Sample records for biological damage induced

  1. Mechanisms of Microwave Induced Damage in Biologic Materials

    DTIC Science & Technology


    Activities and Microwave Exposures Ornithine decarboxylase (ODC), an enzyme involved in the production of the polyamines putrescine and spermidine, has...f 0 0 Mechanisms of Microwave Induced N Damage in Biologic Materials I ,<DTIC .. E LECTEI I Annual Report S FEB08 1990 U January, 1989 m D EFFECTS OF...Clasufication) (U) Mechanisms of Microwave Induced Damage in Biologic Materials I 12. PERSONAL AUTHOR(S) .3a. TYPE OF REPORT 13b. TIME COVERED 14

  2. Early mechanisms in radiation-induced biological damage

    SciTech Connect

    Powers, E.L.


    An introduction to the mechanisms of radiation action in biological systems is presented. Several questions about the nature of the radiation damage process are discussed, including recognition of the oxygen effects, dose-response relationships, and the importance of the hydroxyl radical. (ACR)

  3. Mechanisms of Microwave Induced Damage in Biologic Materials

    DTIC Science & Technology


    246, 1978. [6] F. Oosawa, Polyelectrolytes, Marcel Dekker, New York, 88, 1971. (7] Z. Alexandrowics, A. Katchalsky, " Colligative properties of...condensation in polyelectrolyte solutions: I. Colligative properties ", The Journal of Chemical Physics, 51, 924-933, 1969. e3 CAPTER IV EXPERIMENTAL BIOLOGICAL...exogenously applied electromagnetic fields on certain measured properties of a biological system is a transient one. 1,203,4 The system’s response, determined

  4. Modeling electrical power absorption and thermally-induced biological tissue damage.


    Zohdi, T I


    This work develops a model for thermally induced damage from high current flow through biological tissue. Using the first law of thermodynamics, the balance of energy produced by the current and the energy absorbed by the tissue are investigated. The tissue damage is correlated with an evolution law that is activated upon exceeding a temperature threshold. As an example, the Fung material model is used. For certain parameter choices, the Fung material law has the ability to absorb relatively significant amounts of energy, due to its inherent exponential response character, thus, to some extent, mitigating possible tissue damage. Numerical examples are provided to illustrate the model's behavior.

  5. Effects of carotenoids on damage of biological lipids induced by gamma irradiation

    NASA Astrophysics Data System (ADS)

    Saito, Takeshi; Fujii, Noriko


    Carotenoids are considered to be involved in the radioresistant mechanisms of radioresistant bacteria. In these bacterial cells, carotenoids are present in biological lipids, and therefore may be related to the radiation-induced damage of lipids. However, only limited data are available for the role of carotenoids in such damage. In this study, we irradiated an α-linolenic acid-benzene solution with gamma rays and analyzed the resulting oxidative degradation and peroxidation damage in the presence or absence of two typical carotenoids: β-carotene and astaxanthin. The analyses revealed that oxidative degradation and peroxidation of α-linolenic acid, as evaluated by the amount of malondialdehyde and conjugated diene formed, respectively, increased in a dose-dependent manner. Moreover, 8.5×10-3 M β-carotene inhibited gamma radiation-induced oxidative degradation of α-linolenic acid, whereas 5.0×10-5 and 5.0×10-6 M β-carotene, and 5.0×10-7 and 5.0×10-8 M astaxanthin promoted degradation. In contrast, neither β-carotene nor astaxanthin affected peroxidation of α-linolenic acid. These results suggest that an optimum concentration of carotenoids in radioresistant bacteria protects biological lipid structures from radiation-induced damage.

  6. Wavelength dependence of biological damage induced by UV radiation on bacteria.


    Santos, Ana L; Oliveira, Vanessa; Baptista, Inês; Henriques, Isabel; Gomes, Newton C M; Almeida, Adelaide; Correia, António; Cunha, Ângela


    The biological effects of UV radiation of different wavelengths (UVA, UVB and UVC) were assessed in nine bacterial isolates displaying different UV sensitivities. Biological effects (survival and activity) and molecular markers of oxidative stress [DNA strand breakage (DSB), generation of reactive oxygen species (ROS), oxidative damage to proteins and lipids, and the activity of antioxidant enzymes catalase and superoxide dismutase] were quantified and statistically analyzed in order to identify the major determinants of cell inactivation under the different spectral regions. Survival and activity followed a clear wavelength dependence, being highest under UVA and lowest under UVC. The generation of ROS, as well as protein and lipid oxidation, followed the same pattern. DNA damage (DSB) showed the inverse trend. Multiple stepwise regression analysis revealed that survival under UVA, UVB and UVC wavelengths was best explained by DSB, oxidative damage to lipids, and intracellular ROS levels, respectively.

  7. Biological damage induced by ionizing cosmic rays in dry Arabidopsis seeds.


    Kranz, A R; Bork, U; Bucker, H; Reitz, G


    In September 1987 dry seeds containing embryos of the crucifer plant Arabidopsis thaliana (L.) Heynh, were flown in orbit for 13 days on the Kosmos 1887 satellite. The seeds were fixed on CNd detectors and stored in units of Biorack type I/O. One unit was exposed inside, another one outside the satellite. The temperature profile of the flown seeds inside the satellite was simulated on earth in an identical backup control sample (BC). An additional control (SC) was studied with the original seeds sample. By use of the CNd-detector, HZE-tracks were measured with a PC-assisted microscope. The biological damages were investigated by growing the seeds under controlled climatic conditions. The following biological endpoints of the cosmic radiation damage were studied: germination, radicle length, sublethality, morphological aberrations, flower development, tumorization, embryo lethality inside the siliques. The summarized damage (D) and the mutation frequencies of embyronic lethal genes were calculated. The following results were obtained: the damages increase significantly in orbit at all biological endpoints; germination and fiowerings especially, as well as embryo lethality of fruits and lethal mutation frequency, were maximum mostly for HZE-hit seeds. Additionally, an increase of damage was observed for the seeds of the outside-exposed Biorack in comparison to the inside ones, which was probably caused by less radiation shielding and free space vacuum. The significance of the results obtained is discussed with respect to stress and risk and, thus, the quality of the RBE-factors and heavy ionizing radiation all needed for the very definition of radiation protection standards in space.

  8. Role of cellular communication in the pathways of radiation-induced biological damage

    NASA Astrophysics Data System (ADS)

    Ballarini, Francesca; Facoetti, Angelica; Mariotti, Luca; Nano, Rosanna; Ottolenghi, Andrea

    During the last decade, a large number of experimental studies on the so-called "non-targeted effects", in particular bystander effects, outlined that cellular communication plays a signifi- cant role in the pathways leading to radiation-induced biological damage. This might imply a paradigm shift in (low-dose) radiobiology, according to which one has to consider the response of groups of cells behaving like a population rather than single cells behaving as individuals. Furthermore, bystander effects, which are observed both for lethal endpoints (e.g. clonogenic inactivation and apoptosis) and for non-lethal ones (e.g. mutations and neoplastic transformation), tend to show non-linear dose responses characterized by a sharp increase followed by a plateau. This might have significant consequences in terms of low-dose risk, which is generally calculated on the basis of the "Linear No Threshold" hypothesis. Although it is known that two types of cellular communication (i.e. via gap junctions and/or molecular messengers diffusing in the extra-cellular environment, such as cytokines) play a major role, it is of utmost importance to better understand the underlying mechanisms, and how such mechanisms can be modulated by ionizing radiation. Though the "final" goal is to elucidate the in vivo scenario, in the meanwhile also in vitro studies can provide useful insights. In the present paper we will discuss key issues on the mechanisms underlying non-targeted effects and, more generally, cell communication, with focus on candidate molecular signals. Theoretical models and simulation codes can be of help in elucidating such mechanisms. In this framework, we will present a model and Monte Carlo code, under development at the University of Pavia, simulating the release, diffusion and internalization of candidate signals (typically cytokines) travelling in the extra-cellular environment, both by unirradiated (i.e., control) cells and by irradiated cells. The focus will be on the

  9. Radiation-induced DNA damage and the relative biological effectiveness of 18F-FDG in wild-type mice


    Taylor, Kristina; Lemon, Jennifer A.; Boreham, Douglas R.


    Clinically, the most commonly used positron emission tomography (PET) radiotracer is the glucose analog 2-[18F] fluoro-2-deoxy-d-glucose (18F-FDG), however little research has been conducted on the biological effects of 18F-FDG injections. The induction and repair of DNA damage and the relative biological effectiveness (RBE) of radiation from 18F-FDG relative to 662 keV γ-rays were investigated. The study also assessed whether low-dose radiation exposure from 18F-FDG was capable of inducing an adaptive response. DNA damage to the bone marrow erythroblast population was measured using micronucleus formation and lymphocyte γH2A.X levels. To test the RBE of 18F-FDG, mice were injected with a rangemore » of activities of 18F-FDG (0–14.80 MBq) or irradiated with Cs-137 γ-rays (0–100 mGy). The adaptive response was investigated 24 h after the 18F-FDG injection by 1 Gy in vivo challenge doses for micronucleated reticulocyte (MN-RET) formation or 1, 2 and 4 Gy in vitro challenges doses for γH2A.X formation. A significant increase in MN-RET formation above controls occurred following injection activities of 3.70, 7.40 or 14.80 MBq (P < 0.001) which correspond to bone marrow doses of ~35, 75 and 150 mGy, respectively. Per unit dose, the Cs-137 radiation exposure induced significantly more damage than the 18F-FDG injections (RBE = 0.79 ± 0.04). A 20% reduction in γH2A.X fluorescence was observed in mice injected with a prior adapting low dose of 14.80 MBq 18F-FDG relative to controls (P < 0.019). A 0.74 MBq 18F-FDG injection, which gives mice a dose approximately equal to a typical human PET scan, did not cause a significant increase in DNA damage nor did it generate an adaptive response. Typical 18F-FDG injection activities used in small animal imaging (14.80 MBq) resulted in a decrease in DNA damage, as measured by γH2A.X formation, below spontaneous levels observed in control mice. Lastly, the 18F-FDG RBE was <1.0, indicating that the mixed radiation quality

  10. Laser-induced damage in biological tissue: Role of complex and dynamic optical properties of the medium

    NASA Astrophysics Data System (ADS)

    Ahmed, Elharith M.

    Since its invention in the early 1960's, the laser has been used as a tool for surgical, therapeutic, and diagnostic purposes. To achieve maximum effectiveness with the greatest margin of safety it is important to understand the mechanisms of light propagation through tissue and how that light affects living cells. Lasers with novel output characteristics for medical and military applications are too often implemented prior to proper evaluation with respect to tissue optical properties and human safety. Therefore, advances in computational models that describe light propagation and the cellular responses to laser exposure, without the use of animal models, are of considerable interest. Here, a physics-based laser-tissue interaction model was developed to predict the spatial and temporal temperature and pressure rise during laser exposure to biological tissues. Our new model also takes into account the dynamic nature of tissue optical properties and their impact on the induced temperature and pressure profiles. The laser-induced retinal damage is attributed to the formation of microbubbles formed around melanosomes in the retinal pigment epithelium (RPE) and the damage mechanism is assumed to be photo-thermal. Selective absorption by melanin creates these bubbles that expand and collapse around melanosomes, destroying cell membranes and killing cells. The Finite Element (FE) approach taken provides suitable ground for modeling localized pigment absorption which leads to a non-uniform temperature distribution within pigmented cells following laser pulse exposure. These hot-spots are sources for localized thermo-elastic stresses which lead to rapid localized expansions that manifest themselves as microbubbles and lead to microcavitations. Model predictions for the interaction of lasers at wavelengths of 193, 694, 532, 590, 1314, 1540, 2000, and 2940 nm with biological tissues were generated and comparisons were made with available experimental data for the retina

  11. DNA Damage Induced Neuronal Death

    DTIC Science & Technology


    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  12. Radiation-induced DNA damage and the relative biological effectiveness of 18F-FDG in wild-type mice

    SciTech Connect

    Taylor, Kristina; Lemon, Jennifer A.; Boreham, Douglas R.


    Clinically, the most commonly used positron emission tomography (PET) radiotracer is the glucose analog 2-[18F] fluoro-2-deoxy-d-glucose (18F-FDG), however little research has been conducted on the biological effects of 18F-FDG injections. The induction and repair of DNA damage and the relative biological effectiveness (RBE) of radiation from 18F-FDG relative to 662 keV γ-rays were investigated. The study also assessed whether low-dose radiation exposure from 18F-FDG was capable of inducing an adaptive response. DNA damage to the bone marrow erythroblast population was measured using micronucleus formation and lymphocyte γH2A.X levels. To test the RBE of 18F-FDG, mice were injected with a range of activities of 18F-FDG (0–14.80 MBq) or irradiated with Cs-137 γ-rays (0–100 mGy). The adaptive response was investigated 24 h after the 18F-FDG injection by 1 Gy in vivo challenge doses for micronucleated reticulocyte (MN-RET) formation or 1, 2 and 4 Gy in vitro challenges doses for γH2A.X formation. A significant increase in MN-RET formation above controls occurred following injection activities of 3.70, 7.40 or 14.80 MBq (P < 0.001) which correspond to bone marrow doses of ~35, 75 and 150 mGy, respectively. Per unit dose, the Cs-137 radiation exposure induced significantly more damage than the 18F-FDG injections (RBE = 0.79 ± 0.04). A 20% reduction in γH2A.X fluorescence was observed in mice injected with a prior adapting low dose of 14.80 MBq 18F-FDG relative to controls (P < 0.019). A 0.74 MBq 18F-FDG injection, which gives mice a dose approximately equal to a typical human PET scan, did not cause a significant increase in DNA damage nor did it generate an adaptive response. Typical 18F-FDG injection activities used in small animal imaging (14.80 MBq) resulted in a decrease in DNA damage, as measured by γH2A.X formation

  13. Damage to biological tissues induced by radical initiator 2,2'-azobis(2-amidinopropane) dihydrochloride and its inhibition by chain-breaking antioxidants.


    Terao, K; Niki, E


    A water-soluble azo compound, 2,2'-azobis(2-amidinopropane) dihydrochloride, a well-known free radical initiator, was administered intraperitoneally to mice to study the toxicological effects on biological tissues in vivo and their inhibition by chain-breaking antioxidants. It caused damage to biological tissues without biotransformation. No specific target organ was observed. The most striking fine structural changes were the degeneration, swelling, and disruption of the endothelium lining cells of the capillaries in various organs. Furthermore, the death of lymphocytes in the lymphoid tissues and the fatty degeneration of the liver and kidneys have also been observed. Water-soluble chain-breaking antioxidants, such as 2-carboxy-2,5,7,8-tetramethyl-6-chromanol (a vitamin E analogue), uric acid, cysteine, and glutathione suppressed the above damage, whereas vitamin C was ineffective.

  14. Chemistry and Structural Biology of DNA Damage and Biological Consequences

    PubMed Central

    Stone, Michael P.; Huang, Hai; Brown, Kyle L.; Shanmugam, Ganesh


    The formation of adducts by the reaction of chemicals with DNA is a critical step for the initiation of carcinogenesis. The structural analysis of various DNA adducts reveals that conformational and chemical rearrangements and interconversions are a common theme. Conformational changes are modulated both by the nature of adduct and the base sequences neighboring the lesion sites. Equilibria between conformational states may modulate both DNA repair and error-prone replication past these adducts. Likewise, chemical rearrangements of initially formed DNA adducts are also modulated both by the nature of adducts and the base sequences neighboring the lesion sites. In this review, we focus on DNA damage caused by a number of environmental and endogenous agents, and biological consequences. PMID:21922653

  15. Effect of polishing induced subsurface damages on laser induced damage in fused silica optics

    NASA Astrophysics Data System (ADS)

    He, Xiang; Zhao, Heng; Huang, Ying; Cai, Chao; Hu, JiangChuan; Ma, Ping


    Conventional used ceria polishing would induce both of Ce contaminants and subsurface damages, which mainly restricts the laser induced damage resistance of fused silica optics. To control the near surface defects, nanometer sized colloidal silica are used to polish fused silica optics after the normal ceria polishing process. Then the contaminant elements and subsurface damages of the polished samples were analyzed by secondary ion mass spectrometry and Nomarski microscopy. It reveals that ceria polishing would introduce lots of subsurface damages whereas colloidal silica polishing induces much fewer subsurface damages especially no fracture induced severe subsurface damages. The laser damage tests reveal that subsequent colloidal silica polishing of the ceria pre-polished samples could gradually eliminate the ceria polishing induced subsurface damages and lower the laser induced damage density accordingly with the increased polishing time. But unlike the damage density, only the severe subsurface damages are totally eliminated could the damage threshold be substantially improved. These results incline to indicate that the subsurface damages have great influence on the laser induced damage density and the fracture related severe subsurface damages will greatly restrict the damage threshold in polished optics.

  16. The loss of ATP2C1 impairs the DNA damage response and induces altered skin homeostasis: Consequences for epidermal biology in Hailey-Hailey disease

    PubMed Central

    Cialfi, Samantha; Le Pera, Loredana; De Blasio, Carlo; Mariano, Germano; Palermo, Rocco; Zonfrilli, Azzurra; Uccelletti, Daniela; Palleschi, Claudio; Biolcati, Gianfranco; Barbieri, Luca; Screpanti, Isabella; Talora, Claudio


    Mutation of the Golgi Ca2+-ATPase ATP2C1 is associated with deregulated calcium homeostasis and altered skin function. ATP2C1 mutations have been identified as having a causative role in Hailey-Hailey disease, an autosomal-dominant skin disorder. Here, we identified ATP2C1 as a crucial regulator of epidermal homeostasis through the regulation of oxidative stress. Upon ATP2C1 inactivation, oxidative stress and Notch1 activation were increased in cultured human keratinocytes. Using RNA-seq experiments, we found that the DNA damage response (DDR) was consistently down-regulated in keratinocytes derived from the lesions of patients with Hailey-Hailey disease. Although oxidative stress activates the DDR, ATP2C1 inactivation down-regulates DDR gene expression. We showed that the DDR response was a major target of oxidative stress-induced Notch1 activation. Here, we show that this activation is functionally important because early Notch1 activation in keratinocytes induces keratinocyte differentiation and represses the DDR. These results indicate that an ATP2C1/NOTCH1 axis might be critical for keratinocyte function and cutaneous homeostasis, suggesting a plausible model for the pathological features of Hailey-Hailey disease. PMID:27528123

  17. DNA damage and biological effects induced by photosensitization with new N(1)-unsubstituted furo[2,3-h]quinolin-2(1H)-ones.


    Marzano, Cristina; Chilin, Adriana; Bordin, Franco; Baccichetti, Francarosa; Guiotto, Adriano


    New furoquinolinones unsubstituted at the N(1) position were prepared and their photobiological activities were studied in comparison with 4,6,8,9-tetramethylfuro[2,3-h]quinolin-2(1H)-one (HFQ) and 8-MOP. The anti-proliferative activity of furoquinolinones 3a-f was tested upon UVA irradiation in mammalian cells, studying DNA synthesis and clonal growth capacity, and in micro-organisms, evaluating T2 infectivity. Almost all compounds appeared to be more active than 8-MOP, and free of any mutagenic activity and skin phototoxicity. Among them, compound 3b was the most effective one. Similarly to HFQ, compound 3b appeared to be very active also in DNA damaging, forming monoadducts and DPC(L=0), but no ISC and DPC(L>0), both responsible for furocoumarin genotoxicity and phototoxicity. Moreover, Ehrlich ascites cells, photoinactivated by the new furoquinolinone 3b and injected into recipient mice, proved to be capable of inducing protection against a successive challenge performed with the same tumor cells. For all these features, 3b seemed to be a new promising potential drug for PUVA therapy and photopheresis.

  18. Quantifying pulsed laser induced damage to graphene

    SciTech Connect

    Currie, Marc; Caldwell, Joshua D.; Bezares, Francisco J.; Robinson, Jeremy; Anderson, Travis; Chun, Hayden; Tadjer, Marko


    As an emerging optical material, graphene's ultrafast dynamics are often probed using pulsed lasers yet the region in which optical damage takes place is largely uncharted. Here, femtosecond laser pulses induced localized damage in single-layer graphene on sapphire. Raman spatial mapping, SEM, and AFM microscopy quantified the damage. The resulting size of the damaged area has a linear correlation with the optical fluence. These results demonstrate local modification of sp{sup 2}-carbon bonding structures with optical pulse fluences as low as 14 mJ/cm{sup 2}, an order-of-magnitude lower than measured and theoretical ablation thresholds.

  19. Blood-Induced Joint Damage

    PubMed Central

    Roosendaal, Goris; Jansen, Nathalie W.D.; Lafeber, Floris P.J.G.; Mastbergen, Simon C.


    Objective. Four days of blood exposure leads to irreversible cartilage damage in vitro. In contrast, intermittent intra-articular blood injections twice a week during 4 weeks (mimicking micro-bleeds) in a canine model resulted in transient damage only. In this study, it was evaluated whether acute joint bleeds are more harmful than micro-bleeds in a canine model of knee arthropathy. Design. Seven dogs received 4 sequential daily intra-articular blood injections twice in 2 weeks (mimicking 2 acute 4-day joint bleeds). Seven other dogs received the same blood load but in a total of 8 injections intermittently over the 4-week period with at least 1 day in between (mimicking micro-bleeds over the same timespan). Contralateral knees served as controls. Ten weeks after the last injection cartilage matrix turnover and synovial inflammation were evaluated. Results. Only after the acute joint bleeds the release of newly formed and total (resident) cartilage matrix glycosaminoglycans were increased (P = 0.04 and P = 0.01, respectively). Furthermore, in animals with the acute joint bleeds cartilage glycosaminoglycan content was decreased (P = 0.01) and not in animals with micro-bleeds. Mild synovial inflammation was observed in both groups (both P < 0.0001) but was not different between groups. Conclusions. In contrast to micro-bleeds, 2 acute joint bleeds lead to prolonged cartilage damage independent of the level of synovial inflammation. This model suggests that micro-bleeds are less devastating than acute joint bleeds with respect to joint damage, which might be of relevance to treatment of joint bleeds in clinical practice. PMID:26069675


    ERIC Educational Resources Information Center



  1. Autophagy in light-induced retinal damage

    PubMed Central

    Chen, Yu; Perusek, Lindsay; Maeda, Akiko


    Vision is reliant upon converting photon signals to electrical information which is interpreted by the brain and therefore allowing us to receive information about our surroundings. However, when exposed to excessive light, photoreceptors and other types of cells in the retina can undergo light-induced cell death, termed light-induced retinal damage. In this review, we summarize our current knowledge regarding molecular events in the retina after excessive light exposure and mechanisms of light-induced retinal damage. We also introduce works which investigate potential roles of autophagy, an essential cellular mechanism required for maintaining homeostasis under stress conditions, in the illuminated retina and animal models of light-induced retinal damage. PMID:26325327

  2. Autophagy in light-induced retinal damage.


    Chen, Yu; Perusek, Lindsay; Maeda, Akiko


    Vision is reliant upon converting photon signals to electrical information which is interpreted by the brain and therefore allowing us to receive information about our surroundings. However, when exposed to excessive light, photoreceptors and other types of cells in the retina can undergo light-induced cell death, termed light-induced retinal damage. In this review, we summarize our current knowledge regarding molecular events in the retina after excessive light exposure and mechanisms of light-induced retinal damage. We also introduce works which investigate potential roles of autophagy, an essential cellular mechanism required for maintaining homeostasis under stress conditions, in the illuminated retina and animal models of light-induced retinal damage.

  3. Multiomic Analysis of the UV-Induced DNA Damage Response.


    Boeing, Stefan; Williamson, Laura; Encheva, Vesela; Gori, Ilaria; Saunders, Rebecca E; Instrell, Rachael; Aygün, Ozan; Rodriguez-Martinez, Marta; Weems, Juston C; Kelly, Gavin P; Conaway, Joan W; Conaway, Ronald C; Stewart, Aengus; Howell, Michael; Snijders, Ambrosius P; Svejstrup, Jesper Q


    In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.

  4. DNA damage induced by 4,6,8,9-tetramethyl-2H-furo[2,3-h]quinolin-2-one, a new furocoumarin analog: biological consequences.


    Marzano, C; Baccichetti, F; Carlassare, F; Chilin, A; Lora, S; Bordin, F


    4,6,8,9-Tetramethyl-2H-furo[2,3-h]quinolin-2-one (HFQ) and its isomer FQ (1,4,6,8-tetramethyl-2H-furo[2,3-h]quinolin-2-one) showed very strong antiproliferative activity in mammalian cells, about two times greater than 8-methoxypsoralen (8-MOP). Both compounds induced DNA-protein cross-links (DPC) but not interstrand cross-links. The FQ generated DPC in a biphotonic process, yielding a new kind of diadduct, whereas HFQ induced DPC by a monophotonic one, probably without its physical participation in the covalent bridge. These lesions gave different toxic responses. Sensitization of FQ led to extensive DNA fragmentation and to a number of chromosomal aberrations. Conversely, HFQ seemed to be completely inactive and 8-MOP gave intermediate results. A strict relationship between DPC formation and induction of chromosomal aberrations was observed. The HFQ did not induce light skin erythemas, whereas FQ was more phototoxic than 8-MOP, thus suggesting that FQ lesions, DPC in particular, may be implicated in skin phototoxicity. Ehrlich ascites cells, a transplantable mouse tumor, inactivated by furoquinolinone sensitization and injected into healthy mice, protected them from a successive challenge by viable tumor cells. This response appeared to be based on an immune mechanism. Comparable amounts of base substitution revertants were scored when testing furoquinolinones and 8-MOP in bacteria but no DPC were detected. This suggests that classic mutagenesis tests on bacteria are insufficient to give adequate information on furocoumarin genotoxicity. Given its features, HFQ can be regarded as an interesting new agent for psoralen plus UVA photochemotherapy and photopheresis.

  5. Chemical genoprotection: reducing biological damage to as low as reasonably achievable levels

    PubMed Central

    Alcaraz, M; Armero, D; Martínez-Beneyto, Y; Castillo, J; Benavente-García, O; Fernandez, H; Alcaraz-Saura, M; Canteras, M


    Objectives The aim of this study was to evaluate the antioxidant substances present in the human diet with an antimutagenic protective capacity against genotoxic damage induced by exposure to X-rays in an attempt to reduce biological damage to as low a level as reasonably possible. Methods Ten compounds were assessed using the lymphocyte cytokinesis-block micronucleus (MN) cytome test. The compounds studied were added to human blood at 25 μM 5 min before exposure to irradiation by 2 Gy of X-rays. Results The protective capacity of the antioxidant substances assessed was from highest to lowest according to the frequency of the MN generated by X-ray exposure: rosmarinic acid = carnosic acid = δ-tocopherol = l-acid ascorbic = apigenin = amifostine (P < 0.001) > green tea extract = diosmine = rutin = dimetylsulfoxide (P < 0.05) > irradiated control. The reduction in genotoxic damage with the radiation doses administered reached 58%, which represents a significant reduction in X-ray-induced chromosomal damage (P < 0.001). This degree of protection is greater than that obtained with amifostine, a radioprotective compound used in radiotherapy and which is characterised by its high toxicity. Conclusion Several antioxidant substances, common components of the human diet and lacking toxicity, offer protection from the biological harm induced by ionizing radiation. Administering these protective substances to patients before radiological exploration should be considered, even in the case of small radiation doses and regardless of the biological damage expected. PMID:21697157

  6. Non-Problematic Risks from Low-Dose Radiation-Induced DNA Damage Clusters

    PubMed Central

    Hayes, Daniel P.


    Radiation-induced DNA damage clusters have been proposed and are usually considered to pose the threat of serious biological damage. This has been attributed to DNA repair debilitation or cessation arising from the complexity of cluster damage. It will be shown here, contrary to both previous suggestions and perceived wisdom, that radiation induced damage clusters contribute to non-problematic risks in the low-dose, low-LET regime. The very complexity of cluster damage which inhibits and/or compromises DNA repair will ultimately be responsible for the elimination and/or diminution of precancer-ous and cancerous cells. PMID:18648573

  7. LET analyses of biological damage during solar particle events

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Wilson, John W.; Townsend, Lawrence W.; Shinn, Judy L.; Katz, Robert


    The effects of nuclear reactions on integral low-linear-energy-transfer (LET) protons spectra are studied, behind typical levels of spacecraft and body shielding, for the historically largest flares using the high-energy transport code BRYNTRN in conjunction with several biological damage models. The cellular track model of Katz provides an accurate description of cellular damage from heavy ion exposure. The track model is applied with BRYNTRN to provide a LET decomposition of survival and transformation rates for solar proton events. In addition, a fluence-based risk coefficient formalism is used to estimate Harderian gland-tumor induction in rodents and cataractogenesis in rabbits from solar flares, and a LET analysis is used to assess the relative contribution from target fragments on these biological endpoints.

  8. Laser-Induced Damage of Calcium Fluoride

    SciTech Connect

    Espana, A.; Joly, A.G.; Hess, W.P.; Dickinson, J.T.


    As advances continue to be made in laser technology there is an increasing demand for materials that have high thresholds for laser-induced damage. Laser damage occurs when light is absorbed, creating defects in the crystal lattice. These defects can lead to the emission of atoms, ions and molecules from the sample. One specific field where laser damage is of serious concern is semiconductor lithography, which is beginning to use light at a wavelength of 157 nm. CaF2 is a candidate material for use in this new generation of lithography. In order to prevent unnecessary damage of optical components, it is necessary to understand the mechanisms for laser damage and the factors that serve to enhance it. In this research, we study various aspects of laser interactions with CaF2, including impurity absorbance and various forms of damage caused by incident laser light. Ultraviolet (UV) laser light at 266 nm with both femtosecond (fs) and nanosecond (ns) pulse widths is used to induce ion and neutral particle emission from cleaved samples of CaF2. The resulting mass spectra show significant differences suggesting that different mechanisms for desorption occur following excitation using the different pulse durations. Following irradiation by ns pulses at 266 nm, multiple single-photon absorption from defect states is likely responsible for ion emission whereas the fs case is driven by a multi-photon absorption process. This idea is further supported by the measurements made of the transmission and reflection of fs laser pulses at 266 nm, the results of which reveal a non-linear absorption process in effect at high incident intensities. In addition, the kinetic energy profiles of desorbed Ca and K contaminant atoms are different indicating that a different mechanism is responsible for their emission as well. Overall, these results show that purity plays a key role in the desorption of atoms from CaF2 when using ns pulses. On the other hand, once the irradiance reaches high

  9. Initial Biological Damage from Space Radiation: Implications for Development of Biological Countermeasures

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Paloski, William H. (Technical Monitor)


    Astronauts are exposed to high-energy nuclear particles originating from the galactic cosmic rays, high-energy protons trapped in the Earth's magnetic field or solar particle events, and secondary radiation produced by nuclear reactions. Important differences between conventional radiation including X-rays or gamma-rays, and high-energy nuclei occur at the level of initial damage to DNA and other potential biological target molecules, and to tissues. Such differences include a large fraction of the initial damage from high charge and energy (HZE) nuclear particles manifested as irreparable lesions including small- and large-scale DNA deletions. Also, low dose-rate exposures in space result in a heterogeneous population of damaged cells distinct from energetic photon irradiation of tissue. We present an overview of the initial biological damage and dose and dose-rate effects produced by ionizing radiation using track structure and nuclear reaction models. Implications of the differences in cellular and tissue damage between conventional radiation and space radiation for the development of biological countermeasures are discussed.

  10. Correlation of polishing-induced shallow subsurface damages with laser-induced gray haze damages in fused silica optics

    NASA Astrophysics Data System (ADS)

    He, Xiang; Zhao, Heng; Wang, Gang; Zhou, Peifan; Ma, Ping


    Laser-induced damage in fused silica optics greatly restricts the performances of laser facilities. Gray haze damage, which is always initiated on ceria polished optics, is one of the most important damage morphologies in fused silica optics. In this paper, the laser-induced gray haze damages of four fused silica samples polished with CeO2, Al2O3, ZrO2, and colloidal silica slurries are investigated. Four samples all present gray haze damages with much different damage densities. Then, the polishing-induced contaminant and subsurface damages in four samples are analyzed. The results reveal that the gray haze damages could be initiated on the samples without Ce contaminant and are inclined to show a tight correlation with the shallow subsurface damages.

  11. WE-DE-202-03: Modeling of Biological Processes - What Happens After Early Molecular Damage?


    McMahon, S


    Radiation therapy for the treatment of cancer has been established as a highly precise and effective way to eradicate a localized region of diseased tissue. To achieve further significant gains in the therapeutic ratio, we need to move towards biologically optimized treatment planning. To achieve this goal, we need to understand how the radiation-type dependent patterns of induced energy depositions within the cell (physics) connect via molecular, cellular and tissue reactions to treatment outcome such as tumor control and undesirable effects on normal tissue. Several computational biology approaches have been developed connecting physics to biology. Monte Carlo simulations are the most accurate method to calculate physical dose distributions at the nanometer scale, however simulations at the DNA scale are slow and repair processes are generally not simulated. Alternative models that rely on the random formation of individual DNA lesions within one or two turns of the DNA have been shown to reproduce the clusters of DNA lesions, including single strand breaks (SSBs), double strand breaks (DSBs) without the need for detailed track structure simulations. Efficient computational simulations of initial DNA damage induction facilitate computational modeling of DNA repair and other molecular and cellular processes. Mechanistic, multiscale models provide a useful conceptual framework to test biological hypotheses and help connect fundamental information about track structure and dosimetry at the sub-cellular level to dose-response effects on larger scales. In this symposium we will learn about the current state of the art of computational approaches estimating radiation damage at the cellular and sub-cellular scale. How can understanding the physics interactions at the DNA level be used to predict biological outcome? We will discuss if and how such calculations are relevant to advance our understanding of radiation damage and its repair, or, if the underlying biological

  12. [Galactic heavy charged particles damaging effect on biological structures].


    Grigor'ev, A I; Krasavin, E A; Ostrovskiĭ, M A


    A concept of the radiation risk of the manned interplanetary flights is proposed and substantiated. Heavy charged particles that are a component of the galactic cosmic rays (GCR) have a high damaging effect on the biological structures as great amount of energy is deposited in heavy particle tracks. The high biological effectiveness of heavy ions is observed in their action on cell genetic structures and the whole organism, including the brain structures. The hippocampus is the part of the central nervous system that is the most sensitive to radiation--first of all, to heavy charged particles. Irradiation of animals with accelerated iron ions at doses corresponding to the real fluxes of GCR heavy nuclei, to which Mars mission crews can be exposed, leads to marked behavioral function disorders in the post-irradiation period. To evaluate the radiation risk for the interplanetary flight crews, the concept of successful mission accomplishment is introduced. In these conditions, the central nervous system structures can be the critical target of GCR heavy nuclei. Their damage can modify the higher integrative functions of the brain and cause disorders in the crew members' operator performances.


    PubMed Central

    Suhasini, Avvaru N.; Brosh, Robert M.


    Helicases catalytically unwind structured nucleic acids in a nucleoside-triphosphate-dependent and directionally specific manner, and are essential for virtually all aspects of nucleic acid metabolism. ATPase-driven helicases which translocate along nucleic acids play a role in damage recognition or unwinding of a DNA tract containing the lesion. Although classical biochemical experiments provided evidence that bulky covalent adducts inhibit DNA unwinding catalyzed by certain DNA helicases in a strand-specific manner (i.e. , block to DNA unwinding restricted to adduct residence in the strand the helicase translocates), recent studies suggest more complex arrangements that may depend on the helicase under study, its assembly in a protein complex, and the type of structural DNA perturbation. Moreover, base and sugar phosphate backbone modifications exert effects on DNA helicases that suggest specialized tracking mechanisms. As a component of the replication stress response, the single-stranded DNA binding protein Replication Protein A (RPA) may serve to enable eukaryotic DNA helicases to overcome certain base lesions. Helicases play important roles in DNA damage signaling which also involve their partnership with RPA. In this review, we will discuss our current understanding of mechanistic and biological aspects of helicase action on damaged DNA. PMID:20574162

  14. Opportunities for nutritional amelioration of radiation-induced cellular damage

    NASA Technical Reports Server (NTRS)

    Turner, Nancy D.; Braby, Leslie A.; Ford, John; Lupton, Joanne R.


    The closed environment and limited evasive capabilities inherent in space flight cause astronauts to be exposed to many potential harmful agents (chemical contaminants in the environment and cosmic radiation exposure). Current power systems used to achieve space flight are prohibitively expensive for supporting the weight requirements to fully shield astronauts from cosmic radiation. Therefore, radiation poses a major, currently unresolvable risk for astronauts, especially for long-duration space flights. The major detrimental radiation effects that are of primary concern for long-duration space flights are damage to the lens of the eye, damage to the immune system, damage to the central nervous system, and cancer. In addition to the direct damage to biological molecules in cells, radiation exposure induces oxidative damage. Many natural antioxidants, whether consumed before or after radiation exposure, are able to confer some level of radioprotection. In addition to achieving beneficial effects from long-known antioxidants such as vitamins E and C and folic acid, some protection is conferred by several recently discovered antioxidant molecules, such as flavonoids, epigallocatechin, and other polyphenols. Somewhat counterintuitive is the protection provided by diets containing elevated levels of omega-3 polyunsaturated fatty acids, considering they are thought to be prone to peroxidation. Even with the information we have at our disposal, it will be difficult to predict the types of dietary modifications that can best reduce the risk of radiation exposure to astronauts, those living on Earth, or those enduring diagnostic or therapeutic radiation exposure. Much more work must be done in humans, whether on Earth or, preferably, in space, before we are able to make concrete recommendations.

  15. Track Structure and the Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage

    NASA Technical Reports Server (NTRS)

    George, K.; Hada, M.; Chappell, L.; Cucinotta, F. A.


    Track structure models predict that at a fixed value of LET, particles with lower charge number, Z will have a higher biological effectiveness compared to particles with a higher Z. In this report we investigated how track structure effects induction of chromosomal aberration in human cells. Human lymphocytes were irradiated in vitro with various energies of accelerated iron, silicon, neon, or titanium ions and chromosome damage was assessed in using three color FISH chromosome painting in chemically induced PCC samples collected a first cell division post irradiation. The LET values for these ions ranged from 30 to195 keV/micron. Of the particles studied, Neon ions have the highest biological effectiveness for induction of total chromosome damage, which is consistent with track structure model predictions. For complex-type exchanges 64 MeV/ u Neon and 450 MeV/u Iron were equally effective and induced the most complex damage. In addition we present data on chromosomes exchanges induced by six different energies of protons (5 MeV/u to 2.5 GeV/u). The linear dose response term was similar for all energies of protons suggesting that the effect of the higher LET at low proton energies is balanced by the production of nuclear secondaries from the high energy protons.

  16. Renal tissue damage induced by focused shock waves

    NASA Astrophysics Data System (ADS)

    Ioritani, N.; Kuwahara, M.; Kambe, K.; Taguchi, K.; Saitoh, T.; Shirai, S.; Orikasa, S.; Takayama, K.; Lush, P. A.


    Biological evidence of renal arterial wall damage induced by the microjet due to shock wave-cavitation bubble interaction was demonstrated in living dog kidneys. We also intended to clarify the mechanism of renal tissue damage and the effects of different conditions of shock wave exposure (peak pressure of focused area, number of shots, exposure rate) on the renal tissue damage in comparison to stone disintegration. Disruption of arterial wall was the most remarkable histological change in the focused area of the kidneys. This lesion appeared as if the wall had been punctured by a needle. Large hematoma formation in the renal parenchym, and interstitial hemorrhage seemed to be the results of the arterial lesion. This arterial disorder also led to ischemic necrosis of the tubules surrounding the hematoma. Micro-angiographic examination of extracted kidneys also proved such arterial puncture lesions and ischemic lesions. The number of shots required for model stone disintegration was not inversely proportional to peak pressure. It decreased markedly when peak pressure was above 700 bar. Similarly thenumber of shots for hematoma formation was not inversely proportional to peak pressure, however, this decreased markedly above 500 bar. These results suggested that a hematoma could be formed under a lower peak pressure than that required for stone disintegration.

  17. Silica radical-induced DNA damage and lipid peroxidation.

    PubMed Central

    Shi, X; Mao, Y; Daniel, L N; Saffiotti, U; Dalal, N S; Vallyathan, V


    In recent years, more attention has been given to the mechanism of disease induction caused by the surface properties of minerals. In this respect, specific research needs to be focused on the biologic interactions of oxygen radicals generated by mineral particles resulting in cell injury and DNA damage leading to fibrogenesis and carcinogenesis. In this investigation, we used electron spin resonance (ESR) and spin trapping to study oxygen radical generation from aqueous suspensions of freshly fractured crystalline silica. Hydroxyl radical (.OH), superoxide radical (O2.-) and singlet oxygen (1O2) were all detected. Superoxide dismutase (SOD) partially inhibited .OH yield, whereas catalase abolished .OH generation. H2O2 enhanced .OH generation while deferoxamine inhibited it, indicating that .OH is generated via a Haber-Weiss type reaction. These spin trapping measurements provide the first evidence that aqueous suspensions of silica particles generate O2.- and 1O2. Oxygen consumption measurements indicate that freshly fractured silica uses molecular oxygen to generate O2.- and 1O2. Electrophoretic assays of in vitro DNA strand breakages showed that freshly fractured silica induced DNA strand breakage, which was inhibited by catalase and enhanced by H2O2. In an argon atmosphere, DNA damage was suppressed, showing that molecular oxygen is required for the silica-induced DNA damage. Incubation of freshly fractured silica with linoleic acid generated linoleic acid-derived free radicals and caused dose-dependent lipid peroxidation as measured by ESR spin trapping and malondialdehyde formation. SOD, catalase, and sodium benzoate inhibited lipid peroxidation by 49, 52, and 75%, respectively, again showing the role of oxygen radicals in silica-induced lipid peroxidation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7. PMID:7705289

  18. Copper deficiency potentiates ethanol induced liver damage

    SciTech Connect

    Zidenberg-Cherr, S.; Han, B.; Graham, T.W.; Keen, C.L. )


    Copper sufficient (+Cu) and deficient ({minus}Cu) rats were fed liquid diets with EtOH or dextrose at 36% of kcals for 2 mo. Consumption of either the {minus}Cu diet or EtOH resulted in lower liver CuZn superoxide dismutase (CuZnSOD) and glutathione peroxidase (GPx) activities were lowest in EtOH/{minus}Cu rats; being 20% and 50% of control values, respectively. Ethanol resulted in higher MnSOD activity in +Cu and {minus}Cu rats. Low Cu intake as well as EtOH resulted in lower mitochondrial (Mit) TBARS relative to controls. TBARS were lowest in Mit from EtOH/{minus}Cu rats. Microsomal (Micro) TBARS were lower in {minus}Cu and EtOH-fed rats than in controls. The peroxidizability index (PI) was calculated as an index of substrate availability for lipid peroxidation. Ethanol feeding resulted in lower PI's in Mit and Micro than measured in non-EtOH rats. There was a positive correlation between Micro PI's and TBARS. These results show that despite reductions in components of antioxidant defense, compensatory mechanism arise resulting in reduction in peroxidation targets and/or an increase in alternate free radical quenching factors. Histological examination demonstrated increased portal and intralobular connective tissue and cell necrosis in EtOH/{minus}Cu rats, suggesting that Cu may be a critical modulator of EtOH induced tissue damage.

  19. GUI to Facilitate Research on Biological Damage from Radiation

    NASA Technical Reports Server (NTRS)

    Cucinotta, Frances A.; Ponomarev, Artem Lvovich


    A graphical-user-interface (GUI) computer program has been developed to facilitate research on the damage caused by highly energetic particles and photons impinging on living organisms. The program brings together, into one computational workspace, computer codes that have been developed over the years, plus codes that will be developed during the foreseeable future, to address diverse aspects of radiation damage. These include codes that implement radiation-track models, codes for biophysical models of breakage of deoxyribonucleic acid (DNA) by radiation, pattern-recognition programs for extracting quantitative information from biological assays, and image-processing programs that aid visualization of DNA breaks. The radiation-track models are based on transport models of interactions of radiation with matter and solution of the Boltzmann transport equation by use of both theoretical and numerical models. The biophysical models of breakage of DNA by radiation include biopolymer coarse-grained and atomistic models of DNA, stochastic- process models of deposition of energy, and Markov-based probabilistic models of placement of double-strand breaks in DNA. The program is designed for use in the NT, 95, 98, 2000, ME, and XP variants of the Windows operating system.

  20. Radiation-induced chromosome damage in astronauts' lymphocytes.


    Testard, I; Ricoul, M; Hoffschir, F; Flury-Herard, A; Dutrillaux, B; Fedorenko, B; Gerasimenko, V; Sabatier, L


    The increased number of manned space missions has made it important to estimate the biological risks encountered by astronauts. As they are exposed to cosmic rays, especially ions with high linear energy transfer (LET), it is necessary to estimate the doses they receive. The most sensitive biological dosimetry used is based on the quantification of radiation-induced chromosome damage to human lymphocytes. After the space missions ANTARES (1992) and ALTAIR (1993), we performed cytogenetic analysis of blood samples from seven astronauts who had spent from 2 weeks to 6 months in space. After 2 or 3 weeks, the X-ray equivalent dose was found to be below the cytogenetic detection level of 20 mGy. After 6 months, the biological dose greatly varied among the astronauts, from 95 to 455 mGy equivalent dose. These doses are in the same range as those estimated by physical dosimetry (90 mGy absorbed dose and 180 mSv equivalent dose). Some blood cells exhibited the same cytogenetic pattern as the 'rogue cells' occasionally observed in controls, but with a higher frequency. We suggest that rogue cells might result from irradiation with high-LET particles of cosmic origin. However, the responsibility of such cells for the long-term effects of cosmic irradiation remains unknown and must be investigated.

  1. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.


    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E


    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  2. Heat induced damage detection in composite materials by terahertz radiation

    NASA Astrophysics Data System (ADS)

    Radzieński, Maciej; Mieloszyk, Magdalena; Rahani, Ehsan Kabiri; Kundu, Tribikram; Ostachowicz, Wiesław


    In recent years electromagnetic Terahertz (THz) radiation or T-ray has been increasingly used for nondestructive evaluation of various materials such as polymer composites and porous foam tiles in which ultrasonic waves cannot penetrate but T-ray can. Most of these investigations have been limited to mechanical damage detection like inclusions, cracks, delaminations etc. So far only a few investigations have been reported on heat induced damage detection. Unlike mechanical damage the heat induced damage does not have a clear interface between the damaged part and the surrounding intact material from which electromagnetic waves can be reflected back. Difficulties associated with the heat induced damage detection in composite materials using T-ray are discussed in detail in this paper. T-ray measurements are compared for different levels of heat exposure of composite specimens.

  3. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  4. Mechanisms of Diabetes-Induced Liver Damage

    PubMed Central

    Mohamed, Jamaludin; Nazratun Nafizah, A. H.; Zariyantey, A. H.; Budin, S. B.


    Diabetes mellitus is a non-communicable disease that occurs in both developed and developing countries. This metabolic disease affects all systems in the body, including the liver. Hyperglycaemia, mainly caused by insulin resistance, affects the metabolism of lipids, carbohydrates and proteins and can lead to non-alcoholic fatty liver disease, which can further progress to non-alcoholic steatohepatitis, cirrhosis and, finally, hepatocellular carcinomas. The underlying mechanism of diabetes that contributes to liver damage is the combination of increased oxidative stress and an aberrant inflammatory response; this activates the transcription of pro-apoptotic genes and damages hepatocytes. Significant involvement of pro-inflammatory cytokines—including interleukin (IL)-1β, IL-6 and tumour necrosis factor-α—exacerbates the accumulation of oxidative damage products in the liver, such as malondialdehyde, fluorescent pigments and conjugated dienes. This review summarises the biochemical, histological and macromolecular changes that contribute to oxidative liver damage among diabetic individuals. PMID:27226903

  5. Relationship of gonadal activity and chemotherapy-induced gonadal damage

    SciTech Connect

    Rivkees, S.A.; Crawford, J.D.


    The authors tested the hypothesis that chemotherapy-induced gonadal damage is proportional to the degree of gonadal activity during treatment. Thirty studies that evaluated gonadal function after cyclophosphamide therapy for renal disease or combination chemotherapy for Hodgkin's disease or acute lymphocytic leukemia provided data for analysis. Data were stratified according to sex, illness, chemotherapeutic regimen and dose, and pubertal stage at the time of treatment. Chemotherapy-induced damage was more likely to occur in patients who were treated when sexually mature compared with those who were treated when prepubertal. Males were significantly more frequently affected than females when treated for renal disease of Hodgkin's disease. Chemotherapy-induced damage was also more likely to occur when patients were treated with large doses of alkylating agents. These data suggest that chemotherapy-induced damage is proportional to gonadal activity. Further efforts are needed to test whether induced gonadal quiescence during chemotherapy will reduce the strikingly high incidence of gonadal failure following chemotherapy.

  6. Damage-induced nonassociated inelastic flow in rock salt

    SciTech Connect

    Chan, K.S.; Bodner, S.R.; Brodsky, N.S.; Fossum, A.F.


    The multi-mechanism deformation coupled fracture model recently developed by CHAN, et al. (1992), for describing time-dependent, pressure-sensitive inelastic flow and damage evolution in crystalline solids was evaluated against triaxial creep experiments on rock salt. Guided by experimental observations, the kinetic equation and the flow law for damage-induced inelastic flow in the model were modified to account for the development of damage and inelastic dilatation in the transient creep regime. The revised model was then utilized to obtain the creep response and damage evolution in rock salt as a function of confining pressure and stress difference. Comparison between model calculation and experiment revealed that damage-induced inelastic flow is nonassociated, dilatational, and contributes significantly to the macroscopic strain rate observed in rock salt deformed at low confining pressures. The inelastic strain rate and volumetric strain due to damage decrease with increasing confining pressures, and all are suppressed at sufficiently high confining pressures.

  7. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  8. Biological oxidative damage by carbon nanotubes: fingerprint or footprint?


    Hsieh, Shu-Feng; Bello, Dhimiter; Schmidt, Daniel F; Pal, Anoop K; Rogers, Eugene J


    Carbon nanotubes (CNTs) have received much attention for performance and toxicity, but vary substantially in terms of impurity type and content, morphology, and surface activity. This study determined the decrease of antioxidant capacity, defined as biological oxidative damage (BOD), of CNTs-exposed serum. The variability in several physicochemical properties of CNTs and their links to BOD elicited in human serum were explored. Tremendous variation in transition metal type and content (104-fold), specific surface area (SSA, nine-fold), and BOD were observed. Mass specific BOD (mBOD) varied from 0.006-0.187 μmol TEU mg(-1), whereas surface area specific BOD (sBOD) varied from 0.068-0.42 μmol TEU m(-2). The sBOD increased in a stepwise fashion from ∼0.1-0.32 μmol TEU m(-2) for tubes with outer diameter less than 10 nm. The mBOD and sBOD may be useful denominators of surface activity and impurity content and assist in designing safer CNTs.

  9. Characterization of UVC-induced DNA damage in bloodstains: forensic implications.


    Hall, Ashley; Ballantyne, Jack


    The ability to detect DNA polymorphisms using molecular genetic techniques has revolutionized the forensic analysis of biological evidence. DNA typing now plays a critical role within the criminal justice system, but one of the limiting factors with the technology is that DNA isolated from biological stains recovered from the crime scene is sometimes so damaged as to be intractable to analysis. Potential remedies for damaged DNA are likely to be dependent upon the precise nature of the DNA damage present in any particular sample but, unfortunately, current knowledge of the biochemical nature, and the extent, of such DNA damage in dried biological stains is rudimentary. As a model for DNA damage assessment in biological stains recovered from crime scenes, we have subjected human bloodstains and naked DNA in the hydrated and dehydrated states to varying doses of UVC radiation. It was possible to damage the DNA sufficiently in a bloodstain to cause a standard autosomal short tandem repeat (STR) profile to be lost. However, a detailed analysis of the process, based upon assays developed to detect bipyrimidine photoproducts (BPPPs), single- and double-strand breaks, and DNA-DNA crosslinks, produced some unexpected findings. Contrary to the situation with living tissues or cells in culture, the predominant UVC-induced damage to DNA in bloodstains appears not to be pyrimidine dimers. Although some evidence for the presence of BPPPs and DNA crosslinks was obtained, the major form of UVC damage causing genetic profile loss appeared to be single-strand breaks. It was not possible, however, to preclude the possibility that a combination of damage types was responsible for the profile loss observed. We demonstrate here that a significant measure of protection against UVC-mediated genetic profile loss in dried biological stain material is afforded by the dehydrated state of the DNA and, to a lesser extent, the DNA cellular milieu.

  10. Mitochondrial DNA damage by bleomycin induces AML cell death.


    Yeung, ManTek; Hurren, Rose; Nemr, Carine; Wang, Xiaoming; Hershenfeld, Samantha; Gronda, Marcela; Liyanage, Sanduni; Wu, Yan; Augustine, Jeevan; Lee, Eric A; Spagnuolo, Paul A; Southall, Noel; Chen, Catherine; Zheng, Wei; Jeyaraju, Danny V; Minden, Mark D; Laposa, Rebecca; Schimmer, Aaron D


    Mitochondria contain multiple copies of their own 16.6 kb circular genome. To explore the impact of mitochondrial DNA (mtDNA) damage on mitochondrial (mt) function and viability of AML cells, we screened a panel of DNA damaging chemotherapeutic agents to identify drugs that could damage mtDNA. We identified bleomycin as an agent that damaged mtDNA in AML cells at concentrations that induced cell death. Bleomycin also induced mtDNA damage in primary AML samples. Consistent with the observed mtDNA damage, bleomycin reduced mt mass and basal oxygen consumption in AML cells. We also demonstrated that the observed mtDNA damage was functionally important for bleomycin-induced cell death. Finally, bleomycin delayed tumor growth in xenograft mouse models of AML and anti-leukemic concentrations of the drug induced mtDNA damage in AML cells preferentially over normal lung tissue. Taken together, mtDNA-targeted therapy may be an effective strategy to target AML cells and bleomycin could be useful in the treatment of this disease.

  11. Preventing Ultraviolet Light-Induced Damage: The Benefits of Antioxidants

    ERIC Educational Resources Information Center

    Yip, Cheng-Wai


    Extracts of fruit peels contain antioxidants that protect the bacterium "Escherichia coli" against damage induced by ultraviolet light. Antioxidants neutralise free radicals, thus preventing oxidative damage to cells and deoxyribonucleic acid. A high survival rate of UV-exposed cells was observed when grapefruit or grape peel extract was…

  12. Single-cell analysis challenges the connection between autophagy and senescence induced by DNA damage.


    Filippi-Chiela, Eduardo Cremonese; Bueno e Silva, Mardja Manssur; Thomé, Marcos Paulo; Lenz, Guido


    Autophagy and senescence have been described as central features of cell biology, but the interplay between these mechanisms remains obscure. Using a therapeutically relevant model of DNA damage-induced senescence in human glioma cells, we demonstrated that acute treatment with temozolomide induces DNA damage, a transitory activation of PRKAA/AMPK-ULK1 and MAPK14/p38 and the sustained inhibition of AKT-MTOR. This produced a transient induction of autophagy, which was followed by senescence. However, at the single cell level, this coordinated transition was not observed, and autophagy and senescence were triggered in a very heterogeneous manner. Indeed, at a population level, autophagy was highly negatively correlated with senescence markers, while in single cells this correlation did not exist. The inhibition of autophagy triggered apoptosis and decreased senescence, while its activation increased temozolomide-induced senescence, showing that DNA damage-induced autophagy acts by suppressing apoptosis.

  13. Protection by estrogens of biological damage by 2,2'-azobis(2-amidinopropane) dihydrochloride.


    Muraoka, Sanae; Miura, Toshiaki


    We examined by using 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) as a radical generator the ability of estrogens to scavenge carbon-centered and peroxyl radicals. Electron spin resonance signals of carbon-centered radicals from AAPH were diminished by catecholestrogens but not by phenolic estrogens, showing that catecholestrogens efficiently scavenged carbon-centered radicals. However, fluorescent decomposition of R-phycoerythrin by AAPH-derived peroxyl radicals was inhibited by catecholestrogens and phenolic estrogens. Evidently, peroxyl radicals were scavenged by catecholestrogens and by phenolic estrogens. However, the scavenging ability of 4-hydroxyestradiol was less than 2-hydroxyestradiol. Strand break of DNA induced by AAPH was inhibited by catecholestrogens, but not by phenolic estrogens under aerobic and anaerobic conditions. Inactivation of lysozyme induced by AAPH was completely blocked by 2-hydroxyestradiol under aerobic and anaerobic conditions, and by 4-hyroxyestradiol only under anaerobic conditions. Peroxidation of arachidonic acid by AAPH was strongly inhibited by catecholestrogens at low concentrations. Only large amounts of phenolic estrogens markedly inhibited lipid peroxidation. These results show that catecholestrogens were antioxidant against AAPH-induced damage to biological molecules through scavenging both carbon-centered and peroxyl radicals, but phenolic estrogens partially inhibited AAPH-induced damage because they scavenged only peroxyl radicals.

  14. New insights in photoaging, UVA induced damage and skin types.


    Battie, Claire; Jitsukawa, Setsuko; Bernerd, Françoise; Del Bino, Sandra; Marionnet, Claire; Verschoore, Michèle


    UVA radiation is the most prevalent component of solar UV radiation; it deeply penetrates into the skin and induces profound alterations of the dermal connective tissue. In recent years, the detrimental effects of UVA radiation were more precisely demonstrated at cellular and molecular levels, using adequate methods to identify biological targets of UVA radiation and the resulting cascade impairment of cell functions and tissue degradation. In particular gene expression studies recently revealed that UVA radiation induces modulation of several genes confirming the high sensitivity of dermal fibroblasts to UVA radiation. The major visible damaging effects of UVA radiation only appear after years of exposure: it has been clearly evidenced that they are responsible for more or less early signs of photoageing and photocarcinogenesis. UVA radiation appears to play a key role in pigmented changes occurring with age, the major sign of skin photoaging in Asians. Skin susceptibility to photoaging alterations also depends on constitutive pigmentation. The skin sensitivity to UV light has been demonstrated to be linked to skin color type.

  15. Effects of Ionizing Radiation on Biological Molecules—Mechanisms of Damage and Emerging Methods of Detection

    PubMed Central

    Reisz, Julie A.; Bansal, Nidhi; Qian, Jiang; Zhao, Weiling


    Abstract Significance: The detrimental effects of ionizing radiation (IR) involve a highly orchestrated series of events that are amplified by endogenous signaling and culminating in oxidative damage to DNA, lipids, proteins, and many metabolites. Despite the global impact of IR, the molecular mechanisms underlying tissue damage reveal that many biomolecules are chemoselectively modified by IR. Recent Advances: The development of high-throughput “omics” technologies for mapping DNA and protein modifications have revolutionized the study of IR effects on biological systems. Studies in cells, tissues, and biological fluids are used to identify molecular features or biomarkers of IR exposure and response and the molecular mechanisms that regulate their expression or synthesis. Critical Issues: In this review, chemical mechanisms are described for IR-induced modifications of biomolecules along with methods for their detection. Included with the detection methods are crucial experimental considerations and caveats for their use. Additional factors critical to the cellular response to radiation, including alterations in protein expression, metabolomics, and epigenetic factors, are also discussed. Future Directions: Throughout the review, the synergy of combined “omics” technologies such as genomics and epigenomics, proteomics, and metabolomics is highlighted. These are anticipated to lead to new hypotheses to understand IR effects on biological systems and improve IR-based therapies. Antioxid. Redox Signal. 21: 260–292. PMID:24382094

  16. Quercitrin protects skin from UVB-induced oxidative damage

    SciTech Connect

    Yin, Yuanqin; Li, Wenqi; Son, Young-Ok; Sun, Lijuan; Lu, Jian; Kim, Donghern; Wang, Xin; Yao, Hua; Wang, Lei; Pratheeshkumar, Poyil; Hitron, Andrew J.; Luo, Jia; Gao, Ning; Shi, Xianglin; Zhang, Zhuo


    Exposure of the skin to ultraviolet B (UVB) radiation causes oxidative damage to skin, resulting in sunburn, photoaging, and skin cancer. It is generally believed that the skin damage induced by UV irradiation is a consequence of generation of reactive oxygen species (ROS). Recently, there is an increased interest in the use of natural products as chemopreventive agents for non-melanoma skin cancer (NMSC) due to their antioxidants and anti-inflammatory properties. Quercitrin, glycosylated form of quercetin, is the most common flavonoid in nature with antioxidant properties. The present study investigated the possible beneficial effects of quercitrin to inhibit UVB irradiation-induced oxidative damage in vitro and in vivo. Our results showed that quercitrin decreased ROS generation induced by UVB irradiation in JB6 cells. Quercitrin restored catalase expression and GSH/GSSG ratio reduced by UVB exposure, two major antioxidant enzymes, leading to reductions of oxidative DNA damage and apoptosis and protection of the skin from inflammation caused by UVB exposure. The present study demonstrated that quercitrin functions as an antioxidant against UVB irradiation-induced oxidative damage to skin. - Highlights: • Oxidative stress plays a key role in UV-induced cell and tissue injuries. • Quercitrin decreases ROS generation and restores antioxidants irradiated by UVB. • Quercitrin reduces UVB-irradiated oxidative DNA damage, apoptosis, and inflammation. • Quercitrin functions as an antioxidant against UVB-induced skin injuries.

  17. Photoexcited riboflavin induces oxidative damage to human serum albumin

    NASA Astrophysics Data System (ADS)

    Hirakawa, Kazutaka; Yoshioka, Takuto


    Photoexcited riboflavin induced damage of human serum albumin (HSA), a water soluble protein, resulting in the diminishment of fluorescence from the tryptophan residue. Because riboflavin hardly photosensitized singlet oxygen generation and sodium azide, a singlet oxygen quencher, did not inhibit protein damage, electron transfer-mediated oxidation of HSA was speculated. Fluorescence lifetime of riboflavin was not affected by HSA, suggesting that the excited triplet state of riboflavin is responsible for protein damage through electron transfer. In addition, the preventive effect of xanthone derivatives, triplet quenchers, on photosensitized protein damage could be evaluated using this photosensitized reaction system of riboflavin and HSA.

  18. PWR fuel features to preclude externally induced damage

    SciTech Connect

    Shallenberger, J.M.; Wilson, J.F.; Knott, R.P.


    Over the past several years there have been instances of pressurized water reactor (PWR) fuel damage attributed to factors external to the fuel. These externally induced causes include debris in the reactor coolant and baffle jetting. These causes of PWR fuel damage account for --50% of the total number of damaged rods. This paper discusses two features that significantly reduce the potential for fuel damage due to debris and baffle jetting. These two features are the debris filter bottom nozzle (DFBN) and the antivibration clip.

  19. DNA damage in cells exhibiting radiation-induced genomic instability


    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  20. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  1. Chemically Induced Damage to the Hippocampal Formation,

    DTIC Science & Technology


    31-42. Siesj0, B K (1981): Cell damage in the brain: A speculative synthe i, J Cereb Blood Flow Metabol 1, 155-85. Stefanis, C (1964): Hippocampal... serotonin effects on central neurons, Advanc Pharmacol 6A, 414-18. Storm-Mathisen, J (1972): Glutamate decarboxylase in the rat hippo- campal region...and chro- nic toluene inhalation on behavior and [ H]- serotonin binding in rat, Life Sciences 30, 1997-2002. Zimmer, L, Woolley, D and Chang, L (1985


    SciTech Connect

    Mayer, John; Brisbin, I. Lehr


    about anything; and, they can live just about anywhere. On top of that, wild pigs are both very difficult to control and, with the possible exception of island ecosystems, almost impossible to eradicate (Dickson et al. 2001, Sweeney et al. 2003). The solution to the wild pig problem has not been readily apparent. The ultimate answer as to how to control these animals has not been found to date. In many ways, wild pigs are America's most successful large invasive species. All of which means that wild pigs are a veritable nightmare for land and resource managers trying to keep the numbers of these animals and the damage that they do under control. Since the more that one knows about an invasive species, the easier it is to deal with and hopefully control. For wild pigs then, it is better to 'know thy enemy' than to not, especially if one expects to be able to successfully control them. In an effort to better 'know thy enemy,' a two-day symposium was held in Augusta, Georgia, on April 21-22, 2004. This symposium was organized and sponsored by U.S.D.A. Forest Service-Savannah River (USFS-SR), U. S. Department of Energy-Savannah River Operations Office (DOE-SR), the Westinghouse Savannah River Company (WSRC), the South Carolina Chapter of the Soil & Water Conservation Society, and the Savannah River Ecology Laboratory (SREL). The goal of this symposium was to assemble researchers and land managers to first address various aspects of the biology and damage of wild pigs, and then review the control techniques and management of this invasive species. The result would then be a collected synopsis of what is known about wild pigs in the United States. Although the focus of the symposium was primarily directed toward federal agencies, presenters also included professionals from academic institutions, and private-sector control contractors and land managers. Most of the organizations associated with implementing this symposium were affiliated with the Savannah River Site (SRS), a

  3. New Treatment Strategies for Alcohol-Induced Heart Damage

    PubMed Central

    Fernández-Solà, Joaquim; Planavila Porta, Ana


    High-dose alcohol misuse induces multiple noxious cardiac effects, including myocyte hypertrophy and necrosis, interstitial fibrosis, decreased ventricular contraction and ventricle enlargement. These effects produce diastolic and systolic ventricular dysfunction leading to congestive heart failure, arrhythmias and an increased death rate. There are multiple, dose-dependent, synchronic and synergistic mechanisms of alcohol-induced cardiac damage. Ethanol alters membrane permeability and composition, interferes with receptors and intracellular transients, induces oxidative, metabolic and energy damage, decreases protein synthesis, excitation-contraction coupling and increases cell apoptosis. In addition, ethanol decreases myocyte protective and repair mechanisms and their regeneration. Although there are diverse different strategies to directly target alcohol-induced heart damage, they are partially effective, and can only be used as support medication in a multidisciplinary approach. Alcohol abstinence is the preferred goal, but control drinking is useful in alcohol-addicted subjects not able to abstain. Correction of nutrition, ionic and vitamin deficiencies and control of alcohol-related systemic organ damage are compulsory. Recently, several growth factors (myostatin, IGF-1, leptin, ghrelin, miRNA, and ROCK inhibitors) and new cardiomyokines such as FGF21 have been described to regulate cardiac plasticity and decrease cardiac damage, improving cardiac repair mechanisms, and they are promising agents in this field. New potential therapeutic targets aim to control oxidative damage, myocyte hypertrophy, interstitial fibrosis and persistent apoptosis In addition, stem-cell therapy may improve myocyte regeneration. However, these strategies are not yet approved for clinical use. PMID:27690014

  4. Physics associated with cavitation induced material damage

    NASA Technical Reports Server (NTRS)

    Peterson, F. B.


    The role of cavitation in mechanical failure is discussed. Some of the most common types of material damage associated with the presence of cavitation are surface material removal, delamination and structural vibration. This occurs in external flows such as on propellers, hydrofoils, and high speed non-lifting surfaces. In internal flows, pipe bends, inlets, constructions, pumps and turbines are typical. Nominally nonflowing liquids are also susceptible in, for example, strong acoustic fields and high energy particle detectors. For flowing systems, Bernoulli's equation shows how a local pressure is reduced as the fluid's velocity is increased. At sufficiently high velocities, a tension can actually develop and this has, in fact, been demonstrated experimentally. Once the pressure is reduced below the fluid vapor pressure a vapor cavity can be nucleated. Various aspects of this process are simply shown by considering the flow over a lifting surface.

  5. Hydroxyl radical Thymine adduct induced DNA damages

    NASA Astrophysics Data System (ADS)

    Schyman, Patric; Eriksson, Leif A.; Zhang, Ru bo; Laaksonen, Aatto


    DNA damages caused by a 5-hydroxy-5,6-dihydrothymine-6-yl radical (5-OHT-6yl) abstracting a C2‧ hydrogen from a neighboring sugar (inter-H abstraction) have been theoretically investigated using hybrid DFT in gas phase and in water solution. The inter-H abstraction was here shown to be comparable in energy (24 kcal mol-1) with the intra-H abstraction in which the 5-OHT-6yl abstracts a C2‧ hydrogen from its own sugar. The effect of a neutrally or a negatively charged phosphate group was also studied and the results show no significant impact on the activation energy of the hydrogen abstraction whereas base release and strand break reactions are affected.

  6. Molecular biology of doxorubicin-induced cardiomyopathy

    PubMed Central

    Umlauf, J; Horký, M


    The anthracycline doxorubicin is an antineoplastic agent, eliciting chronic cardiac toxicity. It occurs in patients after prolonged administration of doxorubicin, leading to congestive heart failure. The pathogenesis of the doxorubicin-induced car-diomyopathy is not well understood. The present article summarizes the unique effect of doxorubicin on cardiac-specific gene expression. In addition to binding to DNA, doxorubicin directly affects the function of a variety of proteins. Free radical generation, damage to mitochondria and active cell death are also critical in the development of doxorubicin-induced cardiac toxicity. Agents providing effective cardioprotection are also reviewed. PMID:19644577

  7. Pathology and biology of radiation-induced cardiac disease

    PubMed Central

    Tapio, Soile


    Heart disease is the leading global cause of death. The risk for this disease is significantly increased in populations exposed to ionizing radiation, but the mechanisms are not fully elucidated yet. This review aims to gather and discuss the latest data about pathological and biological consequences in the radiation-exposed heart in a comprehensive manner. A better understanding of the molecular and cellular mechanisms underlying radiation-induced damage in heart tissue and cardiac vasculature will provide novel targets for therapeutic interventions. These may be valuable for individuals clinically or occupationally exposed to varying doses of ionizing radiation. PMID:27422929

  8. Heavy ion induced permanent damage in MNOS gate insulators

    NASA Astrophysics Data System (ADS)

    Pickel, J. C.; Blandford, J. T., Jr.; Waskiewicz, A. E.; Strahan, V. H., Jr.


    Heavy-ion-induced permanent damage in MNOS gate insulators has been investigated using a Cf252 fission source. The electric field and ion LET thresholds for onset of the damage has been characterized. The results are consistent with a thermal runaway mechanism in the silicon nitride layer initiated by a single heavy ion and leading to a permanent high conductivity path through the dielectric layers.

  9. Polymer-induced compression of biological hydrogels

    NASA Astrophysics Data System (ADS)

    Datta, Sujit; Preska Steinberg, Asher; Ismagilov, Rustem

    Hydrogels - such as mucus, blood clots, and the extracellular matrix - provide critical functions in biological systems. However, little is known about how their structure is influenced by many of the polymeric materials they come into contact with regularly. Here, we focus on one critically important biological hydrogel: colonic mucus. While several biological processes are thought to potentially regulate the mucus hydrogel structure, the polymeric composition of the gut environment has been ignored. We use Flory-Huggins solution theory to characterize polymer-mucus interactions. We find that gut polymers, including those small enough to penetrate the mucus hydrogel, can in fact alter mucus structure, changing its equilibrium degree of swelling and forcing it to compress. The extent of compression increases with increasing polymer concentration and size. We use experiments on mice to verify these predictions with common dietary and therapeutic gut polymers. Our results provide a foundation for investigating similar, previously overlooked, polymer-induced effects in other biological hydrogels.

  10. Inducible repair of oxidative DNA damage in Escherichia coli.


    Demple, B; Halbrook, J

    Hydrogen peroxide is lethal to many cell types, including the bacterium Escherichia coli. Peroxides yield transient radical species that can damage DNA and cause mutations. Such partially reduced oxygen species are occasionally released during cellular respiration and are generated by lethal and mutagenic ionizing radiation. Because cells live in an environment where the threat of oxidative DNA damage is continual, cellular mechanisms may have evolved to avoid and repair this damage. Enzymes are known which evidently perform these functions. We report here that resistance to hydrogen peroxide toxicity can be induced in E. coli, that this novel induction is specific and occurs, in part, at the level of DNA repair.


    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  12. Modeling of Laser Induced Damage in NIF UV Optics

    SciTech Connect

    Feit, M D; Rubenchik, A M


    Controlling damage to nominally transparent optical elements such as lenses, windows and frequency conversion crystals on high power lasers is a continuing technical problem. Scientific understanding of the underlying mechanisms of laser energy absorption, material heating and vaporization and resultant mechanical damage is especially important for UV lasers with large apertures such as NIF. This LDRD project was a single year effort, in coordination with associated experimental projects, to initiate theoretical descriptions of several of the relevant processes. In understanding laser damage, we distinguish between damage initiation and the growth of existent damage upon subsequent laser irradiation. In general, the effect of damage could be ameliorated by either preventing its initiation or by mitigating its growth. The distinction comes about because initiation is generally due to extrinsic factors such as contaminants, which provide a means of local laser energy absorption. Thus, initiation tends to be local and stochastic in nature. On the other hand, the initial damaging event appears to modify the surrounding material in such a way that multiple pulse damage grows more or less regularly. More exactly, three ingredients are necessary for visible laser induced damage. These are adequate laser energy, a mechanism of laser energy absorption and mechanical weakness. For damage growth, the material surrounding a damage site is already mechanically weakened by cracks and probably chemically modified as well. The mechanical damage can also lead to electric field intensification due to interference effects, thus increasing the available laser energy density. In this project, we successfully accounted for the pulselength dependence of damage threshold in bulk DKDP crystals with the hypothesis of small absorbers with a distribution of sizes. We theoretically investigated expected scaling of damage initiation craters both to baseline detailed numerical simulations

  13. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  14. Modulation of irinotecan-induced genomic DNA damage by theanine.


    Attia, Sabry


    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity.

  15. Quercitrin protects skin from UVB-induced oxidative damage.


    Yin, Yuanqin; Li, Wenqi; Son, Young-Ok; Sun, Lijuan; Lu, Jian; Kim, Donghern; Wang, Xin; Yao, Hua; Wang, Lei; Pratheeshkumar, Poyil; Hitron, Andrew J; Luo, Jia; Gao, Ning; Shi, Xianglin; Zhang, Zhuo


    Exposure of the skin to ultraviolet B (UVB) radiation causes oxidative damage to skin, resulting in sunburn, photoaging, and skin cancer. It is generally believed that the skin damage induced by UV irradiation is a consequence of generation of reactive oxygen species (ROS). Recently, there is an increased interest in the use of natural products as chemopreventive agents for non-melanoma skin cancer (NMSC) due to their antioxidants and anti-inflammatory properties. Quercitrin, glycosylated form of quercetin, is the most common flavonoid in nature with antioxidant properties. The present study investigated the possible beneficial effects of quercitrin to inhibit UVB irradiation-induced oxidative damage in vitro and in vivo. Our results showed that quercitrin decreased ROS generation induced by UVB irradiation in JB6 cells. Quercitrin restored catalase expression and GSH/GSSG ratio reduced by UVB exposure, two major antioxidant enzymes, leading to reductions of oxidative DNA damage and apoptosis and protection of the skin from inflammation caused by UVB exposure. The present study demonstrated that quercitrin functions as an antioxidant against UVB irradiation-induced oxidative damage to skin.

  16. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  17. Blasting-induced damage in coal

    SciTech Connect

    Kabongo, K.K.


    The paper is drawn from a project intended to explore a technique of prediction, control and optimization of fracture in coal induced by blasting. It evaluates the fines generated in coal submitted to dynamic loading stresses in an impact stamp mortar. The aim is to analyze a complex phenomenon of coal response to blast-generated stresses from a series of discrete simulations of shock and gas actions in controllable processes. It is learned that despite the nucleation of primary crushing and fractures to originate from the point of impact energy in coal, a secondary crushing appears to depart from within the burden progressing towards the free boundaries. The extension of the secondary crushing zone appears to be influenced by the magnitude of the breaking stresses generated and the coal burden distance. A strong dependence of fines on the coal`s innate discontinuities (strength) and the energy input is highlighted.

  18. Transesophageal Echocardiography and Radiation-induced Damages

    PubMed Central

    Cottini, Marzia; Polizzi, Vincenzo; Pino, Paolo Giuseppe; Buffa, Vitaliano; Musumeci, Francesco


    The long-term sequelae of mantle therapy include, especially lung and cardiac disease but also involve the vessels and the organs in the neck and thorax (such as thyroid, aorta, and esophagus). We presented the case of 66-year-old female admitted for congestive heart failure in radiation-induced heart disease. The patient had undergone to massive radiotherapy 42 years ago for Hodgkin's disease (type 1A). Transesophageal echocardiography was performed unsuccessfully with difficulty because of the rigidity and impedance of esophageal walls. Our case is an extraordinary report of radiotherapy's latency effect as a result of dramatic changes in the structure of mediastinum, in particular in the esophagus, causing unavailability of a transesophageal echocardiogram. PMID:27867461

  19. Genetic damage induced by organic extract of coke oven emissions on human bronchial epithelial cells.


    Zhai, Qingfeng; Duan, Huawei; Wang, Yadong; Huang, Chuanfeng; Niu, Yong; Dai, Yufei; Bin, Ping; Liu, Qingjun; Chen, Wen; Ma, Junxiang; Zheng, Yuxin


    Coke oven emissions are known as human carcinogen, which is a complex mixture of polycyclic aromatic hydrocarbon. In this study, we aimed to clarify the mechanism of action of coke oven emissions induced carcinogenesis and to identify biomarkers of early biological effects in a human bronchial epithelial cell line with CYP1A1 activity (HBE-CYP1A1). Particulate matter was collected in the oven area on glass filter, extracted and analyzed by GC/MS. DNA breaks and oxidative damage were evaluated by alkaline and endonucleases (FPG, hOGG1 and ENDO III)-modified comet assays. Cytotoxicity and chromosomal damage were assessed by the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. The cells were treated with organic extract of coke oven emissions (OE-COE) representing 5, 10, 20, 40μg/mL extract for 24h. We found that there was a dose-effect relationship between the OE-COE and the direct DNA damage presented by tail length, tail intensity and Olive tail moment in the comet assay. The presence of lesion-specific endonucleases in the assays increased DNA migration after OE-COE treatment when compared to those without enzymes, which indicated that OE-COE produced oxidative damage at the level of pyrimidine and purine bases. The dose-dependent increase of micronuclei, nucleoplasmic bridges and nuclear buds in exposed cells was significant, indicating chromosomal and genomic damage induced by OE-COE. Based on the cytotoxic biomarkers in CBMN-Cyt assay, OE-COE may inhibit nuclear division, interfere with apoptosis, or induce cell necrosis. This study indicates that OE-COE exposure can induce DNA breaks/oxidative damage and genomic instability in HBE-CYP1A1 cells. The FPG-comet assay appears more specific for detecting oxidative DNA damage induced by complex mixtures of genotoxic substances.

  20. UV and ionizing radiations induced DNA damage, differences and similarities

    NASA Astrophysics Data System (ADS)

    Ravanat, Jean-Luc; Douki, Thierry


    Both UV and ionizing radiations damage DNA. Two main mechanisms, so-called direct and indirect pathways, are involved in the degradation of DNA induced by ionizing radiations. The direct effect of radiation corresponds to direct ionization of DNA (one electron ejection) whereas indirect effects are produced by reactive oxygen species generated through water radiolysis, including the highly reactive hydroxyl radicals, which damage DNA. UV (and visible) light damages DNA by again two distinct mechanisms. UVC and to a lesser extend UVB photons are directly absorbed by DNA bases, generating their excited states that are at the origin of the formation of pyrimidine dimers. UVA (and visible) light by interaction with endogenous or exogenous photosensitizers induce the formation of DNA damage through photosensitization reactions. The excited photosensitizer is able to induce either a one-electron oxidation of DNA (type I) or to produce singlet oxygen (type II) that reacts with DNA. In addition, through an energy transfer from the excited photosensitizer to DNA bases (sometime called type III mechanism) formation of pyrimidine dimers could be produced. Interestingly it has been shown recently that pyrimidine dimers are also produced by direct absorption of UVA light by DNA, even if absorption of DNA bases at these wavelengths is very low. It should be stressed that some excited photosensitizers (such as psoralens) could add directly to DNA bases to generate adducts. The review will described the differences and similarities in terms of damage formation (structure and mechanisms) between these two physical genotoxic agents.

  1. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.


    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  2. Hardening measures for bipolar transistors against microwave-induced damage

    NASA Astrophysics Data System (ADS)

    Chai, Chang-Chun; Ma, Zhen-Yang; Ren, Xing-Rong; Yang, Yin-Tang; Zhao, Ying-Bo; Yu, Xin-Hai


    In the present paper we study the influences of the bias voltage and the external components on the damage progress of a bipolar transistor induced by high-power microwaves. The mechanism is presented by analyzing the variation in the internal distribution of the temperature in the device. The findings show that the device becomes less vulnerable to damage with an increase in bias voltage. Both the series diode at the base and the relatively low series resistance at the emitter, Re, can obviously prolong the burnout time of the device. However, Re will aid damage to the device when the value is sufficiently high due to the fact that the highest hot spot shifts from the base-emitter junction to the base region. Moreover, the series resistance at the base Rb will weaken the capability of the device to withstand microwave damage.

  3. Heat Induced Damage Detection by Terahertz (THz) Radiation

    NASA Astrophysics Data System (ADS)

    Rahani, Ehsan Kabiri; Kundu, Tribikram; Wu, Ziran; Xin, Hao


    Terahertz (THz) and sub-terahertz imaging and spectroscopy are becoming increasingly popular nondestructive evaluation techniques for damage detection and characterization of materials. THz radiation is being used for inspecting ceramic foam tiles used in TPS (Thermal Protection System), thick polymer composites and polymer tiles that are not good conductors of ultrasonic waves. Capability of THz electromagnetic waves in detecting heat induced damage in porous materials is investigated in this paper. Porous pumice stone blocks are subjected to long time heat exposures to produce heat induced damage in the block. The dielectric properties extracted from THz TDS (Time Domain Spectroscopy) measurements are compared for different levels of heat exposure. Experimental results show noticeable and consistent change in dielectric properties with increasing levels of heat exposure, well before its melting point.

  4. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  5. Shock-induced damage in rocks: Application to impact cratering

    NASA Astrophysics Data System (ADS)

    Ai, Huirong

    Shock-induced damage beneath impact craters is studied in this work. Two representative terrestrial rocks, San Marcos granite and Bedford limestone, are chosen as test target. Impacts into the rock targets with different combinations of projectile material, size, impact angle, and impact velocity are carried out at cm scale in the laboratory. Shock-induced damage and fracturing would cause large-scale compressional wave velocity reduction in the recovered target beneath the impact crater. The shock-induced damage is measured by mapping the compressional wave velocity reduction in the recovered target. A cm scale nondestructive tomography technique is developed for this purpose. This technique is proved to be effective in mapping the damage in San Marcos granite, and the inverted velocity profile is in very good agreement with the result from dicing method and cut open directly. Both compressional velocity and attenuation are measured in three orthogonal directions on cubes prepared from one granite target impacted by a lead bullet at 1200 m/s. Anisotropy is observed from both results, but the attenuation seems to be a more useful parameter than acoustic velocity in studying orientation of cracks. Our experiments indicate that the shock-induced damage is a function of impact conditions including projectile type and size, impact velocity, and target properties. Combined with other crater phenomena such as crater diameter, depth, ejecta, etc., shock-induced damage would be used as an important yet not well recognized constraint for impact history. The shock-induced damage is also calculated numerically to be compared with the experiments for a few representative shots. The Johnson-Holmquist strength and failure model, initially developed for ceramics, is applied to geological materials. Strength is a complicated function of pressure, strain, strain rate, and damage. The JH model, coupled with a crack softening model, is used to describe both the inelastic response of

  6. Potential role of punicalagin against oxidative stress induced testicular damage

    PubMed Central

    Rao, Faiza; Tian, Hui; Li, Wenqing; Hung, Helong; Sun, Fei


    Punicalagin is isolated from pomegranate and widely used for the treatment of different diseases in Chinese traditional medicine. This study aimed to evaluate the effect of Punicalagin (purity ≥98%) on oxidative stress induced testicular damage and its effect on fertility. We detected the antioxidant potential of punicalagin in lipopolysaccharide (LPS) induced oxidative stress damage in testes, also tried to uncover the boosting fertility effect of Punicalagin (PU) against oxidative stress-induced infertility. Results demonstrated that 9 mg kg−1 for 7 days treatment significantly decreases LPS induced oxidative damage in testes and nitric oxide production. The administration of oxidative stress resulted in a significant reduction in testes antioxidants GSH, T-SOD, and CAT raised LPO, but treatment with punicalagin for 7 days increased antioxidant defense GSH, T-SOD, and CAT by the end of the experiment and reduced LPO level as well. PU also significantly activates Nrf2, which is involved in regulation of antioxidant defense systems. Hence, the present research categorically elucidates the protective effect of punicalagin against LPS induced oxidative stress induced perturbation in the process of spermatogenesis and significantly increased sperm health and number. Moreover, fertility success significantly decreased in LPS-injected mice compared to controls. Mice injected with LPS had fertility indices of 12.5%, while others treated with a combination of PU + LPS exhibited 75% indices. By promoting fertility and eliminating oxidative stress and inflammation, PU may be a useful nutrient for the treatment of infertility. PMID:26763544

  7. Potential role of punicalagin against oxidative stress induced testicular damage.


    Rao, Faiza; Tian, Hui; Li, Wenqing; Hung, Helong; Sun, Fei


    Punicalagin is isolated from pomegranate and widely used for the treatment of different diseases in Chinese traditional medicine. This study aimed to evaluate the effect of Punicalagin (purity ≥98%) on oxidative stress induced testicular damage and its effect on fertility. We detected the antioxidant potential of punicalagin in lipopolysaccharide (LPS) induced oxidative stress damage in testes, also tried to uncover the boosting fertility effect of Punicalagin (PU) against oxidative stress-induced infertility. Results demonstrated that 9 mg kg-1 for 7 days treatment significantly decreases LPS induced oxidative damage in testes and nitric oxide production. The administration of oxidative stress resulted in a significant reduction in testes antioxidants GSH, T-SOD, and CAT raised LPO, but treatment with punicalagin for 7 days increased antioxidant defense GSH, T-SOD, and CAT by the end of the experiment and reduced LPO level as well. PU also significantly activates Nrf2, which is involved in regulation of antioxidant defense systems. Hence, the present research categorically elucidates the protective effect of punicalagin against LPS induced oxidative stress induced perturbation in the process of spermatogenesis and significantly increased sperm health and number. Moreover, fertility success significantly decreased in LPS-injected mice compared to controls. Mice injected with LPS had fertility indices of 12.5%, while others treated with a combination of PU + LPS exhibited 75% indices. By promoting fertility and eliminating oxidative stress and inflammation, PU may be a useful nutrient for the treatment of infertility.

  8. Autophagy Induced by Calcium Phosphate Precipitates Targets Damaged Endosomes*

    PubMed Central

    Chen, Xi; Khambu, Bilon; Zhang, Hao; Gao, Wentao; Li, Min; Chen, Xiaoyun; Yoshimori, Tamotsu; Yin, Xiao-Ming


    Calcium phosphate precipitates (CPPs) form complexes with DNA, which enter cells via endocytosis. Under this condition CPPs induce autophagy via the canonic autophagy machinery. Here we showed that CPP-induced autophagy was also dependent on endocytosis as the process was significantly inhibited by methyl-β-cyclodextrin and dynasore, which suppress clathrin-dependent endocytosis. Consistently, CPP treatment triggered the formation of filipin-positive intracellular vesicles whose membranes are rich in cholesterol. Unexpectedly, these vesicles were also positive for galectin 3, suggesting that they were damaged and the membrane glycans became accessible to galectins to bind. Endosome damage was caused by endocytosis of CPPs and was reversed by calcium chelators or by endocytosis inhibitors. Notably, CPP-induced LC3-positive autophagosomes were colocalized with galectin 3, ubiquitin, and p62/SQSTM1. Inhibition of galectin 3 reduced p62 puncta and autophagosome formation. Knockdown of p62 additionally inhibited the colocalization of autophagosomes with galectins. Furthermore, most of the galectin 3-positive vesicles were colocalized with Rab7 or LAMP1. Agents that affect endosome/lysosome maturation and function, such as bafilomycin A1, also significantly affected CPP-induced tubulovesicular autophagosome formation. These findings thus indicate that endocytosed CPPs caused endosome damage and recruitment of galectins, particularly at the later endosome stage, which led to the interaction of the autophagosomal membranes with the damaged endosome in the presence of p62. PMID:24619419

  9. NBQX and TCP prevent soman-induced hippocampal damage

    SciTech Connect

    Lallement, G.; Carpentier, P.; Pernot-Marino, I.; Baubichon, D.; Blanchet, G.


    In a previous investigation we demonstrated that the measurement of w3 (peripheral-type benzodiazepine) binding site densities could be of widespread applicability in the localization and quantification of soman-induced damage in the central nervous system. We thus used this marker to assess, in mouse hippocampus, the neuroprotective activity against soman-induced brain damage of NBQX and TCP which are respective antagonists of non-NMDA and NMDA glutamatergic receptors. Injection of NBQX at 20 or 40 mg/kg 5 min prior to soman totally prevented the neuronal damage. Comparatively, TCP had neuroprotective efficacy when administered at l mg/kg 5 min prior to soman followed by a reinjection 1 hour after. These results demonstrate that both NBQX and TCP afford a satisfactory neuroprotection against soman-induced brain damage. Since it is known that the neuropathology due to soman is closely seizure-related, it is likely that the neuroprotective activities of NBQX and TCP are related to the respective roles of non-NMDA and NMDA receptors in the onset and maintenance of soman-induced seizures.

  10. Multiscale physics of ion-induced radiation damage.


    Surdutovich, Eugene; Solov'yov, A V


    This is a review of a multiscale approach to the physics of ion-beam cancer therapy, an approach suggested in order to understand the interplay of a large number of phenomena involved in the radiation damage scenario occurring on a range of temporal, spatial, and energy scales. We describe different effects that take place on different scales and play major roles in the scenario of interaction of ions with tissue. The understanding of these effects allows an assessment of relative biological effectiveness that relates the physical quantities, such as dose, to the biological values, such as the probability of cell survival.

  11. The basic chemistry of exercise-induced DNA oxidation: oxidative damage, redox signaling, and their interplay.


    Cobley, James N; Margaritelis, Nikos V; Morton, James P; Close, Graeme L; Nikolaidis, Michalis G; Malone, John K


    Acute exercise increases reactive oxygen and nitrogen species generation. This phenomenon is associated with two major outcomes: (1) redox signaling and (2) macromolecule damage. Mechanistic knowledge of how exercise-induced redox signaling and macromolecule damage are interlinked is limited. This review focuses on the interplay between exercise-induced redox signaling and DNA damage, using hydroxyl radical ((·)OH) and hydrogen peroxide (H2O2) as exemplars. It is postulated that the biological fate of H2O2 links the two processes and thus represents a bifurcation point between redox signaling and damage. Indeed, H2O2 can participate in two electron signaling reactions but its diffusion and chemical properties permit DNA oxidation following reaction with transition metals and (·)OH generation. It is also considered that the sensing of DNA oxidation by repair proteins constitutes a non-canonical redox signaling mechanism. Further layers of interaction are provided by the redox regulation of DNA repair proteins and their capacity to modulate intracellular H2O2 levels. Overall, exercise-induced redox signaling and DNA damage may be interlinked to a greater extent than was previously thought but this requires further investigation.

  12. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    NASA Astrophysics Data System (ADS)

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar


    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  13. Protective effects of honokiol against methylglyoxal-induced osteoblast damage.


    Suh, Kwang Sik; Chon, Suk; Choi, Eun Mi


    Honokiol is an active compound isolated from Magnolia officinalis that has been used without notable side effects in traditional medicine. We investigated the effects of honokiol against methylglyoxal (MG)-induced cytotoxicity in MC3T3-E1 osteoblast cells and the possible molecular mechanism(s) involved. The results showed that honokiol alleviated MG-induced cell death and the production of intracellular ROS, mitochondrial superoxide, cardiolipin peroxidation, and inflammatory cytokines. MG induction of the soluble receptor for advanced glycation end product (AGE) was reduced by pretreatment with honokiol. Furthermore, honokiol increased the levels of Nrf2 and increased the levels of glutathione and the activity of glyoxalase I. Pretreatment with honokiol prior to MG exposure reduced MG-induced mitochondrial dysfunction and alleviated MG-induced reduction of nitric oxide and PGC1α levels, suggesting that honokiol may induce mitochondrial biogenesis. It was concluded that honokiol could be useful in the attenuation of MG-induced cell damage.

  14. Avermectin induced inflammation damage in king pigeon brain.


    Chen, Li-Jie; Sun, Bao-Hong; Qu, Jian Ping; Xu, Shiwen; Li, Shu


    To determine the effect of Avermectin (AVM) on inflammation damage in king pigeon brain, eighty two-month-old American king pigeons were randomly divided into four groups, and were fed with either commercial diet or AVM-supplemented diet containing 20 mg kg(-1)diet, 40 mg kg(-1)diet, and 60 mg kg(-1)diet AVM for 30, 60 and 90 d, respectively. Then, the expression level of inflammatory factors (iNOS, PTGEs, NF-κB), histological damage, and ultra-structural damage were examined. It showed that AVM caused higher expressions (P<0.05) of iNOS, PTGEs, NF-κB with disorganized histological and ultra-structural structures in cerebrum, cerebellum, and optic lobe. Meanwhile, inflammatory and histopathological damage were induced by AVM in king pigeon brains. In addition, the main targeted organelle in nervous system was mitochondria, which indicated that mitochondria may be relevant to the process of inflammation induced by AVM. To our best knowledge, this is the first report to study the toxic effect of AVM on inflammatory damage in king pigeon. Thus, the information presented in this study is believed to be helpful in supplementing data for further AVM toxicity study.

  15. Overloaded training increases exercise-induced oxidative stress and damage.


    Palazzetti, Stephane; Richard, Marie-Jeanne; Favier, Alain; Margaritis, Irene


    We hypothesized that overloaded training (OT) in triathlon would induce oxidative stress and damage on muscle and DNA. Nine male triathletes and 6 male sedentary subjects participated in this study. Before and after a 4-week OT, triathletes exercised for a duathlon. Blood ratio of reduced vs. oxidized glutathione (GSH/GSSG), plasma thiobarbituric acid reactive substances (TBARS), leukocyte DNA damage, creatine kinase (CK), and CK-MB mass in plasma, erythrocyte superoxide dismutase (SOD) activity, erythrocyte and plasma glutathione peroxidase (GSH-Px) activities, and plasma total antioxidant status (TAS) were measured before and after OT in pre- and postexercise situations. Triathletes were overloaded in response to OT. In rest conditions, OT induced plasma GSH-Px activity increase and plasma TAS decrease (both p < 0.05). In exercise conditions, OT resulted in higher exercise-induced variations of blood GSH/GSSG ratio, TBARS level (both p < 0.05), and CK-MB mass (p < 0.01) in plasma; and decreased TAS response (p < 0.05). OT could compromise the antioxidant defense mechanism with respect to exercise-induced response. The resulting increased exercise-induced oxidative stress and further cellular susceptibility to damage needs more study.

  16. Zebrafish fin regeneration after cryoinjury-induced tissue damage

    PubMed Central

    Chassot, Bérénice; Pury, David


    ABSTRACT Although fin regeneration following an amputation procedure has been well characterized, little is known about the impact of prolonged tissue damage on the execution of the regenerative programme in the zebrafish appendages. To induce histolytic processes in the caudal fin, we developed a new cryolesion model that combines the detrimental effects of freezing/thawing and ischemia. In contrast to the common transection model, the damaged part of the fin was spontaneously shed within two days after cryoinjury. The remaining stump contained a distorted margin with a mixture of dead material and healthy cells that concomitantly induced two opposing processes of tissue debris degradation and cellular proliferation, respectively. Between two and seven days after cryoinjury, this reparative/proliferative phase was morphologically featured by displaced fragments of broken bones. A blastemal marker msxB was induced in the intact mesenchyme below the damaged stump margin. Live imaging of epithelial and osteoblastic transgenic reporter lines revealed that the tissue-specific regenerative programmes were initiated after the clearance of damaged material. Despite histolytic perturbation during the first week after cryoinjury, the fin regeneration resumed and was completed without further alteration in comparison to the simple amputation model. This model reveals the powerful ability of the zebrafish to restore the original appendage architecture after the extended histolysis of the stump. PMID:27215324

  17. Mitochondrial DNA damage induces apoptosis in senescent cells

    PubMed Central

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F


    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV–HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells. PMID:23868060

  18. Mitochondrial DNA damage induces apoptosis in senescent cells.


    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F


    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV-HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells.

  19. Computational modeling of process induced damage during plasma clean

    NASA Astrophysics Data System (ADS)

    Rauf, S.; Haggag, A.; Moosa, M.; Ventzek, P. L. G.


    When partially completed circuits come in contact with plasmas during integrated circuit fabrication, current from the plasma can potentially damage active devices on the wafer. A suite of computational models is used in this article to investigate damage to ultrathin (1.0-5.5nm) transistor gate dielectric (SiO2) during Ar /O2 based plasma cleaning in a capacitively coupled plasma reactor. This modeling infrastructure includes a two-dimensional plasma equipment model for relating process control parameters to ion and electron currents, a three-dimensional model for flux density calculation within a circular via, an electrostatic model for computing potential across the gate dielectric, and a percolation model to investigate dielectric damage characteristics. Computational results show that when the plasma current comes in contact with the gate dielectric, the gate dielectric rapidly charges up and the potential difference across the dielectric saturates at the level necessary to support the plasma induced current. The steady-state voltage across the dielectric determines the propensity of irreversible damage that can occur under this electrical stress. Gate dielectric damage was found to be most sensitively linked to dielectric thickness. As thin dielectrics (<2.0nm) are leaky, direct tunneling current flow ensures that the potential drop across the gate dielectric remains small. As a consequence, the dielectric is able to withstand the plasma current and the probability of damage is small. However, for thicker dielectrics where Fowler-Nordheim tunneling is dominant, a large voltage builds up across the gate dielectric due to the plasma induced current. The probability of thicker dielectrics getting damaged during the plasma process is therefore high. For given plasma conditions and gate dielectric thickness, current collection area (i.e., antenna size) determines the voltage buildup across the gate dielectric. Damage probability increases with the size of the

  20. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  1. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  2. Pattern Learning, Damage and Repair within Biological Neural Networks

    NASA Astrophysics Data System (ADS)

    Siu, Theodore; Fitzgerald O'Neill, Kate; Shinbrot, Troy


    Traumatic brain injury (TBI) causes damage to neural networks, potentially leading to disability or even death. Nearly one in ten of these patients die, and most of the remainder suffer from symptoms ranging from headaches and nausea to convulsions and paralysis. In vitro studies to develop treatments for TBI have limited in vivo applicability, and in vitro therapies have even proven to worsen the outcome of TBI patients. We propose that this disconnect between in vitro and in vivo outcomes may be associated with the fact that in vitro tests assess indirect measures of neuronal health, but do not investigate the actual function of neuronal networks. Therefore in this talk, we examine both in vitro and in silico neuronal networks that actually perform a function: pattern identification. We allow the networks to execute genetic, Hebbian, learning, and additionally, we examine the effects of damage and subsequent repair within our networks. We show that the length of repaired connections affects the overall pattern learning performance of the network and we propose therapies that may improve function following TBI in clinical settings.

  3. Contribution of endogenous and exogenous damage to the total radiation-induced damage in the bacterial spore

    SciTech Connect

    Jacobs, G.P.; Samuni, A.; Czapski, G.


    Radical scavengers such as polyethylene glycol 4000 and bovine albumin have been used to define the contribution of exogenous and endogenous damage to the total radiation-induced damage in aqueous buffered suspensions of Bacillus pumilus spores. The results indicate that this damage in the bacterial spore is predominantly endogenous.

  4. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  5. Investigation of the laser-induced damage of dispersive coatings

    NASA Astrophysics Data System (ADS)

    Angelov, Ivan B.; von Conta, Aaron; Trushin, Sergei A.; Major, Zsuzsanna; Karsch, Stefan; Krausz, Ferenc; Pervak, Vladimir


    Different dispersive coatings were tested in terms of laser-induced damage threshold by using a Ti:Sapphire laser yielding 1 mJ, 30 fs pulses at 500 Hz repetition rate at 790 nm central wavelength. The beam was focused down to 140 μm. Single layer coatings of Au, Ag, Nb2O5, SiO2, Ta2O5 and mixtures of Ta2O5 and silica were examined as well as different dispersive coatings. We observed a direct dependence of the damage threshold on the band gap of the materials used to produce the different samples. The damage threshold values for the dispersive coatings employing the same high index material lay within a range of 30% of each other.

  6. Statistical analysis of vibration-induced bone and joint damages.


    Schenk, T


    Vibration-induced damages to bones and joints are still occupational diseases with insufficient knowledge about causing and moderating factors and resulting damages. For a better understanding of these relationships also retrospective analyses of already acknowledged occupational diseases may be used. Already recorded detailed data for 203 in 1970 to 1979 acknowledged occupational diseases in the building industry and the building material industry of the GDR are the basis for the here described investigations. The data were gathered from the original documents of the occupational diseases and scaled in cooperation of an industrial engineer and an industrial physician. For the purposes of this investigations the data are to distinguish between data which describe the conditions of the work place (e.g. material, tools and posture), the exposure parameters (e.g. beginning of exposure and latency period) and the disease (e.g. anamnestical and radiological data). These data are treated for the use with sophisticated computerized statistical methods. The following analyses were carried out. Investigation of the connections between the several characteristics, which describe the occupational disease (health damages), including the comparison of the severity of the damages at the individual joints. Investigation of the side dependence of the damages. Investigation of the influence of the age at the beginning of the exposure and the age at the acknowledgement of the occupational disease and herewith of the exposure duration. Investigation of the effect of different occupational and exposure conditions.

  7. Mechanisms for microvascular damage induced by ultrasound-activated microbubbles

    SciTech Connect

    Chen Hong; Brayman, Andrew A.; Evan, Andrew P.; Matula, Thomas J.


    To provide insight into the mechanisms of microvascular damage induced by ultrasound-activated microbubbles, experimental studies were performed to correlate microvascular damage to the dynamics of bubble-vessel interactions. High-speed photomicrography was used to record single microbubbles interacting with microvessels in ex vivo tissue, under the exposure of short ultrasound pulses with a center frequency of 1 MHz and peak negative pressures (PNP) ranging from 0.8-4 MPa. Vascular damage associated with observed bubble-vessel interactions was either indicated directly by microbubble extravasation or examined by transmission electron microscopy (TEM) analyses. As observed previously, the high-speed images revealed that ultrasound-activated microbubbles could cause distention and invagination of adjacent vessel walls, and could form liquid jets in microvessels. Vessel distention, invagination, and liquid jets were associated with the damage of microvessels whose diameters were smaller than those of maximally expanded microbubbles. However, vessel invagination appeared to be the dominant mechanism for the damage of relative large microvessels.

  8. Reformulated meat products protect against ischemia-induced cardiac damage.


    Asensio-Lopez, M C; Lax, A; Sanchez-Mas, J; Avellaneda, A; Planes, J; Pascual-Figal, D A


    The protective effects of the antioxidants present in food are of great relevance for cardiovascular health. This study evaluates whether the extracts from reformulated meat products with a reduction in fat and/or sodium content exert a cardioprotective effect against ischemia-induced oxidative stress in cardiomyocytes, compared with non-meat foods. Ischemic damage caused loss of cell viability, increased reactive oxygen species and lipid peroxidation and decreased the antioxidant activity. Pretreatment for 24 h with digested or non-digested extracts from reformulated meat products led to protection against ischemia-induced oxidative damage: increased cell viability, reduced oxidative stress and restored the antioxidant activity. Similar results were obtained using extracts from tuna fish, but not with the extracts of green peas, salad or white beans. These results suggest that reformulated meat products have a beneficial impact in protecting cardiac cells against ischemia, and they may represent a source of natural antioxidants with benefits for cardiovascular health.

  9. Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

    PubMed Central

    Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.


    Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

  10. Phosphoinositide 3-kinase inhibitors induce DNA damage through nucleoside depletion

    PubMed Central

    Juvekar, Ashish; Hu, Hai; Yadegarynia, Sina; Lyssiotis, Costas A.; Ullas, Soumya; Lien, Evan C.; Bellinger, Gary; Son, Jaekyoung; Hok, Rosanna C.; Seth, Pankaj; Daly, Michele B.; Kim, Baek; Scully, Ralph; Asara, John M.; Cantley, Lewis C.; Wulf, Gerburg M.


    We previously reported that combining a phosphoinositide 3-kinase (PI3K) inhibitor with a poly-ADP Rib polymerase (PARP)-inhibitor enhanced DNA damage and cell death in breast cancers that have genetic aberrations in BRCA1 and TP53. Here, we show that enhanced DNA damage induced by PI3K inhibitors in this mutational background is a consequence of impaired production of nucleotides needed for DNA synthesis and DNA repair. Inhibition of PI3K causes a reduction in all four nucleotide triphosphates, whereas inhibition of the protein kinase AKT is less effective than inhibition of PI3K in suppressing nucleotide synthesis and inducing DNA damage. Carbon flux studies reveal that PI3K inhibition disproportionately affects the nonoxidative pentose phosphate pathway that delivers Rib-5-phosphate required for base ribosylation. In vivo in a mouse model of BRCA1-linked triple-negative breast cancer (K14-Cre BRCA1f/fp53f/f), the PI3K inhibitor BKM120 led to a precipitous drop in DNA synthesis within 8 h of drug treatment, whereas DNA synthesis in normal tissues was less affected. In this mouse model, combined PI3K and PARP inhibition was superior to either agent alone to induce durable remissions of established tumors. PMID:27402769

  11. Stochastics of diffusion induced damage in intercalation materials

    NASA Astrophysics Data System (ADS)

    Barai, Pallab; Mukherjee, Partha P.


    Fundamental understanding of the underlying diffusion-mechanics interplay in the intercalation electrode materials is critical toward improved life and performance of lithium-ion batteries for electric vehicles. Especially, diffusion induced microcrack formation in brittle, intercalation active materials, with emphasis on the grain/grain-boundary (GB) level implications, has been fundamentally investigated based on a stochastic modeling approach. Quasistatic damage evolution has been analyzed under lithium concentration gradient induced stress. Scaling of total amount of microcrack formation shows a power law variation with respect to the system size. Difference between the global and local roughness exponent indicates the existence of anomalous scaling. The deterioration of stiffness with respect to microcrack density displays two distinct regions of damage propagation; namely, diffused damage evolution and stress concentration driven localized crack propagation. Polycrystalline material microstructures with different grain sizes have been considered to study the diffusion-induced fracture in grain and GB regions. Intergranular crack paths are observed within microstructures containing softer GB region, whereas, transgranular crack paths have been observed in microstructures with relatively strong GB region. Increased tortuosity of the spanning crack has been attributed as the reason behind attaining increased fracture strength in polycrystalline materials with smaller grain sizes.

  12. A stochastic model of radiation-induced bone marrow damage

    SciTech Connect

    Cotlet, G.; Blue, T.E.


    A stochastic model, based on consensus principles from radiation biology, is used to estimate bone-marrow stem cell pool survival (CFU-S and stroma cells) after irradiation. The dose response model consists of three coupled first order linear differential equations which quantitatively describe time dependent cellular damage, repair, and killing of red bone marrow cells. This system of differential equations is solved analytically through the use of a matrix approach for continuous and fractionated irradiations. The analytic solutions are confirmed through the dynamical solution of the model equations using SIMULINK. Rate coefficients describing the cellular processes of radiation damage and repair, extrapolated to humans from animal data sets and adjusted for neutron-gamma mixed fields, are employed in a SIMULINK analysis of criticality accidents. The results show that, for the time structures which may occur in criticality accidents, cell survival is established mainly by the average dose and dose rate.

  13. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.


    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth


    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  14. Bacterial Genotoxins: Merging the DNA Damage Response into Infection Biology

    PubMed Central

    Grasso, Francesca; Frisan, Teresa


    Bacterial genotoxins are unique among bacterial toxins as their molecular target is DNA. The consequence of intoxication or infection is induction of DNA breaks that, if not properly repaired, results in irreversible cell cycle arrest (senescence) or death of the target cells. At present, only three bacterial genotoxins have been identified. Two are protein toxins: the cytolethal distending toxin (CDT) family produced by a number of Gram-negative bacteria and the typhoid toxin produced by Salmonella enterica serovar Typhi. The third member, colibactin, is a peptide-polyketide genotoxin, produced by strains belonging to the phylogenetic group B2 of Escherichia coli. This review will present the cellular effects of acute and chronic intoxication or infection with the genotoxins-producing bacteria. The carcinogenic properties and the role of these effectors in the context of the host-microbe interaction will be discussed. We will further highlight the open questions that remain to be solved regarding the biology of this unusual family of bacterial toxins. PMID:26270677

  15. Comparison of biologically damaging spectral solar ultraviolet radiation at a southern hemisphere sub-tropical site.


    Parisi, A V; Sabburg, J; Kimlin, M G


    The first dataset of a complete year of biologically damaging spectral UV at a sub-tropical latitude in the southern hemisphere has been presented. The new data provides a baseline dataset against which comparisons can be made in the future to establish if there have been any long term trends in the biologically damaging UV. The general shape of the variation of the daily biologically damaging exposures through the year depends on the relative response of the various action spectra at the different wavelengths. The ratio of the daily erythemal to actinic exposures drops by approximately 20 to 25% from winter to summer. The ratio of the erythemal to DNA exposures drops by approximately 50% over the same period. In contrast, the ratio of the erythemal to plant damage exposures is higher in summer compared to winter. This is due to the changes in the relative proportion of UVA to UVB wavebands and relative responses of the different action spectra. The relative changes for the different action spectra show that the erythemal action spectrum cannot be used as a proxy for other biologically damaging responses.

  16. Enhancement of ultrasonically induced cell damage by phthalocyanines in vitro.


    Milowska, Katarzyna; Gabryelak, Teresa


    In this work, erythrocytes from carp were used as a nucleated cell model to test the hypothesis that the phthalocyanines (zinc--ZnPc and chloroaluminium -AlClPc) enhance ultrasonically induced damage in vitro. In order to confirm and complete our earlier investigation, the influence of ultrasound (US) and phthalocyanines (Pcs) on unresearched cellular components, was studied. Red blood cells were exposed to 1 MHz continuous ultrasound wave (0.61 and/or 2.44 W/cm(2)) in the presence or absence of phthalocyanines (3 microM). To identify target cell damage, we studied hemolysis, membrane fluidity and morphology of erythrocytes. To demonstrate the changes in the fluidity of plasma membrane we used the spectrofluorimetric methods using two fluorescence probes: 1-[4-(trimethylamino)phenyl]-6-phenyl-1,3,5,-hexatriene (TMA-DPH) and 1,6-diphenyl-1,3,5-hexatriene (DPH). The effect of US and Pcs on nucleated erythrocytes morphology was estimated on the basis of microscopic observation. The enhancement of ultrasonically induced membrane damage by both phthalocyanines was observed in case of hemolysis, and membrane surface fluidity, in comparison to ultrasound. The authors also observed changes in the morphology of erythrocytes. The obtained results support the hypothesis that the Pcs enhance ultrasonically induced cell damage in vitro. Furthermore, the influence of ultrasound on phthalocyanines (Pcs) in medium and in cells was tested. The authors observed changes in the phthalocyanines absorption spectra in the medium and the increase in the intensity of phthalocyanines fluorescence in the cells. These data can suggest changes in the structure of phthalocyanines after ultrasound action.

  17. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.


    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  18. Prevention of downhill walking-induced muscle damage by non-damaging downhill walking

    PubMed Central

    Yamamoto, Masayoshi; Kanehisa, Hiroaki; Nosaka, Kazunori


    Purpose Mountain trekking involves level, uphill, and downhill walking (DW). Prolonged DW induces damage to leg muscles, reducing force generating ability and muscle coordination. These increase risks for more serious injuries and accidents in mountain trekking, thus a strategy to minimize muscle damage is warranted. It has been shown that low-intensity eccentric contractions confer protective effect on muscle damage induced by high-intensity eccentric contractions. This study tested the hypothesis that 5-min non-damaging DW would attenuate muscle damage induced by 40-min DW, but 5-min level walking (LW) would not. Methods Untrained young men were allocated (n = 12/group) to either a control or one of the two preconditioning groups (PRE-DW or PRE-LW). The PRE-DW and PRE-LW groups performed 5-min DW (-28%) and 5-min LW, respectively, at 5 km/h with a load of 10% body mass, 1 week before 40-min DW (-28%, 5 km/h, 10% load). The control group performed 40-min DW only. Maximal knee extension strength, plasma creatine kinase (CK) activity, and muscle soreness (0–100 mm visual analogue scale) were measured before and 24 h after 5-min DW and 5-min LW, and before and 24, 48, and 72 h after 40-min DW. Results No significant changes in any variables were evident after 5-min DW and 5-min LW. After 40-min DW, the control and PRE-LW groups showed significant (P<0.05) changes in the variables without significant differences between groups (control vs. PRE-LW; peak strength reduction: -19.2 ± 6.9% vs. -18.7 ± 11.0%, peak CK: 635.5 ± 306.0 vs. 639.6 ± 405.4 U/L, peak soreness: 81.4 ± 14.8 vs. 72.0 ± 29.2 mm). These changes were significantly (P<0.05) attenuated (47–64%) for the PRE-DW group (-9.9 ± 9.6%, 339.3 ± 148.4 U/L, 27.8 ± 16.8 mm). Conclusions The results supported the hypothesis and suggest that performing small volume of downhill walking is crucial in preparation for trekking. PMID:28288187

  19. Mechanism of site-specific DNA damage induced by ozone.


    Ito, Kimiko; Inoue, Sumiko; Hiraku, Yusuke; Kawanishi, Shosuke


    Ozone has been shown to induce lung tumors in mice. The reactivity of ozone with DNA in an aqueous solution was investigated by a DNA sequencing technique using 32P-labeled DNA fragments. Ozone induced cleavages in the deoxyribose-phosphate backbone of double-stranded DNA, which were reduced by hydroxyl radical scavengers, suggesting the participation of hydroxyl radicals in the cleavages. The ozone-induced DNA cleavages were enhanced with piperidine treatment, which induces cleavages at sites of base modification, but the inhibitory effect of hydroxyl radical scavengers on the piperidine-induced cleavages was limited. Main piperidine-labile sites were guanine and thymine residues. Cleavages at some guanine and thymine residues after piperidine treatment became more predominant with denatured single-stranded DNA. Exposure of calf thymus DNA to ozone resulted in a dose-dependent increase of the 8-oxo-7,8-dihydro-2'-deoxyguanosine formation, which was partially inhibited by hydroxyl radical scavengers. ESR studies using 5,5-dimethylpyrroline-N-oxide (DMPO) showed that aqueous ozone produced the hydroxyl radical adduct of DMPO. In addition, the fluorescein-dependent chemiluminescence was detected during the decomposition of ozone in a buffer solution and the enhancing effect of D2O was observed, suggesting the formation of singlet oxygen. However, no or little enhancing effect of D2O on the ozone-induced DNA damage was observed. These results suggest that DNA backbone cleavages were caused by ozone via the production of hydroxyl radicals, while DNA base modifications were mainly caused by ozone itself and the participation of hydroxyl radicals and/or singlet oxygen in base modifications is small, if any. A possible link of ozone-induced DNA damage to inflammation-associated carcinogenesis as well as air pollution-related carcinogenesis is discussed.

  20. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G


    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  1. Proton-induced radiation damage in germanium detectors

    SciTech Connect

    Bruckner, J.; Korfer, M.; Wanke, H. , Mainz ); Schroeder, A.N.F. ); Figes, D.; Dragovitsch, P. ); Englert, P.A.J. ); Starr, R.; Trombka, J.I. . Goddard Space Flight Center); Taylor, I. ); Drake, D.M.; Shunk, E.R. )


    High-purity germanium (HPGe) detectors will be used in future space missions for gamma-ray measurements and will be subject to interactions with energetic particles. To simulate this process several large-volume n-type HPGe detectors were incrementally exposed to a particle fluence of up to 10{sub 8} protons cm{sup {minus}2} (proton energy: 1.5 GeV) at different operating temperatures (90 to 120 K) to induce radiation damage. Basic scientific as well as engineering data on detector performance were collected. During the incremental irradiation, the peak shape produced by the detectors showed a significant change from a Gaussian shape to a broad complex structure. After the irradiation all detectors were thoroughly characterized by measuring many parameters. To remove the accumulated radiation damage the detectors were stepwise annealed at temperatures T {le} 110{degrees}C while staying specially designed cryostats. This paper shows that n-type HPGe detectors can be used in charged particles environments as high-energy resolution devices until a certain level of radiation damage is accumulated and that the damage can be removed at moderate annealing temperatures and the detector returned to operating condition.

  2. Sunscreens promote repair of ultraviolet radiation-induced dermal damage.


    Kligman, L H; Akin, F J; Kligman, A M


    Chronic UV irradiation profoundly damages the dermis of human and animal skin. These alterations were thought to be irreversible. Recently, we showed that substantial repair occurred in hairless mice after stopping UV exposure. A band of new connective tissue was laid down subepidermally. The present study focussed on whether repair would occur if animals were protected by sunscreens after dermal damage was induced and irradiation was continued. Albino hairless mice were exposed to Westinghouse FS20 sunlamps thrice weekly for 30 weeks. The daily dose of UV (UVB + UVA) was 0.17 J/cm2. Sunscreens of sun protection factors (SPF) 6 and 15 were applied after 10 and 20 weeks of irradiation. Biopsies were taken at 10, 20, 30, and 45 weeks of the experiment. With both sunscreens, especially SPF-15, previously damaged dermis was repaired during continued irradiation. Repair occurred in situ and, in severely damaged skin, in the novel form of subepidermal reconstruction zones of new connective tissue with parallel collagen bundles and a network of fine elastic fibers.

  3. Microscopic studies of cellular damage induced by compression waves in different environments

    NASA Astrophysics Data System (ADS)

    Bo, Chiara; Balzer, Jens; Brown, Katherine A.; Proud, William G.


    The cellular basis of induced-damage in biological samples under dynamic loading conditions is largely uncharacterized. In this study we propose a new approach to investigate the effects of compression waves on in-vitro grown Stem cells extracted from BALB/c mice. A modified split Hopkinson pressure bar system is used to simulate damage in the biological samples: the cells are inserted in a confinement chamber either in their growing media or on a 3D scaffold, they are subjected to compression waves and finally recovered for further analysis. The difference in mechanical impedance between the cells and the hosting environments is believed to be a key point in the generation of damage. To discriminate the effects of the different mechanical supports on cell morphology pre and after compression, membrane and cytoskeletal proteins disruptions are investigated using fluorescence confocal microscopy. Understanding the underlying mechanism of damage at the microscopic scale could set the basis for the development of therapeutic applications at the cellular level.

  4. Radiation-induced thymine base damage in replicating chromatin

    SciTech Connect

    Warters, R.L.; Childers, T.J.


    The efficiency of radiation-induced production of 5',6'-dihydroxydihydrothymine (t/sup ..gamma../)-type damage was determined in nascent and mature chromatin DNA for the dose range of 50 to 150 krad. These large doses affected neither the total fraction of nuclear DNA in chromatin subunits nor the nucleosome subunit repeat length. The DNA in nascent chromatin, however, was found to be 3.3 times more sensitive than mature chromatin DNA to ..gamma..-ray (/sup 137/Cs)-induced t/sup ..gamma../-type damage, while thymine damage of this type was uniformly distributed in the nucleosomal DNA of mature chromatin (i.e., in the nucleosome core and spacer DNA). The half-time for the transition of nascent DNA sensitivity to mature chromatin DNA sensitivity levels was the same as the half-time at 37/sup 0/C for the maturation of nascent into mature chromatin structure. The rate at which nascent chromatin matured was unaffected by radiation doses as large as 150 krad. The most logical explanation for the greater sensitivity of nascent DNA to radiation is the decreased concentration of histone chromosomal proteins in nascent chromatin.

  5. Exercise-Induced Muscle Damage and Running Economy in Humans

    PubMed Central

    Assumpção, Cláudio de Oliveira; Lima, Leonardo Coelho Rabello; Oliveira, Felipe Bruno Dias; Greco, Camila Coelho; Denadai, Benedito Sérgio


    Running economy (RE), defined as the energy demand for a given velocity of submaximal running, has been identified as a critical factor of overall distance running performance. Plyometric and resistance trainings, performed during a relatively short period of time (~15–30 days), have been successfully used to improve RE in trained athletes. However, these exercise types, particularly when they are unaccustomed activities for the individuals, may cause delayed onset muscle soreness, swelling, and reduced muscle strength. Some studies have demonstrated that exercise-induced muscle damage has a negative impact on endurance running performance. Specifically, the muscular damage induced by an acute bout of downhill running has been shown to reduce RE during subsequent moderate and high-intensity exercise (>65% VO2max). However, strength exercise (i.e., jumps, isoinertial and isokinetic eccentric exercises) seems to impair RE only for subsequent high-intensity exercise (~90% VO2max). Finally, a single session of resistance exercise or downhill running (i.e., repeated bout effect) attenuates changes in indirect markers of muscle damage and blunts changes in RE. PMID:23431253

  6. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope


    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  7. Mitochondrial injury and dysfunction in hypertension-induced cardiac damage

    PubMed Central

    Eirin, Alfonso; Lerman, Amir; Lerman, Lilach O.


    Hypertension remains an important modifiable risk factor for cardiovascular disease, associated with increased morbidity and mortality. Deciphering the mechanisms involved in the pathogenesis of hypertension is critical, as its prevalence continues increasing worldwide. Mitochondria, the primary cellular energy producers, are numerous in parenchymal cells of the heart, kidney, and brain, major target organs in hypertension. These membrane-bound organelles not only maintain cellular respiration but also modulate several functions of the cell including proliferation, apoptosis, generation of reactive oxygen species, and intracellular calcium homeostasis. Therefore, mitochondrial damage and dysfunction compromise overall cell functioning. In recent years, significant advances increased our understanding of mitochondrial morphology, bioenergetics, and homeostasis, and in turn of their role in several diseases, so that mitochondrial abnormalities and dysfunction have been identified in experimental models of hypertension. In this review, we summarize current knowledge of the contribution of dysfunctional mitochondria to the pathophysiology of hypertension-induced cardiac damage, as well as available evidence of mitochondrial injury-induced damage in other organs. Finally, we discuss the capability of antihypertensive therapy to ameliorate hypertensive mitochondrial injury, and the potential position of mitochondria as therapeutic targets in patients with hypertension. PMID:25385092

  8. Protective effect of curcumin against heavy metals-induced liver damage.


    García-Niño, Wylly Ramsés; Pedraza-Chaverrí, José


    Occupational or environmental exposures to heavy metals produce several adverse health effects. The common mechanism determining their toxicity and carcinogenicity is the generation of oxidative stress that leads to hepatic damage. In addition, oxidative stress induced by metal exposure leads to the activation of the nuclear factor (erythroid-derived 2)-like 2/Kelch-like ECH-associated protein 1/antioxidant response elements (Nrf2/Keap1/ARE) pathway. Since antioxidant and chelating agents are generally used for the treatment of heavy metals poisoning, this review is focused on the protective role of curcumin against liver injury induced by heavy metals. Curcumin has shown, in clinical and preclinical studies, numerous biological activities including therapeutic efficacy against various human diseases and anti-hepatotoxic effects against environmental or occupational toxins. Curcumin reduces the hepatotoxicity induced by arsenic, cadmium, chromium, copper, lead and mercury, prevents histological injury, lipid peroxidation and glutathione (GSH) depletion, maintains the liver antioxidant enzyme status and protects against mitochondrial dysfunction. The preventive effect of curcumin on the noxious effects induced by heavy metals has been attributed to its scavenging and chelating properties, and/or to the ability to induce the Nrf2/Keap1/ARE pathway. However, additional research is needed in order to propose curcumin as a potential protective agent against liver damage induced by heavy metals.

  9. Laser pointer induced macular damage: case report and mini review.


    Turaka, Kiran; Bryan, J Shepard; Gordon, Alan J; Reddy, Rahul; Kwong, Henry M; Sell, Clive H


    To report laser pointer induced damage to retina and choroid and briefly review literature. A case report of a 13-year old Caucasian boy developed blurry central vision and central scotoma in right eye (OD). He was exposed for one minute to class IIIA green laser pointer of 650 nm wavelength and 5 mW power. Clinical examination showed a grayish lesion in foveal region. Ancillary testing revealed disruption of the retinal pigment epithelial (RPE) layer in foveal region and indocyanine green angiography demonstrated evidence of choroidal hypofluorescence suggestive of choroidal infarction in OD. Visual acuity improved from 20/100 to 20/60 in one day and he was treated with tapering doses of oral prednisolone (40 mg) for 3 weeks. Laser pointer with a power of >5 mW caused damage to RPE in the macula. Children should not be given laser pointers as toys especially those with label of danger instructions.

  10. Dietary strategies to recover from exercise-induced muscle damage.


    Sousa, Mónica; Teixeira, Vítor H; Soares, José


    Exhaustive or unaccustomed intense exercise can cause exercise-induced muscle damage (EIMD) and its undesirable consequences may decrease the ability to exercise and to adhere to a training programme. This review briefly summarises the muscle damage process, focusing predominantly on oxidative stress and inflammation as contributing factors, and describes how nutrition may be positively used to recover from EIMD. The combined intake of carbohydrates and proteins and the use of antioxidants and/or anti-inflammatory nutrients within physiological ranges are interventions that may assist the recovery process. Although the works studying food instead of nutritional supplements are very scarce, their results seem to indicate that food might be a favourable option as a recovery strategy. To date, the only tested foods were milk, cherries, blueberries and pomegranate with promising results. Other potential solutions are foods rich in protein, carbohydrates, antioxidants and/or anti-inflammatory nutrients.

  11. Revision of laser-induced damage threshold evaluation from damage probability data

    SciTech Connect

    Bataviciute, Gintare; Grigas, Povilas; Smalakys, Linas; Melninkaitis, Andrius


    In this study, the applicability of commonly used Damage Frequency Method (DFM) is addressed in the context of Laser-Induced Damage Threshold (LIDT) testing with pulsed lasers. A simplified computer model representing the statistical interaction between laser irradiation and randomly distributed damage precursors is applied for Monte Carlo experiments. The reproducibility of LIDT predicted from DFM is examined under both idealized and realistic laser irradiation conditions by performing numerical 1-on-1 tests. A widely accepted linear fitting resulted in systematic errors when estimating LIDT and its error bars. For the same purpose, a Bayesian approach was proposed. A novel concept of parametric regression based on varying kernel and maximum likelihood fitting technique is introduced and studied. Such approach exhibited clear advantages over conventional linear fitting and led to more reproducible LIDT evaluation. Furthermore, LIDT error bars are obtained as a natural outcome of parametric fitting which exhibit realistic values. The proposed technique has been validated on two conventionally polished fused silica samples (355 nm, 5.7 ns).

  12. Trophic Complexity and the Adaptive Value of Damage-Induced Plant Volatiles

    PubMed Central

    Kaplan, Ian


    Indirect plant defenses are those facilitating the action of carnivores in ridding plants of their herbivorous consumers, as opposed to directly poisoning or repelling them. Of the numerous and diverse indirect defensive strategies employed by plants, inducible volatile production has garnered the most fascination among plant-insect ecologists. These volatile chemicals are emitted in response to feeding by herbivorous arthropods and serve to guide predators and parasitic wasps to their prey. Implicit in virtually all discussions of plant volatile-carnivore interactions is the premise that plants “call for help” to bodyguards that serve to boost plant fitness by limiting herbivore damage. This, by necessity, assumes a three-trophic level food chain where carnivores benefit plants, a theoretical framework that is conceptually tractable and convenient, but poorly depicts the complexity of food-web dynamics occurring in real communities. Recent work suggests that hyperparasitoids, top consumers acting from the fourth trophic level, exploit the same plant volatile cues used by third trophic level carnivores. Further, hyperparasitoids shift their foraging preferences, specifically cueing in to the odor profile of a plant being damaged by a parasitized herbivore that contains their host compared with damage from an unparasitized herbivore. If this outcome is broadly representative of plant-insect food webs at large, it suggests that damage-induced volatiles may not always be beneficial to plants with major implications for the evolution of anti-herbivore defense and manipulating plant traits to improve biological control in agricultural crops. PMID:23209381

  13. Role of neutrophils in acrylonitrile-induced gastric mucosal damage.


    Hamdy, Nadia M; Al-Abbasi, Fahad A; Alghamdi, Hassan A; Tolba, Mai F; Esmat, Ahmed; Abdel-Naim, Ashraf B


    Acrylonitrile (ACN) is a widely used intermediate in the manufacture of plastics, acrylic fibers, synthetic rubbers and resins that are used in a variety of products including food containers and medical devices. ACN is a possible human carcinogen and a documented animal carcinogen, with the stomach being an important target of its toxicity. ACN has been previously reported to require metabolic activation to reactive intermediates and finally to cyanide (CN⁻). The current study aimed at exploring the potential role of neutrophils in ACN-induced gastric damage in rats. Experimental neutropenia was attained by injecting rats with methotrexate. This significantly ameliorated gastric mucosal injury induced by ACN. This is evidenced by protection against the increase in gastric ulcer index, myeloperoxidase (MPO) activity and CN⁻ level. Also, neutropenia guarded against the decrease in prostaglandin E2 (PGE2), induction of oxidative stress and reduction of total nitrites and alleviated histopathological alterations in rat stomachs. These data indicate that neutrophil infiltration is, at least partly, involved in ACN-induced gastric damage in rats.

  14. The Protecting Effect of Deoxyschisandrin and Schisandrin B on HaCaT Cells against UVB-Induced Damage

    PubMed Central

    Hou, Wei; Gao, Wei; Wang, Datao; Liu, Qingxiu; Zheng, Siwen; Wang, Yingping


    Schisandra chinensis is a traditional Chinese medicine that has multiple biological activities, including antioxidant, anticancer, tonic, and anti-aging effects. Deoxyschisandrin (SA) and schisandrin B (SB), the two major lignans isolated from S. chinensis, exert high antioxidant activities in vitro and in vivo by scavenging free radicals, such as reactive oxygen species (ROS). Ultraviolet B-ray (UVB) radiation induces the production of ROS and DNA damage, which eventually leads to cell death by apoptosis. However, it is unknown whether SA or SB protects cells against UVB-induced cellular DNA damage. Our study showed that both SA and SB effectively protected HaCaT cells from UVB-induced cell death by antagonizing UVB-mediated production of ROS and induction of DNA damage. Our results showed that both SA and SB significantly prevented UVB-induced loss of cell viability using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assays. Dichloro-dihydro-fluorescein diacetate (DCFH-DA) assays showed that the production of ROS following UVB exposure was inhibited by treatment with SA and SB. Moreover, SA and SB decreased the UVB-induced DNA damage in HaCaT cells by comet assays. In addition, SA and SB also prevented UVB-induced cell apoptosis and the cleavage of caspase-3, caspase-8 and caspase-9. In a word, our results imply that the antioxidants SA and SB could protect cells from UVB-induced cell damage via scavenging ROS. PMID:25978330

  15. Induction and repair of HZE induced cytogenetic damage

    NASA Technical Reports Server (NTRS)

    Brooks, A. L.; Bao, S.; Rithidech, K.; Chrisler, W. B.; Couch, L. A.; Braby, L. A.


    Wistar rats were exposed to high-mass, high energy (HZE) 56Fe particles (1000 GeV/AMU) using the Alternating Gradient Synchrotron (AGS). The animals were sacrificed at 1-5 hours or after a 30-day recovery period. The frequency of micronuclei in the tracheal and the deep lung epithelial cells were evaluated. The relative effectiveness of 56Fe, for the induction of initial chromosome damage in the form of micronuclei, was compared to damage produced in the same biological system exposed to other types of high and low-LET radiation. It was demonstrated that for animals sacrificed at short times after exposure, the tracheal and lung epithelial cells, the 56Fe particles were 3.3 and 1.3 times as effective as 60Co in production of micronuclei, respectively. The effectiveness was also compared to that for exposure to inhaled radon. With this comparison, the 56Fe exposure of the tracheal epithelial cells and the lung epithelial cells were only 0.18 and 0.20 times as effective as radon in the production of the initial cytogenetic damage. It was suggested that the low relative effectiveness was related to potential for 'wasted energy' from the core of the 56Fe particles. When the animals were sacrificed after 30 days, the slopes of the dose-response relationships, which reflect the remaining level of damage, decreased by a factor of 10 for both the tracheal and lung epithelial cells. In both cases, the slope of the dose-response lines were no longer significantly different from zero, and the r2 values were very high. Lung epithelial cells, isolated from the animals sacrificed hours after exposure, were maintained in culture, and the micronuclei frequency evaluated after 4 and 6 subcultures. These cells were harvested at 24 and 36 days after the exposure. There was no dose-response detected in these cultures and no signs of genomic instability at either sample time.

  16. Oxidative damage and neurodegeneration in manganese-induced neurotoxicity

    SciTech Connect

    Milatovic, Dejan; Yu, Yingchun


    Exposure to excessive manganese (Mn) levels results in neurotoxicity to the extrapyramidal system and the development of Parkinson's disease (PD)-like movement disorder, referred to as manganism. Although the mechanisms by which Mn induces neuronal damage are not well defined, its neurotoxicity appears to be regulated by a number of factors, including oxidative injury, mitochondrial dysfunction and neuroinflammation. To investigate the mechanisms underlying Mn neurotoxicity, we studied the effects of Mn on reactive oxygen species (ROS) formation, changes in high-energy phosphates (HEP), neuroinflammation mediators and associated neuronal dysfunctions both in vitro and in vivo. Primary cortical neuronal cultures showed concentration-dependent alterations in biomarkers of oxidative damage, F{sub 2}-isoprostanes (F{sub 2}-IsoPs) and mitochondrial dysfunction (ATP), as early as 2 h following Mn exposure. Treatment of neurons with 500 {mu}M Mn also resulted in time-dependent increases in the levels of the inflammatory biomarker, prostaglandin E{sub 2} (PGE{sub 2}). In vivo analyses corroborated these findings, establishing that either a single or three (100 mg/kg, s.c.) Mn injections (days 1, 4 and 7) induced significant increases in F{sub 2}-IsoPs and PGE{sub 2} in adult mouse brain 24 h following the last injection. Quantitative morphometric analyses of Golgi-impregnated striatal sections from mice exposed to single or three Mn injections revealed progressive spine degeneration and dendritic damage of medium spiny neurons (MSNs). These findings suggest that oxidative stress, mitochondrial dysfunction and neuroinflammation are underlying mechanisms in Mn-induced neurodegeneration.

  17. Damage-free vibrational spectroscopy of biological materials in the electron microscope

    SciTech Connect

    Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L.; Dellby, Niklas; Lovejoy, Tracy C.; Wolf, Sharon G.; Cohen, Hagai


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an ‘aloof’ electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies o1 eV can be ‘safely’ investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C–H, N–H and C=O vibrational signatures with no observable radiation damage. Furthermore, the technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ~10nm, simultaneously combined with imaging in the electron microscope.

  18. Damage-free vibrational spectroscopy of biological materials in the electron microscope

    PubMed Central

    Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L.; Dellby, Niklas; Lovejoy, Tracy C.; Wolf, Sharon G.; Cohen, Hagai


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an ‘aloof' electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies <1 eV can be ‘safely' investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C–H, N–H and C=O vibrational signatures with no observable radiation damage. The technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ∼10 nm, simultaneously combined with imaging in the electron microscope. PMID:26961578

  19. Gender differences in alcohol-induced neurotoxicity and brain damage.


    Alfonso-Loeches, Silvia; Pascual, María; Guerri, Consuelo


    Considerable evidence has demonstrated that women are more vulnerable than men to the toxic effects of alcohol, although the results as to whether gender differences exist in ethanol-induced brain damage are contradictory. We have reported that ethanol, by activating the neuroimmune system and Toll-like receptors 4 (TLR4), can cause neuroinflammation and brain injury. However, whether there are gender differences in alcohol-induced neuroinflammation and brain injury are currently controversial. Using the brains of TLR4(+/+) and TLR4(-/-) (TLR4-KO) mice, we report that chronic ethanol treatment induces inflammatory mediators (iNOS and COX-2), cytokines (IL-1β, TNF-α), gliosis processes, caspase-3 activation and neuronal loss in the cerebral cortex of both female and male mice. Conversely, the levels of these parameters tend to be higher in female than in male mice. Using an in vivo imaging technique, our results further evidence that ethanol treatment triggers higher GFAP levels and lower MAP-2 levels in female than in male mice, suggesting a greater effect of ethanol-induced astrogliosis and less MAP-2(+) neurons in female than in male mice. Our results further confirm the pivotal role of TLR4 in alcohol-induced neuroinflammation and brain damage since the elimination of TLR4 protects the brain of males and females against the deleterious effects of ethanol. In short, the present findings demonstrate that, during the same period of ethanol treatment, females are more vulnerable than males to the neurotoxic/neuroinflammatory effects of ethanol, thus supporting the view that women are more susceptible than men to the medical consequences of alcohol abuse.

  20. Protective Effect of Acacia nilotica (L.) against Acetaminophen-Induced Hepatocellular Damage in Wistar Rats

    PubMed Central

    Kannan, Narayanan; Sakthivel, Kunnathur Murugesan; Guruvayoorappan, Chandrasekaran


    The potential biological functions of A. nilotica have long been described in traditional system of medicine. However, the protective effect of A. nilotica on acetaminophen-induced hepatotoxicity is still unknown. The present study attempted to investigate the protective effect of A. nilotica against acetaminophen-induced hepatic damage in Wistar rats. The biochemical liver functional tests Alanine transaminase (ALT), Aspartate transaminase (AST), Alkaline phosphatase (ALP), total bilirubin, total protein, oxidative stress test (Lipid peroxidation), antioxidant parameter glutathione (GSH), and histopathological changes were examined. Our results show that the pretreatment with A. nilotica (250 mg/kg·bw) orally revealed attenuation of serum activities of ALT, AST, ALP, liver weight, and total bilirubin levels that were enhanced by administration of acetaminophen. Further, pretreatment with extract elevated the total protein and GSH level and decreased the level of LPO. Histopathological analysis confirmed the alleviation of liver damage and reduced lesions caused by acetaminophen. The present study undoubtedly provides a proof that hepatoprotective action of A. nilotica extract may rely on its effect on reducing the oxidative stress in acetaminophen-induced hepatic damage in rat model. PMID:23864853

  1. Cellular track model of biological damage to mammalian cell cultures from galactic cosmic rays

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Katz, Robert; Wilson, John W.; Townsend, Lawrence W.; Nealy, John E.; Shinn, Judy L.


    The assessment of biological damage from the galactic cosmic rays (GCR) is a current interest for exploratory class space missions where the highly ionizing, high-energy, high-charge ions (HZE) particles are the major concern. The relative biological effectiveness (RBE) values determined by ground-based experiments with HZE particles are well described by a parametric track theory of cell inactivation. Using the track model and a deterministic GCR transport code, the biological damage to mammalian cell cultures is considered for 1 year in free space at solar minimum for typical spacecraft shielding. Included are the effects of projectile and target fragmentation. The RBE values for the GCR spectrum which are fluence-dependent in the track model are found to be more severe than the quality factors identified by the International Commission on Radiological Protection publication 26 and seem to obey a simple scaling law with the duration period in free space.

  2. Simulation of ion induced radiation damage in cells

    NASA Astrophysics Data System (ADS)

    Friedland, W.; Jacob, P.; Paretzke, H. G.; Ottolenghi, A.; Ballarini, F.; Dingfelder, M.

    The biophysical simulation code PARTRAC has been used in several studies of DNA damage induced by various radiation qualities including photons electrons protons alphas and ions heavier than alpha particles Ion-electron interaction cross sections are taken from isotachic protons scaled by Z eff 2 with the effective charge calculated according to the Barkas formula Recently ion type dependent angular distributions were introduced for intermediate secondary electron energies taking into account the different kinematic scaling of the constituents of the electron spectra Calculated stopping powers radial dose distributions and secondary electron spectra were found in good agreement with available experimental and theoretical results Radiation damage to DNA is determined in PARTRAC by superposition of the calculated track structures with a DNA target model taking into account direct effects from coincidences of ionisations and atoms within the DNA helix as well as indirect effects due to interactions of OH radicals produced in water surrounding the DNA For a simulation of radiation effects in human cells this target model comprises several genomic structure levels from the DNA double-helix up to chromosomes Calculated DNA damage due to irradiation of human fibroblast cells by ions of boron nitrogen and neon was compared to corresponding experimental data The calculated total yield of DSB per dose showed saturation behaviour with an RBE of about 2 whereas experimental data had a decreasing tendency with increasing LET to RBE values

  3. Bee products prevent agrichemical-induced oxidative damage in fish.


    Ferreira, Daiane; Rocha, Helio Carlos; Kreutz, Luiz Carlos; Loro, Vania Lucia; Marqueze, Alessandra; Koakoski, Gessi; da Rosa, João Gabriel Santos; Gusso, Darlan; Oliveira, Thiago Acosta; de Abreu, Murilo Sander; Barcellos, Leonardo José Gil


    In southern South America and other parts of the world, aquaculture is an activity that complements agriculture. Small amounts of agrichemicals can reach aquaculture ponds, which results in numerous problems caused by oxidative stress in non-target organisms. Substances that can prevent or reverse agrichemical-induced oxidative damage may be used to combat these effects. This study includes four experiments. In each experiment, 96 mixed-sex, 6-month-old Rhamdia quelen (118±15 g) were distributed into eight experimental groups: a control group that was not exposed to contaminated water, three groups that were exposed to various concentrations of bee products, three groups that were exposed to various concentrations of bee products plus tebuconazole (TEB; Folicur 200 CE™) and a group that was exposed to 0.88 mg L(-1) of TEB alone (corresponding to 16.6% of the 96-h LC50). We show that waterborne bee products, including royal jelly (RJ), honey (H), bee pollen (BP) and propolis (P), reversed the oxidative damage caused by exposure to TEB. These effects were likely caused by the high polyphenol contents of these bee-derived compounds. The most likely mechanism of action for the protective effects of bee products against tissue oxidation and the resultant damage is that the enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST) are increased.

  4. Quercetin protection against ciprofloxacin induced liver damage in rats.


    Taslidere, E; Dogan, Z; Elbe, H; Vardi, N; Cetin, A; Turkoz, Y


    Ciprofloxacin is a common, broad spectrum antibacterial agent; however, evidence is accumulating that ciprofloxacin may cause liver damage. Quercetin is a free radical scavenger and antioxidant. We investigated histological changes in hepatic tissue of rats caused by ciprofloxacin and the effects of quercetin on these changes using histochemical and biochemical methods. We divided 28 adult female Wistar albino rats into four equal groups: control, quercetin treated, ciprofloxacin treated, and ciprofloxacin + quercetin treated. At the end of the experiment, liver samples were processed for light microscopic examination and biochemical measurements. Sections were prepared and stained with hematoxylin and eosin, and a histopathologic damage score was calculated. The sections from the control group appeared normal. Hemorrhage, inflammatory cell infiltration and intracellular vacuolization were observed in the ciprofloxacin group. The histopathological findings were reduced in the group treated with quercetin. Significant differences were found between the control and ciprofloxacin groups, and between the ciprofloxacin and ciprofloxacin + quercetin groups. Quercetin administration reduced liver injury caused by ciprofloxacin in rats. We suggest that quercetin may be useful for preventing ciprofloxacin induced liver damage.

  5. Bee Products Prevent Agrichemical-Induced Oxidative Damage in Fish

    PubMed Central

    Ferreira, Daiane; Rocha, Helio Carlos; Kreutz, Luiz Carlos; Loro, Vania Lucia; Marqueze, Alessandra; Koakoski, Gessi; Santos da Rosa, João Gabriel; Gusso, Darlan; Oliveira, Thiago Acosta; de Abreu, Murilo Sander; Barcellos, Leonardo José Gil


    In southern South America and other parts of the world, aquaculture is an activity that complements agriculture. Small amounts of agrichemicals can reach aquaculture ponds, which results in numerous problems caused by oxidative stress in non-target organisms. Substances that can prevent or reverse agrichemical-induced oxidative damage may be used to combat these effects. This study includes four experiments. In each experiment, 96 mixed-sex, 6-month-old Rhamdia quelen (118±15 g) were distributed into eight experimental groups: a control group that was not exposed to contaminated water, three groups that were exposed to various concentrations of bee products, three groups that were exposed to various concentrations of bee products plus tebuconazole (TEB; Folicur 200 CE™) and a group that was exposed to 0.88 mg L−1 of TEB alone (corresponding to 16.6% of the 96-h LC50). We show that waterborne bee products, including royal jelly (RJ), honey (H), bee pollen (BP) and propolis (P), reversed the oxidative damage caused by exposure to TEB. These effects were likely caused by the high polyphenol contents of these bee-derived compounds. The most likely mechanism of action for the protective effects of bee products against tissue oxidation and the resultant damage is that the enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST) are increased. PMID:24098336

  6. Photodynamic therapy induced vascular damage: an overview of experimental PDT

    NASA Astrophysics Data System (ADS)

    Wang, W.; Moriyama, L. T.; Bagnato, V. S.


    Photodynamic therapy (PDT) has been developed as one of the most important therapeutic options in the treatment of cancer and other diseases. By resorting to the photosensitizer and light, which convert oxygen into cytotoxic reactive oxygen species (ROS), PDT will induce vascular damage and direct tumor cell killing. Another consequence of PDT is the microvascular stasis, which results in hypoxia and further produces tumor regression. To improve the treatment with PDT, three promising strategies are currently attracting much interest: (1) the combination of PDT and anti-angiogenesis agents, which more effectively prevent the proliferation of endothelial cells and the formation of new blood vessels; (2) the nanoparticle-assisted delivery of photosensitizer, which makes the photosensitizer more localized in tumor sites and thus renders minimal damage to the normal tissues; (3) the application of intravascular PDT, which can avoid the loss of energy during the transmission and expose the target area directly. Here we aim to review the important findings on vascular damage by PDT on mice. The combination of PDT with other approaches as well as its effect on cancer photomedicine are also reviewed.

  7. Solvent effect induced solute damage in an organic inner salt.


    Shui, Min; Jin, Xiao; Li, Zhongguo; Yang, Junyi; Shi, Guang; Zhang, Xueru; Wang, Yuxiao; Yang, Kun; Wei, Tai-huei; Song, Yinglin


    Nonlinear absorption of a newly synthesized organic inner salt Ge-150 dissolved in four different solvents (DMF, DMSO, acetonitrile and acetone) is investigated by the Z-scan technique with both nanosecond and picosecond pulses. When pulse energy surpasses a threshold and pulse-to-pulse separation is shorter than a characteristic time, all the four solutions show absorption weakening induced by cross-pulse effects in the picosecond regime. However, only two of them (Ge-150 dissolved in DMF and DMSO) show this weakening in the nanosecond regime. By conducting a simple verification experiment, we verify this absorption weakening is induced by solute damage related to solvent effect rather than solute migration. A simple theoretical model is proposed to interpret the experimental phenomenon.

  8. Anchor-induced chondral damage in the hip.


    Matsuda, Dean K; Bharam, Srino; White, Brian J; Matsuda, Nicole A; Safran, Marc


    The purpose of this study is to investigate the outcomes from anchor-induced chondral damage of the hip, both with and without frank chondral penetration. A multicenter retrospective case series was performed of patients with chondral deformation or penetration during initial hip arthroscopic surgery. Intra-operative findings, post-surgical clinical courses, hip outcome scores and descriptions of arthroscopic treatment in cases requiring revision surgery and anchor removal are reported. Five patients (three females) of mean age 32 years (range, 16-41 years) had documented anchor-induced chondral damage with mean 3.5 years (range, 1.5-6.0 years) follow-up. The 1 o'clock position (four cases) and anterior and mid-anterior portals (two cases each) were most commonly implicated. Two cases of anchor-induced acetabular chondral deformation without frank penetration had successful clinical and radiographic outcomes, while one case progressed from deformation to chondral penetration with clinical worsening. Of the cases that underwent revision hip arthroscopy, all three had confirmed exposed hard anchors which were removed. Two patients have had clinical improvement and one patient underwent early total hip arthroplasty. Anchor-induced chondral deformation without frank chondral penetration may be treated with close clinical and radiographic monitoring with a low threshold for revision surgery and anchor removal. Chondral penetration should be treated with immediate removal of offending hard anchor implants. Preventative measures include distal-based portals, small diameter and short anchors, removable hard anchors, soft suture-based anchors, curved drill and anchor insertion instrumentation and attention to safe trajectories while visualizing the acetabular articular surface.

  9. Laser induced damage in optical materials: tenth ASTM symposium.


    Glass, A J; Guenther, A H


    The tenth annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 12-14 September 1978. The symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy, and the Office of Naval Research. About 175 scientists attended, including representatives of the United Kingdom, France, Canada, Japan, West Germany, and the Soviet Union. The symposium was divided into sessions concerning the measurement of absorption characteristics, bulk material properties, mirrors and surfaces, thin film damage, coating materials and design, and breakdown phenomena. As in previous years, the emphasis of the papers presented was directed toward new frontiers and new developments. Particular emphasis was given to materials for use from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was also discussed. In commemoration of the tenth symposium in this series, a number of comprehensive review papers were presented to assess the state of the art in various facets of laser induced damage in optical materials. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons. The eleventh annual symposium is scheduled for 30-31 October 1979 at the National Bureau of Standards, Boulder, Colorado.

  10. Scaling Relations for Intercalation Induced Damage in Electrodes

    SciTech Connect

    Chen, Chien-Fan; Barai, Pallab; Smith, Kandler; Mukherjee, Partha P.


    Mechanical degradation, owing to intercalation induced stress and microcrack formation, is a key contributor to the electrode performance decay in lithium-ion batteries (LIBs). The stress generation and formation of microcracks are caused by the solid state diffusion of lithium in the active particles. Here in this work, scaling relations are constructed for diffusion induced damage in intercalation electrodes based on an extensive set of numerical experiments with a particle-level description of microcrack formation under disparate operating and cycling conditions, such as temperature, particle size, C-rate, and drive cycle. The microcrack formation and evolution in active particles is simulated based on a stochastic methodology. A reduced order scaling law is constructed based on an extensive set of data from the numerical experiments. The scaling relations include combinatorial constructs of concentration gradient, cumulative strain energy, and microcrack formation. Lastly, the reduced order relations are further employed to study the influence of mechanical degradation on cell performance and validated against the high order model for the case of damage evolution during variable current vehicle drive cycle profiles.

  11. Scaling Relations for Intercalation Induced Damage in Electrodes

    SciTech Connect

    Chen, Chien-Fan; Barai, Pallab; Smith, Kandler; Mukherjee, Partha P.


    Mechanical degradation, owing to intercalation induced stress and microcrack formation, is a key contributor to the electrode performance decay in lithium-ion batteries (LIBs). The stress generation and formation of microcracks are caused by the solid state diffusion of lithium in the active particles. In this work, scaling relations are constructed for diffusion induced damage in intercalation electrodes based on an extensive set of numerical experiments with a particle-level description of microcrack formation under disparate operating and cycling conditions, such as temperature, particle size, C-rate, and drive cycle. The microcrack formation and evolution in active particles is simulated based on a stochastic methodology. A reduced order scaling law is constructed based on an extensive set of data from the numerical experiments. The scaling relations include combinatorial constructs of concentration gradient, cumulative strain energy, and microcrack formation. The reduced order relations are further employed to study the influence of mechanical degradation on cell performance and validated against the high order model for the case of damage evolution during variable current vehicle drive cycle profiles.

  12. Scaling Relations for Intercalation Induced Damage in Electrodes


    Chen, Chien-Fan; Barai, Pallab; Smith, Kandler; ...


    Mechanical degradation, owing to intercalation induced stress and microcrack formation, is a key contributor to the electrode performance decay in lithium-ion batteries (LIBs). The stress generation and formation of microcracks are caused by the solid state diffusion of lithium in the active particles. Here in this work, scaling relations are constructed for diffusion induced damage in intercalation electrodes based on an extensive set of numerical experiments with a particle-level description of microcrack formation under disparate operating and cycling conditions, such as temperature, particle size, C-rate, and drive cycle. The microcrack formation and evolution in active particles is simulated based onmore » a stochastic methodology. A reduced order scaling law is constructed based on an extensive set of data from the numerical experiments. The scaling relations include combinatorial constructs of concentration gradient, cumulative strain energy, and microcrack formation. Lastly, the reduced order relations are further employed to study the influence of mechanical degradation on cell performance and validated against the high order model for the case of damage evolution during variable current vehicle drive cycle profiles.« less

  13. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.


    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke


    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles.

  14. Damages of Biological Components in Bacteria and Bacteriophages Exposed to Atmospheric Non-thermal Plasma

    NASA Astrophysics Data System (ADS)

    Mizuno, Akira; Yasuda, Hachiro

    Mechanism of inactivation of bio-particles exposed to dielectric barrier discharge, DBD, has been studied using E. coli and bacteriophages. States of different biological components were monitored during the course of inactivation. Analysis of green fluorescent protein, GFP, introduced into E.coli cells proved that Non-thermal Plasma, NTP causes a prominent protein damages without cutting peptide bonds. We have developed a biological assay which evaluates in vitro DNA damage of the bacteriophages. Bacteriophage λ having double stranded DNA was exposed to DBD, then DNA was purified and subjected to in vitro DNA packaging reactions. The re-packaged phages consist of the DNA from discharged phages and brand-new coat proteins. Survival curves of the re-packaged phages showed extremely large D value (D = 25 s) compared to the previous D value (D = 3 s) from the discharged phages. The results indicate that DNA damage hardly contributed to the inactivation, and the damage in coat proteins is responsible for inactivation of the phages. M13 phages having single stranded DNA were also examined with the same manner. In this case, damage to DNA was as severe as that of the coat proteins.

  15. Diethylstilbestrol induces oxidative DNA damage, resulting in apoptosis of spermatogonial stem cells in vitro.


    Habas, Khaled; Brinkworth, Martin H; Anderson, Diana


    The spermatogonial stem cells (SSCs) are the only germline stem cells in adults that are responsible for the transmission of genetic information from mammals to the next generation. SSCs play a very important role in the maintenance of progression of spermatogenesis and help provide an understanding of the reproductive biology of future gametes and a strategy for diagnosis and treatment of infertility and male reproductive toxicity. Androgens/oestrogens are very important for the suitable maintenance of male germ cells. There is also evidence confirming the damaging effects of oestrogen-like compounds on male reproductive health. We investigated the effects in vitro, of diethylstilbestrol (DES) on mouse spermatogonial stem cells separated using Staput unit-gravity velocity sedimentation, evaluating any DNA damage using the Comet assay and apoptotic cells in the TUNEL assay. Immunocytochemistry assays showed that the purity of isolated mouse spermatogonial cells was 90%, and the viability of these isolated cells was over 96%. Intracellular superoxide anion production (O2(-)) in SSCs was detected using p-Nitro Blue Tetrazolium (NBT) assay. The viability of cells after DES treatment was examined in the CCK8 (cell counting kit-8) cytotoxicity assay. The results showed that DES-induced DNA damage causes an increase in intracellular superoxide anions which are reduced by the flavonoid, quercetin. Investigating the molecular mechanisms and biology of SSCs provides a better understanding of spermatogonial stem cell regulation in the testis.

  16. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.


    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  17. Risk of Eye Damage from the Wavelength-Dependent Biologically Effective UVB Spectrum Irradiances

    PubMed Central

    Wang, Fang; Gao, Qian; Hu, Liwen; Gao, Na; Ge, Tiantian; Yu, Jiaming; Liu, Yang


    A number of previous studies have discussed the risk of eye damage from broadband ultraviolet (UV) radiation. As the biologically damaging effectiveness of UV irradiation on the human body is known to be wavelength-dependent, it is necessary to study the distribution of the UV spectral irradiance. In order to quantify the ocular biologically effective UV (UVBE) irradiance exposure of different wavelengths and assess the risk of eye damage, UV exposure values were measured at Sanya, China (18.4° N, 109.7°E, altitude 18 m), using a manikin and a dual-detector spectrometer to measure simultaneously the ocular exposure and ambient UV spectral irradiance data and solar elevation angle (SEA) range (approximately 7°–85°). The present study uses the ocular UV spectral irradiance exposure weighted with the action spectra for photokeratitis, photoconjunctivitis and cataracts to calculate the ocular UVBE irradiance exposure for photokeratitis (UVBEpker), photoconjunctivitis (UVBEpcon) and cataracts (UVBEcat). We found that the ocular exposure to UV irradiance is strongest in the 30°–60° SEA range when ∼50% of ocular exposure to UV irradiance on a summer’s day is received. In the 7°–30° SEA range, all the biologically highly effective wavelengths of UVBEpker, UVBEpcon and UVBEcat irradiances are at 300 nm. However, in other SEA ranges the biologically highly effective wavelengths of UVBEpker, UVBEpcon and UVBEcat irradiances are different, corresponding to 311 nm, 300 nm and 307 nm, respectively. PMID:23284960

  18. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central


    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  19. DNA damage induced by low energy electron collision and new experimental setup for further studying DNA damage by plasma

    NASA Astrophysics Data System (ADS)

    Park, Yeunsoo; Sanche, Leon; Wagner, Richard


    Low energy electrons (LEEs; below 10 eV) are the most abundant among the radiolytic species generated along the high energy radiation track in living cell. And these electrons are also one of major components with ions and photon in plasma. Interestingly, it has turned out that LEEs can create DNA damages such as base release, single- and double- strand breaks (SSB and DSB) via indirect action named dissociative electron attachment (DEA). The purposes of this study are to further find out exact mechanisms of DNA damage by LEEs at the molecular level and to verify new DNA damage like structural alteration on DNA subunits. And we will expand our study to DNA damage by plasma source to develop plasma-based new medical and biological applications. We are currently setting new experimental system for reaching our goals. We will show some recent results about new finding DNA modification damage and some experimental designs and working principles.

  20. Earthquake-induced Landslidingand Ground Damage In New Zealand

    NASA Astrophysics Data System (ADS)

    Hancox, G. T.; Perrin, N. D.; Dellow, G. D.

    A study of landsliding caused by 22 historical earthquakes in New Zealand was completed at the end of 1997 (Hancox et al., 1997). The main aims of that study were to determine: (a) the nature and extent of landsliding and other ground damage (sand boils, subsidence and lateral spreading due to soil liquefaction) caused by historical earthquakes; (b) relationships between landsliding and earthquake magnitude, epicentre, faulting, geology and topography; (c) improved environmental criteria and ground classes for assigning MM intensities and seismic hazard assessments in N.Z. The data and results of the 1997 study have recently been summarised and expanded (Hancox et al., in press), and are described in this paper. Relationships developed from these studies indicate that the minimum magnitude for earthquake-induced landsliding (EIL) in N.Z. is about M 5, with significant landsliding occurring at M 6 or greater. The minimum MM intensity for landsliding is MM6, while the most common intensities for significant landsliding are MM7-8. The intensity threshold for soil liquefaction in New Zealand was found to be MM7 for sand boils, and MM8 for lateral spreading, although such effects may also occur at one intensity level lower in highly susceptible materials. The minimum magnitude for liquefaction phenomena in N.Z. is about M 6, compared to M 5 overseas where highly susceptible soils are probably more widespread. Revised environmental response criteria (landsliding, subsidence, liquefaction-induced sand boils and lateral spreading) have also been established for the New Zealand MM Intensity Scale, and provisional landslide susceptibility Ground Classes developed for assigning MM intensities in areas where there are few buildings. Other new data presented include a size/frequency distribution model for earthquake-induced landslides over the last 150 years and a preliminary EIL Opportunity model for N.Z. The application of EIL data and relationships for seismic hazard

  1. Mechanisms of Microwave Induced Damage in Biologic Materials

    DTIC Science & Technology


    Logarithmically growing cultures of murine L929 cells were maintained in Eagle’s minimum essential culture medium with 5 % fetal bovine serum. Daudi cells were...grown in RPMI 1640 medium supplemented with 20% fetal bovine serum. Cells were plated 24 h prior to microwave exposure. To avoid serum stimulation of ODC...growing cultures of murine L929 cells, maintained in Eagle’s minimum essential culture medium with 5% fetal bovine serum, were plated 24 h prior to

  2. Mechanisms of Microwave Induced Damage in Biologic Materials

    DTIC Science & Technology


    display senescence after multiple population doublings (14). Fibroblasts of Clone 12 BE, derived from a patient with the disease xeroderma pigmentosum ...were also employed. The xeroderma pigmentosum (XP) cells are deficient in DNA repair (6), a genetic defect which produced the disease condition in the...SARs as high as 1500-1600 mW/g. 2.3.3 Xeroderma Pigmentosum (Clone 12BE) Irradiations To supplement the CW data on IMR-90 an additional set of

  3. Mechanisms of Microwave Induced Damage in Biologic Materials

    DTIC Science & Technology


    transcription from exposure to electromagnetic fields. Bioelectro - magnetics, 11:297-312. Maffeo, S., A. A. Brayman, M. W. Miler, E. L. Carstensen, V...613-618. Martin, A. H. (1988) Magnetic fields and time dependent effects on development. Bioelectro - magnetics, 9:393-396. Martin, A. H. (1990) ELF...under isothermal conditions. Bioelectro - magnetics, 11:47-56. Cossarizza, A., D. Miti, F. Bersani, M. Cantini, R. Cadossi, A. Sacchi and C. Franceschi

  4. Mechanisms of Microwave Induced Damage in Biologic Materials.

    DTIC Science & Technology


    Radiat. Biol. 52,1 787-793 (1987). 7. A. H. Martin, Magnetic fields and time dependent effects on development, Bioelectro - magnetics 9, 393-396 (1988...of the effect of ELF on oncogene expression in normal and transformed human cells, presented at the Thirteenth Annual Meeting of the Bioelectro

  5. Liposomal Antioxidants for Protection against Oxidant-Induced Damage

    PubMed Central

    Suntres, Zacharias E.


    Reactive oxygen species (ROS), including superoxide anion, hydrogen peroxide, and hydroxyl radical, can be formed as normal products of aerobic metabolism and can be produced at elevated rates under pathophysiological conditions. Overproduction and/or insufficient removal of ROS result in significant damage to cell structure and functions. In vitro studies showed that antioxidants, when applied directly and at relatively high concentrations to cellular systems, are effective in conferring protection against the damaging actions of ROS, but results from animal and human studies showed that several antioxidants provide only modest benefit and even possible harm. Antioxidants have yet to be rendered into reliable and safe therapies because of their poor solubility, inability to cross membrane barriers, extensive first-pass metabolism, and rapid clearance from cells. There is considerable interest towards the development of drug-delivery systems that would result in the selective delivery of antioxidants to tissues in sufficient concentrations to ameliorate oxidant-induced tissue injuries. Liposomes are biocompatible, biodegradable, and nontoxic artificial phospholipid vesicles that offer the possibility of carrying hydrophilic, hydrophobic, and amphiphilic molecules. This paper focus on the use of liposomes for the delivery of antioxidants in the prevention or treatment of pathological conditions related to oxidative stress. PMID:21876690

  6. Prevention of chloride-induced corrosion damage to bridges

    SciTech Connect

    Cramer, Stephen D.; Covino, Bernard S., Jr.; Bullard, Sophie J.; Holcomb, Gordon R.; Russell, James H.; Ziomek-Moroz, Margaret; Virmani, Y.P. | Butler, J.T.; Nelson, F.J. | Thompson, N.G.


    The annual direct cost of bridge infrastructure corrosion to the U.S. economy is estimated at $8.3 billion, with indirect costs approximately 10 times higher. Of the approximately 600000 bridges in the U.S., between 15% and 20% are listed as ?structurally deficient,? frequently due to corrosion damage. Five technologies are presented for reducing the cost of chloride-induced corrosion damage: (1) conductive coating anodes for cathodic protection of existing reinforce concrete bridges, (2) epoxy-coated rebar (ECR), (3) stainless steel rebar, and (4) high-performance concrete for extending the service life of new structures, and (5) metalizing to provide economical, long-term corrosion protection of steel bridges. Conductive coating anodes and stainless steel rebar represent ongoing work by the Oregon Department of Transportation with final verdicts not expected for years. The ECR and metalizing technology have longer track records and are better established in the bridge construction and protection industry. Application of these technologies is guided by a thorough understanding of their performance, of characteristics of the bridge and its environment, and of the results that are sought.

  7. Laser induced damage and fracture in fused silica vacuum windows

    SciTech Connect

    Campbell, J.H.; Hurst, P.A.; Heggins, D.D.; Steele, W.A.; Bumpas, S.E.


    Laser-induced damage, that initiates catastrophic fracture, has been observed in large ({le}61 cm dia) fused silica lenses that also serve as vacuum barriers in Nova and Beamlet lasers. If the elastic stored energy in the lens is high enough, the lens will fracture into many pieces (implosion). Three parameters control the degree of fracture in the vacuum barrier window: elastic stored energy (tensile stress), ratio of window thickness to flaw depth, and secondary crack propagation. Fracture experiments were conducted on 15-cm dia fused silica windows that contain surface flaws caused by laser damage. Results, combined with window failure data on Beamlet and Nova, were used to develop design criteria for a ``fail-safe`` lens (that may catastrophically fracture but not implode). Specifically, the window must be made thick enough so that the peak tensile stress is less than 500 psi (3.4 MPa) and the thickness/critical flaw size is less than 6. The air leak through the window fracture and into the vacuum must be rapid enough to reduce the load on the window before secondary crack growth occurs. Finite element stress calculations of a window before and immediately following fracture into two pieces show that the elastic stored energy is redistributed if the fragments ``lock`` in place and thereby bridge the opening. In such cases, the peak stresses at the flaw site can increase, leading to further (i.e. secondary) crack growth.

  8. Oxidatively induced DNA damage and its repair in cancer.


    Dizdaroglu, Miral


    Oxidatively induced DNA damage is caused in living organisms by endogenous and exogenous reactive species. DNA lesions resulting from this type of damage are mutagenic and cytotoxic and, if not repaired, can cause genetic instability that may lead to disease processes including carcinogenesis. Living organisms possess DNA repair mechanisms that include a variety of pathways to repair multiple DNA lesions. Mutations and polymorphisms also occur in DNA repair genes adversely affecting DNA repair systems. Cancer tissues overexpress DNA repair proteins and thus develop greater DNA repair capacity than normal tissues. Increased DNA repair in tumors that removes DNA lesions before they become toxic is a major mechanism for development of resistance to therapy, affecting patient survival. Accumulated evidence suggests that DNA repair capacity may be a predictive biomarker for patient response to therapy. Thus, knowledge of DNA protein expressions in normal and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. DNA repair proteins constitute targets for inhibitors to overcome the resistance of tumors to therapy. Inhibitors of DNA repair for combination therapy or as single agents for monotherapy may help selectively kill tumors, potentially leading to personalized therapy. Numerous inhibitors have been developed and are being tested in clinical trials. The efficacy of some inhibitors in therapy has been demonstrated in patients. Further development of inhibitors of DNA repair proteins is globally underway to help eradicate cancer.

  9. Knee proprioception after exercise-induced muscle damage.


    Torres, R; Vasques, J; Duarte, J A; Cabri, J M H


    The purpose of the present study was to investigate whether exercise-induced quadriceps muscle damage affects knee proprioception such as joint position sense (JPS), force sense and the threshold to detect passive movement (TTDPM). Fourteen young men performed sets of eccentric quadriceps contractions at a target of 60% of the maximal concentric peak torque until exhaustion; the exercise was interrupted whenever the subject could not complete two sets. Muscle soreness, JPS, the TTDPM and force sense were examined before the exercise as well as one, 24, 48, 72 and 96 h after exercise. The results were compared using one-way repeated-measure ANOVA. Plasma CK activity, collected at the same times, was analyzed by the Friedman's test to discriminate differences between baseline values and each of the other assessment moments (p<0.05). Relative to the proprioception assessment, JPS at 30 and 70 degrees of knee flexion and force sense were significantly decreased up to 48 h, whereas TTDPM decreased significantly at only one hour and 24 h after exercise, at 30 and 70 degrees of the knee flexion, respectively. The results allow the conclusion that eccentric exercise leading to muscle damage alters joint proprioception, suggesting that there might be impairment in the intrafusal fibres of spindle muscles and in the tendon organs.

  10. Tamoxifen inhibits mitochondrial oxidative stress damage induced by copper orthophenanthroline.


    Buelna-Chontal, Mabel; Hernández-Esquivel, Luz; Correa, Francisco; Díaz-Ruiz, Jorge Luis; Chávez, Edmundo


    In this work, we studied the effect of tamoxifen and cyclosporin A on mitochondrial permeability transition caused by addition of the thiol-oxidizing pair Cu(2+) -orthophenanthroline. The findings indicate that tamoxifen and cyclosporin A circumvent the oxidative membrane damage manifested by matrix Ca(2+) release, mitochondrial swelling, and transmembrane electrical gradient collapse. Furthermore, it was found that tamoxifen and cyclosporin A prevent the generation of TBARs promoted by Cu(2+) -orthophenanthroline, as well as the inactivation of the mitochondrial enzyme aconitase and disruption of mDNA. Electrophoretic analysis was unable to demonstrate a cross-linking reaction between membrane proteins. Yet, it was found that Cu(2+) -orthophenanthroline induced the generation of reactive oxygen species. It is thus plausible that membrane leakiness is due to an oxidative stress injury.

  11. Sonic-boom-induced building structure responses including damage.

    NASA Technical Reports Server (NTRS)

    Clarkson, B. L.; Mayes, W. H.


    Concepts of sonic-boom pressure loading of building structures and the associated responses are reviewed, and results of pertinent theoretical and experimental research programs are summarized. The significance of sonic-boom load time histories, including waveshape effects, are illustrated with the aid of simple structural elements such as beams and plates. Also included are discussions of the significance of such other phenomena as three-dimensional loading effects, air cavity coupling, multimodal responses, and structural nonlinearities. Measured deflection, acceleration, and strain data from laboratory models and full-scale building tests are summarized, and these data are compared, where possible, with predicted values. Damage complaint and claim experience due both to controlled and uncontrolled supersonic flights over communities are summarized with particular reference to residential, commercial, and historic buildings. Sonic-boom-induced building responses are compared with those from other impulsive loadings due to natural and cultural events and from laboratory simulation tests.

  12. Pyrosequencing: Applicability for Studying DNA Damage-induced Mutagenesis

    PubMed Central

    Minko, Irina G.; Earley, Lauriel F.; Larlee, Kimberly E.; Lin, Ying-Chih; Lloyd, R. Stephen


    Site-specifically modified DNAs are routinely used in the study of DNA damage-induced mutagenesis. These analyses involve the creation of DNA vectors containing a lesion at a predetermined position, DNA replication, and detection of mutations at the target site. The final step has previously required the isolation of individual DNA clones, hybridization with radioactively-labeled probes, and verification of mutations by Sanger sequencing. In search for an alternative procedure that would allow direct quantification of sequence variants in a mixed population of DNA molecules, we evaluated the applicability of pyrosequencing to site-specific mutagenesis assays. The progeny DNAs were analyzed that originated from replication of N6-(deoxy-D-erythro-pentofuranosyl)-2,6-diamino-3,4-dihydro-4-oxo-5-N-methylformamidopyrimidine (MeFapy-dG)-containing vectors in primate cells, with the lesion being positioned in the 5′-GCNGG-3′ sequence context. Pyrosequencing detected ~8% G to T transversions and ~3.5% G to A transitions, a result that was in excellent agreement with frequencies previously measured by the standard procedure [Earley et al., 2013]. However, ~3.5% G to C transversions and ~2.0% deletions could not be detected by pyrosequencing. Consistent with these observations, the sensitivity of pyrosequencing for measuring the single deoxynucleotide variants differed depending on the deoxynucleotide identity, and in the given sequence contexts, was determined to be ~1-2% for A and T and ~5% for C. Pyrosequencing of other DNA isolates that were obtained following replication of MeFapy-dG-containing vectors in primate cells or Escherichia coli, identified several additional limitations. Collectively, our data demonstrated that pyrosequencing can be used for studying DNA damage-induced mutagenesis as an effective complementary experimental approach to current protocols. PMID:24962778

  13. Role of Oxidative Damage in Radiation-Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    Schreurs, Ann-Sofie; Alwood, Joshua S.; Limoli, Charles L.; Globus, Ruth K.


    used an array of countermeasures (Antioxidant diets and injections) to prevent the radiation-induced bone loss, although these did not prevent bone loss, analysis is ongoing to determine if these countermeasure protected radiation-induced damage to other tissues.

  14. Comparison of Model Calculations of Biological Damage from Exposure to Heavy Ions with Measurements

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee Y.; Hada, Megumi; Cucinotta, Francis A.; Wu, Honglu


    The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET gamma or X rays, the presence of shielding does not always reduce the radiation risks for energetic charged-particle exposure. Dose delivered by the charged particle increases sharply at the Bragg peak. However, the Bragg curve does not necessarily represent the biological damage along the particle path since biological effects are influenced by the track structures of both primary and secondary particles. Therefore, the ''biological Bragg curve'' is dependent on the energy and the type of the primary particle and may vary for different biological end points. Measurements of the induction of micronuclei (MN) have made across the Bragg curve in human fibroblasts exposed to energetic silicon and iron ions in vitro at two different energies, 300 MeV/nucleon and 1 GeV/nucleon. Although the data did not reveal an increased yield of MN at the location of the Bragg peak, the increased inhibition of cell progression, which is related to cell death, was found at the Bragg peak location. These results are compared to the calculations of biological damage using a stochastic Monte-Carlo track structure model, Galactic Cosmic Ray Event-based Risk Model (GERM) code (Cucinotta, et al., 2011). The GERM code estimates the basic physical properties along the passage of heavy ions in tissue and shielding materials, by which the experimental set-up can be interpreted. The code can also be used to describe the biophysical events of interest in radiobiology, cancer therapy, and space exploration. The calculation has shown that the severely damaged cells at the Bragg peak are more likely to go through reproductive death, the so called "overkill".

  15. Topical Application of Liposomal Antioxidants for Protection Against CEES Induced Skin Damage

    DTIC Science & Technology


    keratinocytes. Task 2: Similar to HD, CEES induces oxidative stress in the skin cells resulting in ROS generation, DNA damaging, protein and lipid oxidation...W81XWH-05-2-0034 TITLE: Topical Application of Liposomal Antioxidants for Protection Against CEES Induced Skin Damage PRINCIPAL...NUMBER Topical Application of Liposomal Antioxidants for Protection Against CEES Induced Skin Damage 5b. GRANT NUMBER W81XWH-05-2-0034 5c. PROGRAM

  16. Exposure to 50Hz-sinusoidal electromagnetic field induces DNA damage-independent autophagy.


    Shen, Yunyun; Xia, Ruohong; Jiang, Hengjun; Chen, Yanfeng; Hong, Ling; Yu, Yunxian; Xu, Zhengping; Zeng, Qunli


    As electromagnetic field (EMF) is commonly encountered within our daily lives, the biological effects of EMF are of great concern. Autophagy is a key process for maintaining cellular homeostasis, and it can also reveal cellular responses to environmental stimuli. In this study, we aim to investigate the biological effects of a 50Hz-sinusoidal electromagnetic field on autophagy and we identified its mechanism of action in Chinese Hamster Lung (CHL) cells. CHL cells were exposed to a 50Hz sinusoidal EMF at 0.4mT for 30min or 24h. In this study, we found that a 0.4mT EMF resulted in: (i) an increase in LC3-II expression and increased autophagosome formation; (ii) no significant difference in the incidence of γH2AX foci between the sham and exposure groups; (iii) reorganized actin filaments and increased pseudopodial extensions without promoting cell migration; and (iv) enhanced cell apoptosis when autophagy was blocked by Bafilomycin A1. These results implied that DNA damage was not directly involved in the autophagy induced by a 0.4mT 50Hz EMF. In addition, an EMF induced autophagy balanced the cellular homeostasis to protect the cells from severe adverse biological consequences.

  17. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.


    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  18. Repair and misrepair of heavy-ion-induced chromosomal damage

    NASA Astrophysics Data System (ADS)

    Goodwin, E.; Blakely, E.; Ivery, G.; Tobias, C.

    The premature chromosome condensation (PCC) technique was used to investigate chromosomal damage, repair, and misrepair in the G1 phase of a human/hamster hybrid cell line that contains a single human chromosome. Plateau-phase cell cultures were exposed to either x-rays or a 425 MeV/u beam of neon ions near the Bragg peak where the LET is 183 keV/μm. An in situ hybridization technique coupled to fluorescent staining of PCC spreads confirmed the linearity of the dose response for initial chromatin breakage in the human chromosome to high doses (1600 cGy x-ray or 1062 cGy Ne). On Giemsa-stained slides, initial chromatin breakage in the total genome and the rejoining kinetics of these breaks were determined. As a measure of chromosomal misrepair, ring PCC aberrations were also scored. Ne ions were about 1.5 x more effective per unit dose compared to x-rays at producing the initially measured chromatin breakage. 90% of the x-ray-induced breaks rejoined in cells incubated at 37°C after exposure. In contrast, only 50% of Ne-ion-induced breaks rejoined. In the irradiated G1 cells, ring PCC aberrations increased with time apparently by first order kinetics after either x-ray or Ne exposures. However, far fewer rings formed in Ne-irradiated cells after a dose giving a comparable initial number of chromatin breaks. Following x-ray exposures, the yield of rings formed after long repair times (6 to 9 hrs) fit a quadratic dose-response curve. These results indicate quantitative and qualitative differences in the chromosomal lesions induced by low- and high-LET radiations.

  19. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.


    Background Spontaneous reports from patients able to report vascular sequelae in real time, and recognition that serum non transferrin bound iron may reach or exceed 10μmol/L in the blood stream after iron tablets or infusions, led us to hypothesize that conventional iron treatments may provoke acute vascular injury. This prompted us to examine whether a phenotype could be observed in normal human endothelial cells treated with low dose iron. Methodology Confluent primary human endothelial cells (EC) were treated with filter-sterilized iron (II) citrate or fresh media for RNA sequencing and validation studies. RNA transcript profiles were evaluated using directional RNA sequencing with no pre-specification of target sequences. Alignments were counted for exons and junctions of the gene strand only, blinded to treatment types. Principal Findings Rapid changes in RNA transcript profiles were observed in endothelial cells treated with 10μmol/L iron (II) citrate, compared to media-treated cells. Clustering for Gene Ontology (GO) performed on all differentially expressed genes revealed significant differences in biological process terms between iron and media-treated EC, whereas 10 sets of an equivalent number of randomly selected genes from the respective EC gene datasets showed no significant differences in any GO terms. After 1 hour, differentially expressed genes clustered to vesicle mediated transport, protein catabolism, and cell cycle (Benjamini p = 0.0016, 0.0024 and 0.0032 respectively), and by 6 hours, to cellular response to DNA damage stimulus most significantly through DNA repair genes FANCG, BLM, and H2AFX. Comet assays demonstrated that 10μM iron treatment elicited DNA damage within 1 hour. This was accompanied by a brisk DNA damage response pulse, as ascertained by the development of DNA damage response (DDR) foci, and p53 stabilization. Significance These data suggest that low dose iron treatments are sufficient to modify the vascular endothelium

  20. Biological effects of DNA damage in the hyperthermophilic archaeon Sulfolobus acidocaldarius.


    Reilly, Michelle S; Grogan, Dennis W


    To investigate the generality of efficient double-strand break repair and damage-induced mutagenesis in hyperthermophilic archaea, we systematically measured the effects of five DNA-damaging agents on Sulfolobus acidocaldarius and compared the results to those obtained for Escherichia coli under corresponding conditions. The observed lethality of gamma-radiation was very similar for S. acidocaldarius and E. coli, arguing against unusually efficient double-strand break repair in S. acidocaldarius. In addition, DNA-strand-breaking agents (gamma-radiation or bleomycin), as well as DNA-cross-linking agents (mechlorethamine, butadiene diepoxide or cisplatin) stimulated forward mutation, reverse mutation, and formation of recombinants via conjugation in Sulfolobus cells. Although two of the five DNA-damaging agents failed to revert the E. coli auxotrophs under these conditions, all five reverted S. acidocaldarius auxotrophs.

  1. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun


    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  2. The effects of pre-exercise vibration stimulation on the exercise-induced muscle damage

    PubMed Central

    Kim, Ji-Yun; Kang, Da-Haeng; Lee, Joon-Hee; O, Se-Min; Jeon, Jae-Keun


    [Purpose] To investigate the effects of pre-induced muscle damage vibration stimulation on the pressure-pain threshold and muscle-fatigue-related metabolites of exercise-induced muscle damage. [Subjects and Methods] Thirty healthy, adult male subjects were randomly assigned to the pre-induced muscle damage vibration stimulation group, post-induced muscle damage vibration stimulation group, or control group (n=10 per group). To investigate the effects of pre-induced muscle damage vibration stimulation, changes in the pressure-pain threshold (lb), creatine kinase level (U/L), and lactate dehydrogenase level (U/L) were measured and analyzed at baseline and at 24 hours, 48 hours, and 72 hours after exercise. [Results] The pressure-pain thresholds and concentrations of creatine kinase and lactate dehydrogenase varied significantly in each group and during each measurement period. There were interactions between the measurement periods and groups, and results of the post-hoc test showed that the pre-induced muscle damage vibration stimulation group had the highest efficacy among the groups. [Conclusion] Pre-induced muscle damage vibration stimulation is more effective than post-induced muscle damage vibration stimulation for preventing muscle damage. PMID:28210056

  3. Damage-free vibrational spectroscopy of biological materials in the electron microscope


    Rez, Peter; Aoki, Toshihiro; March, Katia; ...


    Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an ‘aloof’ electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies o1 eV can be ‘safely’ investigated. To demonstrate the potential of aloof spectroscopy, we record electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C–H, N–H and C=O vibrational signatures with nomore » observable radiation damage. Furthermore, the technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ~10nm, simultaneously combined with imaging in the electron microscope.« less

  4. Mediators of Inflammation-Induced Bone Damage in Arthritis and Their Control by Herbal Products

    PubMed Central

    Nanjundaiah, Siddaraju M.; Astry, Brian; Moudgil, Kamal D.


    Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic inflammation of the synovial joints leading to bone and cartilage damage. Untreated inflammatory arthritis can result in severe deformities and disability. The use of anti-inflammatory agents and biologics has been the mainstay of treatment of RA. However, the prolonged use of such agents may lead to severe adverse reactions. In addition, many of these drugs are quite expensive. These limitations have necessitated the search for newer therapeutic agents for RA. Natural plant products offer a promising resource for potential antiarthritic agents. We describe here the cellular and soluble mediators of inflammation-induced bone damage (osteoimmunology) in arthritis. We also elaborate upon various herbal products that possess antiarthritic activity, particularly mentioning the specific target molecules. As the use of natural product supplements by RA patients is increasing, this paper presents timely and useful information about the mechanism of action of promising herbal products that can inhibit the progression of inflammation and bone damage in the course of arthritis. PMID:23476694

  5. Male-killing symbiont damages host's dosage-compensated sex chromosome to induce embryonic apoptosis

    PubMed Central

    Harumoto, Toshiyuki; Anbutsu, Hisashi; Lemaitre, Bruno; Fukatsu, Takema


    Some symbiotic bacteria are capable of interfering with host reproduction in selfish ways. How such bacteria can manipulate host's sex-related mechanisms is of fundamental interest encompassing cell, developmental and evolutionary biology. Here, we uncover the molecular and cellular mechanisms underlying Spiroplasma-induced embryonic male lethality in Drosophila melanogaster. Transcriptomic analysis reveals that many genes related to DNA damage and apoptosis are up-regulated specifically in infected male embryos. Detailed genetic and cytological analyses demonstrate that male-killing Spiroplasma causes DNA damage on the male X chromosome interacting with the male-specific lethal (MSL) complex. The damaged male X chromosome exhibits a chromatin bridge during mitosis, and bridge breakage triggers sex-specific abnormal apoptosis via p53-dependent pathways. Notably, the MSL complex is not only necessary but also sufficient for this cytotoxic process. These results highlight symbiont's sophisticated strategy to target host's sex chromosome and recruit host's molecular cascades toward massive apoptosis in a sex-specific manner. PMID:27650264

  6. Nonthermal atmospheric plasma rapidly disinfects multidrug-resistant microbes by inducing cell surface damage.


    Kvam, Erik; Davis, Brian; Mondello, Frank; Garner, Allen L


    Plasma, a unique state of matter with properties similar to those of ionized gas, is an effective biological disinfectant. However, the mechanism through which nonthermal or "cold" plasma inactivates microbes on surfaces is poorly understood, due in part to challenges associated with processing and analyzing live cells on surfaces rather than in aqueous solution. Here, we employ membrane adsorption techniques to visualize the cellular effects of plasma on representative clinical isolates of drug-resistant microbes. Through direct fluorescent imaging, we demonstrate that plasma rapidly inactivates planktonic cultures, with >5 log(10) kill in 30 s by damaging the cell surface in a time-dependent manner, resulting in a loss of membrane integrity, leakage of intracellular components (nucleic acid, protein, ATP), and ultimately focal dissolution of the cell surface with longer exposure time. This occurred with similar kinetic rates among methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa, and Candida albicans. We observed no correlative evidence that plasma induced widespread genomic damage or oxidative protein modification prior to the onset of membrane damage. Consistent with the notion that plasma is superficial, plasma-mediated sterilization was dramatically reduced when microbial cells were enveloped in aqueous buffer prior to treatment. These results support the use of nonthermal plasmas for disinfecting multidrug-resistant microbes in environmental settings and substantiate ongoing clinical applications for plasma devices.

  7. Methylphenidate and Amphetamine Do Not Induce Cytogenetic Damage in Lymphocytes of Children with ADHD

    ERIC Educational Resources Information Center

    Witt, Kristine L.; Shelby, Michael D.; Itchon-Ramos, Nilda; Faircloth, Melissa; Kissling, Grace E.; Chrisman, Allan K.; Ravi, Hima; Murli, Hemalatha; Mattison, Donald R.; Kollins, Scott H.


    The inducement of chromosomal damage in lymphocytes among children with attention deficit hyperactivity disorder receiving treatment with methylphenidate- or amphetamine-based drugs is investigated. Findings did not reveal significant increases in cytogenetic damage related to the treatment. The risk for cytogenetic damage posed by such products…

  8. Apigenin inhibits oxidative stress-induced macromolecular damage in N-nitrosodiethylamine (NDEA)-induced hepatocellular carcinogenesis in Wistar albino rats.


    Jeyabal, Prince Vijeya Singh; Syed, Mumtaz Banu; Venkataraman, Magesh; Sambandham, Jamuna Kumari; Sakthisekaran, Dhanapal


    Apigenin (4',5,7-trihydroxyflavone), a flavone subclass of flavonoid widely distributed in many herbs, fruits, and vegetables is a substantial component of the human diet and has been shown to possess a variety of biological activities including tumor growth inhibition and chemoprevention. Recent studies in several biological systems have shown that apigenin induces tumor growth inhibition, cell cycle arrest, and apoptosis. Free radical-induced degradation of polyunsaturated fatty acid results in electrophilic products and causes severe oxidative stress. Oxidative stress induced by free radicals, nonoxidizing species, electrophiles, and associated DNA damages have been frequently coupled with carcinogenesis. In the present study, the protective role of apigenin was examined against the oxidative stress caused by N-nitrosodiethylamine (NDEA) and phenobarbital (PB) in Wistar albino rats. Oxidative stress was measured in terms of lipid peroxidation (LPO) and protein carbonyl formation. Oxidative stress-induced DNA damage was measured by single cell gel electrophoresis (comet assay). Apigenin exhibited its antioxidant defense against NDEA-induced oxidative stress. We have observed minimal levels of LPO and DNA damage in apigenin-treated hepatoma bearing animals. Based on the results, we suggest that apigenin may be developed as a promising chemotherapeutic agent against the development of chemical carcinogenesis.

  9. Subsurface defects of fused silica optics and laser induced damage at 351 nm.


    Hongjie, Liu; Jin, Huang; Fengrui, Wang; Xinda, Zhou; Xin, Ye; Xiaoyan, Zhou; Laixi, Sun; Xiaodong, Jiang; Zhan, Sui; Wanguo, Zheng


    Many kinds of subsurface defects are always present together in the subsurface of fused silica optics. It is imperfect that only one kind of defects is isolated to investigate its impact on laser damage. Therefore it is necessary to investigate the impact of subsurface defects on laser induced damage of fused silica optics with a comprehensive vision. In this work, we choose the fused silica samples manufactured by different vendors to characterize subsurface defects and measure laser induced damage. Contamination defects, subsurface damage (SSD), optical-thermal absorption and hardness of fused silica surface are characterized with time-of-flight secondary ion mass spectrometry (TOF-SIMS), fluorescence microscopy, photo-thermal common-path interferometer and fully automatic micro-hardness tester respectively. Laser induced damage threshold and damage density are measured by 351 nm nanosecond pulse laser. The correlations existing between defects and laser induced damage are analyzed. The results show that Cerium element and SSD both have a good correlation with laser-induced damage thresholds and damage density. Research results evaluate process technology of fused silica optics in China at present. Furthermore, the results can provide technique support for improving laser induced damage performance of fused silica.

  10. Examination of naturally occurring polyacetylenes and alpha-terthienyl for their ability to induce cytogenetic damage.


    MacRae, W D; Chan, G F; Wat, C K; Towers, G H; Lam, J


    alpha-Terthienyl and 5 polyacetylenes were examined for chromosome damaging activity using Syrian hamster cells. None of these naturally occurring compounds induced sister chromatid exchanges and neither alpha-terthienyl nor phenylheptatriyne induced chromosome aberrations.

  11. Relative biological damage in and out of field of 6, 10 and 18 MV clinical photon beams

    NASA Astrophysics Data System (ADS)

    Ezzati, A. O.


    The lower energy of scattered radiation in and out of a megavoltage (MV) photon beam suggests that relative biological damage (RBD) may change from in- to out-of-field regions for unit absorbed dose. Because of high linear energy transfer (LET) and potential of causing severe damage to the DNA, low-energy (10 eV-1 keV) slowing down electrons should be included in radiation biological damage calculations. In this study RBD was calculated in and out of field of 6, 10 and 18 MV clinical photon beams including low-energy slowing down electrons in the track length estimated method. Electron spectra at energies higher than 2 keV were collected in a water phantom at different depths and off-axis points by using the MCNP code. A new extrapolation method was used to estimate the electron spectra at energies lower than 2 keV. The obtained spectra at energies lower than 2 keV merged with spectra at energies higher than 2 keV by using continuity of the spectra. These spectra were used as an input to a validated microdosimetric Monte Carlo (MC) code, MC damage simulation (MCDS), to calculate the RBD of induced DSB in DNA at points in and out of the primary radiation field under fully aerobic (100% O2 and anoxic (0% O2 conditions. There was an observable difference in the energy spectra for electrons for points in the primary radiation field and those points out of field. RBD had maximum variation, 11% in 6 MV photons at field size of 20×20 cm2. This variation was less than 11% for 10 and 18 MV photons and field sizes smaller than 20×20 cm2. Our simulations also showed that under the anoxic condition, RBD increases up to 6% for 6 and 10 MV photons and the 20×20 cm2 field size. This work supports the hypothesis that in megavoltage treatments out-of-field radiation quality can vary enough to have an impact on RBD per unit dose and that this may play a role as the radiation therapy community explores biological optimization as a tool to assist treatment planning.

  12. Calculation of radiation damage induced by neutrons in compound materials

    NASA Astrophysics Data System (ADS)

    Lunéville, L.; Simeone, D.; Jouanne, C.


    Many years have been devoted to study the behaviour of solids submitted to impinging particles like ions or neutrons. The nuclear evaluations describe more and more accurately the various neutron-atom interactions. Anisotropic neutron-atom cross-sections are now available for many elements. Moreover, clear mathematical formalism now allows to calculate the number of displacements per atom in polyatomic targets in a realistic way using the binary collision approximation (BCA) framework. Even if these calculations do not take into account relaxation processes at the end of the displacement spike, they can be used to compare damages induced by different facilities like pressurized water reactors (PWR), fast breeder reactors (FBR), high temperature reactors (HTR) and fusion facilities like the European Spallation Source (ESS) and the International Fusion Material Irradiation Facility (IFMIF) on a defined material. In this paper, a formalism is presented to describe the neutron-atom cross-section and primary recoil spectra taking into account the anisotropy of nuclear reactions extracted from nuclear evaluations. Such a formalism permitted to compute displacement per atom production rate, primary and weighted recoil spectra within the BCA. The multigroup approximation has been used to calculate displacement per atom production rate and recoil spectra for a define nuclear reactor. All these informations are useful to compare recoil spectra and displacement per atom production rate produced by particle accelerator and nuclear reactor.

  13. Chemical modification of normal tissue damage induced by photodynamic therapy.

    PubMed Central

    Sigdestad, C. P.; Fingar, V. H.; Wieman, T. J.; Lindberg, R. D.


    One of the limitations of successful use of photodynamic therapy (PDT) employing porphyrins is the acute and long-term cutaneous photosensitivity. This paper describes results of experiments designed to test the effects of two radiation protective agents (WR-2721, 500 mg kg-1 or WR-3689, 700 mg kg-1) on murine skin damage induced by PDT. C3H mice were shaved and depilated three days prior to injection with the photosensitiser, Photofrin (5 or 10 mg kg-1). Twenty-four hours later, the mice were injected intraperitoneally with a protector 30 min prior to Argon dye laser (630 nm) exposure. The skin response was followed for two weeks post irradiation using an arbitrary response scale. A light dose response as well as a drug dose response was obtained. The results indicate that both protectors reduced the skin response to PDT, however WR-2721 was demonstrated to be the most effective. The effect of the protectors on vascular stasis after PDT was determined using a fluorescein dye exclusion assay. In mice treated with Photofrin (5 mg kg-1), and 630 nm light (180 J cm-2) pretreatment with either WR-2721 or WR-3689 resulted in significant protection of the vascular effects of PDT. These studies document the ability of the phosphorothioate class of radiation protective agents to reduce the effects of light on photosensitized skin. They do so in a drug dose-dependent fashion with maximum protection at the highest drug doses. PMID:8763855

  14. Retinal Damage Induced by Internal Limiting Membrane Removal

    PubMed Central

    Gelman, Rachel; Stevenson, William; Prospero Ponce, Claudia; Agarwal, Daniel; Christoforidis, John Byron


    The internal limiting membrane (ILM), the basement membrane of the Müller cells, serves as the interface between the vitreous body and the retinal nerve fiber layer. It has a fundamental role in the development, structure, and function of the retina, although it also is a pathologic component in the various vitreoretinal disorders, most notably in macular holes. It was not until understanding of the evolution of idiopathic macular holes and the advent of idiopathic macular hole surgery that the idea of adjuvant ILM peeling in the treatment of tractional maculopathies was explored. Today intentional ILM peeling is a commonly applied surgical technique among vitreoretinal surgeons as it has been found to increase the rate of successful macular hole closure and improve surgical outcomes in other vitreoretinal diseases. Though ILM peeling has refined surgery for tractional maculopathies, like all surgical procedures it is not immune to perioperative risk. The essential role of the ILM to the integrity of the retina and risk of trauma to retinal tissue spurs suspicion with regard to its routine removal. Several authors have investigated the retinal damage induced by ILM peeling and these complications have been manifested across many different diagnostic studies. PMID:26425355

  15. SHI induced damage in electrical properties of silicon NPN BJTs

    NASA Astrophysics Data System (ADS)

    Kumar, M. Vinay; Kumar, Santhosh; Yashoda, T.; Krishnaveni, S.


    The investigation of radiation damage in Si microelectronic circuitry and devices are being carried out by various research groups globally. In particular the Si Bipolar junction transistors are very sensitive to high energetic radiation. In the present study, radiation response of NPN Bipolar junction transistor (2N3773) has been examined for 60 MeV B4+ ion. Key electrical properties like Gummel, dc current gain and capacitance - voltage (C-V) characteristics of 60 MeV B4+ ion irradiated transistor were studied before and after irradiation. Ion irradiation and subsequent electrical characterizations were performed at room temperature. Current voltage (I-V) measurements showed the increase in collector current for VBE ≤ 0.4 V as a function of fluence, which is due to B4+ ion induced surface leakage currents. Base current is observed to be more sensitive than collector current and gain appears to be degraded with ion fluence. Also, C-V measurements shows that both built in potential and doping concentration increased significantly after irradiation.

  16. Novel DNA damage checkpoint in mitosis: Mitotic DNA damage induces re-replication without cell division in various cancer cells.


    Hyun, Sun-Yi; Rosen, Eliot M; Jang, Young-Joo


    DNA damage induces multiple checkpoint pathways to arrest cell cycle progression until damage is repaired. In our previous reports, when DNA damage occurred in prometaphase, cells were accumulated in 4 N-DNA G1 phase, and mitosis-specific kinases were inactivated in dependent on ATM/Chk1 after a short incubation for repair. We investigated whether or not mitotic DNA damage causes cells to skip-over late mitotic periods under prolonged incubation in a time-lapse study. 4 N-DNA-damaged cells re-replicated without cell division and accumulated in 8 N-DNA content, and the activities of apoptotic factors were increased. The inhibition of DNA replication reduced the 8 N-DNA cell population dramatically. Induction of replication without cell division was not observed upon depletion of Chk1 or ATM. Finally, mitotic DNA damage induces mitotic slippage and that cells enter G1 phase with 4 N-DNA content and then DNA replication is occurred to 8 N-DNA content before completion of mitosis in the ATM/Chk1-dependent manner, followed by caspase-dependent apoptosis during long-term repair.

  17. Comparison of Model Calculations of Biological Damage from Exposure to Heavy Ions with Measurements

    NASA Astrophysics Data System (ADS)

    Kim, Myung-Hee Y.; Wu, Honglu; Hada, Megumi; Cucinotta, Francis

    The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET g or X rays, the presence of shielding does not always reduce the radiation risks for energetic charged-particle exposure. Dose delivered by the charged particle increases sharply at the Bragg peak. However, the Bragg curve does not necessarily represent the biological damage along the particle path since biological effects are influenced by the track structures of both primary and secondary particles. Therefore, the ‘‘biological Bragg curve’’ is dependent on the energy and the type of the primary particle and may vary for different biological end points. Measurements of the induction of micronuclei (MN) have made across the Bragg curve in human fibroblasts exposed to energetic silicon and iron ions in vitro at two different energies, 300 MeV/nucleon and 1 GeV/nucleon. Although the data did not reveal an increased yield of MN at the location of the Bragg peak, the increased inhibition of cell progression, which is related to cell death, was found at the Bragg peak location. These results are compared to the calculations of biological damage using a stochastic Monte-Carlo track structure model, Galactic Cosmic Ray Event-based Risk Model (GERM) code (Cucinotta et al., 2011). The GERM code estimates the basic physical properties along the passage of heavy ions in tissue and shielding materials, by which the experimental set-up can be interpreted. The code can also be used to describe the biophysical events of interest in radiobiology, cancer therapy, and space exploration. The calculation has shown that the severely damaged cells at the Bragg peak are more likely to go through reproductive death, the so called “overkill”. F. A. Cucinotta, I. Plante, A. L. Ponomarev, and M. Y. Kim, Nuclear Interactions in Heavy Ion Transport and Event

  18. Advances and New Concepts in Alcohol-Induced Organelle Stress, Unfolded Protein Responses and Organ Damage

    PubMed Central

    Ji, Cheng


    Alcohol is a simple and consumable biomolecule yet its excessive consumption disturbs numerous biological pathways damaging nearly all organs of the human body. One of the essential biological processes affected by the harmful effects of alcohol is proteostasis, which regulates the balance between biogenesis and turnover of proteins within and outside the cell. A significant amount of published evidence indicates that alcohol and its metabolites directly or indirectly interfere with protein homeostasis in the endoplasmic reticulum (ER) causing an accumulation of unfolded or misfolded proteins, which triggers the unfolded protein response (UPR) leading to either restoration of homeostasis or cell death, inflammation and other pathologies under severe and chronic alcohol conditions. The UPR senses the abnormal protein accumulation and activates transcription factors that regulate nuclear transcription of genes related to ER function. Similarly, this kind of protein stress response can occur in other cellular organelles, which is an evolving field of interest. Here, I review recent advances in the alcohol-induced ER stress response as well as discuss new concepts on alcohol-induced mitochondrial, Golgi and lysosomal stress responses and injuries. PMID:26047032

  19. Local opioid-sensitive afferent sensory neurones in the modulation of gastric damage induced by Paf.

    PubMed Central

    Esplugues, J. V.; Whittle, B. J.; Moncada, S.


    1. The role of local sensory neurones in modulating the extent of gastric mucosal damage induced by close-arterial infusion of platelet-activating factor (Paf 50 ng kg-1 min-1 for 10 min) has been investigated in the anaesthetized rat. 2. Local intra-arterial infusion of the neurotoxin, tetrodotoxin (TTX), substantially augmented the mucosal damage induced by Paf, as assessed by both macroscopic and histological techniques. 3. In rats pretreated with capsaicin 2 weeks prior to study, to induce a functional ablation of primary afferent neurones, gastric damage induced by Paf was significantly augmented. 4. Administration of morphine (0.75-3 mg kg-1 i.v.) or its peripherally acting quaternary analogue, N-methyl morphine (15 mg kg-1 i.v.), also significantly enhanced the gastric damage induced by Paf. 5. The potentiation by morphine of Paf-induced gastric damage was inhibited by administration of the opioid antagonists, naloxone (1 mg kg-1 i.v.) or the peripherally acting N-methyl nalorphine (3 mg kg-1 i.v.). 6. Administration of TTX or morphine alone, or pretreatment with capsaicin did not induce any detectable mucosal damage, suggesting that interference with local sensory neuronal activity itself does not directly induce mucosal disruption. 7. These results indicate that peripheral opiate-sensitive afferent sensory neurones play a physiological defensive role in the mucosa, attenuating the extent of gastric damage induced by Paf. PMID:2758231

  20. Eucalyptus globulus extract protects upon acetaminophen-induced kidney damages in male rat

    PubMed Central

    Dhibi, Sabah; Mbarki, Sakhria; Elfeki, Abdelfettah; Hfaiedh, Najla


    Plants have historically been used in treating many diseases. Eucalyptus globules, a rich source of bioactive compounds, and have been shown to possess antioxidative properties. The purpose of this study, carried out on male Wistar rats, was to evaluate the beneficial effects of Eucalyptus globulus extract upon acetaminophen-induced damages in kidney. Our study is realized in the Department of Biology, Faculty of Sciences of Sfax (Tunisia). 32 Wistar male rats; were divided into 4 batches: a control group (n=8), a group of rats treated with acetaminophen (goomg/kg) by intraperitoneal injection during 4 days (n=8), a group receiving Eucalyptus globulus extract (130 mg of dry leaves/kg/day) in drinking water during 42 days after 2 hours of acetaminophen administration (during 4 days) (n=8) and group received only Eucalyptus (n=8) during 42 days. After 6 weeks, animals from each group were rapidly sacrificed by decapitation. Blood serum was obtained by centrifugation. Under our experimental conditions, acetaminophen poisoning resulted in an oxidative stress evidenced by statistically significant losses in the activities of catalase (CAT), superoxide-dismutase (SOD), glutathione-peroxidase (GPX) activities and an increase in lipids peroxidation level in renal tissue of acetaminophen-treated group compared with the control group. Acetaminophen also caused kidney damage as evident by statistically significant (p<0.05) increase in levels of creatinine and urea and decreased levels of uric acid and proteins in blood. Histological analysis demonstrated alteration of proximal tubules, atrophy of the glomerule and dilatation of urinary space. Previous administration of plant extract is found to alleviate this acetaminophen-induced damage. PMID:24856382

  1. Cosmic ray induced permanent damage in MNOS EAROMs

    NASA Astrophysics Data System (ADS)

    Blandford, J. T., Jr.; Pickel, J. C.; Waskiewicz, A. E.


    Permanent damage to the memory cells in Metal Nitride Oxide Semiconductor (MNOS) Electrically Alterable Read Only Memories (EAROM) has been observed after exposure to a heavy ion beam from a cyclotron under high field (Erase/Write Mode) conditions. The probability of permanent damage depends on the system application.

  2. Cosmic ray induced permanent damage in MNOS EAROMs

    SciTech Connect

    Blandford, J.T.; Pickel, J.C.; Waskiewicz, A.E.


    Permanent damage to the memory cells in Metal Nitride Oxide Semiconductor (MNOS) Electrically Alterable Read Only Memories (EAROM) has been observed after exposure to a heavy ion beam from a cyclotron under high field (Erase/Write Mode) conditions. The probability, of permanent damage depends on the system application.

  3. DNA damage induced by red food dyes orally administered to pregnant and male mice.


    Tsuda, S; Murakami, M; Matsusaka, N; Kano, K; Taniguchi, K; Sasaki, Y F


    We determined the genotoxicity of synthetic red tar dyes currently used as food color additives in many countries, including JAPAN: For the preliminary assessment, we treated groups of 4 pregnant mice (gestational day 11) once orally at the limit dose (2000 mg/kg) of amaranth (food red No. 2), allura red (food red No. 40), or acid red (food red No. 106), and we sampled brain, lung, liver, kidney, glandular stomach, colon, urinary bladder, and embryo 3, 6, and 24 h after treatment. We used the comet (alkaline single cell gel electrophoresis) assay to measure DNA damage. The assay was positive in the colon 3 h after the administration of amaranth and allura red and weakly positive in the lung 6 h after the administration of amaranth. Acid red did not induce DNA damage in any sample at any sampling time. None of the dyes damaged DNA in other organs or the embryo. We then tested male mice with amaranth, allura red, and a related color additive, new coccine (food red No. 18). The 3 dyes induced DNA damage in the colon starting at 10 mg/kg. Twenty ml/kg of soaking liquid from commercial red ginger pickles, which contained 6.5 mg/10 ml of new coccine, induced DNA damage in colon, glandular stomach, and bladder. The potencies were compared to those of other rodent carcinogens. The rodent hepatocarcinogen p-dimethylaminoazobenzene induced colon DNA damage at 1 mg/kg, whereas it damaged liver DNA only at 500 mg/kg. Although 1 mg/kg of N-nitrosodimethylamine induced DNA damage in liver and bladder, it did not induce colon DNA damage. N-nitrosodiethylamine at 14 mg/kg did not induce DNA damage in any organs examined. Because the 3 azo additives we examined induced colon DNA damage at a very low dose, more extensive assessment of azo additives is warranted.

  4. Molecular responses of radiation-induced liver damage in rats.


    Cheng, Wei; Xiao, Lei; Ainiwaer, Aimudula; Wang, Yunlian; Wu, Ge; Mao, Rui; Yang, Ying; Bao, Yongxing


    The aim of the present study was to investigate the molecular responses involved in radiation‑induced liver damage (RILD). Sprague‑Dawley rats (6‑weeks‑old) were irradiated once at a dose of 20 Gy to the right upper quadrant of the abdomen. The rats were then sacrificed 3 days and 1, 2, 4, 8 and 12 weeks after irradiation and rats, which were not exposed to irradiation were used as controls. Weight measurements and blood was obtained from the rats and liver tissues were collected for histological and apoptotic analysis. Immunohistochemistry, reverse transcription quantitative polymerase chain reaction (RT‑qPCR) and western blot analysis were performed to measure the expression levels of mRNAs and proteins, respectively. The serum levels of alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase were increased significantly in the RILD rats. Histological investigation revealed the proliferation of collagen and the formation of fibrotic tissue 12 weeks after irradiation. Apoptotic cells were observed predominantly 2 and 4 weeks after irradiation. The immunohistochemistry, RT‑qPCR and western blot analysis all revealed the same pattern of changes in the expression levels of the molecules assessed. The expression levels of transforming growth factor‑β1 (TGF‑β1), nuclear factor (NF)‑κB65, mothers against decapentaplegic homolog 3 (Smad3) and Smad7 and connective tissue growth factor were increased during the recovery period following irradiation up to 12 weeks. The expression levels of tumor necrosis factor‑α, Smad7 and Smad4 were only increased during the early phase (first 4 weeks) of recovery following irradiation. In the RILD rat model, the molecular responses indicated that the TGF‑β1/Smads and NF‑κB65 signaling pathways are involved in the mechanism of RILD recovery.

  5. Origin and temperature dependence of radiation damage in biological samples at cryogenic temperatures.


    Meents, Alke; Gutmann, Sascha; Wagner, Armin; Schulze-Briese, Clemens


    Radiation damage is the major impediment for obtaining structural information from biological samples by using ionizing radiation such as x-rays or electrons. The knowledge of underlying processes especially at cryogenic temperatures is still fragmentary, and a consistent mechanism has not been found yet. By using a combination of single-crystal x-ray diffraction, small-angle scattering, and qualitative and quantitative radiolysis experiments, we show that hydrogen gas, formed inside the sample during irradiation, rather than intramolecular bond cleavage between non-hydrogen atoms, is mainly responsible for the loss of high-resolution information and contrast in diffraction experiments and microscopy. The experiments that are presented in this paper cover a temperature range between 5 and 160 K and reveal that the commonly used temperature in x-ray crystallography of 100 K is not optimal in terms of minimizing radiation damage and thereby increasing the structural information obtainable in a single experiment. At 50 K, specific radiation damage to disulfide bridges is reduced by a factor of 4 compared to 100 K, and samples can tolerate a factor of 2.6 and 3.9 higher dose, as judged by the increase of R(free) values of elastase and cubic insulin crystals, respectively.

  6. [Attenuation of chronic stress-induced hippocampal damages following physical exercise].


    Ma, Qiang; Wang, Jing; Liu, Hong-Tao; Chao, Fu-Huan


    The long-term potentiation (LTP) in the hippocampal dentate gyrus and the plasma glucocorticoids level were observed in rats to study the effects of physical exercise on chronic stress-induced hippocampal damages. Eight-week spontaneous wheel running exercise could attenuate the suppression of LTP induced by 21-day restraint stress, and maintain the normal plasma glucocorticoids levels. It is suggested that long-term physical exercise may protect the hippocampus from stress-induced damages.

  7. Helium vs. Proton Induced Displacement Damage in Electronic Materials

    NASA Technical Reports Server (NTRS)

    Ringo, Sawnese; Barghouty, A. F.


    In this project, the specific effects of displacement damage due to the passage of protons and helium nuclei on some typical electronic materials will be evaluated and contrasted. As the electronic material absorbs the energetic proton and helium momentum, degradation of performance occurs, eventually leading to overall failure. Helium nuclei traveling at the same speed as protons are expected to impart more to the material displacement damage; due to the larger mass, and thus momentum, of helium nuclei compared to protons. Damage due to displacement of atoms in their crystalline structure can change the physical properties and hence performance of the electronic materials.

  8. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.


    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji


    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.

  9. Short and longer-term effects of creatine supplementation on exercise induced muscle damage.


    Rosene, John; Matthews, Tracey; Ryan, Christine; Belmore, Keith; Bergsten, Alisa; Blaisdell, Jill; Gaylord, James; Love, Rebecca; Marrone, Michael; Ward, Kristine; Wilson, Eric


    The purpose of this investigation was to determine if creatine supplementation assisted with reducing the amount of exercise induced muscle damage and if creatine supplementation aided in recovery from exercise induced muscle damage. Two groups of subjects (group 1 = creatine; group 2 = placebo) participated in an eccentric exercise protocol following 7 and 30 days of creatine or placebo supplementation (20 g.d(-1) for 7 d followed by 6g.d(-1) for 23 d = 30 d). Prior to the supplementation period, measurements were obtained for maximal dynamic strength, maximal isometric force, knee range of motion, muscle soreness, and serum levels of creatine kinase (CK) and lactate dehydrogenase (LDH). Following 7 days of creatine supplementation, on day 8, subjects began consuming 6 g.d(-1) of creatine for 23 days. Additionally on days 8 and 31, subjects performed an eccentric exercise protocol using the knee extensors to induce muscle damage. Indirect markers of muscle damage, including maximal isometric force, knee range of motion, muscle soreness, and serum levels of CK and LDH, were collected at 12, 24, and 48 hours following each exercise bout. The results indicated that acute bouts of creatine have no effect on indirect markers of muscle damage for the acute (7 days) bout. However, maximal isometric force was greater for the creatine group versus placebo for the chronic (30 days) bout. This suggests that the ergogenic effect of creatine following 30 days of supplementation may have a positive impact on exercise induced muscle damage. Key pointsEccentric muscle actions highly associated with exercise induced muscle damage.Creatine supplementation has ergogenic effect to increase protein synthesis.Creatine supplementation does not attenuate exercise induced muscle damage with short term supplementation (7 days).Increased maximal isometric force seen with creatine supplementation after 30 days following exercise induced muscle damage.Ergogenic effect of creatine

  10. Short and longer-term effects of creatine supplementation on exercise induced muscle damage

    PubMed Central

    Rosene, John; Matthews, Tracey; Ryan, Christine; Belmore, Keith; Bergsten, Alisa; Blaisdell, Jill; Gaylord, James; Love, Rebecca; Marrone, Michael; Ward, Kristine; Wilson, Eric


    The purpose of this investigation was to determine if creatine supplementation assisted with reducing the amount of exercise induced muscle damage and if creatine supplementation aided in recovery from exercise induced muscle damage. Two groups of subjects (group 1 = creatine; group 2 = placebo) participated in an eccentric exercise protocol following 7 and 30 days of creatine or placebo supplementation (20 g.d-1 for 7 d followed by 6g.d-1 for 23 d = 30 d). Prior to the supplementation period, measurements were obtained for maximal dynamic strength, maximal isometric force, knee range of motion, muscle soreness, and serum levels of creatine kinase (CK) and lactate dehydrogenase (LDH). Following 7 days of creatine supplementation, on day 8, subjects began consuming 6 g.d-1 of creatine for 23 days. Additionally on days 8 and 31, subjects performed an eccentric exercise protocol using the knee extensors to induce muscle damage. Indirect markers of muscle damage, including maximal isometric force, knee range of motion, muscle soreness, and serum levels of CK and LDH, were collected at 12, 24, and 48 hours following each exercise bout. The results indicated that acute bouts of creatine have no effect on indirect markers of muscle damage for the acute (7 days) bout. However, maximal isometric force was greater for the creatine group versus placebo for the chronic (30 days) bout. This suggests that the ergogenic effect of creatine following 30 days of supplementation may have a positive impact on exercise induced muscle damage. Key points Eccentric muscle actions highly associated with exercise induced muscle damage. Creatine supplementation has ergogenic effect to increase protein synthesis. Creatine supplementation does not attenuate exercise induced muscle damage with short term supplementation (7 days). Increased maximal isometric force seen with creatine supplementation after 30 days following exercise induced muscle damage. Ergogenic effect of creatine

  11. Laser-induced damage on fused silica with photo-acoustic method

    NASA Astrophysics Data System (ADS)

    Yi, Muyu; Ke, Kai; Zhao, Jianjun; Yuan, Xiao; Zhang, Xiang


    The surface damage processes of fused silica are studied by a new photo-acoustic probe with Anti-Emi (Electron-Magnetic Interference), easy-adjusted and non-damage for the samples, and the damage thresholds is detected according to the rapid increase of the acoustic signals. Experimental results show that the damage threshold of fused silica samples is 13.86 J/cm2 at the wavelength of 1064 nm and the pulse width of 10 ns. This work may provide an effective technical support for the laser-induced damage detection.

  12. The Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage: Track Structure Effects and Cytogenetic Signatures of High-LET Exposure

    NASA Technical Reports Server (NTRS)

    George, K.; Hada, M.; Chappell, L.; Cucinotta, F. A.


    Track structure models predict that at a fixed value of LET, particles with lower charge number, Z will have a higher biological effectiveness compared to particles with a higher Z. In this report we investigated how track structure effects induction of chromosomal aberration in human cells. Human lymphocytes were irradiated in vitro with various energies of accelerated iron, silicon, neon, or titanium ions and chromosome damage was assessed in using three color FISH chromosome painting in chemically induced PCC samples collected a first cell division post irradiation. The LET values for these ions ranged from 30 to 195 keV/micrometers. Of the particles studied, Neon ions have the highest biological effectiveness for induction of total chromosome damage, which is consistent with track structure model predictions. For complex-type exchanges 64 MeV/ u Neon and 450 MeV/u Iron were equally effective and induced the most complex damage. In addition we present data on chromosomes exchanges induced by six different energies of protons (5 MeV/u to 2.5 GeV/u). The linear dose response term was similar for all energies of protons suggesting that the effect of the higher LET at low proton energies is balanced by the production of nuclear secondaries from the high energy protons. All energies of protons have a much higher percentage of complex-type chromosome exchanges than gamma rays, signifying a cytogenetic signature for proton exposures.

  13. Electron-Induced Displacement Damage Effects in CCDs

    NASA Technical Reports Server (NTRS)

    Becker, Heidi N.; Elliott, Tom; Alexander, James W.


    We compare differences in parametric degradation for CCDs irradiated to the same displacement damage dose with 10-MeV and 50-MeV electrons. Charge transfer efficiency degradation was observed to not scale with NIEL for small signals.

  14. Shock induced multi-mode damage in depleted uranium

    SciTech Connect

    Koller, Darcie D; Cerreta, Ellen K; Gray, Ill, George T


    Recent dynamic damage studies on depleted uranium samples have revealed mixed mode failure mechanisms leading to incipient cracking as well as ductile failure processes. Results show that delamination of inclusions upon compression may provide nucleation sites for damage initiation in the form of crack tip production. However, under tension the material propagates cracks in a mixed shear localization and mode-I ductile tearing and cracking. Cracks tips appear to link up through regions of severe, shear dominated plastic flow. Shock recovery experiments were conducted on a 50 mm single stage light gas gun. Serial metallographic sectioning was conducted on the recovered samples to characterize the bulk response of the sample. Experiments show delaminated inclusions due to uniaxial compression without damage propagation. Further results show the propagation of the damage through tensile loading to the incipient state, illustrating ductile processes coupled with mixed mode-I tensile ductile tearing, shear localization, and mode-I cracking in depleted uranium.

  15. Influence of Subsurface Cracks on Laser Induced Surface Damage

    SciTech Connect

    Feit, M D; Rubenchik, A M


    Cracks can affect laser damage susceptibility in three ways. These are field intensification due to interference, enhanced absorption due to trapped material in the cracks, and increased mechanical weakness. Enhanced absorption is the most important effect.

  16. Repair Machinery for Radiation-Induced DNA Damage

    DTIC Science & Technology


    significant defect in the repair of certain DNA damages, but of which damages needs to be determined. We have selected Chinese Hamster Ovary ( CHO ) as...chromosome (BAC) genomic fragment, which we isolated from a CHO BAC library, revealed that APE1 exists as a single copy gene in AA8 (see Appendix, Figure... cells , we first determined the APE1 gene copy number in the CHO AA8 cell line. Fluorescence in situ hybridization with an APE1 bacterial artificial

  17. Investigation of Friction-induced Damage to the Pig Cornea.


    Barros, Raquel C; Van Kooten, Theo G; Veeregowda, Deepak Halenahally


    Mechanical friction causes damage to the cornea. A friction measurement device with minimal intervention with the pig cornea tear film revealed a low friction coefficient of 0.011 in glycerine solution. Glycerine molecules presumably bind to water, mucins, and epithelial cells and therewith improve both squeeze film and boundary lubrication. Using confocal microscopy, we determined that glycerine solution reduced damage to epithelial cells by 50% compared with the phosphate buffer saline.

  18. Modelling biofilm-induced formation damage and biocide treatment in subsurface geosystems

    PubMed Central

    Ezeuko, C C; Sen, A; Gates, I D


    Biofilm growth in subsurface porous media, and its treatment with biocides (antimicrobial agents), involves a complex interaction of biogeochemical processes which provide non-trivial mathematical modelling challenges. Although there are literature reports of mathematical models to evaluate biofilm tolerance to biocides, none of these models have investigated biocide treatment of biofilms growing in interconnected porous media with flow. In this paper, we present a numerical investigation using a pore network model of biofilm growth, formation damage and biocide treatment. The model includes three phases (aqueous, adsorbed biofilm, and solid matrix), a single growth-limiting nutrient and a single biocide dissolved in the water. Biofilm is assumed to contain a single species of microbe, in which each cell can be a viable persister, a viable non-persister, or non-viable (dead). Persisters describe small subpopulation of cells which are tolerant to biocide treatment. Biofilm tolerance to biocide treatment is regulated by persister cells and includes ‘innate’ and ‘biocide-induced’ factors. Simulations demonstrate that biofilm tolerance to biocides can increase with biofilm maturity, and that biocide treatment alone does not reverse biofilm-induced formation damage. Also, a successful application of biological permeability conformance treatment involving geologic layers with flow communication is more complicated than simply engineering the attachment of biofilm-forming cells at desired sites. PMID:23164434

  19. Contribution of reactive oxygen species to UV-B-induced damage in bacteria.


    Santos, Ana L; Gomes, Newton C M; Henriques, Isabel; Almeida, Adelaide; Correia, António; Cunha, Ângela


    The present work aimed to identify the reactive oxygen species (ROS) produced during UV-B exposure and their biochemical targets, in a set of bacterial isolates displaying different UV susceptibilities. For that, specific exogenous ROS scavengers (catalase/CAT, superoxide dismutase/SOD, sodium azide and mannitol) were used. Biological effects were assessed from total bacterial number, colony counts and heterotrophic activity (glucose uptake and respiration). DNA strand breakage, ROS generation, oxidative damage to proteins and lipids were used as markers of oxidative stress. Sodium azide conferred a statistically significant protection in terms of lipid oxidation and cell survival, suggesting that singlet oxygen might play an important role in UV-B induced cell inactivation. Mannitol exerted a significant protection against DNA strand breakage and protein carbonylation, assigning hydroxyl radicals to DNA and protein damage. The addition of exogenous CAT and SOD significantly protected the capacity for glucose uptake and respiration, suggesting that superoxide and H(2)O(2) are involved in the impairment of activity during UV-B exposure. The observation that amendment with ROS scavengers can sometimes also exert a pro-oxidant effect suggests that the intracellular oxidant status of the cell ultimately determines the efficiency of antioxidant defenses.

  20. Is Allelopathic Activity of Ipomoea murucoides Induced by Xylophage Damage?


    Flores-Palacios, Alejandro; Corona-López, Angélica María; Rios, María Yolanda; Aguilar-Guadarrama, Berenice; Toledo-Hernández, Víctor Hugo; Rodríguez-López, Verónica; Valencia-Díaz, Susana


    Herbivory activates the synthesis of allelochemicals that can mediate plant-plant interactions. There is an inverse relationship between the activity of xylophages and the abundance of epiphytes on Ipomoea murucoides. Xylophagy may modify the branch chemical constitution, which also affects the liberation of allelochemicals with defense and allelopathic properties. We evaluated the bark chemical content and the effect of extracts from branches subjected to treatments of exclusion, mechanical damage and the presence/absence of epiphytes, on the seed germination of the epiphyte Tillandsia recurvata. Principal component analysis showed that branches without any treatment separate from branches subjected to treatments; damaged and excluded branches had similar chemical content but we found no evidence to relate intentional damage with allelopathy; however 1-hexadecanol, a defense volatile compound correlated positively with principal component (PC) 1. The chemical constitution of branches subject to exclusion plus damage or plus epiphytes was similar among them. PC2 indicated that palmitic acid (allelopathic compound) and squalene, a triterpene that attracts herbivore enemies, correlated positively with the inhibition of seed germination of T. recurvata. Inhibition of seed germination of T. recurvata was mainly correlated with the increment of palmitic acid and this compound reached higher concentrations in excluded branches treatments. Then, it is likely that the allelopathic response of I. murucoides would increase to the damage (shade, load) that may be caused by a high load of epiphytes than to damage caused by the xylophages.

  1. Is Allelopathic Activity of Ipomoea murucoides Induced by Xylophage Damage?

    PubMed Central

    Flores-Palacios, Alejandro; Corona-López, Angélica María; Rios, María Yolanda; Aguilar-Guadarrama, Berenice; Toledo-Hernández, Víctor Hugo; Rodríguez-López, Verónica; Valencia-Díaz, Susana


    Herbivory activates the synthesis of allelochemicals that can mediate plant-plant interactions. There is an inverse relationship between the activity of xylophages and the abundance of epiphytes on Ipomoea murucoides. Xylophagy may modify the branch chemical constitution, which also affects the liberation of allelochemicals with defense and allelopathic properties. We evaluated the bark chemical content and the effect of extracts from branches subjected to treatments of exclusion, mechanical damage and the presence/absence of epiphytes, on the seed germination of the epiphyte Tillandsia recurvata. Principal component analysis showed that branches without any treatment separate from branches subjected to treatments; damaged and excluded branches had similar chemical content but we found no evidence to relate intentional damage with allelopathy; however 1-hexadecanol, a defense volatile compound correlated positively with principal component (PC) 1. The chemical constitution of branches subject to exclusion plus damage or plus epiphytes was similar among them. PC2 indicated that palmitic acid (allelopathic compound) and squalene, a triterpene that attracts herbivore enemies, correlated positively with the inhibition of seed germination of T. recurvata. Inhibition of seed germination of T. recurvata was mainly correlated with the increment of palmitic acid and this compound reached higher concentrations in excluded branches treatments. Then, it is likely that the allelopathic response of I. murucoides would increase to the damage (shade, load) that may be caused by a high load of epiphytes than to damage caused by the xylophages. PMID:26625350

  2. NAD(+) administration decreases doxorubicin-induced liver damage of mice by enhancing antioxidation capacity and decreasing DNA damage.


    Wang, Ban; Ma, Yingxin; Kong, Xiaoni; Ding, Xianting; Gu, Hongchen; Chu, Tianqing; Ying, Weihai


    One of the major obstacles for cancer treatment is the toxic side effects of anti-cancer drugs. Doxorubicin (DOX) is one of the most widely used anti-cancer drugs, which produces significant toxic side effects on the heart and such organs as the liver. Because NAD(+) can decrease cellular or tissue damage under multiple conditions, we hypothesized that NAD(+) administration may decrease DOX-induced hepatotoxicity. In this study we tested this hypothesis by using a mouse model, showing that NAD(+) administration can significantly attenuate DOX-induced increase in serum glutamate oxaloacetate transaminase activity and decrease in liver weight. The NAD(+) administration also attenuated the DOX-induced increases in the levels of double-strand DNA (dsDNA) damage, TUNEL signals, and active caspase-3. Furthermore, our data has suggested that the NAD(+) administration could produce protective effects at least partially by restoring the antioxidation capacity of the liver, because NAD(+) administration can attenuate the decreases in both the GSH levels and the glutathione reductase activity of the DOX-treated liver, which could play a significant role in the DOX-induced hepatotoxicity. This finding has provided the first evidence indicating that NAD(+) is capable of increasing the antioxidation capacity of tissues. Collectively, our study has found that NAD(+) can significantly decrease DOX-induced liver damage at least partially by enhancing antioxidation capacity and decreasing dsDNA damage. Because it can also selectively decrease tumor cell survival, NAD(+) may have significant merits over antioxidants for applying jointly with DOX to decrease the toxic side effects of DOX.

  3. Genetic and Functional Studies of Genes that Regulate DNA-Damage-Induced Cell Death

    DTIC Science & Technology


    AD Award Number: DAMD17-01-1-0145 TITLE: Genetic and Functional Studies of Genes that Regulate DNA-damage-induced Cell Death PRINCIPAL INVESTIGATOR...and Functional Studies of Genes that Regulate DAMD17-01-1-0145 DNA-damage-induced Cell Death 6. A UTHOR(S) Zhou Songyang, Ph.D. 7. PERFORMING ORGANIZA...mechanisms of genes that regulate DNA damage induced cell death are much less well studied. We have proposed to establish a genetic system to screen for

  4. Lightning Strike Induced Damage Mechanisms of Carbon Fiber Composites

    NASA Astrophysics Data System (ADS)

    Kawakami, Hirohide

    Composite materials have a wide application in aerospace, automotive, and other transportation industries, because of the superior structural and weight performances. Since carbon fiber reinforced polymer composites possess a much lower electrical conductivity as compared to traditional metallic materials utilized for aircraft structures, serious concern about damage resistance/tolerance against lightning has been rising. Main task of this study is to clarify the lightning damage mechanism of carbon fiber reinforced epoxy polymer composites to help further development of lightning strike protection. The research on lightning damage to carbon fiber reinforced polymer composites is quite challenging, and there has been little study available until now. In order to tackle this issue, building block approach was employed. The research was started with the development of supporting technologies such as a current impulse generator to simulate a lightning strike in a laboratory. Then, fundamental electrical properties and fracture behavior of CFRPs exposed to high and low level current impulse were investigated using simple coupon specimens, followed by extensive parametric investigations in terms of different prepreg materials frequently used in aerospace industry, various stacking sequences, different lightning intensity, and lightning current waveforms. It revealed that the thermal resistance capability of polymer matrix was one of the most influential parameters on lightning damage resistance of CFRPs. Based on the experimental findings, the semi-empirical analysis model for predicting the extent of lightning damage was established. The model was fitted through experimental data to determine empirical parameters and, then, showed a good capability to provide reliable predictions for other test conditions and materials. Finally, structural element level lightning tests were performed to explore more practical situations. Specifically, filled-hole CFRP plates and patch

  5. Protective effects of curcumin on amyloid-β-induced neuronal oxidative damage.


    Huang, Han-Chang; Chang, Ping; Dai, Xue-Ling; Jiang, Zhao-Feng


    To investigate the protective effects of curcumin against amyloid-β (Aβ)-induced neuronal damage. Primary rat cortical neurons were cultured with different treatments of Aβ and curcumin. Neuronal morphologies, viability and damage were assessed. Neuronal oxidative stress was assessed, including extracellular hydrogen peroxide and intracellular reactive oxygen species. The abilities of curcumin to scavenge free radicals and to inhibit Aβ aggregation and β-sheeted formation are further assessed and discussed. Curcumin preserves cell viability, which is decreased by Aβ. The results of changed morphology, released Lactate dehydrogenases and cell viability assays indicate that curcumin protects Aβ-induced neuronal damage. Curcumin depresses Aβ-induced up-regulation of neuronal oxidative stress. The treatment sequence impacts the protective effect of curcumin on Aβ-induced neuronal damage. Curcumin shows a more protective effect on neuronal oxidative damage when curcumin was added into cultured neurons not later than Aβ, especially prior to Aβ. The abilities of curcumin to scavenge free radicals and to inhibit the formation of β-sheeted aggregation are both beneficial to depress Aβ-induced oxidative damage. Curcumin prevents neurons from Aβ-induced oxidative damage, implying the therapeutic usage for the treatment of Alzheimer's disease patients.

  6. Modelling blast induced damage from a fully coupled explosive charge

    PubMed Central

    Onederra, Italo A.; Furtney, Jason K.; Sellers, Ewan; Iverson, Stephen


    This paper presents one of the latest developments in the blasting engineering modelling field—the Hybrid Stress Blasting Model (HSBM). HSBM includes a rock breakage engine to model detonation, wave propagation, rock fragmentation, and muck pile formation. Results from two controlled blasting experiments were used to evaluate the code’s ability to predict the extent of damage. Results indicate that the code is capable of adequately predicting both the extent and shape of the damage zone associated with the influence of point-of-initiation and free-face boundary conditions. Radial fractures extending towards a free face are apparent in the modelling output and matched those mapped after the experiment. In the stage 2 validation experiment, the maximum extent of visible damage was of the order of 1.45 m for the fully coupled 38-mm emulsion charge. Peak radial velocities were predicted within a relative difference of only 1.59% at the nearest history point at 0.3 m from the explosive charge. Discrepancies were larger further away from the charge, with relative differences of −22.4% and −42.9% at distances of 0.46 m and 0.61 m, respectively, meaning that the model overestimated particle velocities at these distances. This attenuation deficiency in the modelling produced an overestimation of the damage zone at the corner of the block due to excessive stress reflections. The extent of visible damage in the immediate vicinity of the blasthole adequately matched the measurements. PMID:26412978

  7. Oxidative stress contributes to cobalt oxide nanoparticles-induced cytotoxicity and DNA damage in human hepatocarcinoma cells

    PubMed Central

    Alarifi, Saud; Ali, Daoud; Y, Al Omar Suliman; Ahamed, Maqusood; Siddiqui, Maqsood A; Al-Khedhairy, Abdulaziz A


    Background Cobalt oxide nanoparticles (Co3O4NPs) are increasingly recognized for their utility in biological applications, magnetic resonance imaging, and drug delivery. However, little is known about the toxicity of Co3O4NPs in human cells. Methods We investigated the possible mechanisms of genotoxicity induced by Co3O4NPs in human hepatocarcinoma (HepG2) cells. Cell viability, reactive oxygen species (ROS), glutathione, thiobarbituric acid reactive substance, apoptosis, and DNA damage were assessed in HepG2 cells after Co3O4NPs and Co2+ exposure. Results Co3O4NPs elicited a significant (P < 0.01) reduction in glutathione with a concomitant increase in lipid hydroperoxide, ROS generation, superoxide dismutase, and catalase activity after 24- and 48-hour exposure. Co3O4NPs had a mild cytotoxic effect in HepG2 cells; however, it induced ROS and oxidative stress, leading to DNA damage, a probable mechanism of genotoxicity. The comet assay showed a statistically significant (P < 0.01) dose- and time-related increase in DNA damage for Co3O4NPs, whereas Co2+ induced less change than Co3O4NPs but significantly more than control. Conclusion Our results demonstrated that Co3O4NPs induced cytotoxicity and genotoxicity in HepG2 cells through ROS and oxidative stress. PMID:23326189

  8. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi


    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  9. Cryptococcus neoformans-induced macrophage lysosome damage crucially contributes to fungal virulence.


    Davis, Michael J; Eastman, Alison J; Qiu, Yafeng; Gregorka, Brian; Kozel, Thomas R; Osterholzer, John J; Curtis, Jeffrey L; Swanson, Joel A; Olszewski, Michal A


    Upon ingestion by macrophages, Cryptococcus neoformans can survive and replicate intracellularly unless the macrophages become classically activated. The mechanism enabling intracellular replication is not fully understood; neither are the mechanisms that allow classical activation to counteract replication. C. neoformans-induced lysosome damage was observed in infected murine bone marrow-derived macrophages, increased with time, and required yeast viability. To demonstrate lysosome damage in the infected host, we developed a novel flow cytometric method for measuring lysosome damage. Increased lysosome damage was found in C. neoformans-containing lung cells compared with C. neoformans-free cells. Among C. neoformans-containing myeloid cells, recently recruited cells displayed lower damage than resident cells, consistent with the protective role of recruited macrophages. The magnitude of lysosome damage correlated with increased C. neoformans replication. Experimental induction of lysosome damage increased C. neoformans replication. Activation of macrophages with IFN-γ abolished macrophage lysosome damage and enabled increased killing of C. neoformans. We conclude that induction of lysosome damage is an important C. neoformans survival strategy and that classical activation of host macrophages counters replication by preventing damage. Thus, therapeutic strategies that decrease lysosomal damage, or increase resistance to such damage, could be valuable in treating cryptococcal infections.

  10. Gastric mucosal damage induced by nonsalicylate nonsteroidal antiinflammatory drugs in rats is mediated systemically.


    Skeljo, M V; Giraud, A S; Yeomans, N D


    The gastric toxicities of an enteric-coated formulation and conventional indomethacin were compared in rats. Both formulations were equally damaging to the mucosa, suggesting that topical damage was not the major route of injury. The importance of systemically mediated damage was further determined by gastrotoxicity dose-response curves and pyloric ligation experiments in which indomethacin was administered either orally or parenterally, or into stomach or duodenum with the pylorus occluded. Gastric damage was significantly higher in those groups that had received the drug parenterally or intraduodenally. The extent of deeper mucosal damage, assessed histologically, was greater in parenterally dosed rats. In further experiments, oral and parenteral routes of administration of two other nonsalicylate NSAIDs, naproxen and sodium diclofenac, were found to be equally damaging to the mucosa. Our results show that indomethacin-induced gastric damage, unlike aspirin injury, is mediated mainly systemically. Enteric-coating may not be a useful strategy in reducing gastric injury by nonsalicylate, nonsteroidal antiinflammatory drugs.

  11. Variation of the enhanced biologically damaging solar UV due to clouds.


    Parisi, Alfio V; Downs, Nathan


    The variation of the biologically damaging solar UV (UVBE) enhanced by clouds above that of clear sky UVBE has been investigated. This was undertaken for summer through to winter for SZA of 5 to 60 degrees employing an integrated automatic cloud and spectral UV measurement system that recorded the solar UV spectra and the sky images at five minute intervals. The UVBE calculated with action spectra with higher relative effectiveness in the UVA produced the lower percentage of cloud enhanced cases. The DNA UVBE provided the highest percentage of cloud enhanced cases compared to the total number of UV scans with 2.2% cloud enhanced cases. As a comparison, the plant and fish melanoma UVBE provided the lowest percentage of cloud enhanced cases with 0.6 to 0.8% cloud enhanced cases. For the cases of cloud enhanced UVBE, the average ratio of the measured UVBE to calculated cloud free UVBE for the photokeratitis, cataracts, plant, generalized plant damage and fish melanoma action spectra was 1.21 to 1.25. In comparison, the highest value of 1.4 was for the DNA action spectrum.

  12. RNA damage in biological conflicts and the diversity of responding RNA repair systems

    PubMed Central

    Burroughs, A. Maxwell; Aravind, L.


    RNA is targeted in biological conflicts by enzymatic toxins or effectors. A vast diversity of systems which repair or ‘heal’ this damage has only recently become apparent. Here, we summarize the known effectors, their modes of action, and RNA targets before surveying the diverse systems which counter this damage from a comparative genomics viewpoint. RNA-repair systems show a modular organization with extensive shuffling and displacement of the constituent domains; however, a general ‘syntax’ is strongly maintained whereby systems typically contain: a RNA ligase (either ATP-grasp or RtcB superfamilies), nucleotidyltransferases, enzymes modifying RNA-termini for ligation (phosphatases and kinases) or protection (methylases), and scaffold or cofactor proteins. We highlight poorly-understood or previously-uncharacterized repair systems and components, e.g. potential scaffolding cofactors (Rot/TROVE and SPFH/Band-7 modules) with their respective cognate non-coding RNAs (YRNAs and a novel tRNA-like molecule) and a novel nucleotidyltransferase associating with diverse ligases. These systems have been extensively disseminated by lateral transfer between distant prokaryotic and microbial eukaryotic lineages consistent with intense inter-organismal conflict. Components have also often been ‘institutionalized’ for non-conflict roles, e.g. in RNA-splicing and in RNAi systems (e.g. in kinetoplastids) which combine a distinct family of RNA-acting prim-pol domains with DICER-like proteins. PMID:27536007

  13. Authigenic minerals: Biologically influenced and induced organomineralization

    NASA Astrophysics Data System (ADS)

    Dupraz, Christophe


    Organominerals are minerals precipitated by interactions with organic matter without enzymatic control. Organomineralization of authigenic carbonate minerals depends on two key components: (1) the "carbonate alkalinity engine" impacting the calcium carbonate saturation index and (2) the organic matrix comprised of extracellular organic matter (EOM), which provides a template for carbonate nucleation. The alkalinity engine can be "intrinsic" when microbial metabolisms increase supersaturation or lower the kinetic barrier of precipitation, or "extrinsic" when the physicochemical environment creates the conditions for mineral formation. The organic matrix produced by various communities within the microbial mats is known to influence nucleation, morphology and mineralogy of minerals through binding of cations. By playing with these two key components, three types of authigenic minerals can be formed: (1) a purely physicochemical precipitation on an abiotic substrate, (2) a precipitation "influenced" by the presence of an organic matrix but resulting from a physicochemical forcing (environmentally driven), or (3) a "microbially-induced" precipitation, in which both supersaturation and organic matrix are resulting from microbial activity. In this keynote, we will review important processes involved in the precipitation of authigenic carbonate minerals in modern microbial mats and open the discussion on the potential use of authigenic carbonate minerals as biosignatures in the fossil record.

  14. Hybrid molecular dynamics simulation for plasma induced damage analysis

    NASA Astrophysics Data System (ADS)

    Matsukuma, Masaaki


    In order to enable further device size reduction (also known as Moore's law) and improved power performance, the semiconductor industry is introducing new materials and device structures into the semiconductor fabrication process. Materials now include III-V compounds, germanium, cobalt, ruthenium, hafnium, and others. The device structure in both memory and logic has been evolving from planar to three dimensional (3D). One such device is the FinFET, where the transistor gate is a vertical fin made either of silicon, silicon-germanium or germanium. These changes have brought renewed interests in the structural damages caused by energetic ion bombardment of the fin sidewalls which are exposed to the ion flux from the plasma during the fin-strip off step. Better control of the physical damage of the 3D devices requires a better understanding of the damage formation mechanisms on such new materials and structures. In this study, the damage formation processes by ion bombardment have been simulated for Si and Ge substrate by Quantum Mechanics/Molecular Mechanics (QM/MM) hybrid simulations and compared to the results from the classical molecular dynamics (MD) simulations. In our QM/MM simulations, the highly reactive region in which the structural damage is created is simulated with the Density Functional based Tight Binding (DFTB) method and the region remote from the primary region is simulated using classical MD with the Stillinger-Weber and Moliere potentials. The learn on the fly method is also used to reduce the computational load. Hence our QM/MM simulation is much faster than the full QC-MD simulations and the original QM/MM simulations. The amorphous layers profile simulated with QM/MM have obvious differences in their thickness for silicon and germanium substrate. The profile of damaged structure in the germanium substrate is characterized by a deeper tail then in silicon. These traits are also observed in the results from the mass selected ion beam

  15. Ceramide Production Mediates Aldosterone-Induced Human Umbilical Vein Endothelial Cell (HUVEC) Damages.


    Zhang, Yumei; Pan, Yu; Bian, Zhixiang; Chen, Peihua; Zhu, Shijian; Gu, Huiyi; Guo, Liping; Hu, Chun


    Here, we studied the underlying mechanism of aldosterone (Aldo)-induced vascular endothelial cell damages by focusing on ceramide. We confirmed that Aldo (at nmol/L) inhibited human umbilical vein endothelial cells (HUVEC) survival, and induced considerable cell apoptosis. We propose that ceramide (mainly C18) production might be responsible for Aldo-mediated damages in HUVECs. Sphingosine-1-phosphate (S1P), an anti-ceramide lipid, attenuated Aldo-induced ceramide production and following HUVEC damages. On the other hand, the glucosylceramide synthase (GCS) inhibitor PDMP or the ceramide (C6) potentiated Aldo-induced HUVEC apoptosis. Eplerenone, a mineralocorticoid receptor (MR) antagonist, almost completely blocked Aldo-induced C18 ceramide production and HUVEC damages. Molecularly, ceramide synthase 1 (CerS-1) is required for C18 ceramide production by Aldo. Knockdown of CerS-1 by targeted-shRNA inhibited Aldo-induced C18 ceramide production, and protected HUVECs from Aldo. Reversely, CerS-1 overexpression facilitated Aldo-induced C18 ceramide production, and potentiated HUVEC damages. Together, these results suggest that C18 ceramide production mediates Aldo-mediated HUVEC damages. MR and CerS-1 could be the two signaling molecule regulating C18 ceramide production by Aldo.

  16. Ceramide Production Mediates Aldosterone-Induced Human Umbilical Vein Endothelial Cell (HUVEC) Damages

    PubMed Central

    Zhang, Yumei; Pan, Yu; Bian, Zhixiang; Chen, Peihua; Zhu, Shijian; Gu, Huiyi; Guo, Liping; Hu, Chun


    Here, we studied the underlying mechanism of aldosterone (Aldo)-induced vascular endothelial cell damages by focusing on ceramide. We confirmed that Aldo (at nmol/L) inhibited human umbilical vein endothelial cells (HUVEC) survival, and induced considerable cell apoptosis. We propose that ceramide (mainly C18) production might be responsible for Aldo-mediated damages in HUVECs. Sphingosine-1-phosphate (S1P), an anti-ceramide lipid, attenuated Aldo-induced ceramide production and following HUVEC damages. On the other hand, the glucosylceramide synthase (GCS) inhibitor PDMP or the ceramide (C6) potentiated Aldo-induced HUVEC apoptosis. Eplerenone, a mineralocorticoid receptor (MR) antagonist, almost completely blocked Aldo-induced C18 ceramide production and HUVEC damages. Molecularly, ceramide synthase 1 (CerS-1) is required for C18 ceramide production by Aldo. Knockdown of CerS-1 by targeted-shRNA inhibited Aldo-induced C18 ceramide production, and protected HUVECs from Aldo. Reversely, CerS-1 overexpression facilitated Aldo-induced C18 ceramide production, and potentiated HUVEC damages. Together, these results suggest that C18 ceramide production mediates Aldo-mediated HUVEC damages. MR and CerS-1 could be the two signaling molecule regulating C18 ceramide production by Aldo. PMID:26788916

  17. Explosive-induced shock damage in copper and recompression of the damaged region

    NASA Astrophysics Data System (ADS)

    Turley, W. D.; Stevens, G. D.; Hixson, R. S.; Cerreta, E. K.; Daykin, E. P.; Graeve, O. A.; La Lone, B. M.; Novitskaya, E.; Perez, C.; Rigg, P. A.; Veeser, L. R.


    We have studied the dynamic spall process for copper samples in contact with detonating low-performance explosives. When a triangular shaped shock wave from detonation moves through a sample and reflects from the free surface, tension develops immediately, one or more damaged layers can form, and a spall scab can separate from the sample and move ahead of the remaining target material. For dynamic experiments, we used time-resolved velocimetry and x-ray radiography. Soft-recovered samples were analyzed using optical imaging and microscopy. Computer simulations were used to guide experiment design. We observe that for some target thicknesses the spall scab continues to run ahead of the rest of the sample, but for thinner samples, the detonation product gases accelerate the sample enough for it to impact the spall scab several microseconds or more after the initial damage formation. Our data also show signatures in the form of a late-time reshock in the time-resolved data, which support this computational prediction. A primary goal of this research was to study the wave interactions and damage processes for explosives-loaded copper and to look for evidence of this postulated recompression event. We found both experimentally and computationally that we could tailor the magnitude of the initial and recompression shocks by varying the explosive drive and the copper sample thickness; thin samples had a large recompression after spall, whereas thick samples did not recompress at all. Samples that did not recompress had spall scabs that completely separated from the sample, whereas samples with recompression remained intact. This suggests that the hypothesized recompression process closes voids in the damage layer or otherwise halts the spall formation process. This is a somewhat surprising and, in some ways controversial, result, and the one that warrants further research in the shock compression community.

  18. The Effects of Creatine Supplementation on Exercise-Induced Muscle Damage.

    ERIC Educational Resources Information Center

    Rawson, Eric S.; Gunn, Bridget; Clarkson, Priscilla M.


    Investigated the effects of oral creatine (Cr) supplementation on markers of exercise-induced muscle damage following high-force eccentric exercise in men randomly administered Cr or placebo. Results indicated that 5 days of Cr supplementation did not reduce indirect makers of muscle damage or enhance recovery from high-force eccentric exercise.…

  19. Catastrophic nanosecond laser induced damage in the bulk of potassium titanyl phosphate crystals

    SciTech Connect

    Wagner, Frank R. Natoli, Jean-Yves; Akhouayri, Hassan; Commandré, Mireille; Duchateau, Guillaume


    Due to its high effective nonlinearity and the possibility to produce periodically poled crystals, potassium titanyl phosphate (KTiOPO{sub 4}, KTP) is still one of the economically important nonlinear optical materials. In this overview article, we present a large study on catastrophic nanosecond laser induced damage in this material and the very similar RbTiOPO{sub 4} (RTP). Several different systematic studies are included: multiple pulse laser damage, multi-wavelength laser damage in KTP, damage resistance anisotropy, and variations of the laser damage thresholds for RTP crystals of different qualities. All measurements were carried out in comparable experimental conditions using a 1064 nm Q-switched laser and some were repeated at 532 nm. After summarizing the experimental results, we detail the proposed model for laser damage in this material and discuss the experimental results in this context. According to the model, nanosecond laser damage is caused by light-induced generation of transient laser-damage precursors which subsequently provide free electrons that are heated by the same nanosecond pulse. We also present a stimulated Raman scattering measurement and confront slightly different models to the experimental data. Finally, the physical nature of the transient damage precursors is discussed and similarities and differences to laser damage in other crystals are pointed out.

  20. RNase H enables efficient repair of R-loop induced DNA damage

    PubMed Central

    Amon, Jeremy D; Koshland, Douglas


    R-loops, three-stranded structures that form when transcripts hybridize to chromosomal DNA, are potent agents of genome instability. This instability has been explained by the ability of R-loops to induce DNA damage. Here, we show that persistent R-loops also compromise DNA repair. Depleting endogenous RNase H activity impairs R-loop removal in Saccharomyces cerevisiae, causing DNA damage that occurs preferentially in the repetitive ribosomal DNA locus (rDNA). We analyzed the repair kinetics of this damage and identified mutants that modulate repair. We present a model that the persistence of R-loops at sites of DNA damage induces repair by break-induced replication (BIR). This R-loop induced BIR is particularly susceptible to the formation of lethal repair intermediates at the rDNA because of a barrier imposed by RNA polymerase I. DOI: PMID:27938663

  1. Antecedent glycemic control reduces severe hypoglycemia-induced neuronal damage in diabetic rats.


    Reno, Candace M; Tanoli, Tariq; Bree, Adam; Daphna-Iken, Dorit; Cui, Chen; Maloney, Susan E; Wozniak, David F; Fisher, Simon J


    Brain damage due to severe hypoglycemia occurs in insulin-treated people with diabetes. This study tests the hypothesis that chronic insulin therapy that normalizes elevated blood glucose in diabetic rats would be neuroprotective against brain damage induced by an acute episode of severe hypoglycemia. Male Sprague-Dawley rats were split into three groups: 1) control, non-diabetic; 2) STZ-diabetic; and 3) insulin-treated STZ-diabetic. After 3 wk of chronic treatment, unrestrained awake rats underwent acute hyperinsulinemic severe hypoglycemic (10-15 mg/dl) clamps for 1 h. Rats were subsequently analyzed for brain damage and cognitive function. Severe hypoglycemia induced 15-fold more neuronal damage in STZ-diabetic rats compared with nondiabetic rats. Chronic insulin treatment of diabetic rats, which nearly normalized glucose levels, markedly reduced neuronal damage induced by severe hypoglycemia. Fortunately, no cognitive defects associated with the hypoglycemia-induced brain damage were observed in any group. In conclusion, antecedent blood glucose control represents a major modifiable therapeutic intervention that can afford diabetic subjects neuroprotection against severe hypoglycemia-induced brain damage.

  2. Effect of Creatine Supplementation on Muscle Damage and Repair Following Eccentrically-Induced Damage to the Elbow Flexor Muscles

    PubMed Central

    McKinnon, Neal B.; Graham, Mitchell T.; Tiidus, Peter M.


    We investigated effects of creatine (Cr) supplementation (CrS) on exercise-induced muscle damage. Untrained males and females (N = 27) ages 18-25, with no CrS history in the past 4 months, were randomly assigned to CrS (creatine and carbohydrate) (n = 9), placebo (P) (carbohydrate only) (n = 9), or control (C) (no supplements) groups (n = 9). Participants followed a 5-day Cr loading protocol of 40 g·day-1, divided for 5 days prior to exercise, reduced to 10 g g·day-1 for 5 days following exercise. Testing consisted of 5 maximal isometric contractions at 90 arm flexion with the preferred arm on a CYBEX NORM dynamometer, assessed prior to, immediately following, and 24, 48, 72, and 96 hours post muscle-damaging procedures. Damage was induced to the elbow flexor muscles using 6 sets of 10 eccentric contractions at 75 °/sec, 90 °/sec and 120 °/sec. Participants were asked to rate their muscle soreness on a scale of 1-10. Data was analyzed using repeated-measures ANOVA, with an alpha of 0.05. No significant differences were found between muscle force loss and rate of recovery or muscle soreness between groups over the 96 hr recovery period (p > 0.05). Across all 3 experimental groups an initial decrease in force was observed, followed by a gradual recovery. Significant differences were found between baseline and all others times (p = 0.031,0 .022, 0.012, 0.001 respectively), and between the 48 hour and 96 hour time periods (p = 0.034). A weak negative correlation between subjectively rated muscle soreness and mean peak isometric force loss (R2 = 0.0374 at 96 hours), suggested that muscle soreness and muscle force loss may not be directly related. In conclusion, 5 days of Cr loading, followed by a Cr maintenance protocol did not reduce indices of muscle damage or speed recovery of upper body muscles following eccentrically induced muscle damage. Key points Creatine supplementation has been suggested as a means to diminish exercise induced muscle damage and speed

  3. Automated cell inspection systems for the determination of DNA damage and repair in the biological research

    NASA Astrophysics Data System (ADS)

    Boecker, Wilfried


    One important field of interest in medicine and biology is the evaluation of DNA repair and cellular DNA damage after physical or chemical treatment. Manual analysis has some disadvantages such as a decrease in recognition ability during the time consuming observations as well as a requirement of experts for microscopic investigations. Therefore, automatic inspection and recognition of biological structures in several applications such as fluorescence in situ hybridization (FISH), fluorescence immuno-assays, comet-assay, chromosome karyotyping and micronucleus assay have been considerably advanced in the last decade. This presentation will give an overview of the image analysis and pattern recognition methods employed in different automated cell inspection systems which have been developed in our institute during the last years. Depending on the kind of assay, different experimental setups must be used in order to extract the respective measurement quantities. For example FISH technique requires a very sensitive fluorescence microscope combined with an image intensified target or time integrating camera. The major algorithms for image preprocessing and image segmentation based on mathematical morphology are briefly introduced. Feature classification is carried out with different methods.

  4. Residual force enhancement following eccentric induced muscle damage.


    Power, Geoffrey A; Rice, Charles L; Vandervoort, Anthony A


    During lengthening of an activated skeletal muscle, the force maintained following the stretch is greater than the isometric force at the same muscle length. This is termed residual force enhancement (RFE), but it is unknown how muscle damage following repeated eccentric contractions affects RFE. Using the dorsiflexors, we hypothesised muscle damage will impair the force generating sarcomeric structures leading to a reduction in RFE. Following reference maximal voluntary isometric contractions (MVC) in 8 young men (26.5±2.8y) a stretch was performed at 30°/s over a 30° ankle excursion ending at the same muscle length as the reference MVCs (30° plantar flexion). Surface electromyography (EMG) of the tibialis anterior and soleus muscles was recorded during all tasks. The damage protocol involved 4 sets of 25 isokinetic (30°/s) lengthening contractions. The same measures were collected at baseline and immediately post lengthening contractions, and for up to 10min recovery. Following the lengthening contraction task, there was a 30.3±6.4% decrease in eccentric torque (P<0.05) and 36.2±9.7% decrease in MVC (P<0.05) compared to baseline. Voluntary activation using twitch interpolation and RMS EMG amplitude of the tibialis anterior remained near maximal without increased coactivation for MVC. Contrary to our hypothesis, RFE increased (∼100-250%) following muscle damage (P<0.05). It appears stretch provided a mechanical strategy for enhanced muscle function compared to isometric actions succeeding damage. Thus, active force of cross-bridges is decreased because of impaired excitation-contraction coupling but force generated during stretch remains intact because force contribution from stretched sarcomeric structures is less impaired.

  5. Relationship between recurrent liquefaction-induced damage and subsurface conditions in Midorigaoka, Japan

    SciTech Connect

    Wakamatsu, Kazue; Yoshida, Nozomu


    Midorigaoka, Kushiro City, northeast Japan, suffered liquefaction-induced ground failures during four successive earthquakes in the past thirty years. This paper presents the ground failures and their effects to structures observed in Midorigaoka during the earthquakes, and examines the relationships between recurrent liquefaction-induced damage and subsurface conditions. As a result, thick liquefiable fill, slope of the ground surface, and subsurface water conditions, which resulted primarily from filling a marshy valley, are found to be responsible on the damage.

  6. Long-term biological effects induced by ionizing radiation--implications for dose mediated risk.


    Miron, S D; Astărăstoae, V


    Ionizing radiations are considered to be risk agents that are responsible for the effects on interaction with living matter. The occurring biological effects are due to various factors such as: dose, type of radiation, exposure time, type of biological tissue, health condition and the age of the person exposed. The mechanisms involved in the direct modifications of nuclear DNA and mitochondrial DNA are reviewed. Classical target theory of energy deposition in the nucleus that causes DNA damages, in particular DNA double-strand breaks and that explanation of the biological consequences of ionizing radiation exposure is a paradigm in radiobiology. Recent experimental evidences have demonstrated the existence of a molecular mechanism that explains the non-targeted effects of ionizing radiation exposure. Among these novel data, genomic instability and a variety of bystander effects are discussed here. Those bystander effects of ionizing radiation are fulfilled by cellular communication systems that give rise to non-targeted effects in the neighboring non irradiated cells. This paper provides also a commentary on the synergistic effects induced by the co-exposures to ionizing radiation and various physical agents such as electromagnetic fields and the co-exposures to ionizing radiation and chemical environmental contaminants such as metals. The biological effects of multiple stressors on genomic instability and bystander effects are also discussed. Moreover, a brief presentation of the methods used to characterize cyto- and genotoxic damages is offered.

  7. Acrylonitrile-Induced Oxidative Stress and Oxidative DNA Damage in Male Sprague-Dawley Rats

    PubMed Central

    Kamendulis, Lisa M.; Klaunig, James E.


    Studies have demonstrated that the induction of oxidative stress may be involved in brain tumor induction in rats by acrylonitrile. The present study examined whether acrylonitrile induces oxidative stress and DNA damage in rats and whether blood can serve as a valid surrogate for the biomonitoring of oxidative stress induced by acrylonitrile in the exposed population. Male Sprague-Dawley rats were treated with 0, 3, 30, 100, and 200 ppm acrylonitrile in drinking water for 28 days. One group of rats were also coadministered N-acetyl cysteine (NAC) (0.3% in diet) with acrylonitrile (200 ppm in drinking water) to examine whether antioxidant supplementation was protective against acrylonitrile-induced oxidative stress. Direct DNA strand breakage in white blood cells (WBC) and brain was measured using the alkaline comet assay. Oxidative DNA damage in WBC and brain was evaluated using formamidopyrimidine DNA glycosylase (fpg)-modified comet assay and with high-performance liquid chromatography-electrochemical detection. No significant increase in direct DNA strand breaks was observed in brain and WBC from acrylonitrile-treated rats. However, oxidative DNA damage (fpg comet and 8′hydroxyl-2-deoxyguanosine) in brain and WBC was increased in a dose-dependent manner. In addition, plasma levels of reactive oxygen species (ROS) increased in rats administered acrylonitrile. Dietary supplementation with NAC prevented acrylonitrile-induced oxidative DNA damage in brain and WBC. A slight, but significant, decrease in the GSH:GSSG ratio was seen in brain at acrylonitrile doses > 30 ppm. These results provide additional support that the mode of action for acrylonitrile-induced astrocytomas involves the induction of oxidative stress and damage. Significant associations were seen between oxidative DNA damage in WBC and brain, ROS formation in plasma, and the reported tumor incidences. Since oxidative DNA damage in brain correlated with oxidative damage in WBC, these results suggest

  8. Laser-matter coupling mechanisms governing particulate-induced damage on optical surfaces

    NASA Astrophysics Data System (ADS)

    Matthews, M. J.; Feigenbaum, E.; Demos, S. G.; Raman, R. N.; Qiu, S. R.; Shen, N.; Harris, C.; Negres, R. A.; Norton, M.; Cross, D.; Rubenchik, A. M.


    A comprehensive study of laser-induced damage associated with particulate damage on optical surfaces is presented. Contaminant-driven damage on silica windows and multilayer dielectrics is observed to range from shallow pitting to more classical fracture-type damage, depending on particle-substrate material combination, as well as laser pulse characteristics. Ejection dynamics is studied in terms of plasma emission spectroscopy and pump-probe shadowgraphy. Our data is used to assess the momentum coupling between incident energy and the ejected plasma, which dominates the laser-particle-substrate interaction. Beam propagation analysis is also presented to characterize the impact of contaminant-driven surface pitting on optical performance.

  9. 4-hydroxybenzaldehyde-chitooligomers suppresses H2O2-induced oxidative damage in microglia BV-2 cells.


    Oh, Sea-Hun; Ryu, BoMi; Ngo, Dai-Hung; Kim, Won-Suk; Kim, Dong Gyu; Kim, Se-Kwon


    Positive charges of chitooligomer (COS) enable COS to interact with negatively charged anionic groups on the cell surface resulting in an improvement in the biological activity of COS and its derivatives. In this study, 4-hydroxybenzaldehyde-COS (HB-COS) was synthesized and investigated for its abilities against H2O2-induced oxidative stress in microglia BV-2 cells. Under oxidative stress, HB-COS significantly attenuated reactive oxygen species (ROS) generation and DNA oxidation, and upregulated the protein levels of antioxidative enzymes. HB-COS is therefore proposed as a potential protective agent against neuronal damage.

  10. Damage mechanisms for ultrasound-induced cavitation in tissue

    NASA Astrophysics Data System (ADS)

    Warnez, M.; Vlaisavljevich, E.; Xu, Z.; Johnsen, E.


    In a variety of biomedical applications, cavitation occurs in soft tissue. Although significant amounts of research have been performed on cavitation in water, bubble dynamics, and related bioeffects remain poorly understood. We use numerical simulations of spherical bubble dynamics in soft tissue to assess the extent to which viscoelasticity affects "known" and introduces "new" damage mechanisms. We find that deviatoric stresses - although not an important damage mechanism in water - are significantly enhanced and could be an important bioeffect mechanism in tissue. Both the viscoelastic properties and the nonlinear, large-collapse radius contribute to stress amplification in the surroundings. In addition, temperatures in the surrounding medium increase more in the Zener tissue than in water, due to viscous heating.

  11. Radiation-Induced Liver Damage: Correlation of Histopathology with Hepatobiliary Magnetic Resonance Imaging, a Feasibility Study

    SciTech Connect

    Seidensticker, Max; Burak, Miroslaw; Kalinski, Thomas; Garlipp, Benjamin; Koelble, Konrad; Wust, Peter; Antweiler, Kai; Seidensticker, Ricarda; Mohnike, Konrad; Pech, Maciej; Ricke, Jens


    PurposeRadiotherapy of liver malignancies shows promising results (radioembolization, stereotactic irradiation, interstitial brachytherapy). Regardless of the route of application, a certain amount of nontumorous liver parenchyma will be collaterally damaged by radiation. The functional reserve may be significantly reduced with an impact on further treatment planning. Monitoring of radiation-induced liver damage by imaging is neither established nor validated. We performed an analysis to correlate the histopathological presence of radiation-induced liver damage with functional magnetic resonance imaging (MRI) utilizing hepatobiliary contrast media (Gd-BOPTA).MethodsPatients undergoing local high-dose-rate brachytherapy for whom a follow-up hepatobiliary MRI within 120 days after radiotherapy as well as an evaluable liver biopsy from radiation-exposed liver tissue within 7 days before MRI were retrospectively identified. Planning computed tomography (CT)/dosimetry was merged to the CT-documentation of the liver biopsy and to the MRI. Presence/absence of radiation-induced liver damage (histopathology) and Gd-BOPTA uptake (MRI) as well as the dose applied during brachytherapy at the site of tissue sampling was determined.ResultsFourteen biopsies from eight patients were evaluated. In all cases with histopathological evidence of radiation-induced liver damage (n = 11), no uptake of Gd-BOPTA was seen. In the remaining three, cases no radiation-induced liver damage but Gd-BOPTA uptake was seen. Presence of radiation-induced liver damage and absence of Gd-BOPTA uptake was correlated with a former high-dose exposition.ConclusionsAbsence of hepatobiliary MRI contrast media uptake in radiation-exposed liver parenchyma may indicate radiation-induced liver damage. Confirmatory studies are warranted.

  12. Evaluating thermal damage induced by pulsed light with multiphoton microscopy

    NASA Astrophysics Data System (ADS)

    Gong, Wei; Xie, Shusen; Huang, Yimei


    Nonablative skin remodeling is a new light treatment approach for photodamaged skin. Compared to ablative CO2 or Er:YAG laser resurfacing, dermabrasion, and chemical peels, the clinical objective of nonablative skin remodeling is to maximize thermal damage to upper dermis while minimizing injury to the epidermis and surrounding tissue, consequently decreasing potential complications and shortening long recuperation periods. Histological analysis of preoperative and postoperative biopsies using H&E or special stains has indicated the dermal thermal injury, which resulting in collagen denaturation, is the most important mechanism of nonablative skin remodeling for improving skin situation. And the extent of improvement of skin situation corresponded to the formation of a new band of dense, compact collagen bundles in the papillary dermis. The diversity of individual skin condition influences the choice of pulsed light treatment parameters, and further influences the degree of dermal thermal damage, thus the efficacy of nonablative skin remodeling remains unstable. Recently, multiphoton microscopy has show a promising application for monitoring skin thermal damage, because collagen could produce strong second harmonic generation (SHG). And SHG intensity is presumably proportional to the percentage of collagen in dermis. In this paper, the auto-fluorescence (AF) intensity and SHG intensity of mice skin irradiated by pulsed Nd:YAG laser were measured and imaged with multiphoton microscope, and the results show the ratio of SHG to AF decreases with the increase of irradiation exposure dose, and could be a quantitative technique to assess dermal thermal damage, and could further benefit the choice of light treatment parameters.

  13. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    DTIC Science & Technology


    seed extract supplements and Labrador tea whole leaf extracts as potential radioprotectants. Three different commercial grape seed extracts were... supplements and Labrador tea whole leaf extracts as potential radioprotectants. A novel assay was used to compare DNA damage in cellular and...concentrations of commercial grape seed extract supplements and Labrador tea. In addition, this work has identified and validated a set of procedures to use

  14. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.


    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  15. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan


    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  16. Few-cycle pulse laser-induced damage of thin films in air and vacuum ambience

    NASA Astrophysics Data System (ADS)

    Kafka, Kyle R. P.; Talisa, Noah; Tempea, Gabriel; Austin, Drake R.; Neacsu, Catalin; Chowdhury, Enam A.


    Laser-induced damage mechanisms were investigated for an ultra-broadband chirped mirror, as part of a systematic study of few-cycle pulse laser-induced damage threshold (LIDT) of widely-used ultra-broadband optics, in vacuum and in air, for single and multi-pulse regimes (S-on-1). Microscopic analysis of damage morphology suggests that three different damage mechanisms occur across the fluence range 0.15-0.4J/cm2, while no ablation was yet observed. The three regimes resulted in shallow swelling (< 10 nm tall), tall blistering ( 150 nm tall), and annular blistering (damage suppressed at highest intensity, forming a ring shape). Descriptions of the potential mechanisms are discussed.

  17. A statistical mechanics model to predict electromigration induced damage and void growth in solder interconnects

    NASA Astrophysics Data System (ADS)

    Wang, Yuexing; Yao, Yao; Keer, Leon M.


    Electromigration is an irreversible mass diffusion process with damage accumulation in microelectronic materials and components under high current density. Based on experimental observations, cotton type voids dominate the electromigration damage accumulation prior to cracking in the solder interconnect. To clarify the damage evolution process corresponding to cotton type void growth, a statistical model is proposed to predict the stochastic characteristic of void growth under high current density. An analytical solution of the cotton type void volume growth over time is obtained. The synchronous electromigration induced damage accumulation is predicted by combining the statistical void growth and the entropy increment. The electromigration induced damage evolution in solder joints is developed and applied to verify the tensile strength deterioration of solder joints due to electromigration. The predictions agree well with the experimental results.

  18. Laser induced damage in optical materials: 8th ASTM symposium.


    Glass, A J; Guenther, A H


    The Eighth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was hosted by the National Bureau of Standards in Boulder, Colorado, from 13 to 15 July 1976. The Symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Energy Research and Development Administration, and the Office of Naval Research. About 160 scientists attended the Symposium, including representatives of the United Kingdom, France, Canada, and Brazil. The Symposium was divided into five half-day sessions concerning Bulk Material Properties and Thermal Behavior, Mirrors and Surfaces, Thin Film Properties, Thin Film Damage, and Scaling Laws and Fundamental Mechanisms. As in previous years, the emphasis of the papers presented at the Symposium was directed toward new frontiers and new developments. Particular emphasis was given to new materials for use at 10.6 microm in mirror substrates, windo s, and coatings. New techniques in film deposition and advances in diamond-turning of optics were described. The scaling of damage thresholds with pulse duration, focal area, and wavelength were discussed. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons of the Symposium. The Ninth Annual Symposium is scheduled for 4-6 October 1977 at the National Bureau of Standards, Boulder, Colorado.

  19. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.


    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong


    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  20. The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response

    PubMed Central

    Zhang, Xinna; Wan, Guohui; Berger, Franklin G.; He, Xiaoming; Lu, Xiongbin


    SUMMARY The DNA damage response involves a complex network of processes that detect and repair DNA damage. Here we show that miRNA biogenesis is globally induced upon DNA damage in an ATM-dependent manner. About one fourth of miRNAs are significantly up-regulated after DNA damage, while loss of ATM abolishes their induction. KSRP (KH-type splicing regulatory protein) is a key player that translates DNA damage signaling to miRNA biogenesis. The ATM kinase directly binds to and phosphorylates KSRP, leading to enhanced interaction between KSRP and pri-miRNAs and increased KSRP activity in miRNA processing. Mutations of the ATM phosphorylation sites of KSRP impaired its activity in regulating miRNAs. These findings reveal a mechanism by which DNA damage signaling is linked to miRNA biogenesis. PMID:21329876

  1. Induced superficial chondrocyte death reduces catabolic cartilage damage in murine posttraumatic osteoarthritis.


    Zhang, Minjie; Mani, Sriniwasan B; He, Yao; Hall, Amber M; Xu, Lin; Li, Yefu; Zurakowski, David; Jay, Gregory D; Warman, Matthew L


    Joints that have degenerated as a result of aging or injury contain dead chondrocytes and damaged cartilage. Some studies have suggested that chondrocyte death precedes cartilage damage, but how the loss of chondrocytes affects cartilage integrity is not clear. In this study, we examined whether chondrocyte death undermines cartilage integrity in aging and injury using a rapid 3D confocal cartilage imaging technique coupled with standard histology. We induced autonomous expression of diphtheria toxin to kill articular surface chondrocytes in mice and determined that chondrocyte death did not lead to cartilage damage. Moreover, cartilage damage after surgical destabilization of the medial meniscus of the knee was increased in mice with intact chondrocytes compared with animals whose chondrocytes had been killed, suggesting that chondrocyte death does not drive cartilage damage in response to injury. These data imply that chondrocyte catabolism, not death, contributes to articular cartilage damage following injury. Therefore, therapies targeted at reducing the catabolic phenotype may protect against degenerative joint disease.

  2. Fracture Induced Sub-Band Absorption as a Precursor to Optical Damage on Fused Silica Surfaces

    SciTech Connect

    Miller, P E; Bude, J D; Suratwala, T I; Shen, N; Laurence, T A; Steele, W A; Menapace, J; Feit, M D; Wong, L L


    The optical damage threshold of indentation induced flaws on fused silica surfaces was explored. Mechanical flaws were characterized by laser damaged testing, SEM, optical, and photoluminescence microscopy. Localized polishing, chemical etching, and the control of indentation morphology were used to isolate the structural features which limit optical damage. A thin defect layer on fracture surfaces, including those smaller than the wavelength of visible light, was found to be the dominant source of laser damage initiation during illumination with 355nm, 3ns laser pulses. Little evidence was found that either displaced or densified material or fluence intensification plays a significant role in optical damage at fluences >35J/cm{sup 2}. Elimination of the defect layer was shown to increase the overall damage performance of fused silica optics.

  3. Modelling biological and chemically induced precipitation of calcium phosphate in enhanced biological phosphorus removal systems.


    Barat, R; Montoya, T; Seco, A; Ferrer, J


    The biologically induced precipitation processes can be important in wastewater treatment, in particular treating raw wastewater with high calcium concentration combined with Enhanced Biological Phosphorus Removal. Currently, there is little information and experience in modelling jointly biological and chemical processes. This paper presents a calcium phosphate precipitation model and its inclusion in the Activated Sludge Model No 2d (ASM2d). The proposed precipitation model considers that aqueous phase reactions quickly achieve the chemical equilibrium and that aqueous-solid change is kinetically governed. The model was calibrated using data from four experiments in a Sequencing Batch Reactor (SBR) operated for EBPR and finally validated with two experiments. The precipitation model proposed was able to reproduce the dynamics of amorphous calcium phosphate (ACP) formation and later crystallization to hydroxyapatite (HAP) under different scenarios. The model successfully characterised the EBPR performance of the SBR, including the biological, physical and chemical processes.

  4. The effect of phytosterol protects rats against 4-nitrophenol-induced liver damage.


    Chen, Jiaqin; Song, Meiyan; Li, Yansen; Zhang, Yonghui; Taya, Kazuyoshi; Li, ChunMei


    We investigated the effect of phytosterol (PS) in regard to liver damage induced by 4-nitrophenol (PNP). Twenty rats were randomly divided into four groups (Control, PS, PNP, and PNP+PS). The PS and PNP+PS groups were pretreated with PS for one week. The PNP and PNP+PS groups were injected subcutaneously with PNP for 28 days. The control group received a basal diet and was injected with vehicle alone. Treatment with PS prevented the elevation of the total bilirubin levels, as well as an increase in serum alkaline transaminase and aspartate transaminase, which are typically caused by PNP-induced liver damage. Histopathologically showed that liver damage was significantly mitigated by PS treatment. However, there was no significant change in antioxidant enzyme activities, and the Nrf2-antioxidant system was not activated after treatment with PS. These results suggest that PS could mitigate liver damage induced by PNP, but does not enhance antioxidant capacity.

  5. Laser-induced fluorescence-cued, laser-induced breakdown spectroscopy biological-agent detection

    SciTech Connect

    Hybl, John D.; Tysk, Shane M.; Berry, Shaun R.; Jordan, Michael P


    Methods for accurately characterizing aerosols are required for detecting biological warfare agents. Currently, fluorescence-based biological agent sensors provide adequate detection sensitivity but suffer from high false-alarm rates. Combining single-particle fluorescence analysis with laser-induced breakdown spectroscopy (LIBS) provides additional discrimination and potentially reduces false-alarm rates. A transportable UV laser-induced fluorescence-cued LIBS test bed has been developed and used to evaluate the utility of LIBS for biological-agent detection. Analysis of these data indicates that LIBS adds discrimination capability to fluorescence-based biological-agent detectors.However, the data also show that LIBS signatures of biological agent simulants are affected by washing. This may limit the specificity of LIBS and narrow the scope of its applicability in biological-agent detection.

  6. Laser induced damage in optical materials: eleventh ASTM symposium.


    Bennett, H E; Glass, A J; Guenther, A H; Newnam, B


    The eleventh Symposium on Optical Materials for High-Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 30-31 October 1979. The symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Projects Agency, the Department of Energy, and the Office of Naval Research. About 150 scientists attended the symposium, including representatives of the United Kingdom, France, Canada, Japan, West Germany, and Denmark. The symposium was divided into sessions concerning transparent optical materials and the measurement of their properties, mirrors and surfaces, thin film characteristics, thin film damage, considerations for high-power systems, and finally theory and breakdown. As in previous years, the emphasis of the papers presented at the symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high-power apparatus. The wavelength range of prime interest was from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was discussed in detail. Harold E. Bennett of the Naval Weapons Center, Alexander J. Glass of the Lawrence Livermore Laboratory, Arthur H. Guenther of the Air Force Weapons Laboratory, and Brian E. Newnam of the Los Alamos Scientific Laboratory were cochairpersons. The twelfth annual symposium is scheduled for 30 September-1 October 1980 at the National Bureau of Standards, Boulder, Colorado.

  7. Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damage Measured in Metaphase and Interphase Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    George, Kerry; Durante, Marco; Willingham, Veronica; Wu, Honglu; Yang, Tracy C.; Cucinotta, Francis A.


    Chromosome aberrations were investigated in human lymphocytes after in vitro exposure to 1H-, 3He-, 12C-, 40Ar-, 28Si-, 56Fe-, or 197Au-ion beams, with LET ranging from approximately 0.4-1393 keV/microm in the dose range of 0.075-3 Gy. Dose-response curves for chromosome exchanges, measured at the first mitosis postirradiation using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosomal damage with respect to low- or high-dose-rate gamma rays. Estimates of RBEmax values for mitotic spreads, which ranged from near 0.7 to 11.1 for total exchanges, increased with LET, reaching a maximum at about 150 keV/microm, and decreased with further increase in LET. RBEs for complex aberrations are undefined due to the lack of an initial slope for gamma rays. Additionally, the effect of mitotic delay on RBE values was investigated by measuring chromosome aberrations in interphase after chemically induced premature chromosome condensation (PCC), and values were up to threefold higher than for metaphase analysis.

  8. The Influence of Shielding on the Biological Effectiveness of Accelerated Particles for the Induction of Chromosome Damages

    NASA Technical Reports Server (NTRS)

    George, K.; Cucinotta, F. A.


    Chromosome damage was assessed in human peripheral blood lymphocytes after in vitro exposure to the either Si-28 (490 or 600 MeV/n), Ti-48 (1000 MeV/n), or Fe-56 (600, 1000, or 5000 MeV/n). LET values for these ions ranged from approximately 50 to 174 keV/micrometers and doses ranged from 10 to 200 cGy. The effect of either aluminum or polyethylene shielding on the induction of chromosome aberrations was investigated for each ion. Chromosome exchanges were measured using fluorescence in situ hybridization (FISH) with whole chromosome probes in cells collected 48-56 hours after irradiation using a chemical-induced premature chromosome condensation (PCC) technique. The yield of chromosomal aberrations increased linearly with dose and the relative biological effectiveness (RBE) for the primary beams, estimated from the initial slope of the dose response curve for total chromosomal exchanges with respect to gamma-rays, ranged from 14 to 35. The RBE values increased with LET, reaching a maximum for the 1 GeV/n Fe ions with LET of 150 keV/micrometers, and decreased with further increases in LET. When LET of the primary beam was in the region of increasing RBE (i.e. below approximately 100 keV/micrometers), the addition of shielding material increased the effectiveness per unit dose. Whereas shielding decreased the effectiveness per unit dose when the LET of the primary particle beam was higher than 150 keV/micrometers.

  9. Impaired repair of ionizing radiation-induced DNA damage in Cockayne syndrome cells.


    Cramers, Patricia; Verhoeven, Esther E; Filon, A Ronald; Rockx, Davy A P; Santos, Susy J; van der Leer, Anneke A; Kleinjans, Jos C S; van Zeeland, Albert A; Mullenders, Leon H F


    Cockayne syndrome (CS) cells are defective in transcription-coupled repair (TCR) and sensitive to oxidizing agents, including ionizing radiation. We examined the hypothesis that TCR plays a role in ionizing radiation-induced oxidative DNA damage repair or alternatively that CS plays a role in transcription elongation after irradiation. Irradiation with doses up to 100 Gy did not inhibit RNA polymerase II-dependent transcription in normal and CS-B fibroblasts. In contrast, RNA polymerase I-dependent transcription was severely inhibited at 5 Gy in normal cells, indicating different mechanisms of transcription response to X rays. The frequency of radiation-induced base damage was 2 × 10(-7) lesions/base/Gy, implying that 150 Gy is required to induce one lesion/30-kb transcription unit; no TCR of X-ray-induced base damage in the p53 gene was observed. Therefore, it is highly unlikely that defective TCR underlies the sensitivity of CS to ionizing radiation. Overall genome repair levels of radiation-induced DNA damage measured by repair replication were significantly reduced in CS-A and CS-B cells. Taken together, the results do not provide evidence for a key role of TCR in repair of radiation-induced oxidative damages in human cells; rather, impaired repair of oxidative lesions throughout the genome may contribute to the CS phenotype.

  10. Dissecting the molecular mechanism of ionizing radiation-induced tissue damage in the feather follicle.


    Chen, Xi; Liao, Chunyan; Chu, Qiqi; Zhou, Guixuan; Lin, Xiang; Li, Xiaobo; Lu, Haijie; Xu, Benhua; Yue, Zhicao


    Ionizing radiation (IR) is a common therapeutic agent in cancer therapy. It damages normal tissue and causes side effects including dermatitis and mucositis. Here we use the feather follicle as a model to investigate the mechanism of IR-induced tissue damage, because any perturbation of feather growth will be clearly recorded in its regular yet complex morphology. We find that IR induces defects in feather formation in a dose-dependent manner. No abnormality was observed at 5 Gy. A transient, reversible perturbation of feather growth was induced at 10 Gy, leading to defects in the feather structure. This perturbation became irreversible at 20 Gy. Molecular and cellular analysis revealed P53 activation, DNA damage and repair, cell cycle arrest and apoptosis in the pathobiology. IR also induces patterning defects in feather formation, with disrupted branching morphogenesis. This perturbation is mediated by cytokine production and Stat1 activation, as manipulation of cytokine levels or ectopic Stat1 over-expression also led to irregular feather branching. Furthermore, AG-490, a chemical inhibitor of Stat1 signaling, can partially rescue IR-induced tissue damage. Our results suggest that the feather follicle could serve as a useful model to address the in vivo impact of the many mechanisms of IR-induced tissue damage.


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  13. Laser induced damage in optical materials: ninth ASTM symposium.


    Glass, A J; Guenther, A H


    The Ninth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 4-6 October 1977. The symposium was under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy (formerly ERDA), and the Office of Naval Research. About 185 scientists attended, including representatives of the United Kingdom, France, Canada, Australia, Union of South Africa, and the Soviet Union. The Symposium was divided into sessions concerning Laser Windows and Materials, Mirrors and Surfaces, Thin Films, Laser Glass and Glass Lasers, and Fundamental Mechanisms. As in previous years, the emphasis of the papers was directed toward new frontiers and new developments. Particular emphasis was given to materials for use from 10.6 microm to the uv region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength were also discussed. Alexander J. Glass of Lawrence Livermore Laboratory and Arthur H. Guenther of the Air Force Weapons Laboratory were co-chairpersons. The Tenth Annual Symposium is scheduled for 12-14 September 1978 at the National Bureau of Standards, Boulder, Colorado.

  14. Protective Effect of Pyruvate Against Radiation-Induced Damage in Collagenized Tissues

    NASA Technical Reports Server (NTRS)

    Griko, Y. V.; Yan, Xiaoli


    Exposure to high doses of ionizing radiation produces both acute and late effects on the collagenized tissues and have profound effects on wound healing. Because of the crucial practical importance for new radioprotective agents, our study has been focused on evaluation of the efficacy of non-toxic naturally occurring compounds to protect tissue integrity against high-dose gamma radiation. Here, we demonstrate that molecular integrity of collagen may serve as a sensitive biological marker for quantitative evaluation of molecular damage to collagenized tissue and efficacy of radioprotective agents. Increasing doses of gamma radiation (0-50kGy) result in progressive destruction of the native collagen fibrils, which provide a structural framework, strength, and proper milieu for the regenerating tissue. The strategy used in this study involved the thermodynamic specification of all structural changes in collagenized matrix of skin, aortic heart valve, and bone tissue induced by different doses and conditions of g-irradiation. This study describes a simple biophysical approach utilizing the Differential Scanning Calorimetry (DSC) to characterize the structural resistance of the aortic valve matrix exposed to different doses of g-irradiation. It allows us to identify the specific response of each constituent as well as to determine the influence of the different treatments on the characteristic parameters of protein structure. We found that pyruvate, a substance that naturally occurs in the body, provide significant protection (up to 80%) from biochemical and biomechanical damage to the collagenized tissue through the effective targeting of reactive oxygen species. The recently discovered role of pyruvate in the cell antioxidant defense to O2 oxidation, and its essential constituency in the daily human diet, indicate that the administration of pyruvate-based radioprotective formulations may provide safe and effective protection from deleterious effects of ionizing

  15. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben


    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  16. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed


    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  17. Effects of fatigue induced damage on the longitudinal fracture resistance of cortical bone.


    Fletcher, Lloyd; Codrington, John; Parkinson, Ian


    As a composite material, cortical bone accumulates fatigue microdamage through the repetitive loading of everyday activity (e.g. walking). The accumulation of fatigue microdamage is thought to contribute to the occurrence of fragility fractures in older people. Therefore it is beneficial to understand the relationship between microcrack accumulation and the fracture resistance of cortical bone. Twenty longitudinally orientated compact tension fracture specimens were machined from a single bovine femur, ten specimens were assigned to both the control and fatigue damaged groups. The damaged group underwent a fatigue loading protocol to induce microdamage which was assessed via fluorescent microscopy. Following fatigue loading, non-linear fracture resistance tests were undertaken on both the control and damaged groups using the J-integral method. The interaction of the crack path with the fatigue induced damage and inherent toughening mechanisms were then observed using fluorescent microscopy. The results of this study show that fatigue induced damage reduces the initiation toughness of cortical bone and the growth toughness within the damage zone by three distinct mechanisms of fatigue-fracture interaction. Further analysis of the J-integral fracture resistance showed both the elastic and plastic component were reduced in the damaged group. For the elastic component this was attributed to a decreased number of ligament bridges in the crack wake while for the plastic component this was attributed to the presence of pre-existing fatigue microcracks preventing energy absorption by the formation of new microcracks.

  18. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids.


    El-Yazbi, Amira F; Loppnow, Glen R


    Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb(3+)). Single-stranded oligonucleotides greatly enhance the Tb(3+) emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb(3+)/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb(3+), producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb(3+)/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb(3+)/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36±1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  19. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  20. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response.


    Xiang, Yang; Laurent, Benoit; Hsu, Chih-Hung; Nachtergaele, Sigrid; Lu, Zhike; Sheng, Wanqiang; Xu, Chuanyun; Chen, Hao; Ouyang, Jian; Wang, Siqing; Ling, Dominic; Hsu, Pang-Hung; Zou, Lee; Jambhekar, Ashwini; He, Chuan; Shi, Yang


    Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m(6)A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)(+) transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3) and the demethylase FTO (fat mass and obesity-associated protein). In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m(6)A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m(6)A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m(6)A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

  1. Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase

    PubMed Central

    Yuan, Zhi-Min; Huang, Yinyin; Ishiko, Takatoshi; Kharbanda, Surender; Weichselbaum, Ralph; Kufe, Donald


    Activation of the c-Abl protein tyrosine kinase by certain DNA-damaging agents contributes to down-regulation of Cdk2 and G1 arrest by a p53-dependent mechanism. The present work investigates the potential role of c-Abl in apoptosis induced by DNA damage. Transient transfection studies with wild-type, but not kinase-inactive, c-Abl demonstrate induction of apoptosis. Cells that stably express inactive c-Abl exhibit resistance to ionizing radiation-induced loss of clonogenic survival and apoptosis. Cells null for c-abl are also impaired in the apoptotic response to ionizing radiation. We further show that cells deficient in p53 undergo apoptosis in response to expression of c-Abl and exhibit decreases in radiation-induced apoptosis when expressing inactive c-Abl. These findings suggest that c-Abl kinase regulates DNA damage-induced apoptosis. PMID:9037071

  2. Coupling statistics and heat transfer to study laser-induced crystal damage by nanosecond pulses.


    Duchateau, Guillaume; Dyan, Anthony


    By coupling statistics and heat transfer, we investigate numerically laser-induced crystal damage by multi-gigawatt nanosecond pulses. Our model is based on the heating of nanometric absorbing defects that may cooperate when sufficiently aggregated. In that configuration, they induce locally a strong increase of temperature that may lead to a subsequent damage. This approach allows to predict cluster size distribution and damage probabilities as a function of the laser fluence. By studying the influence of the pulse duration onto the laser-induced damage threshold, we have established scaling laws that link the critical laser fluence to its pulse duration tau. In particular, this approach provides an explanation to the deviation from the standard tau(1/2) scaling law that has been recently observed in laser-induced damage experiments with KH(2)PO(4) (KDP) crystals [J.J. Adams et al., Proc. of SPIE 5991, 5991R-1 (2005)]. In the present paper, despite the 3D problem is tackled, we focus our attention on a 1D modeling of thermal diffusion that is shown to provide more reliable predictions than the 3D one. These results indicate that absorbers involved in KDP damage may be associated with a collection of planar defects. First general comparisons with some experimental facts have been performed.

  3. A Topical Mitochondria-Targeted Redox-Cycling Nitroxide Mitigates Oxidative Stress-Induced Skin Damage.


    Brand, Rhonda M; Epperly, Michael W; Stottlemyer, J Mark; Skoda, Erin M; Gao, Xiang; Li, Song; Huq, Saiful; Wipf, Peter; Kagan, Valerian E; Greenberger, Joel S; Falo, Louis D


    Skin is the largest human organ, and it provides a first line of defense that includes physical, chemical, and immune mechanisms to combat environmental stress. Radiation is a prevalent environmental stressor. Radiation-induced skin damage ranges from photoaging and cutaneous carcinogenesis caused by UV exposure, to treatment-limiting radiation dermatitis associated with radiotherapy, to cutaneous radiation syndrome, a frequently fatal consequence of exposures from nuclear accidents. The major mechanism of skin injury common to these exposures is radiation-induced oxidative stress. Efforts to prevent or mitigate radiation damage have included development of antioxidants capable of reducing reactive oxygen species. Mitochondria are particularly susceptible to oxidative stress, and mitochondrial-dependent apoptosis plays a major role in radiation-induced tissue damage. We reasoned that targeting a redox cycling nitroxide to mitochondria could prevent reactive oxygen species accumulation, limiting downstream oxidative damage and preserving mitochondrial function. Here we show that in both mouse and human skin, topical application of a mitochondrially targeted antioxidant prevents and mitigates radiation-induced skin damage characterized by clinical dermatitis, loss of barrier function, inflammation, and fibrosis. Further, damage mitigation is associated with reduced apoptosis, preservation of the skin's antioxidant capacity, and reduction of irreversible DNA and protein oxidation associated with oxidative stress.

  4. Depletion of enteric bacteria diminishes leukocyte infiltration following doxorubicin-induced small intestinal damage in mice

    PubMed Central

    Carr, Jacquelyn S.; King, Stephanie


    Background & aims While enteric bacteria have been shown to play a critical role in other forms of intestinal damage, their role in mediating the response to the chemotherapeutic drug Doxorubicin (Doxo) is unclear. In this study, we used a mouse model of intestinal bacterial depletion to evaluate the role enteric bacteria play in mediating Doxo-induced small intestinal damage and, more specifically, in mediating chemokine expression and leukocyte infiltration following Doxo treatment. An understanding of this pathway may allow for development of intervention strategies to reduce chemotherapy-induced small intestinal damage. Methods Mice were treated with (Abx) or without (NoAbx) oral antibiotics in drinking water for four weeks and then with Doxo. Jejunal tissues were collected at various time points following Doxo treatment and stained and analyzed for apoptosis, crypt damage and restitution, and macrophage and neutrophil number. In addition, RNA expression of inflammatory markers (TNFα, IL1-β, IL-10) and cytokines (CCL2, CC7, KC) was assessed by qRT-PCR. Results In NoAbx mice Doxo-induced damage was associated with rapid induction of apoptosis in jejunal crypt epithelium and an increase weight loss and crypt loss. In addition, we observed an increase in immune-modulating chemokines CCL2, CCL7 and KC and infiltration of macrophages and neutrophils. In contrast, while still positive for induction of apoptosis following Doxo treatment, Abx mice showed neither the overall weight loss nor crypt loss seen in NoAbx mice nor the increased chemokine expression and leukocyte infiltration. Conclusion Enteric bacteria play a critical role in Doxo-induced small intestinal damage and are associated with an increase in immune-modulating chemokines and cells. Manipulation of enteric bacteria or the damage pathway may allow for prevention or treatment of chemotherapy-induced small intestinal damage. PMID:28257503

  5. Protective effects of topical application of a poorly soluble antioxidant astaxanthin liposomal formulation on ultraviolet-induced skin damage.


    Hama, Susumu; Takahashi, Kanako; Inai, Yuko; Shiota, Kanako; Sakamoto, Ryota; Yamada, Asako; Tsuchiya, Hiroyuki; Kanamura, Kiyoshi; Yamashita, Eiji; Kogure, Kentaro


    Astaxanthin (Asx) would be expected to prevent ultraviolet (UV)-induced skin damage, as it is regarded as a potent antioxidative carotenoid in biological membranes. However, it is difficult to administer Asx topically to skin because of its poor water solubility. In this study, we attempted to solve this problem by preparing liposomes containing Asx (Asx-lipo), which were dispersible in the water phase, and therefore, suitable for topical application to the skin. Asx-lipo was shown to have potent scavenging ability against chemiluminescence-dependent singlet oxygen production in the water phase. When Asx-lipo was applied to skin before UV exposure, UV-induced skin thickening was prevented. Interestingly, collagen reduction induced by UV exposure was also prevented by preadministration of Asx-lipo. In addition, topical administration of Asx-lipo containing cationic lipid inhibited melanin production in skin exposed to UV. Consequently, we succeeded in preventing UV-induced skin damage using a topical application of a liposomal formulation containing Asx.

  6. Oxidative damage induced in Vicia faba by coke plant wastewater.


    Liu, Yuxiang; Lv, Yongkang


    The present study investigated toxic impacts of coke plant wastewater over a concentration gradient of COD( Cr) 40-640 mg/l on malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in roots and leaves of Vicia faba. MDA levels and SOD activities were significantly increased at all concentrations both in roots and leaves of Vicia faba; CAT and POD activities were significantly enhanced in roots at low concentrations and were significantly decreased at high concentrations (COD(Cr) 320 and 640 mg/l for CAT; COD( Cr) 640 mg/l for POD). In leaves, CAT and POD activities remained enhanced at all concentration and did not show significant difference at COD( Cr) 640 mg/l for CAT and COD(Cr) 40, 640 mg/l for POD. These results suggest that coke plant wastewater can cause oxidative damage in roots and leaves of Vicia faba and root enzymes seemed more sensitive to the wastewater.

  7. Molecular Hydrogen Therapy Ameliorates Organ Damage Induced by Sepsis.


    Zheng, Yijun; Zhu, Duming


    Since it was proposed in 2007, molecular hydrogen therapy has been widely concerned and researched. Many animal experiments were carried out in a variety of disease fields, such as cerebral infarction, ischemia reperfusion injury, Parkinson syndrome, type 2 diabetes mellitus, metabolic syndrome, chronic kidney disease, radiation injury, chronic hepatitis, rheumatoid arthritis, stress ulcer, acute sports injuries, mitochondrial and inflammatory disease, and acute erythema skin disease and other pathological processes or diseases. Molecular hydrogen therapy is pointed out as there is protective effect for sepsis patients, too. The impact of molecular hydrogen therapy against sepsis is shown from the aspects of basic vital signs, organ functions (brain, lung, liver, kidney, small intestine, etc.), survival rate, and so forth. Molecular hydrogen therapy is able to significantly reduce the release of inflammatory factors and oxidative stress injury. Thereby it can reduce damage of various organ functions from sepsis and improve survival rate. Molecular hydrogen therapy is a prospective method against sepsis.

  8. Oxidative damage of the male reproductive system induced by paraquat.


    Chen, Qing; Zhang, Xin; Zhao, Jin-Yan; Lu, Xiao-Ning; Zheng, Peng-Sheng; Xue, Xiang


    The effects of paraquat (PQ) on the male reproductive system are unclear. In this study, male rats were divided into four groups (0, 0.5, 2, and 8 mg/kg) and treated with PQ by oral gavage for 8 weeks. At the end of the experiment, a significant decline in sperm count, motility, and viability and an increase in teratospermia were observed in the PQ-treated group (P < 0.05). Further investigation found that PQ resulted in enhanced lipid peroxidation and more apoptosis in the testis tissues, and apoptosis was likely to be associated with activation of the mitochondrial pathway. In summary, our study demonstrated oxidative damage due to PQ on the male reproductive system.

  9. Laser induced damage in optical materials: twelfth ASTM symposium.


    Bennett, H E; Glass, A J; Guenther, A H; Newnam, B


    The twelfth annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, Colorado, 30 Sept.-l Oct., 1980. The symposium was held under the auspices of ASTM Committee F-l, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Projects Agency, the Department of Energy, the Office of Naval Research, and the Air Force Office of Scientific research. Over 150 scientists attended the symposium, including representatives of the United Kingdom, France, Japan, and West Germany. The symposium was divided into sessions concerning materials and measurements, mirrors and surfaces, thin films, and finally fundamental mechanisms. As in previous years, the emphasis of the papers presented at the symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high power systems. The wavelength range of prime interest was from 10.6 microm to the UV region. Highlights included surface characterization, thin film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. The scaling of damage thresholds with pulse duration, focal area, and wavelength was discussed in detail. Harold E. Bennett of the Naval Weapons Center, Alexander J. Glass of the Lawrence Livermore National Laboratory, Arthur H. Guenther of the Air Force Weapons Laboratory, and Brian E. Newnam of the Los Alamos National Laboratory were cochairmen of the symposium. The thirteenth annual symposium is scheduled for 17-18 Nov. 1981 at the National Bureau of Standards, Boulder, Colorado.

  10. Sulodexide prevents peripheral nerve damage in streptozotocin induced diabetic rats.


    Jin, Heung Yong; Lee, Kyung Ae; Song, Sun Kyung; Liu, Wei Jing; Choi, Ji Hae; Song, Chang Ho; Baek, Hong Sun; Park, Tae Sun


    We investigated whether sulodexide has additional protective effects against peripheral nerve damage caused by microvascular dysfunction in a rat model of diabetes. Female Sprague-Dawley (SD) rats were divided into the following 4 groups (n=7-9/group): Normal, Normal+Sulodexide (sulodexide 10mg/kg), diabetic group, and diabetic+Sulodexide (sulodexide 10mg/kg). We assessed current perception threshold, skin blood flow, superoxide dismutase, and proteinuria in experimental rats after oral administration of sulodexide for 20 weeks. We also performed morphometric analysis of sciatic nerves and intraepidermal nerve fibers of the foot. Superoxide dismutase activity in the blood and sciatic nerve were increased significantly after sulodexide treatment in the diabetic group. Current perception threshold was reduced at 2000 Hz (633.3 ± 24.15 vs 741.2 ± 23.5 μA, P<0.05) and skin blood flow was improved (10.90 ± 0.67 vs 8.85 ± 0.49 TPU, P<0.05) in the diabetic+Sulodexide group compared with the diabetic group. The mean myelinated axon area was significantly larger (56.6 ± 2.2 vs 49.8 ± 2.7 μm(2), P<0.05) and the intraepidermal nerve fiber density was significantly less reduced (6.27 ± 0.24 vs 5.40 ± 0.25/mm, P<0.05) in the diabetic+Sulodexide group compared to the diabetic group. Our results demonstrate that sulodexide exhibits protective effects against peripheral nerve damage in a rat experimental model of diabetes. Therefore, these findings suggest that sulodexide is a potential new therapeutic agent for diabetic peripheral neuropathy.

  11. Feasibility of OCT to detect radiation-induced esophageal damage in small animal models (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Jelvehgaran, Pouya; Alderliesten, Tanja; Salguero, Javier; Borst, Gerben; Song, Ji-Ying; van Leeuwen, Ton G.; de Boer, Johannes F.; de Bruin, Daniel M.; van Herk, Marcel B.


    Lung cancer survival is poor and radiotherapy patients often suffer serious treatment side effects. The esophagus is particularly sensitive leading to reduced food intake or even fistula formation. Only few direct techniques exist to measure radiation-induced esophageal damage, for which knowledge is needed to improve the balance between risk of tumor recurrence and complications. Optical coherence tomography (OCT) is a minimally-invasive imaging technique that obtains cross-sectional, high-resolution (1-10µm) images and is capable of scanning the esophageal wall up to 2-3mm depth. In this study we investigated the feasibility of OCT to detect esophageal radiation damage in mice. In total 30 mice were included in 4 study groups (1 main and 3 control groups). Mice underwent cone-beam CT imaging for initial setup assessment and dose planning followed by single-fraction dose delivery of 4, 10, 16, and 20Gy on 5mm spots, spaced 10mm apart. Mice were repeatedly imaged using OCT: pre-irradiation and up to 3 months post-irradiation. The control groups received either OCT only, irradiation only, or were sham-operated. We used histopathology as gold standard for radiation-induced damage diagnosis. The study showed edema in both the main and OCT-only groups. Furthermore, radiation-induced damage was primarily found in the highest dose region (distal esophagus). Based on the histopathology reports we were able to identify the radiation-induced damage in the OCT images as a change in tissue scattering related to the type of induced damage. This finding indicates the feasibility and thereby the potentially promising role of OCT in radiation-induced esophageal damage assessment.

  12. Extract from Armoracia rusticana and its flavonoid components protect human lymphocytes against oxidative damage induced by hydrogen peroxide.


    Gafrikova, Michala; Galova, Eliska; Sevcovicova, Andrea; Imreova, Petronela; Mucaji, Pavel; Miadokova, Eva


    DNA damage prevention is an important mechanism involved in cancer prevention by dietary compounds. Armoracia rusticana is cultivated mainly for its roots that are used in the human diet as a pungent spice. The roots represent rich sources of biologically active phytocompounds, which are beneficial for humans. In this study we investigated the modulation of H₂O₂ genotoxicity using the A. rusticana root aqueous extract (AE) and two flavonoids (kaempferol or quercetin). Human lymphocytes pre-treated with AE, kaempferol and quercetin were challenged with H₂O₂ and the DNA damage was assessed by the comet assay. At first we assessed a non-genotoxic concentration of AE and flavonoids, respectively. In lymphocytes challenged with H₂O₂ we proved that the 0.0025 mg·mL⁻¹ concentration of AE protected human DNA. It significantly reduced H₂O₂-induced oxidative damage (from 78% to 35.75%). Similarly, a non-genotoxic concentration of kaempferol (5 μg·mL⁻¹) significantly diminished oxidative DNA damage (from 83.3% to 19.4%), and the same concentration of quercetin also reduced the genotoxic effect of H₂O₂ (from 83.3% to 16.2%). We conclude that AE, kaempferol and quercetin probably act as antimutagens. The molecular mechanisms underlying their antimutagenic activity might be explained by their antioxidant properties.


    EPA Science Inventory

    Numerous natural and man-made agents are continuously released into the environment due to human activity. Many of these agents cause irreversible damage to the normal biological functions leading to morbidity and mortality in the exposed organisms. The possibility of deliberat...


    EPA Science Inventory

    Numerous natural and man-made agents are continuously released into the environment due to human activity. Many of these agents cause irreversible damage to the normal biological functions leading to morbidity and mortality in the exposed organisms. The possibility of deliberat...

  15. Ultrashort Laser Pulse Induced Electromagnetic Stress on Biological Macromolecular Systems.

    DTIC Science & Technology


    ULTRASHORT LASER PULSE INDUCED ~~~~~ ELECTROMAGNET IC STRESS ON BIOLOGICAL MACROMOLECULAR SYSTEMS Adam P. Bruckner , Ph.D. ( i~iiCJ. Michael ...AFSC, Brooks Air Force Base, Texas. Dr. John Taboada (RZL) was the Laboratory Project When U.S. Goverrijie~t drawings...available to the general public , including foreignnations. Thi s technical report has been reviewed and is approved for publ i-cation. OHN TABOADA , Ph.D

  16. Biological effects of laser-induced stress waves

    SciTech Connect

    Doukas, A.; Lee, S.; McAuliffe, D.


    Laser-induced stress waves can be generated by one of the following mechanisms: Optical breakdown, ablation or rapid heating of an absorbing medium. These three modes of laser interaction with matter allow the investigation of cellular and tissue responses to stress waves with different characteristics and under different conditions. The most widely studied phenomena are those of the collateral damage seen in photodisruption in the eye and in 193 run ablation of cornea and skin. On the other hand, the therapeutic application of laser-induced stress waves has been limited to the disruption of noncellular material such as renal stones, atheromatous plaque and vitreous strands. The effects of stress waves to cells and tissues can be quite disparate. Stress waves can fracture tissue, damage cells, and increase the permeability of the plasma membrane. The viability of cell cultures exposed to stress waves increases with the peak stress and the number of pulses applied. The rise time of the stress wave also influences the degree of cell injury. In fact, cell viability, as measured by thymidine incorporation, correlates better with the stress gradient than peak stress. Recent studies have also established that stress waves induce a transient increase of the permeability of the plasma membrane in vitro. In addition, if the stress gradient is below the damage threshhold, the cells remain viable. Thus, stress waves can be useful as a means of drug delivery, increasing the intracellular drug concentration and allowing the use of drugs which are impermeable to the cell membrane. The present studies show that it is important to create controllable stress waves. The wavelength tunability and the micropulse structure of the free electron laser is ideal for generating stress waves with independently adjustable parameters, such as rise time, duration and peak stress.

  17. The Cartography of UV-induced DNA Damage Formation and DNA Repair.


    Hu, Jinchuan; Adar, Sheera


    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis.

  18. Compartmental stress responses correlate with cell survival in bystander effects induced by the DNA damage agent, bleomycin.


    Savu, Diana; Petcu, Ileana; Temelie, Mihaela; Mustaciosu, Cosmin; Moisoi, Nicoleta


    Physical or chemical stress applied to a cell system trigger a signal cascade that is transmitted to the neighboring cell population in a process known as bystander effect. Despite its wide occurrence in biological systems this phenomenon is mainly documented in cancer treatments. Thus understanding whether the bystander effect acts as an adaptive priming element for the neighboring cells or a sensitization factor is critical in designing treatment strategies. Here we characterize the bystander effects induced by bleomycin, a DNA-damaging agent, and compartmental stress responses associated with this phenomenon. Mouse fibroblasts were treated with increasing concentrations of bleomycin and assessed for DNA damage, cell death and induction of compartmental stress response (endoplasmic reticulum, mitochondrial and cytoplasmic stress). Preconditioned media were used to analyze bystander damage using the same end-points. Bleomycin induced bystander response was reflected primarily in increased DNA damage. This was dependent on the concentration of bleomycin and time of media conditioning. Interestingly, we found that ROS but not NO are involved in the transmission of the bystander effect. Consistent transcriptional down-regulation of the stress response factors tested (i.e. BiP, mtHsp60, Hsp70) occurred in the direct effect indicating that bleomycin might induce an arrest of transcription correlated with decreased survival. We observed the opposite trend in the bystander effect, with specific stress markers appearing increased and correlated with increased survival. These data shed new light on the potential role of stress pathways activation in bystander effects and their putative impact on the pro-survival pro-death balance.

  19. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-Replication

    DTIC Science & Technology


    ml a that sustained rereplication leads to a dramatic decrease factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and...significant decrease in cell viability and a cellular DNA damage response. Strikingly, we have observed DNA damage in the absence of a classical...genome re-replicates. In this reporting period, we have shown that re-replication induces a rapid and significant decrease in cell viability and a

  20. Analyzing electrostatic induced damage risk to reticles with an in situ e-reticle system

    NASA Astrophysics Data System (ADS)

    Tu, Richard; Sebald, Thomas


    E-Reticle system is an electrostatic field test device, which has the form factor of a conventional six inch quartz production reticle. The E-Reticle was used to assess the ESD damage risks in a mask cleaning tool. Test results indicate that a reticle may see higher than ITRS recommended electrostatic potential specifications when mechanical operations and cold DIW rinse start and in progress, hence seeing increased probability of electrostatic induced damages.

  1. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.


    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  2. Testis damage induced by zinc deficiency in rats.


    Merker, H J; Günther, T


    Male Wistar rats were fed a Zn-deficient diet (1.2 mg/kg of Zn) for 28 days. Testes were then studied by light and electron microscopy. Zn deficiency induced necroses of precursors of germ cells leading to tubular atrophy and affected differentiation of spermatids. This was expressed by the occurrence of 2-4 axoneme-dense fibre-mitochondria complexes in one spermatid. Moreover, outer dense fibres, which normally contain 90% of sperm Zn, were "uncoiled" and flattened. The multiplication of the axoneme-dense fibre-mitochondria complexes induced by Zn deficiency might have been produced by an increase of Fe in spermatids and an increased formation of oxygen free radicals.

  3. Modification of radiation-induced oxidative damage in liposomal and microsomal membrane by eugenol

    NASA Astrophysics Data System (ADS)

    Pandey, B. N.; Lathika, K. M.; Mishra, K. P.


    Radiation-induced membrane oxidative damage, and their modification by eugenol, a natural antioxidant, was investigated in liposomes and microsomes. Liposomes prepared with DPH showed decrease in fluorescence after γ-irradiation, which was prevented significantly by eugenol and correlated with magnitude of oxidation of phospholipids. Presence of eugenol resulted in substantial inhibition in MDA formation in irradiated liposomes/microsomes, which was less effective when added after irradiation. Similarly, the increase in phospholipase C activity observed after irradiation in microsomes was inhibited in samples pre-treated with eugenol. Results suggest association of radio- oxidative membrane damage with alterations in signaling molecules, and eugenol significantly prevented these membrane damaging events.

  4. Initiation, Growth and Mitigation of UV Laser Induced Damage in Fused Silica

    SciTech Connect

    Rubenchik, A M; Feit, M D


    Laser damage of large fused silica optics initiates at imperfections. Possible initiation mechanisms are considered. We demonstrate that a model based on nanoparticle explosions is consistent with the observed initiation craters. Possible mechanisms for growth upon subsequent laser irradiation, including material modification and laser intensification, are discussed. Large aperture experiments indicate an exponential increase in damage size with number of laser shots. Physical processes associated with this growth and a qualitative explanation of self-accelerated growth is presented. Rapid growth necessitates damage growth mitigation techniques. Several possible mitigation techniques are mentioned, with special emphasis on CO{sub 2} processing. Analysis of material evaporation, crack healing, and thermally induced stress are presented.

  5. Initiation, Growth and Mitigation of UV Laser Induced Damage in Fused Silica

    SciTech Connect

    Rubenchik, A M; Feit, M D


    Laser damage of large fused silica optics initiates at imperfections. Possible initiation mechanisms are considered. We demonstrate that a model based on nanoparticle explosions is consistent with the observed initiation craters. Possible mechanisms for growth upon subsequent laser irradiation, including material modification and laser intensification, are discussed. Large aperture experiments indicate an exponential increase in damage size with number of laser shots. Physical processes associated with this growth and a qualitative explanation of self-accelerated growth is presented. Rapid growth necessitates damage growth mitigation techniques. Several possible mitigation techniques are mentioned, with special emphasis on CO{sub 2} processing. Analysis of material evaporation, crack healing, and thermally induced stress are presented.

  6. Modeling of laser-induced damage and optic usage at the National Ignition Facility

    NASA Astrophysics Data System (ADS)

    Liao, Zhi M.; Nostrand, Mike; Carr, Wren; Bude, Jeff; Suratwala, Tayyab I.


    Modeling of laser-induced optics damage has been introduced to benchmark existing optic usage at the National Ignition Facility (NIF) which includes the number of optics exchanged for damage repair. NIF has pioneered an optics recycle strategy to allow it to run the laser at capacity since fully commissioned in 2009 while keeping the cost of optics usage manageable. We will show how the damage model is being used to evaluate strategies to streamline our optics loop efficiency, as we strive to increase the laser shot rate without increasing operating costs.

  7. Preliminary Results of Earthquake-Induced Building Damage Detection with Object-Based Image Classification

    NASA Astrophysics Data System (ADS)

    Sabuncu, A.; Uca Avci, Z. D.; Sunar, F.


    Earthquakes are the most destructive natural disasters, which result in massive loss of life, infrastructure damages and financial losses. Earthquake-induced building damage detection is a very important step after earthquakes since earthquake-induced building damage is one of the most critical threats to cities and countries in terms of the area of damage, rate of collapsed buildings, the damage grade near the epicenters and also building damage types for all constructions. Van-Ercis (Turkey) earthquake (Mw= 7.1) was occurred on October 23th, 2011; at 10:41 UTC (13:41 local time) centered at 38.75 N 43.36 E that places the epicenter about 30 kilometers northern part of the city of Van. It is recorded that, 604 people died and approximately 4000 buildings collapsed or seriously damaged by the earthquake. In this study, high-resolution satellite images of Van-Ercis, acquired by Quickbird-2 (Digital Globe Inc.) after the earthquake, were used to detect the debris areas using an object-based image classification. Two different land surfaces, having homogeneous and heterogeneous land covers, were selected as case study areas. As a first step of the object-based image processing, segmentation was applied with a convenient scale parameter and homogeneity criterion parameters. As a next step, condition based classification was used. In the final step of this preliminary study, outputs were compared with streetview/ortophotos for the verification and evaluation of the classification accuracy.

  8. The effect of laser pulse width on laser-induced damage at K9 and UBK7 components surface

    NASA Astrophysics Data System (ADS)

    Zhou, Xinda; Ba, Rongsheng; Zheng, Yinbo; Yuan, Jing; Li, Wenhong; Chen, Bo


    In this paper, we investigated the effects of laser pulse width on laser-induced damage. We measured the damage threshold of K9 glass and UBK7 glass optical components at different pulse width, then analysis pulse-width dependence of damage threshold. It is shown that damage threshold at different pulse width conforms to thermal restriction mechanism, Because of cm size laser beam, defect on the optical component surface leads to laser-induced threshold decreased.

  9. Massage and ultrasound as therapeutic modalities in exercise-induced muscle damage.


    Tiidus, P M


    Although both massage and ultrasound treatment are used in clinical settings to enhance muscle functional recovery following exercise-induced muscle damage, there is a paucity of experimental evidence for their efficacy. Theoretically both massage and ultrasound could affect some physiological factors associated with enhancement of postexercise muscle recovery. However, the actual physiological mechanisms by which massage or ultrasound could influence postexercise muscle damage and repair are unknown. Most experimental evidence suggests that massage has little influence on muscle blood flow, clearance of "noxious" substances, recovery of postexercise muscle strength, or delayed soreness sensation. However, more data is needed before conclusions can be drawn as to the ability of massage to influence postexercise inflammatory response or various other physiological changes that characterize exercise-induced muscle damage and repair. There is even less information on the ability of ultrasound to influence physiological or functional factors associated with postexercise muscle damage. The few experiments that have been done tend to be contradictory and have yet to consider the range of ultrasound treatment parameters for therapeutic effectiveness in treating postexercise damage and influencing repair processes. Much more research is needed to determine whether either treatment modality can have any therapeutic effect on exercise-induced muscle damage and recovery of postexercise muscle function.

  10. The DNA damage response in viral-induced cellular transformation.


    Nikitin, P A; Luftig, M A


    The DNA damage response (DDR) has emerged as a critical tumour suppressor pathway responding to cellular DNA replicative stress downstream of aberrant oncogene over-expression. Recent studies have now implicated the DDR as a sensor of oncogenic virus infection. In this review, we discuss the mechanisms by which tumour viruses activate and also suppress the host DDR. The mechanism of tumour virus induction of the DDR is intrinsically linked to the need for these viruses to promote an S-phase environment to replicate their nucleic acid during infection. However, inappropriate expression of viral oncoproteins can also activate the DDR through various mechanisms including replicative stress, direct interaction with DDR components and induction of reactive oxygen species. Given the growth-suppressive consequences of activating the DDR, tumour viruses have also evolved mechanisms to attenuate these pathways. Aberrant expression of viral oncoproteins may therefore promote tumourigenesis through increased somatic mutation and aneuploidy due to DDR inactivation. This review will focus on the interplay between oncogenic viruses and the DDR with respect to cellular checkpoint control and transformation.

  11. Dimethylformamide-induced liver damage among synthetic leather workers

    SciTech Connect

    Wang, J.D.; Lai, M.Y.; Chen, J.S.; Lin, J.M.; Chiang, J.R.; Shiau, S.J.; Chang, W.S. )


    Prevalence of liver injury associated with dimethylformamide (DMF) exposure was determined. Medical examinations, liver function tests, and creatine phosphokinase (CPK) determinations were performed on 183 of 204 (76%) employees of a synthetic leather factory. Air concentrations of solvents were measured with personal samplers and gas chromatography. The concentration of DMF in air to which each worker was exposed was categorized. High exposure concentrations of DMF (i.e., 25-60 ppm) were significantly associated with elevated alanine aminotransferase (ALT) levels (ALT greater than or equal to 35 IU/l), a result that did not change even after stratification by hepatitis B carrier status. Modeling by logistic regression demonstrated that exposure to high concentrations of DMF was associated with an elevated ALT (p = .01), whereas hepatitis B surface antigen (HBsAg) was slightly but independently associated with an elevated ALT (p = .07). In those workers who had normal ALT values, there occurred still significantly higher mean ALT and aspartate aminotransferase (AST) activities, especially among those who were not HBsAg carriers. A significant association existed between elevated CPK levels and exposure to DMF. However, an analysis of the CPK isoenzyme among 143 workers did not reveal any specific damage to muscles. This outbreak of liver injury among synthetic leather workers is ascribed to DMF. It is recommended that the occupational standard for DMF and its toxicity among HBsAg carriers be evaluated further.

  12. Laser-induced damage in optical materials: sixteenth ASTM symposium.


    Bennett, H E; Guenther, A H; Milam, D; Newnam, B E


    The Sixteenth Annual Symposium on Optical Materials for High Power Lasers (Boulder Damage Symposium) was held at the National Bureau of Standards in Boulder, CO, 15-17 Oct. 1984. The Symposium was held under the auspices of ASTM Committee F-1, Subcommittee on Laser Standards, with the joint sponsorship of NBS, the Defense Advanced Research Project Agency, the Department of Energy, the Office of Naval Research, and the Air Force Office of Scientific Research. Approximately 180 scientists attended the Symposium, including representatives from England, France, The Netherlands, Scotland, and West Germany. The Symposium was divided into sessions concerning Materials and Measurements, Mirrors and Surfaces, Thin Films, and Fundamental Mechanisms. As in previous years, the emphasis of the papers presented at the Symposium was directed toward new frontiers and new developments. Particular emphasis was given to materials for high-power apparatus. The wavelength range of prime interest was from 10.6,microm to the UV region. Highlights included surface characterization, thin-film-substrate boundaries, and advances in fundamental laser-matter threshold interactions and mechanisms. Harold E. Bennett of the U.S. Naval Weapons Center, Arthur H. Guenther of the U.S. Air Force Weapons Laboratory, David Milam of the Lawrence Livermore National Laboratory, and Brian E. Newnam of the Los Alamos National Laboratory were cochairmen of the Symposium.

  13. Brown propolis attenuates cerebral ischemia-induced oxidative damage via affecting antioxidant enzyme system in mice.


    Bazmandegan, Gholamreza; Boroushaki, Mohammad Taher; Shamsizadeh, Ali; Ayoobi, Fatemeh; Hakimizadeh, Elham; Allahtavakoli, Mohammad


    Oxidative stress plays a critical role in ischemic brain injury. Superoxide dismutase (SOD) and glutathione peroxidase (GPx) are the enzymes underlying the endogenous antioxidant mechanisms affected by stroke and are considered as oxidative stress biomarkers. Brown propolis (BP) is a bioactive natural product with a set of biological activities that in turn may differ depending on the area from which the substance is originated. The aim of this study was to investigate the effect of water-extracted brown propolis (WEBPs), from two regions of Iran, against cerebral ischemia-induced oxidative injury in a mouse model of stroke. Experimentally, the chemical characterization and total polyphenol content were determined using GC/MS and Folin-Ciocalteu assay respectively. Seventy-two adult male mice were randomly divided into the surgical sham group, control group (treated with vehicle), and four groups of WEBPs-treated animals. The WEBPs were administered at the doses of 100 and 200mg/kg IP, during four different time points. Oxidative stress biomarkers (SOD and GPx activity, SOD/GPx ratio), lipid peroxidation (LPO) index (malondialdehyde content) and infarct volume were measured 48h post stroke. Behavioral tests were evaluated 24 and 48h after stroke. WEBPs treatment resulted in significant restoration of antioxidant enzymes activity and a subsequent decrease in LPO as well as the infarct volume compared to the control group. Sensory-motor impairment and neurological deficits were improved significantly as well. These results indicate that Iranian BP confers neuroprotection on the stroke-induced neuronal damage via an antioxidant mechanism which seems to be mediated by the endogenous antioxidant system.

  14. Neutrophil-derived microparticles induce myeloperoxidase-mediated damage of vascular endothelial cells

    PubMed Central


    Background Upon activation neutrophil releases microparticles - small plasma membrane vesicles that contain cell surface proteins and cytoplasmic matter, with biological activities. In this study we investigated the potential role of myeloperoxidase in the endothelial cell injury caused by neutrophil-derived microparticles. Results Microparticles were produced by activating human neutrophils with a calcium ionophore and characterized by flow cytometry and transmission and scanning electron microscopy. Myeloperoxidase activity was measured by luminol-dependent chemiluminescence. Neutrophil microparticles-induced injuries and morphological alterations in human umbilical vein endothelial cells (HUVECs) were evaluated by microscopy and flow cytometry. Neutrophil microparticles were characterized as structures bounded by lipid bilayers and were less than 1 μm in diameter. The microparticles also expressed CD66b, CD62L and myeloperoxidase, which are all commonly expressed on the surface of neutrophils, as well as exposition of phosphatidylserine. The activity of the myeloperoxidase present on the microparticles was confirmed by hypochlorous acid detection. This compound is only catalyzed by myeloperoxidase in the presence of hydrogen peroxide and chloride ion. The addition of sodium azide or taurine inhibited and reduced enzymatic activity, respectively. Exposure of HUVEC to neutrophil microparticles induced a loss of cell membrane integrity and morphological changes. The addition of sodium azide or myeloperoxidase-specific inhibitor-I consistently reduced the injury to the endothelial cells. Taurine addition reduced HUVEC morphological changes. Conclusions We have demonstrated the presence of active myeloperoxidase in neutrophil microparticles and that the microparticle-associated myeloperoxidase cause injury to endothelial cells. Hence, the microparticle-associated myeloperoxidase-hydrogen peroxide-chloride system may contribute to widespread endothelial cell damage

  15. Polyphenols in exercise performance and prevention of exercise-induced muscle damage.


    Malaguti, Marco; Angeloni, Cristina; Hrelia, Silvana


    Although moderate physical exercise is considered an essential component of a healthy lifestyle that leads the organism to adapt itself to different stresses, exercise, especially when exhaustive, is also known to induce oxidative stress, inflammation, and muscle damage. Many efforts have been carried out to identify dietary strategies or micronutrients able to prevent or at least attenuate the exercise-induced muscle damage and stress. Unfortunately most studies have failed to show protection, and at the present time data supporting the protective effect of micronutrients, as antioxidant vitamins, are weak and trivial. This review focuses on those polyphenols, present in the plant kingdom, that have been recently suggested to exert some positive effects on exercise-induced muscle damage and oxidative stress. In the last decade flavonoids as quercetin, catechins, and other polyphenols as resveratrol have caught the scientists attention. However, at the present time drawing a clear and definitive conclusion seems to be untimely.

  16. Polyphenols in Exercise Performance and Prevention of Exercise-Induced Muscle Damage

    PubMed Central

    Hrelia, Silvana


    Although moderate physical exercise is considered an essential component of a healthy lifestyle that leads the organism to adapt itself to different stresses, exercise, especially when exhaustive, is also known to induce oxidative stress, inflammation, and muscle damage. Many efforts have been carried out to identify dietary strategies or micronutrients able to prevent or at least attenuate the exercise-induced muscle damage and stress. Unfortunately most studies have failed to show protection, and at the present time data supporting the protective effect of micronutrients, as antioxidant vitamins, are weak and trivial. This review focuses on those polyphenols, present in the plant kingdom, that have been recently suggested to exert some positive effects on exercise-induced muscle damage and oxidative stress. In the last decade flavonoids as quercetin, catechins, and other polyphenols as resveratrol have caught the scientists attention. However, at the present time drawing a clear and definitive conclusion seems to be untimely. PMID:23983900

  17. Chlorogenic acid prevents isoproterenol-induced DNA damage in vascular smooth muscle cells

    PubMed Central

    Wang, Jingshuai; Li, Jiyang; Liu, Jie; Xu, Mengjiao; Tong, Xiaowen; Wang, Jianjun


    Numerous clinical therapeutic agents have been identified as DNA damaging. The present study revealed that isoproterenol (Iso) resulted in DNA damage in vascular smooth muscle cells (VSMCs) and increased the levels of intracellular oxygen free radicals. Administration of chlorogenic acid (CGA) inhibited this effect. Pretreatment with CGA abrogated the increase in protein expression levels of γ-H2A histone family member X, phosphorylated ataxia telangiectasia mutated, phosphorylated Rad3-related protein, breast cancer 1 and C-terminal Src homologous kinase induced by Iso. In addition, the increase in levels of intracellular reactive oxygen species (ROS) induced by Iso was inhibited by CGA pretreatment in a dose-dependent manner. The results of the present study suggest that CGA may inhibit Iso-induced VSMC damage via the suppression of ROS generation. Therefore, CGA may be a novel agent for the treatment of vascular diseases. PMID:27634104

  18. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    SciTech Connect

    Keszenman, D.J.; Sutherland, B. M.


    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  19. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    SciTech Connect

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.


    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased ..beta..-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of ..beta..-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of ..beta..-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events.

  20. Displacement damage induced in iron by gammas and neutrons under irradiation in the IFMIF test cell

    NASA Astrophysics Data System (ADS)

    Simakov, S. P.; Fischer, U.


    This work presents a complete comparative analysis of the radiation damage induced in iron-based materials in IFMIF by photons and neutrons. The gamma induced damage takes into account, for the first time, both photonuclear and photoatomic reaction mechanisms. The relevant cross sections were taken from available data evaluations. The gamma and neutron radiation fields were calculated by the McDeLicious Monte Carlo code using a 3-D geometry model. Finally the gamma and neutron induced damages in the iron have been assessed inside the IFMIF test cell and the surrounding concrete walls. It was found that the photoatomic mechanism dominates the photonuclear with at least one hundred times higher damage rates. The ratio of the gamma and the neutron induced displacement damage was found to be 10 -3 inside the concrete wall and 10 -5 in the components close to d-Li source. This fraction may increase a few times due to the uncertainty of the evaluated γ-dpa cross sections and the different surviving probabilities for defects produced by gammas and neutrons, nevertheless unlikely exceed 1%.

  1. Quercetin protects hamster spermatogenic cells from oxidative damage induced by diethylstilboestrol.


    Li, G; Ma, Aituan; Shi, W; Zhong, Xiuhui


    Quercetin has been reported to be an efficient antioxidant which protects chicken spermatogonial cells from oxidative damage through increasing intracellular antioxidants and decreasing lipid peroxidation. Exposure to diethylstilboestrol (DES) could cause reproductive damage in males, which is associated with oxidative stress. This study was conducted to investigate the protective effects of quercetin on DES-induced oxidative damage in cultured hamster spermatogenic cells. The cells were treated with different concentrations of DES, and their growth status was observed under inverted microscope. The viability of spermatogenic cells was detected by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT). The contents of superoxide dismutase (SOD) in supernatants and glutathione peroxidase (GSH-Px) in cells were detected with spectrophotography. The results showed that quercetin significantly inhibited the DES-induced damage on spermatogenic cells, with the exception of the low-dose group in which no significant difference was observed. The cell survival rate increased significantly in the middle- and high-dose groups. The contents of SOD and GSH-Px were significantly elevated after medication with quercetin (P < 0.01). It can be concluded that quercetin protects spermatogenic cells against DES-induced oxidative damage through increasing intracellular antioxidants and decreasing lipid peroxidation. Quercetin plays a very important role in ameliorating reproductive toxicity induced by environmental oestrogens.

  2. Modification of tumour cell metabolism modulates sensitivity to Chk1 inhibitor-induced DNA damage

    PubMed Central

    Massey, Andrew J.


    Chk1 kinase inhibitors are currently under clinical investigation as potentiators of cytotoxic chemotherapy and demonstrate potent activity in combination with anti-metabolite drugs that increase replication stress through the inhibition of nucleotide or deoxyribonucleotide biosynthesis. Inhibiting other metabolic pathways critical for the supply of building blocks necessary to support DNA replication may lead to increased DNA damage and synergy with an inhibitor of Chk1. A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A. Compounds, such as 2-deoxyglucose or 6-aminonicotinamide, that reduced the fraction of cells undergoing active replication rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage. Withdrawal of glucose or glutamine induced G1 and G2/M arrest without increasing DNA damage and reduced Chk1 expression and activation through autophosphorylation. This suggests the expression and activation of Chk1 kinase is associated with cells undergoing active DNA replication. Glutamine starvation rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage and reversal of the glutamine starvation restored the sensitivity of tumour cells to Chk1 inhibitor-induced DNA damage. Chk1 inhibitors may be a potentially useful therapeutic treatment for patients whose tumours contain a high fraction of replicating cells. PMID:28106079

  3. Oleandrin induces DNA damage responses in cancer cells by suppressing the expression of Rad51

    PubMed Central

    Bao, Zhengqiang; Tian, Baoping; Wang, Xiaohui; Feng, Hanrong; Liang, Ye; Chen, Zhihua; Li, Wen; Shen, Huahao; Ying, Songmin


    Oleandrin is a monomeric compound extracted from leaves and seeds of Nerium oleander. It had been reported that oleandrin could effectively inhibit the growth of human cancer cells. However, the specific mechanisms of the oleandrin-induced anti-tumor effects remain largely unclear. Genomic instability is one of the main features of cancer cells, it can be the combined effect of DNA damage and tumour-specific DNA repair defects. DNA damage plays important roles during tumorigenesis. In fact, most of the current chemotherapy agents were designed to kill cancer cells by inducing DNA damage. In this study, we found that oleandrin was effective to induce apoptosis in cancer cells, and cause rapid DNA damage response, represented by nuclear RPA (Replication Protein A, a single strand DNA binding protein) and γH2AX(a marker for DNA double strand breaks) foci formation. Interestingly, expression of RAD51, a key protein involved in homologous recombination (HR), was suppressed while XRCC1 was up-regulated in oleandrin treated cancer cells. These results suggested that XRCC1 may play a predominant role in repairing oleandrin-induced DNA damage. Collectively, oleandrin may be a potential anti-tumor agent by suppressing the expression of Rad51. PMID:27449097

  4. Strain-dependent Damage Evolution and Velocity Reduction in Fault Zones Induced by Earthquake Rupture

    NASA Astrophysics Data System (ADS)

    Zhong, J.; Duan, B.


    Low-velocity fault zones (LVFZs) with reduced seismic velocities relative to the surrounding wall rocks are widely observed around active faults. The presence of such a zone will affect rupture propagation, near-field ground motion, and off-fault damage in subsequent earth-quakes. In this study, we quantify the reduction of seismic velocities caused by dynamic rup-ture on a 2D planar fault surrounded by a low-velocity fault zone. First, we implement the damage rheology (Lyakhovsky et al. 1997) in EQdyna (Duan and Oglesby 2006), an explicit dynamic finite element code. We further extend this damage rheology model to include the dependence of strains on crack density. Then, we quantify off-fault continuum damage distribution and velocity reduction induced by earthquake rupture with the presence of a preexisting LVFZ. We find that the presence of a LVFZ affects the tempo-spatial distribu-tions of off-fault damage. Because lack of constraint in some damage parameters, we further investigate the relationship between velocity reduction and these damage prameters by a large suite of numerical simulations. Slip velocity, slip, and near-field ground motions computed from damage rheology are also compared with those from off-fault elastic or elastoplastic responses. We find that the reduction in elastic moduli during dynamic rupture has profound impact on these quantities.

  5. Dynamics of DNA Damage Induced Pathways to Cancer

    PubMed Central

    Tian, Kun; Rajendran, Ramkumar; Doddananjaiah, Manjula


    Chemotherapy is commonly used in cancer treatments, however only 25% of cancers are responsive and a significant proportion develops resistance. The p53 tumour suppressor is crucial for cancer development and therapy, but has been less amenable to therapeutic applications due to the complexity of its action, reflected in 66,000 papers describing its function. Here we provide a systematic approach to integrate this information by constructing a large-scale logical model of the p53 interactome using extensive database and literature integration. The model contains 206 nodes representing genes or proteins, DNA damage input, apoptosis and cellular senescence outputs, connected by 738 logical interactions. Predictions from in silico knock-outs and steady state model analysis were validated using literature searches and in vitro based experiments. We identify an upregulation of Chk1, ATM and ATR pathways in p53 negative cells and 61 other predictions obtained by knockout tests mimicking mutations. The comparison of model simulations with microarray data demonstrated a significant rate of successful predictions ranging between 52% and 71% depending on the cancer type. Growth factors and receptors FGF2, IGF1R, PDGFRB and TGFA were identified as factors contributing selectively to the control of U2OS osteosarcoma and HCT116 colon cancer cell growth. In summary, we provide the proof of principle that this versatile and predictive model has vast potential for use in cancer treatment by identifying pathways in individual patients that contribute to tumour growth, defining a sub population of “high” responders and identification of shifts in pathways leading to chemotherapy resistance. PMID:24023735

  6. Tetracycline Reduces Kidney Damage Induced by Loxosceles Spider Venom

    PubMed Central

    Okamoto, Cinthya Kimori; van den Berg, Carmen W.; Masashi, Mizuno; Gonçalves-de-Andrade, Rute M.; Tambourgi, Denise V.


    Envenomation by Loxosceles spider can result in two clinical manifestations: cutaneous and systemic loxoscelism, the latter of which includes renal failure. Although incidence of renal failure is low, it is the main cause of death, occurring mainly in children. The sphingomyelinase D (SMase D) is the main component in Loxosceles spider venom responsible for local and systemic manifestations. This study aimed to investigate the toxicity of L. intermedia venom and SMase D on kidney cells, using both In vitro and in vivo models, and the possible involvement of endogenous metalloproteinases (MMP). Results demonstrated that venom and SMase D are able to cause death of human kidney cells by apoptosis, concomitant with activation and secretion of extracellular matrix metalloproteases, MMP-2 and MMP-9. Furthermore, cell death and MMP synthesis and secretion can be prevented by tetracycline. In a mouse model of systemic loxoscelism, Loxosceles venom-induced kidney failure was observed, which was abrogated by administration of tetracycline. These results indicate that MMPs may play an important role in Loxosceles venom-induced kidney injury and that tetracycline administration may be useful in the treatment of human systemic loxoscelism. PMID:28257106

  7. Tetracycline Reduces Kidney Damage Induced by Loxosceles Spider Venom.


    Okamoto, Cinthya Kimori; van den Berg, Carmen W; Masashi, Mizuno; Gonçalves-de-Andrade, Rute M; Tambourgi, Denise V


    Envenomation by Loxosceles spider can result in two clinical manifestations: cutaneous and systemic loxoscelism, the latter of which includes renal failure. Although incidence of renal failure is low, it is the main cause of death, occurring mainly in children. The sphingomyelinase D (SMase D) is the main component in Loxosceles spider venom responsible for local and systemic manifestations. This study aimed to investigate the toxicity of L. intermedia venom and SMase D on kidney cells, using both In vitro and in vivo models, and the possible involvement of endogenous metalloproteinases (MMP). Results demonstrated that venom and SMase D are able to cause death of human kidney cells by apoptosis, concomitant with activation and secretion of extracellular matrix metalloproteases, MMP-2 and MMP-9. Furthermore, cell death and MMP synthesis and secretion can be prevented by tetracycline. In a mouse model of systemic loxoscelism, Loxosceles venom-induced kidney failure was observed, which was abrogated by administration of tetracycline. These results indicate that MMPs may play an important role in Loxosceles venom-induced kidney injury and that tetracycline administration may be useful in the treatment of human systemic loxoscelism.

  8. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, K.; Cucinotta, F. A.


    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to 28Si- ions with energies ranging from 90 to 600 MeV/u, or to 56Fe-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Fe beams in this study ranged from 145 to 440 keV/micron and the LET of the Si ions ranged from 48 to 158 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to -rays. The estimates of RBE(sub max) values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBE(sub max) value for Fe ions was obtained with the 600-Mev/u beam, and the highest RBE(sub max) value for Si ions was obtained with the 170 MeV/u beam. For both ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/ m for Si, and decreasing with further increase in LET. Additional studies for low doses 28Si-ions down to 0.02 Gy will be discussed.

  9. Rhabdomyolysis and myocardial damage induced by palytoxin, a toxin of blue humphead parrotfish.


    Okano, H; Masuoka, H; Kamei, S; Seko, T; Koyabu, S; Tsuneoka, K; Tamai, T; Ueda, K; Nakazawa, S; Sugawa, M; Suzuki, H; Watanabe, M; Yatani, R; Nakano, T


    A 55-year-old man had rhabdomyolysis and myocardial damage induced by palytoxin. Weakness and myalgia of four extremities occurred five hours after eating a fish. Rhabdomyolysis developed and the serum creatine phosphokinase (CK) was elevated to 40,000 IU/l on the 3rd day. Gastric lavage with activated charcoal and forced mannitol-alkaline diuresis therapy were performed. The patient recovered with no complication such as renal failure. In this case, palytoxin was suggested to induce myocardial damage which was demonstrated by an elevation of the myosin light chain level and a change in electrocardiogram.

  10. Melatonin attenuates brain mitochondria DNA damage induced by potassium cyanide in vivo and in vitro.


    Yamamoto, Hiro-aki; Mohanan, Parayanthala V


    The effect of potassium cyanide on mitochondria DNA (mtDNA) in mouse brain was investigated in vivo and in vitro. When potassium cyanide (0, 0.1, 1.0 or 2.0 mM) was incubated with a crude mitochondria fraction prepared from mouse brain at 37 degrees C for 60 min, the damage of mtDNA was observed in a concentration-dependent manner. However, the mtDNA damage was prevented by a co-treatment with melatonin (1.5 mM), a scavenger of hydroxyl radicals (*OH). Furthermore, a subcutaneous injection of potassium cyanide (7mg/kg) caused both brain mtDNA damage and severe seizures in mouse. The damage of mtDNA and seizures induced by potassium cyanide were abolished by the pre-injection of melatonin (20 mg/kg). Hydrogen peroxide (1.5 mM) inflicted damage to brain mtDNA in the presence of Fe(2+) (3.0 microM). The damage was abolished by the co-treatment with melatonin. Furthermore, when cyanide (0, 0.1 or 1.0 mM) was incubated with the crude mitochondria fraction prepared from mouse brain, the lipid peroxidation was significantly increased in a concentration-dependent manner. The increased lipid peroxidation was completely inhibited by the co-treatment with melatonin (1.0 mM). These results suggest that reactive oxygen species including the *OH may play a cardinal role for mtDNA damage induced by potassium cyanide. Hence, the present study concluded that melatonin protects against DNA damage induced by the *OH produced by cyanide or hydrogen peroxide.

  11. Molecular responses to photogenotoxic stress induced by the antibiotic lomefloxacin in human skin cells: from DNA damage to apoptosis.


    Marrot, Laurent; Belaïdi, Jean Phillipe; Jones, Christophe; Perez, Phillipe; Riou, Lydia; Sarasin, Alain; Meunier, Jean Roch


    Photo-unstable chemicals sometimes behave as phototoxins in skin, inducing untoward clinical side-effects when exposed to sunlight. Some drugs, such as psoralens or fluoroquinolones, can damage genomic DNA, thus increasing the risk of photocarcinogenesis. Here, lomefloxacin, an antibiotic from the fluoroquinolone family known to be involved in skin tumor development in photoexposed mice, was studied using normal human skin cells in culture: fibroblasts, keratinocytes, and Caucasian melanocytes. When treated cells were exposed to simulated solar ultraviolet A (320-400 nm), lomefloxacin induced damage such as strand breaks and pyrimidine dimers in genomic DNA. Lomefloxacin also triggered various stress responses: heme-oxygenase-1 expression in fibroblasts, changes in p53 status as shown by the accumulation of p53 and p21 proteins or the induction of MDM2 and GADD45 genes, and stimulation of melanogenesis by increasing the tyrosinase activity in melanocytes. Lomefloxacin could also lead to apoptosis in keratinocytes exposed to ultraviolet A: caspase-3 was activated and FAS-L gene was induced. Moreover, keratinocytes were shown to be the most sensitive cell type to lomefloxacin phototoxic effects, in spite of the well-established effectiveness of their antioxidant equipment. These data show that the phototoxicity of a given drug can be driven by different mechanisms and that its biologic impact varies according to cell type.

  12. Sulforaphane protects against cytokine- and streptozotocin-induced {beta}-cell damage by suppressing the NF-{kappa}B pathway

    SciTech Connect

    Song, Mi-Young; Kim, Eun-Kyung; Moon, Woo-Sung; Park, Jin-Woo; Kim, Hyung-Jin; So, Hong-Seob; Park, Raekil; Kwon, Kang-Beom Park, Byung-Hyun


    Sulforaphane (SFN) is an indirect antioxidant that protects animal tissues from chemical or biological insults by stimulating the expression of several NF-E2-related factor-2 (Nrf2)-regulated phase 2 enzymes. Treatment of RINm5F insulinoma cells with SFN increases Nrf2 nuclear translocation and expression of phase 2 enzymes. In this study, we investigated whether the activation of Nrf2 by SFN treatment or ectopic overexpression of Nrf2 inhibited cytokine-induced {beta}-cell damage. Treatment of RIN cells with IL-1{beta} and IFN-{gamma} induced {beta}-cell damage through a NF-{kappa}B-dependent signaling pathway. Activation of Nrf2 by treatment with SFN and induction of Nrf2 overexpression by transfection with Nrf2 prevented cytokine toxicity. The mechanism by which Nrf2 activation inhibited NF-{kappa}B-dependent cell death signals appeared to involve the reduction of oxidative stress, as demonstrated by the inhibition of cytokine-induced H{sub 2}O{sub 2} production. The protective effect of SFN was further demonstrated by the restoration of normal insulin secreting responses to glucose in cytokine-treated rat pancreatic islets. Furthermore, pretreatment with SFN blocked the development of type 1 diabetes in streptozotocin-treated mice.

  13. Cerium oxide nanoparticles, combining antioxidant and UV shielding properties, prevent UV-induced cell damage and mutagenesis

    NASA Astrophysics Data System (ADS)

    Caputo, Fanny; de Nicola, Milena; Sienkiewicz, Andrzej; Giovanetti, Anna; Bejarano, Ignacio; Licoccia, Silvia; Traversa, Enrico; Ghibelli, Lina


    Efficient inorganic UV shields, mostly based on refracting TiO2 particles, have dramatically changed the sun exposure habits. Unfortunately, health concerns have emerged from the pro-oxidant photocatalytic effect of UV-irradiated TiO2, which mediates toxic effects on cells. Therefore, improvements in cosmetic solar shield technology are a strong priority. CeO2 nanoparticles are not only UV refractors but also potent biological antioxidants due to the surface 3+/4+ valency switch, which confers anti-inflammatory, anti-ageing and therapeutic properties. Herein, UV irradiation protocols were set up, allowing selective study of the extra-shielding effects of CeO2vs. TiO2 nanoparticles on reporter cells. TiO2 irradiated with UV (especially UVA) exerted strong photocatalytic effects, superimposing their pro-oxidant, cell-damaging and mutagenic action when induced by UV, thereby worsening the UV toxicity. On the contrary, irradiated CeO2 nanoparticles, via their Ce3+/Ce4+ redox couple, exerted impressive protection on UV-treated cells, by buffering oxidation, preserving viability and proliferation, reducing DNA damage and accelerating repair; strikingly, they almost eliminated mutagenesis, thus acting as an important tool to prevent skin cancer. Interestingly, CeO2 nanoparticles also protect cells from the damage induced by irradiated TiO2, suggesting that these two particles may also complement their effects in solar lotions. CeO2 nanoparticles, which intrinsically couple UV shielding with biological and genetic protection, appear to be ideal candidates for next-generation sun shields.

  14. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.


    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  15. Nature and Consequences of Induced Chromosome Damage in Mammals

    PubMed Central

    Searle, A. G.


    There are marked qualitative and quantitative differences in the patterns of chromosomal damage observed after irradiation of spermatogonia, spermatozoa and oocytes of mice. These differences often result from reduced or zero transmission of particular classes of abberration arising in pre-meiotic germ cells. Probably this is the reason why the level of X-chromosomal and autosomal monosomy is not increased after spermatogonial irradiation. Similarly, the reduced transmission of certain d–se deficiencies may help to explain their low F1 frequency after pre-meiotic as compared with later irradiation. Spermatozoal irradiation has revealed no Robertsonian translocations, but has produced some types of reciprocal translocations which apparently are not transmitted to the F1 after spermatogonial treatment because they prevent maturation of the male pre-meiotic germ cell. Thus they cause sterility in males, but not in females. They include X-autosome and Y-autosome translocations, those giving a metacentric or sub-metacentric chromosome (with reciprocal product present) and those in which one break-point is in or near the centromeric heterochromatin while the other is more distally placed. This last group (which grades into male sub-fertile conditions) gives a preponderance of chain configurations (often with one separate univalent) in heterozygotes of both sexes at meiosis and a high incidence of somatic marker chromosomes. Nondisjunction associated with the univalent generates tertiary trisomics, which are usually male-sterile also and may show phenotypic abnormalities. Sterile males with complete separation of X and Y chromosomes have also been reported after mutagenic treatment of meiotic and post-meiotic germ cells. Such separation seems to prevent a primary spermatocyte from forming a secondary one. The usual derivation (in mouse and man) of tertiary trisomics from mothers rather than from fathers may be due to a similar block, together with a general tendency for

  16. Orally administered epigallocatechin gallate attenuates light-induced photoreceptor damage.


    Costa, Belmira Lara da Silveira Andrade da; Fawcett, Rebecca; Li, Guang-Yu; Safa, Rukhsana; Osborne, Neville N


    EGCG, a major component of green tea, has a number of properties which includes it being a powerful antioxidant. The purpose of this investigation was to deduce whether inclusion of EGCG in the drinking water of albino rats attenuates the effect of a light insult (2200lx, for 24h) to the retina. TUNEL-positive cells were detected in the outer nuclear layer of the retina, indicating the efficacy of the light insult in inducing photoreceptor degeneration. Moreover, Ret-P1 and the mRNA for rhodopsin located at photoreceptors were also significantly reduced as well as the amplitude of both the a- and b-waves of the electroretinogram was also reduced showing that photoreceptors in particular are affected by light. An increase in protein/mRNA of GFAP located primarily to Müller cells caused by light shows that other retinal components are also influenced by the light insult. However, antigens associated with bipolar (alpha-PKC), ganglion (Thy-1) and amacrine (GABA) cells, in contrast, appeared unaffected. The light insult also caused a change in the content of various proteins (caspase-3, caspase-8, PARP, Bad, and Bcl-2) involved in apoptosis. A number of the changes to the retina caused by a light insult were significantly attenuated when EGCG was in the drinking water. The reduction of the a- and b-waves and photoreceptor specific mRNAs/protein caused by light were significantly less. In addition, EGCG attenuated the changes caused by light to certain apoptotic proteins (especially at after 2 days) but did not appear to significantly influence the light-induced up-regulation of GFAP protein/mRNA. It is concluded that orally administered EGCG blunts the detrimental effect of light to the retina of albino rats where the photoreceptors are primarily affected.

  17. Gold nanoparticles induce DNA damage in the blood and liver of rats

    NASA Astrophysics Data System (ADS)

    Cardoso, Eria; Londero, Eduardo; Ferreira, Gabriela Kozuchovski; Rezin, Gislaine Tezza; Zanoni, Elton Torres; de Souza Notoya, Frederico; Leffa, Daniela Dimer; Damiani, Adriani Paganini; Daumann, Francine; Rohr, Paula; da Silva, Luciano; Andrade, Vanessa M.; da Silva Paula, Marcos Marques


    The potential of gold nanoparticles (GNPs) for use in different biological applications has led to a strong interest in the study of their possible deleterious effects in biological systems and how these effects may be mitigated. This study was undertaken to investigate the effects of the acute and chronic administration of GNPs with mean diameters of 10 and 30 nm on deoxyribonucleic acid (DNA) damage in the blood and liver of adult rats. For the acute administration, Wistar adult rats received a single intraperitoneal injection of either GNPs or a saline solution. For the chronic administration, Wistar adult rats received a daily single injection of the same GNPs or saline solution for 28 days. Twenty-four hours after either the single (acute) or final injection (chronic), the rats were euthanised by decapitation, and the blood and liver were isolated for the evaluation of DNA damage. In this study, we demonstrated that the acute and chronic administration of GNPs 10 and 30 nm in size increased the frequency of DNA damage and the damage index in the blood and liver of adult rats. These findings suggest that the DNA damage may be caused by oxidative stress, which occurred regardless of the type of administration and GNP size.

  18. Hyaluronic acid prevents immunosuppressive drug-induced ovarian damage via up-regulating PGRMC1 expression

    PubMed Central

    Zhao, Guangfeng; Yan, Guijun; Cheng, Jie; Zhou, Xue; Fang, Ting; Sun, Haixiang; Hou, Yayi; Hu, Yali


    Chemotherapy treatment in women can frequently cause damage to the ovaries, which may lead to primary ovarian insufficiency (POI). In this study, we assessed the preventative effects of hyaluronic acid (HA) in immunosuppressive drug-induced POI-like rat models and investigated the possible mechanisms. We found that HA, which was reduced in primary and immunosuppressant-induced POI patients, could protect the immunosuppressant-induced damage to granulosa cells (GCs) in vitro. Then we found that HA blocked the tripterygium glycosides (TG) induced POI-like presentations in rats, including delayed or irregular estrous cycles, reduced 17 beta-estradiol(E2) concentration, decreased number of follicles, destruction of follicle structure, and damage of reproductive ability. Furthermore, we investigated the mechanisms of HA prevention effects on POI, which was associated with promotion of GC proliferation and PGRMC1 expression. In conclusion, HA prevents chemotherapy-induced ovarian damage by promoting PGRMC1 in GCs. This study may provide a new strategy for prevention and treatment of POI. PMID:25558795

  19. Involvement of DNA-PK and ATM in radiation- and heat-induced DNA damage recognition and apoptotic cell death.


    Tomita, Masanori


    Exposure to ionizing radiation and hyperthermia results in important biological consequences, e.g. cell death, chromosomal aberrations, mutations, and DNA strand breaks. There is good evidence that the nucleus, specifically cellular DNA, is the principal target for radiation-induced cell lethality. DNA double-strand breaks (DSBs) are considered to be the most serious type of DNA damage induced by ionizing radiation. On the other hand, verifiable mechanisms which can lead to heat-induced cell death are damage to the plasma membrane and/or inactivation of heat-labile proteins caused by protein denaturation and subsequent aggregation. Recently, several reports have suggested that DSBs can be induced after hyperthermia because heat-induced phosphorylated histone H2AX (γ-H2AX) foci formation can be observed in several mammalian cell lines. In mammalian cells, DSBs are repaired primarily through two distinct and complementary mechanisms: non-homologous end joining (NHEJ), and homologous recombination (HR) or homology-directed repair (HDR). DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia mutated (ATM) are key players in the initiation of DSB repair and phosphorylate and/or activate many substrates, including themselves. These phosphorylated substrates have important roles in the functioning of cell cycle checkpoints and in cell death, as well as in DSB repair. Apoptotic cell death is a crucial cell suicide mechanism during development and in the defense of homeostasis. If DSBs are unrepaired or misrepaired, apoptosis is a very important system which can protect an organism against carcinogenesis. This paper reviews recently obtained results and current topics concerning the role of DNA-PK and ATM in heat- or radiation-induced apoptotic cell death.

  20. Taurocholic Acid Prevents Biliary Damage Induced by Hepatic Artery Ligation in Cholestatic Rats

    PubMed Central

    Glaser, Shannon; Onori, Paolo; Gaudio, Eugenio; Ueno, Yoshiyuki; Pannarale, Luigi; Franchitto, Antonio; Francis, Heather; Mancinelli, Romina; Carpino, Guido; Venter, Julie; White, Mellanie; Kopriva, Shelley; Vetuschi, Antonella; Sferra, Roberta; Alpini, Gianfranco


    Background Ischemic injury by hepatic artery ligation (HAL) during obstructive cholestasis induced by bile duct ligation (BDL) results in bile duct damage, which can be prevented by administration of VEGF-A. The potential regulation of VEGF and VEGF receptor expression and secretion by bile acids in BDL with HAL is unknown. Aims We evaluated whether taurocholic acid (TC) can prevent HAL-induced cholangiocyte damage via the alteration of VEGFR-2 and/or VEGF-A expression. Methods Utilizing BDL, BDL+TC, BDL+HAL, BDL+HAL+TC, and BDL+HAL+wortmannin+TC treated rats, we evaluated cholangiocyte apoptosis, proliferation, and secretion as well VEGF-A and VEGFR-2 expression by immunohistochemistry. In vitro, we evaluated the effects of TC on cholangiocyte secretion of VEGF-A and the dependence of TC-induced proliferation on the activity of VEGFR-2. Results In BDL rats with HAL, chronic feeding of TC prevented HAL-induced loss of bile ducts and HAL-induced decreased cholangiocyte secretion. TC also prevented HAL-inhibited VEGF-A and VEGFR-2 expression in liver sections and HAL-induced circulating VEGF-A levels, which were blocked by wortmannin administration. In vitro, TC stimulated increased VEGF-A secretion by cholangiocytes, which was blocked by wortmannin and stimulated cholangiocyte proliferation that was blocked by VEGFR-2 kinase inhibitor. Conclusion TC prevented HAL-induced biliary damage by upregulation of VEGF-A expression. PMID:20303838

  1. Dielectric-thickness dependence of damage induced by electron-beam irradiation of MNOS gate pattern

    NASA Astrophysics Data System (ADS)

    Matsui, Miyako; Mine, Toshiyuki; Hozawa, Kazuyuki; Watanabe, Kikuo; Inoue, Jiro; Nagaishi, Hiroshi


    We analyzed the electron-irradiation damage induced by electron-beam inspection of MNOS capacitors with various gate-dielectric thicknesses. Damage induced in a MNOS capacitor with SiON dielectric for high-performance CMOS devices was compared with that induced on a MOS capacitor with SiO II dielectric. We found that there is no remarkable difference between the damage to MOS capacitors and that to MNOS capacitors. The induced damage strongly depends on the thickness of the gate dielectric. Damages were induced when a higher-energy electron-beam, whose electron range was larger than the thickness of the gate electrode, was irradiated. When the electron beam was irradiated to a MOS capacitor with gate-dielectric thickness of 10.0 nm the flat-band-voltage shifted due to the created traps. When the electron beam was scanned to a MOS or MNOS capacitor with gate-dielectric thickness of 4.0 nm, Vfb shifted by less than 6 mV. However, the leakage-current density increased to 10 -7 A/cm2 at gate-electrode voltage of 3.0 V. On the other hand, when the electron beam was scanned on a MNOS capacitor with 2.5-nm-thick SiON dielectric, even the leakage current density was not increased. Accordingly, for damage-free inspection when gate-dielectric thickness is 4.0 nm or more, the electron-beam energy should be lower so that the electron range is smaller than the thickness of the gate electrode.

  2. Prevention of UVB Radiation-induced Epidermal Damage by Expression of Heat Shock Protein 70*

    PubMed Central

    Matsuda, Minoru; Hoshino, Tatsuya; Yamashita, Yasuhiro; Tanaka, Ken-ichiro; Maji, Daisuke; Sato, Keizo; Adachi, Hiroaki; Sobue, Gen; Ihn, Hironobu; Funasaka, Yoko; Mizushima, Tohru


    Irradiation with UV light, especially UVB, causes epidermal damage via the induction of apoptosis, inflammatory responses, and DNA damage. Various stressors, including UV light, induce heat shock proteins (HSPs) and the induction, particularly that of HSP70, provides cellular resistance to such stressors. The anti-inflammatory activity of HSP70, such as its inhibition of nuclear factor kappa B (NF-κB), was recently revealed. These in vitro results suggest that HSP70 protects against UVB-induced epidermal damage. Here we tested this idea by using transgenic mice expressing HSP70 and cultured keratinocytes. Irradiation of wild-type mice with UVB caused epidermal damage such as induction of apoptosis, which was suppressed in transgenic mice expressing HSP70. UVB-induced apoptosis in cultured keratinocytes was suppressed by overexpression of HSP70. Irradiation of wild-type mice with UVB decreased the cutaneous level of IκB-α (an inhibitor of NF-κB) and increased the infiltration of leukocytes and levels of pro-inflammatory cytokines and chemokines in the epidermis. These inflammatory responses were suppressed in transgenic mice expressing HSP70. In vitro, the overexpression of HSP70 suppressed the expression of pro-inflammatory cytokines and chemokines and increased the level of IκB-α in keratinocytes irradiated with UVB. UVB induced an increase in cutaneous levels of cyclobutane pyrimidine dimers and 8-hydroxy-2′-deoxyguanosine, both of which were suppressed in transgenic mice expressing HSP70. This study provides genetic evidence that HSP70 protects the epidermis from UVB-induced radiation damage. The findings here also suggest that the protective action of HSP70 is mediated by anti-apoptotic, anti-inflammatory, and anti-DNA damage effects. PMID:20018843

  3. A synthetic biology approach allows inducible retrotransposition in whole plants

    PubMed Central

    Böhmdorfer, Gudrun; Tramontano, Andrea; Luxa, Kerstin


    Retrotransposons are mobile genetic elements that transpose by reverse transcription of element RNA, followed by insertion of the cDNA into new positions of the host genome. Although they are major constituents of eukaryotic genomes, many facets of their biology remain to be understood. Transposition is generally rare, suggesting that it is subject to tight regulation. However, only the first regulatory step (transcriptional induction) is currently amenable to investigation in higher eukaryotes. To investigate the complete life cycle of a long terminal repeat (LTR) retrotransposon in plants, we established a synthetic biology program on tobacco retrotransposon Tto1, and achieved transposition in whole plants triggered by an inducible promoter. The engineered element, iTto (inducible Tto1), is a novel tool for analysis of retrotransposition in plants. In addition, it allows to explore the potential of an inducible retrotransposon for insertional mutagenesis. Electronic supplementary material The online version of this article (doi:10.1007/s11693-010-9053-4) contains supplementary material, which is available to authorized users. PMID:20805932

  4. Phosphorylation of Daxx by ATM Contributes to DNA Damage-Induced p53 Activation

    PubMed Central

    Cheng, Qian; Qu, Like; Brewer, Michael D.; Chen, Jiandong; Yang, Xiaolu


    p53 plays a central role in tumor suppression. It does so by inducing anti-proliferative processes as a response to various tumor-promoting stresses. p53 is regulated by the ubiquitin ligase Mdm2. The optimal function of Mdm2 requires Daxx, which stabilizes Mdm2 through the deubiquitinase Hausp/USP7 and also directly promotes Mdm2’s ubiquitin ligase activity towards p53. The Daxx-Mdm2 interaction is disrupted upon DNA damage. However, both the mechanisms and the consequence of the Daxx-Mdm2 dissociation are not understood. Here we show that upon DNA damage Daxx is phosphorylated in a manner that is dependent on ATM, a member of the PI 3-kinase family that orchestrates the DNA damage response. The main phosphorylation site of Daxx is identified to be Ser564, which is a direct target of ATM. Phosphorylation of endogenous Daxx at Ser564 occurs rapidly during the DNA damage response and precedes p53 activation. Blockage of this phosphorylation event prevents the separation of Daxx from Mdm2, stabilizes Mdm2, and inhibits DNA damage-induced p53 activation. These results suggest that phosphorylation of Daxx by ATM upon DNA damage disrupts the Daxx-Mdm2 interaction and facilitates p53 activation. PMID:23405218

  5. The improvement of laser induced damage resistance of optical workpiece surface by hydrodynamic effect polishing

    NASA Astrophysics Data System (ADS)

    Peng, Wenqiang; Guan, Chaoliang; Li, Shengyi; Wang, Zhuo


    Surface and subsurface damage in optical element will greatly decrease the laser induced damage threshold (LIDT) in the intense laser optical system. Processing damage on the workpiece surface can be inevitably caused when the material is removed in brittle or plastic mode. As a non-contact polishing technology, hydrodynamic effect polishing (HEP) shows very good performance on generating an ultra-smooth surface without damage. The material is removed by chemisorption between nanoparticle and workpiece surface in the elastic mode in HEP. The subsurface damage and surface scratches can be effectively removed after the polishing process. Meanwhile ultra-smooth surface with atomic level surface roughness can be achieved. To investigate the improvement of LIDT of optical workpiece, polishing experiment was conducted on a magnetorheological finishing (MRF) silica glass sample. AFM measurement results show that all the MRF directional plastic marks have been removed clearly and the root-mean-square (rms) surface roughness has decreased from 0.673nm to 0.177nm after HEP process. Laser induced damage experiment was conducted with laser pulse of 1064nm wavelength and 10ns time width. Compared with the original state, the LEDT of the silica glass sample polished by HEP has increased from 29.78J/cm2 to 45.47J/cm2. It demonstrates that LIDT of optical element treated by HEP can be greatly improved for ultra low surface roughness and nearly defect-free surface/subsurface.

  6. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.


    Calvo, Jennifer A; Moroski-Erkul, Catherine A; Lake, Annabelle; Eichinger, Lindsey W; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T; Christiani, David C; Meira, Lisiane B; Samson, Leona D


    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  7. Oxidative damage induced by copper in mouse primary hepatocytes by single-cell analysis.


    Jing, Mingyang; Liu, Yang; Song, Wei; Yan, Yunxing; Yan, Wenbao; Liu, Rutao


    Copper can disturb the intracellular redox balance, induce oxidative stress, and subsequently cause irreversible damage, leading to a variety of diseases. In the present study, mouse primary hepatocytes were chosen to elucidate the in vitro oxidative damage of short-term copper exposure (10-200 μM) by single-cell analysis. We evaluated the toxicity of copper by reactive oxygen species (ROS), glutathione (GSH), and oxidative DNA damage at the single-cell level. Oxidative damage induced by copper was verified by the morphological changes, persistent elevations of excessive ROS and malondialdehyde (MDA), a decrease in GSH level, and the oxidative DNA damage. Furthermore, the average ROS generation, GSH consumption, and the indicators in DNA damage did not significantly change at relatively low concentrations (10 or 50 μM), but we can find the alterations of parameters in some single cells clearly. Emphasis on the analysis of single cells is conducive to gain a better understanding on the toxicity of copper. This study will also complement studies on the environmental risk assessment of copper pollution.

  8. DNA damage-induced centrosome amplification occurs via excessive formation of centriolar satellites.


    Löffler, H; Fechter, A; Liu, F Y; Poppelreuther, S; Krämer, A


    Centrosome amplification is a frequent phenomenon in malignancies and may facilitate tumorigenesis by promoting chromosomal instability. On the other hand, a centrosome inactivation checkpoint comprising centrosome amplification leading to elimination of cells by mitotic catastrophe has been described in response to DNA damage by ionizing radiation or cytostatic drugs. So far, the exact nature of DNA damage-induced centrosome amplification, which might be overduplication or fragmentation of existing centrosomes, has been controversial. To solve this controversy, we have established a method to distinguish between these two possibilities using A549 cells expressing photoconvertible CETN2-Dendra2. In response to various DNA-damaging treatments, centrosome amplification but not fragmentation was observed. Moreover, centrosome amplification was preceded by excessive formation of centrin-containing centriolar satellites, which were identified as de novo-generated atypical centrin dots staining positive for centriolar satellite markers but negative or only weakly positive for other established centrosomal markers, and which could be verified as centriolar satellites using immunogold electron microscopy. In line with this notion, disruption of dynein-mediated recruitment of centrosomal proteins via centriolar satellites suppressed centrosome amplification after DNA damage, and excessive formation of centriolar satellites could be inhibited by interference with Chk1, a known mediator of centrosome amplification in response to DNA damage. In conclusion, we provide a model in which a Chk1-mediated DNA damage checkpoint induces excessive formation of centriolar satellites constituting assembly platforms for centrosomal proteins, which subsequently leads to centrosome amplification.

  9. Yields of biologically significant damage produced in mammalian DNA by irradiation associated with radon decay. Final progress report

    SciTech Connect

    Ward, J.F.


    The objective of this project was to characterize the difference between damage to DNA caused by alpha particles and by low LET radiation. Estimation of the risk posed by exposure to high LET radiation (such as that from radon) relies at present on epidemiological data, and is therefore largely empirical. This empiricism is evident from the concepts of quality factor or RBE that find use for describing the biological effects of high LET radiation. The author argues that some effort should be made to address the mechanisms of DNA damage by high and low LET forms of radiation, and how these mechanisms might relate to the biological endpoints. This report summarizes the results of the author`s investigations and the current understanding of these mechanisms.

  10. Resveratrol protects mouse oocytes from methylglyoxal-induced oxidative damage.


    Liu, Yu; He, Xiao-Qin; Huang, Xin; Ding, Lu; Xu, Lin; Shen, Yu-Ting; Zhang, Fei; Zhu, Mao-Bi; Xu, Bai-Hui; Qi, Zhong-Quan; Wang, Hai-Long


    Methylglyoxal, a reactive dicarbonyl compound, is mainly formed from glycolysis. Methylglyoxal can lead to the dysfunction of mitochondria, the depletion of cellular anti-oxidation enzymes and the formation of advanced glycation ends. Previous studies showed that the accumulation of methylglyoxal and advanced glycation ends can impair the oocyte maturation and reduce the oocyte quality in aged and diabetic females. In this study, we showed that resveratrol, a kind of phytoalexin found in the skin of grapes, red wine and other botanical extracts, can alleviate the adverse effects caused by methylglyoxal, such as inhibition of oocyte maturation and disruption of spindle assembly. Besides, methylglyoxal-treated oocytes displayed more DNA double strands breaks and this can also be decreased by treatment of resveratrol. Further investigation of these processes revealed that methylglyoxal may affect the oocyte quality by resulting in excessive reactive oxygen species production, aberrant mitochondrial distribution and high level lipid peroxidation, and resveratrol can block these cytotoxic changes. Collectively, our results showed that resveratrol can protect the oocytes from methylglyoxal-induced cytotoxicity and this was mainly through the correction of the abnormity of cellular reactive oxygen species metabolism.

  11. Glial cell plasticity in sensory ganglia induced by nerve damage.


    Hanani, M; Huang, T Y; Cherkas, P S; Ledda, M; Pannese, E


    Numerous studies have been done on the effect of nerve injury on neurons of sensory ganglia but little is known about the contribution of satellite glial cells (SCs) in these ganglia to post-injury events. We investigated cell-to-cell coupling and ultrastructure of SCs in mouse dorsal root ganglia after nerve injury (axotomy). Under control conditions SCs were mutually coupled, but mainly to other SCs around a given neuron. After axotomy SCs became extensively coupled to SCs that enveloped other neurons, apparently by gap junctions. Serial section electron microscopy showed that after axotomy SC sheaths enveloping neighboring neurons formed connections with each other. Such connections were absent in control ganglia. The number of gap junctions between SCs increased 6.5-fold after axotomy. We propose that axotomy induces growth of perineuronal SC sheaths, leading to contacts between SCs enveloping adjacent neurons and to formation of new gap junctions between SCs. These changes may be an important mode of glial plasticity and can contribute to neuropathic pain.

  12. Testosterone production and spermatogenic damage induced by organophosphorate pesticides.


    Contreras, H R; Paredes, V; Urquieta, B; Del Valle, L; Bustos-Obregón, E


    Parathion is an organophosphorate pesticide amply used in agriculture. Many alterations induced by organophosphorate pesticides have been described, such as: cytogenetic alterations in germinal cells, oligozoospermia and teratozoospermia in the mouse. The effect of Parathion, both pure (PP) and commercial (PC), on mouse interstitial cell testosterone production was evaluated in vivo and in vitro. Male mice were intraperitoneally injected with a single dose of 1/3 LD50 of Parathion, both PP and PC. The animals were sacrificed at 1, 8 and 40 days post injection to evaluate the impact of disrupting testosterone production on spermatogonia, spermatocytes and elongated spermatids. The plasma testosterone was assayed by standard radioimmunoanalysis. The same method was used to assay testosterone in the culture medium of interstitial cells obtained from the control and Parathion treated animals at the same time intervals. Sperm count, sperm teratozoospermia and tubular blockage were analyzed for an appraisal of spermatogenesis. Increase in the teratozoospermia and tubular blockage was detected in the PP and PC group at 8 and 40 days post injection. Plasma testosterone levels drop significantly at 8 days and recovered slowly at 40 days only in PP animals as detected in vivo, implying interference of testicular steroidogenesis due to the toxicant. Recuperation of normality occurs at long time intervals. In conclusion, Parathion disturbs the synthesis of testosterone in mice affecting qualitatively the spermatogenesis

  13. Urea-induced oxidative damage in Elodea densa leaves.


    Maleva, Maria; Borisova, Galina; Chukina, Nadezda; Prasad, M N V


    Urea being a fertilizer is expected to be less toxic to plants. However, it was found that urea at 100 mg L(-1) caused the oxidative stress in Elodea leaves due to the formation of reactive oxygen species (ROS) and lipid peroxidation that are known to stimulate antioxidant pathway. Urea at a concentration of 500 and 1000 mg L(-1) decreased low-molecular-weight antioxidants. In this case, the antioxidant status of plants was supported by the activity of antioxidant enzymes such as superoxide dismutase and guaiacol peroxidase. A significant increase in the soluble proteins and -SH groups was observed with high concentrations of urea (30-60 % of control). Thus, the increased activity of antioxidant enzymes, low-molecular-weight antioxidants, and induced soluble protein thiols are implicated in plant resistance to oxidative stress imposed by urea. We found that guaiacol peroxidase plays an important role in the removal of the peroxide in Elodea leaves exposed to 1000 mg L(-1)of urea.

  14. Perinatal radiation-induced renal damage in the beagle

    SciTech Connect

    Jaenke, R.S.; Angleton, G.M. )


    The developing perinatal kidney is particularly sensitive to radiation. The pathogenesis of the radiation-induced lesion is related to the destruction of outer cortical developing nephrons and direct radiation injury with secondary hemodynamic alterations in remnant nephrons. In this study, which is part of a life span investigation of the effects of whole-body gamma radiation during prenatal and early postnatal life, dogs were given 0, 0.16, 0.83, or 1.25 Gy irradiation at either 55 days postcoitus or 2 days postpartum and were examined morphometrically and histopathologically at 70 days of age. Although irradiated dogs showed no reduction in the total number of nephrons per kidney, there was a significant increase in the total number and relative percentage of immature, dysplastic glomeruli. In addition, deeper cortical glomeruli of irradiated kidneys exhibited mesangial sclerosis similar to that associated with progressive renal failure in our previous studies. These findings are in accord with those reported at doses of 2.24 to 3.57 Gy and demonstrate that the perinatal kidney is affected by radiation doses much lower than previously demonstrated.

  15. Effect of multiblade slurry saw induced damage on silicon solar cells

    NASA Technical Reports Server (NTRS)

    Daud, T.; Liu, J. K.; Pollock, G. A.; Koliwad, K. M.


    A correlation between the optimum etch loss and the depth of damage is established using wafers produced by the Multiblade Slurry (MBS) and the Internal Diameter (ID) saws. The observations are based on the measurement of the performance of solar cells fabricated on these wafers. Sample preparation and test results are described and the following conclusions are made: (1) the amount of silicon removal necessary for optimum solar cell performance coincides with the depth of saw-induced damage; (2) optimization of cell performance is not affected by the method of silicon removal; (3) sawing conditions should be optimized to minimize the extent of saw-induced damage; (4) the MBS saw is found to induce damage to a lesser extent; (5) since the extent of damage in MBS-sawn wafers is in the limit of etch loss required in texture etching, it is possible to achieve optimum improvement in cell performance by merely texture etching the surface of as-sawn wafers.

  16. Sex Differences in Exercise-Induced Muscle Pain and Muscle Damage

    PubMed Central

    Dannecker, Erin A.; Liu, Ying; Rector, R. Scott; Thomas, Tom R.; Fillingim, Roger B.; Robinson, Michael E.


    There is uncertainty about sex differences in exercise-induced muscle pain and muscle damage due to several methodological weaknesses in the literature. This investigation tested the hypothesis that higher levels of exercise-induced muscle pain and muscle damage indicators would be found in women than men when several methodological improvements were executed in the same study. Participants (N = 33; 42% women) with an average age of 23 years (SD = 2.82) consented to participate. After a familiarization session, participants visited the laboratory before and across four days after eccentric exercise was completed to induce arm muscle pain and muscle damage. Our primary outcomes were arm pain ratings and pressure pain thresholds. However, we also measured the following indicators of muscle damage: arm girth; resting elbow extension; isometric elbow flexor strength; myoglobin (Mb); tumor necrosis factor (TNFa); interleukin 1beta (IL1b); and total nitric oxide (NO). Temporary induction of muscle damage was indicated by changes in all outcome measures except TNFa, and IL1b. In contrast to our hypotheses, women reported moderately lower and less frequent muscle pain than men. Also, women’s arm girth and Mb levels increased moderately less than men’s, but the differences were not significant. Few large sex differences were detected. PMID:23182229

  17. Physical and balance performance following exercise induced muscle damage in male soccer players

    PubMed Central

    Khan, Muzaffar Ahmad; Moiz, Jamal Ali; Raza, Shahid; Verma, Shalini; Shareef, M.Y.; Anwer, Shahnawaz; Alghadir, Ahmad


    [Purpose] The present study aimed to determine the changes in physical and balance performance following exercise-induced muscle damage using a sport-specific protocol. [Subjects and Methods] Fifteen collegiate soccer players were asked to perform a sport-specific sprint protocol to induce muscle damage. The markers of muscle damage (soreness, range of motion, limb girth, muscle strength, creatine kinase and lactate dehydrogenase), physical performance (speed, agility and power) and balance (static and dynamic balance) were assessed at baseline and 24, 48 and 72 hours following the sprint protocol. [Results] All variables, including the markers of muscle damage, physical performance and balance showed a significant difference when assessed at the 4 time points. [Conclusion] The study demonstrated that both the physical and balance performance were affected following repeated sprint protocol in soccer players. It is recommended the balance performance of an athlete be continually assessed following exercise-induced muscle damage so as to determine the appropriate return to sport decision thereby, minimizing the risk of further injury. PMID:27821967

  18. Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation

    PubMed Central

    Davalos, Dimitrios; Kyu Ryu, Jae; Merlini, Mario; Baeten, Kim M.; Le Moan, Natacha; Petersen, Mark A.; Deerinck, Thomas J.; Smirnoff, Dimitri S.; Bedard, Catherine; Hakozaki, Hiroyuki; Gonias Murray, Sara; Ling, Jennie B.; Lassmann, Hans; Degen, Jay L.; Ellisman, Mark H.; Akassoglou, Katerina


    Blood-brain barrier disruption, microglial activation and neurodegeneration are hallmarks of multiple sclerosis. However, the initial triggers that activate innate immune responses and their role in axonal damage remain unknown. Here we show that the blood protein fibrinogen induces rapid microglial responses toward the vasculature and is required for axonal damage in neuroinflammation. Using in vivo two-photon microscopy, we demonstrate that microglia form perivascular clusters before myelin loss or paralysis onset and that, of the plasma proteins, fibrinogen specifically induces rapid and sustained microglial responses in vivo. Fibrinogen leakage correlates with areas of axonal damage and induces reactive oxygen species release in microglia. Blocking fibrin formation with anticoagulant treatment or genetically eliminating the fibrinogen binding motif recognized by the microglial integrin receptor CD11b/CD18 inhibits perivascular microglial clustering and axonal damage. Thus, early and progressive perivascular microglial clustering triggered by fibrinogen leakage upon blood-brain barrier disruption contributes to axonal damage in neuroinflammatory disease. PMID:23187627

  19. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  20. Laser-induced damage threshold of camera sensors and micro-opto-electro-mechanical systems

    NASA Astrophysics Data System (ADS)

    Schwarz, Bastian; Ritt, Gunnar; Körber, Michael; Eberle, Bernd


    The continuous development of laser systems towards more compact and efficient devices constitutes an increasing threat to electro-optical imaging sensors such as complementary metal-oxide-semiconductors (CMOS) and charge-coupled devices (CCD). These types of electronic sensors are used in day-to-day life but also in military or civil security applications. In camera systems dedicated to specific tasks, also micro-opto-electro-mechanical systems (MOEMS) like a digital micromirror device (DMD) are part of the optical setup. In such systems, the DMD can be located at an intermediate focal plane of the optics and it is also susceptible to laser damage. The goal of our work is to enhance the knowledge of damaging effects on such devices exposed to laser light. The experimental setup for the investigation of laser-induced damage is described in detail. As laser sources both pulsed lasers and continuous-wave (CW) lasers are used. The laser-induced damage threshold (LIDT) is determined by the single-shot method by increasing the pulse energy from pulse to pulse or in the case of CW-lasers, by increasing the laser power. Furthermore, we investigate the morphology of laser-induced damage patterns and the dependence of the number of destructed device elements on the laser pulse energy or laser power. In addition to the destruction of single pixels, we observe aftereffects like persisting dead columns or rows of pixels in the sensor image.

  1. Physical and balance performance following exercise induced muscle damage in male soccer players.


    Khan, Muzaffar Ahmad; Moiz, Jamal Ali; Raza, Shahid; Verma, Shalini; Shareef, M Y; Anwer, Shahnawaz; Alghadir, Ahmad


    [Purpose] The present study aimed to determine the changes in physical and balance performance following exercise-induced muscle damage using a sport-specific protocol. [Subjects and Methods] Fifteen collegiate soccer players were asked to perform a sport-specific sprint protocol to induce muscle damage. The markers of muscle damage (soreness, range of motion, limb girth, muscle strength, creatine kinase and lactate dehydrogenase), physical performance (speed, agility and power) and balance (static and dynamic balance) were assessed at baseline and 24, 48 and 72 hours following the sprint protocol. [Results] All variables, including the markers of muscle damage, physical performance and balance showed a significant difference when assessed at the 4 time points. [Conclusion] The study demonstrated that both the physical and balance performance were affected following repeated sprint protocol in soccer players. It is recommended the balance performance of an athlete be continually assessed following exercise-induced muscle damage so as to determine the appropriate return to sport decision thereby, minimizing the risk of further injury.

  2. Attenuation of eccentric exercise-induced muscle damage conferred by maximal isometric contractions: a mini review

    PubMed Central

    Lima, Leonardo C. R.; Denadai, Benedito S.


    Although, beneficial in determined contexts, eccentric exercise-induced muscle damage (EIMD) might be unwanted during training regimens, competitions and daily activities. There are a vast number of studies investigating strategies to attenuate EIMD response after damaging exercise bouts. Many of them consist of performing exercises that induce EIMD, consuming supplements or using equipment that are not accessible for most people. It appears that performing maximal isometric contractions (ISOs) 2–4 days prior to damaging bouts promotes significant attenuation of EIMD symptoms that are not related to muscle function. It has been shown that the volume of ISOs, muscle length in which they are performed, and interval between them and the damaging bout influence the magnitude of this protection. In addition, it appears that this protection is not long-lived, lasting no longer than 4 days. Although no particular mechanisms for these adaptations were identified, professionals should consider applying this non-damaging stimulus before submitting their patients to unaccustomed exercised. However, it seems not to be the best option for athletes or relatively trained individuals. Future, studies should focus on establishing if ISOs protect other populations (i.e., trained individuals) or muscle groups (i.e., knee extensors) against EIMD, as well as investigate different mechanisms for ISO-induced protection. PMID:26578972

  3. Ascorbic acid and beta-carotene reduce stress-induced oxidative organ damage in rats.


    Esrefoglu, M; Akinci, A; Taslidere, E; Elbe, H; Cetin, A; Ates, B


    Antioxidants are potential therapeutic agents for reducing stress-induced organ damage. We investigated the effects of ascorbic acid and β-carotene on oxidative stress-induced cerebral, cerebellar, cardiac and hepatic damage using microscopy and biochemistry. Male Wistar albino rats were divided into five groups: untreated control, stressed, stressed + saline, stressed + ascorbic acid and stressed + β-carotene. The rats in the stressed groups were subjected to starvation, immobilization and cold. The histopathological damage scores for the stressed and stressed + saline groups were higher than those of the control group for all organs examined. The histopathological damage scores and mean tissue malondialdehyde levels for the groups treated with antioxidants were lower than those for the stressed and stressed + saline groups. Mean tissue superoxide dismutase activities for groups that received antioxidants were higher than those for the stressed + saline group for most organs evaluated. Ascorbic acid and β-carotene can reduce stress-induced organ damage by both inhibiting lipid oxidation and supporting the cellular antioxidant defense system.

  4. Evaluation of service-induced damage and restoration of cast turbine blades

    SciTech Connect

    Persson, C.; Persson, P.O. )


    Conventionally cast turbine blades of Inconel 713C, from a military gas turbine aircraft engine, have been investigated with regard to service-induced microstructural damage and residual creep life time. For cast turbine blades, service life is defined by statistical values. The statistical methods can prove to be uneconomical, because safe limits must be stated with regard to the statistical probability that some blades will have higher damage than normal. An alternative approach is to determine the service-induced microstructural damage on each blade, or a representative number of blades, to better optimize blade usage. Ways to use service-induced [gamma][prime] rafting and void formation as quantified microstructural damage parameters in a service lifetime prediction model are suggested. The damage parameters were quantified, in blades with different service exposure levels, and correlated to remaining creep life evaluated from creep test specimens taken from different positions of serviced blades. Results from tests with different rejuvenation treatments, including hot isostatic pressing and/or heat treatment, are discussed briefly.

  5. Dunnione ameliorates cisplatin-induced small intestinal damage by modulating NAD(+) metabolism.


    Pandit, Arpana; Kim, Hyung-Jin; Oh, Gi-Su; Shen, AiHua; Lee, Su-Bin; Khadka, Dipendra; Lee, SeungHoon; Shim, Hyeok; Yang, Sei-Hoon; Cho, Eun-Young; Kwon, Kang-Beom; Kwak, Tae Hwan; Choe, Seong-Kyu; Park, Raekil; So, Hong-Seob


    Although cisplatin is a widely used anticancer drug for the treatment of a variety of tumors, its use is critically limited because of adverse effects such as ototoxicity, nephrotoxicity, neuropathy, and gastrointestinal damage. Cisplatin treatment increases oxidative stress biomarkers in the small intestine, which may induce apoptosis of epithelial cells and thereby elicit damage to the small intestine. Nicotinamide adenine dinucleotide (NAD(+)) is a cofactor for various enzymes associated with cellular homeostasis. In the present study, we demonstrated that the hyper-activation of poly(ADP-ribose) polymerase-1 (PARP-1) is closely associated with the depletion of NAD(+) in the small intestine after cisplatin treatment, which results in downregulation of sirtuin1 (SIRT1) activity. Furthermore, a decrease in SIRT1 activity was found to play an important role in cisplatin-mediated small intestinal damage through nuclear factor (NF)-κB p65 activation, facilitated by its acetylation increase. However, use of dunnione as a strong substrate for the NADH:quinone oxidoreductase 1 (NQO1) enzyme led to an increase in intracellular NAD(+) levels and prevented the cisplatin-induced small intestinal damage correlating with the modulation of PARP-1, SIRT1, and NF-κB. These results suggest that direct modulation of cellular NAD(+) levels by pharmacological NQO1 substrates could be a promising therapeutic approach for protecting against cisplatin-induced small intestinal damage.

  6. Effects of a Strength Training Session After an Exercise Inducing Muscle Damage on Recovery Kinetics.


    Abaïdia, Abd-Elbasset; Delecroix, Barthélémy; Leduc, Cédric; Lamblin, Julien; McCall, Alan; Baquet, Georges; Dupont, Grégory


    Abaïdia, A-E, Delecroix, B, Leduc, C, Lamblin, J, McCall, A, Baquet, G, and Dupont, G. Effects of a strength training session after an exercise inducing muscle damage on recovery kinetics. J Strength Cond Res 31(1): 115-125, 2017-The purpose of this study was to investigate the effects of an upper-limb strength training session the day after an exercise inducing muscle damage on recovery of performance. In a randomized crossover design, subjects performed the day after the exercise, on 2 separate occasions (passive vs. active recovery conditions) a single-leg exercise (dominant in one condition and nondominant in the other condition) consisting of 5 sets of 15 eccentric contractions of the knee flexors. Active recovery consisted of performing an upper-body strength training session the day after the exercise. Creatine kinase, hamstring strength, and muscle soreness were assessed immediately and 20, 24, and 48 hours after exercise-induced muscle damage. The upper-body strength session, after muscle-damaging exercise accelerated the recovery of slow concentric force (effect size = 0.65; 90% confidence interval = -0.06 to 1.32), but did not affect the recovery kinetics for the other outcomes. The addition of an upper-body strength training session the day after muscle-damaging activity does not negatively affect the recovery kinetics. Upper-body strength training may be programmed the day after a competition.

  7. The neuroprotective effect of hyperbaric oxygen treatment on laser-induced retinal damage in rats

    NASA Astrophysics Data System (ADS)

    Vishnevskia-Dai, Victoria; Belokopytov, Mark; Dubinsky, Galina; Nachum, Gal; Avni, Isaac; Belkin, Michael; Rosner, Mordechai


    Retinal damage induced by mechanical trauma, ischemia or laser photocoagulation increases considerably by secondary degeneration processes. The spread of damage may be ameliorated by neuroprotection that is aimed at reducing the extent of the secondary degeneration and promote healing processes. Hyperbaric oxygen (HBO) treatment consists of inspiration of oxygen at higher than one absolute atmospheric pressure. Improved neural function was observed in patients with acute brain trauma or ischemia treated with HBO. This study was designed to evaluate the neuroprotective effect of hyperbaric oxygen (HBO) on laser induced retinal damage in a rat model. Standard argon laser lesions were created in 25 pigmented rats divided into three groups: Ten rats were treated immediately after the irradiation with HBO three times during the first 24 hr followed by 12 consecutive daily treatments. Five rats received a shorter treatment regimen of 10 consecutive HBO treatments. The control group (10 rats) underwent the laser damage with no additional treatment. The retinal lesions were evaluated 20 days after the injury. All outcome measures were improved by the longer HBO treatment (P<0.01). The shorter HBO treatment was less effective, showing an increase only in nuclei density at the central area of lesion (P< 0.01). Hyperbaric oxygen seems to exert a neuroprotective effect on laser-induced retinal damage in a rat model. In the range of HBO exposures studied, longer exposure provides more neuroprotection. These results encourage further evaluation of the potential therapeutic use of hyperbaric oxygen in diseases and injuries of the retina.

  8. Fluoride induces oxidative damage and SIRT1/autophagy through ROS-mediated JNK signaling.


    Suzuki, Maiko; Bandoski, Cheryl; Bartlett, John D


    Fluoride is an effective caries prophylactic, but at high doses can also be an environmental health hazard. Acute or chronic exposure to high fluoride doses can result in dental enamel and skeletal and soft tissue fluorosis. Dental fluorosis is manifested as mottled, discolored, porous enamel that is susceptible to dental caries. Fluoride induces cell stress, including endoplasmic reticulum stress and oxidative stress, which leads to impairment of ameloblasts responsible for dental enamel formation. Recently we reported that fluoride activates SIRT1 and autophagy as an adaptive response to protect cells from stress. However, it still remains unclear how SIRT1/autophagy is regulated in dental fluorosis. In this study, we demonstrate that fluoride exposure generates reactive oxygen species (ROS) and the resulting oxidative damage is counteracted by SIRT1/autophagy induction through c-Jun N-terminal kinase (JNK) signaling in ameloblasts. In the mouse-ameloblast-derived cell line LS8, fluoride induced ROS, mitochondrial damage including cytochrome-c release, up-regulation of UCP2, attenuation of ATP synthesis, and H2AX phosphorylation (γH2AX), which is a marker of DNA damage. We evaluated the effects of the ROS inhibitor N-acetylcysteine (NAC) and the JNK inhibitor SP600125 on fluoride-induced SIRT1/autophagy activation. NAC decreased fluoride-induced ROS generation and attenuated JNK and c-Jun phosphorylation. NAC decreased SIRT1 phosphorylation and formation of the autophagy marker LC3II, which resulted in an increase in the apoptosis mediators γH2AX and cleaved/activated caspase-3. SP600125 attenuated fluoride-induced SIRT1 phosphorylation, indicating that fluoride activates SIRT1/autophagy via the ROS-mediated JNK pathway. In enamel organs from rats or mice treated with 50, 100, or 125 ppm fluoride for 6 weeks, cytochrome-c release and the DNA damage markers 8-oxoguanine, p-ATM, and γH2AX were increased compared to those in controls (0 ppm fluoride). These

  9. Storm-induced damages along the Catalan coast (NW Mediterranean) during the period 1958-2008

    NASA Astrophysics Data System (ADS)

    Jiménez, José A.; Sancho-García, Amanda; Bosom, Eva; Valdemoro, Herminia I.; Guillén, Jorge


    The temporal and spatial patterns of storm-induced damage along the Catalan coast (NW Mediterranean) during the last 50 years have been analyzed to identify main climatic and non-climatic forcings. In the absence of systematic data, a storm-induced damage database compiled from press news has been built, which together with an intensity scale has allowed us to characterize the frequency and intensity of damage. Although no temporal trend has been detected in storm-induced hazards, coastal damage has increased at a rate of about 40% per decade during the last 50 years along the Catalan coast. The main non-climatic factors identified controlling this trend were the urban growth along the coastal fringe and the generalized erosive behavior of beaches. The first one increased values at risk and the second one increased their exposure to storm-induced hazards. In spite of the importance of non-climatic factors to modulate coastal damage, an exponential dependence of damages on storm-induced inundation and erosion was detected. In addition to this, storm-induced geomorphic changes along the Ebro delta coast have also been analyzed. During the period analyzed, "harmful" storms seem to be clustered, with most of the events being present in the late 1990s and especially from 2001 to 2004, resulting in frequent events of intense beach/barrier breaching, massive overwash and flooding. They are mainly expressed in sensitive areas which are subject to long-term erosional processes and comprise a low-lying profile and a narrow beach. This reflects the role of coastal morphology in controlling the intensity of storm-induced hazards along the deltaic coast. Shoreline evolution rates calculated during this period were significantly larger than the previously recorded ones, reflecting a pulsating erosion behavior where large pulses occur during stormy periods and are reduced during post-storm periods. Under the present scenario of maximum coastal development, storm-induced damage

  10. Fluoride induces oxidative damage and SIRT1/autophagy through ROS-mediated JNK signaling

    PubMed Central

    Suzuki, Maiko; Bandoski, Cheryl; Bartlett, John D.


    Fluoride is an effective caries prophylactic, but at high doses can also be an environmental health hazard. Acute or chronic exposure to high fluoride doses can result in dental enamel and skeletal and soft tissue fluorosis. Dental fluorosis is manifested as mottled, discolored, porous enamel that is susceptible to dental caries. Fluoride induces cell stress, including endoplasmic reticulum stress and oxidative stress, which leads to impairment of ameloblasts responsible for dental enamel formation. Recently we reported that fluoride activates SIRT1 and autophagy as an adaptive response to protect cells from stress. However, it still remains unclear how SIRT1/autophagy is regulated in dental fluorosis. In this study, we demonstrate that fluoride exposure generates reactive oxygen species (ROS) and the resulting oxidative damage is counteracted by SIRT1/autophagy induction through c-Jun N-terminal kinase (JNK) signaling in ameloblasts. In the mouse-ameloblast-derived cell line LS8, fluoride induced ROS, mitochondrial damage including cytochrome-c release, up-regulation of UCP2, attenuation of ATP synthesis, and H2AX phosphorylation (γH2AX), which is a marker of DNA damage. We evaluated the effects of the ROS inhibitor N-acetylcysteine (NAC) and the JNK inhibitor SP600125 on fluoride-induced SIRT1/autophagy activation. NAC decreased fluoride-induced ROS generation and attenuated JNK and c-Jun phosphorylation. NAC decreased SIRT1 phosphorylation and formation of the autophagy marker LC3II, which resulted in an increase in the apoptosis mediators γH2AX and cleaved/activated caspase-3. SP600125 attenuated fluoride-induced SIRT1 phosphorylation, indicating that fluoride activates SIRT1/autophagy via the ROS-mediated JNK pathway. In enamel organs from rats or mice treated with 50, 100, or 125 ppm fluoride for 6 weeks, cytochrome-c release and the DNA damage markers 8-oxoguanine, p-ATM, and γH2AX were increased compared to those in controls (0 ppm fluoride). These

  11. Eugenol attenuates pulmonary damage induced by diesel exhaust particles.


    Zin, Walter A; Silva, Ana G L S; Magalhães, Clarissa B; Carvalho, Giovanna M C; Riva, Douglas R; Lima, Crystianne C; Leal-Cardoso, Jose H; Takiya, Christina M; Valença, Samuel S; Saldiva, Paulo H N; Faffe, Débora S


    Environmentally relevant doses of inhaled diesel particles elicit pulmonary inflammation and impair lung mechanics. Eugenol, a methoxyphenol component of clove oil, presents in vitro and in vivo anti-inflammatory and antioxidant properties. Our aim was to examine a possible protective role of eugenol against lung injuries induced by diesel particles. Male BALB/c mice were divided into four groups. Mice received saline (10 μl in; CTRL group) or 15 μg of diesel particles DEP (15 μg in; DIE and DEUG groups). After 1 h, mice received saline (10 μl; CTRL and DIE groups) or eugenol (164 mg/kg; EUG and DEUG group) by gavage. Twenty-four hours after gavage, pulmonary resistive (ΔP1), viscoelastic (ΔP2) and total (ΔPtot) pressures, static elastance (Est), and viscoelastic component of elastance (ΔE) were measured. We also determined the fraction areas of normal and collapsed alveoli, amounts of polymorpho- (PMN) and mononuclear cells in lung parenchyma, apoptosis, and oxidative stress. Est, ΔP2, ΔPtot, and ΔE were significantly higher in the DIE than in the other groups. DIE also showed significantly more PMN, airspace collapse, and apoptosis than the other groups. However, no beneficial effect on lipid peroxidation was observed in DEUG group. In conclusion, eugenol avoided changes in lung mechanics, pulmonary inflammation, and alveolar collapse elicited by diesel particles. It attenuated the activation signal of caspase-3 by DEP, but apoptosis evaluated by TUNEL was avoided. Finally, it could not avoid oxidative stress as indicated by malondialdehyde.

  12. How to Cope with DNA Damage Induced by Ionizing Radiation and Anti-Cancer Drugs?

    NASA Astrophysics Data System (ADS)

    Enomoto, A.; Miyagawa, K.

    Ionizing radiation and chemotherapeutic agents induce many types of DNA lesions, of which DNA double-strand breaks (DSBs) are assumed to be the most deleterious. DNA damage response mechanisms encompass pathways of DNA damage signaling, DNA repair, cell cycle checkpoint arrest, and apoptosis. Increasing evidence suggests that these pathways function co-operatively to maintain genomic stability in the face of exogenous and endogenous DNA damage. The relative impact of one mechanism over another probably depends on the kinds of lesions, the cell cycle phase, and the cell or tissue type. The inability to respond properly to or to repair DSBs may lead to hypersensitivity to DNA damaging agents and genomic instability including chromosomal aberrations. Chromosomal instability, a state of continuous accumulation of chromosomal change, is a common feature of many human cancers and of chromosome instability syndromes with increased cancer susceptibility. Here, we review the DNA da mage response and the links between deficiencies in response to DSBs and chromosomal instability.

  13. Baicalein protects mice against radiation-induced DNA damages and genotoxicity.


    Gandhi, Nitin Motilal


    Baicalein is the major flavonoid extracted from the root of Scutellaria baicaleins. This flavonoid is used extensively in Chinese herbal medicine. In the present study baicalein is evaluated for its radioprotective properties. Human blood cells when exposed to the γ-radiation ex vivo in presence of baicalein underwent the reduced DNA damage compared to the control. Baicalein administration prior to the whole-body γ-radiation (4 Gy) exposure of mice resulted in protecting the damage to the DNA as measured in their blood cells by alkaline comet assay. Mice when exposed to the radiation (whole body; 1.7 Gy) resulted in damage to the bone marrow as measured by micronucleated reticulocyte (MNRET) formation. Baicalein pre-treatment reduces the radiation induced damage to the bone marrow cells, as there was decrease in the percentage MNRET formation. These findings indicate radio-protecting ability of baicalein.

  14. Correlation between helium atmospheric pressure plasma jet (APPJ) variables and plasma induced DNA damage

    NASA Astrophysics Data System (ADS)

    Adhikari, Ek R.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) source with a dielectric capillary and two tubular electrodes was used to induce damage in aqueous plasmid DNA. The fraction of different types of DNA damage (i.e., intact or undamaged, double strand breaks (DSBs), and single strand breaks (SSBs)) that occurred as the result of plasma irradiation was quantified through analysis of agarose gel electrophoresis images. The total DNA damage increased with an increase in both flow rate and duration of irradiation, but decreased with an increase in distance between the APPJ and sample. The average power of the plasma was calculated and the length of APPJ was measured for various flow rates and voltages applied. The possible effects of plasma power and reactive species on DNA damage are discussed.

  15. TSG attenuates LPC-induced endothelial cells inflammatory damage through notch signaling inhibition.


    Zhao, Jing; Liang, Yuan; Song, Fan; Xu, Shouzhu; Nian, Lun; Zhou, Xuanxuan; Wang, Siwang


    Lysophosphatidylcholine (LPC) induces inflammation in endothelial cells (ECs) but the mechanism is not fully understood. The Notch signaling pathway is involved in chronic EC inflammation, but its functions in LPC-induced endothelial inflammatory damage and 2,3,5,4'-tetrahydroxystilbene-2-O-β-d-glucoside's (TSG) protective effect during LPC-induced inflammatory damage in human umbilical vein endothelial cells (HUVECs) is largely unknown. We report that Notch signaling activation contributed to LPC-induced injury in HUVECs, and that TSG protected HUVECs from LPC-induced injury by antagonizing Notch signaling activation by LPC. γ-secretase inhibitor (DAPT), a specific inhibitor of the Notch signaling pathway, and Notch1 siRNA were used to inhibit Notch activity. HUVECs were exposed to LPC in the presence or absence of TSG, DAPT, and Notch1 siRNA. LPC treatment of HUVECs resulted in reduced cell viability, and Notch1 and Hes1 upregulation. Either silencing of Notch1 by siRNA or pharmacological inhibition of Notch signaling by DAPT prevented the loss of cell viability, and induction of apoptosis, and enhanced expression Notch1, Hes1 and MCP-1 by LPC in HUVECs. Similarly, TSG reduced LPC stimulation of Notch1, Hes1, and MCP-1 expression, prevented the release of IL-6 and CRP and rescued HUVECs from LPC-induced cell damage. Our data indicate that the Notch signaling pathway is a crucial mediator of endothelial inflammatory damage and that TSG protects against endothelial inflammatory damage by inhibiting the Notch signaling pathway. Our findings suggest that targeting Notch signaling by natural products such as TSG is a promising strategy for the prevention and treatment of chronic inflammation associated diseases, including atherosclerosis. © 2015 IUBMB Life, 68(1):37-50, 2016.

  16. Nanosecond laser-induced damage of transparent conducting ITO film at 1064nm

    NASA Astrophysics Data System (ADS)

    Yoo, Jae-Hyuck; Adams, John J.; Menor, Marlon G.; Olson, Tammy Y.; Lee, Jonathan R. I.; Samanta, Amit; Bude, Jeff; Elhadj, Selim


    Transparent conducting films with superior laser damage performance have drawn intense interests toward optoelectronic applications under high energy density environment. In order to make optoelectronic applications with high laser damage performance, a fundamental understanding of damage mechanisms of conducting films is crucial. In this study, we performed laser damage experiments on tin-doped indium oxide films (ITO, Bandgap = 4.0 eV) using a nanosecond (ns) pulse laser (1064 nm) and investigated the underlying physical damage mechanisms. Single ns laser pulse irradiation on ITO films resulted in common thermal degradation features such as melting and evaporation although the laser photon energy (1.03 eV, 1064 nm) was smaller than the bandgap. Dominant laser energy absorption of the ITO film is attributed to free carriers due to degenerate doping. Upon multi-pulse irradiation on the film, damage initiation and growth were observed at lower laser influences, where no apparent damage was formed upon single pulse, suggesting a laser-induced incubation effect.

  17. Statistical evaluation of characteristic SDDLV-induced stress resultants to discriminate between undamaged and damaged elements

    NASA Astrophysics Data System (ADS)

    Hansen, L. M.; Johansen, R. J.; Ulriksen, M. D.; Tcherniak, D.; Damkilde, L.


    The stochastic dynamic damage location vector (SDDLV) method utilizes the vectors from the kernel of a damaged-induced transfer function matrix change to localize damages in a structure. The kernel vectors associated with the lowest singular values are converted into static pseudo-loads and applied alternately to an undamaged reference model with known stiffness matrix, hereby, theoretically, yielding characteristic stress resultants approaching zero in the damaged elements. At present, the discrimination between potentially damaged elements and undamaged ones is typically conducted on the basis of modified characteristic stress resultants, which are compared to a pre-defined tolerance value, without any thorough statistical evaluation. In the present paper, it is tested whether three widely-used statistical pattern-recognition-based damage-detection methods can provide an effective statistical evaluation of the characteristic stress resultants, hence facilitating general discrimination between damaged and undamaged elements. The three detection methods in question enable outlier analysis on the basis of, respectively, Euclidian distance, Hotelling's T2 statistics, and Mahalanobis distance. The study of the applicability of these methods is based on experimentally obtained accelerations of a cantilevered residential-sized wind turbine blade subjected to an unmeasured multi-impulse load. The characteristic stress resultants are derived by applying the static pseudo-loads to a representative finite element (FE) model of the actual blade.

  18. Filamentation and damage in fused silica induced by tightly focused femtosecond laser pulses

    SciTech Connect

    Couairon, A.; Sudrie, L.; Franco, M.; Prade, B.; Mysyrowicz, A.


    We investigate experimentally and numerically the damage tracks induced by tightly focused (NA=0.5) infrared femtosecond laser pulses in the bulk of a fused silica sample. Two types of irreversible damage are observed. The first damage corresponds to a permanent change of refractive index without structural modifications (type I). It appears for input pulse energies beyond 0.1 {mu}J. It takes the form of a narrow track extending over more than 100 {mu}m at higher input powers. It is attributed to a change of the polarizability of the medium, following a filamentary propagation which generates an electron-hole plasma through optical field ionization. A second type of damage occurs for input pulse energies beyond 0.3 {mu}J (type II). It takes the form of a pear-shaped structural damage associated with an electron-ion plasma triggered by avalanche. The temporal evolution of plasma absorption is studied by pump-probe experiments. For type I damage, a fast electron-hole recombination is observed. Type II damage is linked with a longer absorption.

  19. Modeling marrow damage from response data: Morphallaxis from radiation biology to benzene toxicity

    SciTech Connect

    Jones, T.D.; Morris, M.D.; Hasan, J.S.


    Consensus principles from radiation biology were used to describe a generic set of nonlinear, first-order differential equations for modeling of toxicity-induced compensatory cell kinetics in terms of sublethal injury, repair, direct killing, killing of cells with unrepaired sublethal injury, and repopulation. This cellular model was linked to a probit model of hematopoietic mortality that describes death from infection and/or hemorrhage between {approximately} 5 and 30 days. Mortality data from 27 experiments with 851 doseresponse groups, in which doses were protracted by rate and/or fractionation, were used to simultaneously estimate all rate constants by maximum-likelihood methods. Data used represented 18,940 test animals distributed according to: (mice, 12,827); (rats, 2,925); (sheep, 1,676); (swine, 829); (dogs, 479); and (burros, 204). Although a long-term, repopulating hematopoietic stem cell is ancestral to all lineages needed to restore normal homeostasis, the dose-response data from the protracted irradiations indicate clearly that the particular lineage that is ``critical`` to hematopoietic recovery does not resemble stem-like cells with regard to radiosensitivity and repopulation rates. Instead, the weakest link in the chain of hematopoiesis was found to have an intrinsic radioresistance equal to or greater than stromal cells and to repopulate at the same rates. Model validation has been achieved by predicting the LD{sub 50} and/or fractional group mortality in 38 protracted-dose experiments (rats and mice) that were not used in the fitting of model coefficients.

  20. Modeling marrow damage from response data: evolution from radiation biology to benzene toxicity.


    Jones, D T; Morris, M D; Hasan, J S


    Consensus principles from radiation biology were used to describe a generic set of nonlinear, first-order differential equations for modeling toxicity-induced compensatory cell kinetics in terms of sublethal injury, repair, direct killing, killing of cells with unrepaired sublethal injury, and repopulation. This cellular model was linked to a probit model of hematopoietic mortality that describes death from infection and/or hemorrhage between 5 and 30 days. Mortality data from 27 experiments with 851 dose-response groups, in which doses were protracted by rate and/or fractionation, were used to simultaneously estimate all rate constants by maximum-likelihood methods. Data used represented 18,940 test animals: 12,827 mice, 2925 rats, 1676 sheep, 829 swine, 479 dogs, and 204 burros. Although a long-term, repopulating hematopoietic stem cell is ancestral to all lineages needed to restore normal homeostasis, the dose-response data from the protracted irradiations indicate clearly that the particular lineage that is critical to hematopoietic recovery does not resemble stemlike cells with regard to radiosensitivity and repopulation rates. Instead, the weakest link in the chain of hematopoiesis was found to have an intrinsic radioresistance equal to or greater than stromal cells and to repopulate at the same rates. Model validation has been achieved by predicting the LD50 and/or fractional group mortality in 38 protracted-dose experiments (rats and mice) that were not used in fitting of model coefficients.

  1. Modeling marrow damage from response data: Evolution from radiation biology to benzene toxicity

    SciTech Connect

    Jones, T.D.; Morris, M.D.; Hasan, J.S.


    Consensus principles from radiation biology were used to describe a generic set of nonlinear, first-order differential equations for modeling toxicity-induced compensatory cell kinetics in terms of sublethal injury, repair, direct killing, killing of cells with unrepaired sublethal injury, and repopulation. This cellular model was linked to a probit model of hematopoietic mortality that describes death from infection and/or hemorrhage between 5 and 30 days. Mortality data from 27 experiments with 851 dose-response groups, in which doses were protracted by rate and/or fractionation, were used to simultaneously estimate all rate constants by maximum-likelihood methods. Data used represented 18,940 test animals: 12,827 mice, 2925 rats, 1676 sheep, 829 swine, 479 dogs, and 204 burros. Although a long-term, repopulating hematopoietic stem cell is ancestral to all lineages needed to restore normal homeostasis, the dose-response data from the protracted irradiations indicate clearly that the particular lineage that is critical to hematopoietic recovery does not resemble stemlike cells with regard to radiosensitivity and repopulation rates. Instead, the weakest link in the chain of hematopoiesis was found to have an intrinsic radioresistance equal to or greater than stromal cells and to repopulate at the same rates. Model validation has been achieved by predicting the LD50 and/or fractional group mortality in 38 protracted-dose experiments (rats and mice) that were not used in the fitting of model coefficients. 29 refs., 5 figs., 5 tabs.

  2. Cavitation-Induced Structural and Neural Damage in Live Brain Tissue Slices: Relevance to TBI

    DTIC Science & Technology


    0704-0188 3. DATES COVERED (From - To) - UU UU UU UU 14-10-2014 Approved for public release; distribution is unlimited. Quad: Cavitation -Induced...AND ADDRESS (ES) U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 Cavitation ; Neurons, Traumatic brain injury...University of Florida Office of Engineering Research 339 Weil Hall Gainesville, FL 32611 -6550 ABSTRACT Quad: Cavitation -Induced Structural and Neural Damage

  3. PTEN Activation by DNA Damage Induces Protective Autophagy in Response to Cucurbitacin B in Hepatocellular Carcinoma Cells

    PubMed Central

    Niu, Yanan; Sun, Wen; Lu, Jin-Jian; Pei, Lixia


    Cucurbitacin B (Cuc B), a natural product, induced both protective autophagy and DNA damage mediated by ROS while the detailed mechanisms remain unclear. This study explored the mechanism of Cuc B-induced DNA damage and autophagy. Cuc B decreased cell viability in concentration- and time-dependent manners. Cuc B caused long comet tails and increased expression of γ-H2AX, phosphorylation of ATM/ATR, and Chk1/Chk2. Cuc B induced autophagy as evidenced by monodansylcadaverine (MDC) staining, increased expression of LC3II, phosphorylated ULK1, and decreased expression of phosphorylated AKT, mTOR. Cuc B induced apoptosis mediated by Bcl-2 family proteins and caspase activation. Furthermore, Cuc B induced ROS formation, which was inhibited by N-acetyl-L-cysteine (NAC). NAC pretreatment dramatically reversed Cuc B-induced DNA damage, autophagy, and apoptosis. Cuc B-induced apoptosis was reversed by NAC but enhanced by 3-methyladenine (3-MA), chloroquine (CQ), and silencing phosphatase and tensin homolog (PTEN). 3-MA and CQ showed no effect on Cuc B-induced DNA damage. In addition, Cuc B increased PTEN phosphorylation and silence PTEN restored Cuc B-induced autophagic protein expressions without affecting DNA damage. In summary, Cuc B induced DNA damage, apoptosis, and protective autophagy mediated by ROS. PTEN activation in response to DNA damage bridged DNA damage and prosurvival autophagy. PMID:28042385

  4. Radiation-damage-induced phasing: a case study using UV irradiation with light-emitting diodes.


    de Sanctis, Daniele; Zubieta, Chloe; Felisaz, Franck; Caserotto, Hugo; Nanao, Max H


    Exposure to X-rays, high-intensity visible light or ultraviolet radiation results in alterations to protein structure such as the breakage of disulfide bonds, the loss of electron density at electron-rich centres and the movement of side chains. These specific changes can be exploited in order to obtain phase information. Here, a case study using insulin to illustrate each step of the radiation-damage-induced phasing (RIP) method is presented. Unlike a traditional X-ray-induced damage step, specific damage is introduced via ultraviolet light-emitting diodes (UV-LEDs). In contrast to UV lasers, UV-LEDs have the advantages of small size, low cost and relative ease of use.

  5. Oxidative damage and cell-programmed death induced in Zea mays L. by allelochemical stress.


    Ciniglia, Claudia; Mastrobuoni, Francesco; Scortichini, Marco; Petriccione, Milena


    The allelochemical stress on Zea mays was analyzed by using walnut husk washing waters (WHWW), a by-product of Juglans regia post-harvest process, which possesses strong allelopathic potential and phytotoxic effects. Oxidative damage and cell-programmed death were induced by WHWW in roots of maize seedlings. Treatment induced ROS burst, with excess of H2O2 content. Enzymatic activities of catalase were strongly increased during the first hours of exposure. The excess in malonildialdehyde following exposure to WHWW confirmed that oxidative stress severely damaged maize roots. Membrane alteration caused a decrease in NADPH oxidase activity along with DNA damage as confirmed by DNA laddering. The DNA instability was also assessed through sequence-related amplified polymorphism assay, thus suggesting the danger of walnut processing by-product and focusing the attention on the necessity of an efficient treatment of WHWW.

  6. Lipids and Oxidative Stress Associated with Ethanol-Induced Neurological Damage.


    Hernández, José A; López-Sánchez, Rosa C; Rendón-Ramírez, Adela


    The excessive intake of alcohol is a serious public health problem, especially given the severe damage provoked by chronic or prenatal exposure to alcohol that affects many physiological processes, such as memory, motor function, and cognitive abilities. This damage is related to the ethanol oxidation in the brain. The metabolism of ethanol to acetaldehyde and then to acetate is associated with the production of reactive oxygen species that accentuate the oxidative state of cells. This metabolism of ethanol can induce the oxidation of the fatty acids in phospholipids, and the bioactive aldehydes produced are known to be associated with neurotoxicity and neurodegeneration. As such, here we will review the role of lipids in the neuronal damage induced by ethanol-related oxidative stress and the role that lipids play in the related compensatory or defense mechanisms.

  7. Lipids and Oxidative Stress Associated with Ethanol-Induced Neurological Damage

    PubMed Central


    The excessive intake of alcohol is a serious public health problem, especially given the severe damage provoked by chronic or prenatal exposure to alcohol that affects many physiological processes, such as memory, motor function, and cognitive abilities. This damage is related to the ethanol oxidation in the brain. The metabolism of ethanol to acetaldehyde and then to acetate is associated with the production of reactive oxygen species that accentuate the oxidative state of cells. This metabolism of ethanol can induce the oxidation of the fatty acids in phospholipids, and the bioactive aldehydes produced are known to be associated with neurotoxicity and neurodegeneration. As such, here we will review the role of lipids in the neuronal damage induced by ethanol-related oxidative stress and the role that lipids play in the related compensatory or defense mechanisms. PMID:26949445

  8. Spontaneous perseverative turning in rats with radiation-induced hippocampal damage

    SciTech Connect

    Mickley, G.A.; Ferguson, J.L.; Nemeth, T.J.; Mulvihill, M.A.; Alderks, C.E. )


    This study found a new behavioral correlate of lesions specific to the dentate granule cell layer of the hippocampus: spontaneous perseverative turning. Irradiation of a portion of the neonatal rat cerebral hemispheres produced hypoplasia of the granule cell layer of the hippocampal dentate gyrus while sparing the rest of the brain. Radiation-induced damage to the hippocampal formation caused rats placed in bowls to spontaneously turn in long, slow bouts without reversals. Irradiated subjects also exhibited other behaviors characteristic of hippocampal damage (e.g., perseveration in spontaneous exploration of the arms of a T-maze, retarded acquisition of a passive avoidance task, and increased horizontal locomotion). These data extend previously reported behavioral correlates of fascia dentata lesions and suggest the usefulness of a bout analysis of spontaneous bowl turning as a measure of nondiscrete-trial spontaneous alternation and a sensitive additional indicator of radiation-induced hippocampal damage.

  9. Antioxidant protective effect of honey in cigarette smoke-induced testicular damage in rats.


    Mohamed, Mahaneem; Sulaiman, Siti Amrah; Jaafar, Hasnan; Sirajudeen, Kuttulebbai Nainamohamed Salam


    Cigarette smoke (CS) can cause testicular damage and we investigated the possible protective effect of honey against CS-induced testicular damage and oxidative stress in rats. CS exposure (8 min, 3 times daily) and honey supplementation (1.2 g/kg daily) were given for 13 weeks. Rats exposed to CS significantly had smaller seminiferous tubules diameter and epithelial height, lower Leydig cell count and increased percentage of tubules with germ cell loss. CS also produced increased lipid peroxidation (TBARS) and glutathione peroxidase (GPx) activity, as well as reduced total antioxidant status (TAS) and activities of superoxide dismutase (SOD) and catalase (CAT). However, supplementation of honey significantly reduced histological changes and TBARS level, increased TAS level, as well as significantly restored activities of GPx, SOD and CAT in rat testis. These findings may suggest that honey has a protective effect against damage and oxidative stress induced by CS in rat testis.

  10. 'Nothing of chemistry disappears in biology': the Top 30 damage-prone endogenous metabolites.


    Lerma-Ortiz, Claudia; Jeffryes, James G; Cooper, Arthur J L; Niehaus, Thomas D; Thamm, Antje M K; Frelin, Océane; Aunins, Thomas; Fiehn, Oliver; de Crécy-Lagard, Valérie; Henry, Christopher S; Hanson, Andrew D


    Many common metabolites are intrinsically unstable and reactive, and hence prone to chemical (i.e. non-enzymatic) damage in vivo Although this fact is widely recognized, the purely chemical side-reactions of metabolic intermediates can be surprisingly hard to track down in the literature and are often treated in an unprioritized case-by-case way. Moreover, spontaneous chemical side-reactions tend to be overshadowed today by side-reactions mediated by promiscuous ('sloppy') enzymes even though chemical damage to metabolites may be even more prevalent than damage from enzyme sloppiness, has similar outcomes, and is held in check by similar biochemical repair or pre-emption mechanisms. To address these limitations and imbalances, here we draw together and systematically integrate information from the (bio)chemical literature, from cheminformatics, and from genome-scale metabolic models to objectively define a 'Top 30' list of damage-prone metabolites. A foundational part of this process was to derive general reaction rules for the damage chemistries involved. The criteria for a 'Top 30' metabolite included predicted chemical reactivity, essentiality, and occurrence in diverse organisms. We also explain how the damage chemistry reaction rules ('operators') are implemented in the Chemical-Damage-MINE (CD-MINE) database ( to provide a predictive tool for many additional potential metabolite damage products. Lastly, we illustrate how defining a 'Top 30' list can drive genomics-enabled discovery of the enzymes of previously unrecognized damage-control systems, and how applying chemical damage reaction rules can help identify previously unknown peaks in metabolomics profiles.

  11. Ultrasonic Assessment of Impact-Induced Damage and Microcracking in Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Liaw, Benjamin; Villars, Esther; Delmont, Frantz; Bowles, Kenneth J. (Technical Monitor)


    The main objective of this NASA FAR project is to conduct ultrasonic assessment of impact-induced damage and microcracking in polymer matrix composites at various temperatures. It is believed that the proposed study of impact damage assessment on polymer matrix composites will benefit several NASA missions and current interests, such as ballistic impact testing of composite fan containment and high strain rate deformation modeling of polymer matrix composites. Impact-induced damage mechanisms in GLARE and ARALL fiber-metal laminates subject to instrumented drop-weight impacts at various temperatures were studied. GLARE and ARALL are hybrid composites made of alternating layers of aluminum and glass (for GLARE) and aramid- (for ARALL) fiber-reinforced epoxy. Damage in pure aluminum panels impacted by foreign objects was mainly characterized by large plastic deformation surrounding a deep penetration dent. On the other hand, plastic deformation in fiber-metal laminates was often not as severe although the penetration dent was still produced. The more stiff fiber-reinforced epoxy layers provided better bending rigidity; thus, enhancing impact damage tolerance. Severe cracking, however, occurred due to the use of these more brittle fiber-reinforced epoxy layers. Fracture patterns, e.g., crack length and delamination size, were greatly affected by the lay-up configuration rather than by the number of layers, which implies that thickness effect was not significant for the panels tested in this study. Immersion ultrasound techniques were then used to assess damages generated by instrumented drop-weight impacts onto these fiber-metal laminate panels as well as 6061-T6 aluminum/cast acrylic sandwich plates adhered by epoxy. Depending on several parameters, such as impact velocity, mass, temperature, laminate configuration, sandwich construction, etc., various types of impact damage were observed, including plastic deformation, radiating cracks emanating from the impact site

  12. Ultrasonic Assessment of Impact-Induced Damage and Microcracking in Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Gyekanyesi, John (Technical Monitor); Liaw, Benjamin; Villars, Esther; Delmont, Frantz


    The main objective of this NASA Faculty Awards for Research (FAR) project is to conduct ultrasonic assessment of impact-induced damage and microcracking in fiber-metal laminated (FML) composites at various temperatures. It is believed that the proposed study of impact damage assessment on FML composites will benefit several NASA's missions and current interests, such as ballistic impact testing of composite fan containment and high strain rate deformation modeling of polymer matrix composites. Impact-induced damage mechanisms in GLARE and ARALL fiber-metal laminates subject to instrumented drop-weight impacts at various temperatures were studied. GLARE and ARALL are hybrid composites made of alternating layers of aluminum and glass- (for GLARE) and aramid- (for ARALL) fiber reinforced epoxy. Damage in pure aluminum panels impacted by foreign objects was mainly characterized by large plastic deformation surrounding a deep penetration dent. On the other hand, plastic deformation in fiber-metal laminates was often not as severe although the penetration dent was still produced. The more stiff fiber-reinforced epoxy layers provided better bending rigidity; thus, enhancing impact damage tolerance. Severe cracking, however, occurred due to the use of these more brittle fiber-reinforced epoxy layers. Fracture patterns, e.g., crack length and delamination size, were greatly affected by the lay-up configuration rather than by the number of layers, which implies that thickness effect was not significant for the panels tested in this study. Immersion ultrasound techniques were then used to assess damages generated by instrumented drop-weight impacts onto these fiber-metal laminate panels as well as 2024-T3 aluminum/cast acrylic sandwich plates adhered by epoxy. Depending on several parameters, such as impact velocity, mass, temperature, laminate configuration, sandwich construction, etc., various types of impact damage were observed, including plastic deformation, radiating

  13. Tomography Study of Shock-Induced Damage Beneath Craters by Normal and Oblique Impacts

    NASA Astrophysics Data System (ADS)

    Ai, H.; Ahrens, T.


    Comparisons of laboratory impact craters produced in rock and planetary-scale impact structures, indicate that the observed reductions in elastic wave velocities by shock-induced damage of rock beneath impact craters can be used to constrain the impact history. A series of small-scale normal and oblique impact experiments were conducted on 20x20x15 cm samples of San Marcos granite by a 1.2 km/s, 2 kJ impactor. The resulting largely circular (8 cm in diameter) crater dimensions agrees closely with previous data. By conducting a multiple source-receiver ultrasonic survey of the shocked rock beneath laboratory craters (sampled by 290 ray paths beneath the crater) we have tomographically mapped the in-situ P-wave velocity beneath craters and find measurable damage, as defined by > 0.1 km/s velocity reduction, are induced to depths of 7 cm beneath the crater for normal impacts. However, oblique impacts produce shallower damage zone ( ˜ 3 cm deep) that are asymmetric along the plane containing the impact trajectory. The downrange shows more damage than the uprange. Since the extent of the shock-damage region depends on impact velocity and impact energy, the extent of damage in our laboratory impact structures , and we presume also planetary scale impact structures, carries both impact velocity and direction of impact information not previously recognized or sought. Hence damage zone dimensions are expected to constrain planetary impacts parameters. Oblique impacts, where the tracjectory is ≥ 15° relative to the impacted surface, yields approximately circular craters, can in principle, provide information on impactor trajectory. For planetary impacts, the damage profile, as measured by seismic velocity deficit, beneath craters allow some statistical constraint on impacts produced by low-inclination orbit objects (asteroids and Jupiter-family comets), versus, high-inclination orbit objects (long-period and new comets).

  14. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella


    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  15. Anti- and pro-oxidant effects of (+)-catechin on hemoglobin-induced protein oxidative damage.


    Lu, Naihao; Chen, Puqing; Yang, Qin; Peng, Yi-Yuan


    Evidence to support the role of heme proteins as major inducers of oxidative damage is increasingly present. Flavonoids have been widely used to ameliorate oxidative damage in vivo and in vitro, where the mechanism of this therapeutic action was usually dependent on their anti-oxidant effects. In this study, we investigated the influence of (+)-catechin, a polyphenol identified in tea, cocoa, and red wine, on hemoglobin-induced protein oxidative damage. It was found that (+)-catechin had the capacities to act as a free radical scavenger and reducing agent to remove cytotoxic ferryl hemoglobin, demonstrating apparent anti-oxidant activities. However, the presence of (+)-catechin surprisingly promoted hemoglobin-induced protein oxidation, which was probably due to the ability of this anti-oxidant to rapidly trigger the oxidative degradation of normal hemoglobin. In addition, hemoglobin-H2O2-induced protein carbonyl formation was significantly enhanced by (+)-catechin at lower concentrations, while it was efficiently inhibited when higher concentrations were used. These novel results showed that the dietary intake and therapeutic use of catechins might possess pro-oxidant activity through aggravating hemoglobin-related oxidative damage. The dual effects on hemoglobin redox reactions may provide new insights into the physiological implications of tea extract and wine (catechins) with cellular heme proteins.

  16. Maternal separation increases methamphetamine-induced damage in the striatum in male, but not female rats.


    Hensleigh, Emily; Pritchard, Laurel M


    Methamphetamine abuse impacts the global economy through costs associated with drug enforcement, emergency room visits, and treatment. Previous research has demonstrated early life stress, such as childhood abuse, increases the likelihood of developing a substance abuse disorder. However, the effects of early life stress on neuronal damage induced by binge methamphetamine administration are unknown. We aimed to elucidate the effects of early life stress on methamphetamine induced dopamine damage in the striatum. Pups were separated from dams for 3h per day during the first two weeks of development or 15 min for control. In adulthood, rats received either subcutaneous 0.9% saline or 5.0mg/kg METH injections every 2h for a total of four injections. Rectal temperatures were taken before the first injection and 1h after each subsequent injection. Seven days after treatment, rats were euthanized and striatum was collected for quantification of tyrosine hydroxylase (TH) and dopamine transporters (DAT) content by Western blot. Methamphetamine significantly elevated core body temperature in males and decreased striatal DAT and TH content, and this effect was potentiated by early life stress. Females did not exhibit elevated core body temperatures or changes in DAT or TH in either condition. Results indicate maternal separation increases methamphetamine induced damage, and females are less susceptible to methamphetamine induced damage.

  17. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.


    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  18. Laser-Induced Damage Threshold and Certification Procedures for Optical Materials

    NASA Technical Reports Server (NTRS)


    This document provides instructions for performing laser-induced-damage-threshold tests and pass-fail certification tests on optical materials used in pulsed-laser systems. The optical materials to which these procedures apply include coated and uncoated optical substrates, laser crystals, Q-switches, polarizers, and other optical components employed in pulsed-laser systems.


    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  20. High Power Optical Coatings by Atomic Layer Deposition and Signatures of Laser-Induced Damage

    DTIC Science & Technology


    hafnia:alumina ratio remained somewhat vague. In a study of the nanosecond-scale laser-induced damage threshold (LIDT) of an ALD titania -alumina...nanolaminate relative to a polycrystalline titania film indicated that the smooth, amorophous nanolaminate had at least twice the LIDT of the titania

  1. A new CT-based method to quantify radiation-induced lung damage in patients.


    Ghobadi, Ghazaleh; Wiegman, Erwin M; Langendijk, Johannes A; Widder, Joachim; Coppes, Robert P; van Luijk, Peter


    A new method to assess radiation-induced lung toxicity (RILT) using CT-scans was developed. It is more sensitive in detecting damage and corresponds better to physician-rated radiation pneumonitis than routinely-used methods. Use of this method may improve lung toxicity assessment and thereby facilitate development of more accurate predictive models for RILT.

  2. Methacryloxylethyl Cetyl Ammonium Chloride Induces DNA Damage and Apoptosis in Human Dental Pulp Cells via Generation of Oxidative Stress

    PubMed Central

    Jiao, Yang; Ma, Sai; Wang, Yirong; Li, Jing; Shan, Lequn; Sun, Jinlong; Chen, Jihua


    The polymerizable antibacterial monomer methacryloxylethyl cetyl ammonium chloride (DMAE-CB) has provided an effective strategy to combat dental caries. However, the application of such material raises the question about the biological safety and the question remains open. The mechanism of this toxic action, however, is not yet clearly understood. The present study aims at providing novel insight into the possible causal link between cellular oxidative stress and DNA damage, as well as apoptosis in human dental pulp cells exposed to DMAE-CB. The enhanced formation of reactive oxygen species and depletion of glutathione, as well as differential changes in activities of superoxide dismutase, glutathione peroxidase, and catalase in DMAE-CB-treated cells indicated oxidative stress. By using substances that can alter GSH synthesis, we found that GSH was the key component in the regulation of cell response towards oxidative stress induced by DMAE-CB. The increase in oxidative stress-sensitive 8-Oxo-2'-deoxyguanosine (8-OHdG) content, formation of γ-H2AX and cell cycle G1 phase arrest indicated that DNA damage occurred as a result of the interaction between DNA base and ROS beyond the capacities of antioxidant mechanisms in cells exposed to DMAE-CB. Such oxidative DNA damage thus triggers the activation of ataxia telangiectasia-mutated (ATM) signaling, the intrinsic apoptotic pathway, and destruction of mitochondrial morphology and function. PMID:27143955

  3. Prevention of carcinogen and inflammation-induced dermal cancer by oral rapamycin includes reducing genetic damage.


    Dao, Vinh; Pandeswara, Srilakshmi; Liu, Yang; Hurez, Vincent; Dodds, Sherry; Callaway, Danielle; Liu, Aijie; Hasty, Paul; Sharp, Zelton D; Curiel, Tyler J


    Cancer prevention is a cost-effective alternative to treatment. In mice, the mTOR inhibitor rapamycin prevents distinct spontaneous, noninflammatory cancers, making it a candidate broad-spectrum cancer prevention agent. We now show that oral microencapsulated rapamycin (eRapa) prevents skin cancer in dimethylbenz(a)anthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA) carcinogen-induced, inflammation-driven carcinogenesis. eRapa given before DMBA/TPA exposure significantly increased tumor latency, reduced papilloma prevalence and numbers, and completely inhibited malignant degeneration into squamous cell carcinoma. Rapamycin is primarily an mTORC1-specific inhibitor, but eRapa did not reduce mTORC1 signaling in skin or papillomas, and did not reduce important proinflammatory factors in this model, including p-Stat3, IL17A, IL23, IL12, IL1β, IL6, or TNFα. In support of lack of mTORC1 inhibition, eRapa did not reduce numbers or proliferation of CD45(-)CD34(+)CD49f(mid) skin cancer initiating stem cells in vivo and marginally reduced epidermal hyperplasia. Interestingly, eRapa reduced DMBA/TPA-induced skin DNA damage and the hras codon 61 mutation that specifically drives carcinogenesis in this model, suggesting reduction of DNA damage as a cancer prevention mechanism. In support, cancer prevention and DNA damage reduction effects were lost when eRapa was given after DMBA-induced DNA damage in vivo. eRapa afforded picomolar concentrations of rapamycin in skin of DMBA/TPA-exposed mice, concentrations that also reduced DMBA-induced DNA damage in mouse and human fibroblasts in vitro. Thus, we have identified DNA damage reduction as a novel mechanism by which rapamycin can prevent cancer, which could lay the foundation for its use as a cancer prevention agent in selected human populations.

  4. Effects of helium on inflammatory and oxidative stress-induced endothelial cell damage.


    Smit, Kirsten F; Kerindongo, Raphaela P; Böing, Anita; Nieuwland, Rienk; Hollmann, Markus W; Preckel, Benedikt; Weber, Nina C


    Helium induces preconditioning in human endothelium protecting against postischemic endothelial dysfunction. Circulating endothelial microparticles are markers of endothelial dysfunction derived in response to injury. Another noble gas, xenon, protected human umbilical vein endothelial cells (HUVEC) against inflammatory stress in vitro. We hypothesised that helium protects the endothelium in vitro against inflammatory and oxidative stress. HUVEC were isolated from fresh umbilical cords and grown upon confluence. Cells were subjected to starving medium for 12h before the experiment and treated for either 3 × 5 min or 1 × 30 min with helium (5% CO2, 25% O2, 70% He) or control gas (5% CO2, 25% O2, 70% N2) in a specialised gas chamber. Subsequently, cells were stimulated with TNF-α (40 ng/ml for 24h or 10 ng/ml for 2h) or H2O2 (500 μM for 2h) or left untreated. Adhesion molecule expression was analysed using real-time quantitative polymerase chain reaction. Caspase-3 expression and viability of the cells was measured by flowcytometry. Microparticles were investigated by nanoparticle tracking analysis. Helium had no effect on adhesion molecule expression after TNF-α stimulation but in combination with oxidative stress decreased cell viability (68.9 ± 1.3% and 58 ± 1.9%) compared to control. Helium further increased TNF-α induced release of caspase-3 containing particles compared to TNF-α alone (6.4 × 10(6) ± 1.1 × 10(6) and 2.9 × 10(6) ± 0.7 × 10(6), respectively). Prolonged exposure of helium increased microparticle formation (2.4 × 10(9) ± 0.5 × 10(9)) compared to control (1.7 × 10(9) ± 0.2 × 10(9)). Summarized, helium increases inflammatory and oxidative stress-induced endothelial damage and is thus not biologically inert. A possible noxious effects on the cellular level causing alterations in microparticle formation both in number and content should be acknowledged.

  5. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry; Cucinotta, F. A.


    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to Si-28-ions with energies ranging from 90 to 600 MeV/u, Ti-48-ions with energies ranging from 240 to 1000 MeV/u, or to Fe-56-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Si beams in this study ranged from 48 to 158 keV/ m, the LET of the Ti ions ranged from 107 to 240 keV/micron, and the LET of the Fe-ions ranged from 145 to 440 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to gamma-rays. The estimates of RBEmax values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, 21.4+/-1.7 to 28.3+/-2.4 for Ti ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBEmax value for Fe ions was obtained with the 600 MeV/u beam, the highest RBEmax value for Ti ions was obtained 1000 MeV/u beam, and the highest RBEmax value for Si ions was obtained with the 170 MeV/u beam. For Si and Fe ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/micron for Si, and decreasing with further increase in LET. Additional studies for low doses Si-28-ions down to 0.02 Gy will be discussed.

  6. Mfd is required for rapid recovery of transcription following UV-induced DNA damage but not oxidative DNA damage in Escherichia coli.


    Schalow, Brandy J; Courcelle, Charmain T; Courcelle, Justin


    Transcription-coupled repair (TCR) is a cellular process by which some forms of DNA damage are repaired more rapidly from transcribed strands of active genes than from nontranscribed strands or the overall genome. In humans, the TCR coupling factor, CSB, plays a critical role in restoring transcription following both UV-induced and oxidative DNA damage. It also contributes indirectly to the global repair of some forms of oxidative DNA damage. The Escherichia coli homolog, Mfd, is similarly required for TCR of UV-induced lesions. However, its contribution to the restoration of transcription and to global repair of oxidative damage has not been examined. Here, we report the first direct study of transcriptional recovery following UV-induced and oxidative DNA damage in E. coli. We observed that mutations in mfd or uvrA reduced the rate that transcription recovered following UV-induced damage. In contrast, no difference was detected in the rate of transcription recovery in mfd, uvrA, fpg, nth, or polB dinB umuDC mutants relative to wild-type cells following oxidative damage. mfd mutants were also fully resistant to hydrogen peroxide (H(2)O(2)) and removed oxidative lesions from the genome at rates comparable to wild-type cells. The results demonstrate that Mfd promotes the rapid recovery of gene expression following UV-induced damage in E. coli. In addition, these findings imply that Mfd may be functionally distinct from its human CSB homolog in that it does not detectably contribute to the recovery of gene expression or global repair following oxidative damage.

  7. Genetic damage induced by benzo[a]pyrene diol epoxide and risk of lung cancer

    SciTech Connect

    Wei, Q.; Cheng, L.; Li, D.


    Lung cancer is the paradigm of carcinogen-induced disease. A chemical carcinogen, benzo[a]pyrene, commonly found in tobacco, is both mutagenic and carcinogenic. It is hypothesized that individuals have varying responses to exposure to environmental carcinogens. In this study, we used benzo[a]pyrene diol epoxide (BPDE) as the test mutagen to investigate three in-vitro susceptibility markers in lymphocytes from 51 patients with lung cancer and 172 cancer-free controls. These markers were: BPDE-induced chromosomal aberrations, BPDE-induced DNA adducts, and DNA repair capacity using host cell reactivation assay with BPDE-damaged plasmid. Using the medians of the controls as the cutoff values, increased risk of lung cancer was associated with increased frequency of chromosomal aberrations (OR=6.53; 95% confidence interval (C.I.), 3.74-11.4), increased BPDE-DNA adduct level (odds ratio (OR)=4.7; 95% C.I., 1.2-18.5), and reduced DNA repair capacity (OR=5.7; 95% C.I., 2.1-15.7). In correlation analyses, cellular ability to repair BPDE-induced DNA damage was found to be inversely correlated with the levels of BPDE-induced DNA adducts (n=34; r=0.34; p=0.048) and the levels of BPDE-DNA adducts correlated significantly with the frequency of chromosomal aberrations (n=62; r=0.42; p=0.001). However, cellular ability to repair BPDE-induced DNA damage was not correlated significantly with the frequency of chromosomal aberrations (n=47; r=0.06; p=0.677). These biomarkers have differing sensitivities in measuring repair of damage induced by chemical carcinogens; therefore, the complementary use of these assays should increase the probability of identifying individuals with susceptibility to smoking-related cancers.

  8. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons

    PubMed Central

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua


    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies. PMID:27420046

  9. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons.


    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua


    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies.

  10. Amifostine, a radioprotectant agent, protects rat brain tissue lipids against ionizing radiation induced damage: An FTIR microspectroscopic imaging study

    SciTech Connect

    Cakmak G.; Miller L.; Zorlu, F.; Severcan, F.


    Amifostine is the only approved radioprotective agent by FDA for reducing the damaging effects of radiation on healthy tissues. In this study, the protective effect of amifostine against the damaging effects of ionizing radiation on the white matter (WM) and grey matter (GM) regions of the rat brain were investigated at molecular level. Sprague-Dawley rats, which were administered amifostine or not, were whole-body irradiated at a single dose of 800 cGy, decapitated after 24 h and the brain tissues of these rats were analyzed using Fourier transform infrared microspectroscopy (FTIRM). The results revealed that the total lipid content and CH{sub 2} groups of lipids decreased significantly and the carbonyl esters, olefinic=CH and CH{sub 3} groups of lipids increased significantly in the WM and GM after exposure to ionizing radiation, which could be interpreted as a result of lipid peroxidation. These changes were more prominent in the WM of the brain. The administration of amifostine before ionizing radiation inhibited the radiation-induced lipid peroxidation in the brain. In addition, this study indicated that FTIRM provides a novel approach for monitoring ionizing radiation induced-lipid peroxidation and obtaining different molecular ratio images can be used as biomarkers to detect lipid peroxidation in biological systems.

  11. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology.


    Cheung-Ong, Kahlin; Giaever, Guri; Nislow, Corey


    DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action. This review covers the current DNA-damaging agents used in the clinic, discusses their limitations, and describes the use of chemical genomics to uncover new information about the DNA damage response network and to evaluate novel DNA-damaging compounds.

  12. Assessing Nezara viridula (Hemiptera: Pentatomidae) feeding damage in macadamia nuts by using a biological stain.


    Golden, Mary; Follett, Peter A; Wright, Mark G


    Damage caused by southern green stink bug, Nezara viridula (L.), to macadamia nuts, Macadamia integrifolia Maiden & Betche, is normally determined after nuts are harvested and processed, which may be many months after damage occurred in the field. We developed a method using ruthenium red dye to stain stink bug feeding probes and indirectly assess feeding activity in macadamia nuts. By using the staining method, feeding probes were easily detected on the husk, shell, and kernel. Husk probing was highly correlated (0.80-0.90) with feeding and damage to the kernel. Failure rate to detect kernel damage from stained husk probes was generally <6%. The staining method was equally effective for immature and mature nuts; therefore, N. viridula feeding activity can be monitored throughout the season to evaluate pest management tactics and forecast outbreak populations.

  13. Influence of biological control damage on efficacy of penoxsulam and two other herbicides on waterhyacinth

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Populations of waterhyacinth (Eichhornia crassipes (Mart.) Solms.) in the southeastern U.S. have been reduced by widespread herbicidal control and by introduced waterhyacinth weevils (Neochetina spp) and native pathogens. However, damaging populations of this weed persist and integrated approaches ...

  14. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.


    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan


    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition.

  15. Impact of Gas Adsorption Induced Coal Matrix Damage on the Evolution of Coal Permeability

    NASA Astrophysics Data System (ADS)

    Zhu, W. C.; Wei, C. H.; Liu, J.; Xu, T.; Elsworth, D.


    It has been widely reported that coal permeability can change from reduction to enhancement due to gas adsorption even under the constant effective stress condition, which is apparently inconsistent with the classic theoretical solutions. This study addresses this inconsistency through explicit simulations of the dynamic interactions between coal matrix swelling/shrinking induced damage and fracture aperture alteration, and translations of these interactions to permeability evolution under the constant effective stress condition. We develop a coupled coal-gas interaction model that incorporates the material heterogeneity and damage evolution of coal, which allows us to couple the progressive development of damage zone with gas adsorption processes within the coal matrix. For the case of constant effective stress, coal permeability changes from reduction to enhancement while the damage zone within the coal matrix develops from the fracture wall to further inside the matrix. As the peak Langmuir strain is approached, the decrease of permeability halts and permeability increases with pressure. The transition of permeability reduction to permeability enhancement during gas adsorption, which may be closely related to the damage zone development in coal matrix, is controlled by coal heterogeneity, external boundary condition, and adsorption-induced swelling.

  16. Influence of surface cracks on laser-induced damage resistance of brittle KH₂PO₄ crystal.


    Cheng, Jian; Chen, Mingjun; Liao, Wei; Wang, Haijun; Wang, Jinghe; Xiao, Yong; Li, Mingquan


    Single point diamond turning (SPDT) currently is the leading finishing method for achieving ultra-smooth surface on brittle KH(2)PO(4) crystal. In this work, the light intensification modulated by surface cracks introduced by SPDT cutting is numerically simulated using finite-difference time-domain algorithm. The results indicate that the light intensification caused by surface cracks is wavelength, crack geometry and position dependent. Under the irradiation of 355 nm laser, lateral cracks on front surfaces and conical cracks on both front and rear surfaces can produce light intensification as high as hundreds of times, which is sufficient to trigger avalanche ionization and finally lower the laser damage resistance of crystal components. Furthermore, we experimentally tested the laser-induced damage thresholds (LIDTs) on both crack-free and flawed crystal surfaces. The results imply that brittle fracture with a series of surface cracks is the dominant source of laser damage initiation in crystal components. Due to the negative effect of surface cracks, the LIDT on KDP crystal surface could be sharply reduced from 7.85J/cm(2) to 2.33J/cm(2) (355 nm, 6.4 ns). In addition, the experiment of laser-induced damage growth is performed and the damage growth behavior agrees well with the simulation results of light intensification caused by surface cracks with increasing crack depths.

  17. Aflatoxin B1-Induced Developmental and DNA Damage in Caenorhabditis elegans

    PubMed Central

    Feng, Wei-Hong; Xue, Kathy S.; Tang, Lili; Williams, Phillip L.; Wang, Jia-Sheng


    Aflatoxin B1 (AFB1) is a ubiquitous mycotoxin produced by toxicogenic Aspergillus species. AFB1 has been reported to cause serious adverse health effects, such as cancers and abnormal development and reproduction, in animals and humans. AFB1 is also a potent genotoxic mutagen that causes DNA damage in vitro and in vivo. However, the link between DNA damage and abnormal development and reproduction is unclear. To address this issue, we examined the DNA damage, germline apoptosis, growth, and reproductive toxicity following exposure to AFB1, using Caenorhabditis elegans as a study model. Results found that AFB1 induced DNA damage and germline apoptosis, and significantly inhibited growth and reproduction of the nematodes in a concentration-dependent manner. Exposure to AFB1 inhibited growth or reproduction more potently in the DNA repair-deficient xpa-1 nematodes than the wild-type N2 strain. According to the relative expression level of pathway-related genes measured by real-time PCR, the DNA damage response (DDR) pathway was found to be associated with AFB1-induced germline apoptosis, which further played an essential role in the dysfunction of growth and reproduction in C. elegans. PMID:28035971

  18. Few-cycle pulse laser induced damage threshold determination of ultra-broadband optics.


    Kafka, Kyle R P; Talisa, Noah; Tempea, Gabriel; Austin, Drake R; Neacsu, Catalin; Chowdhury, Enam A


    A systematic study of few-cycle pulse laser induced damage threshold (LIDT) determination was performed for commercially-available ultra-broadband optics, (i.e. chirped mirrors, silver mirrors, beamsplitters, etc.) in vacuum and in air, for single and multi-pulse regime (S-on-1). Multi-pulse damage morphology at fluences below the single-pulse LIDT was studied in order to investigate the mechanisms leading to the onset of damage. Stark morphological contrast was observed between multi-pulse damage sites formed in air versus those in vacuum. One effect of vacuum testing compared to air included suppression of laser-induced periodic surface structures (LIPSS) formation, possibly influenced by a reduced presence of damage debris. Another effect of vacuum was occasional lowering of LIDT, which appears to be due to the stress-strain performance of the coating design during laser irradiation and under the external stress of vacuum ambience. A fused silica substrate is also examined, and a non-LIPSS nanostructuring is observed on the surface. Possible mechanisms are discussed.

  19. Effectiveness of Disaster-prevention Technologies against Quake-induced Damage of MR Scanners during the Great East Japan Earthquake.


    Yamaguchi-Sekino, Sachiko; Machida, Yoshio; Tsuchihashi, Toshio; Isoda, Haruo; Noguchi, Takashi; Nakai, Toshiharu


    In the present study, we have performed a statistical analysis to investigate damages in magnetic resonance (MR) scanners caused by the Great East Japan Earthquake (GEJE, magnitude 9.0) and evaluated whether these disaster-prevention technologies contributed to the reduction of damages in the GEJE or not. It was confirmed that the extent of damage was significantly different between seismic scale (SS) 5 and SS over 6. Our survey study demonstrated that anchoring of MR facilities reduced damages due to quakes and demonstrated that anchoring is an efficient method for quake-induced damage prevention. The odds ratio revealed that base isolation was very useful to prevent damages in MR scanners.

  20. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  1. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales


    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  2. Antioxidant and hepatoprotective effects of punicalagin and punicalin on acetaminophen-induced liver damage in rats.


    Lin, C C; Hsu, Y F; Lin, T C; Hsu, H Y


    Punicalagin and punicalin were isolated from the leaves of Terminalia catappa L., a Combretaceous plant distributed throughout tropical and subtropical beaches, which is used for the treatment of dermatitis and hepatitis. Our previous studies showed that both of these compounds exert antioxidative activity. In this study, the antihepatotoxic activity of punicalagin and punicalin on acetaminophen-induced toxicity in the rat liver was evaluated. After evaluating the changes of several biochemical functions in serum, the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were increased by acetaminophen administration and reduced by punicalagin and punicalin. Histological changes around the hepatic central vein and oxidative damage induced by acetaminophen were also recovered by both compounds. The data show that both punicalagin and punicalin exert antihepatotoxic activity, but treatment with larger doses enhanced liver damage. These results suggest that even if punicalagin and punicalin have antioxidant activity at small doses, treatment with larger doses will possibly induce some cell toxicities.

  3. The DNA damage response induced by infection with human cytomegalovirus and other viruses.


    Xiaofei, E; Kowalik, Timothy F


    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  4. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    PubMed Central

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  5. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  6. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  7. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress.


    Skipper, Anthony; Sims, Jennifer N; Yedjou, Clement G; Tchounwou, Paul B


    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium. Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG₂) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG₂ cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG₂ cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG₂) cells.

  8. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen


    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  9. Laser induced bulk damage of KDP crystals prepared by rapid growth

    NASA Astrophysics Data System (ADS)

    Zhao, Yuan'an; Wang, Yueliang; Hu, Guohang; Shao, Jianda; Chang, Junxiu; Liu, Xiaofeng; Li, Dawei; Yao, Yuangen; Lin, Xiuqin; Zheng, Guozong


    Laser damage of TYPE-I KDP plate was investigated. High-purity large-aperture KDP crystals used for second harmonic frequency generation in high power laser systems were prepared by rapid growth. The different parts of the KDP boule, spanning the growth history including early, middle and late growth stages, were examined for their bulk defect properties and laser damage behaviors. Ultra-microscopy was employed to analyze the preexisting laser scattering defects, and the correlations between scattering and laser damage initiations/ growth were identified. The laser damage fluence was dominated by the defect scale or the scattering intensity. Simulation of thermal response of the defects under laser radiation indicated the micro-explosion occurrence. Thermal annealing and laser conditioning were applied to reduce defect density and improve laser damage resistance. Based on the above techniques, laser induced damage threshold (LIDT) of 400 mm aperture TYPE-I crystal plate exceeded 22J/cm2 (1064nm, 3ns), which met the requirements of the high power laser systems.

  10. Delayed repair of radiation induced clustered DNA damage: Friend or foe?

    PubMed Central

    Eccles, Laura J.; O’Neill, Peter; Lomax, Martine E.


    A signature of ionizing radiation exposure is the induction of DNA clustered damaged sites, defined as two or more lesions within one to two helical turns of DNA by passage of a single radiation track. Clustered damage is made up of double strand breaks (DSB) with associated base lesions or abasic (AP) sites, and non-DSB clusters comprised of base lesions, AP sites and single strand breaks. This review will concentrate on the experimental findings of the processing of non-DSB clustered damaged sites. It has been shown that non-DSB clustered damaged sites compromise the base excision repair pathway leading to the lifetime extension of the lesions within the cluster, compared to isolated lesions, thus the likelihood that the lesions persist to replication and induce mutation is increased. In addition certain non-DSB clustered damaged sites are processed within the cell to form additional DSB. The use of E. coli to demonstrate that clustering of DNA lesions is the major cause of the detrimental consequences of ionizing radiation is also discussed. The delayed repair of non-DSB clustered damaged sites in humans can be seen as a “friend”, leading to cell killing in tumour cells or as a “foe”, resulting in the formation of mutations and genetic instability in normal tissue. PMID:21130102

  11. Detection of DNA damage induced by space radiation in Mir and space shuttle.


    Ohnishi, Takeo; Ohnishi, Ken; Takahashi, Akihisa; Taniguchi, Yoshitaka; Sato, Masaru; Nakano, Tamotsu; Nagaoka, Shunji


    Although physical monitoring of space radiation has been accomplished, we aim to measure exact DNA damage as caused by space radiation. If DNA damage is caused by space radiation, we can detect DNA damage dependent on the length of the space flight periods by using post-labeling methods. To detect DNA damage caused by space radiation, we placed fixed human cervical carcinoma (HeLa) cells in the Russian Mir space station for 40 days and in an American space shuttle for 9 days. After landing, we labeled space-radiation-induced DNA strand breaks by enzymatic incorporation of [3H]-dATP with terminal deoxyribo-nucleotidyl transferase (TdT). We detected DNA damage as many grains on fixed silver emulsion resulting from beta-rays emitted from 3H-atoms in the nuclei of the cells placed in the Mir-station (J/Mir mission, STS-89), but detected hardly any in the ground control sample. In the space shuttle samples (S/MM-8), the number of cells having many grains was lower than that in the J/Mir mission samples. These results suggest that DNA damage is caused by space radiation and that it is dependent on the length of the space flight.

  12. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.


    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely


    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  13. ELF magnetic fields do not affect cell survival and DNA damage induced by ultraviolet B.


    Mizuno, Kohei; Narita, Eijiro; Yamada, Masaru; Shinohara, Naoki; Miyakoshi, Junji


    We investigated whether extremely low frequency (ELF) magnetic field exposure has modification effects on cell survival after ultraviolet B (UV-B) irradiation and on repair process of DNA damage induced by UV-B irradiation in WI38VA13 subcloned 2RA and XP2OS(SV) cells. The ELF magnetic field exposure was conducted using a Helmholtz coil-based system that was designed to generate a sinusoidal magnetic field at 5 mT and 60 Hz. Cell survival was assessed by WST assay after UV-B irradiation at 20-80 J/m(2) , ELF magnetic field exposure for 24 h, followed by incubation for 48 h. DNA damage was assessed by quantification of cyclobutane pyrimidine dimer formation and 6-4 photoproduct formation using ELISA after UV-B irradiation at 20-80 J/m(2) followed by ELF magnetic field exposure for 24 h. No significant changes were observed in cell survival between ELF magnetic field and sham exposures. Similarly, DNA damage induced by UV-B irradiation did not change significantly following ELF magnetic field exposure. Our results suggest that ELF magnetic field exposure at 5 mT does not have modification effect on cell survival after UV-B irradiation and on repair process of DNA damage induced by UV-B irradiation.

  14. Identification of Earthquake Induced Damage Areas Using Fourier Transform and SPOT HRVIR Pan Images

    PubMed Central

    Sertel, Elif


    A devastating earthquake with a magnitude of Mw 7.4 occurred on the North Anatolian Fault Zone (NAFZ) of Turkey on August 17, 1999 at 00:01:39 UTC (3:01 a.m. local time). The aim of this study is to propose a new approach to automatically identify earthquake induced damage areas which can provide valuable information to support emergency response and recovery assessment procedures. This research was conducted in the Adapazari inner city, covering a 3 × 3 km area, where 11,373 buildings collapsed as a result of the earthquake. SPOT high resolution visible infrared (HRVIR) Pan images obtained before (25 June 1999) and after (4 October 1999) the earthquake were used in the study. Five steps were employed to conduct the research and these are: (i) geometric and radiometric correction of satellite images, (ii) Fast Fourier Transform (FFT) of pre- and post-earthquake images and filtering the images in frequency domain, (iii) generating difference image using Inverse Fast Fourier Transform (IFFT) pre- and post- earthquake images, (iv) application of level slicing to difference image to identify the earthquake-induced damages, (v) accuracy assessment of the method using ground truth obtained from a 1/5,000 scale damage map. The total accuracy obtained in the research is 80.19 %, illustrating that the proposed method can be successfully used to automatically identify earthquake-induced damage areas. PMID:22573966

  15. Identification of Earthquake Induced Damage Areas Using Fourier Transform and SPOT HRVIR Pan Images.


    Sertel, Elif


    A devastating earthquake with a magnitude of Mw 7.4 occurred on the North Anatolian Fault Zone (NAFZ) of Turkey on August 17, 1999 at 00:01:39 UTC (3:01 a.m. local time). The aim of this study is to propose a new approach to automatically identify earthquake induced damage areas which can provide valuable information to support emergency response and recovery assessment procedures. This research was conducted in the Adapazari inner city, covering a 3 × 3 km area, where 11,373 buildings collapsed as a result of the earthquake. SPOT high resolution visible infrared (HRVIR) Pan images obtained before (25 June 1999) and after (4 October 1999) the earthquake were used in the study. Five steps were employed to conduct the research and these are: (i) geometric and radiometric correction of satellite images, (ii) Fast Fourier Transform (FFT) of pre- and post-earthquake images and filtering the images in frequency domain, (iii) generating difference image using Inverse Fast Fourier Transform (IFFT) pre- and post- earthquake images, (iv) application of level slicing to difference image to identify the earthquake-induced damages, (v) accuracy assessment of the method using ground truth obtained from a 1/5,000 scale damage map. The total accuracy obtained in the research is 80.19 %, illustrating that the proposed method can be successfully used to automatically identify earthquake-induced damage areas.

  16. Curcumin reduces cold storage-induced damage in human cardiac myoblasts.


    Abuarqoub, Hadil; Green, Colin J; Foresti, Roberta; Motterlini, Roberto


    Curcumin is a polyphenolic compound possessing interesting anti-inflammatory and antioxidant properties and has the ability to induce the defensive protein heme oxygenase-1 (HO-1). The objective of this study was to investigate whether curcumin protects against cold storage-mediated damage of human adult atrial myoblast cells (Girardi cells) and to assess the potential involvement of HO-1 in this process. Girardi cells were exposed to either normothermic or hypothermic conditions in Celsior preservation solution in the presence or absence of curcumin. HO-1 protein expression and heme oxygenase activity as well as cellular damage were assessed after cold storage or cold storage followed by re-warming. In additional experiments, an inhibitor of heme oxygenase activity (tin protoporphyrin IX, 10 microM) or siRNA for HO-1 were used to investigate the participation of HO-1 as a mediator of curcumin-induced effects. Treatment with curcumin produced a marked induction of cardiac HO-1 in normothermic condition but cells were less responsive to the polyphenolic compound at low temperature. Cold storage-induced damage was markedly reduced in the presence of curcumin and HO-1 contributed to some extent to this effect. Thus, curcumin added to Celsior preservation solution effectively prevents the damage caused by cold-storage; this effect involves the protective enzyme HO-1 but also other not yet identified mechanisms.

  17. Beneficial protective effect of pramipexole on light-induced retinal damage in mice.


    Shibagaki, Keiichi; Okamoto, Kazuyoshi; Katsuta, Osamu; Nakamura, Masatsugu


    We investigated the effects of pramipexole, a potent dopamine receptor D2/D3 agonist, on light-induced retinal damage in mice, H2O2-induced retinal pigment epithelium ARPE-19 cell injury in humans, and hydroxyl radical scavenging activity in a cell-free system. Pramipexole (0.1 and 1 mg/kg body weight) was orally administered to mice 1 h before light exposure (5000 lux, 2 h). Electrophysiological and morphologic studies were performed to evaluate the effects of the pramipexole on light-induced retinal damage in mice. Pramipexole significantly prevented the reduction of the a- and b-wave electroretinogram (ERG) amplitudes caused by light exposure in a dose-dependent manner. In parallel, damage to the inner and outer segments (IS/OS) of the photoreceptors, loss of photoreceptor nuclei, and the number of Tdt-mediated dUTP nick-end labeling (TUNEL)-positive cells in the outer nuclear layer (ONL) caused by light exposure were notably ameliorated by pramipexole. Additionally, pramipexole suppressed H2O2-induced ARPE-19 cell death in vitro in a concentration-dependent manner. The effect of pramipexole was significant at concentrations of 10(-6) M or higher. Pramipexole also significantly prevented H2O2-induced activation of caspases-3/7 and the intracellular accumulation of reactive oxygen species (ROS) in a concentration-dependent manner ranging from 10(-5) to 10(-3) M. Furthermore, pramipexole increased the scavenging activity toward a hydroxyl radical generated from H2O2 in a Fenton reaction. Our results suggest that pramipexole protects against light-induced retinal damage as an antioxidant and that it may be a novel and effective therapy for retinal degenerative disorders, such as dry age-related macular degeneration.

  18. Deformation-induced damage and recovery in model hydrogels - A molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Zidek, Jan; Milchev, Andrey; Jancar, Josef; Vilgis, Thomas A.


    Using molecular dynamics simulation of a model hybrid cross-link hydrogel, we investigate the network damage evolution and the related structure transformations. We model the hydrogel structure as a network-connected assembly of crosslinked clusters whereby deformation-induced damage is considered along with network recovery. The two principal mechanisms involved in hydrogel recovery from deformation include segment hops of the building structure units (segments) between clusters and cluster shape modification. These mechanisms act either instantaneously, or with a certain time delay after the onset of deformation. By elucidating the conditions under which one of the mechanisms prevails, one may design hydrogel materials with a desired response to deformation.

  19. DNA damage response induces structural alterations in histone H3–H4

    PubMed Central

    Izumi, Yudai; Fujii, Kentaro; Yamamoto, Satoshi; Matsuo, Koichi; Namatame, Hirofumi; Taniguchi, Masaki; Yokoya, Akinari


    Synchrotron-radiation circular-dichroism spectroscopy was used to reveal that the DNA damage response induces a decrement of α-helix and an increment of β-strand contents of histone H3–H4 extracted from X-ray–irradiated human HeLa cells. The trend of the structural alteration was qualitatively opposite to that of our previously reported results for histone H2A–H2B. These results strongly suggest that histones share roles in DNA damage responses, particularly in DNA repair processes and chromatin remodeling, via a specific structural alteration of each histone. PMID:27672100

  20. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.


    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  1. Molecular dynamics study of accelerated ion-induced shock waves in biological media

    NASA Astrophysics Data System (ADS)

    de Vera, Pablo; Mason, Nigel J.; Currell, Fred J.; Solov'yov, Andrey V.


    We present a molecular dynamics study of the effects of carbon- and iron-ion induced shock waves in DNA duplexes in liquid water. We use the CHARMM force field implemented within the MBN Explorer simulation package to optimize and equilibrate DNA duplexes in liquid water boxes of different sizes and shapes. The translational and vibrational degrees of freedom of water molecules are excited according to the energy deposited by the ions and the subsequent shock waves in liquid water are simulated. The pressure waves generated are studied and compared with an analytical hydrodynamics model which serves as a benchmark for evaluating the suitability of the simulation boxes. The energy deposition in the DNA backbone bonds is also monitored as an estimation of biological damage, something which is not possible with the analytical model.

  2. Leg Immersion in Warm Water, Stretch-Shortening Exercise, and Exercise-Induced Muscle Damage

    PubMed Central

    Skurvydas, Albertas; Kamandulis, Sigitas; Stanislovaitis, Aleksas; Streckis, Vytautas; Mamkus, Gediminas; Drazdauskas, Adomas


    Context: Whether muscle warming protects against exercise-induced muscle damage is unknown. Objective: To determine the effect of leg immersion in warm water before stretch-shortening exercise on the time course of indirect markers of exercise-induced muscle damage. Design: Crossover trial. Setting: Human kinetics laboratory. Patients or Other Participants: Eleven healthy, untrained men (age  =  21.5 ± 1.7 years). Intervention(s): Participants' legs were immersed in a water bath at 44 ± 1°C for 45 minutes. Main Outcome Measure(s): Creatine kinase changes in the blood, muscle soreness, prolonged (within 72 hours) impairment in maximal voluntary contraction force and height of drop jump, and electrically evoked muscle force at low and high stimulation frequencies at short and long muscle lengths. Results: Leg immersion in warm water before stretch-shortening exercise reduced most of the indirect markers of exercise-induced muscle damage, including creatine kinase activity in the blood, muscle soreness, maximal voluntary contraction force, and jump height. The values for maximal voluntary contraction force and jump height, however, were higher during prewarming than for the control condition at 48 hours after stretch-shortening exercise, but this difference was only minor at other time points. Muscle prewarming did not bring about any changes in the dynamics of low-frequency fatigue, registered at either short or long muscle length, within 72 hours of stretch-shortening exercise. Conclusions: Leg immersion in warm water before stretch-shortening exercise reduced most of the indirect markers of exercise-induced muscle damage. However, the clinical application of muscle prewarming may be limited, because decreasing muscle damage did not necessarily lead to improved voluntary performance. PMID:19030137

  3. Microcystin-LR induced DNA damage in human peripheral blood lymphocytes.


    Zegura, B; Gajski, G; Straser, A; Garaj-Vrhovac, V; Filipič, M


    Human exposure to microcystins, which are produced by freshwater cyanobacterial species, is of growing concern due to increasing appearance of cyanobacterial blooms as a consequence of global warming and increasing water eutrophication. Although microcystins are considered to be liver-specific, there is evidence that they may also affect other tissues. These substances have been shown to induce DNA damage in vitro and in vivo, but the mechanisms of their genotoxic activity remain unclear. In human peripheral blood lymphocytes (HPBLs) exposure to non-cytotoxic concentrations (0, 0.1, 1 and 10μg/ml) of microcystin-LR (MCLR) induced a dose- and time-dependent increase in DNA damage, as measured with the comet assay. Digestion of DNA from MCLR-treated HPBLs with purified formamidopyrimidine-DNA glycosylase (Fpg) displayed a greater number of DNA strand-breaks than non-digested DNA, confirming the evidence that MCLR induces oxidative DNA damage. With the cytokinesis-block micronucleus assay no statistically significant induction of micronuclei, nucleoplasmic bridges and nuclear buds was observed after a 24-h exposure to MCLR. At the molecular level, no changes in the expression of selected genes involved in the cellular response to DNA damage and oxidative stress were observed after a 4-h exposure to MCLR (1μg/ml). After 24h, DNA damage-responsive genes (p53, mdm2, gadd45a, cdkn1a), a gene involved in apoptosis (bax) and oxidative stress-responsive genes (cat, gpx1, sod1, gsr, gclc) were up-regulated. These results provide strong support that MCLR is an indirectly genotoxic agent, acting via induction of oxidative stress, and that lymphocytes are also the target of microcystin-induced toxicity.

  4. DNA damage induced by Strontium-90 exposure at low concentrations in mesenchymal stromal cells: the functional consequences

    PubMed Central

    Musilli, S.; Nicolas, N.; El Ali, Z.; Orellana-Moreno, P.; Grand, C.; Tack, K.; Kerdine-Römer, S.; Bertho, J. M.


    90Sr is one of the radionuclides released after nuclear accidents that can significantly impact human health in the long term. 90Sr accumulates mostly in the bones of exposed populations. Previous research has shown that exposure induces changes in bone physiology both in humans and in mice. We hypothesize that, due to its close location with bone marrow stromal cells (BMSCs), 90Sr could induce functional damage to stromal cells that may explain these biological effects due to chronic exposure to 90Sr. The aim of this work was to verify this hypothesis through the use of an in vitro model of MS5 stromal cell lines exposed to 1 and 10 kBq.mL−1 of 90Sr. Results indicated that a 30-minute exposure to 90Sr induced double strand breaks in DNA, followed by DNA repair, senescence and differentiation. After 7 days of exposure, MS5 cells showed a decreased ability to proliferate, changes in cytokine expression, and changes in their ability to support hematopoietic progenitor proliferation and differentiation. These results demonstrate that chronic exposure to a low concentration of 90Sr can induce functional changes in BMSCs that in turn may explain the health effects observed in following chronic 90Sr exposure. PMID:28134299

  5. Influence of chromatin condensation on the number of direct DSB damages induced by ions studied using a Monte Carlo code.


    Dos Santos, M; Clairand, I; Gruel, G; Barquinero, J F; Incerti, S; Villagrasa, C


    The purpose of this work is to evaluate the influence of the chromatin condensation on the number of direct double-strand break (DSB) damages induced by ions. Two geometries of chromosome territories containing either condensed or decondensed chromatin were implemented as biological targets in the Geant4 Monte Carlo simulation code and proton and alpha irradiation was simulated using the Geant4-DNA processes. A DBSCAN algorithm was used in order to detect energy deposition clusters that could give rise to single-strand breaks or DSBs on the DNA molecule. The results of this study show an increase in the number and complexity of DNA DSBs in condensed chromatin when compared with decondensed chromatin.

  6. Modeling the roles of damage accumulation and mechanical healing on rainfall-induced landslides

    NASA Astrophysics Data System (ADS)

    Fan, Linfeng; Lehmann, Peter; Or, Dani


    The abrupt release of rainfall-induced shallow landslides is preceded by local failures that may abruptly coalesce and form a continuous failure plane within a hillslope. The mechanical status of hillslopes reflects a competition between the extent of severity of accumulated local damage during prior rainfall events and the rates of mechanically healing (i.e. regaining of strength) by closure of micro-cracks, regrowth of roots, etc. The interplay of these processes affects the initial conditions for landslide modeling and shapes potential failure patterns during future rainfall events. We incorporated these competing mechanical processes in a hydro-mechanical landslide triggering model subjected to a sequence of rainfall scenarios. The model employs the Fiber Bundle Model (FBM) with bonds (fiber bundle) with prescribed threshold linking adjacent soil columns and soil to bedrock. Prior damage was represented by a fraction of broken fibers during previous rainfall events, and the healing of broken fibers was described by strength regaining models for soil and roots at different characteristic time scales. Results show that prior damage and healing introduce highly nonlinear response to landslide triggering. For small prior damage, mechanical bonds at soil-bedrock interface may fail early in next rainfall event but lead to small perturbations onto lateral bonds without triggering a landslide. For more severe damage weakening lateral bonds, excess load due to failure at soil-bedrock interface accumulates at downslope soil columns resulting in early soil failure with patterns strongly correlated with prior damage distribution. Increasing prior damage over the hillslope decreases the volume of first landslide and prolongs the time needed to trigger the second landslide due to mechanical relaxation of the system. The mechanical healing of fibers diminishes effects of prior damage on the time of failure, and shortens waiting time between the first and second landslides

  7. Effects of Traumeel (Tr14) on Exercise-Induced Muscle Damage Response in Healthy Subjects: A Double-Blind RCT

    PubMed Central

    Deuster, Vanessa; Frech, Torsten; Pons-Kühnemann, Jörn; Mooren, Frank-Christoph


    The present double-blind, randomized, placebo-controlled clinical trial intended to test whether ingestion of a natural combination medicine (Tr14 tablets) affects serum muscle damage and inflammatory immune response after downhill running. 96 male subjects received Tr14 tablets, which consist of 14 diluted biological and mineral components, or a placebo for 72 h after the exercise test, respectively. Changes in postexercise levels of various serum muscle damage and immunological markers were investigated. The area under the curve with respect to the increase (AUCi) of perceived pain score and creatine kinase (CK) were defined as primary outcome measures. While for CK the p value of the difference between the two groups is borderline, the pain score and muscle strength were not statistically significant. However, a trend towards lower levels of muscle damage (CK, p = 0.05; LDH, p = 0.06) in the Tr14 group was shown. Less pronounced lymphopenia (p = 0.02), a trend towards a lower expression of CD69 count (p = 0.07), and antigen-stimulated ICAM-1 (p = 0.01) were found in the verum group. The Tr14 group showed a tendentially lower increase of neutrophils (p = 0.10), BDNF (p = 0.03), stem cell factor (p = 0.09), and GM-CSF (p = 0.09) to higher levels. The results of the current study indicate that Tr14 seems to limit exercise-induced muscle damage most likely via attenuation of both innate and adaptive immune responses. This study was registered with (NCT01912469). PMID:27478305

  8. Day and night variations in the repair of ionizing-radiation-induced DNA damage in mouse splenocytes.


    Palombo, Philipp; Moreno-Villanueva, Maria; Mangerich, Aswin


    In mammals, biological rhythms synchronize physiological and behavioral processes to the 24-h light-dark (LD) cycle. At the molecular level, self-sustaining processes, such as oscillations of transcription-translation feedback loops, control the circadian clock, which in turn regulates a wide variety of cellular processes, including gene expression and cell cycle progression. Furthermore, previous studies reported circadian oscillations in the repair capacity of DNA lesions specifically repaired by nucleotide excision repair (NER). However, it is so far only poorly understood if DNA repair pathways other than NER are under circadian control, in particular base excision and DNA strand break repair. In the present study, we analyzed potential day and night variations in the repair of DNA lesions induced by ionizing radiation (i.e., mainly oxidative damage and DNA strand breaks) in living mouse splenocytes using a modified protocol of the automated FADU assay. Our results reveal that splenocytes isolated from mice during the light phase (ZT06) displayed higher DNA repair activity than those of the dark phase (ZT18). As analyzed by highly sensitive and accurate qPCR arrays, these alterations were accompanied by significant differences in expression profiles of genes involved in the circadian clock and DNA repair. Notably, the majority of the DNA repair genes were expressed at higher levels during the light phase (ZT06). This included genes of all major DNA repair pathways with the strongest differences observed for genes of base excision and DNA double strand break repair. In conclusion, here we provide novel evidence that mouse splenocytes exhibit significant differences in the repair of IR-induced DNA damage during the LD cycle, both on a functional and on a gene expression level. It will be interesting to test if these findings could be exploited for therapeutic purposes, e.g. time-of-the-day-specific application of DNA-damaging treatments used against blood

  9. Targeting neddylation induces DNA damage and checkpoint activation and sensitizes chronic lymphocytic leukemia B cells to alkylating agents.


    Paiva, C; Godbersen, J C; Berger, A; Brown, J R; Danilov, A V


    Microenvironment-mediated upregulation of the B-cell receptor (BCR) and nuclear factor-κB (NF-κB) signaling in CLL cells resident in the lymph node and bone marrow promotes apoptosis evasion and clonal expansion. We recently reported that MLN4924 (pevonedistat), an investigational agent that inhibits the NEDD8-activating enzyme (NAE), abrogates stromal-mediated NF-κB pathway activity and CLL cell survival. However, the NAE pathway also assists degradation of multiple other substrates. MLN4924 has been shown to induce DNA damage and cell cycle arrest, but the importance of this mechanism in primary neoplastic B cells has not been studied. Here we mimicked the lymph node microenvironment using CD40 ligand (CD40L)-expressing stroma and interleukin-21 (IL-21) to find that inducing proliferation of the primary CLL cells conferred enhanced sensitivity to NAE inhibition. Treatment of the CD40-stimulated CLL cells with MLN4924 resulted in deregulation of Cdt1, a DNA replication licensing factor, and cell cycle inhibitors p21 and p27. This led to DNA damage, checkpoint activation and G2 arrest. Alkylating agents bendamustine and chlorambucil enhanced MLN4924-mediated DNA damage and apoptosis. These events were more prominent in cells stimulated with IL-21 compared with CD40L alone, indicating that, following NAE inhibition, the culture conditions were able to direct CLL cell fate from an NF-κB inhibition to a Cdt1 induction program. Our data provide insight into the biological consequences of targeting NAE in CLL and serves as further rationale for studying the clinical activity of MLN4924 in CLL, particularly in combination with alkylating agents.

  10. Gremlin inhibits UV-induced skin cell damages via activating VEGFR2-Nrf2 signaling.


    Ji, Chao; Huang, Jin-Wen; Xu, Qiu-Yun; Zhang, Jing; Lin, Meng-Ting; Tu, Ying; He, Li; Bi, Zhi-Gang; Cheng, Bo


    Ultra Violet (UV) radiation induces reactive oxygen species (ROS) production, DNA oxidation and single strand breaks (SSBs), which will eventually lead to skin cell damages or even skin cancer. Here, we tested the potential activity of gremlin, a novel vascular endothelial growth factor (VEGF) receptor 2 (VEGFR2) agonist, against UV-induced skin cell damages. We show that gremlin activated VEGFR2 and significantly inhibited UV-induced death and apoptosis of skin keratinocytes and fibroblasts. Pharmacological inhibition or shRNA-mediated knockdown of VEGFR2 almost abolished gremlin-mediated cytoprotection against UV in the skin cells. Further studies showed that gremlin activated VEGFR2 downstream NF-E2-related factor 2 (Nrf2) signaling, which appeared required for subsequent skin cell protection. Nrf2 shRNA knockdown or S40T dominant negative mutation largely inhibited gremlin-mediated skin cell protection against UV. At last, we show that gremlin dramatically inhibited UV-induced ROS production and DNA SSB formation in skin keratinocytes and fibroblasts. We conclude that gremlin protects skin cells from UV damages via activating VEGFR2-Nrf2 signaling. Gremlin could be further tested as a novel anti-UV skin protectant.

  11. FTY720 Attenuates Angiotensin II-Induced Podocyte Damage via Inhibiting Inflammatory Cytokines

    PubMed Central

    Su, Ke; Zeng, Ping; Liang, Wei; Luo, Zhengyu; Wang, Yiman; Lv, Xifeng; Han, Qi; Yan, Miao


    FTY720, a new chemical substance derived from the ascomycete Isaria sinclairii, is used for treating multiple sclerosis, renal cancer, and asthma. Sphingosine 1-phosphate (S1P) is a bioactive sphingolipid metabolite and exists in red blood cells. FTY720 is a synthetic S1P analog which can block S1P evoking physiological effects. Recently studies show that S1P was participating in activated inflammation cells induced renal injury. The objective of this study was to assess the protective effect of FTY720 on kidney damage and the potential mechanism of FTY720 which alleviate podocyte injury in chronic kidney disease. In this study, we selected 40 patients with IgA nephropathy and examined their clinical characteristics. Ang II-infusion rat renal injury model was established to evaluate the glomeruli and tubulointerstitial lesion. The result showed that the concentration of S1P in serum and urine was positively correlated with IgA nephropathy patients' renal injury. FTY720 could reduce renal histological lesions induced by Ang II-infusion in rats. Moreover, FTY720 decreased S1P synthesis in Ang II-infusion rats via downregulation of inflammatory cytokines including TNF-α and IL-6. In addition, FTY720 alleviated exogenous S1P-induced podocyte damage. In conclusion, FTY720 is able to attenuate S1P-induced podocyte damage via reducing inflammatory cytokines. PMID:28270699

  12. DNA damage, apoptosis and langerhans cells--Activators of UV-induced immune tolerance.


    Timares, Laura; Katiyar, Santosh K; Elmets, Craig A


    Solar UVR is highly mutagenic but is only partially absorbed by the outer stratum corneum of the epidermis. UVR can penetrate into the deeper layers of the epidermis, depending on melanin content, where it induces DNA damage and apoptosis in epidermal cells, including those in the germinative basal layer. The cellular decision to initiate either cellular repair or undergo apoptosis has evolved to balance the acute need to maintain skin barrier function with the long-term risk of retaining precancerous cells. Langerhans cells (LCs) are positioned suprabasally, where they may sense UV damage directly, or indirectly through recognition of apoptotic vesicles and soluble mediators derived from surrounding keratinocytes. Apoptotic vesicles will contain UV-induced altered proteins that may be presented to the immune system as foreign. The observation that UVR induces immune tolerance to skin-associated antigens suggests that this photodamage response has evolved to preserve the skin barrier by protecting it from autoimmune attack. LC involvement in this process is not clear and controversial. We will highlight some basic concepts of photobiology and review recent advances pertaining to UV-induced DNA damage, apoptosis regulation, novel immunomodulatory mechanisms and the role of LCs in generating antigen-specific regulatory T cells.

  13. Protection by N-acetylcysteine against pulmonary endothelial cell damage induced by oxidant injury.


    Sala, R; Moriggi, E; Corvasce, G; Morelli, D


    The protective effect of N-acetylcysteine (NAC) against oxidant lung injury was investigated in a model of acute immunological alveolitis in the rat. Intrapulmonary immune complex deposition into rat lungs, induced by intratracheal infusion of immunoglobulin G (IgG) anti-bovine serum albumin (BSA) antibodies and intravenous injection of the antigen, caused lung damage associated with a marked decrease in [14C]5-hydroxytryptamine ([14C]5HT) uptake capacity, taken as a biochemical marker of endothelial cell function. The oral administration of a single dose of NAC (2 60 min before antigen/antibody (Ag/Ab) treatment was effective in preventing pulmonary endothelial cell [14C]5HT uptake loss induced by immune complex deposition. The mechanisms involved in this lung protective action of NAC were investigated by studying the antioxidant activity of NAC on hypoxanthine/xanthine oxidase-induced lung damage in vitro, and the effectiveness of the drug as lung glutathione (reduced form) (GSH) precursor in diethylmaleate-depleted rats. The results obtained provide further evidence on the ability of NAC to reduce the susceptibility of lung tissue to free radical-induced damage, by potentiating the antioxidant defence systems.

  14. Hypothalamic Astrocytes Respond to Gastric Mucosal Damage Induced by Restraint Water-Immersion Stress in Rat

    PubMed Central

    Sun, Haiji; Li, Ruisheng; Xu, Shiguo; Liu, Zhen; Ma, Xiaoli


    Restraint water-immersion stress (RWIS), a compound stress model, includes both psychological and physical stimulation. Studies have shown that neurons in the hypothalamus are involved in RWIS, but the role of astrocytes and the interactions between astrocytes and neurons in RWIS are not clear. Here, we tested our hypothesis that hypothalamus astrocytes are involved in RWIS and interact with neurons to regulate gastric mucosal damage induced by RWIS. The expression of Glial fibrillary acidic protein (GFAP) and c-Fos in the paraventricular nucleus (PVN) and supraoptic nucleus (SON) significantly increased following the RWIS. GFAP and c-Fos expression are similar in the temporal pattern, peaked at 1 h after the RWIS, then reduced gradually, and reached a maximal level again at 5 h which show “double-peak” characteristics. Intracerebroventricular administration of astroglial toxin L-a-aminoadipate (L-AA) and c-Fos antisense oligodeoxy nucleotides (ASO) both decreased RWIS-induced gastric mucosal damage. Results of immunohistochemistry assay revealed that both L-AA and ASO decreased the activation of astrocytes and neurons in the hypothalamus by RWIS. These results showed that hypothalamus neuron-astrocyte “network” involved in gastric mucosal damage induced by RWIS. This study may offer theoretical basis for some novel therapeutic strategies for RWIS-induced gastric ulcers. PMID:27847472

  15. Role of calcitonin gene-related peptide in hypertension-induced renal damage.


    Bowers, Mark C; Katki, Khurshed A; Rao, Arundhati; Koehler, Michael; Patel, Parag; Spiekerman, Alvin; DiPette, Donald J; Supowit, Scott C


    Calcitonin gene-related peptide, a potent vasodilator neuropeptide, is localized in perivascular sensory nerves. We have reported that alpha-calcitonin gene-related peptide knockout mice have elevated baseline blood pressure and enhanced hypertension-induced renal damage compared with wild-type controls. Thus, the aim of this study was to determine the mechanism and functional significance of this increased hypertension-induced renal damage. We previously demonstrated by telemetric recording that the deoxycorticosterone-salt protocol produces a 35% increase in mean arterial pressure in both alpha-calcitonin gene-related peptide knockout and wild-type mice. Both strains of mice were studied at 0, 14, and 21 days after deoxycorticosterone-salt hypertension. Renal sections from hypertensive wild-type mice showed no pathological changes at any time point studied. However, on days 14 and 21, hypertensive knockout mice displayed progressive increases in glomerular proliferation, crescent formation, and tubular protein casts, as well as the inflammatory markers intercellular adhesion molecule-1, vascular adhesion molecule-1, and monocyte chemoattractant protein-1. There was a significant increase in 24-hour urinary isoprostane, a marker of oxidative stress-induced lipid peroxidation, levels at days 14 and 21 in the hypertensive knockout compared with hypertensive wild-type mice. Urinary microalbumin was significantly higher (2-fold) at day 21 and creatinine clearance was significantly decreased 4-fold in the hypertensive knockout compared with hypertensive wild-type mice. Therefore, in the absence of alpha-calcitonin gene-related peptide, deoxycorticosterone-salt hypertension induces enhanced oxidative stress, inflammation, and renal histopathologic damage, resulting in reduced renal function. Thus, sensory nerves, via alpha-calcitonin gene-related peptide, appear to be renoprotective against hypertension-induced damage.

  16. DNA damage and estrogenic activity induced by the environmental pollutant 2-nitrotoluene and its metabolite

    PubMed Central

    Watanabe, Chigusa; Egami, Takashi; Midorikawa, Kaoru; Hiraku, Yusuke; Oikawa, Shinji; Kawanishi, Shosuke


    Objectives The environmental pollutant 2-nitrotoluene (2-NO2-T) is carcinogenic and reproductively toxic in animals. In this study, we elucidated the mechanisms of its carcinogenicity and reproductive toxicity. Methods We examined DNA damage induced by 2-NO2-T and its metabolite, 2-nitrosotoluene (2-NO-T), using 32P-5′-end-labeled DNA. We measured 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA and cellular DNA in cultured human leukemia (HL-60) cells treated with 2-NO2-T and 2-NO-T. 8-Oxoguanine DNA glycosylase (OGG1) gene expression in HL-60 cells was measured by real-time polymerase chain reaction (PCR). We examined estrogenic activity using an E-screen assay and a surface plasmon resonance (SPR) sensor. Results In experiments with isolated DNA fragments, 2-NO-T induced oxidative DNA damage in the presence of Cu (II) and β-nicotinamide adenine dinucleotide disodium salt (reduced form) (NADH), while 2-NO2-T did not. 2-NO-T significantly increased levels of 8-oxodG in HL-60 cells. Real-time polymerase chain reaction (PCR) analysis revealed upregulation of OGG1 gene expression induced by 2-NO-T. An E-screen assay using the human breast cancer cell line MCF-7 revealed that 2-NO2-T induced estrogen-dependent cell proliferation. In contrast, 2-NO-T decreased the cell number and suppressed 17β-estradiol-induced cell proliferation. The data obtained with the SPR sensor using estrogen receptor α and the estrogen response element supported the results of the E-screen assay. Conclusions Oxidative DNA damage caused by 2-NO-T and estrogen-disrupting effects caused by 2-NO2-T and 2-NO-T may play a role in the reproductive toxicity and carcinogenicity of these entities. PMID:21432561

  17. Protection against UVA-induced photooxidative damage in mammalian cell lines expressing increased levels of metallothionein

    SciTech Connect

    Dudek, E.J. Illinois Inst. of Tech., Chicago, IL . Dept. of Biology); Peak, J.G.; Peak, M.J. ); Roth, R.M. . Dept. of Biology)


    Metallothionein (MT) is an endogenous low molecular weight protein that is inducible in a variety of eukaryotic cells and has the ability to selectivity bind heavy metal ions such as zinc and the cadmium. Although the exact physiological role of MT is still not understood, there is strong evidence that MT is involved in providing cellular resistance against the damaging effects of heavy metals and in the regulation of intracellular zinc and copper. Recently, it has been demonstrated that MT can scavenge radiation-induced reactive oxygen intermediates in vitro, specifically hydroxyl and superoxide radicals, and because of these observations it has been suggested that MT may provide protection against radiation-induced oxidative stress in vivo. Cell lines expressing increased levels of MT have demonstrated resistance to ionizing radiation, to ultraviolet radiation, and also to various DNA damaging agents including melphalan and cis-diaminedichloroplatinum. It is therefore important to gain some insight into the relationship between cellular MT content and cellular resistance to radiation and other DNA damaging agents. In this study we investigated the role of MT in providing protection against monochromatic 365-nm UVA radiation, which is known to generate intracellular reactive oxygen species that are involved in both DNA damage and cell killing. For this purpose, we used zinc acetate, a potent inducer of MT, to elevate MT levels in V79 Chinese hamster fibroblasts prior to UVA exposure and determined cell survival for uninduced and induced cultures. In order to eliminate any zinc effects other than MT induction, we also isolated and characterized cadmium chloride-resistant clones of V79 cells that have increased steady-state levels of both MT mRNA and protein, and we examined their survival characteristics against 365-nm radiation in the absence of zinc acetate. 14 refs., 3 figs.

  18. Organophosphates induce distal axonal damage, but not brain oedema, by inactivating neuropathy target esterase

    SciTech Connect

    Read, David J.; Li Yong; Chao, Moses V.; Cavanagh, John B.; Glynn, Paul


    Single doses of organophosphorus compounds (OP) which covalently inhibit neuropathy target esterase (NTE) can induce lower-limb paralysis and distal damage in long nerve axons. Clinical signs of neuropathy are evident 3 weeks post-OP dose in humans, cats and chickens. By contrast, clinical neuropathy in mice following acute dosing with OPs or any other toxic compound has never been reported. Moreover, dosing mice with ethyloctylphosphonofluoridate (EOPF) - an extremely potent NTE inhibitor - causes a different (subacute) neurotoxicity with brain oedema. These observations have raised the possibility that mice are intrinsically resistant to neuropathies induced by acute toxic insult, but may incur brain oedema, rather than distal axonal damage, when NTE is inactivated. Here we provide the first report that hind-limb dysfunction and extensive axonal damage can occur in mice 3 weeks after acute dosing with a toxic compound, bromophenylacetylurea. Three weeks after acutely dosing mice with neuropathic OPs no clinical signs were observed, but distal lesions were present in the longest spinal sensory axons. Similar lesions were evident in undosed nestin-cre:NTEfl/fl mice in which NTE had been genetically-deleted from neural tissue. The extent of OP-induced axonal damage in mice was related to the duration of NTE inactivation and, as reported in chickens, was promoted by post-dosing with phenylmethanesulfonylfluoride. However, phenyldipentylphosphinate, another promoting compound in chickens, itself induced in mice lesions different from the neuropathic OP type. Finally, EOPF induced subacute neurotoxicity with brain oedema in both wild-type and nestin-cre:NTEfl/fl mice indicating that the molecular target for this effect is not neural NTE.

  19. WE-G-BRE-04: Gold Nanoparticle Induced Vasculature Damage for Proton Therapy: Monte Carlo Simulation

    SciTech Connect

    Lin, Y; Paganetti, H; Schuemann, J


    Purpose: The aim of this work is to investigate the gold nanoparticle (GNP) induced vasculature damage in a proton beam. We compared the results using a clinical proton beam, 6MV photon beam and two kilovoltage photon beams. Methods: Monte Carlo simulations were carried out using TOPAS (TOol for PArticle Simulation) to obtain the spatial dose distribution in close proximity to GNPs up to 20μm distance. The spatial dose distribution was used as an input to calculate the additional dose deposited to the blood vessels. For this study, GNP induced vasculature damage is evaluated for three particle sources (proton beam, MV photon beam and kV photon beam), various treatment depths for each particle source, various GNP uptakes and three different vessel diameters (8μm, 14μm and 20μm). Results: The result shows that for kV photon, GNPs induce more dose in the vessel wall for 150kVp photon source than 250kVp. For proton therapy, GNPs cause more dose in the vessel wall at shallower treatment depths. For 6MV photons, GNPs induce more dose in the vessel wall at deeper treatment depths. For the same GNP concentration and prescribed dose, the additional dose at the inner vessel wall is 30% more than the prescribed dose for the kVp photon source, 15% more for the proton source and only 2% more for the 6MV photon source. In addition, the dose from GNPs deceases sharper for proton therapy than kVp photon therapy as the distance from the vessel inner wall increases. Conclusion: We show in this study that GNPs can potentially be used to enhance radiation therapy by causing vasculature damage using clinical proton beams. The GNP induced damage for proton therapy is less than for the kVp photon source but significantly larger than for the clinical MV photon source.

  20. Hard-Mask-Through UV-Light-Induced Damage to Low-k Film during Plasma Process for Dual Damascene

    NASA Astrophysics Data System (ADS)

    Noriaki Matsunaga,; Hirokatsu Okumura,; Butsurin Jinnai,; Seiji Samukawa,


    Plasma irradiation impact on a SiO2-hardmask/SiOCH low-k film stacked structure was investigated in detail. The plasma irradiation induces damage to the low-k film although it is covered by a hard mask. The hard-mask-through UV-light-induced damage showed plasma source gas dependence. The damage is determined by the UV light wavelength and photon energy. It was also found that a high substrate temperature accelerates the hard-mask-through UV-light-induced damage. The hard-mask-through UV-light-induced damage was hardly seen for the hard masks thicker than 115 nm in the O2-irradiation experiment. Conversely, an actual SiO2 film deposition process by plasma-enhanced chemical vapor deposition (PE-CVD) induces damage during deposition. The PE-CVD process induces heavier damage to the low-k film than the O2-plasma experiment. Higher process temperature accelerates the hard-mask-through UV-light-induced damage in the hard mask SiO2 deposition process.

  1. The production and repair of aflatoxin B sub 1 -induced DNA damage

    SciTech Connect

    Leadon, S.A.


    To investigate the influence of function or activity of a DNA sequence on its repair, we have studied excision repair of aflatoxin B{sub 1} (AFB{sub 1})-induced damage in the nontranscribed, heterochromatic alpha DNA of monkey cells and in the metallothionein genes of human cells. In confluent cells, AFB{sub 1} adducts are produced in similar frequencies in alpha and in the rest of the DNA, but removal from alpha DNA is severely deficient, however, removal of AFB{sub 1} adducts from alpha DNA is enhanced by small doses of UV. The repair deficiencies are not observed in actively growing cells. We have also shown that there is preferential repair of AFB{sub 1} damage in active genes. AFB{sub 1} damage is efficiently repaired in the active human metallothionein (hMT) genes, but deficiently repaired in inactive hMT genes. 51 refs., 3 tabs.

  2. A Robust Damage-Reporting Strategy for Polymeric Materials Enabled by Aggregation-Induced Emission

    PubMed Central


    Microscopic damage inevitably leads to failure in polymers and composite materials, but it is difficult to detect without the aid of specialized equipment. The ability to enhance the detection of small-scale damage prior to catastrophic material failure is important for improving the safety and reliability of critical engineering components, while simultaneously reducing life cycle costs associated with regular maintenance and inspection. Here, we demonstrate a simple, robust, and sensitive fluorescence-based approach for autonomous detection of damage in polymeric materials and composites enabled by aggregation-induced emission (AIE). This simple, yet powerful system relies on a single active component, and the general mechanism delivers outstanding performance in a wide variety of materials with diverse chemical and mechanical properties. PMID:27725956

  3. Plant Nuclei Move to Escape Ultraviolet-Induced DNA Damage and Cell Death.


    Iwabuchi, Kosei; Hidema, Jun; Tamura, Kentaro; Takagi, Shingo; Hara-Nishimura, Ikuko


    A striking feature of plant nuclei is their light-dependent movement. In Arabidopsis (Arabidopsis thaliana) leaf mesophyll cells, the nuclei move to the side walls of cells within 1 to 3 h after blue-light reception, although the reason is unknown. Here, we show that the nuclear movement is a rapid and effective strategy to avoid ultraviolet B (UVB)-induced damages. Mesophyll nuclei were positioned on the cell bottom in the dark, but sudden exposure of these cells to UVB caused severe DNA damage and cell death. The damage was remarkably reduced in both blue-light-treated leaves and mutant leaves defective in the actin cytoskeleton. Intriguingly, in plants grown under high-light conditions, the mesophyll nuclei remained on the side walls even in the dark. These results suggest that plants have two strategies for reducing UVB exposure: rapid nuclear movement against acute exposure and nuclear anchoring against chronic exposure.

  4. A Robust Damage-Reporting Strategy for Polymeric Materials Enabled by Aggregation-Induced Emission.


    Robb, Maxwell J; Li, Wenle; Gergely, Ryan C R; Matthews, Christopher C; White, Scott R; Sottos, Nancy R; Moore, Jeffrey S


    Microscopic damage inevitably leads to failure in polymers and composite materials, but it is difficult to detect without the aid of specialized equipment. The ability to enhance the detection of small-scale damage prior to catastrophic material failure is important for improving the safety and reliability of critical engineering components, while simultaneously reducing life cycle costs associated with regular maintenance and inspection. Here, we demonstrate a simple, robust, and sensitive fluorescence-based approach for autonomous detection of damage in polymeric materials and composites enabled by aggregation-induced emission (AIE). This simple, yet powerful system relies on a single active component, and the general mechanism delivers outstanding performance in a wide variety of materials with diverse chemical and mechanical properties.

  5. Correlation of Laser-Induced Damage to Phase Objects in Bulk Fused Silica

    SciTech Connect

    Nostrand, M C; Cerjan, C J; Johnson, M A; Suratwala, T I; Weiland, T L; Sell, W D; Vickers, J L; Luthi, R L; Stanley, J R; Parham, T G; Thorsness, C B


    The Optical Sciences Laser (OSL) Upgrade facility, described in last year's proceedings, is a kJ-class, large aperture (100cm{sup 2}) laser system that can accommodate prototype optical components for large-scale inertial confinement fusion lasers. High-energy operation of such lasers is often limited by damage to the optical components. Recent experiments on the OSL Upgrade facility using fused silica components at 4 J/cm{sup 2} (351-nm, 3-ns) have created output surface and bulk damage sites that have been correlated to phase objects in the bulk of the material. Optical Path Difference (OPD) measurements of the phase defects indicate the probability of laser-induced damage is strongly dependent on OPD.

  6. Insulin inhibits AMPA-induced neuronal damage via stimulation of protein kinase B (Akt).


    Kim, S-J; Han, Y


    We designed a series of experiments to explore the neuroprotective effects of insulin. Insulin significantly inhibited the alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-induced neuronal cell damage as evidenced by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-bromide (MTT) assay. However, insulin had little affect on the AMPA-induced glial cell damage. To determine whether insulin inhibits AMPA-induced excitotoxicity, we performed grease-gap recording assays using rat brain slices. In these experiments, insulin also significantly inhibited AMPA-induced depolarization. Flow cytometry and DNA fragmentation assays showed that insulin inhibits AMPA-induced apoptosis and DNA fragmentation, respectively. Insulin stimulated protein kinase B (Akt) activity, whereas AMPA pretreatment did not alter the insulin-stimulated Akt activity. On the contrary, insulin blocked induction of SAPK/JNK, which AMPA stimulated. Taken together, these results suggest that insulin exerts neuroprotective effects by inhibiting AMPA-induced excitotoxicity and apoptosis, possibly by activating Akt and blocking SAPK/JNK.

  7. Oats supplementation prevents alcohol-induced gut leakiness in rats by preventing alcohol-induced oxidative tissue damage.


    Tang, Yueming; Forsyth, Christopher B; Banan, Ali; Fields, Jeremy Z; Keshavarzian, Ali


    We reported previously that oats supplementation prevents gut leakiness and alcoholic steatohepatitis (ASH) in our rat model of alcoholic liver disease. Because oxidative stress is implicated in the pathogenesis of both alcohol-induced gut leakiness and ASH, and because oats have antioxidant properties, we tested the hypothesis that oats protect by preventing alcohol-induced oxidative damage to the intestine. Male Sprague-Dawley rats were gavaged for 12 weeks with alcohol (starting dose of 1 g/kg increasing to 6 g/kg/day over the first 2 weeks) or dextrose, with or without oats supplementation (10 g/kg/day). Oxidative stress and injury were assessed by measuring colonic mucosal inducible nitric-oxide synthase (iNOS) (by immunohistochemistry), nitric oxide (colorimetric assay), and protein carbonylation and nitrotyrosination (immunoblotting). Colonic barrier integrity was determined by assessing the integrity of the actin cytoskeleton (immunohistochemistry) and the integrity of tight junctions (electron microscopy). Oats supplementation prevented alcohol-induced up-regulation of iNOS, nitric oxide overproduction in the colonic mucosa, and increases in protein carbonyl and nitrotyrosine levels. This protection was associated with prevention of ethanol (EtOH)-induced disorganization of the actin cytoskeleton and disruption of tight junctions. We conclude that oats supplementation attenuates EtOH-induced disruption of intestinal barrier integrity, at least in part, by inhibiting EtOH-induced increases in oxidative stress and oxidative tissue damage. This inhibition prevents alcohol-induced disruption of the cytoskeleton and tight junctions. This study suggests that oats may be a useful therapeutic agent--a nutraceutical--for the prevention of alcohol-induced oxidative stress and organ dysfunction.

  8. Laser-induced bulk damage of silica glass at 355nm and 266nm

    NASA Astrophysics Data System (ADS)

    Kashiwagi, R.; Aramomi, S.


    Laser processing machines using Nd:YAG 3rd harmonic wave (355 nm) and 4th harmonic wave (266 nm) have been developed and put into practical use lately. Due to this, optical elements with high laser durability to 355 nm and 266 nm are required. Silica glass is the optical element which has high UV transmission and high laser durability. Laser-induced surface damage of the silica glass has been studied in detail, but we hardly have the significant knowledge of laserinduced bulk damage. This knowledge is required in order to evaluate the silica glass itself. That is because cracks and scratches on the surface give rise to a higher possibility of damage. Therefore, we studied the laser durability of a variety of the silica glass samples by 1-on-1 and S-on-1 laser-induced bulk damage threshold (LIDT) at 355 nm and 266 nm. In this study, we gained knowledge in three areas about bulk damage to the silica glass. First, the LIDT became lower as shot counts increased. Second, the LIDT decreased as the hydroxyl content in the silica glass increased. Last, the LIDT became higher as the hydrogen concentration in the silica glass increased. Under the UV irradiation, impurities are generated and the silica glass absorbs more light. Therefore, the LIDT decreased as shot counts increased. Also, the hydroxyl in particular generates more impurities, so damage easily occurs. On the other hand, the hydrogen reacts with impurities and absorption is suppressed. Based on these results, we can improve laser durability at 355 nm and 266 nm by reducing the hydroxyl content and increasing the hydrogen concentration in the silica glass.

  9. Gravity-induced rock mass damage related to large en masse rockslides: Evidence from Vajont

    NASA Astrophysics Data System (ADS)

    Paronuzzi, Paolo; Bolla, Alberto


    The Vajont landslide is a well-known, reservoir-induced slope failure that occurred on 9 October 1963 and was characterized by an 'en masse' sliding motion that triggered various large waves, determining catastrophic consequences for the nearby territory and adjacent villages. During the Vajont dam construction, and especially after the disaster, some researchers identified widespread field evidence of heavy rock mass damage involving the presumed prehistoric rockslide and/or the 1963 failed mass. This paper describes evidence of heavy gravitational damage, including (i) folding, (ii) fracturing, (iii) faulting, and (iv) intact rock disintegration. The gravity-induced rock mass damage (GRMD) characterizes the remnants of the basal shear zone, still resting on the large detachment surface, and the 1963 failed rock mass. The comprehensive geological study of the 1963 Vajont landslide, based on the recently performed geomechanical survey (2006-present) and on the critical analysis of the past photographic documentation (1959-1964), allows us to recognize that most GRMD evidence is related to the prehistoric multistage Mt. Toc rockslide. The 1963 catastrophic en masse remobilization induced an increase to the prehistoric damage, reworking preexisting structures and creating additional gravity-driven features (folds, fractures, faults, and rock fragmentation). The gravity-induced damage was formed during the slope instability phases that preceded the collapse (static or quasi-static GRMD) and also as a consequence of the sliding motion and of the devastating impact between the failed blocks (dynamic GRMD). Gravitational damage originated various types of small drag folds such as flexures, concentric folds, chevron, and kink-box folds, all having a radius of 1-5 m. Large buckle folds (radius of 10-50 m) are related to the dynamic damage and were formed during the en masse motion as a consequence of deceleration and impact processes that involved the sliding mass. Prior

  10. Process-induced damage evolution and management in resin transfer molding of composite panels

    NASA Astrophysics Data System (ADS)

    Kuan, Yean-Der


    Woven fiber composites made by resin transfer molding process are currently used as the primary and secondary load bearing structures in automotive and aircraft industries. A variety of defects could be evolved during the injection stage and the curing stage of the process. Improper injection conditions or unsound tool design would result in process induced damage in the form of dry spots, incomplete filling, or displacement of the fiber. In the curing stage, the process parameters of heating and cooling rates, and the temperature level at each element of the curing cycle have direct effects on the development of internal residual stresses, and shape distortion due to warpage. The work in this dissertation aims at developing numerical models to predict, characterize, and minimize process-induced