA transfer in biological cells

    NASA Astrophysics Data System (ADS)

    Vilaithong, T.; Yu, L. D.; Apavatjrut, P.; Phanchaisri, B.; Sangyuenyongpipat, S.; Anuntalabhochai, S.; Brown, I. G.


    Low-energy ion beam bombardment of biological materials for genetic modification purposes has experienced rapid growth in the last decade, particularly for the direct DNA transfer into living organisms including both plants and bacteria. Attempts have been made to understand the mechanisms involved in ion-bombardment-induced direct gene transfer into biological cells. Here we summarize the present status of the application of low-energy ions for genetic modification of living sample materials.

  16. Involvement of inducible nitric oxide synthase in radiation-induced vascular endothelial damage.


    Hong, Chang-Won; Kim, Young-Mee; Pyo, Hongryull; Lee, Joon-Ho; Kim, Suwan; Lee, Sunyoung; Noh, Jae Myoung


    The use of radiation therapy has been linked to an increased risk of cardiovascular disease. To understand the mechanisms underlying radiation-induced vascular dysfunction, we employed two models. First, we examined the effect of X-ray irradiation on vasodilation in rabbit carotid arteries. Carotid arterial rings were irradiated with 8 or 16 Gy using in vivo and ex vivo methods. We measured the effect of acetylcholine-induced relaxation after phenylephrine-induced contraction on the rings. In irradiated carotid arteries, vasodilation was significantly attenuated by both irradiation methods. The relaxation response was completely blocked by 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, a potent inhibitor of soluble guanylate cyclase. Residual relaxation persisted after treatment with L-N(ω)-nitroarginine (L-NA), a non-specific inhibitor of nitric oxide synthase (NOS), but disappeared following the addition of aminoguanidine (AG), a selective inhibitor of inducible NOS (iNOS). The relaxation response was also affected by tetraethylammonium, an inhibitor of endothelium-derived hyperpolarizing factor activity. In the second model, we investigated the biochemical events of nitrosative stress in human umbilical-vein endothelial cells (HUVECs). We measured iNOS and nitrotyrosine expression in HUVECs exposed to a dose of 4 Gy. The expression of iNOS and nitrotyrosine was greater in irradiated HUVECs than in untreated controls. Pretreatment with AG, L-N(6)-(1-iminoethyl) lysine hydrochloride (a selective inhibitor of iNOS), and L-NA attenuated nitrosative stress. While a selective target of radiation-induced vascular endothelial damage was not definitely determined, these results suggest that NO generated from iNOS could contribute to vasorelaxation. These studies highlight a potential role of iNOS inhibitors in ameliorating radiation-induced vascular endothelial damage. PMID:23704776

  17. Monosodium glutamate-induced oxidative kidney damage and possible mechanisms: a mini-review.


    Sharma, Amod


    Animal studies suggest that chronic monosodium glutamate (MSG) intake induces kidney damage by oxidative stress. However, the underlying mechanisms are still unclear, despite the growing evidence and consensus that α-ketoglutarate dehydrogenase, glutamate receptors and cystine-glutamate antiporter play an important role in up-regulation of oxidative stress in MSG-induced renal toxicity. This review summaries evidence from studies into MSG-induced renal oxidative damage, possible mechanisms and their importance from a toxicological viewpoint. PMID:26493866

  18. The Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage: Track Structure Effects and Cytogenetic Signatures of High-LET Exposure

    NASA Technical Reports Server (NTRS)

    George, K.; Hada, M.; Chappell, L.; Cucinotta, F. A.


    Track structure models predict that at a fixed value of LET, particles with lower charge number, Z will have a higher biological effectiveness compared to particles with a higher Z. In this report we investigated how track structure effects induction of chromosomal aberration in human cells. Human lymphocytes were irradiated in vitro with various energies of accelerated iron, silicon, neon, or titanium ions and chromosome damage was assessed in using three color FISH chromosome painting in chemically induced PCC samples collected a first cell division post irradiation. The LET values for these ions ranged from 30 to 195 keV/micrometers. Of the particles studied, Neon ions have the highest biological effectiveness for induction of total chromosome damage, which is consistent with track structure model predictions. For complex-type exchanges 64 MeV/ u Neon and 450 MeV/u Iron were equally effective and induced the most complex damage. In addition we present data on chromosomes exchanges induced by six different energies of protons (5 MeV/u to 2.5 GeV/u). The linear dose response term was similar for all energies of protons suggesting that the effect of the higher LET at low proton energies is balanced by the production of nuclear secondaries from the high energy protons. All energies of protons have a much higher percentage of complex-type chromosome exchanges than gamma rays, signifying a cytogenetic signature for proton exposures.

  19. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.


    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji


    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  20. Simulation of damage induced by ion implantation in Lithium Niobate

    NASA Astrophysics Data System (ADS)

    Bianconi, M.; Bentini, G. G.; Chiarini, M.; De Nicola, P.; Montanari, G. B.; Menin, A.; Nubile, A.; Sugliani, S.


    A simulation tool has been developed to engineer the damage formation in Lithium Niobate by ion irradiation with any atomic number and energy. Both nuclear and electronic processes were considered and, in particular, the dependence on the ion velocity of the electronic excitation damage efficiency has been taken into account. By using this tool it is possible both to draw damage nomograms, useful to qualitatively foresee the result of a given process, and to perform reliable simulations of the defect depth profiles, as demonstrated by the good agreement with the experimental data available in the literature.

  1. Helium vs. Proton Induced Displacement Damage in Electronic Materials

    NASA Technical Reports Server (NTRS)

    Ringo, Sawnese; Barghouty, A. F.


    In this project, the specific effects of displacement damage due to the passage of protons and helium nuclei on some typical electronic materials will be evaluated and contrasted. As the electronic material absorbs the energetic proton and helium momentum, degradation of performance occurs, eventually leading to overall failure. Helium nuclei traveling at the same speed as protons are expected to impart more to the material displacement damage; due to the larger mass, and thus momentum, of helium nuclei compared to protons. Damage due to displacement of atoms in their crystalline structure can change the physical properties and hence performance of the electronic materials.

  2. Modelling biofilm-induced formation damage and biocide treatment in subsurface geosystems

    PubMed Central

    Ezeuko, C C; Sen, A; Gates, I D


    Biofilm growth in subsurface porous media, and its treatment with biocides (antimicrobial agents), involves a complex interaction of biogeochemical processes which provide non-trivial mathematical modelling challenges. Although there are literature reports of mathematical models to evaluate biofilm tolerance to biocides, none of these models have investigated biocide treatment of biofilms growing in interconnected porous media with flow. In this paper, we present a numerical investigation using a pore network model of biofilm growth, formation damage and biocide treatment. The model includes three phases (aqueous, adsorbed biofilm, and solid matrix), a single growth-limiting nutrient and a single biocide dissolved in the water. Biofilm is assumed to contain a single species of microbe, in which each cell can be a viable persister, a viable non-persister, or non-viable (dead). Persisters describe small subpopulation of cells which are tolerant to biocide treatment. Biofilm tolerance to biocide treatment is regulated by persister cells and includes ‘innate’ and ‘biocide-induced’ factors. Simulations demonstrate that biofilm tolerance to biocides can increase with biofilm maturity, and that biocide treatment alone does not reverse biofilm-induced formation damage. Also, a successful application of biological permeability conformance treatment involving geologic layers with flow communication is more complicated than simply engineering the attachment of biofilm-forming cells at desired sites. PMID:23164434

  3. Laser-induced retinal damage thresholds for annular retinal beam profiles

    NASA Astrophysics Data System (ADS)

    Kennedy, Paul K.; Zuclich, Joseph A.; Lund, David J.; Edsall, Peter R.; Till, Stephen; Stuck, Bruce E.; Hollins, Richard C.


    The dependence of retinal damage thresholds on laser spot size, for annular retinal beam profiles, was measured in vivo for 3 μs, 590 nm pulses from a flashlamp-pumped dye laser. Minimum Visible Lesion (MVL)ED50 thresholds in rhesus were measured for annular retinal beam profiles covering 5, 10, and 20 mrad of visual field; which correspond to outer beam diameters of roughly 70, 160, and 300 μm, respectively, on the primate retina. Annular beam profiles at the retinal plane were achieved using a telescopic imaging system, with the focal properties of the eye represented as an equivalent thin lens, and all annular beam profiles had a 37% central obscuration. As a check on experimental data, theoretical MVL-ED50 thresholds for annular beam exposures were calculated using the Thompson-Gerstman granular model of laser-induced thermal damage to the retina. Threshold calculations were performed for the three experimental beam diameters and for an intermediate case with an outer beam diameter of 230 μm. Results indicate that the threshold vs. spot size trends, for annular beams, are similar to the trends for top hat beams determined in a previous study; i.e., the threshold dose varies with the retinal image area for larger image sizes. The model correctly predicts the threshold vs. spot size trends seen in the biological data, for both annular and top hat retinal beam profiles.

  4. Authigenic minerals: Biologically influenced and induced organomineralization

    NASA Astrophysics Data System (ADS)

    Dupraz, Christophe


    Organominerals are minerals precipitated by interactions with organic matter without enzymatic control. Organomineralization of authigenic carbonate minerals depends on two key components: (1) the "carbonate alkalinity engine" impacting the calcium carbonate saturation index and (2) the organic matrix comprised of extracellular organic matter (EOM), which provides a template for carbonate nucleation. The alkalinity engine can be "intrinsic" when microbial metabolisms increase supersaturation or lower the kinetic barrier of precipitation, or "extrinsic" when the physicochemical environment creates the conditions for mineral formation. The organic matrix produced by various communities within the microbial mats is known to influence nucleation, morphology and mineralogy of minerals through binding of cations. By playing with these two key components, three types of authigenic minerals can be formed: (1) a purely physicochemical precipitation on an abiotic substrate, (2) a precipitation "influenced" by the presence of an organic matrix but resulting from a physicochemical forcing (environmentally driven), or (3) a "microbially-induced" precipitation, in which both supersaturation and organic matrix are resulting from microbial activity. In this keynote, we will review important processes involved in the precipitation of authigenic carbonate minerals in modern microbial mats and open the discussion on the potential use of authigenic carbonate minerals as biosignatures in the fossil record.

  5. Femtosecond laser threshold: retinal damage versus induced breakdown mechanisms

    NASA Astrophysics Data System (ADS)

    Cain, Clarence P.; Toth, Cynthia A.; Stein, Cindy D.; Noojin, Gary D.; Stolarski, David J.; Rockwell, Benjamin A.; Boppart, Stephen A.; Roach, William P.


    Threshold measurements at 90 femtoseconds (fs) and 600 fs have been made for minimum visible lesions (MVLs) using Dutch Belted rabbit and Rhesus monkey eyes. Laser induced breakdown (LIB) thresholds on biological materials including vitreous, normal saline, tap water, and ultrapure water are reported along with irradiance calculations utilizing nonlinear transmission properties including self-focusing. At both pulsewidths the ED50 dose required for the Rhesus monkey eye was less than half the value determined for the Dutch Belted rabbit eye, all thresholds being 1 microjoule ((mu) J) or less. Measurements on the Rhesus eye at 600 fs found the ED50 dose (0.26 (mu) J) to be much lower than the ED50 dose at 90 fs (0.43 (mu) J). But for these two pulsewidths, almost the same energy level was determined for the Dutch Belted rabbit eye (0.94 (mu) J vs. 1.0 (mu) J). LIB threshold measurements at 100 fs and 300 fs using a simulated eye with isolated vitreous found the ED50 dosages to be 3.5 and 6.0 (mu) J respectively. We found in all cases that the ED50 dosages required to produce MVLs in 24 hours for rabbit and monkey eyes were less than the ED50 values measured for LIB in vitreous or saline or any other breakdown values reported. Also observed was the fact that many of the threshold lesions did not appear in the 1-hour postexposure check but clearly showed up at the 24-hour reading which provided for a much lower threshold dose after 24 hours. We discuss the energy levels and peak powers at which nonlinear effects can begin to occur.

  6. Electron-Induced Displacement Damage Effects in CCDs

    NASA Technical Reports Server (NTRS)

    Becker, Heidi N.; Elliott, Tom; Alexander, James W.


    We compare differences in parametric degradation for CCDs irradiated to the same displacement damage dose with 10-MeV and 50-MeV electrons. Charge transfer efficiency degradation was observed to not scale with NIEL for small signals.

  7. Shock induced multi-mode damage in depleted uranium

    SciTech Connect

    Koller, Darcie D; Cerreta, Ellen K; Gray, Ill, George T


    Recent dynamic damage studies on depleted uranium samples have revealed mixed mode failure mechanisms leading to incipient cracking as well as ductile failure processes. Results show that delamination of inclusions upon compression may provide nucleation sites for damage initiation in the form of crack tip production. However, under tension the material propagates cracks in a mixed shear localization and mode-I ductile tearing and cracking. Cracks tips appear to link up through regions of severe, shear dominated plastic flow. Shock recovery experiments were conducted on a 50 mm single stage light gas gun. Serial metallographic sectioning was conducted on the recovered samples to characterize the bulk response of the sample. Experiments show delaminated inclusions due to uniaxial compression without damage propagation. Further results show the propagation of the damage through tensile loading to the incipient state, illustrating ductile processes coupled with mixed mode-I tensile ductile tearing, shear localization, and mode-I cracking in depleted uranium.

  8. Genetic variation and exercise-induced muscle damage: implications for athletic performance, injury and ageing.


    Baumert, Philipp; Lake, Mark J; Stewart, Claire E; Drust, Barry; Erskine, Robert M


    Prolonged unaccustomed exercise involving muscle lengthening (eccentric) actions can result in ultrastructural muscle disruption, impaired excitation-contraction coupling, inflammation and muscle protein degradation. This process is associated with delayed onset muscle soreness and is referred to as exercise-induced muscle damage. Although a certain amount of muscle damage may be necessary for adaptation to occur, excessive damage or inadequate recovery from exercise-induced muscle damage can increase injury risk, particularly in older individuals, who experience more damage and require longer to recover from muscle damaging exercise than younger adults. Furthermore, it is apparent that inter-individual variation exists in the response to exercise-induced muscle damage, and there is evidence that genetic variability may play a key role. Although this area of research is in its infancy, certain gene variations, or polymorphisms have been associated with exercise-induced muscle damage (i.e. individuals with certain genotypes experience greater muscle damage, and require longer recovery, following strenuous exercise). These polymorphisms include ACTN3 (R577X, rs1815739), TNF (-308 G>A, rs1800629), IL6 (-174 G>C, rs1800795), and IGF2 (ApaI, 17200 G>A, rs680). Knowing how someone is likely to respond to a particular type of exercise could help coaches/practitioners individualise the exercise training of their athletes/patients, thus maximising recovery and adaptation, while reducing overload-associated injury risk. The purpose of this review is to provide a critical analysis of the literature concerning gene polymorphisms associated with exercise-induced muscle damage, both in young and older individuals, and to highlight the potential mechanisms underpinning these associations, thus providing a better understanding of exercise-induced muscle damage. PMID:27294501

  9. Is Allelopathic Activity of Ipomoea murucoides Induced by Xylophage Damage?

    PubMed Central

    Flores-Palacios, Alejandro; Corona-López, Angélica María; Rios, María Yolanda; Aguilar-Guadarrama, Berenice; Toledo-Hernández, Víctor Hugo; Rodríguez-López, Verónica; Valencia-Díaz, Susana


    Herbivory activates the synthesis of allelochemicals that can mediate plant-plant interactions. There is an inverse relationship between the activity of xylophages and the abundance of epiphytes on Ipomoea murucoides. Xylophagy may modify the branch chemical constitution, which also affects the liberation of allelochemicals with defense and allelopathic properties. We evaluated the bark chemical content and the effect of extracts from branches subjected to treatments of exclusion, mechanical damage and the presence/absence of epiphytes, on the seed germination of the epiphyte Tillandsia recurvata. Principal component analysis showed that branches without any treatment separate from branches subjected to treatments; damaged and excluded branches had similar chemical content but we found no evidence to relate intentional damage with allelopathy; however 1-hexadecanol, a defense volatile compound correlated positively with principal component (PC) 1. The chemical constitution of branches subject to exclusion plus damage or plus epiphytes was similar among them. PC2 indicated that palmitic acid (allelopathic compound) and squalene, a triterpene that attracts herbivore enemies, correlated positively with the inhibition of seed germination of T. recurvata. Inhibition of seed germination of T. recurvata was mainly correlated with the increment of palmitic acid and this compound reached higher concentrations in excluded branches treatments. Then, it is likely that the allelopathic response of I. murucoides would increase to the damage (shade, load) that may be caused by a high load of epiphytes than to damage caused by the xylophages. PMID:26625350

  10. Theoretical analysis for temperature dependence of laser- induced damage threshold of optical thin films

    NASA Astrophysics Data System (ADS)

    Mikami, K.; Motokoshi, S.; Somekawa, T.; Jitsuno, T.; Fujita, M.; Tanaka, KA; Azechi, H.


    The temperature dependence of the laser-induced damage threshold on optical coatings was studied in detail for laser pulses from 123 K to 473 K at different temperatures. The laser-induced damage threshold increased with decreasing temperatures when we tested long pulses (200 ps and 4 ns). The temperature dependence, however, was reversed for pulses shorter than a few picoseconds (100 fs testing). We propose a scaling model with a flowchart that includes three separate processes: free-electron generation, electron multiplication, and electron heating. Furthermore, we calculated the temperature dependence of laser-induced damage thresholds at different temperatures. Our calculation results agreed well with the experimental results.

  11. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.


    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  12. Lightning Strike Induced Damage Mechanisms of Carbon Fiber Composites

    NASA Astrophysics Data System (ADS)

    Kawakami, Hirohide

    Composite materials have a wide application in aerospace, automotive, and other transportation industries, because of the superior structural and weight performances. Since carbon fiber reinforced polymer composites possess a much lower electrical conductivity as compared to traditional metallic materials utilized for aircraft structures, serious concern about damage resistance/tolerance against lightning has been rising. Main task of this study is to clarify the lightning damage mechanism of carbon fiber reinforced epoxy polymer composites to help further development of lightning strike protection. The research on lightning damage to carbon fiber reinforced polymer composites is quite challenging, and there has been little study available until now. In order to tackle this issue, building block approach was employed. The research was started with the development of supporting technologies such as a current impulse generator to simulate a lightning strike in a laboratory. Then, fundamental electrical properties and fracture behavior of CFRPs exposed to high and low level current impulse were investigated using simple coupon specimens, followed by extensive parametric investigations in terms of different prepreg materials frequently used in aerospace industry, various stacking sequences, different lightning intensity, and lightning current waveforms. It revealed that the thermal resistance capability of polymer matrix was one of the most influential parameters on lightning damage resistance of CFRPs. Based on the experimental findings, the semi-empirical analysis model for predicting the extent of lightning damage was established. The model was fitted through experimental data to determine empirical parameters and, then, showed a good capability to provide reliable predictions for other test conditions and materials. Finally, structural element level lightning tests were performed to explore more practical situations. Specifically, filled-hole CFRP plates and patch

  13. Electron flow through biological molecules: Does hole hopping protect proteins from oxidative damage?

    PubMed Central

    Winkler, Jay R.; Gray, Harry B.


    Biological electron transfers often occur between metal-containing cofactors that are separated by very large molecular distances. Employing photosensitizer-modified iron and copper proteins, we have shown that single-step electron tunneling can occur on nanosecond to microsecond timescales at distances between 15 and 20 angstroms. We also have shown that charge transport can occur over even longer distances by hole hopping (multistep tunneling) through intervening tyrosines and tryptophans. In this Perspective, we advance the hypothesis that such hole hopping through Tyr/Trp chains could protect oxygenase, dioxygenase, and peroxidase enzymes from oxidative damage. In support of this view, by examining the structures of P450 (CYP102A) and 2OG-Fe (TauD) enzymes, we have identified candidate Tyr/Trp chains that could transfer holes from uncoupled high-potential intermediates to reductants in contact with protein surface sites. PMID:26537399

  14. DNA damage as a biological marker in aquatic organisms exposed to benzo(a)pyrene

    SciTech Connect

    Shugart, L.R.; Jimenez, B.D.; McCarthy, J.F.


    We show that minute quantities of BaPDE-DNA adducts in the liver of bluegill sunfish can be detected and quantitated using a simple analytical technique whose sensitivity depends upon the intrinsic fluorescence of the specific adduct being analyzed. These adducts represent damage to DNA of the organism, which, if left uncorrected, could trigger a sequence of events that culminate in the appearance of an overt malignancy. We believe that the data reported here demonstrate that the covalent interaction of genotoxic chemicals with cellular macromolecules such as DNA is, potentially, a sensitive biological marker which could be of early predictive value in assessing exposure and its significance. 13 refs., 1 fig., 1 tab.

  15. The processes controlling damage zone propagation induced by wellbore fluid injection

    NASA Astrophysics Data System (ADS)

    Shalev, Eyal; Lyakhovsky, Vladimir


    Induced seismicity by wellbore fluid injection is an important tool for enhancing permeability in hydrocarbon and geothermal reservoirs. We model nucleation and propagation of damage zones and seismicity patterns for two-dimensional plane strain configuration at a depth of 5 km using novel numerical software developed in the course of this study. Simulations include the coupling of poro-elastic deformation and groundwater flow with damage evolution (weakening and healing) and its effect on the elastic and hydrologic parameters. Results show that the process occurring during fluid injection can be divided into four stages. The duration of each stage depends on the hydrological and mechanical parameters. Initially, fluid flows into the rock with no seismic events (5 to 20 hr). At this stage, damage increases from 0 to 1 creating two sets of conjugate zones (four narrow damage zones). Thereafter, the occurrence of seismic events and faulting begins and accelerates for the next 20 to 70 hr. At the initial part of this stage, two of the damage zones create stress shadows on the other two damage zones that stop progressing. The velocity of the advancing damage is limited only by the rock parameters controlling damage evolution. At the third stage, which lasts for the following 20-30 hr, damage acceleration decreases because fluid transport becomes a limiting factor as the damage zones are too long to efficiently transfer the pressure from the well to the tip of the damage zones. Finally, the damage decelerates and even stops in some cases. The propagation of damage is controlled and limited by fluid transport from the injection well to the tip of the damage zones because fluid transport does not keep up with the dilatancy of the damage zones. The time and distance of propagation depend on the damage-permeability coupling and the remote shear stress. Higher remote shear stress causes shorter initial periods of no seismicity; strong damage-permeability coupling causes

  16. Modelling blast induced damage from a fully coupled explosive charge

    PubMed Central

    Onederra, Italo A.; Furtney, Jason K.; Sellers, Ewan; Iverson, Stephen


    This paper presents one of the latest developments in the blasting engineering modelling field—the Hybrid Stress Blasting Model (HSBM). HSBM includes a rock breakage engine to model detonation, wave propagation, rock fragmentation, and muck pile formation. Results from two controlled blasting experiments were used to evaluate the code’s ability to predict the extent of damage. Results indicate that the code is capable of adequately predicting both the extent and shape of the damage zone associated with the influence of point-of-initiation and free-face boundary conditions. Radial fractures extending towards a free face are apparent in the modelling output and matched those mapped after the experiment. In the stage 2 validation experiment, the maximum extent of visible damage was of the order of 1.45 m for the fully coupled 38-mm emulsion charge. Peak radial velocities were predicted within a relative difference of only 1.59% at the nearest history point at 0.3 m from the explosive charge. Discrepancies were larger further away from the charge, with relative differences of −22.4% and −42.9% at distances of 0.46 m and 0.61 m, respectively, meaning that the model overestimated particle velocities at these distances. This attenuation deficiency in the modelling produced an overestimation of the damage zone at the corner of the block due to excessive stress reflections. The extent of visible damage in the immediate vicinity of the blasthole adequately matched the measurements. PMID:26412978

  17. Variation of the enhanced biologically damaging solar UV due to clouds.


    Parisi, Alfio V; Downs, Nathan


    The variation of the biologically damaging solar UV (UVBE) enhanced by clouds above that of clear sky UVBE has been investigated. This was undertaken for summer through to winter for SZA of 5 to 60 degrees employing an integrated automatic cloud and spectral UV measurement system that recorded the solar UV spectra and the sky images at five minute intervals. The UVBE calculated with action spectra with higher relative effectiveness in the UVA produced the lower percentage of cloud enhanced cases. The DNA UVBE provided the highest percentage of cloud enhanced cases compared to the total number of UV scans with 2.2% cloud enhanced cases. As a comparison, the plant and fish melanoma UVBE provided the lowest percentage of cloud enhanced cases with 0.6 to 0.8% cloud enhanced cases. For the cases of cloud enhanced UVBE, the average ratio of the measured UVBE to calculated cloud free UVBE for the photokeratitis, cataracts, plant, generalized plant damage and fish melanoma action spectra was 1.21 to 1.25. In comparison, the highest value of 1.4 was for the DNA action spectrum. PMID:15238998

  18. Long-term biological effects induced by ionizing radiation--implications for dose mediated risk.


    Miron, S D; Astărăstoae, V


    Ionizing radiations are considered to be risk agents that are responsible for the effects on interaction with living matter. The occurring biological effects are due to various factors such as: dose, type of radiation, exposure time, type of biological tissue, health condition and the age of the person exposed. The mechanisms involved in the direct modifications of nuclear DNA and mitochondrial DNA are reviewed. Classical target theory of energy deposition in the nucleus that causes DNA damages, in particular DNA double-strand breaks and that explanation of the biological consequences of ionizing radiation exposure is a paradigm in radiobiology. Recent experimental evidences have demonstrated the existence of a molecular mechanism that explains the non-targeted effects of ionizing radiation exposure. Among these novel data, genomic instability and a variety of bystander effects are discussed here. Those bystander effects of ionizing radiation are fulfilled by cellular communication systems that give rise to non-targeted effects in the neighboring non irradiated cells. This paper provides also a commentary on the synergistic effects induced by the co-exposures to ionizing radiation and various physical agents such as electromagnetic fields and the co-exposures to ionizing radiation and chemical environmental contaminants such as metals. The biological effects of multiple stressors on genomic instability and bystander effects are also discussed. Moreover, a brief presentation of the methods used to characterize cyto- and genotoxic damages is offered. PMID:25341291

  19. Activation-induced and damage-induced cell death in aging human T cells.


    Sikora, Ewa


    In multicellular organisms the proper system functionality is ensured by the balance between cell division, differentiation, senescence and death. This balance is changed during aging. Immunosenescence plays a crucial role in aging and leads to the shrinkage of T cell repertoire and the propensity to apoptosis. The elimination of expanded T cells at the end of immune response is crucial to maintain homeostasis and avoid any uncontrolled inflammation. Resting mature T lymphocytes, when activated via their antigen-specific receptor (TCR) and CD28 co-receptor, start to proliferate and then undergo the so called activation induced cell death (AICD), which mechanistically is triggered by the death receptor and leads to apoptosis. T lymphocytes, like other cells, are also exposed to damage, which can trigger the so called damage-induced cell death (DICD). It was hypothesized that oxidative stress and chronic antigenic load increasing with age reduced lymphocyte susceptibility to DICD and enhanced a proinflamatory status leading to increased AICD. However, data collected so far are inconsistent and does not support this assumption. Systematic and comprehensive studies are still needed for conclusive elucidation of the role of AICD and DICD in human immunosenescence, including the role of autophagy and necroptosis in the processes. PMID:25843236

  20. Ceramide Production Mediates Aldosterone-Induced Human Umbilical Vein Endothelial Cell (HUVEC) Damages

    PubMed Central

    Zhang, Yumei; Pan, Yu; Bian, Zhixiang; Chen, Peihua; Zhu, Shijian; Gu, Huiyi; Guo, Liping; Hu, Chun


    Here, we studied the underlying mechanism of aldosterone (Aldo)-induced vascular endothelial cell damages by focusing on ceramide. We confirmed that Aldo (at nmol/L) inhibited human umbilical vein endothelial cells (HUVEC) survival, and induced considerable cell apoptosis. We propose that ceramide (mainly C18) production might be responsible for Aldo-mediated damages in HUVECs. Sphingosine-1-phosphate (S1P), an anti-ceramide lipid, attenuated Aldo-induced ceramide production and following HUVEC damages. On the other hand, the glucosylceramide synthase (GCS) inhibitor PDMP or the ceramide (C6) potentiated Aldo-induced HUVEC apoptosis. Eplerenone, a mineralocorticoid receptor (MR) antagonist, almost completely blocked Aldo-induced C18 ceramide production and HUVEC damages. Molecularly, ceramide synthase 1 (CerS-1) is required for C18 ceramide production by Aldo. Knockdown of CerS-1 by targeted-shRNA inhibited Aldo-induced C18 ceramide production, and protected HUVECs from Aldo. Reversely, CerS-1 overexpression facilitated Aldo-induced C18 ceramide production, and potentiated HUVEC damages. Together, these results suggest that C18 ceramide production mediates Aldo-mediated HUVEC damages. MR and CerS-1 could be the two signaling molecule regulating C18 ceramide production by Aldo. PMID:26788916

  1. Description of particle induced damage on protected silver coatings.


    Schwinde, Stefan; Schürmann, Mark; Jobst, Paul Johannes; Kaiser, Norbert; Tünnermann, Andreas


    In the visible to infrared spectral range, highly-reflective silver mirrors are applied in the manufacture of optical instruments such as telescopes. However, it is still difficult to combine high reflectivity and long-term stability of the protected silver coating. We show that the deposition of impervious protective layers is necessary but often not sufficient for long-term environmental stability. Hygroscopic air borne particles absorbed by the protections surface attract water molecules and form a solution. This solution first damages the protection, subsequently permeates the protection and finally damages the silver whereby the reflectivity is reduced. We demonstrate this particular damage mechanism with different experiments and describe this mechanism in detail. PMID:26192652

  2. Cryptococcus neoformans-induced macrophage lysosome damage crucially contributes to fungal virulence1

    PubMed Central

    Davis, Michael J.; Eastman, Alison J.; Qiu, Yafeng; Gregorka, Brian; Kozel, Thomas R.; Osterholzer, John J.; Curtis, Jeffrey L.; Swanson, Joel A.; Olszewski, Michal A.


    Upon ingestion by macrophages, Cryptococcus neoformans (Cn) can survive and replicate intracellularly unless the macrophages become classically activated. The mechanism enabling intracellular replication is not fully understood; neither are the mechanisms which allow classical activation to counteract replication. Cn-induced lysosome damage was observed in infected murine bone marrow-derived macrophages, increased with time and required yeast viability. To demonstrate lysosome damage in the infected host, we developed a novel flow-cytometric method for measuring lysosome damage. Increased lysosome damage was found in Cn-containing lung cells compared to Cn–free cells. Among Cn-containing myeloid cells, recently recruited cells displayed lower damage than resident cells, consistent with the protective role of recruited macrophages. The magnitude of lysosome damage correlated with increased Cn replication. Experimental induction of lysosome damage increased Cn replication. Activation of macrophages with IFN-γ abolished macrophage lysosome damage and enabled increased killing of Cn. We conclude that induction of lysosome damage is an important Cn survival strategy and that classical activation of host macrophages counters replication by preventing damage. Thus, therapeutic strategies which decrease lysosomal damage, or increase resistance to such damage, could be valuable in treating cryptococcal infections. PMID:25637026

  3. Properties of defect-induced multiple pulse laser damage of transmission components.


    Ma, Bin; Zhang, Li; Lu, Menglei; Wang, Ke; Jiao, Hongfei; Zhang, Jinlong; Cheng, Xinbin; Yang, Liming; Wang, Zhanshan


    When the number of laser pulses increases, the laser-induced damage threshold of the optical components gradually declines. The magnitude and tendency of this reduced threshold are associated with various factors. Furthermore, this reduced threshold is conclusively determined by the limiting factors or defect characteristics that trigger damage to optical components. Then, fully understanding the damage properties of different kinds of defects will contribute to the optimization of the performance and lifetime of the optical components. In this study, the statistical and deterministic characterizations of the fatigue effect are used to evaluate the properties of the multiple pulse laser damage of transmission components. First, the influence of spot sizes and polishing materials on the properties of the multiple pulse laser damage of optical components is discussed. Then, the structural, absorptive, and mixed artificial defects are fabricated, and the damage characteristics are evaluated and analyzed. Finally, the damage mechanism of different factors has been clarified. PMID:27607284

  4. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.


    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke


    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  5. The Effects of Creatine Supplementation on Exercise-Induced Muscle Damage.

    ERIC Educational Resources Information Center

    Rawson, Eric S.; Gunn, Bridget; Clarkson, Priscilla M.


    Investigated the effects of oral creatine (Cr) supplementation on markers of exercise-induced muscle damage following high-force eccentric exercise in men randomly administered Cr or placebo. Results indicated that 5 days of Cr supplementation did not reduce indirect makers of muscle damage or enhance recovery from high-force eccentric exercise.…

  6. BHT blocks NfkB activation and Ethanol-Induced Brain Damage

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Binge ethanol administration causes corticolimbic brain damage that models alcoholic neurodegeneration. The mechanism of binge ethanol induced degeneration is unknown, but is not glutamate neurotoxicity. To test the hypothesis that oxidative stress and inflammation are mechanisms of binge ethanol ...

  7. Catastrophic nanosecond laser induced damage in the bulk of potassium titanyl phosphate crystals

    SciTech Connect

    Wagner, Frank R. Natoli, Jean-Yves; Akhouayri, Hassan; Commandré, Mireille; Duchateau, Guillaume


    Due to its high effective nonlinearity and the possibility to produce periodically poled crystals, potassium titanyl phosphate (KTiOPO{sub 4}, KTP) is still one of the economically important nonlinear optical materials. In this overview article, we present a large study on catastrophic nanosecond laser induced damage in this material and the very similar RbTiOPO{sub 4} (RTP). Several different systematic studies are included: multiple pulse laser damage, multi-wavelength laser damage in KTP, damage resistance anisotropy, and variations of the laser damage thresholds for RTP crystals of different qualities. All measurements were carried out in comparable experimental conditions using a 1064 nm Q-switched laser and some were repeated at 532 nm. After summarizing the experimental results, we detail the proposed model for laser damage in this material and discuss the experimental results in this context. According to the model, nanosecond laser damage is caused by light-induced generation of transient laser-damage precursors which subsequently provide free electrons that are heated by the same nanosecond pulse. We also present a stimulated Raman scattering measurement and confront slightly different models to the experimental data. Finally, the physical nature of the transient damage precursors is discussed and similarities and differences to laser damage in other crystals are pointed out.

  8. Automated cell inspection systems for the determination of DNA damage and repair in the biological research

    NASA Astrophysics Data System (ADS)

    Boecker, Wilfried


    One important field of interest in medicine and biology is the evaluation of DNA repair and cellular DNA damage after physical or chemical treatment. Manual analysis has some disadvantages such as a decrease in recognition ability during the time consuming observations as well as a requirement of experts for microscopic investigations. Therefore, automatic inspection and recognition of biological structures in several applications such as fluorescence in situ hybridization (FISH), fluorescence immuno-assays, comet-assay, chromosome karyotyping and micronucleus assay have been considerably advanced in the last decade. This presentation will give an overview of the image analysis and pattern recognition methods employed in different automated cell inspection systems which have been developed in our institute during the last years. Depending on the kind of assay, different experimental setups must be used in order to extract the respective measurement quantities. For example FISH technique requires a very sensitive fluorescence microscope combined with an image intensified target or time integrating camera. The major algorithms for image preprocessing and image segmentation based on mathematical morphology are briefly introduced. Feature classification is carried out with different methods.

  9. Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death.


    Bitomsky, Nadja; Conrad, Elisa; Moritz, Christian; Polonio-Vallon, Tilman; Sombroek, Dirk; Schultheiss, Kathrin; Glas, Carolina; Greiner, Vera; Herbel, Christoph; Mantovani, Fiamma; del Sal, Giannino; Peri, Francesca; Hofmann, Thomas G


    Excessive genome damage activates the apoptosis response. Protein kinase HIPK2 is a key regulator of DNA damage-induced apoptosis. Here, we deciphered the molecular mechanism of HIPK2 activation and show its relevance for DNA damage-induced apoptosis in cellulo and in vivo. HIPK2 autointeracts and site-specifically autophosphorylates upon DNA damage at Thr880/Ser882. Autophosphorylation regulates HIPK2 activity and mutation of the phosphorylation-acceptor sites deregulates p53 Ser46 phosphorylation and apoptosis in cellulo. Moreover, HIPK2 autophosphorylation is conserved between human and zebrafish and is important for DNA damage-induced apoptosis in vivo. Mechanistically, autophosphorylation creates a binding signal for the phospho-specific isomerase Pin1. Pin1 links HIPK2 activation to its stabilization by inhibiting HIPK2 polyubiquitination and modulating Siah-1-HIPK2 interaction. Concordantly, Pin1 is required for DNA damage-induced HIPK2 stabilization and p53 Ser46 phosphorylation and is essential for induction of apotosis both in cellulo and in zebrafish. Our results identify an evolutionary conserved mechanism regulating DNA damage-induced apoptosis. PMID:24145406

  10. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.


    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang


    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  11. SNF2H interacts with XRCC1 and is involved in repair of H2O2-induced DNA damage.


    Kubota, Yoshiko; Shimizu, Shinji; Yasuhira, Shinji; Horiuchi, Saburo


    The protein XRCC1 has no inherent enzymatic activity, and is believed to function in base excision repair as a dedicated scaffold component that coordinates other DNA repair factors. Repair foci clearly represent the recruitment and accumulation of DNA repair factors at sites of damage; however, uncertainties remain regarding their organization in the context of nuclear architecture and their biological significance. Here we identified the chromatin remodeling factor SNF2H/SMARCA5 as a novel binding partner of XRCC1, with their interaction dependent on the casein kinase 2-mediated constitutive phosphorylation of XRCC1. The proficiency of repairing H2O2-induced damage was strongly impaired by SNF2H knock-down, and similar impairment was observed with knock-down of both XRCC1 and SNF2H simultaneously, suggesting their role in a common repair pathway. Most SNF2H exists in the nuclear matrix fraction, forming salt extraction-resistant foci-like structures in unchallenged nuclei. Remarkably, damage-induced formation of both PAR and XRCC1 foci depended on SNF2H, and the PAR and XRCC1 foci co-localized with the SNF2H foci. We propose a model in which a base excision repair complex containing damaged chromatin is recruited to specific locations in the nuclear matrix for repair, with this recruitment mediated by XRCC1-SNF2H interaction. PMID:27268481

  12. Laser-induced fluorescence-cued, laser-induced breakdown spectroscopy biological-agent detection

    SciTech Connect

    Hybl, John D.; Tysk, Shane M.; Berry, Shaun R.; Jordan, Michael P


    Methods for accurately characterizing aerosols are required for detecting biological warfare agents. Currently, fluorescence-based biological agent sensors provide adequate detection sensitivity but suffer from high false-alarm rates. Combining single-particle fluorescence analysis with laser-induced breakdown spectroscopy (LIBS) provides additional discrimination and potentially reduces false-alarm rates. A transportable UV laser-induced fluorescence-cued LIBS test bed has been developed and used to evaluate the utility of LIBS for biological-agent detection. Analysis of these data indicates that LIBS adds discrimination capability to fluorescence-based biological-agent detectors.However, the data also show that LIBS signatures of biological agent simulants are affected by washing. This may limit the specificity of LIBS and narrow the scope of its applicability in biological-agent detection.

  13. NOTE: Comparison of biologically damaging spectral solar ultraviolet radiation at a southern hemisphere sub-tropical site

    NASA Astrophysics Data System (ADS)

    Parisi, A. V.; Sabburg, J.; Kimlin, M. G.


    The first dataset of a complete year of biologically damaging spectral UV at a sub-tropical latitude in the southern hemisphere has been presented. The new data provides a baseline dataset against which comparisons can be made in the future to establish if there have been any long term trends in the biologically damaging UV. The general shape of the variation of the daily biologically damaging exposures through the year depends on the relative response of the various action spectra at the different wavelengths. The ratio of the daily erythemal to actinic exposures drops by approximately 20 to 25% from winter to summer. The ratio of the erythemal to DNA exposures drops by approximately 50% over the same period. In contrast, the ratio of the erythemal to plant damage exposures is higher in summer compared to winter. This is due to the changes in the relative proportion of UVA to UVB wavebands and relative responses of the different action spectra. The relative changes for the different action spectra show that the erythemal action spectrum cannot be used as a proxy for other biologically damaging responses.

  14. Study of filamentary damage in synthesized silica induced by chirped femtosecond laser pulses

    SciTech Connect

    Onda, Satoshi; Watanabe, Wataru; Yamada, Kazuhiro; Itoh, Kazuyoshi; Nishii, Junji


    Different filamentary tracks in synthesized silica were induced by varying both the pulse duration and the incident energy of chirped laser pulses under slow-focusing conditions. Short-duration pulses induced filamentary refractive-index change, whereas longer pulses produced scattering damage in filamentary tracks. We report a systematic study on the morphology and birefringence of filamentary refractive-index change and scattering damage.

  15. Relationship between recurrent liquefaction-induced damage and subsurface conditions in Midorigaoka, Japan

    SciTech Connect

    Wakamatsu, Kazue; Yoshida, Nozomu


    Midorigaoka, Kushiro City, northeast Japan, suffered liquefaction-induced ground failures during four successive earthquakes in the past thirty years. This paper presents the ground failures and their effects to structures observed in Midorigaoka during the earthquakes, and examines the relationships between recurrent liquefaction-induced damage and subsurface conditions. As a result, thick liquefiable fill, slope of the ground surface, and subsurface water conditions, which resulted primarily from filling a marshy valley, are found to be responsible on the damage.

  16. Laser-induced damage in photopolymers thin films with ultrashort pulses

    NASA Astrophysics Data System (ADS)

    Žukauskas, Albertas; BatavičiÅ«tÄ--, GintarÄ--; Å čiuka, Mindaugas; Melninkaitis, Andrius; Malinauskas, Mangirdas


    We characterize laser-induced damage threshold (LIDT) in transparent photopolymers by a sub-ps laser pulses of 515 nm wavelength representing case of high light intensities. Five different photopolymers (SZ2080, OrmoComp, SU-8, PDMS and PMMA) widely used in the laser lithography are investigated. The relationship of the damage threshold and optical band-gap energy of the polymers indicating possible damage mechanism is considered. Incubation model validating damage threshold dependence on the number of laser pulses is studied as well. The obtained characteristic values of LIDT reveal potential of photopolymers and their possible applications in high power laser systems.

  17. Damage of vascular endothelial barrier induced by explosive blast and its clinical significance.


    Wang, Jian-Min; Chen, Jing


    In recent years, injuries induced by explosive blast have got more and more attention owing to weapon development and frequent terrorist activities. Tear, bleeding and edema of tissues and organs are the main manifestations of blast shock wave damage. Vascular endothelial barrier is the main defense of tissues and organs' integrity. This article aims to discuss possible mechanisms of endothelial barrier damage induced by explosive blast and main manifestations of blood brain barrier, bloodeair barrier, and intestinal vascular barrier impairments. In addition, the main regulatory factors of vascular permeability are also summarized so as to provide theoretical basis for prevention and cure of vascular endothelial barrier damage resulting from explosive blast. PMID:27321288

  18. Radiation-Induced Liver Damage: Correlation of Histopathology with Hepatobiliary Magnetic Resonance Imaging, a Feasibility Study

    SciTech Connect

    Seidensticker, Max; Burak, Miroslaw; Kalinski, Thomas; Garlipp, Benjamin; Koelble, Konrad; Wust, Peter; Antweiler, Kai; Seidensticker, Ricarda; Mohnike, Konrad; Pech, Maciej; Ricke, Jens


    PurposeRadiotherapy of liver malignancies shows promising results (radioembolization, stereotactic irradiation, interstitial brachytherapy). Regardless of the route of application, a certain amount of nontumorous liver parenchyma will be collaterally damaged by radiation. The functional reserve may be significantly reduced with an impact on further treatment planning. Monitoring of radiation-induced liver damage by imaging is neither established nor validated. We performed an analysis to correlate the histopathological presence of radiation-induced liver damage with functional magnetic resonance imaging (MRI) utilizing hepatobiliary contrast media (Gd-BOPTA).MethodsPatients undergoing local high-dose-rate brachytherapy for whom a follow-up hepatobiliary MRI within 120 days after radiotherapy as well as an evaluable liver biopsy from radiation-exposed liver tissue within 7 days before MRI were retrospectively identified. Planning computed tomography (CT)/dosimetry was merged to the CT-documentation of the liver biopsy and to the MRI. Presence/absence of radiation-induced liver damage (histopathology) and Gd-BOPTA uptake (MRI) as well as the dose applied during brachytherapy at the site of tissue sampling was determined.ResultsFourteen biopsies from eight patients were evaluated. In all cases with histopathological evidence of radiation-induced liver damage (n = 11), no uptake of Gd-BOPTA was seen. In the remaining three, cases no radiation-induced liver damage but Gd-BOPTA uptake was seen. Presence of radiation-induced liver damage and absence of Gd-BOPTA uptake was correlated with a former high-dose exposition.ConclusionsAbsence of hepatobiliary MRI contrast media uptake in radiation-exposed liver parenchyma may indicate radiation-induced liver damage. Confirmatory studies are warranted.

  19. Glutathione prevents ethanol induced gastric mucosal damage and depletion of sulfhydryl compounds in humans.

    PubMed Central

    Loguercio, C; Taranto, D; Beneduce, F; del Vecchio Blanco, C; de Vincentiis, A; Nardi, G; Romano, M


    Whether parenteral administration of reduced glutathione prevented ethanol induced damage to and depletion of sulfhydryl compounds in the human gastric mucosa was investigated. Ten healthy volunteers underwent endoscopy on three separate occasions. Gastric mucosal damage was induced by spraying 80% ethanol on to the gastric mucosa through the biopsy channel of the endoscope. The gastric mucosal score, total sulfhydryls, glutathione, and cysteine were evaluated in basal conditions and after ethanol administration with and without pretreatment with parenteral glutathione. Glutathione significantly decreased the extent of ethanol induced macroscopic injury to the mucosa of the gastric body and antrum. Glutathione's protective effect is associated with appreciable inhibition of ethanol induced depletion of gastric sulfhydryl compounds. This is the first report of protection against ethanol induced gastric mucosal damage by a sulfhydryl containing agent in humans. PMID:8432465

  20. The effect of pseudo-accumulation in the measurement of fatigue laser-induced damage threshold

    NASA Astrophysics Data System (ADS)

    Melninkaitis, A.; Mirauskas, J.; Jupé, M.; Ristau, D.; Arenberg, J. W.; Sirutkaitis, V.


    Laser-induced damage threshold determination as a function of the number of incident pulses on a specific optic is a classic problem in laser damage studies. There are several models of the fundamental mechanisms explaining the fatigue laser damage behavior including temperature accumulation and changes of electronic or chemical material structure. Herewith we discuss the effects of unstable laser radiation on S-on-1 laser-induced damage probability. Numerical simulations of S-on-1 measurements for specific cases of defect densities, spot sizes and beam jitters are performed. It is demonstrated that the statistical effects of "pseudo-accumulation" reasoned by unstable laser radiation in transparent dielectrics containing nanometer sized defects leads to accumulation-like behavior. The magnitudes of the random beam walking and the energy fluctuations are directly related to the damage probability. Experimental results are also introduced to illustrate the theoretical results.

  1. Laser-induced damage behaviors of antireflective coatings at cryogenic condition.


    Wang, He; Zhang, Weili; He, Hongbo


    The laser-induced damage to antireflective coatings on Yb:YAG crystals under different temperatures was investigated. An optical profiler, field-emission scanning-electron microscopy, and a step profiler were used to determine the damage morphology, including size and depth. The results show that there is about 5 J/cm(2) decrease in the laser-induced damage threshold of cryogenic conditions compared to that of room temperature in 1-on-1 test mode, and a 3 J/cm(2) decrease in 100-on-1 mode. There is an accumulation effect in both cases. Meanwhile, the damage areas and depths are also much larger under cryogenic conditions. The precipitation of the subsurface defects in the substrate and the thermal stress in the interface between the film and the substrate under cryogenic conditions are considered to be the key factors in the unique damage behaviors. PMID:23262610

  2. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.


    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  3. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan


    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  4. X-ray induced damage observations in ZERODUR mirrors

    SciTech Connect

    Takacs, P.Z.; Furenlid, K.; Furenlid, L.


    Catastrophic damage has been observed in some ZERODUR mirrors used as first mirrors in two beam lines at the National Synchrotron Light Source (NSLS). Despite the high reflectivity of the coatings used on these mirrors, a significant flux of high energy photons penetrates below the coating and is absorbed in the substrate. Although model calculations indicate that the local temperature does not increase significantly, the authors suspect that over long time periods the absorbed flux produces structural changes in the material, leading to a build-up of surface stress, gross figure changes, and growth of fractures. These changes are probably related to the nature of the two-phase glass-ceramic composition of the ZERODUR material. Metal mirrors and single-phase materials do not exhibit such catastrophic damage under similar exposure conditions.

  5. Tubular Overexpression of Gremlin Induces Renal Damage Susceptibility in Mice

    PubMed Central

    Droguett, Alejandra; Krall, Paola; Burgos, M. Eugenia; Valderrama, Graciela; Carpio, Daniel; Ardiles, Leopoldo; Rodriguez-Diez, Raquel; Kerr, Bredford; Walz, Katherina; Ruiz-Ortega, Marta; Egido, Jesus; Mezzano, Sergio


    A growing number of patients are recognized worldwide to have chronic kidney disease. Glomerular and interstitial fibrosis are hallmarks of renal progression. However, fibrosis of the kidney remains an unresolved challenge, and its molecular mechanisms are still not fully understood. Gremlin is an embryogenic gene that has been shown to play a key role in nephrogenesis, and its expression is generally low in the normal adult kidney. However, gremlin expression is elevated in many human renal diseases, including diabetic nephropathy, pauci-immune glomerulonephritis and chronic allograft nephropathy. Several studies have proposed that gremlin may be involved in renal damage by acting as a downstream mediator of TGF-β. To examine the in vivo role of gremlin in kidney pathophysiology, we generated seven viable transgenic mouse lines expressing human gremlin (GREM1) specifically in renal proximal tubular epithelial cells under the control of an androgen-regulated promoter. These lines demonstrated 1.2- to 200-fold increased GREM1 expression. GREM1 transgenic mice presented a normal phenotype and were without proteinuria and renal function involvement. In response to the acute renal damage cause by folic acid nephrotoxicity, tubule-specific GREM1 transgenic mice developed increased proteinuria after 7 and 14 days compared with wild-type treated mice. At 14 days tubular lesions, such as dilatation, epithelium flattening and hyaline casts, with interstitial cell infiltration and mild fibrosis were significantly more prominent in transgenic mice than wild-type mice. Tubular GREM1 overexpression was correlated with the renal upregulation of profibrotic factors, such as TGF-β and αSMA, and with increased numbers of monocytes/macrophages and lymphocytes compared to wild-type mice. Taken together, our results suggest that GREM1-overexpressing mice have an increased susceptibility to renal damage, supporting the involvement of gremlin in renal damage progression. This

  6. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.


    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  7. Laser induced damage in optical materials: 8th ASTM symposium.


    Glass, A J; Guenther, A H


    The Eighth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was hosted by the National Bureau of Standards in Boulder, Colorado, from 13 to 15 July 1976. The Symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Energy Research and Development Administration, and the Office of Naval Research. About 160 scientists attended the Symposium, including representatives of the United Kingdom, France, Canada, and Brazil. The Symposium was divided into five half-day sessions concerning Bulk Material Properties and Thermal Behavior, Mirrors and Surfaces, Thin Film Properties, Thin Film Damage, and Scaling Laws and Fundamental Mechanisms. As in previous years, the emphasis of the papers presented at the Symposium was directed toward new frontiers and new developments. Particular emphasis was given to new materials for use at 10.6 microm in mirror substrates, windo s, and coatings. New techniques in film deposition and advances in diamond-turning of optics were described. The scaling of damage thresholds with pulse duration, focal area, and wavelength were discussed. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons of the Symposium. The Ninth Annual Symposium is scheduled for 4-6 October 1977 at the National Bureau of Standards, Boulder, Colorado. PMID:20168679

  8. Radiation damage in PVT (Polyvinyltoluene) induced by energetic ions

    NASA Astrophysics Data System (ADS)

    Torrisi, L.

    Polyvinyltoluene (PVT) is an organic polymer employed as base material for many plastic scintillators useful to detect charged particles. Radiation damage in PVT is investigated irradiating the polymer in vacuum with different ion beams (H+, He+, N+ and Ar+) as a function of their ion stopping power. The structural modifications indced in the polymer are deduced by monitoring in situ, during the ion irradiation, the molecular desorption from the polymer by a highly sensitive mass-quadrupole spectrometer. The desorbed molecules are detected in the mass range 1-100 amu and the chemical yields are measured with respect to the calibrated gas leaks. Main emitted species are H2, C2H2 and C3H5, the yields of which strongly depend on the ion stopping power. As will be discussed, the investigation of radiation damage in PVT permits to extend the results to the damage undergone by plastic scintillators during the detection of charged particles at high energy, such as protons of 10-100 MeV, an energy range useful in nuclear physics and in proton-therapy.


    SciTech Connect

    Teague, L.; Duff, M.


    High quality CdZnTe (or CZT) crystals have the potential for use in room temperature gamma-ray and X-ray spectrometers. Over the last decade, the methods for growing high quality CZT have improved the quality of the produced crystals however there are material features that can influence the performance of these materials as radiation detectors. The presence of structural heterogeneities within the crystals, such as twinning, pipes, grain boundaries (polycrystallinity), and secondary phases (SPs) can have an impact on the detector performance. There is considerable need for reliable and reproducible characterization methods for the measurement of crystal quality. With improvements in material characterization and synthesis, these crystals may become suitable for widespread use in gamma radiation detection. Characterization techniques currently utilized to test for quality and/or to predict performance of the crystal as a gamma-ray detector include infrared (IR) transmission imaging, synchrotron X-ray topography, photoluminescence spectroscopy, transmission electron microscopy (TEM), atomic force microscopy (AFM) and Raman spectroscopy. In some cases, damage caused by characterization methods can have deleterious effects on the crystal performance. The availability of non-destructive analysis techniques is essential to validate a crystal's quality and its ability to be used for either qualitative or quantitative gamma-ray or X-ray detection. The work presented herein discusses the damage that occurs during characterization of the CZT surface by a laser during Raman spectroscopy, even at minimal laser powers. Previous Raman studies have shown that the localized annealing from tightly focused, low powered lasers results in areas of higher Te concentration on the CZT surface. This type of laser damage on the surface resulted in decreased detector performance which was most likely due to increased leakage current caused by areas of higher Te concentration. In this study

  10. The effect of phytosterol protects rats against 4-nitrophenol-induced liver damage.


    Chen, Jiaqin; Song, Meiyan; Li, Yansen; Zhang, Yonghui; Taya, Kazuyoshi; Li, ChunMei


    We investigated the effect of phytosterol (PS) in regard to liver damage induced by 4-nitrophenol (PNP). Twenty rats were randomly divided into four groups (Control, PS, PNP, and PNP+PS). The PS and PNP+PS groups were pretreated with PS for one week. The PNP and PNP+PS groups were injected subcutaneously with PNP for 28 days. The control group received a basal diet and was injected with vehicle alone. Treatment with PS prevented the elevation of the total bilirubin levels, as well as an increase in serum alkaline transaminase and aspartate transaminase, which are typically caused by PNP-induced liver damage. Histopathologically showed that liver damage was significantly mitigated by PS treatment. However, there was no significant change in antioxidant enzyme activities, and the Nrf2-antioxidant system was not activated after treatment with PS. These results suggest that PS could mitigate liver damage induced by PNP, but does not enhance antioxidant capacity. PMID:26748050

  11. Fracture Induced Sub-Band Absorption as a Precursor to Optical Damage on Fused Silica Surfaces

    SciTech Connect

    Miller, P E; Bude, J D; Suratwala, T I; Shen, N; Laurence, T A; Steele, W A; Menapace, J; Feit, M D; Wong, L L


    The optical damage threshold of indentation induced flaws on fused silica surfaces was explored. Mechanical flaws were characterized by laser damaged testing, SEM, optical, and photoluminescence microscopy. Localized polishing, chemical etching, and the control of indentation morphology were used to isolate the structural features which limit optical damage. A thin defect layer on fracture surfaces, including those smaller than the wavelength of visible light, was found to be the dominant source of laser damage initiation during illumination with 355nm, 3ns laser pulses. Little evidence was found that either displaced or densified material or fluence intensification plays a significant role in optical damage at fluences >35J/cm{sup 2}. Elimination of the defect layer was shown to increase the overall damage performance of fused silica optics.

  12. A model for predicting damage induced fatigue life of laminated composite structural components

    NASA Technical Reports Server (NTRS)

    Allen, David H.; Lo, David C.; Georgiou, Ioannis T.; Harris, Charles E.


    This paper presents a model for predicting the life of laminated composite structural components subjected to fatigue induced microstructural damage. The model uses the concept of continuum damage mechanics, wherein the effects of microcracks are incorporated into a damage dependent lamination theory instead of treating each crack as an internal boundary. Internal variables are formulated to account for the effects of both matrix cracks and internal delaminations. Evolution laws for determining the damage variables as functions of ply stresses are proposed, and comparisons of predicted damage evolution are made to experiment. In addition, predicted stiffness losses, as well as ply stresses are shown as functions of damage state for a variety of stacking sequences.

  13. Effect of radiation-induced damage on deuterium retention in tungsten, tungsten coatings and Eurofer

    NASA Astrophysics Data System (ADS)

    Ogorodnikova, O. V.; Sugiyama, K.


    An influence of radiation-induced damage on hydrogen isotope retention and transport in a bulk tungsten (W), dense nano-structured W coatings and Eurofer was investigated under well-defined laboratory conditions. Radiation-induced defects in W materials and Eurofer were created by irradiation with 20 MeV W ions. Following the damage production, samples were exposed to low-energy deuterium plasma. The deuterium (D) retention in each sample was subsequently measured by nuclear reaction analysis (NRA) for the depth profiling up to 6 μm. It was shown that the D retention at radiation-induced damage is almost equivalent for different W grades after irradiation at high enough fluence. The kinetic of D migration and trapping in damaged area as well as recovery of radiation-induced damage were investigated by loading at different temperatures. It was shown that deuterium retention in tungsten in fusion environment will be dominated by radiation-induced effect in a wide range of investigated temperatures, namely, from room temperature to 1100 K. Whereas displacement damage produced in Eurofer has less pronounced effect on the deuterium accumulation.

  14. Thermally induced osteocyte damage initiates pro-osteoclastogenic gene expression in vivo.


    Dolan, Eimear B; Tallon, David; Cheung, Wing-Yee; Schaffler, Mitchell B; Kennedy, Oran D; McNamara, Laoise M


    Bone is often subject to harsh temperatures during orthopaedic procedures resulting in thermally induced bone damage, which may affect the healing response. Postsurgical healing of bone is essential to the success of surgery, therefore, an understanding of the thermally induced responses of bone cells to clinically relevant temperatures in vivo is required. Osteocytes have been shown to be integrally involved in the bone remodelling cascade, via apoptosis, in micro-damage systems. However, it is unknown whether this relationship is similar following thermal damage. Sprague-Dawley rat tibia were exposed to clinically relevant temperatures (47°C or 60°C) to investigate the role of osteocytes in modulating remodelling related factors. Immunohistochemistry was used to quantify osteocyte thermal damage (activated caspase-3). Thermally induced pro-osteoclastogenic genes (Rankl, Opg and M-csf), in addition to genes known to mediate osteoblast and osteoclast differentiation via prostaglandin production (Cox2), vascularization (Vegf) and inflammatory (Il1a) responses, were investigated using gene expression analysis. The results demonstrate that heat-treatment induced significant bone tissue and cellular damage. Pro-osteoclastogenic genes were upregulated depending on the amount of temperature elevation compared with the control. Taken together, the results of this study demonstrate the in vivo effect of thermally induced osteocyte damage on the gene expression profile. PMID:27335224

  15. Mushroom-derived preparations in the prevention of H2O2-induced oxidative damage to cellular DNA.


    Shi, Yu-ling; James, Anthony E; Benzie, Iris F F; Buswell, John A


    Aqueous extracts of the sporophores of eight mushroom species were assessed for their ability to prevent H2O2-induced oxidative damage to cellular DNA using the single-cell gel electrophoresis ("Comet") assay. The highest genoprotective effects were obtained with cold (20 degrees C) and hot (100 degrees C) water extracts of Agaricus bisporus and Ganoderma lucidum fruit bodies, respectively. No protective effects were observed with Mushroom Derived Preparations (MDPs) from Flammulina velutipes, Auricularia auricula, Hypsizygus marmoreus, Lentinula edodes, Pleurotus sajor-caju, and Volvariella volvacea. These findings indicate that some edible mushrooms represent a valuable source of biologically active compounds with potential for protecting cellular DNA from oxidative damage. PMID:11835288

  16. The Influence of Shielding on the Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damages

    NASA Technical Reports Server (NTRS)

    George, K.; Cucinotta, F. A.


    Chromosome damage was assessed in human peripheral blood lymphocytes after in vitro exposure to the either Si-28 (490 or 600 MeV/n), Ti-48 (1000 MeV/n), or Fe-56 (600, 1000, or 5000 MeV/n). LET values for these ions ranged from approximately 50 to 174 keV/micrometers and doses ranged from 10 to 200 cGy. The effect of either aluminum or polyethylene shielding on the induction of chromosome aberrations was investigated for each ion. Chromosome exchanges were measured using fluorescence in situ hybridization (FISH) with whole chromosome probes in cells collected 48-56 hours after irradiation using a chemical-induced premature chromosome condensation (PCC) technique. The yield of chromosomal aberrations increased linearly with dose and the relative biological effectiveness (RBE) for the primary beams, estimated from the initial slope of the dose response curve for total chromosomal exchanges with respect to gamma-rays, ranged from 14 to 35. The RBE values increased with LET, reaching a maximum for the 1 GeV/n Fe ions with LET of 150 keV/micrometers, and decreased with further increases in LET. When LET of the primary beam was in the region of increasing RBE (i.e. below approximately 100 keV/micrometers), the addition of shielding material increased the effectiveness per unit dose. Whereas shielding decreased the effectiveness per unit dose when the LET of the primary particle beam was higher than 150 keV/micrometers.

  17. Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage Measured in Metaphase and Interphase Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    George, Kerry; Durante, Marco; Willingham, Veronica; Wu, Honglu; Yang, Tracy C.; Cucinotta, Francis A.


    Chromosome aberrations were investigated in human lymphocytes after in vitro exposure to 1H-, 3He-, 12C-, 40Ar-, 28Si-, 56Fe-, or 197Au-ion beams, with LET ranging from approximately 0.4-1393 keV/microm in the dose range of 0.075-3 Gy. Dose-response curves for chromosome exchanges, measured at the first mitosis postirradiation using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosomal damage with respect to low- or high-dose-rate gamma rays. Estimates of RBEmax values for mitotic spreads, which ranged from near 0.7 to 11.1 for total exchanges, increased with LET, reaching a maximum at about 150 keV/microm, and decreased with further increase in LET. RBEs for complex aberrations are undefined due to the lack of an initial slope for gamma rays. Additionally, the effect of mitotic delay on RBE values was investigated by measuring chromosome aberrations in interphase after chemically induced premature chromosome condensation (PCC), and values were up to threefold higher than for metaphase analysis.

  18. Chemically induced aneuploidy in mammalian cells: mechanisms and biological significance in cancer

    SciTech Connect

    Oshimura, M.; Barrett, J.C.


    A literature review with over 200 references examines the growing body of evidence from human and animal cancer cytogenetics that aneuploidy is an important chromosome change in carcinogenesis. Evidence from in vitro cell transformation studies supports the idea that aneuploidy has a direct effect on the conversion of a normal cell to a preneoplastic or malignant cell. Induction of an aneuploid state in a preneoplastic or neoplastic cell could have any of the following four biological effects: a change in gene dosage, a change in gene balance, expression of a recessive mutation, or a change in genetic instability (which could secondarily lead to neoplasia). There are a number of possible mechanisms by which chemicals might induce aneuploidy, including effects on microtubules, damage to essential elements for chromosome function reduction in chromosome condensation or pairing, induction of chromosome interchanges, unresolved recombination structures, increased chromosome stickiness, damage to centrioles, impairment of chromosome alignment ionic alterations during mitosis, damage to the nuclear membrane, and a physical disruption of chromosome segregation. Therefore, a number of different targets exist for chemically induced aneuploidy.

  19. Laser induced damage in optical materials: eleventh ASTM symposium.


    Bennett, H E; Glass, A J; Guenther, A H; Newnam, B


    The eleventh Symposium on Optical Materials for High-Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 30-31 October 1979. The symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Projects Agency, the Department of Energy, and the Office of Naval Research. About 150 scientists attended the symposium, including representatives of the United Kingdom, France, Canada, Japan, West Germany, and Denmark. The symposium was divided into sessions concerning transparent optical materials and the measurement of their properties, mirrors and surfaces, thin film characteristics, thin film damage, considerations for high-power systems, and finally theory and breakdown. As in previous years, the emphasis of the papers presented at the symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high-power apparatus. The wavelength range of prime interest was from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was discussed in detail. Harold E. Bennett of the Naval Weapons Center, Alexander J. Glass of the Lawrence Livermore Laboratory, Arthur H. Guenther of the Air Force Weapons Laboratory, and Brian E. Newnam of the Los Alamos Scientific Laboratory were cochairpersons. The twelfth annual symposium is scheduled for 30 September-1 October 1980 at the National Bureau of Standards, Boulder, Colorado. PMID:20234423

  20. Dissecting the molecular mechanism of ionizing radiation-induced tissue damage in the feather follicle.


    Chen, Xi; Liao, Chunyan; Chu, Qiqi; Zhou, Guixuan; Lin, Xiang; Li, Xiaobo; Lu, Haijie; Xu, Benhua; Yue, Zhicao


    Ionizing radiation (IR) is a common therapeutic agent in cancer therapy. It damages normal tissue and causes side effects including dermatitis and mucositis. Here we use the feather follicle as a model to investigate the mechanism of IR-induced tissue damage, because any perturbation of feather growth will be clearly recorded in its regular yet complex morphology. We find that IR induces defects in feather formation in a dose-dependent manner. No abnormality was observed at 5 Gy. A transient, reversible perturbation of feather growth was induced at 10 Gy, leading to defects in the feather structure. This perturbation became irreversible at 20 Gy. Molecular and cellular analysis revealed P53 activation, DNA damage and repair, cell cycle arrest and apoptosis in the pathobiology. IR also induces patterning defects in feather formation, with disrupted branching morphogenesis. This perturbation is mediated by cytokine production and Stat1 activation, as manipulation of cytokine levels or ectopic Stat1 over-expression also led to irregular feather branching. Furthermore, AG-490, a chemical inhibitor of Stat1 signaling, can partially rescue IR-induced tissue damage. Our results suggest that the feather follicle could serve as a useful model to address the in vivo impact of the many mechanisms of IR-induced tissue damage. PMID:24586618


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  3. Biological effects of laser-induced stress waves

    SciTech Connect

    Doukas, A.; Lee, S.; McAuliffe, D.


    Laser-induced stress waves can be generated by one of the following mechanisms: Optical breakdown, ablation or rapid heating of an absorbing medium. These three modes of laser interaction with matter allow the investigation of cellular and tissue responses to stress waves with different characteristics and under different conditions. The most widely studied phenomena are those of the collateral damage seen in photodisruption in the eye and in 193 run ablation of cornea and skin. On the other hand, the therapeutic application of laser-induced stress waves has been limited to the disruption of noncellular material such as renal stones, atheromatous plaque and vitreous strands. The effects of stress waves to cells and tissues can be quite disparate. Stress waves can fracture tissue, damage cells, and increase the permeability of the plasma membrane. The viability of cell cultures exposed to stress waves increases with the peak stress and the number of pulses applied. The rise time of the stress wave also influences the degree of cell injury. In fact, cell viability, as measured by thymidine incorporation, correlates better with the stress gradient than peak stress. Recent studies have also established that stress waves induce a transient increase of the permeability of the plasma membrane in vitro. In addition, if the stress gradient is below the damage threshhold, the cells remain viable. Thus, stress waves can be useful as a means of drug delivery, increasing the intracellular drug concentration and allowing the use of drugs which are impermeable to the cell membrane. The present studies show that it is important to create controllable stress waves. The wavelength tunability and the micropulse structure of the free electron laser is ideal for generating stress waves with independently adjustable parameters, such as rise time, duration and peak stress.

  4. Amelioration of radiation-induced liver damage in partially hepatectomized rats by hepatocyte transplantation.


    Guha, C; Sharma, A; Gupta, S; Alfieri, A; Gorla, G R; Gagandeep, S; Sokhi, R; Roy-Chowdhury, N; Tanaka, K E; Vikram, B; Roy-Chowdhury, J


    Hepatic tumors often recur in the liver after surgical resection. Postoperative radiotherapy (RT) could improve survival, but curative RT may induce delayed life-threatening radiation-induced liver damage. Because RT inhibits liver regeneration, we hypothesized that unirradiated, transplanted hepatocytes would proliferate preferentially in a partially resected and irradiated liver, providing metabolic support. We subjected F344 rats to hepatic RT and partial hepatectomy with/without a single intrasplenic, syngeneic hepatocyte transplantation. Hepatocyte transplantation ameliorated radiation-induced liver damage and improved survival of rats receiving RT after partial hepatectomy. We further demonstrated that transplanted hepatocytes extensively repopulate and function in a heavily irradiated rat liver. PMID:10606225

  5. Protective effect of calcium folinate against methotrexate-induced endosalpinx damage in rats.


    Yang, Xiao-Jun; Chen, Yan-Ping; Wang, Han-Chu; Zhao, Jing; Zheng, Fei-Yun


    The aim of this study was to evaluate the protective effect of calcium folinate (CF) applied in 10% of the methotrexate (MTX) dosage against morphologic and steroid-receptor damage induced by MTX in rat endosalpinx. The result indicated that endosalpingitis, the ultrastructural damage of endosalpinx, and a change in estrogen and P receptor expression induced by low- and high-dose MTX in endosalpinx can be reversed completely and partly (B1, B2) by combined treatment with CF, suggesting that CF combined with MTX protects against the side effects induced by MTX. PMID:20869049

  6. Biologically important radiation damage in DNA. Annual progress report, May 1, 1993--January 31, 1994

    SciTech Connect

    Ward, J.F.


    Most DNA damage by the hydroxyl radical is confined to the bases, and this base damage represents an important component of locally multiply demanded sites (LMOS). The yields of the major damaged bases have been determined by gas chromatography mass spectrometry. For our propose, it was necessary to convert a known fraction of these damaged bases to strand breaks and then assay these labile sites as the increase in strand break yield over the normally observed level. Three potential agents by which this strategy of conversion of base damage to strand break could be implemented were identified in the original application: 1, Sl nuclease; 2, piperidine; and 3, base damage specific enzymes.

  7. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben


    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  8. Experimental determination of the relationship between permeability and microfracture-induced damage in bedded salt

    SciTech Connect

    Pfeifle, T.W.


    The development of deep underground structures (e.g., shafts, mines, storage and disposal caverns) significantly alters the stress state in the rock near the structure or opening. The effect of such an opening is to concentrate the far-field stress near the free surface. For soft rock such as salt, the concentrating effect of the opening induces deviatoric stresses in the salt that may be large enough to initiate microcracks which then propagate with time. The volume of rock susceptible to damage by microfracturing is often referred to as the disturbed rock zone and, by its nature, is expected to exhibit high permeability relative to that of the native, far-field rock. This paper presents laboratory data that characterize microfracture-induced damage and the effect this damage has on permeability for bedded salt from the Waste Isolation Pilot Plant located in southeastern New Mexico. Damage is induced in the salt through a series of tertiary creep experiments and quantified in terms of dilatant volumetric strain. The permeability of damaged specimens is then measured using nitrogen gas as the permeant. The range in damage investigated included dilatant volumetric strains from less than 0.03 percent to nearly 4.0 percent. Permeability values corresponding to these damage levels ranged from 1 {times} 10{sup {minus}18} m{sup 2} to 1 {times} 10{sup {minus}12} m{sup 2}. Two simple models were fitted to the data for use in predicting permeability from dilatant volumetric strain.

  9. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed


    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  10. Effects of fatigue induced damage on the longitudinal fracture resistance of cortical bone.


    Fletcher, Lloyd; Codrington, John; Parkinson, Ian


    As a composite material, cortical bone accumulates fatigue microdamage through the repetitive loading of everyday activity (e.g. walking). The accumulation of fatigue microdamage is thought to contribute to the occurrence of fragility fractures in older people. Therefore it is beneficial to understand the relationship between microcrack accumulation and the fracture resistance of cortical bone. Twenty longitudinally orientated compact tension fracture specimens were machined from a single bovine femur, ten specimens were assigned to both the control and fatigue damaged groups. The damaged group underwent a fatigue loading protocol to induce microdamage which was assessed via fluorescent microscopy. Following fatigue loading, non-linear fracture resistance tests were undertaken on both the control and damaged groups using the J-integral method. The interaction of the crack path with the fatigue induced damage and inherent toughening mechanisms were then observed using fluorescent microscopy. The results of this study show that fatigue induced damage reduces the initiation toughness of cortical bone and the growth toughness within the damage zone by three distinct mechanisms of fatigue-fracture interaction. Further analysis of the J-integral fracture resistance showed both the elastic and plastic component were reduced in the damaged group. For the elastic component this was attributed to a decreased number of ligament bridges in the crack wake while for the plastic component this was attributed to the presence of pre-existing fatigue microcracks preventing energy absorption by the formation of new microcracks. PMID:24715332

  11. MTERF2 contributes to MPP(+)-induced mitochondrial dysfunction and cell damage.


    Han, Yanyan; Gao, Peiye; Qiu, Shi; Zhang, Linbing; Yang, Ling; Zuo, Ji; Zhong, Chunjiu; Zhu, Shun; Liu, Wen


    Parkinson's disease (PD) is a common neurodegenerative disorder whose pathogenesis is under intense investigation. Substantial evidence indicates that mitochondrial dysfunction plays a central role in the pathophysiology of PD. Several mitochondrial internal regulating factors act to maintain the mitochondrial function. However, how these internal regulating factors contribute to mitochondrial dysfunction in PD remains elusive. One of these factors, mitochondrial transcription termination factor 2 (MTERF2), has been implicated in the regulation of oxidative phosphorylation by modulating mitochondrial DNA transcription. Here, we discovered a new role of MTERF2 in regulating mitochondrial dysfunction and cell damage induced by MPP(+) in SH-SY5Y cells. We found that MPP(+) treatment elevated MTERF2 expression, induced mitochondrial dysfunction and cell damage, which was alleviated by MTERF2 knockdown. These findings demonstrate that MTERF2 contributes to MPP(+)-induced mitochondrial disruption and cell damage. This study indicates that MTERF2 is a potential therapeutic target for environmentally induced Parkinson's disease. PMID:26826381

  12. Laser induced damage in optical materials: ninth ASTM symposium.


    Glass, A J; Guenther, A H


    The Ninth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 4-6 October 1977. The symposium was under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy (formerly ERDA), and the Office of Naval Research. About 185 scientists attended, including representatives of the United Kingdom, France, Canada, Australia, Union of South Africa, and the Soviet Union. The Symposium was divided into sessions concerning Laser Windows and Materials, Mirrors and Surfaces, Thin Films, Laser Glass and Glass Lasers, and Fundamental Mechanisms. As in previous years, the emphasis of the papers was directed toward new frontiers and new developments. Particular emphasis was given to materials for use from 10.6 microm to the uv region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength were also discussed. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons. The Tenth Annual Symposium is scheduled for 12-14 September 1978 at the National Bureau of Standards, Boulder, Colorado. PMID:20203792

  13. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  14. BPC-15 reduces trinitrobenzene sulfonic acid-induced colonic damage in rats.


    Veljaca, M; Lesch, C A; Pllana, R; Sanchez, B; Chan, K; Guglietta, A


    The effect of BPC-15 (Booly Protection Compound-15) was evaluated in a rat model of colonic injury. A single intracolonic administration of trinitrobenzene sulfonic acid (TNBS) dissolved in ethanol induces severe colonic damage, which is characterized by areas of necrosis surrounded by areas of acute inflammation. The damage is associated with high myeloperoxidase (MPO) activity, mainly as a reflection of neutrophilic infiltration into the damaged tissue. In this study, 1 hr before a single intracolonic administration of 50 mg/kg of TNBS in 50% ethanol, the animals were treated with one of the following doses of BPC-15: 0.0001, 0.001, 0.01, 0.1, 1 or 10 nmol/kg administered i.p. or with a dose of 10 nmol/kg administered intracolonically. The animals were sacrificed 3 days later and the extent of colonic necrosis and hyperemia was measured with an image analyzer. The i.p. administration of BPC-15 significantly reduced the extent of TNBS-induced colonic damage in a dose-dependent manner. This was associated with a statistically significant and dose-dependent reduction in colonic tissue MPO activity. At the dose tested (10 nmol/kg), intracolonic administration of BPC-15 did not significantly reduce either the extent of the colonic damage or the increase in MPO activity induced by TNBS. In conclusion, this study showed that i.p. administration of BPC-15 reduced TNBS-induced colonic damage in rats. PMID:7815358

  15. Acute liver damage induced by 2-nitropropane in rats: effect of diphenyl diselenide on antioxidant defenses.


    Borges, Lysandro P; Nogueira, Cristina Wayne; Panatieri, Rodrigo B; Rocha, João Batista Teixeira; Zeni, Gilson


    The effect of post-treatment with diphenyl diselenide on liver damage induced by 2-nitropropane (2-NP) was examined in male rats. Rats were pre-treated with a single dose of 2-NP (100 mg/kg body weight dissolved in canola oil). Afterward, the animals were post-treated with a dose of diphenyl diselenide (10, 50 or 100 micromol/kg). The parameters that indicate tissue damage such as liver histopathology, plasma aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma-glutamyl transferase (GGT), urea and creatinine were determined. Since the liver damage induced by 2-NP is related to oxidative damage, lipid peroxidation, superoxide dismutase (SOD), catalase (CAT) and ascorbic acid level were also evaluated. Diphenyl diselenide (50 and 100 micromol/kg) effectively restored the increase of ALT and AST activities and urea level when compared to the 2-NP group. At the higher dose, diphenyl diselenide decreased GGT activity. Treatment with diphenyl diselenide, at all doses, effectively ameliorated the increase of hepatic and renal lipid peroxidation when compared to 2-NP group. 2-NP reduced CAT activity and neither alter SOD activity nor ascorbic acid level. This study points out the involvement of CAT activity in 2-NP-induced acute liver damage and suggests that the post-treatment with diphenyl diselenide was effective in restoring the hepatic damage induced by 2-NP. PMID:16445897

  16. Recurrent Moderate Hypoglycemia Ameliorates Brain Damage and Cognitive Dysfunction Induced by Severe Hypoglycemia

    PubMed Central

    Puente, Erwin C.; Silverstein, Julie; Bree, Adam J.; Musikantow, Daniel R.; Wozniak, David F.; Maloney, Susan; Daphna-Iken, Dorit; Fisher, Simon J.


    OBJECTIVE Although intensive glycemic control achieved with insulin therapy increases the incidence of both moderate and severe hypoglycemia, clinical reports of cognitive impairment due to severe hypoglycemia have been highly variable. It was hypothesized that recurrent moderate hypoglycemia preconditions the brain and protects against damage caused by severe hypoglycemia. RESEARCH DESIGN AND METHODS Nine-week-old male Sprague-Dawley rats were subjected to either 3 consecutive days of recurrent moderate (25–40 mg/dl) hypoglycemia (RH) or saline injections. On the fourth day, rats were subjected to a hyperinsulinemic (0.2 units · kg−1 · min−1) severe hypoglycemic (∼11 mg/dl) clamp for 60 or 90 min. Neuronal damage was subsequently assessed by hematoxylin-eosin and Fluoro-Jade B staining. The functional significance of severe hypoglycemia–induced brain damage was evaluated by motor and cognitive testing. RESULTS Severe hypoglycemia induced brain damage and striking deficits in spatial learning and memory. Rats subjected to recurrent moderate hypoglycemia had 62–74% less brain cell death and were protected from most of these cognitive disturbances. CONCLUSIONS Antecedent recurrent moderate hypoglycemia preconditioned the brain and markedly limited both the extent of severe hypoglycemia–induced neuronal damage and associated cognitive impairment. In conclusion, changes brought about by recurrent moderate hypoglycemia can be viewed, paradoxically, as providing a beneficial adaptive response in that there is mitigation against severe hypoglycemia–induced brain damage and cognitive dysfunction. PMID:20086229

  17. The role of nitric oxide on DNA damage induced by benzene metabolites

    PubMed Central



    Benzene, a tobacco constituent, is a leukemogen in humans and a carcinogen in rodents. Several benzene metabolites generate superoxide anion (O2•−) and induce nitric oxide synthase in the bone marrow of mice. We hypothesized that the reaction of nitric oxide (•NO) with O2•− leads to the formation of peroxynitrite as an intermediate during benzene metabolism. This hypothesis was supported by demonstrating that the exposure of mice to benzene produced nitrated metabolites and enhanced the levels of protein-bound 3-nitrotyrosine in the bone marrow of mice in vivo. In the current study, we investigated the influence of nitric oxide, generated from sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate, on DNA strand breaks induced by each single or binary benzene metabolite at different doses and compared the levels of the DNA damage induced by each benzene metabolite in the presence of nitric oxide with the levels of DNA strand breaks induced by peroxynitrite at similar doses in vitro. We found that among benzene metabolites only 1,2,4-trihydroxybenzene (BT) can induce significant DNA damage in the absence of nitric oxide. While 1,4-dihydroxybenzene (HQ), 1,4-benzo-quinone (BQ) and 1,2-dihydroxybenzene (CAT) require •NO to induce DNA strand breaks, hydroquinone was the most potent DNA-damaging benzene metabolite in the presence of •NO. The order of DNA breaks by benzene metabolites in the presence of •NO is: Peroxynitrite = HQ > BT > BQ > CAT. The •NO and O2•− scavengers inhibited DNA damage induced by [HQ+•NO]. Benzene, trans,trans-muconaldehyde, and phenol, do not induce DNA strand breaks either in the absence or presence of •NO. However, adding phenol to [HQ+•NO] leads to greater DNA damage than [HQ+•NO] alone. Collectively, these results suggest that nitric oxide is an important factor in DNA damage induced by certain benzene metabolites, probably via the formation of the peroxynitrite intermediate. Phenol, the major benzene metabolite

  18. Protective effects of Ankaferd blood stopper on aspirin-induced oxidative mucosal damage in a rat model of gastric injury.


    Hasgul, Rukiye; Uysal, Sema; Haltas, Hacer; Akyol, Sumeyye; Yuksel, Yasemin; Gurel, Ayse; Armutcu, Ferah


    The exposure of gastric mucosa to damaging factors, such as ethanol and some therapeutic drugs, produces pathological changes: inflammatory process, hemorrhagic erosions and even acute ulcers. Ankaferd blood stopper (ABS) comprises a standardized mixture of five different plant extracts. The purpose of our present investigations is to explain the participation of reactive oxygen species in acute gastric mucosal damage by acetylsalicylic acid (ASA) and the effects of new hemostatic agent ABS. Experiments were carried out on 23 male Wistar rats. To assess gastric mucosal damage, biochemical and histopathological data were used. The colorimetric assays were used to determine the malondialdehyde (MDA) and superoxide dismutase (SOD) activity. The level of myeloperoxidase (MPO) activity, the level of nitric oxide (NO) and the proinflammatory cytokine tumor necrosis factor-α (TNF-α) were measured by enzyme-linked immunosorbent assay technique. We demonstrated that the biological effects of ROS were estimated by measuring the tissue and plasma levels of MDA, the products of lipid peroxidation, as well as the activity of SOD and the scavenger of ROS produced by ASA in the experiment group. Moreover, it was found that MPO activity as well as NO and TNF-α levels also demonstrated significant improvement by ABS treatment. The pathogenesis of experimental ASA-induced mucosal damage in rat stomach includes the generation of ROS that seems to play an important role, due to the generation of lipid peroxides, accompanied by the impairment of antioxidative enzyme activity of cells. ABS appeared to attenuate the oxidative and inflammatory changes caused by ASA-induced gastric mucosal damage in rats. PMID:23114375

  19. Cerium Oxide Nanoparticles Induced Toxicity in Human Lung Cells: Role of ROS Mediated DNA Damage and Apoptosis

    PubMed Central

    Pandey, Alok K.


    Cerium oxide nanoparticles (CeO2 NPs) have promising industrial and biomedical applications. In spite of their applications, the toxicity of these NPs in biological/physiological environment is a major concern. Present study aimed to understand the molecular mechanism underlying the toxicity of CeO2 NPs on lung adenocarcinoma (A549) cells. After internalization, CeO2 NPs caused significant cytotoxicity and morphological changes in A549 cells. Further, the cell death was found to be apoptotic as shown by loss in mitochondrial membrane potential and increase in annexin-V positive cells and confirmed by immunoblot analysis of BAX, BCl-2, Cyt C, AIF, caspase-3, and caspase-9. A significant increase in oxidative DNA damage was found which was confirmed by phosphorylation of p53 gene and presence of cleaved poly ADP ribose polymerase (PARP). This damage could be attributed to increased production of reactive oxygen species (ROS) with concomitant decrease in antioxidant “glutathione (GSH)” level. DNA damage and cell death were attenuated by the application of ROS and apoptosis inhibitors N-acetyl-L- cysteine (NAC) and Z-DEVD-fmk, respectively. Our study concludes that ROS mediated DNA damage and cell cycle arrest play a major role in CeO2 NPs induced apoptotic cell death in A549 cells. Apart from beneficial applications, these NPs also impart potential harmful effects which should be properly evaluated prior to their use. PMID:24987704

  20. Modulation of DNA-Induced Damage and Repair Capacity in Humans after Dietary Intervention with Lutein-Enriched Fermented Milk

    PubMed Central

    Herrero-Barbudo, Carmen; Soldevilla, Beatriz; Pérez-Sacristán, Belén; Blanco-Navarro, Inmaculada; Herrera, Mercedes; Granado-Lorencio, Fernando; Domínguez, Gemma


    Dietary factors provide protection against several forms of DNA damage. Additionally, consumer demand for natural products favours the development of bioactive food ingredients with health benefits. Lutein is a promising biologically active component in the food industry. The EFSA Panel on Dietetic Products, Nutrition and Allergies considers that protection from oxidative damage may be a beneficial physiological effect but that a cause and effect relationship has not been established. Thus, our aim was to evaluate the safety and potential functional effect of a lutein-enriched milk product using the Comet Assay in order to analyze the baseline, the induced DNA-damage and the repair capacity in the lymphocytes of 10 healthy donors before and after the intake of the mentioned product. Our data suggest that the regular consumption of lutein-enriched fermented milk results in a significant increase in serum lutein levels and this change is associated with an improvement in the resistance of DNA to damage and the capacity of DNA repair in lymphocytes. Our results also support the lack of a genotoxic effect at the doses supplied as well as the absence of interactions and side effects on other nutritional and biochemicals markers. PMID:24040187

  1. Modulation of DNA-induced damage and repair capacity in humans after dietary intervention with lutein-enriched fermented milk.


    Herrero-Barbudo, Carmen; Soldevilla, Beatriz; Pérez-Sacristán, Belén; Blanco-Navarro, Inmaculada; Herrera, Mercedes; Granado-Lorencio, Fernando; Domínguez, Gemma


    Dietary factors provide protection against several forms of DNA damage. Additionally, consumer demand for natural products favours the development of bioactive food ingredients with health benefits. Lutein is a promising biologically active component in the food industry. The EFSA Panel on Dietetic Products, Nutrition and Allergies considers that protection from oxidative damage may be a beneficial physiological effect but that a cause and effect relationship has not been established. Thus, our aim was to evaluate the safety and potential functional effect of a lutein-enriched milk product using the Comet Assay in order to analyze the baseline, the induced DNA-damage and the repair capacity in the lymphocytes of 10 healthy donors before and after the intake of the mentioned product. Our data suggest that the regular consumption of lutein-enriched fermented milk results in a significant increase in serum lutein levels and this change is associated with an improvement in the resistance of DNA to damage and the capacity of DNA repair in lymphocytes. Our results also support the lack of a genotoxic effect at the doses supplied as well as the absence of interactions and side effects on other nutritional and biochemicals markers. PMID:24040187

  2. Feasibility of OCT to detect radiation-induced esophageal damage in small animal models (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Jelvehgaran, Pouya; Alderliesten, Tanja; Salguero, Javier; Borst, Gerben; Song, Ji-Ying; van Leeuwen, Ton G.; de Boer, Johannes F.; de Bruin, Daniel M.; van Herk, Marcel B.


    Lung cancer survival is poor and radiotherapy patients often suffer serious treatment side effects. The esophagus is particularly sensitive leading to reduced food intake or even fistula formation. Only few direct techniques exist to measure radiation-induced esophageal damage, for which knowledge is needed to improve the balance between risk of tumor recurrence and complications. Optical coherence tomography (OCT) is a minimally-invasive imaging technique that obtains cross-sectional, high-resolution (1-10µm) images and is capable of scanning the esophageal wall up to 2-3mm depth. In this study we investigated the feasibility of OCT to detect esophageal radiation damage in mice. In total 30 mice were included in 4 study groups (1 main and 3 control groups). Mice underwent cone-beam CT imaging for initial setup assessment and dose planning followed by single-fraction dose delivery of 4, 10, 16, and 20Gy on 5mm spots, spaced 10mm apart. Mice were repeatedly imaged using OCT: pre-irradiation and up to 3 months post-irradiation. The control groups received either OCT only, irradiation only, or were sham-operated. We used histopathology as gold standard for radiation-induced damage diagnosis. The study showed edema in both the main and OCT-only groups. Furthermore, radiation-induced damage was primarily found in the highest dose region (distal esophagus). Based on the histopathology reports we were able to identify the radiation-induced damage in the OCT images as a change in tissue scattering related to the type of induced damage. This finding indicates the feasibility and thereby the potentially promising role of OCT in radiation-induced esophageal damage assessment.

  3. Neuroprotective effects of bis(7)-tacrine against glutamate-induced retinal ganglion cells damage

    PubMed Central


    Background Glutamate-mediated excitotoxicity, primarily through N-methyl-D-aspartate (NMDA) receptors, may be an important cause of retinal ganglion cells (RGCs) death in glaucoma and several other retinal diseases. Bis(7)-tacrine is a noncompetitive NMDA receptors antagonist that can prevent glutamate-induced hippocampal neurons damage. We tested the effects of bis(7)-tacrine against glutamate-induced rat RGCs damage in vitro and in vivo. Results In cultured neonatal rats RGCs, the MTT assay showed that glutamate induced a concentration- and time-dependent toxicity. Bis(7)-tacrine and memantine prevented glutamate-induced cell death in a concentration-dependent manner with IC50 values of 0.028 μM and 0.834 μM, respectively. The anti-apoptosis effects of bis(7)-tacrine were confirmed by annexin V-FITC/PI staining. In vivo, TUNEL analysis and retrograde labeling analysis found that pretreatment with bis(7)-tacrine(0.2 mg/kg) induced a significant neuroprotective effect against glutamate-induced RGCs damage. Conclusions Our results showed that bis(7)-tacrine had neuroprotective effects against glutamate-induced RGCs damage in vitro and in vivo, possibly through the drug's anti-NMDA receptor effects. These findings make bis(7)-tacrine potentially useful for treating a variety of ischemic or traumatic retinopathies inclusive of glaucoma. PMID:20199668

  4. Molecular Hydrogen Therapy Ameliorates Organ Damage Induced by Sepsis

    PubMed Central

    Zheng, Yijun; Zhu, Duming


    Since it was proposed in 2007, molecular hydrogen therapy has been widely concerned and researched. Many animal experiments were carried out in a variety of disease fields, such as cerebral infarction, ischemia reperfusion injury, Parkinson syndrome, type 2 diabetes mellitus, metabolic syndrome, chronic kidney disease, radiation injury, chronic hepatitis, rheumatoid arthritis, stress ulcer, acute sports injuries, mitochondrial and inflammatory disease, and acute erythema skin disease and other pathological processes or diseases. Molecular hydrogen therapy is pointed out as there is protective effect for sepsis patients, too. The impact of molecular hydrogen therapy against sepsis is shown from the aspects of basic vital signs, organ functions (brain, lung, liver, kidney, small intestine, etc.), survival rate, and so forth. Molecular hydrogen therapy is able to significantly reduce the release of inflammatory factors and oxidative stress injury. Thereby it can reduce damage of various organ functions from sepsis and improve survival rate. Molecular hydrogen therapy is a prospective method against sepsis. PMID:27413421

  5. Molecular Hydrogen Therapy Ameliorates Organ Damage Induced by Sepsis.


    Zheng, Yijun; Zhu, Duming


    Since it was proposed in 2007, molecular hydrogen therapy has been widely concerned and researched. Many animal experiments were carried out in a variety of disease fields, such as cerebral infarction, ischemia reperfusion injury, Parkinson syndrome, type 2 diabetes mellitus, metabolic syndrome, chronic kidney disease, radiation injury, chronic hepatitis, rheumatoid arthritis, stress ulcer, acute sports injuries, mitochondrial and inflammatory disease, and acute erythema skin disease and other pathological processes or diseases. Molecular hydrogen therapy is pointed out as there is protective effect for sepsis patients, too. The impact of molecular hydrogen therapy against sepsis is shown from the aspects of basic vital signs, organ functions (brain, lung, liver, kidney, small intestine, etc.), survival rate, and so forth. Molecular hydrogen therapy is able to significantly reduce the release of inflammatory factors and oxidative stress injury. Thereby it can reduce damage of various organ functions from sepsis and improve survival rate. Molecular hydrogen therapy is a prospective method against sepsis. PMID:27413421


    EPA Science Inventory

    Numerous natural and man-made agents are continuously released into the environment due to human activity. Many of these agents cause irreversible damage to the normal biological functions leading to morbidity and mortality in the exposed organisms. The possibility of deliberat...


    EPA Science Inventory

    Numerous natural and man-made agents are continuously released into the environment due to human activity. Many of these agents cause irreversible damage to the normal biological functions leading to morbidity and mortality in the exposed organisms. The possibility of deliberat...

  8. Laser induced damage in optical materials: twelfth ASTM symposium.


    Bennett, H E; Glass, A J; Guenther, A H; Newnam, B


    The twelfth annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 30 Sept.-l Oct., 1980. The symposium was held under the auspices of ASTM Committee F-l, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Projects Agency, the Department of Energy, the Office of Naval Research, and the Air Force Office of Scientific research. Over 150 scientists attended the symposium, including representatives of the United Kingdom, France, Japan, and West Germany. The symposium was divided into sessions concerning materials and measurements, mirrors and surfaces, thin films, and finally fundamental mechanisms. As in previous years, the emphasis of the papers presented at the symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high power systems. The wavelength range of prime interest was from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was discussed in detail. Harold E. Bennett of the Naval Weapons Center, Alexander J. Glass of the Lawrence Livermore National Laboratory, Arthur H. Guenther of the Air Force Weapons Laboratory, and Brian E. Newnam of the Los Alamos National Laboratory were cochairmen of the symposium. The thirteenth annual symposium is scheduled for 17-18 Nov. 1981 at the National Bureau of Standards, Boulder, Colorado. PMID:20333088

  9. Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage.


    Cui, T; Jiang, M S


    We assessed the role of A79G, a polymorphism of the myoglobin gene (MB), in susceptibility to exercise-induced skeletal muscle damage. Between January 2012 and December 2014, a total of 166 cases with exercise-induced skeletal muscle damage and 166 controls were recruited into our study. Genotyping of MB A79G was carried out using polymerase chain reaction coupled with restriction fragment length polymorphism. Using unconditional logistic regression analysis, we found that the GG genotype of MB A79G was associated with higher risk of exercise-induced muscle damage compared with the wild-type genotype, and the OR (95%CI) was 2.91 (1.20-7.59). Compared with the AA genotype, the AG+GG genotype was associated with a significantly increased risk of exercise-induced muscle damage for those with blood lactic acid ≥1.80 mM (OR = 2.05; 95%CI = 1.09-3.88). In conclusion, we found that the A79G polymorphism of the MB gene plays an important role in influencing the development of exercise-induced skeletal muscle damage. PMID:27323063

  10. Modal characteristics of turbine blade packets under lacing wire damage induced mistuning

    NASA Astrophysics Data System (ADS)

    Chatterjee, Animesh; Kotambkar, Mangesh S.


    Effect of mistuning on turbo machine blade vibration in a packeted blade-disk system has become an important area of research in the recent past, mainly due to the critical applications in aero engines and power plant turbines. It has been shown that even a small mistuning can lead to stress build up through mode localization under forced vibration. Such mistuning can come from initial geometric blade to blade variation due to manufacturing tolerances or from a crack growing in the bladed disk system during operational life stages. The literature review indicates that researchers have mainly considered blade damage as a cause of mistuning. However, lacing wire damage, although not as catastrophic as blade damage, are more frequent in occurrences and often act as a precursor to subsequent blade damage. Detection of lacing wire damage is therefore equally important. Present work has investigated nature of mistuning induced by lacing wire damage and its effect on the characteristic modal properties. A damage severity index has been introduced and effect of damage on the blade group natural frequencies is investigated. Scope of developing a damage identification methodology in packeted blade-disk system is also discussed.

  11. Topical vitamin C protects porcine skin from ultraviolet radiation-induced damage.


    Darr, D; Combs, S; Dunston, S; Manning, T; Pinnell, S


    Ultraviolet radiation damage to the skin is due, in part, to the generation of reactive oxygen species. Vitamin C (L-ascorbic acid) functions as a biological co-factor and antioxidant due to its reducing properties. Topical application of vitamin C has been shown to elevate significantly cutaneous levels of this vitamin in pigs, and this correlates with protection of the skin from UVB damage as measured by erythema and sunburn cell formation. This protection is biological and due to the reducing properties of the molecule. Further, we provide evidence that the vitamin C levels of the skin can be severely depleted after UV irradiation, which would lower this organ's innate protective mechanism as well as leaving it at risk of impaired healing after photoinduced damage. In addition, vitamin C protects porcine skin from UVA-mediated phototoxic reactions (PUVA) and therefore shows promise as a broad-spectrum photoprotectant. PMID:1390169

  12. Caryocar brasiliense camb protects against genomic and oxidative damage in urethane-induced lung carcinogenesis

    PubMed Central

    Colombo, N.B.R.; Rangel, M.P.; Martins, V.; Hage, M.; Gelain, D.P.; Barbeiro, D.F.; Grisolia, C.K.; Parra, E.R.; Capelozzi, V.L.


    The antioxidant effects of Caryocar brasiliense Camb, commonly known as the pequi fruit, have not been evaluated to determine their protective effects against oxidative damage in lung carcinogenesis. In the present study, we evaluated the role of pequi fruit against urethane-induced DNA damage and oxidative stress in forty 8-12 week old male BALB/C mice. An in vivo comet assay was performed to assess DNA damage in lung tissues and changes in lipid peroxidation and redox cycle antioxidants were monitored for oxidative stress. Prior supplementation with pequi oil or its extract (15 µL, 60 days) significantly reduced urethane-induced oxidative stress. A protective effect against DNA damage was associated with the modulation of lipid peroxidation and low protein and gene expression of nitric oxide synthase. These findings suggest that the intake of pequi fruit might protect against in vivo genotoxicity and oxidative stress. PMID:26200231

  13. Laser-induced damage of multilayer dielectric gratings with picosecond laser pulses under vacuum and air

    NASA Astrophysics Data System (ADS)

    Kong, Fanyu; Jin, Yunxia; Huang, Haopeng; Zhang, Hong; Liu, Shijie; He, Hongbo


    In this study, laser damage tests of multilayer dielectric gratings (MDGs) are performed in vacuum (5×10-4 Pa) and in air at a wavelength of 1053 nm with pulse widths of 0.56 ps ~9.7 ps. The laser-induced damage threshold (LIDT) of MDGs in vacuum/air ranges from 2.1/2.2 J/cm2 to 4.4/4.8 J/cm2 for laser beams of normal incidence. The LIDT of MDGs follows a τ0.26 scaling in the pulse width regime considered. The typical damage morphologies in the two environments caused by the near threshold pulse were observed using a scanning electron microscope (SEM); the results indicate that the damage features of MDGs in vacuum are the same as those in air. The testing results reveal that a clean vacuum environment neither changes the laser damage mechanism nor lowers the LIDT of MDGs.

  14. Correlation between stimulated scattering processes and laser-induced damage in crystalline quartz

    NASA Technical Reports Server (NTRS)

    Yu, C.; Haw, M. F.; Hsu, H.


    The results of a systematic series of experiments to uncover possible correlation between laser-induced stimulated-Brillouin-scattering (SBS) phonons and damage in quartz are presented. Such correlation is confirmed and the various thresholds are established. The anomalous transmission factor under phonon generation is found to decay exponentially as predicted with increasing incident laser power. The LF SBS phonon is also demonstrated to be a sensitive probe for precatastrophic damage.

  15. Analyzing electrostatic induced damage risk to reticles with an in situ e-reticle system

    NASA Astrophysics Data System (ADS)

    Tu, Richard; Sebald, Thomas


    E-Reticle system is an electrostatic field test device, which has the form factor of a conventional six inch quartz production reticle. The E-Reticle was used to assess the ESD damage risks in a mask cleaning tool. Test results indicate that a reticle may see higher than ITRS recommended electrostatic potential specifications when mechanical operations and cold DIW rinse start and in progress, hence seeing increased probability of electrostatic induced damages.

  16. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.


    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  17. Ion-induced annealing and amorphization of isolated damage clusters in Si

    SciTech Connect

    Battaglia, A. ); Priolo, F.; Rimini, E. ); Ferla, G. )


    The interaction between high-energy ion irradiation and pre-existing damage clusters dispersed in single-crystal Si is discussed. Silicon substrates were predamaged by low-dose 150 keV Au ions. Post-irradiation by 600 keV Kr{sup 2+} ions resulted in either damage annealing or damage accumulation, depending on the substrate temperature. The transition temperature between these two different regimes is 420 K. These data are discussed and compared with the ion beam induced epitaxy and amorphization of continuous surface amorphous layers.

  18. Modification of radiation-induced oxidative damage in liposomal and microsomal membrane by eugenol

    NASA Astrophysics Data System (ADS)

    Pandey, B. N.; Lathika, K. M.; Mishra, K. P.


    Radiation-induced membrane oxidative damage, and their modification by eugenol, a natural antioxidant, was investigated in liposomes and microsomes. Liposomes prepared with DPH showed decrease in fluorescence after γ-irradiation, which was prevented significantly by eugenol and correlated with magnitude of oxidation of phospholipids. Presence of eugenol resulted in substantial inhibition in MDA formation in irradiated liposomes/microsomes, which was less effective when added after irradiation. Similarly, the increase in phospholipase C activity observed after irradiation in microsomes was inhibited in samples pre-treated with eugenol. Results suggest association of radio- oxidative membrane damage with alterations in signaling molecules, and eugenol significantly prevented these membrane damaging events.

  19. Effect of low and high temperature anneal on process-induced damage of gate oxide

    SciTech Connect

    King, J.C.; Hu, C. . Dept. of Electrical Engineering and Computer Sciences)


    The authors have investigated the ability of high and low temperature anneals to repair the gate oxide damage due to simulated electrical stress caused by wafer charging resulting from plasma etching, etc. Even 800 C anneal cannot restore the stability in interface trap generation. Even 900 C anneal cannot repair the deteriorated charge-to-breakdown and oxide charge trapping. As a small consolation, the ineffectiveness of anneal in repairing the process-induced damage allows them to monitor the damages even at the end of the fabrication process.

  20. Penetration and induced damage evolution of concrete and granite when subjected to multiple projectile impacts

    NASA Astrophysics Data System (ADS)

    Gomez, Jason Thomas

    An experimental study was conducted to investigate the penetration process of multiple impacts into concrete targets. The concrete targets were subjected to repeated constant velocity impacts with an ogive nose projectile. The penetration and crater formation data were consistent with single impact penetration data from previous studies conducted at Sandia National Laboratories. In order to predict the depth of the multiple impact penetration, a single impact penetration model, developed by M. Forrestal at Sandia National Laboratories, was extended to account for the degradation of the target strength with each subsequent impact. The degradation of the target was determined empirically and included in the model as a strength-modifying factor. To further understand the multiple impact penetration process, a study was conducted to look at both the static and dynamic properties of concrete and granite as a function of induced damage. Both static and dynamic compression experiments were performed on concrete and granite specimens with various levels of induced damage. The static compressive strength of both materials decreased with increasing levels of damage due to the induced damage causing the activation and propagation of failure cracks in the specimens. In contrast, the dynamic compressive strength remained unchanged with increasing damage due to the inability of the fracture process zone to develop and relieve the strain energy before complete specimen failure. A series of dynamic and static tensile-splitting experiments were performed on concrete and granite specimens to investigate the effect of induced damage on their tensile strength. The experiments showed that the static splitting strength was highly dependent on the orientation of the induced damage with regard to the applied loading, however the dynamic tensile strength decreased with increasing damage with no apparent dependency on the random damage orientation. Photoelastic experiments have shown that

  1. Neutrophil-derived microparticles induce myeloperoxidase-mediated damage of vascular endothelial cells

    PubMed Central


    Background Upon activation neutrophil releases microparticles - small plasma membrane vesicles that contain cell surface proteins and cytoplasmic matter, with biological activities. In this study we investigated the potential role of myeloperoxidase in the endothelial cell injury caused by neutrophil-derived microparticles. Results Microparticles were produced by activating human neutrophils with a calcium ionophore and characterized by flow cytometry and transmission and scanning electron microscopy. Myeloperoxidase activity was measured by luminol-dependent chemiluminescence. Neutrophil microparticles-induced injuries and morphological alterations in human umbilical vein endothelial cells (HUVECs) were evaluated by microscopy and flow cytometry. Neutrophil microparticles were characterized as structures bounded by lipid bilayers and were less than 1 μm in diameter. The microparticles also expressed CD66b, CD62L and myeloperoxidase, which are all commonly expressed on the surface of neutrophils, as well as exposition of phosphatidylserine. The activity of the myeloperoxidase present on the microparticles was confirmed by hypochlorous acid detection. This compound is only catalyzed by myeloperoxidase in the presence of hydrogen peroxide and chloride ion. The addition of sodium azide or taurine inhibited and reduced enzymatic activity, respectively. Exposure of HUVEC to neutrophil microparticles induced a loss of cell membrane integrity and morphological changes. The addition of sodium azide or myeloperoxidase-specific inhibitor-I consistently reduced the injury to the endothelial cells. Taurine addition reduced HUVEC morphological changes. Conclusions We have demonstrated the presence of active myeloperoxidase in neutrophil microparticles and that the microparticle-associated myeloperoxidase cause injury to endothelial cells. Hence, the microparticle-associated myeloperoxidase-hydrogen peroxide-chloride system may contribute to widespread endothelial cell damage

  2. DNA damage induced by m-phenylenediamine and its derivative in the presence of copper ion.


    Chen, F; Murata, M; Hiraku, Y; Yamashita, N; Oikawa, S; Kawanishi, S


    To clarify the mechanism of carcinogenesis by hair dyes, we compared the extent of DNA damage induced by mutagenic m-phenylenediamine and 4-methoxy-m-phenylenediamine, using 32P-5'-end-labeled DNA fragments obtained from the human c-Ha-ras-1 protooncogene and the p53 tumor suppressor gene. Carcinogenic 4-methoxy-m-phenylenediamine caused DNA damage at thymine and cytosine residues in the presence of Cu(II). Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited 4-methoxy-m-phenylenediamine-induced DNA damage, suggesting the involvement of H2O2 and Cu(I). Superoxide dismutase (SOD) enhanced the DNA damage. Formation of 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was induced by 4-methoxy-m-phenylenediamine in the presence of Cu(II). UV-visible spectroscopic studies have shown that Cu(II) mediated autoxidation of 4-methoxy-m-phenylenediamine and SOD accelerated the autoxidation. On the other hand, non-carcinogenic m-phenylenediamine did not cause clear DNA damage and significant autoxidation even in the presence of Cu(II). These results suggest that carcinogenicity of m-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:9802551

  3. Derinat Protects Skin against Ultraviolet-B (UVB)-Induced Cellular Damage.


    Hsu, Wen-Li; Lu, Jian-He; Noda, Mami; Wu, Ching-Ying; Liu, Jia-Dai; Sakakibara, Manabu; Tsai, Ming-Hsien; Yu, Hsin-Su; Lin, Ming-Wei; Huang, Yaw-Bin; Yan, Shian-Jang; Yoshioka, Tohru


    Ultraviolet-B (UVB) is one of the most cytotoxic and mutagenic stresses that contribute to skin damage and aging through increasing intracellular Ca(2+) and reactive oxygen species (ROS). Derinat (sodium deoxyribonucleate) has been utilized as an immunomodulator for the treatment of ROS-associated diseases in clinics. However, the molecular mechanism by which Derinat protects skin cells from UVB-induced damage is poorly understood. Here, we show that Derinat significantly attenuated UVB-induced intracellular ROS production and decreased DNA damage in primary skin cells. Furthermore, Derinat reduced intracellular ROS, cyclooxygenase-2 (COX-2) expression and DNA damage in the skin of the BALB/c-nu mice exposed to UVB for seven days in vivo. Importantly, Derinat blocked the transient receptor potential canonical (TRPC) channels (TRPCs), as demonstrated by calcium imaging. Together, our results indicate that Derinat acts as a TRPCs blocker to reduce intracellular ROS production and DNA damage upon UVB irradiation. This mechanism provides a potential new application of Derinat for the protection against UVB-induced skin damage and aging. PMID:26569211

  4. pRB plays an essential role in cell cycle arrest induced by DNA damage

    PubMed Central

    Harrington, Elizabeth A.; Bruce, Jacqueline L.; Harlow, Ed; Dyson, Nicholas


    To maintain genome stability, cells with damaged DNA must arrest to allow repair of mutations before replication. Although several key components required to elicit this arrest have been discovered, much of the pathway remains elusive. Here we report that pRB acts as a central mediator of the proliferative block induced by a diverse range of DNA damaging stimuli. Rb−/− mouse embryo fibroblasts are defective in arrest after γ-irradiation, UV irradiation, and treatment with a variety of chemotherapeutic drugs. In contrast, the pRB related proteins p107 and p130 do not play an essential part in the DNA damage response. pRB is required specifically for the G1/S phase checkpoint induced by γ-irradiation. Despite a defect in G1/S phase arrest, levels of p53 and p21 are increased normally in Rb−/− cells in response to γ-irradiation. These results lead us to propose a model in which pRB acts as an essential downstream target of the DNA damage-induced arrest pathway. The ability of pRB to prevent replication of damaged DNA is likely to inhibit the propagation of carcinogenic mutations and may therefore contribute to its role as a tumor suppressor. Furthermore, because many cancer therapies act by damaging DNA, these findings also have implications for the treatment of tumors in which pRB is inactivated. PMID:9751770

  5. Preliminary Results of Earthquake-Induced Building Damage Detection with Object-Based Image Classification

    NASA Astrophysics Data System (ADS)

    Sabuncu, A.; Uca Avci, Z. D.; Sunar, F.


    Earthquakes are the most destructive natural disasters, which result in massive loss of life, infrastructure damages and financial losses. Earthquake-induced building damage detection is a very important step after earthquakes since earthquake-induced building damage is one of the most critical threats to cities and countries in terms of the area of damage, rate of collapsed buildings, the damage grade near the epicenters and also building damage types for all constructions. Van-Ercis (Turkey) earthquake (Mw= 7.1) was occurred on October 23th, 2011; at 10:41 UTC (13:41 local time) centered at 38.75 N 43.36 E that places the epicenter about 30 kilometers northern part of the city of Van. It is recorded that, 604 people died and approximately 4000 buildings collapsed or seriously damaged by the earthquake. In this study, high-resolution satellite images of Van-Ercis, acquired by Quickbird-2 (Digital Globe Inc.) after the earthquake, were used to detect the debris areas using an object-based image classification. Two different land surfaces, having homogeneous and heterogeneous land covers, were selected as case study areas. As a first step of the object-based image processing, segmentation was applied with a convenient scale parameter and homogeneity criterion parameters. As a next step, condition based classification was used. In the final step of this preliminary study, outputs were compared with streetview/ortophotos for the verification and evaluation of the classification accuracy.

  6. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.


    Nackerdien, Z; Atha, D


    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  7. Polyphenols in Exercise Performance and Prevention of Exercise-Induced Muscle Damage

    PubMed Central

    Hrelia, Silvana


    Although moderate physical exercise is considered an essential component of a healthy lifestyle that leads the organism to adapt itself to different stresses, exercise, especially when exhaustive, is also known to induce oxidative stress, inflammation, and muscle damage. Many efforts have been carried out to identify dietary strategies or micronutrients able to prevent or at least attenuate the exercise-induced muscle damage and stress. Unfortunately most studies have failed to show protection, and at the present time data supporting the protective effect of micronutrients, as antioxidant vitamins, are weak and trivial. This review focuses on those polyphenols, present in the plant kingdom, that have been recently suggested to exert some positive effects on exercise-induced muscle damage and oxidative stress. In the last decade flavonoids as quercetin, catechins, and other polyphenols as resveratrol have caught the scientists attention. However, at the present time drawing a clear and definitive conclusion seems to be untimely. PMID:23983900

  8. Inductively Coupled Plasma-Induced Etch Damage of GaN p-n Junctions

    SciTech Connect



    Plasma-induced etch damage can degrade the electrical and optical performance of III-V nitride electronic and photonic devices. We have investigated the etch-induced damage of an Inductively Coupled Plasma (ICP) etch system on the electrical performance of mesa-isolated GaN pn-junction diodes. GaN p-i-n mesa diodes were formed by Cl{sub 2}/BCl{sub 3}/Ar ICP etching under different plasma conditions. The reverse leakage current in the mesa diodes showed a strong relationship to chamber pressure, ion energy, and plasma flux. Plasma induced damage was minimized at moderate flux conditions ({le} 500 W), pressures {ge}2 mTorr, and at ion energies below approximately -275 V.

  9. Laser-induced damage in optical materials: sixteenth ASTM symposium.


    Bennett, H E; Guenther, A H; Milam, D; Newnam, B E


    The Sixteenth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, CO, 15-17 Oct. 1984. The Symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy, the Office of Naval Research, and the Air Force Office of Scientific Research. Approximately 180 scientists attended the Symposium, including representatives from England, France, The Netherlands, Scotland, and West Germany. The Symposium was divided into sessions concerning Materials and Measurements, Mirrors and Surfaces, Thin Films, and Fundamental Mechanisms. As in previous years, the emphasis of the papers presented at the Symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high-power apparatus. The wavelength range of prime interest was from 10.6,microm to the UV region. Highlights included surface characterization, thin-film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. Harold E. Bennett of the U.S. Naval Weapons Center, Arthur H. Guenther of the U.S. Air Force Weapons Laboratory, David Milam of the Lawrence Livermore National Laboratory, and Brian E. Newnam of the Los Alamos National Laboratory were cochairmen of the Symposium. PMID:20454228

  10. Shear loads induce cellular damage in tendon fascicles.


    Kondratko-Mittnacht, Jaclyn; Lakes, Roderic; Vanderby, Ray


    Tendon is vital to musculoskeletal function, transferring loads from muscle to bone for joint motion and stability. It is an anisotropic, highly organized, fibrous structure containing primarily type I collagen in addition to tenocytes and other extracellular matrix components contributing to maintenance and function. Tendon is generally loaded via normal stress in a longitudinal direction. However, certain situations, including fiber breakage, enzymatic remodeling, or tendon pathology may introduce various degrees of other loading modalities, such as shear-lag at the fiber level, potentially affecting cellular response and subsequent function. Fascicles from rat tail tendon were dissected and placed in one of three paired groups: intact, single laceration, or double laceration. Each pair had a mechanically tested and control specimen. Single laceration fascicles contained one transverse laceration to mimic a partial tear. Double laceration fascicles had overlapping, longitudinally separated lacerations on opposite sides to cause intra-fascicular shear transfer to be the primary mechanism of loading. Elastic properties of the fascicle, e.g. peak load, steady state load, and stiffness, decreased from intact to single laceration to double laceration groups. Surprisingly, 45% of the intact strength was maintained when shear was the primary internal load transfer mechanism. Cellular viability decreased after mechanical testing in both laceration groups; cell death appeared primarily in a longitudinal plane where high shear load transfer occurred. This cell death extended far from the injury site and may further compromise an already damaged tendon via enzymatic factors and subsequent remodeling associated with cell necrosis. PMID:26162546

  11. Dimethylformamide-induced liver damage among synthetic leather workers

    SciTech Connect

    Wang, J.D.; Lai, M.Y.; Chen, J.S.; Lin, J.M.; Chiang, J.R.; Shiau, S.J.; Chang, W.S. )


    Prevalence of liver injury associated with dimethylformamide (DMF) exposure was determined. Medical examinations, liver function tests, and creatine phosphokinase (CPK) determinations were performed on 183 of 204 (76%) employees of a synthetic leather factory. Air concentrations of solvents were measured with personal samplers and gas chromatography. The concentration of DMF in air to which each worker was exposed was categorized. High exposure concentrations of DMF (i.e., 25-60 ppm) were significantly associated with elevated alanine aminotransferase (ALT) levels (ALT greater than or equal to 35 IU/l), a result that did not change even after stratification by hepatitis B carrier status. Modeling by logistic regression demonstrated that exposure to high concentrations of DMF was associated with an elevated ALT (p = .01), whereas hepatitis B surface antigen (HBsAg) was slightly but independently associated with an elevated ALT (p = .07). In those workers who had normal ALT values, there occurred still significantly higher mean ALT and aspartate aminotransferase (AST) activities, especially among those who were not HBsAg carriers. A significant association existed between elevated CPK levels and exposure to DMF. However, an analysis of the CPK isoenzyme among 143 workers did not reveal any specific damage to muscles. This outbreak of liver injury among synthetic leather workers is ascribed to DMF. It is recommended that the occupational standard for DMF and its toxicity among HBsAg carriers be evaluated further.

  12. Radiation-induced renal damage: the effects of hyperfractionation. [Mice

    SciTech Connect

    Stewart, F.A.; Soranson, J.A.; Alpen, E.L.; Williams, M.V.; Denekamp, J.


    The response of mouse kidneys to multifraction irradiation was assessed using three nondestructive functional end points. A series of schedules was investigated giving 1, 2, 4, 8, 16, 32, or 64 equal X-ray doses, using doses per fraction in the range of 0.9 to 16 Gy. The overall treatment time was kept constant at 3 weeks. Kidney function was assessed from 19 to 48 weeks after irradiation by measuring changes in isotope clearance, urine output, and hematocrit. All three assays yielded steep dose-effect curves from which the repair capacity of kidney could be estimated by comparing the isoeffective doses in different schedules. There was a marked influence of fractionation, with increasing dose being required to achieve the same level of damage for increasing fraction number, even between 32 and 64 fractions. The data are well fitted by a linear quadratic dose-response equation, and analysis of the data would suggest that hyperfractionation, using extremely small X-ray doses per fraction, would spare kidneys relative to tumors and acutely responding tissues.

  13. Positive feedback regulation of p53 transactivity by DNA damage-induced ISG15 modification

    PubMed Central

    Park, Jong Ho; Yang, Seung Wook; Park, Jung Mi; Ka, Seung Hyeun; Kim, Ji-Hoon; Kong, Young-Yun; Jeon, Young Joo; Seol, Jae Hong; Chung, Chin Ha


    p53 plays a pivotal role in tumour suppression under stresses, such as DNA damage. ISG15 has been implicated in the control of tumorigenesis. Intriguingly, the expression of ISG15, UBE1L and UBCH8 is induced by DNA-damaging agents, such as ultraviolet and doxorubicin, which are known to induce p53. Here, we show that the genes encoding ISG15, UBE1L, UBCH8 and EFP, have the p53-responsive elements and their expression is induced in a p53-dependent fashion under DNA damage conditions. Furthermore, DNA damage induces ISG15 conjugation to p53 and this modification markedly enhances the binding of p53 to the promoters of its target genes (for example, CDKN1 and BAX) as well as of its own gene by promoting phosphorylation and acetylation, leading to suppression of cell growth and tumorigenesis. These findings establish a novel feedback circuit between p53 and ISG15-conjugating system for positive regulation of the tumour suppressive function of p53 under DNA damage conditions. PMID:27545325

  14. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, K.; Cucinotta, F. A.


    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to 28Si- ions with energies ranging from 90 to 600 MeV/u, or to 56Fe-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Fe beams in this study ranged from 145 to 440 keV/micron and the LET of the Si ions ranged from 48 to 158 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to -rays. The estimates of RBE(sub max) values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBE(sub max) value for Fe ions was obtained with the 600-Mev/u beam, and the highest RBE(sub max) value for Si ions was obtained with the 170 MeV/u beam. For both ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/ m for Si, and decreasing with further increase in LET. Additional studies for low doses 28Si-ions down to 0.02 Gy will be discussed.

  15. Thermal analysis of induced damage to the healthy cell during RFA of breast tumor.


    Singh, Sundeep; Bhowmik, Arka; Repaka, Ramjee


    Effective pre-clinical computational modeling strategies have been demonstrated in this article to enable risk free clinical application of radiofrequency ablation (RFA) of breast tumor. The present study (a) determines various optimal regulating parameters required for RFA of tumor and (b) introduces an essential clinical monitoring scheme to minimize the extent of damage to the healthy cell during RFA of tumor. The therapeutic capabilities offered by RFA of breast tumor, viz., the rise in local temperature and induced thermal damage have been predicted by integrating the bioheat transfer model, the electric field distribution model and the thermal damage model. The mathematical model has been validated with the experimental results available in the literature. The results revealed that, the effective damage of tumor volume sparing healthy tissue essentially depends on the voltage, the exposure time, the local heat distribution, the tumor stage and the electrode geometric configuration. It has been confirmed that, the assessment of damage front can accurately determine the extent of damage as compared to the thermal front. The study further evaluates the damaged healthy and tumor volumes due to RFA of different stages of breast cancer. The assessment of cell survival and damage fractions discloses the propensity of reappearance/healing of tumor cells after treatment. PMID:27157337

  16. Hyperprolinemia induces DNA, protein and lipid damage in blood of rats: antioxidant protection.


    Ferreira, Andréa G K; Scherer, Emilene B; da Cunha, Aline A; Manfredini, Vanusa; Biancini, Giovana Brondani; Vanzin, Camila Simioni; Vargas, Carmen R; Wyse, Angela T S


    The present study investigated the effects of hyperprolinemia on oxidative damage to biomolecules (protein, lipids and DNA) and the antioxidant status in blood of rats. The influence of the antioxidants on the effects elicited by proline was also examined. Wistar rats received two daily injections of proline and/or vitamin E plus C (6th-28th day of life) and were killed 12h after the last injection. Results showed that hyperprolinemia induced a significant oxidative damage to proteins, lipids and DNA demonstrated by increased carbonyl content, malondialdehyde levels and a greater damage index in comet assay, respectively. The concomitant antioxidants administration to proline treatment completely prevented oxidative damage to proteins, but partially prevented lipids and DNA damage. We also observed that the non-enzymatic antioxidant potential was decreased by proline treatment and partially prevented by antioxidant supplementation. The plasma levels of vitamins E and C significantly increased in rats treated exogenously with these vitamins but, interestingly, when proline was administered concomitantly with vitamin E plus C, the levels of these vitamins were similar to those found in plasma of control and proline rats. Our findings suggest that hyperprolinemia promotes oxidative damage to the three major classes of macromolecules in blood of rats. These effects were accomplished by decrease in non-enzymatic antioxidant potential and decrease in vitamins administered exogenously, which significantly decreased oxidative damage to biomolecules studied. These data suggest that antioxidants may be an effective adjuvant therapeutic to limit oxidative damage caused by proline. PMID:24980685

  17. Temperature effect on the shear-induced cell damage in biofabrication.


    Li, Ming G; Tian, Xiao Y; Chen, Xiongbiao


    Biofabrication that incorporates living cells to manufacture various bioproducts is often carried out at different temperatures as the process demands. In the process, cells are subjected to mechanical forces, which may damage cells if the forces reach a certain level. Previous studies have shown that the cell damage is mainly caused by shear stress; however, none of them looked at the temperature effect on cell damage. In the present work, the influence of temperature on shear-induced cell damage was investigated experimentally by using a cone-and-plate rheometer, and based on the experimental results, a cell damage law was established to quantitatively describe the relationship between the cell damage percent and temperature. The so-established cell damage law was then applied to the modeling of the cell damage percent that occurs in the biofabrication process in which pressurized air was applied to dispense Schwann cells suspended in the alginate solution at different temperatures. The agreement between the model predictions and the experimental results suggests that the method presented in this article is effective for use in the investigation of the temperature effect, thereby providing a cue to preserve cell viability in the biofabrication processes. PMID:21752034

  18. Sulforaphane protects against cytokine- and streptozotocin-induced {beta}-cell damage by suppressing the NF-{kappa}B pathway

    SciTech Connect

    Song, Mi-Young; Kim, Eun-Kyung; Moon, Woo-Sung; Park, Jin-Woo; Kim, Hyung-Jin; So, Hong-Seob; Park, Raekil; Kwon, Kang-Beom Park, Byung-Hyun


    Sulforaphane (SFN) is an indirect antioxidant that protects animal tissues from chemical or biological insults by stimulating the expression of several NF-E2-related factor-2 (Nrf2)-regulated phase 2 enzymes. Treatment of RINm5F insulinoma cells with SFN increases Nrf2 nuclear translocation and expression of phase 2 enzymes. In this study, we investigated whether the activation of Nrf2 by SFN treatment or ectopic overexpression of Nrf2 inhibited cytokine-induced {beta}-cell damage. Treatment of RIN cells with IL-1{beta} and IFN-{gamma} induced {beta}-cell damage through a NF-{kappa}B-dependent signaling pathway. Activation of Nrf2 by treatment with SFN and induction of Nrf2 overexpression by transfection with Nrf2 prevented cytokine toxicity. The mechanism by which Nrf2 activation inhibited NF-{kappa}B-dependent cell death signals appeared to involve the reduction of oxidative stress, as demonstrated by the inhibition of cytokine-induced H{sub 2}O{sub 2} production. The protective effect of SFN was further demonstrated by the restoration of normal insulin secreting responses to glucose in cytokine-treated rat pancreatic islets. Furthermore, pretreatment with SFN blocked the development of type 1 diabetes in streptozotocin-treated mice.

  19. Nucleolar damage correlates with neurotoxicity induced by different platinum drugs

    PubMed Central

    McKeage, M J; Hsu, T; Screnci, D; Haddad, G; Baguley, B C


    Platinum-based drugs are very useful in cancer therapy but are associated with neurotoxicity in the clinic. To investigate the mechanism of neurotoxicity, dorsal root ganglia of rats treated with various platinum drugs were studied. Cell body, nuclear and nucleolar dimensions of dorsal root ganglia sensory nerve cells were measured to determine morphological toxicity. Sensory nerve conduction velocity was measured to determine functional toxicity. After a single dose of oxaliplatin (10 mg kg−1), no significant change in nuclear and cell body diameter was seen but decreased nucleolar size was apparent within a few hours of treatment. Changes in nucleolar size were maximal at 24 hours, recovered very slowly and showed a non-linear dependence on oxaliplatin dose (r2= 0.99). Functional toxicity was delayed in onset until 14 days after a single dose of oxaliplatin but eventually recovered 3 months after treatment. Multiple doses of cisplatin, carboplatin, oxaliplatin, R, R -ormaplatin and S, S -ormaplatin were also associated with time-dependent reduction in nucleolar size. A linear correlation was obtained between the rate of change in nucleolar size during multiple dose treatment with the series of platinum drugs and the time taken for the development of altered sensory nerve conduction velocity (r2= 0.86;P< 0.024). Damage to the nucleolus of ganglionic sensory neurons is therefore linked to the neurotoxicity of platinum-based drugs, possibly through mechanisms resulting in the inhibition of rRNA synthesis. © 2001 Cancer Research Campaign PMID:11710838

  20. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.


    Ganesan, Shanthi; Keating, Aileen F


    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  1. Cerium oxide nanoparticles, combining antioxidant and UV shielding properties, prevent UV-induced cell damage and mutagenesis

    NASA Astrophysics Data System (ADS)

    Caputo, Fanny; de Nicola, Milena; Sienkiewicz, Andrzej; Giovanetti, Anna; Bejarano, Ignacio; Licoccia, Silvia; Traversa, Enrico; Ghibelli, Lina


    Efficient inorganic UV shields, mostly based on refracting TiO2 particles, have dramatically changed the sun exposure habits. Unfortunately, health concerns have emerged from the pro-oxidant photocatalytic effect of UV-irradiated TiO2, which mediates toxic effects on cells. Therefore, improvements in cosmetic solar shield technology are a strong priority. CeO2 nanoparticles are not only UV refractors but also potent biological antioxidants due to the surface 3+/4+ valency switch, which confers anti-inflammatory, anti-ageing and therapeutic properties. Herein, UV irradiation protocols were set up, allowing selective study of the extra-shielding effects of CeO2vs. TiO2 nanoparticles on reporter cells. TiO2 irradiated with UV (especially UVA) exerted strong photocatalytic effects, superimposing their pro-oxidant, cell-damaging and mutagenic action when induced by UV, thereby worsening the UV toxicity. On the contrary, irradiated CeO2 nanoparticles, via their Ce3+/Ce4+ redox couple, exerted impressive protection on UV-treated cells, by buffering oxidation, preserving viability and proliferation, reducing DNA damage and accelerating repair; strikingly, they almost eliminated mutagenesis, thus acting as an important tool to prevent skin cancer. Interestingly, CeO2 nanoparticles also protect cells from the damage induced by irradiated TiO2, suggesting that these two particles may also complement their effects in solar lotions. CeO2 nanoparticles, which intrinsically couple UV shielding with biological and genetic protection, appear to be ideal candidates for next-generation sun shields.

  2. Cerium oxide nanoparticles, combining antioxidant and UV shielding properties, prevent UV-induced cell damage and mutagenesis.


    Caputo, Fanny; De Nicola, Milena; Sienkiewicz, Andrzej; Giovanetti, Anna; Bejarano, Ignacio; Licoccia, Silvia; Traversa, Enrico; Ghibelli, Lina


    Efficient inorganic UV shields, mostly based on refracting TiO2 particles, have dramatically changed the sun exposure habits. Unfortunately, health concerns have emerged from the pro-oxidant photocatalytic effect of UV-irradiated TiO2, which mediates toxic effects on cells. Therefore, improvements in cosmetic solar shield technology are a strong priority. CeO2 nanoparticles are not only UV refractors but also potent biological antioxidants due to the surface 3+/4+ valency switch, which confers anti-inflammatory, anti-ageing and therapeutic properties. Herein, UV irradiation protocols were set up, allowing selective study of the extra-shielding effects of CeO2vs. TiO2 nanoparticles on reporter cells. TiO2 irradiated with UV (especially UVA) exerted strong photocatalytic effects, superimposing their pro-oxidant, cell-damaging and mutagenic action when induced by UV, thereby worsening the UV toxicity. On the contrary, irradiated CeO2 nanoparticles, via their Ce(3+)/Ce(4+) redox couple, exerted impressive protection on UV-treated cells, by buffering oxidation, preserving viability and proliferation, reducing DNA damage and accelerating repair; strikingly, they almost eliminated mutagenesis, thus acting as an important tool to prevent skin cancer. Interestingly, CeO2 nanoparticles also protect cells from the damage induced by irradiated TiO2, suggesting that these two particles may also complement their effects in solar lotions. CeO2 nanoparticles, which intrinsically couple UV shielding with biological and genetic protection, appear to be ideal candidates for next-generation sun shields. PMID:26349675

  3. β-Cryptoxanthin supplementation prevents cigarette smoke-induced lung inflammation, oxidative damage and squamous metaplasia in ferrets

    PubMed Central

    Liu, Chun; Bronson, Roderick T.; Russell, Robert M.; Wang, Xiang-Dong


    In epidemiologic studies, high intake of β-cryptoxanthin has been associated with a decreased risk of lung cancer, particularly among current smokers. However, data are not available from well-controlled animal studies to examine the effects of β-cryptoxanthin on cigarette smoke-induced lung lesions, and the biological mechanisms by which β-cryptoxanthin might affect lung carcinogenesis. We evaluated the effects of β-cryptoxanthin supplementation on cigarette smoke-induced squamous metaplasia, inflammation, and changes in protein levels of pro-inflammatory cytokine [tumor necrosis factor alpha (TNFα)] and transcription factors [nuclear factor kappa B (NF-κB) and activator protein-1 (AP-1)], as well as on smoke-induced oxidative DNA damage [8-hydroxy-2′-deoxyguanosine (8-OHdG)] in the lung tissue of ferrets. Thirty six male ferrets were assigned to cigarette smoke exposure or no exposure and to low-dose, or high-dose β-cryptoxanthin, or no dose (2 × 3 factorial design) for 3 months. β-Cryptoxanthin supplementation dose-dependently increased plasma and lung β-cryptoxanthin levels in ferrets, whereas cigarette smoke exposure lowered plasma and lung β-cryptoxanthin levels. β-Cryptoxanthin at both doses significantly decreased smoke-induced lung squamous metaplasia and inflammation. β-Cryptoxanthin also substantially reduced smoke-elevated TNFα levels in alveolar, bronchial, bronchiolar and bronchial serous/mucous gland epithelial cells and in lung macrophages. Moreover, β-cryptoxanthin decreased smoke-induced activation of NF-κB, expression of AP-1 and levels of 8-OHdG. The beneficial effects of β-cryptoxanthin were stronger for high-dose β-cryptoxanthin than for low-dose β-cryptoxanthin. Data from this study indicate that β-cryptoxanthin provides a beneficial effect against cigarette smoke-induced inflammation, oxidative DNA damage and squamous metaplasia in the lungs. PMID:21421799

  4. β-Cryptoxanthin supplementation prevents cigarette smoke-induced lung inflammation, oxidative damage, and squamous metaplasia in ferrets.


    Liu, Chun; Bronson, Roderick T; Russell, Robert M; Wang, Xiang-Dong


    In epidemiologic studies, high intake of β-cryptoxanthin has been associated with a decreased risk of lung cancer, particularly among current smokers. However, data are not available from well-controlled animal studies to examine the effects of β-cryptoxanthin on cigarette smoke-induced lung lesions, and the biological mechanisms by which β-cryptoxanthin might affect lung carcinogenesis. We evaluated the effects of β-cryptoxanthin supplementation on cigarette smoke-induced squamous metaplasia, inflammation, and changes in protein levels of proinflammatory cytokine [tumor necrosis factor alpha (TNFα)] and transcription factors [nuclear factor kappa B (NF-κB) and activator protein-1 (AP-1)], as well as on smoke-induced oxidative DNA damage [8-hydroxy-2'-deoxyguanosine (8-OHdG)] in the lung tissue of ferrets. Thirty-six male ferrets were assigned to cigarette smoke exposure or no exposure and to low-dose, or high-dose β-cryptoxanthin, or no dose (2 × 3 factorial design) for 3 months. β-Cryptoxanthin supplementation dose-dependently increased plasma and lung β-cryptoxanthin levels in ferrets, whereas cigarette smoke exposure lowered plasma and lung β-cryptoxanthin levels. β-Cryptoxanthin at both doses significantly decreased smoke-induced lung squamous metaplasia and inflammation. β-Cryptoxanthin also substantially reduced smoke-elevated TNFα levels in alveolar, bronchial, bronchiolar, and bronchial serous/mucous gland epithelial cells and in lung macrophages. Moreover, β-cryptoxanthin decreased smoke-induced activation of NF-κB, expression of AP-1 and levels of 8-OHdG. The beneficial effects of β-cryptoxanthin were stronger for high-dose β-cryptoxanthin than for low-dose β-cryptoxanthin. Data from this study indicate that β-cryptoxanthin provides a beneficial effect against cigarette smoke-induced inflammation, oxidative DNA damage and squamous metaplasia in the lungs. PMID:21421799

  5. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W.; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  6. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.


    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  7. Nano-ranged low-energy ion-beam-induced DNA transfer in biological cells

    NASA Astrophysics Data System (ADS)

    Yu, L. D.; Wongkham, W.; Prakrajang, K.; Sangwijit, K.; Inthanon, K.; Thongkumkoon, P.; Wanichapichart, P.; Anuntalabhochai, S.


    Low-energy ion beams at a few tens of keV were demonstrated to be able to induce exogenous macromolecules to transfer into plant and bacterial cells. In the process, the ion beam with well controlled energy and fluence bombarded living cells to cause certain degree damage in the cell envelope in nanoscales to facilitate the macromolecules such as DNA to pass through the cell envelope and enter the cell. Consequently, the technique was applied for manipulating positive improvements in the biological species. This physical DNA transfer method was highly efficient and had less risk of side-effects compared with chemical and biological methods. For better understanding of mechanisms involved in the process, a systematic study on the mechanisms was carried out. Applications of the technique were also expanded from DNA transfer in plant and bacterial cells to DNA transfection in human cancer cells potentially for the stem cell therapy purpose. Low-energy nitrogen and argon ion beams that were applied in our experiments had ranges of 100 nm or less in the cell envelope membrane which was majorly composed of polymeric cellulose. The ion beam bombardment caused chain-scission dominant damage in the polymer and electrical property changes such as increase in the impedance in the envelope membrane. These nano-modifications of the cell envelope eventually enhanced the permeability of the envelope membrane to favor the DNA transfer. The paper reports details of our research in this direction.

  8. MCPIP is induced by cholesterol and participated in cholesterol-caused DNA damage in HUVEC

    PubMed Central

    Da, Jingjing; Zhuo, Ming; Qian, Minzhang


    Hypercholesterolemia is an important risk factor for atherosclerosis and cholesterol treatment would cause multiple damages, including DNA damage, on endothelial cells. In this work, we have used human umbilical vein endothelial cell line (HUVEC) to explore the mechanism of cholesterol induced damage. We have found that cholesterol treatment on HUVEC could induce the expression of MCPIP1. When given 12.5 mg/L cholesterol on HUVEC, the expression of MCPIP1 starts to increase since 4 hr after treatment and at 24 hr after treatment it could reach to 10 fold of base line level. We hypothesis this induction of MCPIP1 may contribute to the damaging process and we have used siRNA of MCPIP1 in further research. This MCPIP1 siRNA (siMCPIP) could down regulate MCPIP1 by 73.4% and when using this siRNA on HUVECs, we could see the cholesterol induced DNA damage have been reduced. We have detected DNA damage by γH2AX foci formation in nuclear, γH2AX protein level and COMET assay. Compare to cholesterol alone group, siMCPIP group shows much less γH2AX foci formation in nuclear after cholesterol treatment, less γH2AX protein level in cell and also less tail moment detected in COMET assay. We have also seen that using siMCPIP1 could result in less reactive oxygen species (ROS) in cell after cholesterol treatment. We have also seen that using siMCPIP could reduce the protein level of Nox4 and p47phox, two major regulators in ROS production. These results suggest that MCPIP1 may play an important role in cholesterol induced damage. PMID:26617772

  9. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi


    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  10. Hyaluronic acid prevents immunosuppressive drug-induced ovarian damage via up-regulating PGRMC1 expression

    PubMed Central

    Zhao, Guangfeng; Yan, Guijun; Cheng, Jie; Zhou, Xue; Fang, Ting; Sun, Haixiang; Hou, Yayi; Hu, Yali


    Chemotherapy treatment in women can frequently cause damage to the ovaries, which may lead to primary ovarian insufficiency (POI). In this study, we assessed the preventative effects of hyaluronic acid (HA) in immunosuppressive drug-induced POI-like rat models and investigated the possible mechanisms. We found that HA, which was reduced in primary and immunosuppressant-induced POI patients, could protect the immunosuppressant-induced damage to granulosa cells (GCs) in vitro. Then we found that HA blocked the tripterygium glycosides (TG) induced POI-like presentations in rats, including delayed or irregular estrous cycles, reduced 17 beta-estradiol(E2) concentration, decreased number of follicles, destruction of follicle structure, and damage of reproductive ability. Furthermore, we investigated the mechanisms of HA prevention effects on POI, which was associated with promotion of GC proliferation and PGRMC1 expression. In conclusion, HA prevents chemotherapy-induced ovarian damage by promoting PGRMC1 in GCs. This study may provide a new strategy for prevention and treatment of POI. PMID:25558795

  11. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.


    Haza, Ana Isabel; Morales, Paloma


    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. PMID:20583320

  12. Prevention of UVB Radiation-induced Epidermal Damage by Expression of Heat Shock Protein 70*

    PubMed Central

    Matsuda, Minoru; Hoshino, Tatsuya; Yamashita, Yasuhiro; Tanaka, Ken-ichiro; Maji, Daisuke; Sato, Keizo; Adachi, Hiroaki; Sobue, Gen; Ihn, Hironobu; Funasaka, Yoko; Mizushima, Tohru


    Irradiation with UV light, especially UVB, causes epidermal damage via the induction of apoptosis, inflammatory responses, and DNA damage. Various stressors, including UV light, induce heat shock proteins (HSPs) and the induction, particularly that of HSP70, provides cellular resistance to such stressors. The anti-inflammatory activity of HSP70, such as its inhibition of nuclear factor kappa B (NF-κB), was recently revealed. These in vitro results suggest that HSP70 protects against UVB-induced epidermal damage. Here we tested this idea by using transgenic mice expressing HSP70 and cultured keratinocytes. Irradiation of wild-type mice with UVB caused epidermal damage such as induction of apoptosis, which was suppressed in transgenic mice expressing HSP70. UVB-induced apoptosis in cultured keratinocytes was suppressed by overexpression of HSP70. Irradiation of wild-type mice with UVB decreased the cutaneous level of IκB-α (an inhibitor of NF-κB) and increased the infiltration of leukocytes and levels of pro-inflammatory cytokines and chemokines in the epidermis. These inflammatory responses were suppressed in transgenic mice expressing HSP70. In vitro, the overexpression of HSP70 suppressed the expression of pro-inflammatory cytokines and chemokines and increased the level of IκB-α in keratinocytes irradiated with UVB. UVB induced an increase in cutaneous levels of cyclobutane pyrimidine dimers and 8-hydroxy-2′-deoxyguanosine, both of which were suppressed in transgenic mice expressing HSP70. This study provides genetic evidence that HSP70 protects the epidermis from UVB-induced radiation damage. The findings here also suggest that the protective action of HSP70 is mediated by anti-apoptotic, anti-inflammatory, and anti-DNA damage effects. PMID:20018843

  13. Yields of biologically significant damage produced in mammalian DNA by irradiation associated with radon decay. Final progress report

    SciTech Connect

    Ward, J.F.


    The objective of this project was to characterize the difference between damage to DNA caused by alpha particles and by low LET radiation. Estimation of the risk posed by exposure to high LET radiation (such as that from radon) relies at present on epidemiological data, and is therefore largely empirical. This empiricism is evident from the concepts of quality factor or RBE that find use for describing the biological effects of high LET radiation. The author argues that some effort should be made to address the mechanisms of DNA damage by high and low LET forms of radiation, and how these mechanisms might relate to the biological endpoints. This report summarizes the results of the author`s investigations and the current understanding of these mechanisms.

  14. Effective protection of biological membranes against photo-oxidative damage: Polymeric antioxidant forming a protecting shield over the membrane.


    Mertins, Omar; Mathews, Patrick D; Gomide, Andreza B; Baptista, Mauricio S; Itri, Rosangela


    We have prepared a chitosan polymer modified with gallic acid in order to develop an efficient protection strategy biological membranes against photodamage. Lipid bilayers were challenged with photoinduced damage by photosensitization with methylene blue, which usually causes formation of hydroperoxides, increasing area per lipid, and afterwards allowing leakage of internal materials. The damage was delayed by a solution of gallic acid in a concentration dependent manner, but further suppressed by the polymer at very low concentrations. The membrane of giant unilamellar vesicles was covered with this modified macromolecule leading to a powerful shield against singlet oxygen and thus effectively protecting the lipid membrane from oxidative stress. The results have proven the discovery of a promising strategy for photo protection of biological membranes. PMID:26055894

  15. Lespedeza davurica (Lax.) Schindl. extract protects against cytokine-induced β-cell damage and streptozotocin-induced diabetes.


    Sharma, Bhesh Raj; Rhyu, Dong Young


    Lespedeza has been used for the management of diabetes in folklore medicine. The purpose of this study is to investigate the protective effects of the methanol extract of Lespedeza davurica (LD) on cytokine-induced β-cell damage and streptozotocin- (STZ-) induced diabetes. RINm5F cells were treated with interleukin- (IL-) 1β and interferon- (IFN-) γ to induce pancreatic β-cell damage. The exposure of LD extract significantly decreased cell death, nitric oxide (NO) production, nitric oxide synthase (iNOS) expression, and nucleus factor-kappa B (NF-κB) p65 activation. Antidiabetic effects of LD extract were observed by oral glucose tolerance test (OGTT) in normal rats and by checking the biochemical, physiological, and histopathological parameters in STZ-induced diabetic rats. In OGTT, glucose clearance levels improved by oral treatment of LD extract. The water intake, urine volume, blood glucose, and serum TG, TC, TBARS, and DPP-IV levels were significantly decreased, and liver glycogen content was significantly increased by treatment of LD extract (250 mg/kg BW) in STZ-induced diabetic rats. Also, insulin immunoreactivity of the pancreases was increased in LD extract administrated rats compared with diabetic control rats. These results indicate that LD extract may protect pancreatic β-cell damage and regulate the blood glucose in STZ-induced diabetic rats. PMID:25793188

  16. From radiation-induced chromosome damage to cell death: modelling basic mechanisms and applications to boron neutron capture therapy.


    Ballarini, F; Bortolussi, S; Clerici, A M; Ferrari, C; Protti, N; Altieri, S


    Cell death is a crucial endpoint in radiation-induced biological damage: on one side, cell death is a reference endpoint to characterise the action of radiation in biological targets; on the other side, any cancer therapy aims to kill tumour cells. Starting from Lea's target theory, many models have been proposed to interpret radiation-induced cell killing; after briefly discussing some of these models, in this paper, a mechanistic approach based on an experimentally observed link between chromosome aberrations and cell death was presented. More specifically, a model and a Monte Carlo code originally developed for chromosome aberrations were extended to simulate radiation-induced cell death applying an experimentally observed one-to-one relationship between the average number of 'lethal aberrations' (dicentrics, rings and deletions) per cell and -ln S, S being the fraction of surviving cells. Although such observation was related to X rays, in the present work, the approach was also applied to protons and alpha particles. A good agreement between simulation outcomes and literature data provided a model validation for different radiation types. The same approach was then successfully applied to simulate the survival of cells enriched with boron and irradiated with thermal neutrons at the Triga Mark II reactor in Pavia, to mimic a typical treatment for boron neutron capture therapy. PMID:21159746

  17. A DNA Damage-Induced, SOS-Independent Checkpoint Regulates Cell Division in Caulobacter crescentus

    PubMed Central

    Modell, Joshua W.; Kambara, Tracy K.; Perchuk, Barrett S.; Laub, Michael T.


    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  18. Tempol prevents genotoxicity induced by vorinostat: role of oxidative DNA damage.


    Alzoubi, Karem H; Khabour, Omar F; Jaber, Aya G; Al-Azzam, Sayer I; Mhaidat, Nizar M; Masadeh, Majed M


    Vorinostat is a member of histone deacetylase inhibitors, which represents a new class of anticancer agents for the treatment of solid and hematological malignancies. Studies have shown that these drugs induce DNA damage in blood lymphocytes, which is proposed to be due to the generation of oxidative lesions. The increase in DNA damage is sometimes associated with risk of developing secondary cancer. Thus, finding a treatment that limits DNA damage caused by anticancer drugs would be beneficial. Tempol is a potent antioxidant that was shown to prevent DNA damage induced by radiation. In this study, we aimed to investigate the harmful effects of vorinostat on DNA damage, and the possible protective effects of tempol against this damage. For that, the spontaneous frequency of sister chromatid exchanges (SCEs), chromosomal aberrations (CAs), and 8-hydroxy-2-deoxy guanosine (8-OHdG) levels were measured in cultured human lymphocytes treated with vorinostat and/or tempol. The results showed that vorinostat significantly increases the frequency of SCEs, CAs and 8-OHdG levels in human lymphocytes as compared to control. These increases were normalized by the treatment of cells with tempol. In conclusion, vorinostat is genotoxic to lymphocytes, and this toxicity is reduced by tempol. Such results could set the stage for future studies investigating the possible usefulness of antioxidants co-treatment in preventing the genotoxicity of vorinostat when used as anticancer in human. PMID:23761013

  19. DNA damage response during mitosis induces whole chromosome mis-segregation

    PubMed Central

    Bakhoum, Samuel F.; Kabeche, Lilian; Murnane, John P.; Zaki, Bassem I.; Compton, Duane A.


    Many cancers display both structural (s-CIN) and numerical (w-CIN) chromosomal instabilities. Defective chromosome segregation during mitosis has been shown to cause DNA damage that induces structural rearrangements of chromosomes (s-CIN). In contrast, whether DNA damage can disrupt mitotic processes to generate whole chromosomal instability (w-CIN) is unknown. Here we show that activation of the DNA damage response (DDR) during mitosis selectively stabilizes kinetochore-microtubule (k-MT) attachments to chromosomes through Aurora-A and Plk1 kinases, thereby increasing the frequency of lagging chromosomes during anaphase. Inhibition of DDR proteins, ATM or Chk2, abolishes the effect of DNA damage on k-MTs and chromosome segregation, whereas activation of the DDR in the absence of DNA damage is sufficient to induce chromosome segregation errors. Finally, inhibiting the DDR during mitosis in cancer cells with persistent DNA damage suppresses inherent chromosome segregation defects. Thus, DDR during mitosis inappropriately stabilizes k-MTs creating a link between s-CIN and w-CIN. PMID:25107667

  20. A facile method for the assessment of DNA damage induced by UV-activated nanomaterials

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yuka; Zinchenko, Anatoly A.; Murata, Shizuaki


    Fluorescent microscopy observation of gene-size DNA (T4 phage DNA or λ phage DNA) was used to assess DNA damage induced by UV irradiation in the presence of nanomaterials, such as QDs (quantum dots: CdSe/ZnS semiconductor nanoparticles), the water-soluble fullerene derivative C60(OH)n (n = 6-12) and titanium oxide nanoparticles of 25 nm in diameter. The magnitude of DNA damage could be simply evaluated based on the degree of shortening of the stretched DNA image. This method showed that DNA damage was amplified by the action of QDs under irradiation by C-band (λmax = 254 nm) or B-band (λmax = 303 nm) UV. Smaller QDs that emitted higher-energy fluorescence (λemmax = 565 nm) induced more severe damage than medium- and larger-size QDs that emitted longer-wavelength fluorescence (λemmax = 605 and 705 nm, respectively). The fullerene derivative and TiO2 nanoparticles caused DNA damage even under irradiation by A-band UV (λmax = 365 nm) and showed more severe DNA damage than QDs under similar conditions.

  1. A DNA damage-induced, SOS-independent checkpoint regulates cell division in Caulobacter crescentus.


    Modell, Joshua W; Kambara, Tracy K; Perchuk, Barrett S; Laub, Michael T


    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  2. Ochratoxin A induces oxidative DNA damage in liver and kidney after oral dosing to rats.


    Kamp, Hennicke G; Eisenbrand, Gerhard; Janzowski, Christine; Kiossev, Jetchko; Latendresse, John R; Schlatter, Josef; Turesky, Robert J


    The nephrotoxic/carcinogenic mycotoxin ochratoxin A (OTA) occurs as a contaminant in food and feed and may be linked to human endemic Balkan nephropathy. The mechanism of OTA-derived carcinogenicity is still under debate, since reactive metabolites of OTA and DNA adducts have not been unambiguously identified. Oxidative DNA damage, however, has been observed in vitro after incubation of mammalian cells with OTA. In this study, we investigated whether OTA induces oxidative DNA damage in vivo as well. Male F344 rats were dosed with 0, 0.03, 0.1, 0.3 mg/kg bw per day OTA for 4 wk (gavage, 7 days/wk, five animals per dose group). Subsequently, oxidative DNA damage was determined in liver and kidney by the comet assay (single cell gel electrophoresis) with/without use of the repair enzyme formamido-pyrimidine-DNA-glycosylase (FPG). The administration of OTA had no effect on basic DNA damage (determined without FPG); however, OTA-mediated oxidative damage was detected with FPG treatment in kidney and liver DNA of all dose groups. Since the doses were in a range that had caused kidney tumors in a 2-year carcinogenicity study with rats, the oxidative DNA damage induced by OTA may help to explain its mechanism of carcinogenicity. For the selective induction of tumors in the kidney, increased oxidative stress in connection with severe cytotoxicity and increased cell proliferation might represent driving factors. PMID:16302199

  3. Modeling marrow damage from response data: Evolution from radiation biology to benzene toxicity

    SciTech Connect

    Jones, T.D.; Morris, M.D.; Hasan, J.S.


    Consensus principles from radiation biology were used to describe a generic set of nonlinear, first-order differential equations for modeling toxicity-induced compensatory cell kinetics in terms of sublethal injury, repair, direct killing, killing of cells with unrepaired sublethal injury, and repopulation. This cellular model was linked to a probit model of hematopoietic mortality that describes death from infection and/or hemorrhage between 5 and 30 days. Mortality data from 27 experiments with 851 dose-response groups, in which doses were protracted by rate and/or fractionation, were used to simultaneously estimate all rate constants by maximum-likelihood methods. Data used represented 18,940 test animals: 12,827 mice, 2925 rats, 1676 sheep, 829 swine, 479 dogs, and 204 burros. Although a long-term, repopulating hematopoietic stem cell is ancestral to all lineages needed to restore normal homeostasis, the dose-response data from the protracted irradiations indicate clearly that the particular lineage that is critical to hematopoietic recovery does not resemble stemlike cells with regard to radiosensitivity and repopulation rates. Instead, the weakest link in the chain of hematopoiesis was found to have an intrinsic radioresistance equal to or greater than stromal cells and to repopulate at the same rates. Model validation has been achieved by predicting the LD50 and/or fractional group mortality in 38 protracted-dose experiments (rats and mice) that were not used in the fitting of model coefficients. 29 refs., 5 figs., 5 tabs.

  4. Modeling marrow damage from response data: Morphallaxis from radiation biology to benzene toxicity

    SciTech Connect

    Jones, T.D.; Morris, M.D.; Hasan, J.S.


    Consensus principles from radiation biology were used to describe a generic set of nonlinear, first-order differential equations for modeling of toxicity-induced compensatory cell kinetics in terms of sublethal injury, repair, direct killing, killing of cells with unrepaired sublethal injury, and repopulation. This cellular model was linked to a probit model of hematopoietic mortality that describes death from infection and/or hemorrhage between {approximately} 5 and 30 days. Mortality data from 27 experiments with 851 doseresponse groups, in which doses were protracted by rate and/or fractionation, were used to simultaneously estimate all rate constants by maximum-likelihood methods. Data used represented 18,940 test animals distributed according to: (mice, 12,827); (rats, 2,925); (sheep, 1,676); (swine, 829); (dogs, 479); and (burros, 204). Although a long-term, repopulating hematopoietic stem cell is ancestral to all lineages needed to restore normal homeostasis, the dose-response data from the protracted irradiations indicate clearly that the particular lineage that is ``critical`` to hematopoietic recovery does not resemble stem-like cells with regard to radiosensitivity and repopulation rates. Instead, the weakest link in the chain of hematopoiesis was found to have an intrinsic radioresistance equal to or greater than stromal cells and to repopulate at the same rates. Model validation has been achieved by predicting the LD{sub 50} and/or fractional group mortality in 38 protracted-dose experiments (rats and mice) that were not used in the fitting of model coefficients.

  5. Countermeasures for space radiation induced adverse biologic effects

    NASA Astrophysics Data System (ADS)

    Kennedy, A. R.; Wan, X. S.


    Radiation exposure in space is expected to increase the risk of cancer and other adverse biological effects in astronauts. The types of space radiation of particular concern for astronaut health are protons and heavy ions known as high atomic number and high energy (HZE) particles. Recent studies have indicated that carcinogenesis induced by protons and HZE particles may be modifiable. We have been evaluating the effects of proton and HZE particle radiation in cultured human cells and animals for nearly a decade. Our results indicate that exposure to proton and HZE particle radiation increases oxidative stress, cytotoxicity, cataract development and malignant transformation in in vivo and/or in vitro experimental systems. We have also shown that these adverse biological effects can be prevented, at least partially, by treatment with antioxidants and some dietary supplements that are readily available and have favorable safety profiles. Some of the antioxidants and dietary supplements are effective in preventing radiation induced malignant transformation in vitro even when applied several days after the radiation exposure. Our recent progress is reviewed and discussed in the context of the relevant literature.

  6. A DNA-damage-induced cell cycle checkpoint in Arabidopsis.

    PubMed Central

    Preuss, S B; Britt, A B


    Although it is well established that plant seeds treated with high doses of gamma radiation arrest development as seedlings, the cause of this arrest is unknown. The uvh1 mutant of Arabidopsis is defective in a homolog of the human repair endonuclease XPF, and uvh1 mutants are sensitive to both the toxic effects of UV and the cytostatic effects of gamma radiation. Here we find that gamma irradiation of uvh1 plants specifically triggers a G(2)-phase cell cycle arrest. Mutants, termed suppressor of gamma (sog), that suppress this radiation-induced arrest and proceed through the cell cycle unimpeded were recovered in the uvh1 background; the resulting irradiated plants are genetically unstable. The sog mutations fall into two complementation groups. They are second-site suppressors of the uvh1 mutant's sensitivity to gamma radiation but do not affect the susceptibility of the plant to UV radiation. In addition to rendering the plants resistant to the growth inhibitory effects of gamma radiation, the sog1 mutation affects the proper development of the pollen tetrad, suggesting that SOG1 might also play a role in the regulation of cell cycle progression during meiosis. PMID:12750343

  7. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  8. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.


    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  9. Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation

    PubMed Central

    Davalos, Dimitrios; Kyu Ryu, Jae; Merlini, Mario; Baeten, Kim M.; Le Moan, Natacha; Petersen, Mark A.; Deerinck, Thomas J.; Smirnoff, Dimitri S.; Bedard, Catherine; Hakozaki, Hiroyuki; Gonias Murray, Sara; Ling, Jennie B.; Lassmann, Hans; Degen, Jay L.; Ellisman, Mark H.; Akassoglou, Katerina


    Blood-brain barrier disruption, microglial activation and neurodegeneration are hallmarks of multiple sclerosis. However, the initial triggers that activate innate immune responses and their role in axonal damage remain unknown. Here we show that the blood protein fibrinogen induces rapid microglial responses toward the vasculature and is required for axonal damage in neuroinflammation. Using in vivo two-photon microscopy, we demonstrate that microglia form perivascular clusters before myelin loss or paralysis onset and that, of the plasma proteins, fibrinogen specifically induces rapid and sustained microglial responses in vivo. Fibrinogen leakage correlates with areas of axonal damage and induces reactive oxygen species release in microglia. Blocking fibrin formation with anticoagulant treatment or genetically eliminating the fibrinogen binding motif recognized by the microglial integrin receptor CD11b/CD18 inhibits perivascular microglial clustering and axonal damage. Thus, early and progressive perivascular microglial clustering triggered by fibrinogen leakage upon blood-brain barrier disruption contributes to axonal damage in neuroinflammatory disease. PMID:23187627

  10. The neuroprotective effect of hyperbaric oxygen treatment on laser-induced retinal damage in rats

    NASA Astrophysics Data System (ADS)

    Vishnevskia-Dai, Victoria; Belokopytov, Mark; Dubinsky, Galina; Nachum, Gal; Avni, Isaac; Belkin, Michael; Rosner, Mordechai


    Retinal damage induced by mechanical trauma, ischemia or laser photocoagulation increases considerably by secondary degeneration processes. The spread of damage may be ameliorated by neuroprotection that is aimed at reducing the extent of the secondary degeneration and promote healing processes. Hyperbaric oxygen (HBO) treatment consists of inspiration of oxygen at higher than one absolute atmospheric pressure. Improved neural function was observed in patients with acute brain trauma or ischemia treated with HBO. This study was designed to evaluate the neuroprotective effect of hyperbaric oxygen (HBO) on laser induced retinal damage in a rat model. Standard argon laser lesions were created in 25 pigmented rats divided into three groups: Ten rats were treated immediately after the irradiation with HBO three times during the first 24 hr followed by 12 consecutive daily treatments. Five rats received a shorter treatment regimen of 10 consecutive HBO treatments. The control group (10 rats) underwent the laser damage with no additional treatment. The retinal lesions were evaluated 20 days after the injury. All outcome measures were improved by the longer HBO treatment (P<0.01). The shorter HBO treatment was less effective, showing an increase only in nuclei density at the central area of lesion (P< 0.01). Hyperbaric oxygen seems to exert a neuroprotective effect on laser-induced retinal damage in a rat model. In the range of HBO exposures studied, longer exposure provides more neuroprotection. These results encourage further evaluation of the potential therapeutic use of hyperbaric oxygen in diseases and injuries of the retina.

  11. Sex Differences in Exercise-Induced Muscle Pain and Muscle Damage

    PubMed Central

    Dannecker, Erin A.; Liu, Ying; Rector, R. Scott; Thomas, Tom R.; Fillingim, Roger B.; Robinson, Michael E.


    There is uncertainty about sex differences in exercise-induced muscle pain and muscle damage due to several methodological weaknesses in the literature. This investigation tested the hypothesis that higher levels of exercise-induced muscle pain and muscle damage indicators would be found in women than men when several methodological improvements were executed in the same study. Participants (N = 33; 42% women) with an average age of 23 years (SD = 2.82) consented to participate. After a familiarization session, participants visited the laboratory before and across four days after eccentric exercise was completed to induce arm muscle pain and muscle damage. Our primary outcomes were arm pain ratings and pressure pain thresholds. However, we also measured the following indicators of muscle damage: arm girth; resting elbow extension; isometric elbow flexor strength; myoglobin (Mb); tumor necrosis factor (TNFa); interleukin 1beta (IL1b); and total nitric oxide (NO). Temporary induction of muscle damage was indicated by changes in all outcome measures except TNFa, and IL1b. In contrast to our hypotheses, women reported moderately lower and less frequent muscle pain than men. Also, women’s arm girth and Mb levels increased moderately less than men’s, but the differences were not significant. Few large sex differences were detected. PMID:23182229

  12. Endogenous nitric oxide limits cytokine-induced damage of murine lung epithelial cells.


    Burke-Gaffney, A; Hellewell, P G


    This study investigated whether endogenous nitric oxide (NO) limits cytokine-induced damage to the murine lung epithelial cell line LA-4. NO production was assessed as nitrite using the Griess reaction, and cell damage was assessed using ethidium homodimer-1. Cytotoxicity was first detected after a 24-h incubation with a combination of tumor necrosis factor-alpha, interleukin-1beta, and interferon-gamma (cytomix). Nitrite production increased to 78.0 +/- 0.5 nmol/10(6) cells at 24 h. Coincubation of LA-4 with cytomix and NO synthase inhibitors, aminoguanidine (3-1,000 microM) and N(G)-monomethyl-L-arginine (10-1,000 microM), but not N(G)-monomethyl-D-arginine, or a soluble guanylate cyclase inhibitor, 1H-[1,2,4] oxadiazole [4,3-a] quinoxalin-1-one, reduced cytomix-induced nitrite production and increased cytotoxicity up to twofold (24 h). Removal of L-arginine from the medium increased damage; reintroduction of 1,000 microM L-arginine, but not D-arginine, reversed this. In aminoguanidine-treated cells, replacement of NO with an NO donor, S-nitrosoglutathione (30 microM), reversed, in part, the cell damage observed in aminoguanidine/cytomix-treated cells. These results suggest that endogenous NO limits cytokine-induced lung epithelial damage. PMID:9142945

  13. Mcl-1 protects prostate cancer cells from cell death mediated by chemotherapy-induced DNA damage.


    Reiner, Teresita; de Las Pozas, Alicia; Parrondo, Ricardo; Palenzuela, Deanna; Cayuso, William; Rai, Priyamvada; Perez-Stable, Carlos


    The anti-apoptotic protein Mcl-1 is highly expressed in castration-resistant prostate cancer (CRPC), resulting in resistance to apoptosis and association with poor prognosis. Although predominantly localized in the cytoplasm, there is evidence that Mcl-1 exhibits nuclear localization where it is thought to protect against DNA damage-induced cell death. The role of Mcl-1 in mediating resistance to chemotherapy-induced DNA damage in prostate cancer (PCa) is not known. We show in human PCa cell lines and in TRAMP, a transgenic mouse model of PCa, that the combination of the antimitotic agent ENMD-1198 (analog of 2-methoxyestradiol) with betulinic acid (BA, increases proteotoxic stress) targets Mcl-1 by increasing its proteasomal degradation, resulting in increased γH2AX (DNA damage) and apoptotic/necrotic cell death. Knockdown of Mcl-1 in CRPC cells leads to elevated γH2AX, DNA strand breaks, and cell death after treatment with 1198 + BA- or doxorubicin. Additional knockdowns in PC3 cells suggests that cytoplasmic Mcl-1 protects against DNA damage by blocking the mitochondrial release of apoptosis-inducing factor and thereby preventing its nuclear translocation and subsequent interaction with the cyclophilin A endonuclease. Overall, our results suggest that chemotherapeutic agents that target Mcl-1 will promote cell death in response to DNA damage, particularly in CRPC. PMID:26425662

  14. Attenuation of eccentric exercise-induced muscle damage conferred by maximal isometric contractions: a mini review

    PubMed Central

    Lima, Leonardo C. R.; Denadai, Benedito S.


    Although, beneficial in determined contexts, eccentric exercise-induced muscle damage (EIMD) might be unwanted during training regimens, competitions and daily activities. There are a vast number of studies investigating strategies to attenuate EIMD response after damaging exercise bouts. Many of them consist of performing exercises that induce EIMD, consuming supplements or using equipment that are not accessible for most people. It appears that performing maximal isometric contractions (ISOs) 2–4 days prior to damaging bouts promotes significant attenuation of EIMD symptoms that are not related to muscle function. It has been shown that the volume of ISOs, muscle length in which they are performed, and interval between them and the damaging bout influence the magnitude of this protection. In addition, it appears that this protection is not long-lived, lasting no longer than 4 days. Although no particular mechanisms for these adaptations were identified, professionals should consider applying this non-damaging stimulus before submitting their patients to unaccustomed exercised. However, it seems not to be the best option for athletes or relatively trained individuals. Future, studies should focus on establishing if ISOs protect other populations (i.e., trained individuals) or muscle groups (i.e., knee extensors) against EIMD, as well as investigate different mechanisms for ISO-induced protection. PMID:26578972

  15. Annexin-1 regulated by HAUSP is essential for UV-induced damage response

    PubMed Central

    Park, J-J; Lim, K-H; Baek, K-H


    DNA damage can occur through diverse stimulations such as toxins, drugs, and environmental factors. To respond to DNA damage, mammalian cells induce DNA damage response (DDR). DDR signal activates a rapid signal transduction pathway, regulating the cell fate based on the damaged cell condition. Moreover, serious damaged cells have to be eliminated by the macrophage to maintain homeostasis. Because the DDR induces genomic instability followed by tumor formation, targeting the DDR signaling can be applied for the cancer therapy. Herpes virus-associated ubiquitin-specific protease (HAUSP/USP7) is one of the well-known deubiquitinating enzymes (DUBs) owing to its relevance with Mdm2-p53 complex. The involvement of HAUSP in DDR through p53 led us to investigate novel substrates for HAUSP, which is related to DDR or apoptosis. As a result, we identified annexin-1 (ANXA1) as one of the putative substrates for HAUSP. ANXA1 has numerous roles in cellular systems including anti-inflammation, damage response, and apoptosis. Several studies have demonstrated that ANXA1 can be modified in a post-translational manner by processes such as phosphorylation, SUMOylation, and ubiquitination. In addition, DNA damage gives various functions to ANXA1 such as stress response or cleavage-mediated apoptotic cell clearance. In the current study, our proteomic analysis using two-dimensional electrophoresis, matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) and nano LC-MS/MS, and immunoprecipitation revealed that ANXA1 binds to HAUSP through its HAUSP-binding motif (P/AXXS), and the cleavage and damage-responsive functions of ANXA1 upon UV-induced DNA damage may be followed by HAUSP-mediated deubiquitination of ANXA1. Intriguingly, the UV-induced damage responses via HAUSP-ANXA1 interaction in HeLa cells were different from the responses shown in the Jurkat cells, suggesting that their change of roles may depend on the cell types. PMID:25695607

  16. Annexin-1 regulated by HAUSP is essential for UV-induced damage response.


    Park, J-J; Lim, K-H; Baek, K-H


    DNA damage can occur through diverse stimulations such as toxins, drugs, and environmental factors. To respond to DNA damage, mammalian cells induce DNA damage response (DDR). DDR signal activates a rapid signal transduction pathway, regulating the cell fate based on the damaged cell condition. Moreover, serious damaged cells have to be eliminated by the macrophage to maintain homeostasis. Because the DDR induces genomic instability followed by tumor formation, targeting the DDR signaling can be applied for the cancer therapy. Herpes virus-associated ubiquitin-specific protease (HAUSP/USP7) is one of the well-known deubiquitinating enzymes (DUBs) owing to its relevance with Mdm2-p53 complex. The involvement of HAUSP in DDR through p53 led us to investigate novel substrates for HAUSP, which is related to DDR or apoptosis. As a result, we identified annexin-1 (ANXA1) as one of the putative substrates for HAUSP. ANXA1 has numerous roles in cellular systems including anti-inflammation, damage response, and apoptosis. Several studies have demonstrated that ANXA1 can be modified in a post-translational manner by processes such as phosphorylation, SUMOylation, and ubiquitination. In addition, DNA damage gives various functions to ANXA1 such as stress response or cleavage-mediated apoptotic cell clearance. In the current study, our proteomic analysis using two-dimensional electrophoresis, matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) and nano LC-MS/MS, and immunoprecipitation revealed that ANXA1 binds to HAUSP through its HAUSP-binding motif (P/AXXS), and the cleavage and damage-responsive functions of ANXA1 upon UV-induced DNA damage may be followed by HAUSP-mediated deubiquitination of ANXA1. Intriguingly, the UV-induced damage responses via HAUSP-ANXA1 interaction in HeLa cells were different from the responses shown in the Jurkat cells, suggesting that their change of roles may depend on the cell types. PMID:25695607

  17. TSG attenuates LPC-induced endothelial cells inflammatory damage through notch signaling inhibition.


    Zhao, Jing; Liang, Yuan; Song, Fan; Xu, Shouzhu; Nian, Lun; Zhou, Xuanxuan; Wang, Siwang


    Lysophosphatidylcholine (LPC) induces inflammation in endothelial cells (ECs) but the mechanism is not fully understood. The Notch signaling pathway is involved in chronic EC inflammation, but its functions in LPC-induced endothelial inflammatory damage and 2,3,5,4'-tetrahydroxystilbene-2-O-β-d-glucoside's (TSG) protective effect during LPC-induced inflammatory damage in human umbilical vein endothelial cells (HUVECs) is largely unknown. We report that Notch signaling activation contributed to LPC-induced injury in HUVECs, and that TSG protected HUVECs from LPC-induced injury by antagonizing Notch signaling activation by LPC. γ-secretase inhibitor (DAPT), a specific inhibitor of the Notch signaling pathway, and Notch1 siRNA were used to inhibit Notch activity. HUVECs were exposed to LPC in the presence or absence of TSG, DAPT, and Notch1 siRNA. LPC treatment of HUVECs resulted in reduced cell viability, and Notch1 and Hes1 upregulation. Either silencing of Notch1 by siRNA or pharmacological inhibition of Notch signaling by DAPT prevented the loss of cell viability, and induction of apoptosis, and enhanced expression Notch1, Hes1 and MCP-1 by LPC in HUVECs. Similarly, TSG reduced LPC stimulation of Notch1, Hes1, and MCP-1 expression, prevented the release of IL-6 and CRP and rescued HUVECs from LPC-induced cell damage. Our data indicate that the Notch signaling pathway is a crucial mediator of endothelial inflammatory damage and that TSG protects against endothelial inflammatory damage by inhibiting the Notch signaling pathway. Our findings suggest that targeting Notch signaling by natural products such as TSG is a promising strategy for the prevention and treatment of chronic inflammation associated diseases, including atherosclerosis. © 2015 IUBMB Life, 68(1):37-50, 2016. PMID:26662286

  18. A photoluminescence study of plasma reactive ion etching-induced damage in GaN

    NASA Astrophysics Data System (ADS)

    Mouffak, Z.; Bensaoula, A.; Trombetta, L.


    GaN films with reactive ion etching (RIE) induced damage were analyzed using photoluminescence (PL). We observed band-edge as well as donor-acceptor peaks with associated phonon replicas, all in agreement with previous studies. While both the control and damaged samples have their band-edge peak location change with temperature following the Varshni formula, its intensity however decreases with damage while the D—A peak increases considerably. Nitrogen post-etch plasma was shown to improve the band edge peak and decrease the D—A peak. This suggests that the N2 plasma has helped reduce the number of trapped carriers that were participating in the D—A transition and made the D°X transition more active, which reaffirms the N2 post-etch plasma treatment as a good technique to heal the GaN surface, most likely by filling the nitrogen vacancies previously created by etch damage.

  19. 'Nothing of chemistry disappears in biology': the Top 30 damage-prone endogenous metabolites.


    Lerma-Ortiz, Claudia; Jeffryes, James G; Cooper, Arthur J L; Niehaus, Thomas D; Thamm, Antje M K; Frelin, Océane; Aunins, Thomas; Fiehn, Oliver; de Crécy-Lagard, Valérie; Henry, Christopher S; Hanson, Andrew D


    Many common metabolites are intrinsically unstable and reactive, and hence prone to chemical (i.e. non-enzymatic) damage in vivo Although this fact is widely recognized, the purely chemical side-reactions of metabolic intermediates can be surprisingly hard to track down in the literature and are often treated in an unprioritized case-by-case way. Moreover, spontaneous chemical side-reactions tend to be overshadowed today by side-reactions mediated by promiscuous ('sloppy') enzymes even though chemical damage to metabolites may be even more prevalent than damage from enzyme sloppiness, has similar outcomes, and is held in check by similar biochemical repair or pre-emption mechanisms. To address these limitations and imbalances, here we draw together and systematically integrate information from the (bio)chemical literature, from cheminformatics, and from genome-scale metabolic models to objectively define a 'Top 30' list of damage-prone metabolites. A foundational part of this process was to derive general reaction rules for the damage chemistries involved. The criteria for a 'Top 30' metabolite included predicted chemical reactivity, essentiality, and occurrence in diverse organisms. We also explain how the damage chemistry reaction rules ('operators') are implemented in the Chemical-Damage-MINE (CD-MINE) database ( to provide a predictive tool for many additional potential metabolite damage products. Lastly, we illustrate how defining a 'Top 30' list can drive genomics-enabled discovery of the enzymes of previously unrecognized damage-control systems, and how applying chemical damage reaction rules can help identify previously unknown peaks in metabolomics profiles. PMID:27284066

  20. Eugenol attenuates pulmonary damage induced by diesel exhaust particles.


    Zin, Walter A; Silva, Ana G L S; Magalhães, Clarissa B; Carvalho, Giovanna M C; Riva, Douglas R; Lima, Crystianne C; Leal-Cardoso, Jose H; Takiya, Christina M; Valença, Samuel S; Saldiva, Paulo H N; Faffe, Débora S


    Environmentally relevant doses of inhaled diesel particles elicit pulmonary inflammation and impair lung mechanics. Eugenol, a methoxyphenol component of clove oil, presents in vitro and in vivo anti-inflammatory and antioxidant properties. Our aim was to examine a possible protective role of eugenol against lung injuries induced by diesel particles. Male BALB/c mice were divided into four groups. Mice received saline (10 μl in; CTRL group) or 15 μg of diesel particles DEP (15 μg in; DIE and DEUG groups). After 1 h, mice received saline (10 μl; CTRL and DIE groups) or eugenol (164 mg/kg; EUG and DEUG group) by gavage. Twenty-four hours after gavage, pulmonary resistive (ΔP1), viscoelastic (ΔP2) and total (ΔPtot) pressures, static elastance (Est), and viscoelastic component of elastance (ΔE) were measured. We also determined the fraction areas of normal and collapsed alveoli, amounts of polymorpho- (PMN) and mononuclear cells in lung parenchyma, apoptosis, and oxidative stress. Est, ΔP2, ΔPtot, and ΔE were significantly higher in the DIE than in the other groups. DIE also showed significantly more PMN, airspace collapse, and apoptosis than the other groups. However, no beneficial effect on lipid peroxidation was observed in DEUG group. In conclusion, eugenol avoided changes in lung mechanics, pulmonary inflammation, and alveolar collapse elicited by diesel particles. It attenuated the activation signal of caspase-3 by DEP, but apoptosis evaluated by TUNEL was avoided. Finally, it could not avoid oxidative stress as indicated by malondialdehyde. PMID:22194320

  1. Iron Oxide Nanoparticles Induce Dopaminergic Damage: In vitro Pathways and In Vivo Imaging Reveals Mechanism of Neuronal Damage.


    Imam, Syed Z; Lantz-McPeak, Susan M; Cuevas, Elvis; Rosas-Hernandez, Hector; Liachenko, Serguei; Zhang, Yongbin; Sarkar, Sumit; Ramu, Jaivijay; Robinson, Bonnie L; Jones, Yvonne; Gough, Bobby; Paule, Merle G; Ali, Syed F; Binienda, Zbigniew K


    Various iron-oxide nanoparticles have been in use for a long time as therapeutic and imaging agents and for supplemental delivery in cases of iron-deficiency. While all of these products have a specified size range of ∼ 40 nm and above, efforts are underway to produce smaller particles, down to ∼ 1 nm. Here, we show that after a 24-h exposure of SHSY-5Y human neuroblastoma cells to 10 μg/ml of 10 and 30 nm ferric oxide nanoparticles (Fe-NPs), cellular dopamine content was depleted by 68 and 52 %, respectively. Increases in activated tyrosine kinase c-Abl, a molecular switch induced by oxidative stress, and neuronal α-synuclein expression, a protein marker associated with neuronal injury, were also observed (55 and 38 % percent increases, respectively). Inhibition of cell-proliferation, significant reductions in the number of active mitochondria, and a dose-dependent increase in reactive oxygen species (ROS) were observed in neuronal cells. Additionally, using a rat in vitro blood-brain barrier (BBB) model, a dose-dependent increase in ROS accompanied by increased fluorescein efflux demonstrated compromised BBB integrity. To assess translational implications, in vivo Fe-NP-induced neurotoxicity was determined using in vivo MRI and post-mortem neurochemical and neuropathological correlates in adult male rats after exposure to 50 mg/kg of 10 nm Fe-NPs. Significant decrease in T 2 values was observed. Dynamic observations suggested transfer and retention of Fe-NPs from brain vasculature into brain ventricles. A significant decrease in striatal dopamine and its metabolites was also observed, and neuropathological correlates provided additional evidence of significant nerve cell body and dopaminergic terminal damage as well as damage to neuronal vasculature after exposure to 10 nm Fe-NPs. These data demonstrate a neurotoxic potential of very small size iron nanoparticles and suggest that use of these ferric oxide nanoparticles may result in neurotoxicity, thereby

  2. Statistical evaluation of characteristic SDDLV-induced stress resultants to discriminate between undamaged and damaged elements

    NASA Astrophysics Data System (ADS)

    Hansen, L. M.; Johansen, R. J.; Ulriksen, M. D.; Tcherniak, D.; Damkilde, L.


    The stochastic dynamic damage location vector (SDDLV) method utilizes the vectors from the kernel of a damaged-induced transfer function matrix change to localize damages in a structure. The kernel vectors associated with the lowest singular values are converted into static pseudo-loads and applied alternately to an undamaged reference model with known stiffness matrix, hereby, theoretically, yielding characteristic stress resultants approaching zero in the damaged elements. At present, the discrimination between potentially damaged elements and undamaged ones is typically conducted on the basis of modified characteristic stress resultants, which are compared to a pre-defined tolerance value, without any thorough statistical evaluation. In the present paper, it is tested whether three widely-used statistical pattern-recognition-based damage-detection methods can provide an effective statistical evaluation of the characteristic stress resultants, hence facilitating general discrimination between damaged and undamaged elements. The three detection methods in question enable outlier analysis on the basis of, respectively, Euclidian distance, Hotelling's T2 statistics, and Mahalanobis distance. The study of the applicability of these methods is based on experimentally obtained accelerations of a cantilevered residential-sized wind turbine blade subjected to an unmeasured multi-impulse load. The characteristic stress resultants are derived by applying the static pseudo-loads to a representative finite element (FE) model of the actual blade.

  3. Effects of wet etch processing on laser-induced damage of fused silica surfaces

    SciTech Connect

    Battersby, C.L.; Kozlowski, M.R.; Sheehan, L.M.


    Laser-induced damage of transparent fused silica optical components by 355 nm illumination occurs primarily at surface defects produced during the grinding and polishing processes. These defects can either be surface defects or sub-surface damage.Wet etch processing in a buffered hydrogen fluoride (HF) solution has been examined as a tool for characterizing such defects. A study was conducted to understand the effects of etch depth on the damage threshold of fused silica substrates. The study used a 355 nm, 7.5 ns, 10 Hz Nd:YAG laser to damage test fused silica optics through various wet etch processing steps. Inspection of the surface quality was performed with Nomarski microscopy and Total Internal Reflection Microscopy. The damage test data and inspection results were correlated with polishing process specifics. The results show that a wet etch exposes subsurface damage while maintaining or improving the laser damage performance. The benefits of a wet etch must be evaluated for each polishing process.

  4. A statistical study of the relationship between surface quality and laser induced damage

    NASA Astrophysics Data System (ADS)

    Turner, Trey; Turchette, Quentin; Martin, Alex R.


    Laser induced damage of optical components is a concern in many applications in the commercial, scientific and military market sectors. Numerous component manufacturers supply "high laser damage threshold" (HLDT) optics to meet the needs of this market, and consumers pay a premium price for these products. While there's no question that HLDT optics are manufactured to more rigorous standards (and are therefore inherently more expensive) than conventional products, it is not clear how this added expense translates directly into better performance. This is because the standard methods for evaluating laser damage, and the underlying assumptions about the validity of traditional laser damage testing, are flawed. In particular, the surface and coating defects that generally lead to laser damage (in many laserparameter regimes of interest) are widely distributed over the component surface with large spaces in between them. As a result, laser damage testing typically doesn't include enough of these defects to achieve the sample sizes necessary to make its results statistically meaningful. The result is a poor correlation between defect characteristics and damage events. This paper establishes specifically why this is the case, and provides some indication of what might be done to remedy the problem.

  5. Filamentation and damage in fused silica induced by tightly focused femtosecond laser pulses

    SciTech Connect

    Couairon, A.; Sudrie, L.; Franco, M.; Prade, B.; Mysyrowicz, A.


    We investigate experimentally and numerically the damage tracks induced by tightly focused (NA=0.5) infrared femtosecond laser pulses in the bulk of a fused silica sample. Two types of irreversible damage are observed. The first damage corresponds to a permanent change of refractive index without structural modifications (type I). It appears for input pulse energies beyond 0.1 {mu}J. It takes the form of a narrow track extending over more than 100 {mu}m at higher input powers. It is attributed to a change of the polarizability of the medium, following a filamentary propagation which generates an electron-hole plasma through optical field ionization. A second type of damage occurs for input pulse energies beyond 0.3 {mu}J (type II). It takes the form of a pear-shaped structural damage associated with an electron-ion plasma triggered by avalanche. The temporal evolution of plasma absorption is studied by pump-probe experiments. For type I damage, a fast electron-hole recombination is observed. Type II damage is linked with a longer absorption.

  6. Radiation-damage-induced phasing: a case study using UV irradiation with light-emitting diodes.


    de Sanctis, Daniele; Zubieta, Chloe; Felisaz, Franck; Caserotto, Hugo; Nanao, Max H


    Exposure to X-rays, high-intensity visible light or ultraviolet radiation results in alterations to protein structure such as the breakage of disulfide bonds, the loss of electron density at electron-rich centres and the movement of side chains. These specific changes can be exploited in order to obtain phase information. Here, a case study using insulin to illustrate each step of the radiation-damage-induced phasing (RIP) method is presented. Unlike a traditional X-ray-induced damage step, specific damage is introduced via ultraviolet light-emitting diodes (UV-LEDs). In contrast to UV lasers, UV-LEDs have the advantages of small size, low cost and relative ease of use. PMID:26960126

  7. Laser induced damage in multilayer dielectric gratings due to ultrashort laser pulses. Revision 1

    SciTech Connect

    Shore, B.W.; Stuart, B.C.; Feit, M.D.; Rubenchik, A.M.; Perry, M.D.


    Chirped pulse amplification is increasingly used to produce intense ultrashort laser pulses. When high-efficiency gratings are the dispersive element, as in the LLNL Petawatt laser, their susceptibility to laser induced damage constitutes a limitation on the peak intensities that can be reached. To obtain robust gratings, it is necessary to understand the causes of short-pulse damage, and to recognize the range of design options for high efficiency gratings. Metal gratings owe their high efficiency to their high conductivity. To avoid the inevitable light absorption that accompanies conductivity, we have developed designs for high efficiency rejection gratings that use only transparent dielectric materials. These combine the reflectivity of a multi-layer dielectric stack with a diffraction grating. We report here our present understanding of short-pulse laser induced damage, as it applies to dielectric gratings.

  8. Laser induced damage in multilayer dielectric gratings due to ultrashort laser pulses

    SciTech Connect

    Shore, B.W.; Stuart, B.C.; Feit, M.D.; Rubenchik, A.M.; Perry, M.D.


    Chirped pulse amplification is increasingly used to produce intense ultrashort laser pulses. When high-efficiency gratings are the dispersive element, as in the LLNL Petawatt laser, their susceptibility to laser induced damage constitutes a limitation on the peak intensities that can be reached. To obtain robust gratings, it is necessary to understand the causes of short-pulse damage, and to recognize the range of design options for high efficiency gratings. Metal gratings owe their high efficiency to their high conductivity. To avoid the inevitable light absorption that accompanies conductivity, we have developed designs for high efficiency reflection gratings that use only transparent dielectric materials. These combine the reflectivity of a multilayer dielectric stack with a diffraction grating. We report here our present understanding of short-pulse laser induced damage, as it applies to dielectric gratings.

  9. Laser induced damage of sapphire and titanium doped sapphire crystals under femtosecond to nanosecond laser irradiation

    NASA Astrophysics Data System (ADS)

    Bussière, B.; Utéza, O.; Sanner, N.; Sentis, M.; Riboulet, G.; Vigroux, L.; Commandré, M.; Wagner, F.; Natoli, J.-Y.; Chambaret, J.-P.


    The use of large Ti:Sapphire crystals in ultra fast high peak power laser amplifiers makes crucial the problem of crystal laser induced damage. These works aim to quantify the laser induced damage threshold (LIDT) of Sapphire and Ti:Sapphire crystals under femtosecond, picosecond and nanosecond laser pulse irradiations, which are typically encountered in such laser chains. Furthermore, a study of the influence of cryogenic conditions on the LIDT of Ti:Sapphire crystals and of their anti-reflection coating has been performed. The results are important to understand the mechanisms leading to the damage, and to reveal the key parameters which will have to be optimized in future high peak power laser chains.

  10. The DNA damage-induced cell death response: a roadmap to kill cancer cells.


    Matt, Sonja; Hofmann, Thomas G


    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response. PMID:26791483

  11. Lipids and Oxidative Stress Associated with Ethanol-Induced Neurological Damage

    PubMed Central


    The excessive intake of alcohol is a serious public health problem, especially given the severe damage provoked by chronic or prenatal exposure to alcohol that affects many physiological processes, such as memory, motor function, and cognitive abilities. This damage is related to the ethanol oxidation in the brain. The metabolism of ethanol to acetaldehyde and then to acetate is associated with the production of reactive oxygen species that accentuate the oxidative state of cells. This metabolism of ethanol can induce the oxidation of the fatty acids in phospholipids, and the bioactive aldehydes produced are known to be associated with neurotoxicity and neurodegeneration. As such, here we will review the role of lipids in the neuronal damage induced by ethanol-related oxidative stress and the role that lipids play in the related compensatory or defense mechanisms. PMID:26949445

  12. Oxidative damage and cell-programmed death induced in Zea mays L. by allelochemical stress.


    Ciniglia, Claudia; Mastrobuoni, Francesco; Scortichini, Marco; Petriccione, Milena


    The allelochemical stress on Zea mays was analyzed by using walnut husk washing waters (WHWW), a by-product of Juglans regia post-harvest process, which possesses strong allelopathic potential and phytotoxic effects. Oxidative damage and cell-programmed death were induced by WHWW in roots of maize seedlings. Treatment induced ROS burst, with excess of H2O2 content. Enzymatic activities of catalase were strongly increased during the first hours of exposure. The excess in malonildialdehyde following exposure to WHWW confirmed that oxidative stress severely damaged maize roots. Membrane alteration caused a decrease in NADPH oxidase activity along with DNA damage as confirmed by DNA laddering. The DNA instability was also assessed through sequence-related amplified polymorphism assay, thus suggesting the danger of walnut processing by-product and focusing the attention on the necessity of an efficient treatment of WHWW. PMID:25736610

  13. Spontaneous perseverative turning in rats with radiation-induced hippocampal damage

    SciTech Connect

    Mickley, G.A.; Ferguson, J.L.; Nemeth, T.J.; Mulvihill, M.A.; Alderks, C.E. )


    This study found a new behavioral correlate of lesions specific to the dentate granule cell layer of the hippocampus: spontaneous perseverative turning. Irradiation of a portion of the neonatal rat cerebral hemispheres produced hypoplasia of the granule cell layer of the hippocampal dentate gyrus while sparing the rest of the brain. Radiation-induced damage to the hippocampal formation caused rats placed in bowls to spontaneously turn in long, slow bouts without reversals. Irradiated subjects also exhibited other behaviors characteristic of hippocampal damage (e.g., perseveration in spontaneous exploration of the arms of a T-maze, retarded acquisition of a passive avoidance task, and increased horizontal locomotion). These data extend previously reported behavioral correlates of fascia dentata lesions and suggest the usefulness of a bout analysis of spontaneous bowl turning as a measure of nondiscrete-trial spontaneous alternation and a sensitive additional indicator of radiation-induced hippocampal damage.

  14. Experimental pathology of local tissue damage induced by Bothrops asper snake venom.


    Gutiérrez, José María; Rucavado, Alexandra; Chaves, Fernando; Díaz, Cecilia; Escalante, Teresa


    Envenomations by Bothrops asper are often associated with complex and severe local pathological manifestations, including edema, blistering, dermonecrosis, myonecrosis and hemorrhage. The pathogenesis of these alterations has been investigated at the experimental level. These effects are mostly the consequence of the direct action of zinc-dependent metalloproteinases (SVMPs) and myotoxic phospholipases A(2) (PLA(2)s). SVMPs induce hemorrhage, blistering, dermonecrosis and general extracellular matrix degradation, whereas PLA(2)s induce myonecrosis and also affect lymphatic vessels. In addition, the prominent vascular alterations leading to hemorrhage and edema may contribute to ischemia and further tissue necrosis. The mechanisms of action of SVMPs and PLA(2)s are discussed in detail in this review. Venom-induced tissue damage plays also a role in promoting bacterial infection. A prominent inflammatory reaction develops as a consequence of these local pathological alterations, with the synthesis and release of abundant mediators, resulting in edema and pain. However, whether inflammatory cells and mediators contribute to further tissue damage is not clear at present. Muscle tissue regeneration after venom-induced pathological effects is often impaired, thus resulting in permanent tissue loss and dysfunction. SVMP-induced microvessel damage is likely to be responsible of this poor regenerative outcome. Antivenoms are only partially effective in the neutralization of B. asper-induced local effects, and the search for novel toxin inhibitors represents a potential avenue for improving the treatment of this serious aspect of snakebite envenomation. PMID:19303033

  15. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry; Cucinotta, F. A.


    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to Si-28-ions with energies ranging from 90 to 600 MeV/u, Ti-48-ions with energies ranging from 240 to 1000 MeV/u, or to Fe-56-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Si beams in this study ranged from 48 to 158 keV/ m, the LET of the Ti ions ranged from 107 to 240 keV/micron, and the LET of the Fe-ions ranged from 145 to 440 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to gamma-rays. The estimates of RBEmax values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, 21.4+/-1.7 to 28.3+/-2.4 for Ti ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBEmax value for Fe ions was obtained with the 600 MeV/u beam, the highest RBEmax value for Ti ions was obtained 1000 MeV/u beam, and the highest RBEmax value for Si ions was obtained with the 170 MeV/u beam. For Si and Fe ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/micron for Si, and decreasing with further increase in LET. Additional studies for low doses Si-28-ions down to 0.02 Gy will be discussed.

  16. Methacryloxylethyl Cetyl Ammonium Chloride Induces DNA Damage and Apoptosis in Human Dental Pulp Cells via Generation of Oxidative Stress

    PubMed Central

    Jiao, Yang; Ma, Sai; Wang, Yirong; Li, Jing; Shan, Lequn; Sun, Jinlong; Chen, Jihua


    The polymerizable antibacterial monomer methacryloxylethyl cetyl ammonium chloride (DMAE-CB) has provided an effective strategy to combat dental caries. However, the application of such material raises the question about the biological safety and the question remains open. The mechanism of this toxic action, however, is not yet clearly understood. The present study aims at providing novel insight into the possible causal link between cellular oxidative stress and DNA damage, as well as apoptosis in human dental pulp cells exposed to DMAE-CB. The enhanced formation of reactive oxygen species and depletion of glutathione, as well as differential changes in activities of superoxide dismutase, glutathione peroxidase, and catalase in DMAE-CB-treated cells indicated oxidative stress. By using substances that can alter GSH synthesis, we found that GSH was the key component in the regulation of cell response towards oxidative stress induced by DMAE-CB. The increase in oxidative stress-sensitive 8-Oxo-2'-deoxyguanosine (8-OHdG) content, formation of γ-H2AX and cell cycle G1 phase arrest indicated that DNA damage occurred as a result of the interaction between DNA base and ROS beyond the capacities of antioxidant mechanisms in cells exposed to DMAE-CB. Such oxidative DNA damage thus triggers the activation of ataxia telangiectasia-mutated (ATM) signaling, the intrinsic apoptotic pathway, and destruction of mitochondrial morphology and function. PMID:27143955

  17. Chromosome-wide histone deacetylation by sirtuins prevents hyperactivation of DNA damage-induced signaling upon replicative stress

    PubMed Central

    Simoneau, Antoine; Ricard, Étienne; Weber, Sandra; Hammond-Martel, Ian; Wong, Lai Hong; Sellam, Adnane; Giaever, Guri; Nislow, Corey; Raymond, Martine; Wurtele, Hugo


    The Saccharomyces cerevisiae genome encodes five sirtuins (Sir2 and Hst1–4), which constitute a conserved family of NAD-dependent histone deacetylases. Cells lacking any individual sirtuin display mild growth and gene silencing defects. However, hst3Δ hst4Δ double mutants are exquisitely sensitive to genotoxins, and hst3Δ hst4Δ sir2Δ mutants are inviable. Our published data also indicate that pharmacological inhibition of sirtuins prevents growth of several fungal pathogens, although the biological basis is unclear. Here, we present genome-wide fitness assays conducted with nicotinamide (NAM), a pan-sirtuin inhibitor. Our data indicate that NAM treatment causes yeast to solicit specific DNA damage response pathways for survival, and that NAM-induced growth defects are mainly attributable to inhibition of Hst3 and Hst4 and consequent elevation of histone H3 lysine 56 acetylation (H3K56ac). Our results further reveal that in the presence of constitutive H3K56ac, the Slx4 scaffolding protein and PP4 phosphatase complex play essential roles in preventing hyperactivation of the DNA damage-response kinase Rad53 in response to spontaneous DNA damage caused by reactive oxygen species. Overall, our data support the concept that chromosome-wide histone deacetylation by sirtuins is critical to mitigate growth defects caused by endogenous genotoxins. PMID:26748095

  18. Chromosome-wide histone deacetylation by sirtuins prevents hyperactivation of DNA damage-induced signaling upon replicative stress.


    Simoneau, Antoine; Ricard, Étienne; Weber, Sandra; Hammond-Martel, Ian; Wong, Lai Hong; Sellam, Adnane; Giaever, Guri; Nislow, Corey; Raymond, Martine; Wurtele, Hugo


    The Saccharomyces cerevisiae genome encodes five sirtuins (Sir2 and Hst1-4), which constitute a conserved family of NAD-dependent histone deacetylases. Cells lacking any individual sirtuin display mild growth and gene silencing defects. However, hst3Δ hst4Δ double mutants are exquisitely sensitive to genotoxins, and hst3Δ hst4Δ sir2Δmutants are inviable. Our published data also indicate that pharmacological inhibition of sirtuins prevents growth of several fungal pathogens, although the biological basis is unclear. Here, we present genome-wide fitness assays conducted with nicotinamide (NAM), a pan-sirtuin inhibitor. Our data indicate that NAM treatment causes yeast to solicit specific DNA damage response pathways for survival, and that NAM-induced growth defects are mainly attributable to inhibition of Hst3 and Hst4 and consequent elevation of histone H3 lysine 56 acetylation (H3K56ac). Our results further reveal that in the presence of constitutive H3K56ac, the Slx4 scaffolding protein and PP4 phosphatase complex play essential roles in preventing hyperactivation of the DNA damage-response kinase Rad53 in response to spontaneous DNA damage caused by reactive oxygen species. Overall, our data support the concept that chromosome-wide histone deacetylation by sirtuins is critical to mitigate growth defects caused by endogenous genotoxins. PMID:26748095

  19. Methacryloxylethyl Cetyl Ammonium Chloride Induces DNA Damage and Apoptosis in Human Dental Pulp Cells via Generation of Oxidative Stress.


    Jiao, Yang; Ma, Sai; Wang, Yirong; Li, Jing; Shan, Lequn; Sun, Jinlong; Chen, Jihua


    The polymerizable antibacterial monomer methacryloxylethyl cetyl ammonium chloride (DMAE-CB) has provided an effective strategy to combat dental caries. However, the application of such material raises the question about the biological safety and the question remains open. The mechanism of this toxic action, however, is not yet clearly understood. The present study aims at providing novel insight into the possible causal link between cellular oxidative stress and DNA damage, as well as apoptosis in human dental pulp cells exposed to DMAE-CB. The enhanced formation of reactive oxygen species and depletion of glutathione, as well as differential changes in activities of superoxide dismutase, glutathione peroxidase, and catalase in DMAE-CB-treated cells indicated oxidative stress. By using substances that can alter GSH synthesis, we found that GSH was the key component in the regulation of cell response towards oxidative stress induced by DMAE-CB. The increase in oxidative stress-sensitive 8-Oxo-2'-deoxyguanosine (8-OHdG) content, formation of γ-H2AX and cell cycle G1 phase arrest indicated that DNA damage occurred as a result of the interaction between DNA base and ROS beyond the capacities of antioxidant mechanisms in cells exposed to DMAE-CB. Such oxidative DNA damage thus triggers the activation of ataxia telangiectasia-mutated (ATM) signaling, the intrinsic apoptotic pathway, and destruction of mitochondrial morphology and function. PMID:27143955

  20. Ultrasonic Assessment of Impact-Induced Damage and Microcracking in Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Liaw, Benjamin; Villars, Esther; Delmont, Frantz; Bowles, Kenneth J. (Technical Monitor)


    The main objective of this NASA FAR project is to conduct ultrasonic assessment of impact-induced damage and microcracking in polymer matrix composites at various temperatures. It is believed that the proposed study of impact damage assessment on polymer matrix composites will benefit several NASA missions and current interests, such as ballistic impact testing of composite fan containment and high strain rate deformation modeling of polymer matrix composites. Impact-induced damage mechanisms in GLARE and ARALL fiber-metal laminates subject to instrumented drop-weight impacts at various temperatures were studied. GLARE and ARALL are hybrid composites made of alternating layers of aluminum and glass (for GLARE) and aramid- (for ARALL) fiber-reinforced epoxy. Damage in pure aluminum panels impacted by foreign objects was mainly characterized by large plastic deformation surrounding a deep penetration dent. On the other hand, plastic deformation in fiber-metal laminates was often not as severe although the penetration dent was still produced. The more stiff fiber-reinforced epoxy layers provided better bending rigidity; thus, enhancing impact damage tolerance. Severe cracking, however, occurred due to the use of these more brittle fiber-reinforced epoxy layers. Fracture patterns, e.g., crack length and delamination size, were greatly affected by the lay-up configuration rather than by the number of layers, which implies that thickness effect was not significant for the panels tested in this study. Immersion ultrasound techniques were then used to assess damages generated by instrumented drop-weight impacts onto these fiber-metal laminate panels as well as 6061-T6 aluminum/cast acrylic sandwich plates adhered by epoxy. Depending on several parameters, such as impact velocity, mass, temperature, laminate configuration, sandwich construction, etc., various types of impact damage were observed, including plastic deformation, radiating cracks emanating from the impact site

  1. Ultrasonic Assessment of Impact-Induced Damage and Microcracking in Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Gyekanyesi, John (Technical Monitor); Liaw, Benjamin; Villars, Esther; Delmont, Frantz


    The main objective of this NASA Faculty Awards for Research (FAR) project is to conduct ultrasonic assessment of impact-induced damage and microcracking in fiber-metal laminated (FML) composites at various temperatures. It is believed that the proposed study of impact damage assessment on FML composites will benefit several NASA's missions and current interests, such as ballistic impact testing of composite fan containment and high strain rate deformation modeling of polymer matrix composites. Impact-induced damage mechanisms in GLARE and ARALL fiber-metal laminates subject to instrumented drop-weight impacts at various temperatures were studied. GLARE and ARALL are hybrid composites made of alternating layers of aluminum and glass- (for GLARE) and aramid- (for ARALL) fiber reinforced epoxy. Damage in pure aluminum panels impacted by foreign objects was mainly characterized by large plastic deformation surrounding a deep penetration dent. On the other hand, plastic deformation in fiber-metal laminates was often not as severe although the penetration dent was still produced. The more stiff fiber-reinforced epoxy layers provided better bending rigidity; thus, enhancing impact damage tolerance. Severe cracking, however, occurred due to the use of these more brittle fiber-reinforced epoxy layers. Fracture patterns, e.g., crack length and delamination size, were greatly affected by the lay-up configuration rather than by the number of layers, which implies that thickness effect was not significant for the panels tested in this study. Immersion ultrasound techniques were then used to assess damages generated by instrumented drop-weight impacts onto these fiber-metal laminate panels as well as 2024-T3 aluminum/cast acrylic sandwich plates adhered by epoxy. Depending on several parameters, such as impact velocity, mass, temperature, laminate configuration, sandwich construction, etc., various types of impact damage were observed, including plastic deformation, radiating

  2. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella


    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  3. Tirapazamine-induced cytotoxicity and DNA damage in transplanted tumors: relationship to tumor hypoxia.


    Siim, B G; Menke, D R; Dorie, M J; Brown, J M


    Tirapazamine (TPZ) is a hypoxia-selective bioreductive drug currently in Phases II and III clinical trials with both radiotherapy and chemotherapy. The response of tumors to TPZ is expected to depend both on the levels of reductive enzymes that activate the drug to a DNA-damaging and toxic species and on tumor oxygenation. Both of these parameters are likely to vary between individual tumors. In this study, we examined whether the enhancement of radiation damage to tumors by TPZ can be predicted from TPZ-induced DNA damage measured using the comet assay. DNA damage provides a functional end point that is directly related to cell killing and should be dependent on both reductive enzyme activity and hypoxia. We demonstrate that TPZ potentiates tumor cell kill by fractionated radiation in three murine tumors (SCCVII, RIF-1, and EMT6) and two human tumor xenografts (A549 and HT29), with no potentiation observed in a third xenograft (HT1080). Overall, there was no correlation of radiation potentiation and TPZ-induced DNA damage in the tumors, except that the nonresponsive tumor xenograft had significantly lower levels of DNA damage than the other five tumor types. However, there was a large tumor-to-tumor variability in DNA damage within each tumor type. This variability appeared not to result from differences in activity of the reductive enzymes but largely from differences in oxygenation between individual tumors, measured using fluorescent detection of the hypoxia marker EF5. The results, therefore, suggest that the sensitivity of individual tumors to TPZ, although not necessarily the response to TPZ plus radiation, might be assessed from measurements of DNA damage using the comet assay. PMID:9230202

  4. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.


    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  5. Retinoid protection against x-ray-induced chromatid damage in human peripheral blood lymphocytes.

    PubMed Central

    Sanford, K K; Parshad, R; Price, F M; Tarone, R E; Kraemer, K H


    Oral administration of isotretinoin (13-cis retinoic acid) was shown previously (Kraemer, K. H., J. J. DiGiovanna, A. N. Moshell, R. E. Tarone, and G. L. Peck. 1988. N. Engl. J. Med. 318:1633-1637) to reduce the frequency of skin cancers in xeroderma pigmentosum (XP) patients. The mechanism of protection was unclear. In the present study, x-ray-induced chromatid damage in PHA-stimulated blood lymphocytes from five XP patients receiving isotretinoin was approximately half that in blood samples from the same patients before or subsequent to treatment. The x-ray-induced chromatid damage in blood lymphocytes from a normal control was reduced significantly by cocultivation with blood or plasma from an XP patient receiving isotretinoin or by addition of 10(-6) M isotretinoin to cultures 1 h before x-irradiation. A similar reduction in x-ray-induced chromatid damage was reported previously by adding to the culture medium, mannitol, a scavenger of the free hydroxyl radical, or catalase, which decomposes hydrogen peroxide; both of these products are generated during ionizing radiation. The present observations suggest that isotretinoin acts as a scavenger of such radiation products, thereby providing protection against x-ray-induced chromatid damage. PMID:1430230

  6. p53-dependent SIRT6 expression protects Aβ42-induced DNA damage

    PubMed Central

    Jung, Eun Sun; Choi, Hyunjung; Song, Hyundong; Hwang, Yu Jin; Kim, Ahbin; Ryu, Hoon; Mook-Jung, Inhee


    Alzheimer’s disease (AD) is the most common type of dementia and age-related neurodegenerative disease. Elucidating the cellular changes that occur during ageing is an important step towards understanding the pathogenesis and progression of neurodegenerative disorders. SIRT6 is a member of the mammalian sirtuin family of anti-aging genes. However, the relationship between SIRT6 and AD has not yet been elucidated. Here, we report that SIRT6 protein expression levels are reduced in the brains of both the 5XFAD AD mouse model and AD patients. Aβ42, a major component of senile plaques, decreases SIRT6 expression, and Aβ42-induced DNA damage is prevented by the overexpression of SIRT6 in HT22 mouse hippocampal neurons. Also, there is a strong negative correlation between Aβ42-induced DNA damage and p53 levels, a protein involved in DNA repair and apoptosis. In addition, upregulation of p53 protein by Nutlin-3 prevents SIRT6 reduction and DNA damage induced by Aβ42. Taken together, this study reveals that p53-dependent SIRT6 expression protects cells from Aβ42-induced DNA damage, making SIRT6 a promising new therapeutic target for the treatment of AD. PMID:27156849

  7. Laser-Induced Damage Threshold and Certification Procedures for Optical Materials

    NASA Technical Reports Server (NTRS)


    This document provides instructions for performing laser-induced-damage-threshold tests and pass-fail certification tests on optical materials used in pulsed-laser systems. The optical materials to which these procedures apply include coated and uncoated optical substrates, laser crystals, Q-switches, polarizers, and other optical components employed in pulsed-laser systems.

  8. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    PubMed Central

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.


    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation find in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation, to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy, micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation. PMID:25072018


    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  10. Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients

    PubMed Central


    Background DNA-damage assays, quantifying the initial number of DNA double-strand breaks induced by radiation, have been proposed as a predictive test for radiation-induced toxicity. Determination of radiation-induced apoptosis in peripheral blood lymphocytes by flow cytometry analysis has also been proposed as an approach for predicting normal tissue responses following radiotherapy. The aim of the present study was to explore the association between initial DNA damage, estimated by the number of double-strand breaks induced by a given radiation dose, and the radio-induced apoptosis rates observed. Methods Peripheral blood lymphocytes were taken from 26 consecutive patients with locally advanced breast carcinoma. Radiosensitivity of lymphocytes was quantified as the initial number of DNA double-strand breaks induced per Gy and per DNA unit (200 Mbp). Radio-induced apoptosis at 1, 2 and 8 Gy was measured by flow cytometry using annexin V/propidium iodide. Results Radiation-induced apoptosis increased in order to radiation dose and data fitted to a semi logarithmic mathematical model. A positive correlation was found among radio-induced apoptosis values at different radiation doses: 1, 2 and 8 Gy (p < 0.0001 in all cases). Mean DSB/Gy/DNA unit obtained was 1.70 ± 0.83 (range 0.63-4.08; median, 1.46). A statistically significant inverse correlation was found between initial damage to DNA and radio-induced apoptosis at 1 Gy (p = 0.034). A trend toward 2 Gy (p = 0.057) and 8 Gy (p = 0.067) was observed after 24 hours of incubation. Conclusions An inverse association was observed for the first time between these variables, both considered as predictive factors to radiation toxicity. PMID:20868468

  11. Plasma-induced damage of GaAs during etching of refractory metal contacts

    SciTech Connect

    Shul, R.J.; Lovejoy, M.L.; Baca, A.G.; Zolper, J.C.; Rieger, D.J.; Hafich, M.J.; Corless, R.F.; Vartuli, C.B.


    The effect of plasma-induced damage on the majority carrier transport properties of {ital p}-type GaAs has been studied by monitoring changes in sheet resistance ({ital R}{sub {ital s}}) of thin conducting layers under various plasma conditions including etch conditions for refractory metal contacts. {ital R}{sub {ital s}} determined from transmission line measurements are used to evaluate plasma-induced damage for electron cyclotron resonance (ECR) and reactive ion etch (RIE) conditions by varying the thickness and doping of epitaxial layers. Damage depths calculated from {ital R}{sub {ital s}} data show a strong dependence on doping levels. This can be explained by a plasma-damage-induced trap density profile which tails off into the sample. Consistent trends have been observed where {ital R}{sub {ital s}} increases with increasing dc bias, increasing microwave power, and decreasing pressure, thus showing {ital R}{sub {ital s}} increases as either the ion energy or ion flux increases. The lowest plasma-induced damage observed in this study occurs with ECR at low microwave power and no rf biasing. Under rf-bias conditions, samples exposed to the ECR (1 mTorr total pressure) show more damage than those exposed to the RIE (8 mTorr total pressure) at comparable dc bias. We have also observed {ital R}{sub {ital s}} dependence on ECR plasma chemistry where {ital R}{sub {ital s}} is lower in SF{sub 6}/Ar plasmas than Ar and N{sub 2} plasmas possibly related to interactions of F or S atoms with the GaAs surface. Moderate anneal temperatures (200--500 {degree}C) have shown significant {ital R}{sub {ital s}} recovery. {copyright} {ital 1995} {ital American} {ital Vacuum} {ital Society}

  12. Utilization of biologically generated acid for drilling fluid damage removal and uniform acid placement across long formation intervals

    SciTech Connect

    Almond, S.W.; Harris, R.E.; Penny, G.S.


    A method of drilling damage removal is presented which uses biologically generated acid (BGA) as the stimulation fluid. The BGA solution is not reactive during the actual pumping stage which allows its displacement into the reservoir to be controlled by the relatively low permeability of the near wellbore damage. Catalytic generation of acid occurs at a controlled rate once the BGA has been injected into the formation and results in uniform damage removal around the near wellbore region. The ability of BGA to be generated under a variety of temperature and pressure conditions and the compatibility evaluation of BGA with a variety of commonly used oil and water based drilling muds is first presented to establish some of the operational guidelines for BGA use. Drilling damage removal studies utilizing the modified API linear conductivity flow cell and carbonate material with BGA is presented to demonstrate the effectiveness of this stimulation fluid. Dual core flow test data is then presented which shows BGA`s ability and HCL`s inability to remove drilling damage over long horizontal intervals in carbonate formations.

  13. Cell to Cell Variability of Radiation-Induced Foci: Relation between Observed Damage and Energy Deposition.


    Gruel, Gaëtan; Villagrasa, Carmen; Voisin, Pascale; Clairand, Isabelle; Benderitter, Marc; Bottollier-Depois, Jean-François; Barquinero, Joan Francesc


    Most studies that aim to understand the interactions between different types of photon radiation and cellular DNA assume homogeneous cell irradiation, with all cells receiving the same amount of energy. The level of DNA damage is therefore generally determined by averaging it over the entire population of exposed cells. However, evaluating the molecular consequences of a stochastic phenomenon such as energy deposition of ionizing radiation by measuring only an average effect may not be sufficient for understanding some aspects of the cellular response to this radiation. The variance among the cells associated with this average effect may also be important for the behaviour of irradiated tissue. In this study, we accurately estimated the distribution of the number of radiation-induced γH2AX foci (RIF) per cell nucleus in a large population of endothelial cells exposed to 3 macroscopic doses of gamma rays from 60Co. The number of RIF varied significantly and reproducibly from cell to cell, with its relative standard deviation ranging from 36% to 18% depending on the macroscopic dose delivered. Interestingly, this relative cell-to-cell variability increased as the dose decreased, contrary to the mean RIF count per cell. This result shows that the dose effect, in terms of the number of DNA lesions indicated by RIF is not as simple as a purely proportional relation in which relative SD is constant with dose. To analyse the origins of this observed variability, we calculated the spread of the specific energy distribution for the different target volumes and subvolumes in which RIF can be generated. Variances, standard deviations and relative standard deviations all changed similarly from dose to dose for biological and calculated microdosimetric values. This similarity is an important argument that supports the hypothesis of the conservation of the association between the number of RIF per nucleus and the specific energy per DNA molecule. This comparison allowed us to

  14. Cell to Cell Variability of Radiation-Induced Foci: Relation between Observed Damage and Energy Deposition

    PubMed Central

    Voisin, Pascale; Clairand, Isabelle; Benderitter, Marc; Bottollier-Depois, Jean-François; Barquinero, Joan Francesc


    Most studies that aim to understand the interactions between different types of photon radiation and cellular DNA assume homogeneous cell irradiation, with all cells receiving the same amount of energy. The level of DNA damage is therefore generally determined by averaging it over the entire population of exposed cells. However, evaluating the molecular consequences of a stochastic phenomenon such as energy deposition of ionizing radiation by measuring only an average effect may not be sufficient for understanding some aspects of the cellular response to this radiation. The variance among the cells associated with this average effect may also be important for the behaviour of irradiated tissue. In this study, we accurately estimated the distribution of the number of radiation-induced γH2AX foci (RIF) per cell nucleus in a large population of endothelial cells exposed to 3 macroscopic doses of gamma rays from 60Co. The number of RIF varied significantly and reproducibly from cell to cell, with its relative standard deviation ranging from 36% to 18% depending on the macroscopic dose delivered. Interestingly, this relative cell-to-cell variability increased as the dose decreased, contrary to the mean RIF count per cell. This result shows that the dose effect, in terms of the number of DNA lesions indicated by RIF is not as simple as a purely proportional relation in which relative SD is constant with dose. To analyse the origins of this observed variability, we calculated the spread of the specific energy distribution for the different target volumes and subvolumes in which RIF can be generated. Variances, standard deviations and relative standard deviations all changed similarly from dose to dose for biological and calculated microdosimetric values. This similarity is an important argument that supports the hypothesis of the conservation of the association between the number of RIF per nucleus and the specific energy per DNA molecule. This comparison allowed us to

  15. Genetic damage induced by benzo[a]pyrene diol epoxide and risk of lung cancer

    SciTech Connect

    Wei, Q.; Cheng, L.; Li, D.


    Lung cancer is the paradigm of carcinogen-induced disease. A chemical carcinogen, benzo[a]pyrene, commonly found in tobacco, is both mutagenic and carcinogenic. It is hypothesized that individuals have varying responses to exposure to environmental carcinogens. In this study, we used benzo[a]pyrene diol epoxide (BPDE) as the test mutagen to investigate three in-vitro susceptibility markers in lymphocytes from 51 patients with lung cancer and 172 cancer-free controls. These markers were: BPDE-induced chromosomal aberrations, BPDE-induced DNA adducts, and DNA repair capacity using host cell reactivation assay with BPDE-damaged plasmid. Using the medians of the controls as the cutoff values, increased risk of lung cancer was associated with increased frequency of chromosomal aberrations (OR=6.53; 95% confidence interval (C.I.), 3.74-11.4), increased BPDE-DNA adduct level (odds ratio (OR)=4.7; 95% C.I., 1.2-18.5), and reduced DNA repair capacity (OR=5.7; 95% C.I., 2.1-15.7). In correlation analyses, cellular ability to repair BPDE-induced DNA damage was found to be inversely correlated with the levels of BPDE-induced DNA adducts (n=34; r=0.34; p=0.048) and the levels of BPDE-DNA adducts correlated significantly with the frequency of chromosomal aberrations (n=62; r=0.42; p=0.001). However, cellular ability to repair BPDE-induced DNA damage was not correlated significantly with the frequency of chromosomal aberrations (n=47; r=0.06; p=0.677). These biomarkers have differing sensitivities in measuring repair of damage induced by chemical carcinogens; therefore, the complementary use of these assays should increase the probability of identifying individuals with susceptibility to smoking-related cancers.

  16. Cytoprotective effect of 20S-Rg3 on benzo[a]pyrene-induced DNA damage.


    Poon, Po Ying; Kwok, Hoi Hin; Yue, Patrick Y K; Yang, Mildred S M; Mak, Nai Ki; Wong, Chris K C; Wong, Ricky N S


    Benzo[a]pyrene (BaP) is a polycyclic aromatic hydrocarbon ubiquitously existing in the environment. Its metabolites have been shown to cause DNA damage and cellular dysfunction in humans. Panax ginseng C.A. Meyer is a Chinese medicinal herb, and ginsenosides are the main active constituent of ginseng. Accumulating evidence had indicated that ginseng extract and ginsenosides possess cytoprotective effects. In this study, the protective effect of ginsenosides on BaP-induced DNA damage in human dermal fibroblasts (HDFs) and HepG2 cells was investigated. The genotoxic effect of BaP was measured by the comet assay. Results showed that tail moment was increased in BaP-treated cells, but cotreatment of ginsenoside 20(S)-Rg3 can significantly decrease BaP-induced DNA damage. A downstream mechanistic study revealed that 20(S)-Rg3 increased the gene expression of an important phase II detoxifying enzyme NAD(P)H:quinine oxidoreductase 1. The effect was also associated with the activation of protein kinase B (Akt) and nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2). These results indicated that 20(S)-Rg3 might protect HDFs from BaP-induced DNA damage through the activation of the phosphatidylinositol 3-kinase/Akt/Nrf2 pathway. Our results also demonstrated that 20(S)-Rg3 is a functional ligand of pregnane X receptor (PXR), a nuclear receptor that mediates the induction of drug clearance pathways. Subsequent knockdown of PXR expression by small interfering RNA confirmed the involvement of PXR on the protective effects of 20(S)-Rg3 against BaP-induced DNA damage. In summary, ginsenoside 20(S)-Rg3 can protect against BaP-induced genotoxicity in human cells, suggesting that ginseng may serve as a natural cytoprotective agent against environmental carcinogens. PMID:21956953

  17. In vivo response of the rat's retinal pigment epithelium to azide: changes induced by light damage.


    Ando, H; Noell, W K


    Functional changes in retinal pigment epithelium (RPE) associated with light-induced retinal damage were studied by measuring transocular potential changes evoked by injections of azide and thiocyanate (SCN-). The retinal damage by light in the rat is classified into two types: Type 1, rod cell death associated with RPE deterioration; Type 2, the loss of rod cells without RPE deterioration. To study the type 1 damage, littermate pairs of long-term dark-adapted adult albino rats were tested at 1 h and 10 d after the exposure to green light of 1,200 lx for 1/2 to 24 h. Time course of the damage progress was also followed for 12 h. We found that 1) RPE was affected rapidly by the damaging light, 2) the exposure length determined the ultimate degree of RPE damage, 3) damaging effects on RPE proceeded slower and weaker after exposure than during continuous light, 4) progress of the damage in RPE was two-phasic; during the first phase, the SCN- response was enhanced and the azide response was reduced; both responses were decreased rapidly in the second phase. The first phase was assumed to indicate a depolarization of the basolateral membrane of RPE, and the second phase to manifest the structural deterioration of RPE. The type 2 damage was studied in young rats with exposure to weak light for 28 d. At 30 d after the exposure, a-wave of the ERG and number of rod cells were substantially reduced but azide and SCN- responses were affected slightly. PMID:8230851

  18. Amifostine, a radioprotectant agent, protects rat brain tissue lipids against ionizing radiation induced damage: An FTIR microspectroscopic imaging study

    SciTech Connect

    Cakmak G.; Miller L.; Zorlu, F.; Severcan, F.


    Amifostine is the only approved radioprotective agent by FDA for reducing the damaging effects of radiation on healthy tissues. In this study, the protective effect of amifostine against the damaging effects of ionizing radiation on the white matter (WM) and grey matter (GM) regions of the rat brain were investigated at molecular level. Sprague-Dawley rats, which were administered amifostine or not, were whole-body irradiated at a single dose of 800 cGy, decapitated after 24 h and the brain tissues of these rats were analyzed using Fourier transform infrared microspectroscopy (FTIRM). The results revealed that the total lipid content and CH{sub 2} groups of lipids decreased significantly and the carbonyl esters, olefinic=CH and CH{sub 3} groups of lipids increased significantly in the WM and GM after exposure to ionizing radiation, which could be interpreted as a result of lipid peroxidation. These changes were more prominent in the WM of the brain. The administration of amifostine before ionizing radiation inhibited the radiation-induced lipid peroxidation in the brain. In addition, this study indicated that FTIRM provides a novel approach for monitoring ionizing radiation induced-lipid peroxidation and obtaining different molecular ratio images can be used as biomarkers to detect lipid peroxidation in biological systems.

  19. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons

    PubMed Central

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua


    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies. PMID:27420046

  20. Laser-induced damage of fused silica on high-power laser: beam intensity modulation, optics defect, contamination

    NASA Astrophysics Data System (ADS)

    Zhao, Dongfeng; Sun, Mingyin; Wu, Rong; Lu, Xinqiang; Lin, Zunqi; Zhu, Jianqiang


    The wedged focus lens of fused silica, one of the final optics assembly's optics, focuses the 351 nm beam onto target and separates the residual 1053 and 527 nm light with 351 nm light. After the experiment with beam energies at 3ω range from 3 to 5KJ, and pulse shapes about 3ns, the wedged focus lens has laser-induced damage at particular area. Analysis the damage result, there are three reasons to induce these damages. These reasons are beam intensity modulation, optics defect and contamination that cause different damage morphologies. The 3ω beam intensity modulation, one of three factors, is the mostly import factor to induce damage. Here, the n2 nonlinear coefficient of fused silica material can lead to small-scale self-focusing filament because of optics thickness and beam intensity. And some damage-filaments' tails are bulk damage spots because there are subsurface scratches or metal contaminations.

  1. Assessing Nezara viridula (Hemiptera: Pentatomidae) feeding damage in macadamia nuts by using a biological stain.


    Golden, Mary; Follett, Peter A; Wright, Mark G


    Damage caused by southern green stink bug, Nezara viridula (L.), to macadamia nuts, Macadamia integrifolia Maiden & Betche, is normally determined after nuts are harvested and processed, which may be many months after damage occurred in the field. We developed a method using ruthenium red dye to stain stink bug feeding probes and indirectly assess feeding activity in macadamia nuts. By using the staining method, feeding probes were easily detected on the husk, shell, and kernel. Husk probing was highly correlated (0.80-0.90) with feeding and damage to the kernel. Failure rate to detect kernel damage from stained husk probes was generally <6%. The staining method was equally effective for immature and mature nuts; therefore, N. viridula feeding activity can be monitored throughout the season to evaluate pest management tactics and forecast outbreak populations. PMID:16813317

  2. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology.


    Cheung-Ong, Kahlin; Giaever, Guri; Nislow, Corey


    DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action. This review covers the current DNA-damaging agents used in the clinic, discusses their limitations, and describes the use of chemical genomics to uncover new information about the DNA damage response network and to evaluate novel DNA-damaging compounds. PMID:23706631

  3. Influence of biological control damage on efficacy of penoxsulam and two other herbicides on waterhyacinth

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Populations of waterhyacinth (Eichhornia crassipes (Mart.) Solms.) in the southeastern U.S. have been reduced by widespread herbicidal control and by introduced waterhyacinth weevils (Neochetina spp) and native pathogens. However, damaging populations of this weed persist and integrated approaches ...

  4. Specialty supplement use and biologic measures of oxidative stress and DNA damage

    PubMed Central

    Kantor, Elizabeth D.; Ulrich, Cornelia M.; Owen, Robert W.; Schmezer, Peter; Neuhouser, Marian L.; Lampe, Johanna W.; Peters, Ulrike; Shen, Danny D.; Vaughan, Thomas L.; White, Emily


    Background Oxidative stress and resulting cellular damage have been suggested to play a role in the etiology of several chronic diseases, including cancer and cardiovascular disease. Identifying factors associated with reduced oxidative stress and resulting damage may guide future disease-prevention strategies. Methods In the VITamins And Lifestyle (VITAL) biomarker-study of 209 persons living in the Seattle area, we examined the association between current use of several specialty supplements and oxidative stress, DNA damage, and DNA repair capacity. Use of glucosamine, chondroitin, fish oil, methylsulfonylmethane (MSM), co-enzyme Q10 (CoQ10), ginseng, ginkgo, and saw palmetto was ascertained by a supplement inventory/interview, while use of fiber supplements was ascertained by questionnaire. Supplements used by more than 30 persons (glucosamine and chondroitin) were evaluated as the trend across number of pills/week (non-use, <14 pills/week, 14+ pills/week), while less-commonly used supplements were evaluated as use/non-use. Oxidative stress was measured by urinary 8-isoprostane and PGF2α concentrations using enzyme immunoassays (EIA), while lymphocyte DNA damage and DNA repair capacity were measured using the Comet assay. Multivariate-adjusted linear regression was used to model the associations between supplement use and oxidative stress/DNA damage. Results Use of glucosamine (p-trend:0.01), chondroitin (p-trend:0.003), and fiber supplements (p:0.01) was associated with reduced PGF2α concentrations, while CoQ10 supplementation was associated with reduced baseline DNA damage (p:0.003). Conclusions Use of certain specialty supplements may be associated with reduced oxidative stress and DNA damage. Impact Further research is needed to evaluate the association between specialty supplement use and markers of oxidative stress and DNA damage. PMID:23917455

  5. Ameliorative effects of pycnogenol on carbon tetrachloride-induced hepatic oxidative damage in rats.


    Ahn, Tai-Hwan; Yang, Young-Su; Lee, Jong-Chan; Moon, Chang-Jong; Kim, Sung-Ho; Jun, Woojin; Park, Seung-Chun; Kim, Jong-Choon


    This study evaluated the putative antioxidant activity of Pycnogenol (PYC) against CCl4-induced hepatic oxidative damage in Sprague-Dawley rats. A single oral dose of CCl4 (1.25 mL/kg) produced significantly increased levels of serum aminotransferase (AST) and alanine aminotransferase (ALT) activities. In addition, increased malondialdehyde (MDA) concentration, reduced glutathione (GSH) content, and decreased catalase, superoxide dismutase (SOD) and glutathione-S-transferase (GST) activities were observed in the hepatic tissues. However, concomitant administration with PYC (10 or 20 mg/kg) significantly improved CCl4-induced hepatic injury, as evidenced by the decline of serum AST and ALT activities in a dose dependent manner. Moreover, PYC reduced MDA concentration and increased GSH levels and catalase, SOD and GST activities in hepatic tissues, indicating that concomitant administration with PYC efficiently prevent the CCl4-induced oxidative damage in rats. The free radical scavenging assay showed that PYC has a dose-dependent scavenging activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radicals. These results indicate that PYC has an antioxidant effect against CCl4-induced hepatic oxidative damage and is useful as a hepatoprotective agent against various liver diseases induced by oxidative stress. PMID:17886222

  6. Lycopene protects against acute zearalenone-induced oxidative, endocrine, inflammatory and reproductive damages in male mice.


    Boeira, Silvana Peterini; Funck, Vinícius Rafael; Borges Filho, Carlos; Del'Fabbro, Lucian; de Gomes, Marcelo Gomes; Donato, Franciele; Royes, Luiz Fernando Freire; Oliveira, Mauro Schneider; Jesse, Cristiano Ricardo; Furian, Ana Flávia


    Male mice received lycopene for 10 days before a single oral administration of zearalenone (ZEA). After 48 h testes and blood were collected. Mice treated with lycopene/ZEA exhibited amelioration of the hematological changes. Lycopene prevented the reduction in the number and motility of spermatozoa and testosterone levels, indicating a protective effect in the testicular damage induced by ZEA. Lycopene was also effective in protecting against the decrease in glutathione-S-transferase, glutathione peroxidase, glutathione reductase and δ-aminolevulinic acid dehydratase activities caused by ZEA in the testes. Exposure of animals to ZEA induced modification of antioxidant and inflammatory status with increase of reduced glutathione (GSH) levels and increase of the oxidized glutathione, interleukins 1β, 2, 6, 10, tumor necrosis factor-α and bilirubin levels. Lycopene prevented ZEA-induced changes in GSH levels and inhibited the processes of inflammation, reducing the damage induced by ZEA. Altogether, our results indicate that lycopene was able to prevent ZEA-induced damage in the mice. PMID:25682699

  7. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  8. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.


    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming


    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. PMID:26002045

  9. Re-assessment of chronic radio-induced tissue damage in a rat hindlimb model

    PubMed Central



    Radiotherapy is successfully used to treat neoplastic lesions, but may adversely affect normal tissues within the irradiated volume. However, additional clinical and para-clinical data are required for a comprehensive understanding of the pathogenesis of this damage. We assessed a rat model using clinical records and medical imaging to gain a better understanding of irradiation-induced tissue damage. The hindlimbs of the rats in this model were irradiated with a single dose of 30 or 50 Gy. Sequential analysis was based on observation records of stage and planar scintigraphy. Additional radiography, radiohistology and histology studies were performed to detect histological alterations. All animals developed acute and late effects, with an increased severity after a dose of 50 Gy. The bone uptake of 99mTc-HDP was significantly decreased in a dose- and time-dependent manner. Histologically, significant tissue damage was observed. After the 50 Gy irradiation, the animals developed lesions characteristic of osteoradionecrosis (ORN). Radiographic and histological studies provided evidence of lytic bone lesions. Our rat model developed tissue damage characteristic of radiation injury after a single 30 Gy irradiation and tissue degeneration similar to that which occurs during human ORN after a 50 Gy irradiation. The development of this animal model is an essential step in exploring the pathogenesis of irradiation-induced tissue damage, and may be used to test the efficacy of new treatments. PMID:22993575

  10. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells

    PubMed Central

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N.; Guo, Lei; Mei, Nan


    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  11. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.


    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan


    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  12. Influence of surface cracks on laser-induced damage resistance of brittle KH₂PO₄ crystal.


    Cheng, Jian; Chen, Mingjun; Liao, Wei; Wang, Haijun; Wang, Jinghe; Xiao, Yong; Li, Mingquan


    Single point diamond turning (SPDT) currently is the leading finishing method for achieving ultra-smooth surface on brittle KH(2)PO(4) crystal. In this work, the light intensification modulated by surface cracks introduced by SPDT cutting is numerically simulated using finite-difference time-domain algorithm. The results indicate that the light intensification caused by surface cracks is wavelength, crack geometry and position dependent. Under the irradiation of 355 nm laser, lateral cracks on front surfaces and conical cracks on both front and rear surfaces can produce light intensification as high as hundreds of times, which is sufficient to trigger avalanche ionization and finally lower the laser damage resistance of crystal components. Furthermore, we experimentally tested the laser-induced damage thresholds (LIDTs) on both crack-free and flawed crystal surfaces. The results imply that brittle fracture with a series of surface cracks is the dominant source of laser damage initiation in crystal components. Due to the negative effect of surface cracks, the LIDT on KDP crystal surface could be sharply reduced from 7.85J/cm(2) to 2.33J/cm(2) (355 nm, 6.4 ns). In addition, the experiment of laser-induced damage growth is performed and the damage growth behavior agrees well with the simulation results of light intensification caused by surface cracks with increasing crack depths. PMID:25402114

  13. PEA15 Regulates the DNA Damage-Induced Cell Cycle Checkpoint and Oncogene-Directed Transformation

    PubMed Central

    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y.; Green, Michael R.


    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  14. PEA15 regulates the DNA damage-induced cell cycle checkpoint and oncogene-directed transformation.


    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y; Green, Michael R; Wajapeyee, Narendra


    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  15. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales


    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  16. Antioxidant and hepatoprotective effects of punicalagin and punicalin on acetaminophen-induced liver damage in rats.


    Lin, C C; Hsu, Y F; Lin, T C; Hsu, H Y


    Punicalagin and punicalin were isolated from the leaves of Terminalia catappa L., a Combretaceous plant distributed throughout tropical and subtropical beaches, which is used for the treatment of dermatitis and hepatitis. Our previous studies showed that both of these compounds exert antioxidative activity. In this study, the antihepatotoxic activity of punicalagin and punicalin on acetaminophen-induced toxicity in the rat liver was evaluated. After evaluating the changes of several biochemical functions in serum, the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were increased by acetaminophen administration and reduced by punicalagin and punicalin. Histological changes around the hepatic central vein and oxidative damage induced by acetaminophen were also recovered by both compounds. The data show that both punicalagin and punicalin exert antihepatotoxic activity, but treatment with larger doses enhanced liver damage. These results suggest that even if punicalagin and punicalin have antioxidant activity at small doses, treatment with larger doses will possibly induce some cell toxicities. PMID:11351354

  17. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen


    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  18. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress

    PubMed Central

    Skipper, Anthony; Sims, Jennifer N.; Yedjou, Clement G.; Tchounwou, Paul B.


    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium.  Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG2) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG2 cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG2 cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG2) cells. PMID:26729151

  19. Effects of allopurinol on exercise-induced muscle damage: new therapeutic approaches?


    Sanchis-Gomar, F; Pareja-Galeano, H; Perez-Quilis, C; Santos-Lozano, A; Fiuza-Luces, C; Garatachea, N; Lippi, G; Lucia, A


    Intensive muscular activity can trigger oxidative stress, and free radicals may hence be generated by working skeletal muscle. The role of the enzyme xanthine oxidase as a generating source of free radicals is well documented and therefore is involved in the skeletal muscle damage as well as in the potential transient cardiovascular damage induced by high-intensity physical exercise. Allopurinol is a purine hypoxanthine-based structural analog and a well-known inhibitor of xanthine oxidase. The administration of the xanthine oxidase inhibitor allopurinol may hence be regarded as promising, safe, and an economic strategy to decrease transient skeletal muscle damage (as well as heart damage, when occurring) in top-level athletes when administered before a competition or a particularly high-intensity training session. Although continuous administration of allopurinol in high-level athletes is not recommended due to its possible role in hampering training-induced adaptations, the drug might be useful in non-athletes. Exertional rhabdomyolysis is the most common form of rhabdomyolysis and affects individuals participating in a type of intense exercise to which they are not accustomed. This condition can cause exercise-related myoglobinuria, thus increasing the risk of acute renal failure and is also associated with sickle cell trait. In this manuscript, we have reviewed the recent evidence about the effects of allopurinol on exercise-induced muscle damage. More research is needed to determine whether allopurinol may be useful for preventing not only exertional rhabdomyolysis and acute renal damage but also skeletal muscle wasting in critical illness as well as in immobilized, bedridden, sarcopenic or cachectic patients. PMID:25181966

  20. Iodoacetic acid, but not sodium iodate, creates an inducible swine model of photoreceptor damage.


    Noel, Jennifer M; Fernandez de Castro, Juan P; Demarco, Paul J; Franco, Luisa M; Wang, Wei; Vukmanic, Eric V; Peng, Xiaoyan; Sandell, Julie H; Scott, Patrick A; Kaplan, Henry J; McCall, Maureen A


    Our purpose was to find a method to create a large animal model of inducible photoreceptor damage. To this end, we tested in domestic swine the efficacy of two chemical toxins, known to create photoreceptor damage in other species: Iodoacetic Acid (IAA) and Sodium Iodate (NaIO(3)). Intravenous (IV) administration of NaIO(3) up to 90 mg/kg had no effect on retinal function and 110 mg/kg was lethal. IV administration of IAA (5-20 mg/kg) produced concentration-dependent changes in visual function as measured by full-field and multi-focal electroretinograms (ffERG and mfERG), and 30 mg/kg IAA was lethal. The IAA-induced effects measured at two weeks were stable through eight weeks post-injection, the last time point investigated. IAA at 7.5, 10, and 12 mg/kg produce a concentration-dependent reduction in both ffERG b-wave and mfERG N1-P1 amplitudes compared to baseline at all post-injection times. Comparisons of dark- and light-adapted ffERG b-wave amplitudes show a more significant loss of rod relative to cone function. The fundus of swine treated with ≥10 mg/kg IAA was abnormal with thinner retinal vessels and pale optic discs, and we found no evidence of bone spicule formation. Histological evaluations show concentration-dependent outer retinal damage that correlates with functional changes. We conclude that NaIO(3,) is not an effective toxin in swine. In contrast, IAA can be used to create a rapidly inducible, selective, stable and concentration-dependent model of photoreceptor damage in swine retina. Because of these attributes this large animal model of controlled photoreceptor damage should be useful in the investigation of treatments to replace damaged photoreceptors. PMID:22251455

  1. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.


    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  2. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  3. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  4. Beneficial protective effect of pramipexole on light-induced retinal damage in mice.


    Shibagaki, Keiichi; Okamoto, Kazuyoshi; Katsuta, Osamu; Nakamura, Masatsugu


    We investigated the effects of pramipexole, a potent dopamine receptor D2/D3 agonist, on light-induced retinal damage in mice, H2O2-induced retinal pigment epithelium ARPE-19 cell injury in humans, and hydroxyl radical scavenging activity in a cell-free system. Pramipexole (0.1 and 1 mg/kg body weight) was orally administered to mice 1 h before light exposure (5000 lux, 2 h). Electrophysiological and morphologic studies were performed to evaluate the effects of the pramipexole on light-induced retinal damage in mice. Pramipexole significantly prevented the reduction of the a- and b-wave electroretinogram (ERG) amplitudes caused by light exposure in a dose-dependent manner. In parallel, damage to the inner and outer segments (IS/OS) of the photoreceptors, loss of photoreceptor nuclei, and the number of Tdt-mediated dUTP nick-end labeling (TUNEL)-positive cells in the outer nuclear layer (ONL) caused by light exposure were notably ameliorated by pramipexole. Additionally, pramipexole suppressed H2O2-induced ARPE-19 cell death in vitro in a concentration-dependent manner. The effect of pramipexole was significant at concentrations of 10(-6) M or higher. Pramipexole also significantly prevented H2O2-induced activation of caspases-3/7 and the intracellular accumulation of reactive oxygen species (ROS) in a concentration-dependent manner ranging from 10(-5) to 10(-3) M. Furthermore, pramipexole increased the scavenging activity toward a hydroxyl radical generated from H2O2 in a Fenton reaction. Our results suggest that pramipexole protects against light-induced retinal damage as an antioxidant and that it may be a novel and effective therapy for retinal degenerative disorders, such as dry age-related macular degeneration. PMID:26213307

  5. Melatonin Attenuates Oxidative Damage Induced by Acrylamide In Vitro and In Vivo

    PubMed Central

    Pan, Xiaoqi; Zhu, Lanlan; Lu, Huiping; Wang, Dun; Lu, Qing; Yan, Hong


    Acrylamide (ACR) has been classified as a neurotoxic agent in animals and humans. Melatonin (MT) has been shown to be potentially effective in preventing oxidative stress related neurodegenerative disorders. In this study, whether MT exerted a protective effect against ACR-induced oxidative damage was investigated. Results in cells showed that reactive oxygen species (ROS) and malondialdehyde (MDA) significantly increased after ACR treatment for 24 h. MT preconditioning or cotreatment with ACR reduced ROS and MDA products, whereas the inhibitory effect of MT on oxidant generation was attenuated by blocking the MT receptor. Increased DNA fragmentation caused by ACR was significantly decreased by MT coadministration. In vivo, rats at 40 mg/kg/day ACR by gavage for 12 days showed weight loss and gait abnormality, Purkinje cell nuclear condensation, and DNA damage in rat cerebellum. MT (i.p) cotreatment with ACR not only recovered weight and gait of rats, but also decreased nuclear condensation and DNA damage in rat cerebellum. Using MDA generation, glutathione (GSH) level, superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) activities in rat cerebellum as indicators, MT alleviated ACR-induced lipid peroxidation and depressed antioxidant capacity. Our results suggest that MT effectively prevents oxidative damage induced by ACR. PMID:26185593

  6. Hepatoprotective Activity of Elephantopus scaber on Alcohol-Induced Liver Damage in Mice

    PubMed Central

    Ho, Wan Yong; Yeap, Swee Keong; Ho, Chai Ling; Abdul Rahim, Raha; Alitheen, Noorjahan Banu


    Elephantopus scaber has been traditionally used as liver tonic. However, the protective effect of E. scaber on ethanol-induced liver damage is still unclear. In this study, we have compared the in vivo hepatoprotective effect of E. scaber with Phyllanthus niruri on the ethanol-induced liver damage in mice. The total phenolic and total flavanoid content of E. scaber ethanol extract were determined in this study. Accelerating serum biochemical profiles (including AST, ALT, ALP, triglyceride, and total bilirubin) associated with fat drop and necrotic body in the liver section were observed in the mice treated with ethanol. Low concentration of E. scaber was able to reduce serum biochemical profiles and the fat accumulation in the liver. Furthermore, high concentration of E. scaber and positive control P. niruri were able to revert the liver damage, which is comparable to the normal control. Added to this, E. scaber did not possess any oral acute toxicity on mice. These results suggest the potential effect of this extract as a hepatoprotective agent towards-ethanol induced liver damage without any oral acute toxicity effect. These activities might be contributed, or at least in part, by its high total phenolic and flavonoid contents. PMID:22973401

  7. Naringin protects memory impairment and mitochondrial oxidative damage against aluminum-induced neurotoxicity in rats.


    Prakash, Atish; Shur, Bhargabi; Kumar, Anil


    Aluminum has been indicated in neurodegenerative disorders and naringin, a bioflavonoid has been used to reduce neurotoxic effects of aluminum against aluminum chloride-induced rats. Therefore, present study has been designed to explore the possible role of naringin against aluminum-induced cognitive dysfunction and oxidative damage in rats. Aluminum (100 mg/kg) and naringin (40 and 80 mg/kg) drug treatment were administered orally for six weeks to male wistar rats. Various behavioral performance tasks, biochemical, mitochondrial oxidative parameters, and aluminum concentration in the brain were assessed. Aluminum chloride treatment significantly caused cognitive dysfunction and mitochondria oxidative damage as compared to vehicle treated control group. Besides, aluminum chloride treatment significantly increased acetyl cholinesterase activity and aluminum concentration in the brain as compared to sham. Chronic administration of naringin significantly improved cognitive performance and attenuated mitochondria oxidative damage, acetyl cholinesterase activity, and aluminum concentration in aluminum-treated rats as compared to control rats. Results of the study demonstrate neuroprotective potential of naringin against aluminum chloride-induced cognitive dysfunction and mitochondrial oxidative damage. PMID:23510099

  8. Plasma-induced-damage of GaAs during etching of refractory metal contacts

    SciTech Connect

    Shul, R.J.; Lovejoy, M.L.; Baca, A.G.; Zolper, J.C.; Rieger, D.J.; Hafich, M.J.; Corless, R.F.; Vartuli, C.R.


    The effect of plasma-induced-damage on the majority carrier transport properties of GaAs has been studied by monitoring changes in sheet resistance (R{sub s}) of thin conducting layers under various plasma conditions including etch conditions for refractory metal contacts. R{sub s} determined from transmission line measurements are used to evaluate plasma-induced-damage for electron cyclotron resonance (ECR) and reactive ion etch (RIE) conditions by varying the thickness of doped epitaxial layers. The authors speculate that plasma-induced-damage in the near surface region plays a major role in explaining the damage mechanism observed in this study. Very consistent trends have been observed where R{sub s} increases with increasing ECR and RIE dc-bias, increasing microwave power, and decreasing pressure, thus showing R{sub s} increases as either the ion energy or ion flux increases. The authors have also observed that R{sub s} is lower for samples exposed to the RIE than the ECR, possibly due to higher ion and electron densities generated in the ECR and higher pressures in the RIE. It has also been observed R{sub s} dependence on ECR plasma chemistry where, R{sub s} is lower in SF{sub 6}/Ar plasmas than Ar and N{sub 2} plasmas possibly related to interactions of F or S atoms with the GaAs surface. Moderate anneal temperatures (200 to 500{degrees}C) have shown significant R{sub s} recovery.

  9. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.


    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely


    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna. PMID:24747829

  10. An introduction to alcohol-induced brain damage and its causes.


    Harper, C; Kril, J


    The aim of the symposium on alcohol-induced brain damage is to review current opinion and recent advances concerning factors which are thought to play a significant role in this disorder. The three principal factors are: alcohol specific neurotoxicity, associated vitamin B1 (thiamine) deficiency (the Wernicke-Korsakoff syndrome) and liver failure secondary to alcoholic cirrhosis. There is a complex interaction of these and other factors and it is difficult to dissect out the relative importance of each in the pathogenesis of alcohol-related brain damage. Moreover recent molecular and biochemical studies suggest that several of these factors may have pathogenetic mechanisms in common-for example, excitotoxicity, mitric oxide and free radicals. The application of new technologies in neuropathological studies of carefully selected groups of alcoholic cases is beginning to reveal a far more complex pattern of damage than current view holds. Quantitative morphometry and immunohistochemistry can be combined to create three dimensional images of various anatomical regions of the brain together with detailed analyses of neuronal counts, sizes and neurochemical type. In the Wernicke-Korsakoff syndrome (WKS) there is good evidence (in support of neuropsychological and neuroradiological data) to suggest that specific populations of neurons are damaged in cortical and subcortical regions. In those cases with the WKS there is also evidence of pathological damage in cortical and subcortical regions other than the well described periventricular distributions. These more detailed studies provide us with a more comprehensive understanding of alcohol-related brain damage. PMID:8974342

  11. Laser induced fluorescence imaging of thermal damage in polymer matrix composites

    SciTech Connect

    Fisher, W.G.; Meyer, K.E.; Wachter, E.A.; Perl, D.R.; Kulowitch, P.J.


    A simple, fluorescence based imaging system has been developed that is capable of identifying regions of thermal damage in polymer matrix composites (PMCs). These materials are playing an increasingly important role in the production of high performance vehicles and aircraft, where their low weight and high mechanical strength, combined with advancements in manufacturing technology, ensure increased use for a variety of applications. Of particular concern in the aerospace industry is the tendency of some PMC materials to become irreversibly damaged when exposed to elevated temperatures. Traditional nondestructive testing (NDT) techniques are capable of detecting physical anomalies such as cracks and delaminations but cannot detect initial heat damage, which occurs on a molecular scale. Spectroscopic techniques such as laser induced fluorescence provide an attractive means for detecting this type of damage and are amenable to imaging large, irregularly shaped surfaces. In this report the authors describe instrumentation capable of rapidly detecting thermal damage in graphite epoxy components and suggest improvements which will enable this technology to make quantitative judgments concerning the mechanical strength properties of heat damaged specimens.

  12. Induced superficial chondrocyte death reduces catabolic cartilage damage in murine posttraumatic osteoarthritis.


    Zhang, Minjie; Mani, Sriniwasan B; He, Yao; Hall, Amber M; Xu, Lin; Li, Yefu; Zurakowski, David; Jay, Gregory D; Warman, Matthew L


    Joints that have degenerated as a result of aging or injury contain dead chondrocytes and damaged cartilage. Some studies have suggested that chondrocyte death precedes cartilage damage, but how the loss of chondrocytes affects cartilage integrity is not clear. In this study, we examined whether chondrocyte death undermines cartilage integrity in aging and injury using a rapid 3D confocal cartilage imaging technique coupled with standard histology. We induced autonomous expression of diphtheria toxin to kill articular surface chondrocytes in mice and determined that chondrocyte death did not lead to cartilage damage. Moreover, cartilage damage after surgical destabilization of the medial meniscus of the knee was increased in mice with intact chondrocytes compared with animals whose chondrocytes had been killed, suggesting that chondrocyte death does not drive cartilage damage in response to injury. These data imply that chondrocyte catabolism, not death, contributes to articular cartilage damage following injury. Therefore, therapies targeted at reducing the catabolic phenotype may protect against degenerative joint disease. PMID:27427985

  13. Induced Pluripotent Stem Cell Technology in Regenerative Medicine and Biology

    NASA Astrophysics Data System (ADS)

    Pei, Duanqing; Xu, Jianyong; Zhuang, Qiang; Tse, Hung-Fat; Esteban, Miguel A.

    The potential of human embryonic stem cells (ESCs) for regenerative medicine is unquestionable, but practical and ethical considerations have hampered clinical application and research. In an attempt to overcome these issues, the conversion of somatic cells into pluripotent stem cells similar to ESCs, commonly termed nuclear reprogramming, has been a top objective of contemporary biology. More than 40 years ago, King, Briggs, and Gurdon pioneered somatic cell nuclear reprogramming in frogs, and in 1981 Evans successfully isolated mouse ESCs. In 1997 Wilmut and collaborators produced the first cloned mammal using nuclear transfer, and then Thomson obtained human ESCs from in vitro fertilized blastocysts in 1998. Over the last 2 decades we have also seen remarkable findings regarding how ESC behavior is controlled, the importance of which should not be underestimated. This knowledge allowed the laboratory of Shinya Yamanaka to overcome brilliantly conceptual and technical barriers in 2006 and generate induced pluripotent stem cells (iPSCs) from mouse fibroblasts by overexpressing defined combinations of ESC-enriched transcription factors. Here, we discuss some important implications of human iPSCs for biology and medicine and also point to possible future directions.

  14. Investigation of surface damage precursor evolutions and laser-induced damage threshold improvement mechanism during Ion beam etching of fused silica.


    Shi, Feng; Zhong, Yaoyu; Dai, Yifan; Peng, Xiaoqiang; Xu, Mingjin; Sui, Tingting


    Surface damage precursor evolution has great influence on laser-induced damage threshold improvement of fused silica surface during Ion beam etching. In this work, a series of ion sputtering experiment are carried out to obtain the evolutions of damage precursors (dot-form microstructures, Polishing-Induced Contamination, Hertz scratches, and roughness). Based on ion sputtering theory, surface damage precursor evolutions are analyzed. The results show that the dot-form microstructures will appear during ion beam etching. But as the ion beam etching depth goes up, the dot-form microstructures can be mitigated. And ion-beam etching can broaden and passivate the Hertz scratches without increasing roughness value. A super-smooth surface (0.238nm RMS) can be obtained finally. The relative content of Fe and Ce impurities both significantly reduce after ion beam etching. The laser-induced damage threshold of fused silica is improved by 34% after ion beam etching for 800nm. Research results can be a reference on using ion beam etching process technology to improve laser-induced damage threshold of fused silica optics. PMID:27607688

  15. Autophagy induced by cathepsin S inhibition induces early ROS production, oxidative DNA damage, and cell death via xanthine oxidase.


    Huang, Chien-Chang; Chen, Kuo-Li; Cheung, Chun Hei Antonio; Chang, Jang-Yang


    Cathepsin S plays multiple roles in MHC class II antigen presentation, extracellular matrix degradation, angiogenesis, and tumorogenesis. Our previous study revealed that targeting cathepsin S could induce cellular cytotoxicity and reduce cell viability. For the current study, we further investigated the molecular mechanism responsible for targeting cathepsin S-induced cell death and its association with autophagy. Distinct from regulation of the classic autophagy pathway by reactive oxygen species (ROS), we demonstrated that autophagy is the genuine regulator of early ROS production. The molecular silencing of autophagy-dependent ATG genes (ATG5, ATG7, and LC3) and the pharmacologic inhibition of autophagy with 3-MA and wortmannin reduced ROS production significantly. In addition, xanthine oxidase (XO), which is upregulated by autophagy, is required for early ROS production, oxidative DNA damage, and consequent cell death. Autophagy inhibition suppresses the upregulation of XO, which is induced by cathepsin S inhibition, resulting in reduced ROS generation, DNA damage, and cell death. Collectively, our study reveals a noncanonical molecular pathway in which, after the inhibition of cathepsin S, autophagy induces early ROS production for oxidative DNA damage and cell death through XO. PMID:23892358

  16. Deformation-induced damage and recovery in model hydrogels - A molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Zidek, Jan; Milchev, Andrey; Jancar, Josef; Vilgis, Thomas A.


    Using molecular dynamics simulation of a model hybrid cross-link hydrogel, we investigate the network damage evolution and the related structure transformations. We model the hydrogel structure as a network-connected assembly of crosslinked clusters whereby deformation-induced damage is considered along with network recovery. The two principal mechanisms involved in hydrogel recovery from deformation include segment hops of the building structure units (segments) between clusters and cluster shape modification. These mechanisms act either instantaneously, or with a certain time delay after the onset of deformation. By elucidating the conditions under which one of the mechanisms prevails, one may design hydrogel materials with a desired response to deformation.

  17. A study of ps-laser-induced-damage-threshold in hybrid metal-dielectric mirrors

    NASA Astrophysics Data System (ADS)

    Škoda, Václav; Vanda, Jan


    Laser-induced-damage-threshold of two types of metal-dielectric mirrors was tested using a laser apparatus working at 800 nm wavelength with 1 ps pulse length at 1 kHz repetition rate and in 106-on-1 test mode. Four sets of mirror samples with different layer system designs using a multilayer Ta2O5/SiO2 coating on silver or gold metal layer were manufactured. Both BK7 and fused silica substrate materials were used for manufacturing of samples. The measured damage thresholds at 45 deg incidence and P-polarization were compared with computed properties of layer system and used materials.

  18. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.


    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  19. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    NASA Astrophysics Data System (ADS)

    Kim, G. J.; Kim, W.; Kim, K. T.; Lee, J. K.


    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  20. Mitochondrial ferritin suppresses MPTP-induced cell damage by regulating iron metabolism and attenuating oxidative stress.


    You, Lin-Hao; Li, Zhen; Duan, Xiang-Lin; Zhao, Bao-Lu; Chang, Yan-Zhong; Shi, Zhen-Hua


    Our previous work showed that mitochondrial ferritin (MtFt) played an important role in preventing neuronal damage in 6-OHDA-induced Parkinson's disease (PD). However, the role of MtFt in a PD model induced by MPTP is not clear. Here, we found that methyl-4-phenyl-1, 2, 3, 6-tetra-pyridine (MPTP) significantly upregulated MtFt in the mouse hippocampus, substantia nigra (SN) and striatum. To explore the effect of MtFt upregulation on the MPTP-mediated injury to neural cells, MtFt-/- mice and MtFt-overexpressing cells were used to construct models of PD induced by MPTP. Our results showed that MPTP dramatically downregulated expression of transferrin receptor 1 (TfR1) and tyrosine hydroxylase and upregulated L-ferritin expression in the mouse striatum and SN. Interestingly, MPTP induced high levels of MtFt in these tissues, indicating that MtFt was involved in iron metabolism and influenced dopamine synthesis induced by MPTP. Meanwhile, the Bcl2/Bax ratio was decreased significantly by MPTP in the striatum and SN of MtFt knockout (MtFt-/-) mice compared with controls. Overexpression of MtFt increased TfR1 and decreased ferroportin 1 induced by 1-methyl-4-phenylpyridinium ions (MPP+). MtFt strongly inhibited mitochondrial damage through maintaining the mitochondrial membrane potential and protecting the integrity of the mitochondrial membrane. It also suppressed the increase of the labile iron pool, decreased production of reactive oxygen species and dramatically rescued the apoptosis induced by MPP+. In conclusion, this study demonstrates that MtFt plays an important role in preventing neuronal damage in the MPTP-induced parkinsonian phenotype by inhibiting cellular iron accumulation and subsequent oxidative stress. PMID:27017962

  1. The calcium-sensing receptor participates in testicular damage in streptozotocin-induced diabetic rats.


    Kong, Wei-Yuan; Tong, Li-Quan; Zhang, Hai-Jun; Cao, Yong-Gang; Wang, Gong-Chen; Zhu, Jin-Zhi; Zhang, Feng; Sun, Xue-Ying; Zhang, Tie-Hui; Zhang, Lin-Lin


    Male infertility caused by testicular damage is one of the complications of diabetes mellitus. The calcium-sensing receptor (CaSR) is expressed in testicular tissues and plays a pivotal role in calcium homeostasis by activating cellular signaling pathways, but its role in testicular damage induced by diabetes remains unclear. A diabetic model was established by a single intraperitoneal injection of streptozotocin (STZ, 40 mg kg-1 ) in Wistar rats. Animals then received GdCl 3 (an agonist of CaSR, 8.67 mg kg-1 ), NPS-2390 (an antagonist of CaSR, 0.20 g kg-1 ), or a combination of both 2 months after STZ injection. Diabetic rats had significantly lower testes weights and serum levels of testosterone compared to healthy rats, indicating testicular damage and dysfunction in STZ-induced diabetic rats. Compared with healthy controls, the testicular tissues of diabetic rats overexpressed the CaSR protein and had higher levels of malondialdehyde (MDA), lower superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity, and higher numbers of apoptotic germ cells. The testicular tissues from diabetic rats also expressed lower levels of Bcl-2 and higher levels of Bax and cleaved caspase-3 in addition to higher phosphorylation rates of c-Jun NH 2 -terminal protein kinase (JNK), p38, and extracellular signaling-regulated kinase (ERK) 1/2. The above parameters could be further increased or aggravated by the administration of GdCl 3 , but could be attenuated by injection of NPS-2390. In conclusion, the present results indicate that CaSR activation participates in diabetes-induced testicular damage, implying CaSR may be a potential target for protective strategies against diabetes-induced testicular damage and could help to prevent infertility in diabetic men. PMID:26387585

  2. The calcium-sensing receptor participates in testicular damage in streptozotocin-induced diabetic rats

    PubMed Central

    Kong, Wei-Yuan; Tong, Li-Quan; Zhang, Hai-Jun; Cao, Yong-Gang; Wang, Gong-Chen; Zhu, Jin-Zhi; Zhang, Feng; Sun, Xue-Ying; Zhang, Tie-Hui; Zhang, Lin-Lin


    Male infertility caused by testicular damage is one of the complications of diabetes mellitus. The calcium-sensing receptor (CaSR) is expressed in testicular tissues and plays a pivotal role in calcium homeostasis by activating cellular signaling pathways, but its role in testicular damage induced by diabetes remains unclear. A diabetic model was established by a single intraperitoneal injection of streptozotocin (STZ, 40 mg kg−1) in Wistar rats. Animals then received GdCl3 (an agonist of CaSR, 8.67 mg kg−1), NPS-2390 (an antagonist of CaSR, 0.20 g kg−1), or a combination of both 2 months after STZ injection. Diabetic rats had significantly lower testes weights and serum levels of testosterone compared to healthy rats, indicating testicular damage and dysfunction in STZ-induced diabetic rats. Compared with healthy controls, the testicular tissues of diabetic rats overexpressed the CaSR protein and had higher levels of malondialdehyde (MDA), lower superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity, and higher numbers of apoptotic germ cells. The testicular tissues from diabetic rats also expressed lower levels of Bcl-2 and higher levels of Bax and cleaved caspase-3 in addition to higher phosphorylation rates of c-Jun NH2-terminal protein kinase (JNK), p38, and extracellular signaling-regulated kinase (ERK) 1/2. The above parameters could be further increased or aggravated by the administration of GdCl3, but could be attenuated by injection of NPS-2390. In conclusion, the present results indicate that CaSR activation participates in diabetes-induced testicular damage, implying CaSR may be a potential target for protective strategies against diabetes-induced testicular damage and could help to prevent infertility in diabetic men. PMID:26387585

  3. Denbinobin induces apoptosis by apoptosis-inducing factor releasing and DNA damage in human colorectal cancer HCT-116 cells.


    Chen, Tzu-Hsuan; Pan, Shiow-Lin; Guh, Jih-Hwa; Chen, Chien-Chih; Huang, Yao-Ting; Pai, Hui-Chen; Teng, Che-Ming


    Denbinobin is a phenanthraquinone derivative present in the stems of Ephemerantha lonchophylla. We showed that denbinobin induces apoptosis in human colorectal cancer cells (HCT-116) in a concentration-dependent manner. The addition of a pan-caspase inhibitor (zVAD-fmk) did not suppress the denbinobin-induced apoptotic effect, and denbinobin-induced apoptosis was not accompanied by processing of procaspase-3, -6, -7, -9, and -8. However, denbinobin triggered the translocation of the apoptosis-inducing factor (AIF) from the mitochondria into the nucleus. Small interfering RNA targeting of AIF effectively protected HCT-116 cells against denbinobin-induced apoptosis. Denbinobin treatment also caused DNA damage, activation of the p53 tumor suppressor gene, and upregulation of numerous downstream effectors (p21WAF1/CIP1, Bax, PUMA, and NOXA). A HCT-116 xenograft model demonstrated the in vivo efficacy and low toxicity of denbinobin. Taken together, our findings suggest that denbinobin induces apoptosis of human colorectal cancer HCT-116 cells via DNA damage and an AIF-mediated pathway. These results indicate that denbinobin has potential as a novel anticancer agent. PMID:18607570

  4. Effects of Traumeel (Tr14) on Exercise-Induced Muscle Damage Response in Healthy Subjects: A Double-Blind RCT.


    Muders, Kerstin; Pilat, Christian; Deuster, Vanessa; Frech, Torsten; Krüger, Karsten; Pons-Kühnemann, Jörn; Mooren, Frank-Christoph


    The present double-blind, randomized, placebo-controlled clinical trial intended to test whether ingestion of a natural combination medicine (Tr14 tablets) affects serum muscle damage and inflammatory immune response after downhill running. 96 male subjects received Tr14 tablets, which consist of 14 diluted biological and mineral components, or a placebo for 72 h after the exercise test, respectively. Changes in postexercise levels of various serum muscle damage and immunological markers were investigated. The area under the curve with respect to the increase (AUCi) of perceived pain score and creatine kinase (CK) were defined as primary outcome measures. While for CK the p value of the difference between the two groups is borderline, the pain score and muscle strength were not statistically significant. However, a trend towards lower levels of muscle damage (CK, p = 0.05; LDH, p = 0.06) in the Tr14 group was shown. Less pronounced lymphopenia (p = 0.02), a trend towards a lower expression of CD69 count (p = 0.07), and antigen-stimulated ICAM-1 (p = 0.01) were found in the verum group. The Tr14 group showed a tendentially lower increase of neutrophils (p = 0.10), BDNF (p = 0.03), stem cell factor (p = 0.09), and GM-CSF (p = 0.09) to higher levels. The results of the current study indicate that Tr14 seems to limit exercise-induced muscle damage most likely via attenuation of both innate and adaptive immune responses. This study was registered with (NCT01912469). PMID:27478305

  5. Effects of Traumeel (Tr14) on Exercise-Induced Muscle Damage Response in Healthy Subjects: A Double-Blind RCT

    PubMed Central

    Deuster, Vanessa; Frech, Torsten; Pons-Kühnemann, Jörn; Mooren, Frank-Christoph


    The present double-blind, randomized, placebo-controlled clinical trial intended to test whether ingestion of a natural combination medicine (Tr14 tablets) affects serum muscle damage and inflammatory immune response after downhill running. 96 male subjects received Tr14 tablets, which consist of 14 diluted biological and mineral components, or a placebo for 72 h after the exercise test, respectively. Changes in postexercise levels of various serum muscle damage and immunological markers were investigated. The area under the curve with respect to the increase (AUCi) of perceived pain score and creatine kinase (CK) were defined as primary outcome measures. While for CK the p value of the difference between the two groups is borderline, the pain score and muscle strength were not statistically significant. However, a trend towards lower levels of muscle damage (CK, p = 0.05; LDH, p = 0.06) in the Tr14 group was shown. Less pronounced lymphopenia (p = 0.02), a trend towards a lower expression of CD69 count (p = 0.07), and antigen-stimulated ICAM-1 (p = 0.01) were found in the verum group. The Tr14 group showed a tendentially lower increase of neutrophils (p = 0.10), BDNF (p = 0.03), stem cell factor (p = 0.09), and GM-CSF (p = 0.09) to higher levels. The results of the current study indicate that Tr14 seems to limit exercise-induced muscle damage most likely via attenuation of both innate and adaptive immune responses. This study was registered with (NCT01912469). PMID:27478305

  6. Sodium Selenite Acts as an Otoprotectant against Neomycin-Induced Hair Cell Damage in a Zebrafish Model

    PubMed Central

    Chang, Jiwon; Choi, June; Rah, Yoon Chan; Yoo, Myung Hoon; Oh, Kyoung Ho; Im, Gi Jung; Lee, Seung Hoon; Kwon, Soon Young; Park, Hae-Chul; Chae, Sung Won; Jung, Hak Hyun


    Sodium selenite is a trace element essential for many physiological functions in the body. It is involved in various biological processes; it acts as a cofactor for antioxidant enzymes that protect against free radicals and is reported to limit metal-mediated oxidative DNA damage. In the present study, we investigated the effect of sodium selenite on neomycin ototoxicity in wild-type and transgenic zebrafish (Brn3C: EGFP). Five or six days post-fertilization, zebrafish larvae were co-exposed to 125 μM neomycin and various concentrations (10 μM, 100 μM, 250 μM, and 500 μM) of sodium selenite for 1 h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy (n = 10 fish per treatment). Hair cell survival was estimated as the ratio of the hair cell numbers in each group compared to those of the control group that were not exposed to neomycin. Apoptosis and hair cell damage of neuromasts were evaluated using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide (DASPEI) assay, respectively. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Neuromast hair cells were preserved in zebrafish exposed to 125 μM neomycin and 500 μM sodium selenite for 1 h. Sodium selenite protected against neomycin-induced hair cell loss of neuromasts, reduced apoptosis, and prevented zebrafish ultrastructural changes. We propose that sodium selenite protects against neomycin-induced hair cell damage by inhibiting apoptosis, decreasing the disarray of stereocilia, and preventing ultrastructural changes in the neuromast hair cells of the zebrafish. PMID:26974429

  7. Role of mitochondria, ROS, and DNA damage in arsenic induced carcinogenesis.


    Lee, Chih-Hung; Yu, Hsin-Su


    The International Agency for Research on Cancer (IARC) declared arsenic a class I carcinogen. Arsenic exposure induces several forms of human cancers, including cancers of skin, lung, liver, and urinary bladder. The majority of the arsenic-induced cancers occur in skin. Among these, the most common is Bowen's disease, characterized by epidermal hyperplasia, full layer epidermal dysplasia, leading to intraepidermal carcinoma as well as apoptosis, and moderate dermal infiltrates, which require the participation of mitochondria. The exact mechanism underlying arsenic induced carcinogenesis remains unclear, although increased reactive oxidative stresses, leading to chromosome abnormalities and uncontrolled growth, and aberrant immune regulations might be involved. Here, we highlight how increased mitochondrial biogenesis and oxidative stress lead to mitochondrial DNA damage and mutation in arsenic induced cancers. We also provide therapeutic rationale for targeting mitochondria in the treatment of arsenic induced cancers. PMID:27100709

  8. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    PubMed Central

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A.


    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting. PMID:25099886

  9. Piperlongumine induces pancreatic cancer cell death by enhancing reactive oxygen species and DNA damage

    PubMed Central

    Dhillon, Harsharan; Chikara, Shireen; Reindl, Katie M.


    Pancreatic cancer is one of the most deadly cancers with a nearly 95% mortality rate. The poor response of pancreatic cancer to currently available therapies and the extremely low survival rate of pancreatic cancer patients point to a critical need for alternative therapeutic strategies. The use of reactive oxygen species (ROS)-inducing agents has emerged as an innovative and effective strategy to treat various cancers. In this study, we investigated the potential of a known ROS inducer, piperlongumine (PPLGM), a bioactive agent found in long peppers, to induce pancreatic cancer cell death in cell culture and animal models. We found that PPLGM inhibited the growth of pancreatic cancer cell cultures by elevating ROS levels and causing DNA damage. PPLGM-induced DNA damage and pancreatic cancer cell death was reversed by treating the cells with an exogenous antioxidant. Similar to the in vitro studies, PPLGM caused a reduction in tumor growth in a xenograft mouse model of human pancreatic cancer. Tumors from the PPLGM-treated animals showed decreased Ki-67 and increased 8-OHdG expression, suggesting PPLGM inhibited tumor cell proliferation and enhanced oxidative stress. Taken together, our results show that PPLGM is an effective inhibitor for in vitro and in vivo growth of pancreatic cancer cells, and that it works through a ROS-mediated DNA damage pathway. These findings suggest that PPLGM has the potential to be used for treatment of pancreatic cancer. PMID:25530945

  10. Dexamethasone and betamethasone protect against LPS-induced brain damage in the neonatal rats

    PubMed Central

    Pang, Yi; Fan, Lir-Wan; Zheng, Baoying; Campbell, Leigh R.; Cai, Zhengwei; Rhodes, Philip G.


    The aim of this study is to test whether dexamethasone (Dex) and betamethasone (Beta), two of the most commonly used corticosteroids, protect against lipopolysaccharide (LPS)-induced white matter damage and neurobehavioral dysfunction. LPS or sterile saline was injected into the brain white matter of rat pups at postnatal day 5 (P5) and Dex or Beta was given intraperitoneally to the rat pups 1 h before the LPS microinjection. Brain inflammatory response, brain damage, and myelination were examined at P6, P8 and P14. Neurobehavioral tests were performed from P3 through P22. Our results demonstrate that Dex and Beta markedly diminish the LPS-induced brain inflammatory response, restore myelin basic protein (MBP) expression and alleviate lateral ventricle dilation. Both corticosteroids demonstrate significant protection against most of LPS-induced behavioral deficits, including those in rearing, vibrissa-elicited forelimb-placing, beam walking, learning and elevated plus-maze test. Notably, only Beta improved the locomotion and stereotype dysfunction. In contrast to their beneficial effects, neither drug prevented LPS-induced delay in body weight gain from P6 through P21. Our study suggests that if their adverse effects are minimized, corticosteroids may be the potential candidate drugs to prevent brain damage in premature infants. PMID:22314662

  11. Effects of chronic normovolemic anemia on gastric microcirculation and ethanol-induced gastric damage in rats.


    Marroni, N; Casadevall, M; Panés, J; Piera, C; Jou, J M; Pique, J M


    The effects of chronic normovolemic anemia on gastric microcirculation and gastric mucosal susceptibility to ethanol-induced gastric damage were investigated in anesthetized rats. Blood exchange by a plasma expander during four consecutive days rendered the animals anemic with a 34% decrease in the baseline hematocrit but without affecting blood volume. Chronic anemia induced a decrease in whole blood viscosity, an increase in g