Detection of human papilloma virus 16 and 18 DNA sequences by southern blot hybridization in oral leukoplakia and squamous cell carcinoma.

PubMed

Khanna, Rahul; Rao, G R K; Tiwary, S K; Rai, Ashish; Khanna, Seema; Khanna, A K

2009-04-01

The etiopathological role of human papilloma virus (HPV) in the causation of oral cancer is till a subject of speculation. We used the technique of Southern blot hybridization to detect the presence of HPV types 16 & 18 in biopsy specimens from oral cancer and leukoplakia patients as well as normal oral mucosal biopsies. The prevalence of either HPV type 16 or 18 was found in 64.5% (29/45) of oral cancer, 40%(12/30) of leukoplakia and 20%(9/45) of normal oral mucosal biopsies. No association could be demonstrated between tobacco usage habits or a history of genital warts with HPV prevalence. A significant finding was that none of the oral cancer patients were negative for both: a history of tobacco usage as well as presence of HPV infection, on Southern blot hybridization.

Correlation of Leukocyte Telomere Length Measurement Methods in Patients with Dyskeratosis Congenita and in Their Unaffected Relatives.

PubMed

Khincha, Payal P; Dagnall, Casey L; Hicks, Belynda; Jones, Kristine; Aviv, Abraham; Kimura, Masayuki; Katki, Hormuzd; Aubert, Geraldine; Giri, Neelam; Alter, Blanche P; Savage, Sharon A; Gadalla, Shahinaz M

2017-08-13

Several methods have been employed to measure telomere length (TL) in human studies. It has been difficult to directly compare the results from these studies because of differences in the laboratory techniques and output parameters. We compared TL measurements (TLMs) by the three most commonly used methods, quantitative polymerase chain reaction (qPCR), flow cytometry with fluorescence in situ hybridization (flow FISH) and Southern blot, in a cohort of patients with the telomere biology disorder dyskeratosis congenita (DC) and in their unaffected relatives (controls). We observed a strong correlation between the Southern blot average TL and the flow FISH total lymphocyte TL in both the DC patients and their unaffected relatives ( R ² of 0.68 and 0.73, respectively). The correlation between the qPCR average TL and that of the Southern blot method was modest ( R ² of 0.54 in DC patients and of 0.43 in unaffected relatives). Similar results were noted when comparing the qPCR average TL and the flow FISH total lymphocyte TL ( R ² of 0.49 in DC patients and of 0.42 in unaffected relatives). In conclusion, the strengths of the correlations between the three widely used TL assays (qPCR, flow FISH, and Southern blot) were significantly different. Careful consideration is warranted when selecting the method of TL measurement for research and for clinical studies.

Transfer of a Mycobacterium tuberculosis Genotyping Method, Spoligotyping, from a Reverse Line-Blot Hybridization, Membrane-Based Assay to the Luminex Multianalyte Profiling System

PubMed Central

Cowan, Lauren S.; Diem, Lois; Brake, Mary Catherine; Crawford, Jack T.

2004-01-01

Spoligotyping using Luminex technology was shown to be a highly reproducible method suitable for high-throughput analysis. Spoligotyping of 48 isolates using the traditional membrane-based assay and the Luminex assay yielded concordant results for all isolates. The Luminex platform provides greater flexibility and cost effectiveness than the membrane-based assay. PMID:14715809

Problem-solving test: Southwestern blotting.

PubMed

Szeberényi, József

2014-01-01

Terms to be familiar with before you start to solve the test: Southern blotting, Western blotting, restriction endonucleases, agarose gel electrophoresis, nitrocellulose filter, molecular hybridization, polyacrylamide gel electrophoresis, proto-oncogene, c-abl, Src-homology domains, tyrosine protein kinase, nuclear localization signal, cDNA, deletion mutants, expression plasmid, transfection, RNA polymerase II, promoter, Shine-Dalgarno sequence, polyadenylation element, affinity chromatography, Northern blotting, immunoprecipitation, sodium dodecylsulfate, autoradiography, tandem repeats. Copyright © 2014 The International Union of Biochemistry and Molecular Biology.

Distribution of a macaque immunosuppressive type D retrovirus in neural, lymphoid, and salivary tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lackner, A.A.; Rodriguez, M.H.; Bush, C.E.

1988-06-01

Simian acquired immune deficiency syndrome (SAIDS) in rhesus macaques (Macaca mulatta) at the California Primate Research Center is caused by a type D retrovirus designated SAIDS retrovirus serotype 1 (SRV-1). This syndrome is characterized by profound immunosuppression and death associated with opportunistic infections. Neurologic signs and lesions have not been described as part of this syndrome. The distribution of SRV-1 in the salivary glands, lymph nodes, spleens, thymuses, and brains of eight virus-infected rhesus macaques was examined by immunohistochemistry. Electron microscopy, in situ RNA hybridization, and Southern blot hybridization were also performed on selected tissues to detect viral particles, RNA,more » and DNA, respectively. In seven of eight SRV-1-infected animals, the transmembrane envelope glycoprotein (gp20) of SRV-1 was present in three or more tissues, but never in the brain. In the remaining animal, no viral antigen was detected in any tissue. In this same group of animals, viral nucleic acid was detected in the lymph nodes of six of six animals by Southern blot hybridization, in the salivary glands of two of five animals by both Southern blot and in situ hybridizations, and, surprisingly, in the brains of three of three animals by Southern blot and of three of five animals by in situ hybridization, including the one animal in which viral gp20 was undetectable. None of these animals had neurologic signs or lesions. The detection of viral nucleic acid in the absence of viral antigen in the brain suggests latent SRV-1 infection of the central nervous system.« less

Southern blotting.

PubMed

Brown, T

2001-05-01

Southern blotting is the transfer of DNA fragments from an electrophoresis gel to a membrane support, resulting in immobilization of the DNA fragments, so the membrane carries a semipermanent reproduction of the banding pattern of the gel. After immobilization, the DNA can be subjected to hybridization analysis, enabling bands with sequence similarity to a labeled probe to be identified. This unit describes Southern blotting via upward capillary transfer of DNA from an agarose gel onto a nylon or nitrocellulose membrane, and subsequent immobilization by UV irradiation (for nylon) or baking (for nitrocellulose). A Support Protocol describes how to calibrate a UV transilluminator for optimal UV irradiation of a nylon membrane. An alternate protocol details transfer using nylon membranes and an alkaline buffer, and is primarily used with positively charged nylon membranes. A second alternate protocol describes a transfer method based on a different transfer-stack setup. The traditional method of upward capillary transfer of DNA from gel to membrane has certain disadvantages, notably the fact that the gel can become crushed by the weighted filter papers and paper towels that are laid on top of it. This slows down the blotting process and may reduce the amount of DNA that can be transferred. The downward capillary method described in the second alternate protocol is therefore more rapid and can result in more complete transfer.

A rapid and sensitive dot-blot hybridization assay for the detection of citrus exocortis viroid in Citrus medica with digoxigenin-labelled RNA probes.

PubMed

Fonseca, M E; Marcellino, L H; Gander, E

1996-04-05

A rapid and sensitive dot-blot hybridization assay using in vitro-transcribed digoxigenin-labelled RNA probes (riboprobes) was developed aiming at detection of citrus exocortis viroid (CEVd) in crude sap of infected Citrus medica plants. The protocol includes a very quick and simple preparation of RNA extracts from samples using a denaturation step with formaldehyde. From our results, the employment of this step is highly recommended because the hybridization signals in formaldehyde-denatured samples were significantly stronger when compared with that of extracts without formaldehyde treatment. The assay was found to be sensitive enough to detect 0.1 ng of purified CEVd RNA and was able to detect viroid in 0.2 mg of symptomatic Citrus medica leaves. The use of riboprobes also allowed hybridization under high temperature conditions, avoiding non-specific background.

Detection and quantitation of HER-2/neu gene amplification in human breast cancer archival material using fluorescence in situ hybridization.

PubMed

Pauletti, G; Godolphin, W; Press, M F; Slamon, D J

1996-07-04

Amplification and overexpression of the HER-2/neu gene occurs in 25-30% of human breast cancers. This genetic alteration is associated with a poor clinical prognosis in women with either node negative or node positive breast cancers. The initial studies testing this association were somewhat controversial and this controversy was due in large part to significant heterogeneity in both the methods and/or reagents used in testing archival material for the presence of the alteration. These methods included a number of solid matrix blotting techniques for DNA, RNA and protein as well as immunohistochemistry. Fluorescence in situ hybridization (FISH) represents the newest methodologic approach for testing for this genetic alteration. In this study, FISH is compared to Southern, Northern and Western blot analyses as well as immunohistochemistry in a large cohort of archival human breast cancer specimens. FISH was found to be superior to all other methodologies tested in assessing formalin fixed, paraffin embedded material for HER-2/neu amplification. The results from this study also confirm that overexpression of HER-2/neu rarely occurs in the absence of gene amplification in breast cancer (approximately 3% of cases). This method of analysis is rapid, reproducible and extremely reliable in detecting presence of HER-2/neu gene amplification and should have clinical utility.

Correction to: Generation and characterization of tissue-type plasminogen activator transgenic rats.

PubMed

Ito, Yusuke; Noguchi, Kengo; Morishima, Yoshiyuki; Yamaguchi, Kyoji

2018-01-01

In the original publication of the article, the sentence in "Result" section have been incorrectly published as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and itansgene) and 4.4 kb (endogenous gene) reding appearance, body weight, hematology, and systematization." The corrected sentence should read as: "Three lines of tPA Tg rats were generated and analyzed by Southern blotting to confirm the presence of the transgene in genomic DNA. When rat DNA was digested with EcoRI and hybridized to the tPA probe described in "Materials and methods", a 1.0 kb band was detected (Fig. 1a, b). One founder line was selected because of its high copy number (about ten copies) of tPA gene and its lack of detectable abnormal findings, including appearance, body weight, hematology, and systematization." The original article has been corrected.

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, R.B.; Kimball, A.W.; Gesteland, R.F.; Ferguson, F.M.; Dunn, D.M.; Di Sera, L.J.; Cherry, J.L.

1995-11-28

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, the enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots. 9 figs.

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, Robert B.; Kimball, Alvin W.; Gesteland, Raymond F.; Ferguson, F. Mark; Dunn, Diane M.; Di Sera, Leonard J.; Cherry, Joshua L.

1995-01-01

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, then an enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots.

Detection and quantification of Epstein-Barr virus EBER1 in EBV-infected cells by fluorescent in situ hybridization and flow cytometry

NASA Technical Reports Server (NTRS)

Stowe, R. P.; Cubbage, M. L.; Sams, C. F.; Pierson, D. L.; Barrett, A. D.

1998-01-01

A rapid and highly sensitive fluorescent in situ hybridization (FISH) assay was developed to detect Epstein Barr virus (EBV)-infected cells in peripheral blood. Multiple fluorescein-labeled antisense oligonucleotide probes were designed to hybridize to the EBER1 transcript, which is highly expressed in latently infected cells. After a rapid (30 min) hybridization, the cells were analyzed by flow cytometry. EBER1 was detected in several positive control cell lines that have variable numbers of EBV genome copies. No EBER1 was detected in two known EBV-negative cell lines. Northern blot analyses confirmed the presence and quantity of EBER1 transcripts in each cell line. This method was used to quantify the number of EBV-infected cells in peripheral blood from a patient with chronic mononucleosis. These results indicate that EBV-infected cells can be detected at the single cell level, and that this assay can be used to quantify the number of EBV-infected cells in clinical samples.

Southern blotting.

PubMed

Brown, T

2001-05-01

Southern blotting is the transfer of DNA fragments from an electrophoresis gel to a membrane support (the properties and advantages of the different types of membrane, transfer buffer, and transfer method are discussed in detail), resulting in immobilization of the DNA fragments, so the membrane carries a semipermanent reproduction of the banding pattern of the gel. After immobilization, the DNA can be subjected to hybridization analysis, enabling bands with sequence similarity to a labeled probe to be identified. This appendix describes Southern blotting via upward capillary transfer of DNA from an agarose gel onto a nylon or nitrocellulose membrane, using a high-salt transfer buffer to promote binding of DNA to the membrane. With the high-salt buffer, the DNA becomes bound to the membrane during transfer but not permanently immobilized. Immobilization is achieved by UV irradiation (for nylon) or baking (for nitrocellulose). A Support Protocol describes how to calibrate a UV transilluminator for optimal UV irradiation of a nylon membrane. An alternate protocol details transfer using nylon membranes and an alkaline buffer, and is primarily used with positively charged nylon membranes. The advantage of this combination is that no post-transfer immobilization step is required, as the positively charged membrane binds DNA irreversibly under alkaline transfer conditions. The method can also be used with neutral nylon membranes but less DNA will be retained. A second alternate protocol describes a transfer method based on a different transfer-stack setup. The traditional method of upward capillary transfer of DNA from gel to membrane described in the first basic and alternate protocols has certain disadvantages, notably the fact that the gel can become crushed by the weighted filter papers and paper towels that are laid on top of it. This slows down the blotting process and may reduce the amount of DNA that can be transferred. The downward capillary method described in the second alternate protocol is therefore more rapid than the basic protocol and can result in more complete transfer. Although the ease and reliability of capillary transfer methods makes this far and away the most popular system for Southern blotting with agarose gels, it unfortunately does not work with polyacrylamide gels, whose smaller pore size impedes the transverse movement of the DNA molecules. The third alternate protocol describes an electroblotting procedure that is currently the most reliable method for transfer of DNA from a polyacrylamide gel. Dot and slot blotting are also described.

Detection and genotyping of human papilloma virus in cervical cancer specimens from Saudi patients.

PubMed

Al-Badawi, Ismail A; Al-Suwaine, Abdulrahman; Al-Aker, Murad; Asaad, Lina; Alaidan, Alwaleed; Tulbah, Asma; Fe Bohol, Marie; Munkarah, Adnan R

2011-07-01

To determine the rates and types of human papilloma virus (HPV) infection in cervical cancer specimens from Saudi patients. One hundred specimens were randomly selected and retrieved from the achieved samples stored in the pathology department accessioned under the diagnosis of cervical cancer and carcinoma in situ between the years 1997 and 2007. Human papilloma virus in the clinical samples was detected using polymerase chain reaction amplification methods. Two primer systems are commonly used: the MY09-MY11 primers and the GP5+-GP6+ that amplify a wide range of HPV genotypes. Human papilloma virus isolates were genotyped using DNA sequencing and reverse line blot hybridization assay to identify the high-risk HPV genotypes. Ninety cases fulfilled the diagnostic criteria and were analyzed. The rate of HPV genotype detection among cervical cancer samples was 95.5%. The most common HPV genotype detected by both methods was HPV-16 (63.4%), followed by HPV-18 (11.1%), HPV-45 (4.5%), HPV-33 (3.3%), and HPV-31, HPV-52, HPV-53, HPV-58, HPV-59, and HPV-66 with 2.2% prevalence rate each. Prevalence of HPV genotypes among patients with cervical cancer in Saudi Arabia is comparable to the international rates. The use of the reverse line blot hybridization assay genotyping method could be useful for classifying oncogenic HPV-positive women. It is relatively inexpensive and reliable and can be performed in routine practice or epidemiological study compared with the available standard commercial kits.

DNA probe for lactobacillus delbrueckii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delley, M.; Mollet, B.; Hottinger, H.

1990-06-01

From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an {alpha}-{sup 32}P-labeled probe.

DNA Probe for Lactobacillus delbrueckii

PubMed Central

Delley, Michèle; Mollet, Beat; Hottinger, Herbert

1990-01-01

From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognizes L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an α-32P-labeled DNA probe. Images PMID:16348233

The use of field-inversion gel electrophoresis for deletion detection in Duchenne muscular dystrophy.

PubMed Central

Chen, J D; Denton, M J; Morgan, G; Pearn, J H; Mackinlay, A G

1988-01-01

Deletion is a common cause of Duchenne muscular dystrophy (DMD). Field-inversion gel electrophoresis, in conjunction with Southern blot hybridization, was used to detect large SfiI DNA fragments in the DMD locus. Two unrelated boys with DMD were found to have abnormal sized DNA fragments resulting from deletions. Some of the female relatives of these patients were also shown by this method to have deletions in the DMD locus. Images Figure 1 PMID:3358426

Compositions and methods for detecting gene rearrangements and translocations

DOEpatents

Rowley, Janet D.; Diaz, Manuel O.

2000-01-01

Disclosed is a series of nucleic acid probes for use in diagnosing and monitoring certain types of leukemia using, e.g., Southern and Northern blot analyses and fluorescence in situ hybridization (FISH). These probes detect rearrangements, such as translocations involving chromosome band 11q23 with other chromosomes bands, including 4q21, 6q27, 9p22, 19p13.3, in both dividing leukemic cells and interphase nuclei. The breakpoints in all such translocations are clustered within an 8.3 kb BamHI genomic region of the MLL gene. A novel 0.7 kb BamH1 cDNA fragment derived from this gene detects rearrangements on Southern blot analysis with a single BamHI restriction digest in all patients with the common 11q23 translocations and in patients with other 11q23 anomalies. Northern blot analyses are presented demonstrating that the MLL gene has multiple transcripts and that transcript size differentiates leukemic cells from normal cells. Also disclosed are MLL fusion proteins, MLL protein domains and anti-MLL antibodies.

Microwell hybridization assay for detection of PCR products from Mycobacterium tuberculosis complex and the recombinant Mycobacterium smegmatis strain 1008 used as an internal control.

PubMed Central

Kox, L F; Noordhoek, G T; Kunakorn, M; Mulder, S; Sterrenburg, M; Kolk, A H

1996-01-01

A microwell hybridization assay was developed for the detection of the PCR products from both Mycobacterium tuberculosis complex bacteria and the recombinant Mycobacterium smegmatis strain 1008 that is used as an internal control to monitor inhibition in the PCR based on the M. tuberculosis complex-specific insertion sequence IS6110. The test is based on specific detection with digoxigenin-labeled oligonucleotide probes of biotinylated PCR products which are captured in a microtiter plate coated with streptavidin. The captured PCR products are hybridized separately with two probes, one specific for the PCR product from IS6110 from M. tuberculosis complex and the other specific for the PCR fragment from the modified IS6110 fragment from the recombinant M. smegmatis 1008. The microwell hybridization assay discriminates perfectly between the two types of amplicon. The amount of PCR product that can be detected by this assay is 10 times less than that which can be detected by agarose gel electrophoresis. The test can be performed in 2 h. It is much faster and less laborious than Southern blot hybridization. Furthermore, the interpretation of results is objective. The assay was used with 172 clinical samples in a routine microbiology laboratory, and the results were in complete agreement with those of agarose gel electrophoresis and Southern blot hybridization. PMID:8862568

Chromosomal Distribution of Endogenous Jaagsiekte Sheep Retrovirus Proviral Sequences in the Sheep Genome

PubMed Central

Carlson, Jonathan; Lyon, Monique; Bishop, Jeanette; Vaiman, Anne; Cribiu, Edmond; Mornex, Jean-François; Brown, Susan; Knudson, Dennis; DeMartini, James; Leroux, Caroline

2003-01-01

A family of endogenous retroviruses (enJSRV) closely related to Jaagsiekte sheep retrovirus (JSRV) is ubiquitous in domestic and wild sheep and goats. Southern blot hybridization studies indicate that there is little active replication or movement of the enJSRV proviruses in these species. Two approaches were used to investigate the distribution of proviral loci in the sheep genome. Fluorescence in situ hybridization (FISH) to metaphase chromosome spreads using viral DNA probes was used to detect loci on chromosomes. Hybridization signals were reproducibly detected on seven sheep chromosomes and eight goat chromosomes in seven cell lines. In addition, a panel of 30 sheep-hamster hybrid cell lines, each of which carries one or more sheep chromosomes and which collectively contain the whole sheep genome, was examined for enJSRV sequences. DNA from each of the lines was used as a template for PCR with JSRV gag-specific primers. A PCR product was amplified from 27 of the hybrid lines, indicating that JSRV gag sequences are found on at least 15 of the 28 sheep chromosomes, including those identified by FISH. Thus, enJSRV proviruses are essentially randomly distributed among the chromosomes of sheep and goats. FISH and/or Southern blot hybridization on DNA from several of the sheep-hamster hybrid cell lines suggests that loci containing multiple copies of enJSRV are present on chromosomes 6 and 9. The origin and functional significance of these arrays is not known. PMID:12915578

Occurrence of H2-Uptake Hydrogenases in Bradyrhizobium sp. (Lupinus) and Their Expression in Nodules of Lupinus spp. and Ornithopus compressus1

PubMed Central

Murillo, Jesús; Villa, Ana; Chamber, Manuel; Ruiz-Argüeso, Tomás

1989-01-01

Fifty-four strains of Bradyrhizobium sp. (Lupinus) from worldwide collections were screened by a colony hybridization method for the presence of DNA sequences homologous to the structural genes of the Bradyrhizobium japonicum hydrogenase. Twelve strains exhibited strong colony hybridization signals, and subsequent Southern blot hybridization experiments showed that they fell into two different groups on the basis of the pattern of EcoRI fragments containing the homology to the hup probe. All strains in the first group (UPM860, UPM861, and 750) expressed uptake hydrogenase activity in symbiosis with Lupinus albus, Lupinus angustifolius, Lupinus luteus, and Ornithopus compressus, but both the rate of H2 uptake by bacteroids and the relative efficiency of N2 fixation (RE = 1 - [H2 evolved in air/acetylene reduced]) by nodules were markedly affected by the legume host. L. angustifolius was the less permissive host for hydrogenase expression in symbiosis with the three strains (average RE = 0.76), and O. compressus was the more permissive (average RE = 1.0). None of the strains in the second group expressed hydrogenase activity in lupine nodules, and only one exhibited low H2-uptake activity in symbiosis with O. compressus. The inability of these putative Hup+ strains to induce hydrogenase activity in lupine nodules is discussed on the basis of the legume host effect. Among the 42 strains showing no homology to the B. japonicum hup-specific probe in the colony hybridization assay, 10 were examined in symbiosis with L. angustifolius. The average RE for these strains was 0.51. However, one strain, IM43B, exhibited high RE values (higher than 0.80) and high levels of hydrogenase activity in symbiosis with L. angustifolius, L. albus, and L. luteus. In Southern blot hybridization experiments, no homology was detected between the B. japonicum hup-specific DNA probe and total DNA from vegetative cells or bacteroids from strain IM43B even under low stringency hybridization conditions. We conclude from these results that strain IM43B contains hup DNA sequences different from those in B. japonicum and in other lupine rhizobia strains. Images Figure 1 Figure 2 PMID:16666550

Isolation of the human chromosomal band Xq28 within somatic cell hybrids by fragile X site breakage.

PubMed Central

Warren, S T; Knight, S J; Peters, J F; Stayton, C L; Consalez, G G; Zhang, F P

1990-01-01

The chromosomal fragile-site mapping to Xq27.3 is associated with a frequent form of mental retardation and is prone to breakage after induced deoxyribonucleotide pool perturbation. The human hypoxanthine phosphoribosyltransferase (HPRT) and glucose-6-phosphate dehydrogenase (G6PD) genes flank the fragile X chromosome site and can be used to monitor integrity of the site in human-hamster somatic cell hybrids deficient in the rodent forms of these activities. After induction of the fragile X site, negative selection for HPRT and positive enrichment for G6PD resulted in 31 independent colonies of HPRT-,G6PD+ phenotype. Southern blot analysis demonstrated the loss of all tested markers proximal to the fragile X site with retention of all tested human Xq28 loci in a majority of the hybrids. In situ hybridization with a human-specific probe demonstrated the translocation of a small amount of human DNA to rodent chromosomes in these hybrids, suggesting chromosome breakage at the fragile X site and the subsequent translocation of Xq28. Southern blot hybridization of hybrid-cell DNA, resolved by pulsed-field gel electrophoresis, for human-specific repetitive sequences revealed abundant CpG-islands within Xq28, consistent with its known gene density. The electrophoretic banding patterns of human DNA among the hybrids were remarkably consistent, suggesting that fragile X site breakage is limited to a relatively small region in Xq27-28. These somatic cell hybrids, containing Xq27.3-qter as the sole human DNA, will aid the search for DNA associated with the fragile X site and will augment the high resolution genomic analysis of Xq28, including the identification of candidate genes for genetic-disease loci mapping to this region. Images PMID:2339126

Human minisatellite alleles detectable only after PCR amplification.

PubMed

Armour, J A; Crosier, M; Jeffreys, A J

1992-01-01

We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.

Distribution of cholecystokinin mRNA and peptides in the human brain.

PubMed

Lindefors, N; Brené, S; Kopp, J; Lindén, A; Brodin, E; Sedvall, G; Persson, H

1991-01-01

Expression of preprocholecystokinin mRNA was studied in regions of post mortem human brain using RNA blot analysis (Northern blot) and in situ hybridization. Northern blot analysis using a cDNA probe showed high levels of an approximately 0.8 kb preprocholecystokinin mRNA in all regions of neocortex examined. Lower levels of preprocholecystokinin mRNA were detected in amygdaloid body and thalamus. In situ hybridization analysis using the same cDNA probe revealed numerous weakly labelled neurons in different areas of human neocortex and less numerous neurons in hippocampus and amygdaloid body. High-performance liquid-chromatography and gel-chromatography combined with radioimmunoassay of cholecystokinin-like immunoreactivity from human cerebral cortex and caudate nucleus revealed two major forms, one coeluting with sulphated cholecystokinin-8 and the other coeluting with sulphated cholecystokinin-58. Two minor components coeluting with cholecystokinin-4 and cholecystokinin-5 were also detected. The finding of cholecystokinin-like immunoreactivity corresponding to cholecystokinin-8 and cholecystokinin-58 in caudate nucleus where no preprocholecystokinin mRNA was found, indicates the presence of these peptides in afferent nerve terminals.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Whole genomic DNA probe for detection of Porphyromonas endodontalis.

PubMed

Nissan, R; Makkar, S R; Sela, M N; Stevens, R

2000-04-01

The purpose of the present study was to develop a DNA probe for Porphyromonas endodontalis. Pure cultures of P. endodontalis were grown in TYP medium, in an anaerobic chamber. DNA was extracted from the P. endodontalis and labeled using the Genius System by Boehringer Mannheim. The labeled P. endodontalis DNA was used in dot-blot hybridization reactions with homologous (P. endodontalis) and unrelated bacterial samples. To determine specificity, strains of 40 other oral bacterial species (e.g. Porphyromonas gingivalis, Porphyromonas asaccharolytica, and Prevotella intermedia) were spotted and reacted with the P. endodontalis DNA probe. None of the panel of 40 oral bacteria hybridized with the P. endodontalis probe, whereas the blot of the homologous organism showed a strong positive reaction. To determine the sensitivity of the probe, dilutions of a P. endodontalis suspension of known concentration were blotted onto a nylon membrane and reacted with the probe. The results of our investigation indicate that the DNA probe that we have prepared specifically detects only P. endodontalis and can detect at least 3 x 10(4) cells.

Trypanosomatidae: a spliced-leader-derived probe specific for the genus Phytomonas.

PubMed

Teixeira, M M; Serrano, M G; Nunes, L R; Campaner, M; Buck, G A; Camargo, E P

1996-12-01

We probed DNA from all trypanosomatid genera by slot blot hybridization with an oligonucleotide (SL3') complementary to a sequence of the Phytomonas spliced-leader or mini-exon RNA. The 19-nucleotide probe target site was previously shown to be highly conserved among a limited number of Phytomonas isolates, but diverges in other kinetoplastid genera. Our examination of 84 isolates of various genera of trypanosomatids showed hybridization of this probe exclusively with isolates from plants or insects which could, by morphological, biochemical, and molecular criteria, be considered to belong to the genus Phytomonas. In contrast, no hybridization was observed with flagellates of the genera Blastocrithidia, Crithidia, Endotrypanum, Herpetomonas, Leptomonas, Leishmania, and Trypanosoma. The method detected DNA quantities as low as 50 ng using either radioactive or nonradioactive probes, and was effective with as few as 10(4) intact flagellates. Together, these results suggest that this probe will serve as a convenient marker for taxonomic and epidemiological studies requiring reliable identification of Phytomonas spp. in plants or in putative insect vectors.

Anogenital warts contain several distinct species of human papillomavirus.

PubMed Central

Krzyzek, R A; Watts, S L; Anderson, D L; Faras, A J; Pass, F

1980-01-01

Anogenital warts from 26 patients were examined for the presence of human papillomavirus (HPV). Although no whole, intact virus could be identified, varying amounts of nonintegrated HPV DNA were detected in 18 tissue specimens (70%) by employing both an agarose gel-ethidium bromide staining method and the Southern blot hybridization procedure. When hybridization analysis was performed under stringent conditions, six anogenital warts were observed to contain HPV genomic sequences related to either of the cutaneous viruses HPV type 1 (HPV-1) or HPV-2. In 12 tissue samples lacking sequence homology to either HPV-1 or HPV-2 under stringent conditions, HPV-related sequences were detected when the hybridization was performed under less stringent conditions, indicating that an HPV distinct from both HPV-1 and HPV-2 is also associated with these lesions. This anogenital HPV also appeared to be distinct from the other characterized types of HPV. These data indicate that at least three HPVs are associated with anogenital wart disease. Images PMID:6255208

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Application of a reverse dot blot DNA-DNA hydridization method to quantify host-feeding tendencies of two sibling species in the Anopheles gambiae complex.

PubMed

Fritz, M L; Miller, J R; Bayoh, M N; Vulule, J M; Landgraf, J R; Walker, E D

2013-12-01

A DNA-DNA hybridization method, reverse dot blot analysis (RDBA), was used to identify Anopheles gambiae s.s. and Anopheles arabiensis (Diptera: Culicidae) hosts. Of 299 blood-fed and semi-gravid An. gambiae s.l. collected from Kisian, Kenya, 244 individuals were identifiable to species; of these, 69.5% were An. arabiensis and 29.5% were An. gambiae s.s. Host identifications with RDBA were comparable with those of conventional polymerase chain reaction (PCR) followed by direct sequencing of amplicons of the vertebrate mitochondrial cytochrome b gene. Of the 174 amplicon-producing samples used to compare these two methods, 147 were identifiable by direct sequencing and 139 of these were identifiable by RDBA. Anopheles arabiensis bloodmeals were mostly (94.6%) bovine in origin, whereas An. gambiae s.s. fed upon humans more than 91.8% of the time. Tests by RDBA detected that two of 112 An. arabiensis contained blood from more than one host species, whereas PCR and direct sequencing did not. Recent use of insecticide-treated bednets in Kisian is likely to have caused the shift in the dominant vector species from An. gambiae s.s. to An. arabiensis. Reverse dot blot analysis provides an opportunity to study changes in host-feeding by members of the An. gambiae complex in response to the broadening distribution of vector control measures targeting host-selection behaviours. © 2013 The Royal Entomological Society.

Male specific genes from dioecious white campion identified by fluorescent differential display.

PubMed

Scutt, Charles P; Jenkins, Tom; Furuya, Masaki; Gilmartin, Philip M

2002-05-01

Fluorescent differential display (FDD) has been used to screen for cDNAs that are differentially up-regulated in male flowers of the dioecious plant Silene latifolia in which an X/Y chromosome system of sex determination operates. To adapt FDD to the cloning of large numbers of differential cDNAs, a novel method of confirming the differential expression of these has been devised. FDD gels were Southern electro-blotted and probed with mixtures of individual cDNA clones derived from different FDD product ligation reactions. These Southern blots were then stripped and re-probed with further mixtures of individual cloned FDD products to identify the maximum number of recombinant clones carrying the true differential amplification products. Of 135 differential bands identified by FDD, 56 differential amplification products were confirmed; these represent 23 unique differentially expressed genes as determined by virtual Northern analysis and two genes expressed at or below the level of detection by virtual Northern analysis. These two low expressed genes show bands of hybridization on genomic Southern blots that are specific to male plants, indicating that they are derived from, or closely related to, Y chromosome genes.

A single polyprobe for detecting simultaneously eight pospiviroids infecting ornamentals and vegetables.

PubMed

Torchetti, Enza Maria; Navarro, Beatriz; Di Serio, Francesco

2012-12-01

The spread of viroids belonging to the genus Pospiviroid (family Pospiviroidae), recorded recently in ornamentals and vegetables in several European countries, calls for fast, efficient and sensitive detection methods. Based on bioinformatics analyses of sequence identity among all pospiviroids, a digoxigenin-labeled polyprobe (POSPIprobe) was developed that, when tested by dot-blot and Northern-blot hybridization, detected Potato spindle tuber viroid, Citrus exocortis viroid, Columnea latent viroid, Mexican papita viroid, Tomato planta macho viroid, Tomato apical stunt viroid, Pepper chat fruit viroid and Chrysanthemum stunt viroid. The end-point detection limits of the POSPIprobe ranged from 5(-2) to 5(-4), and from 5(-1) to 5(-3) for nucleic acid preparations obtained by phenol extraction and silica-capture, respectively, similar to those of single probes. Based on sequence identity, the POSPIprobe is expected to detect also the two pospiviroid species not tested in this study (Tomato chlorotic dwarf viroid and Iresine viroid-1). Dot-blot assays with the POSPIprobe were validated by testing 68 samples from tomato, chrysanthemum and argyranthemum infected by different pospiviroids as revealed by RT-PCR, thus confirming the potential of this polyprobe for quarantine, certification and survey programs. Copyright © 2012 Elsevier B.V. All rights reserved.

New Method for Simultaneous Species-Specific Identification of Equine Strongyles (Nematoda, Strongylida) by Reverse Line Blot Hybridization▿

PubMed Central

Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.

2007-01-01

The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

NASA Astrophysics Data System (ADS)

Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

2008-03-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

Non-radioactive labeling of RNA transcripts in vitro with the hapten digoxigenin (DIG); hybridization and ELISA-based detection.

PubMed Central

Höltke, H J; Kessler, C

1990-01-01

We have developed a system for the enzymatic in vitro synthesis of non-radioactively labeled RNA which is derivatized with the hapten digoxigenin (DIG). The labeling reaction as well as the conditions for hybridization and detection of hybrids by an antibody-conjugate and a coupled colour reaction were analyzed and adapted for high sensitivity and low background. In addition, data on the performance and sensitivity of digoxigenin-labeled RNA probes in Southern and Northern blots are presented. Images PMID:2216776

A new source of cytoplasmic male sterility in pearl millet: RFLP analysis of mitochondrial DNA.

PubMed

Sujata, V; Sivaramakrishnan, S; Rai, K N; Seetha, K

1994-06-01

A new source of cytoplasmic male sterility (cms) in pearl millet (Pennisetum glaucum (L.) R.Br.) derived from a half-sib progeny of the Early Gene Pool (EGP 261) and used in a male-sterile line, ICMA 90111, was compared with other known cms sources for RFLP of mitochondrial (mt) DNA. Southern blot hybridization of mtDNA from ICMA 90111 digested with several restriction enzymes and probed with homologous mtDNA clones from pearl millet and heterologous gene clones from maize and wheat revealed the RFLP patterns of ICMA 90111 distinct from others studied so far. The dendrogram of male-sterile lines constructed from the Southern blot hybridization patterns indicated that ICMA 90111 represents a separate group. Our results suggest that this source of cms is unique in several respects.

Microarray slide hybridization using fluorescently labeled cDNA.

PubMed

Ares, Manuel

2014-01-01

Microarray hybridization is used to determine the amount and genomic origins of RNA molecules in an experimental sample. Unlabeled probe sequences for each gene or gene region are printed in an array on the surface of a slide, and fluorescently labeled cDNA derived from the RNA target is hybridized to it. This protocol describes a blocking and hybridization protocol for microarray slides. The blocking step is particular to the chemistry of "CodeLink" slides, but it serves to remind us that almost every kind of microarray has a treatment step that occurs after printing but before hybridization. We recommend making sure of the precise treatment necessary for the particular chemistry used in the slides to be hybridized because the attachment chemistries differ significantly. Hybridization is similar to northern or Southern blots, but on a much smaller scale.

A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

PubMed

Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

2017-01-01

An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

Experimental Methods for Protein Interaction Identification and Characterization

NASA Astrophysics Data System (ADS)

Uetz, Peter; Titz, Björn; Cagney, Gerard

There are dozens of methods for the detection of protein-protein interactions but they fall into a few broad categories. Fragment complementation assays such as the yeast two-hybrid (Y2H) system are based on split proteins that are functionally reconstituted by fusions of interacting proteins. Biophysical methods include structure determination and mass spectrometric (MS) identification of proteins in complexes. Biochemical methods include methods such as far western blotting and peptide arrays. Only the Y2H and protein complex purification combined with MS have been used on a larger scale. Due to the lack of data it is still difficult to compare these methods with respect to their efficiency and error rates. Current data does not favor any particular method and thus multiple experimental approaches are necessary to maximally cover the interactome of any target cell or organism.

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

Rapid detection of rifampin-resistant clinical isolates of Mycobacterium tuberculosis by reverse dot blot hybridization.

PubMed

Guo, Qian; Yu, Yan; Zhu, Yan Ling; Zhao, Xiu Qin; Liu, Zhi Guang; Zhang, Yuan Yuan; Li, Gui Lian; Wei, Jian Hao; Wu, Yi Mou; Wan, Kang Lin

2015-01-01

A PCR-reverse dot blot hybridization (RDBH) assay was developed for rapid detection of rpoB gene mutations in 'hot mutation region' of Mycobacterium tuberculosis (M. tuberculosis). 12 oligonucleotide probes based on the wild-type and mutant genotype rpoB sequences of M. tuberculosis were designed to screen the most frequent wild-type and mutant genotypes for diagnosing RIF resistance. 300 M. tuberculosis clinical isolates were detected by RDBH, conventional drug-susceptibility testing (DST) and DNA sequencing to evaluate the RDBH assay. The sensitivity and specificity of the RDBH assay were 91.2% (165/181) and 98.3% (117/119), respectively, as compared to DST. When compared with DNA sequencing, the accuracy, positive predictive value (PPV) and negative predictive value (NPV) of the RDBH assay were 97.7% (293/300), 98.2% (164/167), and 97.0% (129/133), respectively. Furthermore, the results indicated that the most common mutations were in codons 531 (48.6%), 526 (25.4%), 516 (8.8%), and 511 (6.6%), and the combinative mutation rate was 15 (8.3%). One and two strains of insertion and deletion were found among all strains, respectively. Our findings demonstrate that the RDBH assay is a rapid, simple and sensitive method for diagnosing RIF-resistant tuberculosis. Copyright © 2015 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

The hydrophobic repeated domain of the Clostridium cellulovorans cellulose-binding protein (CbpA) has specific interactions with endoglucanases.

PubMed Central

Takagi, M; Hashida, S; Goldstein, M A; Doi, R H

1993-01-01

We overexpressed one of the hydrophobic repeated domains (HBDs) (110 amino acid residues) of the cellulose-binding protein (CbpA) from Clostridium cellulovorans by making a hybrid protein with the Escherichia coli maltose-binding protein (MalE). The HBD was purified to homogeneity, and interactions between the HBD and endoglucanases were analyzed by a novel interaction Western blotting (immunoblotting) method. The HBD had specific interactions with endoglucanases (EngB and EngD) from C. cellulovorans. These results indicated that the HBD was an endoglucanase binding site of CbpA. Images PMID:8226657

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

PubMed

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-09-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

Conservation of the fourth gene among rotaviruses recovered from asymptomatic newborn infants and its possible role in attenuation.

PubMed Central

Flores, J; Midthun, K; Hoshino, Y; Green, K; Gorziglia, M; Kapikian, A Z; Chanock, R M

1986-01-01

RNA-RNA hybridization was performed to assess the extent of genetic relatedness among human rotaviruses isolated from children with gastroenteritis and from asymptomatic newborn infants. 32P-labeled single-stranded RNAs produced by in vitro transcription from viral cores of the different strains tested were used as probes in two different hybridization assays: undenatured genomic RNAs were resolved by polyacrylamide gel electrophoresis, denatured in situ, electrophoretically transferred to diazobenzyloxymethyl-paper (Northern blots), and then hybridized to the probes under two different conditions of stringency; and denatured genomic double-stranded RNAs were hybridized to the probes in solution and the hybrids which formed were identified by polyacrylamide gel electrophoresis. When analyzed by Northern blot hybridization at a low level of stringency, all genes from the strains tested cross-hybridized, providing evidence for some sequence homology in each of the corresponding genes. However, when hybridization stringency was increased, a difference in gene 4 sequence was detected between strains recovered from asymptomatic newborn infants ("nursery strains") and strains recovered from infants and young children with diarrhea. Although the nursery strains exhibited serotypic diversity (i.e., each of the four strains tested belonged to a different serotype), the fourth gene appeared to be highly conserved. Similarly, each of the virulent strains tested belonged to a different serotype; nonetheless, there was significant conservation of sequence among the fourth genes of three of these viruses. Significantly, the conserved fourth genes of the nursery strains were distinct from the fourth gene of each of the virulent viruses. These results were confirmed and extended during experiments in which the RNA-RNA hybridization was carried out in solution and the resulting hybrids were analyzed by polyacrylamide gel electrophoresis. Under these conditions, the fourth genes of the nursery strains were closely related to each other but not to the fourth genes of the virulent viruses. Full-length hybrids did not form between the fourth genes from the nursery strains and the corresponding genes from the strains recovered from symptomatic infants and young children. Images PMID:3023685

Revealing the first uridyl peptide antibiotic biosynthetic gene cluster and probing pacidamycin biosynthesis.

PubMed

Rackham, Emma J; Grüschow, Sabine; Goss, Rebecca J M

2011-01-01

There is an urgent need for new antibiotics with resistance continuing to emerge toward existing classes. The pacidamycin antibiotics possess a novel scaffold and exhibit unexploited bioactivity rendering them attractive research targets. We recently reported the first identification of a biosynthetic cluster encoding uridyl peptide antibiotic assembly and the engineering of pacidamycin biosynthesis into a heterologous host. We report here our methods toward identifying the biosynthetic cluster. Our initial experiments employed conventional methods of probing a cosmid library using PCR and Southern blotting, however it became necessary to adopt a state-of-the-art genome scanning  and in silico hybridization approach  to pin point the cluster. Here we describe our "real" and "virtual" probing methods and contrast the benefits and pitfalls of each approach. 

Diffusion blotting: a rapid and simple method for production of multiple blots from a single gel.

PubMed

Olsen, Ingrid; Wiker, Harald G

2015-01-01

A very simple and fast method for diffusion blotting of proteins from precast SDS-PAGE gels on a solid plastic support was developed. Diffusion blotting for 3 min gives a quantitative transfer of 10 % compared to 1-h electroblotting. For each subsequent blot from the same gel a doubling of transfer time is necessary to obtain the same amount of protein onto each blot. High- and low-molecular-weight components are transferred equally efficiently when compared to electroblotting. However, both methods do give a higher total transfer of the low-molecular-weight proteins compared to the large proteins. The greatest advantage of diffusion blotting is that several blots can be made from each lane, thus enabling testing of multiple antisera on virtually identical blots. The gel remains on the plastic support, which prevents it from stretching or shrinking. This ensures identical blots and facilitates more reliable molecular weight determination. Furthermore the proteins remaining in the gel can be stained with Coomassie Brilliant Blue or other methods for exact and easy comparison with the developed blots. These advantages make diffusion blotting the method of choice when quantitative protein transfer is not required.

De Novo Centromere Formation and Centromeric Sequence Expansion in Wheat and its Wide Hybrids.

PubMed

Guo, Xiang; Su, Handong; Shi, Qinghua; Fu, Shulan; Wang, Jing; Zhang, Xiangqi; Hu, Zanmin; Han, Fangpu

2016-04-01

Centromeres typically contain tandem repeat sequences, but centromere function does not necessarily depend on these sequences. We identified functional centromeres with significant quantitative changes in the centromeric retrotransposons of wheat (CRW) contents in wheat aneuploids (Triticum aestivum) and the offspring of wheat wide hybrids. The CRW signals were strongly reduced or essentially lost in some wheat ditelosomic lines and in the addition lines from the wide hybrids. The total loss of the CRW sequences but the presence of CENH3 in these lines suggests that the centromeres were formed de novo. In wheat and its wide hybrids, which carry large complex genomes or no sequenced genome, we performed CENH3-ChIP-dot-blot methods alone or in combination with CENH3-ChIP-seq and identified the ectopic genomic sequences present at the new centromeres. In adcdition, the transcription of the identified DNA sequences was remarkably increased at the new centromere, suggesting that the transcription of the corresponding sequences may be associated with de novo centromere formation. Stable alien chromosomes with two and three regions containing CRW sequences induced by centromere breakage were observed in the wheat-Th. elongatum hybrid derivatives, but only one was a functional centromere. In wheat-rye (Secale cereale) hybrids, the rye centromere-specific sequences spread along the chromosome arms and may have caused centromere expansion. Frequent and significant quantitative alterations in the centromere sequence via chromosomal rearrangement have been systematically described in wheat wide hybridizations, which may affect the retention or loss of the alien chromosomes in the hybrids. Thus, the centromere behavior in wide crosses likely has an important impact on the generation of biodiversity, which ultimately has implications for speciation.

De Novo Centromere Formation and Centromeric Sequence Expansion in Wheat and its Wide Hybrids

PubMed Central

Fu, Shulan; Wang, Jing; Zhang, Xiangqi; Hu, Zanmin; Han, Fangpu

2016-01-01

Centromeres typically contain tandem repeat sequences, but centromere function does not necessarily depend on these sequences. We identified functional centromeres with significant quantitative changes in the centromeric retrotransposons of wheat (CRW) contents in wheat aneuploids (Triticum aestivum) and the offspring of wheat wide hybrids. The CRW signals were strongly reduced or essentially lost in some wheat ditelosomic lines and in the addition lines from the wide hybrids. The total loss of the CRW sequences but the presence of CENH3 in these lines suggests that the centromeres were formed de novo. In wheat and its wide hybrids, which carry large complex genomes or no sequenced genome, we performed CENH3-ChIP-dot-blot methods alone or in combination with CENH3-ChIP-seq and identified the ectopic genomic sequences present at the new centromeres. In adcdition, the transcription of the identified DNA sequences was remarkably increased at the new centromere, suggesting that the transcription of the corresponding sequences may be associated with de novo centromere formation. Stable alien chromosomes with two and three regions containing CRW sequences induced by centromere breakage were observed in the wheat-Th. elongatum hybrid derivatives, but only one was a functional centromere. In wheat-rye (Secale cereale) hybrids, the rye centromere-specific sequences spread along the chromosome arms and may have caused centromere expansion. Frequent and significant quantitative alterations in the centromere sequence via chromosomal rearrangement have been systematically described in wheat wide hybridizations, which may affect the retention or loss of the alien chromosomes in the hybrids. Thus, the centromere behavior in wide crosses likely has an important impact on the generation of biodiversity, which ultimately has implications for speciation. PMID:27110907

Genotype-phenotype relationships in human red/green color-vision defects: Molecular and psychophysical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deeb, S.S.; Motulsky, A.G.; Lindsey, D.T.

1992-10-01

The relationship between the molecular structure of the X-linked red and green visual pigment genes and color-vision phenotype as ascertained by anomaloscopy was studied in 64 color-defective males. The great majority of red-green defects were associated with either the deletion of the green-pigment gene or the formation of 5[prime] red-green hybrid genes or 5[prime] green-red hybrid genes. A rapid PCR-based method allowed detection of hybrid genes, including those undetectable by Southern blot analysis, as well as more precise localization of the fusion points in hybrid genes. Protan color-vision defects appeared always associated with 5[prime] red-green hybrid genes. Carriers of singlemore » red-green hybrid genes with fusion in introns 1-4 were protanopes. However, carriers of hybrid genes with red-green fusions in introns 2, 3, or 4 in the presence of additional normal green genes manifested as either protanopes or protanomalous trichromats, with the majority being protanomalous. Deutan defects were associated with green-pigment gene deletions, with 5[prime] green-red hybrid genes, or, rarely, with 5[prime] green-red-green hybrid genes. Complete green-pigment gene deletions or green-red fusions in intron 1 were usually associated with deuteranopia, although the authors unexpectedly found three carriers of a single red-pigment gene without any green-pigment genes to be deuteranomalous trichromats. All but one of the other deuteranomalous subjects had green-red hybrid genes with intron 1, 2, 3, or 4 fusions, as well as several normal green-pigment genes. The one exception had a grossly normal gene array, presumably with a more subtle mutation. Amino acid differences in exon 5 largely determine whether a hybrid gene will be more redlike or more greenlike in phenotype. Various discrepancies as to severity (dichromacy or trichromacy) remain unexplained but may arise because of variability of expression, postreceptoral variation, or both.« less

Practical Molecular Biology for Students: An Integrated Approach to Teaching Basic Techniques.

ERIC Educational Resources Information Center

Hames, B. David; And Others

1990-01-01

An activity that introduces students to the correct handling of bacterial recombinants, antibiotic sensitivity testing, insertional inactivation, plasmid DNA isolation, restriction endonuclease digestion, agarose gel electrophoresis, Southern blotting, hybridization, and autoradiography is presented. A list of needed materials, procedures, safety…

Genetic analysis of chromosomal operons involved in degradation of aromatic hydrocarbons in Pseudomonas putida TMB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polissi, A.; Bestetti, G.; Bertoni, G.

1990-11-01

The catabolic pathway for the degradation of aromatic hydrocarbons encoded by Pseudomonas putida TMB differs from the TOL plasmid-encoded pathway as far as regulation of the upper pathway is concerned. We found, by analyzing Tn5-induced mutants and by Southern blot hybridization with appropriate probes derived from the TOL plasmid pWWO, that the catabolic genes of strain TMB were located on the bacterial chromosome and not on the 84-kb plasmid harbored by this strain. The catabolic genes of TMB and pWWO had sequence homology, as shown by Southern blot hybridization, but different significantly in their restriction patterns. The analysis of themore » mutants suggests that a regulatory mechanism similar to that present in pWWO coexists in TMB with a second mode of regulation which is epistatic on the former and that the chromosomal region carrying the catabolic genes is prone to rearrangements and deletions.« less

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

PubMed

Old, M O; Logan, L H; Maldonado, Y A

1997-11-01

Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

The chloroplast and mitochondrial DNA type are correlated with the nuclear composition of somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia.

PubMed

Wolters, A M; Koornneef, M; Gilissen, L J

1993-09-01

This paper describes the analysis of chloroplast (cp) DNA and mitochondrial (mt) DNA in 21 somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia by means of Southern-blot hybridization. Each of these calli contained only one type of cpDNA; 14 had the N. plumbaginifolia (Np) type and seven the S. tuberosum (St) type. N. plumbaginifolia cpDNA was present in hybrids previously shown to contain predominantly N. plumbaginifolia chromosomes whereas hybrids in which S. tuberosum chromosomes predominated possessed cpDNA from potato. We have analyzed the mtDNA of these 21 somatic hybrid calli using four restriction enzyme/probe combinations. Most fusion products had only, or mostly, mtDNA fragments from the parent that predominated in the nucleus. The hybrids containing mtDNA fragments from only one parent (and new fragments) also possessed chloroplasts from the same species. The results suggest the existence of a strong nucleo-cytoplasmic incongruity which affects the genome composition of somatic hybrids between distantly related species.

Using in situ hybridization and PFGE Southern hybridization to detect translocation breakpoints in a BOR/TRPS patient cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Sapru, M.; Smith, D.

Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder characterized by ear malformations, cervical fistulae, hearing loss and renal abnormalities. We have integrated the Genethon YAC contig maps with additional markers in the chromosome 8q region genetically linked by a unique patient cell line. This cell line is from a patient who has both the branchio-oto-renal syndrome and tricho-rhino-phalangeal syndrome (TRPS). High resolution cytogenetics demonstrated a direct insertion of materials from 8q13.3q21.13 to 8q24.11. TRPS has been previously linked to deletions involving 8q24.11-q24.13. The rearrangement in this patient suggests that TRPS results from loss of gene function due to insertion atmore » the 8q24.11 breakpoint and the possible location for the BOR gene is at either of the two breakpoints of 8q13.3 and 8q21.13. We have constructed cosmid contigs in 8q24.11. In situ hybridization with cosmids mapped to these locations as probes has helped to narrow down the breakpoints. Combinations of cosmids on either side or overlapping the 8q24.11 breakpoint show split signals on one chromosome 8q arm due to insertion of the materials from the proximal region. Cosmids mapped to the TRPS deletion region have been used to hybridize to pulsed field gel genomic blots of DNA from the patient cell line and detected rearranged genomic fragments. Both in situ hybridization and genomic PFGE Southern blot will be used to precisely locate the breakpoints.« less

Patterns of Limnohabitans Microdiversity across a Large Set of Freshwater Habitats as Revealed by Reverse Line Blot Hybridization

PubMed Central

Jezbera, Jan; Jezberová, Jitka; Kasalický, Vojtěch; Šimek, Karel; Hahn, Martin W.

2013-01-01

Among abundant freshwater Betaproteobacteria, only few groups are considered to be of central ecological importance. One of them is the well-studied genus Limnohabitans and mainly its R-BT subcluster, investigated previously mainly by fluorescence in situ hybridization methods. We designed, based on sequences from a large Limnohabitans culture collection, 18 RLBH (Reverse Line Blot Hybridization) probes specific for different groups within the genus Limnohabitans by targeting diagnostic sequences on their 16 S–23 S rRNA ITS regions. The developed probes covered in sum 92% of the available isolates. This set of probes was applied to environmental DNA originating from 161 different European standing freshwater habitats to reveal the microdiversity (intra-genus) patterns of the Limnohabitans genus along a pH gradient. Investigated habitats differed in various physicochemical parameters, and represented a very broad range of standing freshwater habitats. The Limnohabitans microdiversity, assessed as number of RLBH-defined groups detected, increased significantly along the gradient of rising pH of habitats. 14 out of 18 probes returned detection signals that allowed predictions on the distribution of distinct Limnohabitans groups. Most probe-defined Limnohabitans groups showed preferences for alkaline habitats, one for acidic, and some seemed to lack preferences. Complete niche-separation was indicated for some of the probe-targeted groups. Moreover, bimodal distributions observed for some groups of Limnohabitans, suggested further niche separation between genotypes within the same probe-defined group. Statistical analyses suggested that different environmental parameters such as pH, conductivity, oxygen and altitude influenced the distribution of distinct groups. The results of our study do not support the hypothesis that the wide ecological distribution of Limnohabitans bacteria in standing freshwater habitats results from generalist adaptations of these bacteria. Instead, our observations suggest that the genus Limnohabitans, as well as its R-BT subgroup, represent ecologically heterogeneous taxa, which underwent pronounced ecological diversification. PMID:23554898

Application of a reverse dot blot, DNA-DNA hydridization method to quantify host-feeding tendencies of two sibling species in the Anopheles gambiae complex

PubMed Central

Fritz, Megan L; Miller, James R; Bayoh, M Nabie; Vulule, John M; Landgraf, Jeffrey R; Walker, Edward D

2012-01-01

A DNA-DNA hybridization method, reverse dot blot analysis (RDBA), was used for identification of Anopheles gambiae s.s. and An. arabiensis hosts. Of 299 blood fed and half gravid An. gambiae s.l. collected from Kisian, Kenya, 244 individuals were identifiable to species; 69.5% were An. arabiensis, and 29.5% were An. gambiae s.s. Host identifications with RDBA were comparable to conventional PCR followed by direct sequencing of amplicons of the vertebrate mitochondrial cytochrome B gene. Of the 174 amplicon-producing samples used for comparison of these two methods, 147 were identifiable by direct sequencing, and 139 of these same by RDBA. An. arabiensis blood meals were mostly (>90%) bovine in origin, whereas An. gambiae s.s. fed upon humans > 90% of the time. RDBA detected that 2 of 112 An. arabiensis had blood from more than one host species, whereas PCR and direct sequencing did not. Recent insecticide-treated bednet (ITN) use in Kisian has likely caused the shift in the dominant vector species from An. gambiae s.s. to An. arabiensis. RDBA provides an opportunity to study changes in host-feeding by members of the An. gambiae complex as a response to the broadening distribution of vector control measures targeting host-selection behaviors. PMID:24188164

Protein purification and analysis: next generation Western blotting techniques.

PubMed

Mishra, Manish; Tiwari, Shuchita; Gomes, Aldrin V

2017-11-01

Western blotting is one of the most commonly used techniques in molecular biology and proteomics. Since western blotting is a multistep protocol, variations and errors can occur at any step reducing the reliability and reproducibility of this technique. Recent reports suggest that a few key steps, such as the sample preparation method, the amount and source of primary antibody used, as well as the normalization method utilized, are critical for reproducible western blot results. Areas covered: In this review, improvements in different areas of western blotting, including protein transfer and antibody validation, are summarized. The review discusses the most advanced western blotting techniques available and highlights the relationship between next generation western blotting techniques and its clinical relevance. Expert commentary: Over the last decade significant improvements have been made in creating more sensitive, automated, and advanced techniques by optimizing various aspects of the western blot protocol. New methods such as single cell-resolution western blot, capillary electrophoresis, DigiWest, automated microfluid western blotting and microchip electrophoresis have all been developed to reduce potential problems associated with the western blotting technique. Innovative developments in instrumentation and increased sensitivity for western blots offer novel possibilities for increasing the clinical implications of western blot.

Automated design of genomic Southern blot probes

PubMed Central

2010-01-01

Background Sothern blotting is a DNA analysis technique that has found widespread application in molecular biology. It has been used for gene discovery and mapping and has diagnostic and forensic applications, including mutation detection in patient samples and DNA fingerprinting in criminal investigations. Southern blotting has been employed as the definitive method for detecting transgene integration, and successful homologous recombination in gene targeting experiments. The technique employs a labeled DNA probe to detect a specific DNA sequence in a complex DNA sample that has been separated by restriction-digest and gel electrophoresis. Critically for the technique to succeed the probe must be unique to the target locus so as not to cross-hybridize to other endogenous DNA within the sample. Investigators routinely employ a manual approach to probe design. A genome browser is used to extract DNA sequence from the locus of interest, which is searched against the target genome using a BLAST-like tool. Ideally a single perfect match is obtained to the target, with little cross-reactivity caused by homologous DNA sequence present in the genome and/or repetitive and low-complexity elements in the candidate probe. This is a labor intensive process often requiring several attempts to find a suitable probe for laboratory testing. Results We have written an informatic pipeline to automatically design genomic Sothern blot probes that specifically attempts to optimize the resultant probe, employing a brute-force strategy of generating many candidate probes of acceptable length in the user-specified design window, searching all against the target genome, then scoring and ranking the candidates by uniqueness and repetitive DNA element content. Using these in silico measures we can automatically design probes that we predict to perform as well, or better, than our previous manual designs, while considerably reducing design time. We went on to experimentally validate a number of these automated designs by Southern blotting. The majority of probes we tested performed well confirming our in silico prediction methodology and the general usefulness of the software for automated genomic Southern probe design. Conclusions Software and supplementary information are freely available at: http://www.genes2cognition.org/software/southern_blot PMID:20113467

OCT4B1 Regulates the Cellular Stress Response of Human Dental Pulp Cells with Inflammation

PubMed Central

Liu, Lu; Huang, Rong; Yang, Ruiqi

2017-01-01

Introduction. Infection and apoptosis are combined triggers for inflammation in dental tissues. Octamer-binding transcription factor 4-B1 (OCT4B1), a novel spliced variant of OCT4 family, could respond to the cellular stress and possess antiapoptotic property. However, its specific role in dental pulpitis remains unknown. Methods. To investigate the effect of OCT4B1 on inflammation of dental pulp cells (DPCs), its expression in inflamed dental pulp tissues and DPCs was examined by in situ hybridization, real-time PCR, and FISH assay. OCT4B1 overexpressed DPCs model was established, confirmed by western blot and immunofluorescence staining, and then stimulated with Lipopolysaccharide (LPS). Apoptotic rate was determined by Hoechst/PI staining and FACS. Cell survival rate was calculated by CCK8 assay. Results. In situ hybridization, real-time PCR, and FISH assay revealed that OCT4B1 was extensively expressed in inflamed dental pulp tissues and DPCs with LPS stimulation. Western blot and immunofluorescence staining showed the expression of OCT4B1 and OCT4B increased after OCT4B1 transfection. Hoechst/PI staining and FACS demonstrated that less red/blue fluorescence was detected and apoptotic percentage decreased (3.45%) after transfection. CCK8 demonstrated that the survival rate of pCDH-OCT4B1-flag cells increased. Conclusions. OCT4B1 plays an essential role in inflammation and apoptosis of DPCs. OCT4B might operate synergistically with OCT4B1 to reduce apoptosis. PMID:28473980

Interruption of capsule production in Streptococcus pneumonia serotype 3 by insertion of transposon Tn916.

PubMed Central

Watson, D A; Musher, D M

1990-01-01

Transposon Tn916 mutagenesis was used to produce mutant strains of Streptococcus pneumoniae serotype 3 that lacked only a polysaccharide capsule. Southern blotting, DNA-DNA hybridization, and immunochemical analyses demonstrated that the presence of a single copy of Tn916 was sufficient to produce unencapsulation. The 50% lethal dose for such mutants was greater than 5 x 10(7) CFU, as opposed to a 50% lethal dose of 1 CFU for wild-type strains. These experiments outline an effective method for targeting genes in S. pneumoniae by transposon interruption and provide molecular evidence to support the longstanding hypothesis that the capsule is the principal virulence factor in this pathogen. Images PMID:2167295

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

Line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karger, A.E.; Weiss, R.; Gesteland, R.F.

A cryogenically cooled charge-coupled device (CCD) camera equipped with an area CCD array is used in a line scanning system for low-light-level imaging of chemiluminescent DNA sequencing blots. Operating the CCD camera in time-delayed integration (TDI) mode results in continuous data acquisition independent of the length of the CCD array. Scanning is possible with a resolution of 1.4 line pairs/mm at the 50% level of the modulation transfer function. High-sensitivity, low-light-level scanning of chemiluminescent direct-transfer electrophoresis (DTE) DNA sequencing blots is shown. The detection of DNA fragments on the blot involves DNA-DNA hybridization with oligonucleotide-alkaline phosphatase conjugate and 1,2-dioxetane-based chemiluminescence.more » The width of the scan allows the recording of up to four sequencing reactions (16 lanes) on one scan. The scan speed of 52 cm/h used for the sequencing blots corresponds to a data acquisition rate of 384 pixels/s. The chemiluminescence detection limit on the scanned images is 3.9 [times] 10[sup [minus]18] mol of plasmid DNA. A conditional median filter is described to remove spikes caused by cosmic ray events from the CCD images. 39 refs., 9 refs.« less

Anticancer Therapeutic Potential of VEGI, an Antiangiogenic Cytokine

DTIC Science & Technology

2002-10-01

PCR product. The blots were hybridized at 42°C overnight and washed in wash buffer 1 ( 2 x SSC, 0.1% sodium lauryl sulfate ) and wash buffer 2 (1 x SSC...transfected into MDA- MIB-231 breast cancer cells by electroporation. Stable transfectants were selected in 2 mg/ml G418 sulfate (Invitrogen). Conditioned

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Isolation of RNA for dot hybridization by heparin-DNase I treatment of whole cell lysate.

PubMed

Krawczyk, Z; Wu, C

1987-08-15

We have developed a new procedure for the rapid preparation of undegraded total RNA from cultured cells for specific quantitation by dot blotting analysis. Pelleted cells are resuspended in hypotonic solution containing a ribonuclease inhibitor and heparin and disrupted by freeze-thaw. Heparin is employed as an agent for nuclear lysis, dissociation of chromosomal protein, and release of mRNA from rough endoplasmic reticulum. We eliminate chromosomal DNA by digestion with DNase I and denature the RNA in the lysate with formaldehyde. After centrifugation to remove debris, the supernatant is used directly for dot blotting. All manipulations are performed in the same microfuge tube and recovery of RNA is quantitative. The procedure is especially useful for processing large numbers of samples. We illustrate its versatility by analysis of specific RNAs in Drosophila, rat, and human cell lines. In reconstruction experiments, less than 80 molecules per cell of a small RNA (beta-globin) can be detected under highly stringent hybridization conditions, using only moderately labeled double-stranded plasmid DNA probes and short film exposures.

Calreticulin--an endoplasmic reticulum protein with calcium-binding activity is also found in the extracellular matrix.

PubMed

Somogyi, Eszter; Petersson, Ulrika; Hultenby, Kjell; Wendel, Mikael

2003-04-01

Previous studies have reported that calreticulin (CRT), a calcium-binding and chaperoning protein, is expressed only in the endoplasmatic reticulum, nucleus and at the cell surface. In this study we clearly show that odontoblasts and predentin matrix contain CRT. To our knowledge, this is the first time CRT has been described in the extracellular matrix. The expression of CRT was studied by immunohistochemistry, ultrastructural immunocytochemistry and in situ hybridization in developing rat teeth. CRT was detected as a 59-kDa protein in rat pulp cell culture medium and dentin extracellular matrix extract by Western blotting. The presence of the protein was shown in rat odontoblasts and predentin with immunohistochemistry. At the ultrastructural level, the labeling was distributed in the rat odontoblasts, ameloblasts and predentin. Northern blotting showed the presence of CRT mRNA in rat molars, which was confirmed by in situ hybridization in odontoblasts and ameloblasts. We now present the first convincing evidence that CRT is found in extracellular matrix where it may play an important role in mineralization.

Increased expression of glutamic acid decarboxylase mRNA in rat substantia nigra after an ibotenic acid lesion in the caudate-putamen.

PubMed

Lindefors, N; Brené, S; Persson, H

1990-04-01

In situ hybridization histochemistry and RNA blots were used to study expression of glutamic acid decarboxylase (GAD) mRNA in rat caudate-nucleus and substantia nigra. In situ hybridization combined with computerized image analysis revealed that in the intact substantia nigra reticulata the cross-section area of GAD mRNA positive neurons were 25% larger in the dorsolateral part as compared with the ventromedial part. A unilateral ibotenic acid injection in caudate-putamen lesioned neurons, some of which project to the ipsilateral substantia nigra. An increased level of GAD mRNA was observed in substantia nigra ipsilateral to the lesion. Computerized image analysis of sections from in situ hybridization revealed an increase in the number of silver grains over GAD mRNA positive neurons in the dorsolateral substantia nigra reticulata ipsilateral to the lesion. However, no change was observed in the ventromedial part suggesting that GAD mRNA expression in this part of the nigra is less sensitive to inhibition by caudate-putamen afferents. In agreement with in situ experiments, RNA blots showed a 2-fold increased level of GAD mRNA in substantia nigra ipsilateral to the lesion. The increased GAD mRNA expression in the deafferented substantia nigra suggests a disinhibition of nigral GABA neurons, resulting in an increased utilization of GABA in these substantia nigra neurons.

Use of molecular techniques to evaluate the survival of a microorganism injected into an aquifer

USGS Publications Warehouse

Thiem, S.M.; Krumme, M.L.; Smith, R.L.; Tiedje, J.M.

1994-01-01

A PCR primer set and an internal probe that are specific for Pseudomonas sp. strain B13, a 3-chlorobenzoate-metabolizing strain, were developed. Using this primer set and probe, we were able to detect Pseudomonas sp. strain B13 DNA sequences in DNA extracted from aquifer samples 14.5 months after Pseudomonas sp. strain B13 had been injected into a sand and gravel aquifer. This primer set and probe were also used to analyze isolates from 3-chlorobenzoate enrichments of the aquifer samples by Southern blot analysis. Hybridization of Southern blots with the Pseudomonas sp. strain B13-specific probe and a catabolic probe in conjunction with restriction fragment length polymorphism (RFLP) analysis of ribosome genes was used to determine that viable Pseudomonas sp. strain B13 persisted in this environment. We isolated a new 3-chlorobenzoate-degrading strain from one of these enrichment cultures. The B13-specific probe does not hybridize to DNA from this isolate. The new strain could be the result of gene exchange between Pseudomonas sp. strain B13 and an indigenous bacterium. This speculation is based on an RFLP pattern of ribosome genes that differs from that of Pseudomonas sp. strain B13, the fact that identically sized restriction fragments hybridized to the catabolic gene probe, and the absence of any enrichable 3-chlorobenzoate-degrading strains in the aquifer prior to inoculation.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

PubMed

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

Detection of Y chromosome sequences in a 45,X/46,XXq - patient by Southern blot analysis of PCR-amplified DNA and fluorescent in situ hybridization (FISH)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kocova, M.; Siegel, S.F.; Wenger, S.L.

1995-02-13

In some cases of gonadal dysgenesis, cytogenetic analysis seems to be discordant with the phenotype of the patients. We have applied techniques such as Southern blot analysis and fluorescent in situ hybridization (FISH) to resolve the phenotype/genotype discrepancy in a patient with ambiguous genitalia in whom the peripheral blood karotype was 45,X. Gonadectomy at age 7 months showed the gonadal tissue to be prepubertal testis on the left side and a streak gonad on the right. The karyotype obtained from the left gonad was 45,X/46,XXq- and that from the right gonad was 45,X. Three different techniques, PCR amplification, FISH, andmore » chromosome painting for X and Y chromosomes, confirmed the presence of Y chromosome sequences. Five different tissues were evaluated. The highest percentage of Y chromosome positive cells were detected in the left gonad, followed by the peripheral blood lymphocytes, skin fibroblasts, and buccal mucosa. No Y chromosomal material could be identified in the right gonad. Since the Xq- chromosome is present in the left gonad (testis), it is likely that the Xq- contains Y chromosomal material. Sophisticated analysis in this patient showed that she has at least 2 cell lines, one of which contains Y chromosomal material. These techniques elucidated the molecular basis of the genital ambiguity for this patient. When Y chromosome sequences are present in patients with Ullrich-Turner syndrome or gonadal dysgenesis, the risk for gonadal malignancy is significantly increased. Hence, molecular diagnostic methods to ascertain for the presence of Y chromosome sequences may expedite the evaluation of patients with the ambiguous genitalia. 21 refs., 4 figs., 2 tabs.« less

Schizosaccharomyces pombe Polysome Profile Analysis and RNA Purification.

PubMed

Wolf, Dieter A; Bähler, Jürg; Wise, Jo Ann

2017-04-03

Polysome profile analysis is widely used by investigators studying the mechanism and regulation of translation. The method described here uses high-velocity centrifugation of whole cell extracts on linear sucrose gradients to separate 40S and 60S ribosomal subunits from 80S monosomes and polysomes. Cycloheximide is included in the lysis buffer to "freeze" polysomes by blocking translation. After centrifugation, the gradient is fractionated and RNA (and/or protein) is prepared from each fraction for subsequent analysis of individual species using northern or western blots. The entire RNA population in each fraction can be analyzed by hybridization to microarrays or by high-throughput RNA sequencing, and the proteins present can be identified by mass spectrometry analysis. © 2017 Cold Spring Harbor Laboratory Press.

Detection and differentiation of Campylobacter jejuni and Campylobacter coli in broiler chicken samples using a PCR/DNA probe membrane based colorimetric detection assay.

PubMed

O'Sullivan, N A; Fallon, R; Carroll, C; Smith, T; Maher, M

2000-02-01

Campylobacter enteritis in humans has been linked to consumption of poultry meat. Surveys show that 30-100% of poultry harbour Campylobacter as normal flora of the digestive tract which indicates a need to identify prevalent organism types in flocks and trace their epidemiology. In this study we describe a Campylobacter genus specific polymerase chain reaction (PCR) assay, amplifying the 16 S-23 S rRNA intergenic spacer region with an internal Campylobacter genus specific DNA probe and species specific probes for Campylobacter jejuni and Campylobacter coli designed for confirmation of the amplified PCR products by Southern blot and colorimetric reverse hybridization assays. The specificity of this assay was established by testing a range of food pathogens. Broiler chicken samples were tested following presumptive positive identification by the Malthus System V analyser (Malthus Instruments, UK). The combined PCR and colorimetric reverse hybridization assay is easy to perform and faster than conventional methods for confirmation and identification of Campylobacter species. Copyright 2000 Academic Press.

Human papillomavirus type 16 DNA in periungual squamous cell carcinomas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moy, R.L.; Eliezri, Y.D.; Bennett, R.G.

1989-05-12

Ten squamous cell carcinomas (in situ or invasive) of the fingernail region were analyzed for the presence of DNA sequences homologous to human papilloma-virus (HPV) by dot blot hybridization. In most patients, the lesions were verrucae of long-term duration that were refractory to conventional treatment methods. Eight of the lesions contained HPV DNA sequences, and in six of these the sequences were related to HPV 16 as deduced from low-stringency nucleic acid hybridization followed by low- and high-stringency washes. Furthermore, the restriction endonuclease digestion pattern of DNA isolated from four of these lesions was diagnostic of episomal HPV 16. Themore » high-frequency association of HPV 16 with periungual squamous cell carcinoma is similar to that reported for HPV 16 with squamous cell carcinomas on mucous membranes at other sites, notably the genital tract. The findings suggest that HPV 16 may play an important role in the development of squamous cell carcinomas of the finger, most notably those lesions that are chronic and located in the periungual area.« less

[Scientific Evaluation of Crude Drugs and Kampo Medicines Using the Eastern Blotting Method and Its Application to Biological Metabolic Studies].

PubMed

Morinaga, Osamu

2018-01-01

　The scientific evaluation of crude drugs and kampo medicines (KMs) was demonstrated using the eastern blotting method with monoclonal antibodies (MAbs) against bioactive natural compounds. Scutellariae radix is one of the most important crude drugs used in KMs. Part of its pharmaceutical properties is due to the flavone glycoside baicalin (BI). A quantitative analysis method based on eastern blotting was developed for BI using an anti-BI MAb. A rapid, simple, sensitive, specific analytical system was subsequently established for BI with the eastern blotting technique using dot-blot and chemiluminescent methods. This system was useful as a high-throughput analytical method for the determination of BI in KMs as well as HPLC and enzyme-linked immunosorbent assay systems. Furthermore, an eastern blotting method was applied to the biological metabolic study of glycyrrhizic acid (GL), the major active constituent of licorice, for investigation of metabolites of GL such as 3-monoglucuronyl-glycyrrhetinic acid (3MGA) because licorice causes pseudoaldosteronism as a side effect. This approach may make it possible to determine the pathogenic agents of licorice-induced pseudoaldosteronism.

A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.

PubMed

Sinigaglia, Chiara; Thiel, Daniel; Hejnol, Andreas; Houliston, Evelyn; Leclère, Lucas

2018-02-01

In situ hybridization is a widely employed technique allowing spatial visualization of gene expression in fixed specimens. It has greatly advanced our understanding of biological processes, including developmental regulation. In situ protocols are today routinely followed in numerous laboratories, and although details might change, they all include a hybridization step, where specific antisense RNA or DNA probes anneal to the target nucleic acid sequence. This step is generally carried out at high temperatures and in a denaturing solution, called hybridization buffer, commonly containing 50% (v/v) formamide - a hazardous chemical. When applied to the soft-bodied hydrozoan medusa Clytia hemisphaerica, we found that this traditional hybridization approach was not fully satisfactory, causing extensive deterioration of morphology and tissue texture which compromised our observation and interpretation of results. We thus tested alternative solutions for in situ detection of gene expression and, inspired by optimized protocols for Northern and Southern blot analysis, we substituted the 50% formamide with an equal volume of 8M urea solution in the hybridization buffer. Our new protocol not only yielded better morphologies and tissue consistency, but also notably improved the resolution of the signal, allowing more precise localization of gene expression and reducing aspecific staining associated with problematic areas. Given the improved results and reduced manipulation risks, we tested the urea protocol on other metazoans, two brachiopod species (Novocrania anomala and Terebratalia transversa) and the priapulid worm Priapulus caudatus, obtaining a similar reduction of aspecific probe binding. Overall, substitution of formamide by urea during in situ hybridization offers a safer alternative, potentially of widespread use in research, medical and teaching contexts. We encourage other workers to test this approach on their study organisms, and hope that they will also obtain better sample preservation, more precise expression patterns and fewer problems due to aspecific staining, as we report here for Clytia medusae and Novocrania and Terebratalia developing larvae. Copyright © 2017 Elsevier Inc. All rights reserved.

[Assessment of HPV detection assays for use in cervical cancer screening programs].

PubMed

Cañadas, M Paz; Lloveras, Belén; Lorincz, Attila; Ejarque, Maijo; Font, Rebeca; Bosch, F Xavier; de Sanjosé, Silvia

2006-01-01

Detection of high-risk human papillomavirus types (HPV) infection is an important tool in the screening of cervical cancer and triage of cytological abnormalities. The different techniques for detection of this cancer need to be contrasted and validated for use in population screening. Cervical cell samples were collected from 166 women attending a dermatology clinic in Oviedo (Spain). We evaluated the performance of three different assays for VPH detection. The methods utilized were 1) In-house PCR-EIA using LI consensus primers MY09/ MY11, 2) A PCR-reverse line blot hybridization (PCR-LBH) that uses LI consensus PGMY primers. 3) Hybrid Capture 2. All assays were performed blinded. The kappa statistic was used to test for global agreement between assay pairs. HPV DNA was detected in 24,7%, 25,3% and 29,5% of the women, respective to the assay. The overall agreement between the in-house PCR, PCR-LBH and HC2 was (73.5%) with all kappa values between assay pairs exceeding 0.56 (p<0.001). The three HPV assays were equally accurate in estimating high-risk HPV prevalence and HPV-related lesions. The method for HPV detection must be decided depending on the goals of the search (screening, follow-up or molecular studies).

De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Dreyfus, P.; Soreq, H.

1989-01-01

A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Differential Gene Expression at Coral Settlement and Metamorphosis - A Subtractive Hybridization Study

PubMed Central

Hayward, David C.; Hetherington, Suzannah; Behm, Carolyn A.; Grasso, Lauretta C.; Forêt, Sylvain; Miller, David J.; Ball, Eldon E.

2011-01-01

Background A successful metamorphosis from a planktonic larva to a settled polyp, which under favorable conditions will establish a future colony, is critical for the survival of corals. However, in contrast to the situation in other animals, e.g., frogs and insects, little is known about the molecular basis of coral metamorphosis. We have begun to redress this situation with previous microarray studies, but there is still a great deal to learn. In the present paper we have utilized a different technology, subtractive hybridization, to characterize genes differentially expressed across this developmental transition and to compare the success of this method to microarray. Methodology/Principal Findings Suppressive subtractive hybridization (SSH) was used to identify two pools of transcripts from the coral, Acropora millepora. One is enriched for transcripts expressed at higher levels at the pre-settlement stage, and the other for transcripts expressed at higher levels at the post-settlement stage. Virtual northern blots were used to demonstrate the efficacy of the subtractive hybridization technique. Both pools contain transcripts coding for proteins in various functional classes but transcriptional regulatory proteins were represented more frequently in the post-settlement pool. Approximately 18% of the transcripts showed no significant similarity to any other sequence on the public databases. Transcripts of particular interest were further characterized by in situ hybridization, which showed that many are regulated spatially as well as temporally. Notably, many transcripts exhibit axially restricted expression patterns that correlate with the pool from which they were isolated. Several transcripts are expressed in patterns consistent with a role in calcification. Conclusions We have characterized over 200 transcripts that are differentially expressed between the planula larva and post-settlement polyp of the coral, Acropora millepora. Sequence, putative function, and in some cases temporal and spatial expression are reported. PMID:22065994

Association of a cucumber mosaic virus strain with mosaic disease of banana, Musa paradisiaca--an evidence using immuno/nucleic acid probe.

PubMed

Srivastava, A; Raj, S K; Haq, Q M; Srivastava, K M; Singh, B P; Sane, P V

1995-12-01

Virus causing severe chlorosis/mosaic disease of banana was identified as a strain of cucumber mosaic virus (CMV). Association of CMV with the disease was established by Western immunoblot using polyclonal antibodies to CMV-T and slot blot hybridization with nucleic acid probe of CMV-P genome.

Polymerase Chain Reaction Assays For Diagnosis of Pneumocystis Carinii Infections

DTIC Science & Technology

1993-03-25

completing ano rCtew-e- the cOlleCtoIn Of Informationt Send comments regarding this bu •rden es•lratf or An- other A•iep Of this collection ot information...Hybridization was carril out at 45 C in 5 ml Hybrisol III containing 4 pmole of P labeled probe. After hybridiLation, the blot was washed three times at room

World Reference Center for Arboviruses.

DTIC Science & Technology

1985-01-01

CharacterizatioSnP{ viruses in mosquito cell cultures.,.......12 PACE analy. iof recent Mono Lake like virus isolates ...... _17 --wRENAvIRIDA ..... o...33 Sequence relatedness of Palyam virus genes to cognates of the Palyam serogroup viruses by RNA-RNA blot hybridization.38 Stability and use of...Immunofluorescence test relationship of Orungo and JKT-8132 viruses .................................................... 15 7. Growth of NT-192 virus in Culex

Ubiquity of Polynucleobacter necessarius subspecies asymbioticus results from ecological diversification

PubMed Central

Jezbera, Jan; Jezberová, Jitka; Brandt, Ulrike; Hahn, Martin W

2011-01-01

The subspecies Polynucleobacter necessarius asymbioticus (> 99% 16S rRNA similarity) has a cosmopolitan distribution and a ubiquitous occurrence in lentic freshwater habitats. We tested if the observed ubiquity of these free-living planktonic freshwater bacteria results from a euryoecious (generalist) adaptation of P. n. asymbioticus strains, or from ecological diversification within the subspecies. We developed a reverse line blot hybridization assay enabling the cultivation-independent detection of 13 groups within the subspecies in environmental samples. A set of 121 lentic freshwater habitats, spanning a broad variety of habitat types (e.g. pH levels ranging from 3.8 to 8.5) was investigated for the presence of these 13 P. n. asymbioticus groups. Statistical analyses of the reverse line blot hybridization detections revealed pronounced differences in habitat preferences of several of the groups. Their preferences differed regarding pH, conductivity, dissolved organic carbon and oxygen concentration of habitats. For some groups, differences in environmental preferences resulted even in complete niche separation between them. The revealed differences in habitat preferences suggest that the previously reported ubiquity of P. n. asymbioticus results from ecological diversification within the taxon and not from generalist adaptation of strains. PMID:21208356

Performance of PCR-reverse blot hybridization assay for detection of rifampicin-resistant Mycobacterium leprae.

PubMed

Wang, Hye-young; Kim, Hyunjung; Kim, Yeun; Bang, Hyeeun; Kim, Jong-Pill; Hwang, Joo Hwan; Cho, Sang-Nae; Kim, Tae Ue; Lee, Hyeyoung

2015-10-01

Drug resistance in Mycobacterium leprae is a significant problem in countries where leprosy is endemic. A sensitive, specific, and high-throughput reverse blot hybridization assay (REBA) for the detection of genotypic resistance to rifampicin (RIF) was designed and evaluated. It has been shown that resistance to RIF in M. leprae involves mutations in the rpoB gene encoding the -subunit of the RNA polymerase. The PCR-REBA simultaneously detects both 6 wild-type regions and 5 different mutations (507 AGC, 513 GTG, 516 TAT, 531 ATG, and 531 TTC) including the most prevalent mutations at positions 507 and 531. Thirty-one clinical isolates provided by Korea Institute of Hansen-s Disease were analyzed by PCR-REBA with RIF resistance of rpoB gene. As a result, missense mutations at codons 507 AGC and 531 ATG with 2-nucleotide substitutions were found in one sample, and a missense mutation at codon 516 TAT and ΔWT6 (deletion of 530-534) was found in another sample. These cases were confirmed by DNA sequence analysis. This rapid, simple, and highly sensitive assay provides a practical alternative to sequencing for genotypic evaluation of RIF resistance in M. leprae.

Production of Multiple Growth Factors by a Newly Established Human Thyroid Carcinoma Cell Line

PubMed Central

Yoshida, Yataro; Ohashi, Kensaku; Sano, Emiko; Kobayashi, Hisataka; Endo, Keigo; Naruto, Masanobu; Nakamura, Toru

1992-01-01

A multiple growth factor‐producing tumor cell line (NIM‐1) was newly established from a patient with thyroid cancer and remarkable neutrophilia. NIM‐1 cells also caused severe neutrophilia in nude mice bearing tumors. NIM‐1‐conditioned medium (NIM‐1CM) contained activities that supported not only granulocyte, macrophage and eosinophil colony formation of human bone marrow cells but also the growth of colony‐stimulating factor (CSF)‐dependent cell lines, NFS60‐KX and TF‐1. Northern blot hybridization analysis revealed the constitutive expression of granulocyte‐CSF (G‐CSF), granulocyte/macrophage‐CSF (GM‐CSF) and interleukin(IL)‐6 mRNAs in NIM‐1 cells. Enzyme‐linked immunosorbent assays (ELISA) using NIM‐1CM also confirmed the production of IL‐la and a small amount of IL‐1β besides G‐CSF, GM‐CSF and IL‐6 in NIM‐1 cells. In addition, unexpected production of IL‐11 in NIM‐1 cells was detected by northern blot hybridization analysis and by bioassay using an IL‐11‐dependent cell line. Therefore, NIM‐1 cell line is shown to produce multiple cytokines including potentially megakaryopoietic growth factors such as GM‐CSF, IL‐6 and IL‐11. PMID:1372885

Detection and characterization of latent HSV RNA by in situ and northern blot hybridization in guinea pigs.

PubMed

Burke, R L; Hartog, K; Croen, K D; Ostrove, J M

1991-04-01

Following intravaginal infection of guinea pigs, herpes simplex virus establishes a latent infection in the sensory lumbosacral ganglia. Using the techniques of in situ and Northern blot hybridization, we have characterized this latent HSV-2 virus and compared it to latent HSV-1 at the same anatomical site. For HSV-2, a single 1.8-kb latency-associated transcript (LAT) was detected. In contrast, as described for latent HSV-1 in the trigeminal ganglia of rabbits and mice, two HSV-1 LAT species were detected in the lumbosacral ganglia, an abundant transcript of 1.8 kb and a less abundant transcript of 1.55 kb. Despite these differences in LAT expression, the clinical course of the acute and recurrent genital disease was similar for both viruses. LAT was detected in 0.3-6.0% of the sensory neurons of sacral but not in lumbar ganglia. The abundance of LAT correlated with the severity of the initial infection, but not with the frequency of recurrent disease. Thus, vaccination strategies that substantially reduced or eliminated symptomatic disease following challenge infection appeared to block the establishment of a latent infection.

Cloning and characterization of cDNAs encoding human gastrin-releasing peptide.

PubMed Central

Spindel, E R; Chin, W W; Price, J; Rees, L H; Besser, G M; Habener, J F

1984-01-01

We have prepared and cloned cDNAs derived from poly(A)+ RNA from a human pulmonary carcinoid tumor rich in immunoreactivity to gastrin-releasing peptide, a peptide closely related in structure to amphibian bombesin. Mixtures of synthetic oligodeoxyribonucleotides corresponding to amphibian bombesin were used as hybridization probes to screen a cDNA library prepared from the tumor RNA. Sequencing of the recombinant plasmids shows that human gastrin-releasing peptide (hGRP) mRNA encodes a precursor of 148 amino acids containing a typical signal sequence, hGRP consisting of 27 or 28 amino acids, and a carboxyl-terminal extension peptide. hGRP is flanked at its carboxyl terminus by two basic amino acids, following a glycine used for amidation of the carboxyl-terminal methionine. RNA blot analyses of tumor RNA show a major mRNA of 900 bases and a minor mRNA of 850 bases. Blot hybridization analyses using human genomic DNA are consistent with a single hGRP-encoding gene. The presence of two mRNAs encoding the hGRP precursor protein in the face of a single hGRP gene raises the possibility of alternative processing of the single RNA transcript. Images PMID:6207529

Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

PubMed

Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

2017-06-01

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

[Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

PubMed

Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

2011-07-01

Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

PubMed

Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

1993-11-01

In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

Correlation of physical and genetic maps of human chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-01-01

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Correlation of physical and genetic maps of human chromosome 16. Annual progress report, October 1, 1990--July 31, 1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-12-31

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Non-radioactive detection of trinucleotide repeat size variability.

PubMed

Tomé, Stéphanie; Nicole, Annie; Gomes-Pereira, Mario; Gourdon, Genevieve

2014-03-06

Many human diseases are associated with the abnormal expansion of unstable trinucleotide repeat sequences. The mechanisms of trinucleotide repeat size mutation have not been fully dissected, and their understanding must be grounded on the detailed analysis of repeat size distributions in human tissues and animal models. Small-pool PCR (SP-PCR) is a robust, highly sensitive and efficient PCR-based approach to assess the levels of repeat size variation, providing both quantitative and qualitative data. The method relies on the amplification of a very low number of DNA molecules, through sucessive dilution of a stock genomic DNA solution. Radioactive Southern blot hybridization is sensitive enough to detect SP-PCR products derived from single template molecules, separated by agarose gel electrophoresis and transferred onto DNA membranes. We describe a variation of the detection method that uses digoxigenin-labelled locked nucleic acid probes. This protocol keeps the sensitivity of the original method, while eliminating the health risks associated with the manipulation of radiolabelled probes, and the burden associated with their regulation, manipulation and waste disposal.

Detection of proteins on blot transfer membranes.

PubMed

Sasse, Joachim; Gallagher, Sean R

2003-11-01

In the basic and alternate protocols of this unit, proteins are stained after electroblotting from polyacrylamide gels to blot transfer membranes. If the samples of interest are electrophoresed in duplicate and transferred to a blot transfer membrane, half of the membrane can be stained to determine the efficiency of transfer to the membrane and the other half can be used for immunoblotting (i.e., western blotting). Detection limits of each staining method are given along with a list of compatible blot transfer membranes and gels. A support protocol describes a method for alkali treatment that enhances subsequent staining of bound proteins.

Glucocorticoid-suppressible hyperaldosteronism and adrenal tumors occurring in a single French pedigree.

PubMed Central

Pascoe, L; Jeunemaitre, X; Lebrethon, M C; Curnow, K M; Gomez-Sanchez, C E; Gasc, J M; Saez, J M; Corvol, P

1995-01-01

Glucocorticoid-suppressible hyperaldosteronism is a dominantly inherited form of hypertension believed to be caused by the presence of a hybrid CYP11B1/CYP11B2 gene which has arisen from an unequal crossing over between the two CYP11B genes in a previous meiosis. We have studied a French pedigree with seven affected individuals in which two affected individuals also have adrenal tumors and two others have micronodular adrenal hyperplasia. One of the adrenal tumors and the surrounding adrenal tissue has been removed, giving a rare opportunity to study the regulation and action of the hybrid gene causing the disease. The hybrid CYP11B gene was demonstrated to be expressed at higher levels than either CYP11B1 or CYP11B2 in the cortex of the adrenal by RT-PCR and Northern blot analysis. In situ hybridization showed that both CYP11B1 and the hybrid gene were expressed in all three zones of the cortex. In cell culture experiments hybrid gene expression was stimulated by ACTH leading to increased production of aldosterone and the hybrid steroids characteristic of glucocorticoid-suppressible hyperaldosteronism. The genetic basis of the adrenal pathologies in this family is not known but may be related to the duplication causing the hyperaldosteronism. Images PMID:7593610

Genotype-phenotype relationships in human red/green color-vision defects: molecular and psychophysical studies.

PubMed Central

Deeb, S S; Lindsey, D T; Hibiya, Y; Sanocki, E; Winderickx, J; Teller, D Y; Motulsky, A G

1992-01-01

The relationship between the molecular structure of the X-linked red and green visual pigment genes and color-vision phenotype as ascertained by anomaloscopy was studied in 64 color-defective males. The great majority of red-green defects were associated with either the deletion of the green-pigment gene or the formation of 5' red-green hybrid genes or 5' green-red hybrid genes. A rapid PCR-based method allowed detection of hybrid genes, including those undetectable by Southern blot analysis, as well as more precise localization of the fusion points in hybrid genes. Protan color-vision defects appeared always associated with 5' red-green hybrid genes. Carriers of single red-green hybrid genes with fusion in introns 1-4 were protanopes. However, carriers of hybrid genes with red-green fusions in introns 2, 3, or 4 in the presence of additional normal green genes manifested as either protanopes or protanomalous trichromats, with the majority being protanomalous. Deutan defects were associated with green-pigment gene deletions, with 5' green-red hybrid genes, or, rarely, with 5' green-red-green hybrid genes. Complete green-pigment gene deletions or green-red fusions in intron 1 were usually associated with deuteranopia, although we unexpectedly found three carriers of a single red-pigment gene without any green-pigment genes to be deuteranomalous trichromats. All but one of the other deuteranomalous subjects had green-red hybrid genes with intron 1, 2, 3, or 4 fusions, as well as several normal green-pigment genes. The one exception had a grossly normal gene array, presumably with a more subtle mutation. Amino acid differences in exon 5 largely determine whether a hybrid gene will be more redlike or more greenlike in phenotype. Various discrepancies as to severity (dichromacy or trichromacy) remain unexplained but may arise because of variability of expression, postreceptoral variation, or both. When phenotypic color-vision defects exist, the kind of defect (protan or deutan) can be predicted by molecular analysis. Red-green hybrid genes are probably always associated with protan color-vision defects, while the presence of green-red hybrid genes may not always manifest phenotypically with color-vision defects. Four subjects who were found to have 5' green-red hybrid genes in addition to normal red- and green-pigment genes had normal color vision as determined by anomaloscopy. These were discovered among a group of 129 Caucasian males who had been recruited as volunteers for a vision study.(ABSTRACT TRUNCATED AT 400 WORDS) Images Figure 3 PMID:1415215

A new background subtraction method for Western blot densitometry band quantification through image analysis software.

PubMed

Gallo-Oller, Gabriel; Ordoñez, Raquel; Dotor, Javier

2018-06-01

Since its first description, Western blot has been widely used in molecular labs. It constitutes a multistep method that allows the detection and/or quantification of proteins from simple to complex protein mixtures. Western blot quantification method constitutes a critical step in order to obtain accurate and reproducible results. Due to the technical knowledge required for densitometry analysis together with the resources availability, standard office scanners are often used for the imaging acquisition of developed Western blot films. Furthermore, the use of semi-quantitative software as ImageJ (Java-based image-processing and analysis software) is clearly increasing in different scientific fields. In this work, we describe the use of office scanner coupled with the ImageJ software together with a new image background subtraction method for accurate Western blot quantification. The proposed method represents an affordable, accurate and reproducible approximation that could be used in the presence of limited resources availability. Copyright © 2018 Elsevier B.V. All rights reserved.

A 5-mC Dot Blot Assay Quantifying the DNA Methylation Level of Chondrocyte Dedifferentiation In Vitro.

PubMed

Jia, Zhaofeng; Liang, Yujie; Ma, Bin; Xu, Xiao; Xiong, Jianyi; Duan, Li; Wang, Daping

2017-05-17

The dedifferentiation of hyaline chondrocytes into fibroblastic chondrocytes often accompanies monolayer expansion of chondrocytes in vitro. The global DNA methylation level of chondrocytes is considered to be a suitable biomarker for the loss of the chondrocyte phenotype. However, results based on different experimental methods can be inconsistent. Therefore, it is important to establish a precise, simple, and rapid method to quantify global DNA methylation levels during chondrocyte dedifferentiation. Current genome-wide methylation analysis techniques largely rely on bisulfite genomic sequencing. Due to DNA degradation during bisulfite conversion, these methods typically require a large sample volume. Other methods used to quantify global DNA methylation levels include high-performance liquid chromatography (HPLC). However, HPLC requires complete digestion of genomic DNA. Additionally, the prohibitively high cost of HPLC instruments limits HPLC's wider application. In this study, genomic DNA (gDNA) was extracted from human chondrocytes cultured with varying number of passages. The gDNA methylation level was detected using a methylation-specific dot blot assay. In this dot blot approach, a gDNA mixture containing the methylated DNA to be detected was spotted directly onto an N + membrane as a dot inside a previously drawn circular template pattern. Compared with other gel electrophoresis-based blotting approaches and other complex blotting procedures, the dot blot method saves significant time. In addition, dot blots can detect overall DNA methylation level using a commercially available 5-mC antibody. We found that the DNA methylation level differed between the monolayer subcultures, and therefore could play a key role in chondrocyte dedifferentiation. The 5-mC dot blot is a reliable, simple, and rapid method to detect the general DNA methylation level to evaluate chondrocyte phenotype.

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

Genes up-regulated during red coloration in UV-B irradiated lettuce leaves.

PubMed

Park, Jong-Sug; Choung, Myoung-Gun; Kim, Jung-Bong; Hahn, Bum-Soo; Kim, Jong-Bum; Bae, Shin-Chul; Roh, Kyung-Hee; Kim, Yong-Hwan; Cheon, Choong-Ill; Sung, Mi-Kyung; Cho, Kang-Jin

2007-04-01

Molecular analysis of gene expression differences between green and red lettuce leaves was performed using the SSH method. BlastX comparisons of subtractive expressed sequence tags (ESTs) indicated that 7.6% of clones encoded enzymes involved in secondary metabolism. Such clones had a particularly high abundance of flavonoid-metabolism proteins (6.5%). Following SSH, 566 clones were rescreened for differential gene expression using dot-blot hybridization. Of these, 53 were found to overexpressed during red coloration. The up-regulated expression of six genes was confirmed by Northern blot analyses. The expression of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes showed a positive correlation with anthocyanin accumulation in UV-B-irradiated lettuce leaves; flavonoid 3',5'-hydroxylase (F3',5'H) and anthocyanidin synthase (ANS) were expressed continuously in both samples. These results indicated that the genes CHS, F3H, and DFR coincided with increases in anthocyanin accumulation during the red coloration of lettuce leaves. This study show a relationship between red coloration and the expression of up-regulated genes in lettuce. The subtractive cDNA library and EST database described in this study represent a valuable resource for further research for secondary metabolism in the vegetable crops.

Biparental inheritance of organelles in Pelargonium: evidence for intergenomic recombination of mitochondrial DNA.

PubMed

Apitz, Janina; Weihe, Andreas; Pohlheim, Frank; Börner, Thomas

2013-02-01

While uniparental transmission of mtDNA is widespread and dominating in eukaryotes leaving mutation as the major source of genotypic diversity, recently, biparental inheritance of mitochondrial genes has been demonstrated in reciprocal crosses of Pelargonium zonale and P. inquinans. The thereby arising heteroplasmy carries the potential for recombination between mtDNAs of different descent, i.e. between the parental mitochondrial genomes. We have analyzed these Pelargonium hybrids for mitochondrial intergenomic recombination events by examining differences in DNA blot hybridization patterns of the mitochondrial genes atp1 and cob. Further investigation of these genes and their flanking regions using nucleotide sequence polymorphisms and PCR revealed DNA segments in the progeny, which contained both P. zonale and P. inquinans sequences suggesting an intergenomic recombination in hybrids of Pelargonium. This turns Pelargonium into an interesting subject for studies of recombination and evolutionary dynamics of mitochondrial genomes.

Epidemiology of Babesia, Anaplasma and Trypanosoma species using a new expanded reverse line blot hybridization assay.

PubMed

Paoletta, Martina Soledad; López Arias, Ludmila; de la Fournière, Sofía; Guillemi, Eliana Carolina; Luciani, Carlos; Sarmiento, Néstor Fabián; Mosqueda, Juan; Farber, Marisa Diana; Wilkowsky, Silvina Elizabeth

2018-02-01

Vector-borne hemoparasitic infections are a major problem that affects livestock industries worldwide, particularly in tropical and subtropical regions. In this work, a reverse line blot (RLB) hybridization assay was developed for the simultaneous detection and identification of Anaplasma, Babesia and bovine trypanosomes, encompassing in this way the most relevant hemoparasites that affect cattle. A total of 186 bovine blood samples collected from two different ecoepidemiological regions of northeast Argentina, with and without tick control, were analyzed with this new RLB. High diversity of parasites, such as Babesia bovis, B. bigemina, Anaplasma marginale and three different Trypanosoma species, was found. High rates of coinfections were also detected, and significant differences were observed not only in the prevalence of parasites but also in the level of coinfections between the two analyzed areas. Regarding the Trypanosoma genus, we provide molecular evidence of the presence of T. vivax and T. theileri for the first time in Argentina. Besides, since the RLB is a prospective tool, it allowed the identification of a yet unknown bovine trypanosome which could not be assigned to any of the bovine species known so far. In the present study we provide new insights on the prevalence of several pathogens that directly impact on livestock production in Argentina. The RLB assay developed here allows to identify simultaneously numerous pathogenic species which can also be easily expanded to detect other blood borne pathogens. These characteristics make the RLB hybridization assay an essential tool for epidemiological survey of all vector-borne pathogens. Copyright © 2017 Elsevier GmbH. All rights reserved.

Interspecific somatic hybrid plants between eggplant (Solanum melongena) and Solanum torvum.

PubMed

Guri, A; Sink, K C

1988-10-01

Mesophyll protoplasts of eggplant (cv Black Beauty) and of Solanum torvum (both 2n=2x=24) were fused using a modification of the Menczel and Wolfe PEG/DMSO procedure. Protoplasts post-fusion were plated at 1 × 10(5)/ml in modified KM medium, which inhibited division of S. torvum protoplasts. One week prior to shoot regeneration, ten individual calluses had a unique light-green background and were verified as cell hybrids by the presence of the dimer isozyme patterns for phosphoglucoisomerase (PGI) and glutamate oxaloacetate transaminase (GOT). Hybridity was also confirmed at the plant stage by DNA-DNA hybridization to a pea 45S ribosomal RNA gene probe. The ten somatic hybrid plants were established in the greenhouse and exhibited intermediate morphological characteristics such as leaf size and shape, flower size, shape, color and plant stature. Their chromosome number ranged from 46-48 (expected 2n=4x=48) and pollen viability was 5%-70%. In vitro shoots taken from the ten hybrid plants exhibited resistance to a verticillium wilt extract. Total DNA from the ten hybrids was restricted and hybridized with a 5.9 kb Oenothera chloroplast cytochrome f gene probe, a 2.4 kb EcoRI clone encoding mitochondrial cytochrome oxidase subunit II from maize and a 22.1 kb Sal I mitochondrial clone from Nicotiana sylvestris. Southern blot hybridization patterns showed that eight of ten somatic hybrids contained the eggplant cpDNA, while two plants contained the cpDNA hybridization patterns of both parents. The mtDNA analysis revealed the presence of novel bands, loss of some specific parental bands and mixture of specific bands from both parents in the restriction hybridization profiles of the hybrids.

T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.

1989-02-01

Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of themore » polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aiuto, L.; Marzella, R.; Archidiacono, N.

The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusivelymore » to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.« less

Development of molecular techniques for detection of lymphocystis disease virus in different marine fish species.

PubMed

Cano, I; Ferro, P; Alonso, M C; Bergmann, S M; Römer-Oberdörfer, A; Garcia-Rosado, E; Castro, D; Borrego, J J

2007-01-01

The development and evaluation of a protocol based on polymerase chain reaction (PCR) and nucleic acid hybridization techniques for the specific detection of lymphocystis disease virus (LCDV) in several marine fish species. The pair of primers for PCR, OBL3 and OBL4, was designed based on published nucleotide sequence (LCDV-1) and amplifies a fragment within the major capsid protein. The sensitivity was evaluated using DNA from purified viral particles, as well as from cells inoculated with several viral concentrations. The PCR combined with slot blot was the most sensitive methodology, detecting 2.5 ng of viral DNA. Using this methodology LCDV was detected at 5 days postinoculation from SAF-1 cells initially inoculated with 10(-5) TCID(50) ml(-1). The combination of PCR with membrane hybridization has also been proved to be adequate to detect LCDV from apparently healthy carriers by means of caudal fin sample analysis. This asymptomatic infection was also demonstrated by classical virological methods (cell culture and immunoblot). The protocol described in this study allows the specific detection of LCDV, both in cell cultures and in fin homogenates from asymptomatic fish. The detection of asymptomatic carriers by a rapid molecular method using caudal fin sampling, which does not imply animal killing, could be an important tool to control epizootics caused by LCDV, as fish could be analysed before their introduction and/or mobilization in farm facilities.

Varicella zoster virus DNA exists as two isomers.

PubMed Central

Ecker, J R; Hyman, R W

1982-01-01

Fragments of varicella zoster virus DNA produced by EcoRI endonuclease cleavage were cloned in vector pACYC 184 and those produced by HindIII cleavage were cloned in pBR322. Restriction enzyme cleavage maps established by double digestion and blot hybridization showed that varicella zoster virus DNA has a Mr of 80 +/- 3 x 10(6) and exists as a population of two isomers. Images PMID:6275385

Regional distribution of neuropeptide Y mRNA in postmortem human brain.

PubMed

Brené, S; Lindefors, N; Kopp, J; Sedvall, G; Persson, H

1989-12-01

The distribution of messenger RNA encoding neuropeptide Y (NPY) was studied in 11 different postmortem human brain regions using in situ hybridization histochemistry, and RNA blot analysis. In situ hybridization data revealed that the highest numerical density of labeled cells corresponded to neurons in accumbens area, caudate nucleus, putamen, and substantia innominata. Significantly fewer NPY mRNA-containing neurons were found in frontal and parietal cortex, amygdaloid body and dentate gyrus. No NPY mRNA-containing cells were found in substantia nigra. NPY mRNA-positive neurons from all regions studied showed relatively similar labeling, as revealed by computerized image analysis. Blot analysis showed an approximately 0.8 kb NPY mRNA in all brain regions studied, except in substantia nigra and cerebellum. Densitometric scanning of the autoradiograms revealed levels of NPY mRNA in the following order: putamen greater than caudate nucleus greater than frontal cortex (Brodmann areas 4 and 6) greater than temporal cortex (Brodmann area 38) greater than parietal cortex (Brodmann areas 5 and 7) greater than frontal cortex (Brodmann area 11). Hence, although NPY mRNA is widely distributed in neurons of the human brain large regional variation exists, with the highest expression in accumbens area and parts of the basal ganglia.

Subcellular Localization and Rolling Circle Replication of Peach Latent Mosaic Viroid: Hallmarks of Group A Viroids

PubMed Central

Bussière, F.; Lehoux, J.; Thompson, D. A.; Skrzeczkowski, L. J.; Perreault, J.-P.

1999-01-01

We characterized the peach latent mosaic viroid (PLMVd) replication intermediates that accumulate in infected peach leaves and determined the tissue and subcellular localization of the RNA species. Using in situ hybridization, we showed that PLMVd strands of both plus and minus polarities concentrate in the cells forming the palisade parenchyma. At the cellular level, PLMVd was found to accumulate predominantly in chloroplasts. Northern blot analyses demonstrated that PLMVd replicates via a symmetric mode involving the accumulation of both circular and linear monomeric strands of both polarities. No multimeric conformer was detected, indicating that both strands self-cleave efficiently via their hammerhead sequences. Dot blot hybridizations revealed that PLMVd strands of both polarities accumulate equally but that the relative concentrations vary by more than 50-fold between peach cultivars. Taken together these results establish two hallmarks for the classification of viroids. Group A viroids (e.g., PLMVd), which possess hammerhead structures, replicate in the chloroplasts via the symmetric mode. By contrast, group B viroids, which share a conserved central region, replicate in the nucleus via an asymmetric mechanism. This is an important difference between self-cleaving and non-self-cleaving viroids, and the implications for the evolutionary origin and replication are discussed. PMID:10400727

Expression of Msx genes in regenerating and developing limbs of axolotl.

PubMed

Koshiba, K; Kuroiwa, A; Yamamoto, H; Tamura, K; Ide, H

1998-12-15

Msx genes, homeobox-containing genes, have been isolated as homologues of the Drosophila msh gene and are thought to play important roles in the development of chick or mouse limb buds. We isolated two Msx genes, Msx1 and Msx2, from regenerating blastemas of axolotl limbs and examined their expression patterns using Northern blot and whole mount in situ hybridization during regeneration and development. Northern blot analysis revealed that the expression level of both Msx genes increased during limb regeneration. The Msx2 expression level increased in the blastema at the early bud stage, and Msx1 expression level increased at the late bud stage. Whole mount in situ hybridization revealed that Msx2 was expressed in the distal mesenchyme and Msx1 in the entire mesenchyme of the blastema at the late bud stage. In the developing limb bud, Msx1 was expressed in the entire mesenchyme, while Msx2 was expressed in the distal and peripheral mesenchyme. The expression patterns of Msx genes in the blastemas and limb buds of the axolotl were different from those reported for chick or mouse limb buds. These expression patterns of axolotl Msx genes are discussed in relation to the blastema or limb bud morphology and their possible roles in limb patterning.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

Molecular cloning of human T-cell lymphotrophic virus type I-like proviral genome from the peripheral lymphocyte DNA of a patient with chronic neurologic disorders.

PubMed Central

Reddy, E P; Mettus, R V; DeFreitas, E; Wroblewska, Z; Cisco, M; Koprowski, H

1988-01-01

Human T-cell lymphotropic virus type 1 (HTLV-I), the etiologic agent of human T-cell leukemia, has recently been shown to be associated with neurologic disorders such as tropical spastic paraparesis, HTLV-associated myelopathy, and possibly with multiple sclerosis. In this communication, we have examined one specific case of neurologic disorder that can be classified as multiple sclerosis or tropical spastic paraparesis. The patient suffering from chronic neurologic disorder was found to contain antibodies to HTLV-I envelope and gag proteins in his serum and cerebrospinal fluid. Lymphocytes from peripheral blood and cerebrospinal fluid of the patient were shown to express viral RNA sequences by in situ hybridization. Southern blot analysis of the patient lymphocyte DNA revealed the presence of HTLV-I-related sequences. Blot-hybridization analysis of the RNA from fresh peripheral lymphocytes stimulated with interleukin 2 revealed the presence of abundant amounts of genomic viral RNA with little or no subgenomic RNA. We have cloned the proviral genome from the DNA of the peripheral lymphocytes and determined its restriction map. This analysis shows that this proviral genome is very similar if not identical to that of the prototype HTLV-I genome. Images PMID:2897123

Application of a Dot Blot Hybridization Platform to Assess Streptococcus uberis Population Structure in Dairy Herds

PubMed Central

Albuquerque, Pedro; Ribeiro, Niza; Almeida, Alexandre; Panschin, Irena; Porfirio, Afonso; Vales, Marta; Diniz, Francisca; Madeira, Helena; Tavares, Fernando

2017-01-01

Streptococcus uberis is considered one of the most important pathogens associated with bovine mastitis. While traditionally acknowledged as an environmental pathogen, S. uberis has been shown to adopt a contagious epidemiological pattern in several dairy herds. Since different control strategies are employed depending on the mode of transmission, in-depth studies of S. uberis populations are essential to determine the best practices to control this pathogen. In this work, we optimized and validated a dot blot platform, combined with automatic image analysis, to rapidly assess the population structure of infective S. uberis, and evaluated its efficiency when compared to multilocus sequence analysis (MLSA) genotyping. Two dairy herds with prevalent S. uberis infections were followed in a 6 month period, in order to collect and characterize isolates from cows with persistent infections. These herds, located in Portugal (Barcelos and Maia regions), had similar management practices, with the herd from Barcelos being smaller and having a better milking parlor management, since infected cow segregation was immediate. A total of 54 S. uberis isolates were obtained from 24 different cows from the two herds. To overcome operator-dependent analysis of the dot blots and increase the technique's consistency and reliability, the hybridization signals were converted into probability values, with average probabilities higher than 0.5 being considered positive results. These data allowed to confirm the isolates' identity as S. uberis using taxa-specific markers and to determine the presence of virulence- and antibiotic resistance-related genes. In addition, MLSA allowed to disclose the most prevalent S. uberis clonal lineages in both herds. Seven different clusters were identified, with Barcelos showing a high clonal diversity and Maia a dominant lineage infecting most cows, suggesting distinct epidemiological patterns, with S. uberis displaying an environmental or contagious transmission pattern depending on the herd. Overall, this work showed the utility of dot blot and MLSA to characterize population structure and epidemiological patterns of mastitis-causing S. uberis. This approach allowed to disclose prevalent virulence patterns and clonal lineages of S. uberis in two distinct herds, and gain insights on the impact of herd management practices on pathogen population structure. PMID:28174566

Irradiation With Carbon Ion Beams Induces Apoptosis, Autophagy, and Cellular Senescence in a Human Glioma-Derived Cell Line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jinno-Oue, Atsushi; Shimizu, Nobuaki; 21st Century Center of Excellence Program for Biomedical Research Using Accelerator Technology, Maebashi, Gunma

2010-01-15

Purpose: We examined biological responses of human glioma cells to irradiation with carbon ion beams (C-ions). Methods and Materials: A human glioma-derived cell line, NP-2, was irradiated with C-ions. Apoptotic cell nuclei were stained with Hoechst 33342. Induction of autophagy was examined either by staining cells with monodansylcadaverine (MDC) or by Western blotting to detect conversion of microtuble-associated protein light chain 3 (MAP-LC3) (LC3-I) to the membrane-bound form (LC3-II). Cellular senescence markers including induction of senescence-associated beta-galactosidase (SA-beta-gal) were examined. The mean telomere length of irradiated cells was determined by Southern blot hybridization. Expression of tumor suppressor p53 and cyclin/cyclin-dependentmore » kinase inhibitor p21{sup WAF1/CIP1} in the irradiated cells was analyzed by Western blotting. Results: When NP-2 cells were irradiated with C-ions at 6 Gy, the major population of the cells died of apoptosis and autophagy. The residual fraction of attached cells (<1% of initially irradiated cells) could not form a colony: however, they showed a morphological phenotype consistent with cellular senescence, that is, enlarged and flattened appearance. The senescent nature of these attached cells was further indicated by staining for SA-beta-gal. The mean telomere length was not changed after irradiation with C-ions. Phosphorylation of p53 at serine 15 as well as the expression of p21{sup WAF1/CIP1} was induced in NP-2 cells after irradiation. Furthermore, we found that irradiation with C-ions induced cellular senescence in a human glioma cell line lacking functional p53. Conclusions: Irradiation with C-ions induced apoptosis, autophagy, and cellular senescence in human glioma cells.« less

In situ embryo rescue for generation of wide intra- and interspecific hybrids of Panicum virgatum L.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kausch, Albert P.; Tilelli, Michael; Hague, Joel

Wide crosses have been used for decades as a method for transferring novel genetic material and traits in plant breeding. Historically, many products of wide crosses require tedious and inefficient surgical embryo rescue prior to embryo abortion to recover single plantlets. Here, we utilize transgenic switchgrass (Panicum virgatum L. cv Alamo) as a pollen donor in conjunction with antibiotic or herbicide selection for recovery of intra-and interspecific F 1 crosses by using developing ovules from the female parent and selecting for embryogenic cultures derived from the in situ immature embryo. Furthermore, by using this approach, several intravarietial crosses were generatedmore » between transgenic Alamo and the switchgrass varieties Kanlow, Blackwell and Cave-in-Rock as well as an interspecific cross with Atlantic coastal panicgrass. This procedure selected F 1 embryogenic callus produced from the developing embryo contained within isolated immature ovules. Several clonal plants were successfully regenerated from each cross. Southern blot, PCR, phenotypic analyses and genomic analysis confirmed F 1 hybrids. Using genotyping-bysequencing shows the hybridization of the recovered plants by determining the ratio of transgressive markers to total compared markers between parents and their potential offspring. The ratio of transgressive markers to total compared markers was significantly lower between parents and their predicted offspring than between parents and offspring unrelated to them. Our approach provides the possibility to move useful transgenes into varieties that are recalcitrant to direct transformation which can be optionally segregated thus useful to create new hybrids, as well as recovery of wide crosses that are either difficult or impossible using traditional techniques.« less

In situ embryo rescue for generation of wide intra- and interspecific hybrids of Panicum virgatum L.

DOE PAGES

Kausch, Albert P.; Tilelli, Michael; Hague, Joel; ...

2016-06-01

Wide crosses have been used for decades as a method for transferring novel genetic material and traits in plant breeding. Historically, many products of wide crosses require tedious and inefficient surgical embryo rescue prior to embryo abortion to recover single plantlets. Here, we utilize transgenic switchgrass (Panicum virgatum L. cv Alamo) as a pollen donor in conjunction with antibiotic or herbicide selection for recovery of intra-and interspecific F 1 crosses by using developing ovules from the female parent and selecting for embryogenic cultures derived from the in situ immature embryo. Furthermore, by using this approach, several intravarietial crosses were generatedmore » between transgenic Alamo and the switchgrass varieties Kanlow, Blackwell and Cave-in-Rock as well as an interspecific cross with Atlantic coastal panicgrass. This procedure selected F 1 embryogenic callus produced from the developing embryo contained within isolated immature ovules. Several clonal plants were successfully regenerated from each cross. Southern blot, PCR, phenotypic analyses and genomic analysis confirmed F 1 hybrids. Using genotyping-bysequencing shows the hybridization of the recovered plants by determining the ratio of transgressive markers to total compared markers between parents and their potential offspring. The ratio of transgressive markers to total compared markers was significantly lower between parents and their predicted offspring than between parents and offspring unrelated to them. Our approach provides the possibility to move useful transgenes into varieties that are recalcitrant to direct transformation which can be optionally segregated thus useful to create new hybrids, as well as recovery of wide crosses that are either difficult or impossible using traditional techniques.« less

Molecular patterns of X chromosome-linked color vision genes among 134 men of European ancestry.

PubMed Central

Drummond-Borg, M; Deeb, S S; Motulsky, A G

1989-01-01

We used Southern blot hybridization to study X chromosome-linked color vision genes encoding the apoproteins of red and green visual pigments in 134 unselected Caucasian men. One hundred and thirteen individuals (84.3%) had a normal arrangement of their color vision pigment genes. All had one red pigment gene; the number of green pigment genes ranged from one to five with a mode of two. The frequency of molecular genotypes indicative of normal color vision (84.3%) was significantly lower than had been observed in previous studies of color vision phenotypes. Color vision defects can be due to deletions of red or green pigment genes or due to formation of hybrid genes comprising portions of both red and green pigment genes [Nathans, J., Piantanida, T.P., Eddy, R.L., Shows, T.B., Jr., & Hogness, D.S. (1986) Science 232, 203-210]. Characteristic anomalous patterns were seen in 15 (11.2%) individuals: 7 (5.2%) had patterns characteristic of deuteranomaly (mild defect in green color perception), 2 (1.5%) had patterns characteristic of deuteranopia (severe defect in green color perception), and 6 (4.5%) had protan patterns (the red perception defects protanomaly and protanopia cannot be differentiated by current molecular methods). Previously undescribed hybrid gene patterns consisting of both green and red pigment gene fragments in addition to normal red and green genes were observed in another 6 individuals (4.5%). Only 2 of these patterns were considered as deuteranomalous. Thus, DNA testing detected anomalous color vision pigment genes at a higher frequency than expected from phenotypic color vision tests. Some color vision gene arrays associated with hybrid genes are likely to mediate normal color vision. Images PMID:2915991

In vivo modulation of androgen receptor by androgens.

PubMed

Kumar, V L; Majumder, P K; Kumar, V

2002-09-01

To study the effect of androgen and antiandrogen on the level of androgen receptor (AR) mRNA. The total RNA was extracted from the prostate and analyzed by slot blot analysis. The blots were hybridized with AR cDNA probe and 1A probe (internal control) and autoradiography was performed. The intensity of signal was measured with a densitometer and the ratio of AR RNA and 1A RNA was calculated. Androgenic deprivation produced by castration decreased the weight of the prostate and increased the levels of AR mRNA. Treatment of the castrated rats with testostrone increased the weight of prostate and decreased the levels of AR mRNA. Treatment of normal rats with flutamide decreased the weight of the gland and increased the levels of AR mRNA. Androgens produce proliferative effect on the prostate and negatively regulate the AR transcription.

Plasminogen activator inhibitor type 1 gene is located at region q21. 3-q22 of chromosome 7 and genetically linked with cystic fibrosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klinger, K.W.; Winqvist, R.; Riccio, A.

1987-12-01

The regional chromosomal location of the human gene for plasminogen activator inhibitor type 1 (PAI1) was determined by three independent methods of gene mapping. PAI1 was localized first to 7cen-q32 and then to 7q21.3-q22 by Southern blot hybridization analysis of a panel of human and mouse somatic cell hybrids with a PAI1 cDNA probe and in situ hybridization, respectively. The authors frequent HindIII restriction fragment length polymorphism (RFLP) of the PAI1 gene with an information content of 0.369. In family studies using this polymorphism, genetic linkage was found between PAI1 and the loci for erythropoietin (EPO), paraoxonase (PON), the metmore » protooncogene (MET), and cystic fibrosis (CF), all previously assigned to the middle part of the long arm of chromosome 7. The linkage with EPO was closest with an estimated genetic distance of 3 centimorgans, whereas that to CF was 20 centimorgans. A three-point genetic linkage analysis and data from previous studies showed that the most likely order of these loci is EPO, PAI1, PON, (MET, CF), with PAI1 being located centromeric to CF. The PAI1 RFLP may prove to be valuable in ordering genetic markers in the CF-linkage group and may also be valuable in genetic analysis of plasminogen activation-related diseases, such as certain thromboembolic disorders and cancer.« less

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

The Development of a Post-Baccalaureate Certificate Program in Molecular Diagnostics

PubMed Central

Williams, Gail S.; Brown, Judith D.; Keagle, Martha B.

2000-01-01

A post-baccalaureate certificate program in diagnostic molecular sciences was created in 1995 by the Diagnostic Genetic Sciences Program in the School of Allied Health at the University of Connecticut. The required on-campus lecture and laboratory courses include basic laboratory techniques, health care issues, cell biology, immunology, human genetics, research, management, and molecular diagnostic techniques and laboratory in molecular diagnostics. These courses precede a 6-month, full-time practicum at an affiliated full-service molecular laboratory. The practicum includes amplification and blotting methods, a research project, and a choice of specialized electives including DNA sequencing, mutagenesis, in situ hybridization methods, or molecular diagnostic applications in microbiology. Graduates of the program are immediately eligible to sit for the National Credentialing Agency examination in molecular biology to obtain the credential Clinical Laboratory Specialist in Molecular Biology (CLSp(MB). This description of the University of Connecticut program may assist other laboratory science programs in creating similar curricula. PMID:11232107

ZyFISH: A Simple, Rapid and Reliable Zygosity Assay for Transgenic Mice

PubMed Central

McHugh, Donal; O’Connor, Tracy; Bremer, Juliane; Aguzzi, Adriano

2012-01-01

Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR) which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH). The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations. PMID:22666404

Differential diagnosis between complete mole and hydropic abortus by deoxyribonucleic acid fingerprints.

PubMed

Nobunaga, T; Azuma, C; Kimura, T; Tokugawa, Y; Takemura, M; Kamiura, S; Saji, F; Tanizawa, O

1990-08-01

We used a new method of deoxyribonucleic acid fingerprint analysis to obtain the differential diagnosis between complete mole and hydropic abortus. This method with a deoxyribonucleic acid minisatellite probe requires only a small amount of tissue sample and peripheral blood, and presents individual specific restriction fragment length polymorphisms (deoxyribonucleic acid "fingerprints") by simultaneous detection of many hypervariable regions (minisatellite regions) widely dispersed in the human genome. Southern blot hybridization showed that in cases of complete mole, all polymorphic fragments were exclusively inherited from the father. Some of the polymorphic bands of paternal deoxyribonucleic acid were not observed in molar deoxyribonucleic acid. However, in the hydropic abortus, the polymorphic fragments could be traced back to its parent. These results indicate that deoxyribonucleic acid fingerprints could distinguish the abnormal fertilization of complete mole (androgenesis) from the normal fertilization of hydropic abortus by identifying the difference in genetic variations between complete mole and hydropic abortus at the deoxyribonucleic acid level.

Mechanisms of G1 cell cycle arrest and apoptosis in myeloma cells induced by hybrid-compound histone deacetylase inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujii, Seiko; Division of Maxillofacial Surgery, Kyushu Dental University; Okinaga, Toshinori

2013-05-10

Highlights: •Novel histone deacetylase inhibitor Ky-2, remarkably inhibits myeloma cell growth. •Ky-2 demonstrates no cytotoxicity against normal lymphocytic cells. •Ky-2 induces cell cycle arrest through the cell cycle-associated proteins. •Ky-2 induces Bcl-2-inhibitable apoptosis through a caspase-dependent cascade. -- Abstract: Objectives: Histone deacetylase (HDAC) inhibitors are new therapeutic agents, used to treat various types of malignant cancers. In the present study, we investigated the effects of Ky-2, a hybrid-compound HDAC inhibitor, on the growth of mouse myeloma cells. Materials and methods: Myeloma cells, HS-72, P3U1, and mouse normal cells were used in this study. Effect of HDAC inhibitors on cell viabilitymore » was determined by WST-assay and trypan blue assay. Cell cycle was analyzed using flow cytometer. The expression of cell cycle regulatory and the apoptosis associated proteins were examined by Western blot analysis. Hoechst’s staining was used to detect apoptotic cells. Results: Our findings showed that Ky-2 decreased the levels of HDACs, while it enhanced acetylation of histone H3. Myeloma cell proliferation was inhibited by Ky-2 treatment. Interestingly, Ky-2 had no cytotoxic effects on mouse normal cells. Ky-2 treatment induced G1-phase cell cycle arrest and accumulation of a sub-G1 phase population, while Western blotting analysis revealed that expressions of the cell cycle-associated proteins were up-regulated. Also, Ky-2 enhanced the cleavage of caspase-9 and -3 in myeloma cells, followed by DNA fragmentation. In addition, Ky-2 was not found to induce apoptosis in bcl-2 overexpressing myeloma cells. Conclusion: These findings suggest that Ky-2 induces apoptosis via a caspase-dependent cascade and Bcl-2-inhibitable mechanism in myeloma cells.« less

[Better performance of Western blotting: quick vs slow protein transfer, blotting membranes and the visualization methods].

PubMed

Kong, Ling-Quan; Pu, Ying-Hui; Ma, Shi-Kun

2008-01-01

To study how the choices of the quick vs slow protein transfer, the blotting membranes and the visualization methods influence the performance of Western blotting. The cellular proteins were abstracted from human breast cell line MDA-MB-231 for analysis with Western blotting using quick (2 h) and slow (overnight) protein transfer, different blotting membranes (nitrocellulose, PVDF and nylon membranes) and different visualization methods (ECL and DAB). In Western blotting with slow and quick protein transfer, the prestained marker presented more distinct bands on nitrocellulose membrane than on the nylon and PVDF membranes, and the latter also showed clear bands on the back of the membrane to very likely cause confusion, which did not occur with nitrocellulose membrane. PVDF membrane allowed slightly clearer visualization of the proteins with DAB method as compared with nitrocellulose and nylon membranes, and on the latter two membranes, quick protein transfer was likely to result in somehow irregular bands in comparison with slow protein transfer. With slow protein transfer and chemiluminescence for visualization, all the 3 membranes showed clear background, while with quick protein transfer, nylon membrane gave rise to obvious background noise but the other two membranes did not. Different membranes should be selected for immunoblotting according to the actual needs of the experiment. Slow transfer of the proteins onto the membranes often has better effect than quick transfer, and enhanced chemiluminescence is superior to DAB for protein visualization and allows highly specific and sensitive analysis of the protein expressions.

Mechanisms of allele-selective down-regulation of HLA class I in Burkitt's lymphoma.

PubMed

Imreh, M P; Zhang, Q J; de Campos-Lima, P O; Imreh, S; Krausa, P; Browning, M; Klein, G; Masucci, M G

1995-07-04

Burkitt lymphomas (BL) that arise in HLA-AII-positive individuals are characterized by selective loss/down-regulation of the HLA AII polypeptide. We have investigated the molecular basis of such down-regulation by comparing 5 pairs of BL lines and Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines (LCL) derived from the normal B cells of the same individuals. The presence of apparently intact HLA AII genes was confirmed in all 5 BL/LCL pairs by polymerase chain reaction (PCR) typing and by Southern-blot hybridization with HLA A locus-specific probes. Northern-blot analysis with locus- and allele-specific probes revealed a significantly lower expression or absence of AII-specific mRNA in all 5 BL lines compared to the corresponding LCLs. Up-regulation of AII-specific mRNA was achieved by IFN alpha treatment of 2 BL lines with low HLA AII expression (BL-28 and BL-72) while the treatment had no effect in 3 BL lines (WWI-BL, WW2-BL and BL41) that did not express the endogenous gene. HLA AII expression was restored by transfection of the gene in WWI-BL whereas transfectants of BL-41 remained AII-negative. An HLA-AII-promoter-driven chloramphenicol acetyl transferase reporter gene (pAIICAT) was active in WWI-BL but not in BL-41. HLA-AII was expressed in hybrids of BL-41 with an AII-positive LCL, while expression of the endogenous HLA AII gene could not be restored by fusion of BL-41 with an AII-negative LCL, although an adequate set of transcription factors was present in the hybrid. Our results suggest that genetic defects and lack of transcription factors may contribute to the selective down-regulation of HLA AII in BL cells.

The western blot

USDA-ARS?s Scientific Manuscript database

Western blotting is a technique that involves the separation of proteins by gel electrophoresis, their blotting or transfer to a membrane, and selective immunodetection of an immobilized antigen. This is an important and routine method for protein analysis that depends on the specificity of antibod...

Identification of parathyroid hormone-related protein in canine apocrine adenocarcinoma of the anal sac.

PubMed

Rosol, T J; Capen, C C; Danks, J A; Suva, L J; Steinmeyer, C L; Hayman, J; Ebeling, P R; Martin, T J

1990-03-01

The presence of parathyroid hormone-related protein (PTHrP) in the apocrine adenocarcinoma tumor line (CAC-8) derived from a hypercalcemic dog was demonstrated by western and northern blot analyses. Western blots of CAC-8 tumor extracts revealed a major protein with a molecular weight of approximately 18,000 daltons that cross-reacted with antiserum to human PTHrP. Northern blots demonstrated multiple-sized messenger RNA transcripts in CAC-8 that hybridized to a full-length cDNA probe to human PTHrP. Adenocarcinomas derived from apocrine glands of the anal sac also were stained immunohistochemically for antigens that cross-react with antiserum to human PTHrP. The tumor line (CAC-8) maintained in nude mice stained positively for PTHrP in 13 of 24 tumors. Three of ten apocrine adenocarcinomas from dogs with hypercalcemia stained for PTHrP, whereas zero of ten tumors were positive from normocalcemic dogs. Normal canine epidermal keratinocytes and areas of squamous metaplasia in a perianal gland carcinoma also were positive for PTHrP. These data demonstrated that canine tissues contained a homologue to human PTHrP that likely is important in the pathogenesis of humoral hypercalcemia of malignancy.

Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexander, A.J.; Bailey, E.; Woodward, J.G.

1986-03-05

Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a /sup 32/P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphismmore » was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family.« less

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Fusion of CCL21 non-migratory active breast epithelial and breast cancer cells give rise to CCL21 migratory active tumor hybrid cell lines.

PubMed

Berndt, Benjamin; Haverkampf, Sonja; Reith, Georg; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas

2013-01-01

The biological phenomenon of cell fusion has been linked to tumor progression because several data provided evidence that fusion of tumor cells and normal cells gave rise to hybrid cell lines exhibiting novel properties, such as increased metastatogenic capacity and an enhanced drug resistance. Here we investigated M13HS hybrid cell lines, derived from spontaneous fusion events between M13SV1-EGFP-Neo breast epithelial cells exhibiting stem cell characteristics and HS578T-Hyg breast cancer cells, concerning CCL21/CCR7 signaling. Western Blot analysis showed that all cell lines varied in their CCR7 expression levels as well as differed in the induction and kinetics of CCR7 specific signal transduction cascades. Flow cytometry-based calcium measurements revealed that a CCL21 induced calcium influx was solely detected in M13HS hybrid cell lines. Cell migration demonstrated that only M13HS hybrid cell lines, but not parental derivatives, responded to CCL21 stimulation with an increased migratory activity. Knockdown of CCR7 expression by siRNA completely abrogated the CCL21 induced migration of hybrid cell lines indicating the necessity of CCL21/CCR7 signaling. Because the CCL21/CCR7 axis has been linked to metastatic spreading of breast cancer to lymph nodes we conclude from our data that cell fusion could be a mechanism explaining the origin of metastatic cancer (hybrid) cells.

Fusion of CCL21 Non-Migratory Active Breast Epithelial and Breast Cancer Cells Give Rise to CCL21 Migratory Active Tumor Hybrid Cell Lines

PubMed Central

Reith, Georg; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S.; Dittmar, Thomas

2013-01-01

The biological phenomenon of cell fusion has been linked to tumor progression because several data provided evidence that fusion of tumor cells and normal cells gave rise to hybrid cell lines exhibiting novel properties, such as increased metastatogenic capacity and an enhanced drug resistance. Here we investigated M13HS hybrid cell lines, derived from spontaneous fusion events between M13SV1-EGFP-Neo breast epithelial cells exhibiting stem cell characteristics and HS578T-Hyg breast cancer cells, concerning CCL21/CCR7 signaling. Western Blot analysis showed that all cell lines varied in their CCR7 expression levels as well as differed in the induction and kinetics of CCR7 specific signal transduction cascades. Flow cytometry-based calcium measurements revealed that a CCL21 induced calcium influx was solely detected in M13HS hybrid cell lines. Cell migration demonstrated that only M13HS hybrid cell lines, but not parental derivatives, responded to CCL21 stimulation with an increased migratory activity. Knockdown of CCR7 expression by siRNA completely abrogated the CCL21 induced migration of hybrid cell lines indicating the necessity of CCL21/CCR7 signaling. Because the CCL21/CCR7 axis has been linked to metastatic spreading of breast cancer to lymph nodes we conclude from our data that cell fusion could be a mechanism explaining the origin of metastatic cancer (hybrid) cells. PMID:23667660

Sperm flagella protein components: Human meichroacidin constructed by the membrane occupation and recognition nexus motif

PubMed Central

MATSUOKA, YASUHIRO; NISHIMURA, HIROMI; NUMAZAWA, KAHORI; TSUCHIDA, JUNJI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; MATSUMIYA, KIYOMI; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

2005-01-01

Background and Aims:   In a previous study, the authors of the present study cloned mouse meichroacidin (MCA), which is expressed in stages of spermatogenesis from pachytene spermatocytes through round spermatid germ cells. MCA protein contains the membrane occupation and recognition nexus (MORN) motif and localizes to a male meiotic metaphase chromosome. Recently, a MCA homolog of carp (Cyprinus carpio), MORN motif‐containing sperm‐specific axonemal protein (MSAP), was reportedly identified and localized in sperm flagella. Present knowledge of human spermiogenesis requires the identification of proteins in human sperm. The present study identified the human orthologue of MCA. Methods:   Colony hybridization using a human testis plasmid cDNA library was carried out to clone human MCA (h‐MCA) cDNA. Northern blot, Western blot, and immunohistochemical analyses were carried out. Results:   h‐MCA was found to be specifically expressed in the testes. The h‐MCA amino acid sequence shared 79.8% identity with mouse MCA and contained MORN motifs. h‐MCA localized in the sperm flagellum and basal body, as does MSAP in carp. Conclusion:   Expression and localization analyses showed that h‐MCA is a component of the sperm flagellum and basal body and might play an important role in the development of the sperm flagellum in humans. (Reprod Med Biol 2005; 4: 213–219) PMID:29699225

Production of insulin-like growth factor binding proteins by small-cell lung cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaques, G.; Kiefer, P.; Rotsch, M.

1989-10-01

Conditioned serum-free media (CM) from small-cell lung cancer (SCLC) cell lines were examined for the presence of insulin-like growth-factor-binding proteins (IGF-BP). 6/9 SCLC cell lines secreted binding proteins with high affinity for IGFs. When ({sup 125}I)IGF-1 or ({sup 125}I)IGF-II was incubated with the CMs, complexes of tracer with proteins could be demonstrated by gel filtration, by precipitation with polyethylenglycol, and after adsorption of unbound tracer with activated charcoal. Analysis of binding data according to the method of Scatchard resulted in linear plots for IGF-I and IGF-II. Cross-linking of ({sup 125}I)IGF-I or ({sup 125}I)IGF-II to the CMs followed by sodium dodecylmore » sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under nonreducing conditions revealed the presence of IGF-BPs with molecular masses in the range of 24-32 kDa. Northern blot hybridization with an IGF-BP cDNA probe encoding a low-molecular-weight IGF-BP from a human placenta cDNA library and Western blot analysis with a corresponding polyclonal antibody showed no expression of this gene. These data demonstrate that SCLC cell lines release IGF-BPs in culture supernatants, which differ from IGF-BPs detected in liver and placenta. These IGF-BPs might be important mediators in the autocrine/paracrine growth regulation of IGFs in SCLC.« less

Northern blots: capillary transfer of RNA from agarose gels and filter hybridization using standard stringency conditions.

PubMed

Rio, Donald C

2015-03-02

In this protocol, an RNA sample, fractionated by gel electrophoresis, is transferred from the gel onto a membrane by capillary transfer. Short-wave UV light is used to fix the transferred RNA to the membrane. The membrane is then pretreated to block nonspecific probe-binding sites, and hybridization of the immobilized RNA to a (32)P-labeled DNA or RNA probe specific for the mRNA of interest is performed. Finally, the membrane is washed and subjected to autoradiography or phosphorimaging. Because exposure to UV cross-links the RNA to the membrane, the membrane can be stripped and hybridized with other probes. The procedure is suitable for detecting poly(A)(+)-selected mRNA or mRNA in total cellular RNA if the target transcript is relatively abundant. Using DNA or RNA probes labeled to 1 × 10(8)-10 × 10(8) cpm/µg, it should be possible to detect ∼5 pg of a specific RNA. © 2015 Cold Spring Harbor Laboratory Press.

Other notable protein blotting methods: a brief review.

PubMed

Kurien, Biji T; Scofield, R Hal

2015-01-01

Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

A brief review of other notable protein blotting methods.

PubMed

Kurien, Biji T; Scofield, R Hal

2009-01-01

A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

Retrospective Study of Hemoparasites in Cattle in Southern Italy by Reverse Line Blot Hybridization

PubMed Central

CECI, Luigi; IARUSSI, Fabrizio; GRECO, Beatrice; LACINIO, Rosanna; FORNELLI, Stefania; CARELLI, Grazia

2014-01-01

ABSTRACT Tick-borne diseases are widespread in tropical and temperate regions and are responsible for important economic losses in those areas. In order to assess the presence and prevalence of various pathogens in southern Italy, we retrospectively analyzed cattle blood samples collected for a previous study in 2000 using reverse line blot (RLB) hybridization. The study had been carried out in three regions of southern Italy on 1,500 randomly selected and apparently healthy adult cattle. RLB showed that 43.7% of the cattle were positive for nine different species of hemoparasites with either a single infection or a mixed infection. Theileria buffeli was the most common species found, being present in 27.3% of the animals, followed by Anaplasma marginale in 18.1%, Anaplasma centrale in 13.8%, Babesia bigemina and Anaplasma bovis in 4.2%, Anaplasma phagocytophilum in 1.7%, Babesia bovis in 1.6%, Babesia major in 0.2% and Babesia divergens in 0.1%. Complete blood counts showed different degrees of anemia in 363 animals (24.2%) and of these, 169 were RLB-positive for at least one pathogen. Among the ticks that were collected from the cattle, the following species were identified: Rhipicephalus bursa, Ixodes ricinus, Hyalomma marginatum, Boophilus annulatus, Dermacentor marginatus and Haemaphysalis (sulcata, parva, inermis and punctata). The results obtained confirmed the spread of endemic tick-borne pathogens in the regions studied. PMID:24614604

Retrospective study of hemoparasites in cattle in southern Italy by reverse line blot hybridization.

PubMed

Ceci, Luigi; Iarussi, Fabrizio; Greco, Beatrice; Lacinio, Rosanna; Fornelli, Stefania; Carelli, Grazia

2014-06-01

Tick-borne diseases are widespread in tropical and temperate regions and are responsible for important economic losses in those areas. In order to assess the presence and prevalence of various pathogens in southern Italy, we retrospectively analyzed cattle blood samples collected for a previous study in 2000 using reverse line blot (RLB) hybridization. The study had been carried out in three regions of southern Italy on 1,500 randomly selected and apparently healthy adult cattle. RLB showed that 43.7% of the cattle were positive for nine different species of hemoparasites with either a single infection or a mixed infection. Theileria buffeli was the most common species found, being present in 27.3% of the animals, followed by Anaplasma marginale in 18.1%, Anaplasma centrale in 13.8%, Babesia bigemina and Anaplasma bovis in 4.2%, Anaplasma phagocytophilum in 1.7%, Babesia bovis in 1.6%, Babesia major in 0.2% and Babesia divergens in 0.1%. Complete blood counts showed different degrees of anemia in 363 animals (24.2%) and of these, 169 were RLB-positive for at least one pathogen. Among the ticks that were collected from the cattle, the following species were identified: Rhipicephalus bursa, Ixodes ricinus, Hyalomma marginatum, Boophilus annulatus, Dermacentor marginatus and Haemaphysalis (sulcata, parva, inermis and punctata). The results obtained confirmed the spread of endemic tick-borne pathogens in the regions studied.

Clinical and epidemiological correlations between the infection with HPV 16 and HPV 18 and female cervical lesions.

PubMed

Stoian, M; Repanovici, R; Corniţescu, F

1995-01-01

A number of 66 specimens from female cervical lesions were examined for infection with human papillomavirus (HPV) types 6, 11, 16, and 18 by nucleic acid hybridization in dot-blot techniques and 35 sera were tested by the immunodot-blot technique, in order to detect the presence of anti E4 and E7 HPV protein antibodies. The findings were compared with the histologic diagnosis. Fifty-six per cent of specimens contained HPV DNA sequences. In 47% of specimens from cervical carcinoma, HPV 11 was detected in 4 cases, HPV 16 in 21 cases, and HPV 18 in 7 cases. Serum antibodies against HPV 16 E4 and HPV 16 E7 occurred in all the cases of uterine carcinoma, in 4 of 10 cases of CIN I-II, and in 3 of 5 sera obtained from apparently healthy women. The analysis of risk factors disclosed the early onset of sexual activity, a relatively high number of births and abortions before the age of 22 years, the use of oral oestroprogestative contraceptive agents, the presence in anamnesis of genital infections with bacterial flora--Candida albicans, Trichomonas vaginalis, Chlamydia trachomatis, Mycoplasma, etc. Our results showed that HPV typing by nucleic acid hybridization was useful for differentiating low- from high-risk cervical lesions and also tried to elucidate the risk factors associated with HPV infections and progression to malignancy.

Practical diagnostic testing for human immunodeficiency virus.

PubMed Central

Jackson, J B; Balfour, H H

1988-01-01

Since the discovery of human immunodeficiency virus (HIV) as the causative agent of acquired immunodeficiency syndrome in 1983, there has been a proliferation of diagnostic tests. These assays can be used to detect the presence of HIV antibody, HIV antigen, HIV ribonucleic and deoxyribonucleic acids, and HIV reverse transcriptase. Enzyme-linked immunosorbent assays, Western blot, radioimmunoprecipitation assays, indirect immunofluorescence assays, reverse transcriptase assays, and several molecular hybridization techniques are currently available. Enzyme-linked immunosorbent, Western blot, and indirect immunofluorescence assays for HIV antibody are very sensitive, specific, and adaptable to most laboratories. An enzyme-linked immunosorbent assay for HIV antigen is also readily adaptable to most laboratories and will be commercially available soon. While the other assays are more tedious, they are valuable confirmatory tests and are suitable for reference laboratories. The biohazards of performing HIV testing can be minimized with proper biosafety measures. Images PMID:3060241

cDNA cloning and analysis of RNA 2 of a Prunus stem pitting isolate of tomato ringspot virus.

PubMed

Hadidi, A; Powell, C A

1991-10-01

Recombinant plasmids containing sequences derived from the genome of a tomato ringspot virus (TomRSV) isolate associated with both stem pitting disease of stone fruits and apple union necrosis and decline were constructed. Selected inserts were subcloned into the polylinker region of the SP6 transcription vector pSP64. Using the SP6 promoter flanking this region, high specific activity 32P-labelled cRNA probes were generated by SP6 RNA polymerase. cRNA probes were specific for TomRSV RNA 2 present in purified virions or in extracts from woody and herbacous hosts. No sequence relatedness was detected between TomRSV RNA 2 and genomic RNA from tobacco ringspot, arabis mosaic, strawberry latent ringspot, or cucumber mosaic virus in Northern blot analysis using TomRSV cRNA probes. These probes detected TomRSV infection in woody and herbaceous hosts in dot-blot hybridization assays.

Chloroplast and mitochondrial DNA are paternally inherited in Sequoia sempervirens D. Don Endl

PubMed Central

Neale, David B.; Marshall, Kimberly A.; Sederoff, Ronald R.

1989-01-01

Restriction fragment length polymorphisms in controlled crosses were used to infer the mode of inheritance of chloroplast DNA and mitochondrial DNA in coast redwood (Sequoia sempervirens D. Don Endl.). Chloroplast DNA was paternally inherited, as is true for all other conifers studied thus far. Surprisingly, a restriction fragment length polymorphism detected by a mitochondrial probe was paternally inherited as well. This polymorphism could not be detected in hybridizations with chloroplast probes covering the entire chloroplast genome, thus providing evidence that the mitochondrial probe had not hybridized to chloroplast DNA on the blot. We conclude that mitochondrial DNA is paternally inherited in coast redwood. To our knowledge, paternal inheritance of mitochondrial DNA in sexual crosses of a multicellular eukaryotic organism has not been previously reported. Images PMID:16594091

Detection of Human Papillomavirus Type 2 Related Sequence in Oral Papilloma

PubMed Central

Yamaguchi, Taihei; Shindoh, Masanobu; Amemiya, Akira; Inoue, Nobuo; Kawamura, Masaaki; Sakaoka, Hiroshi; Inoue, Masakazu; Fujinaga, Kei

1998-01-01

Oral papilloma is a benign tumourous lesion. Part of this lesion is associated with human papillomavirus (HPV) infection. We analysed the genetical and histopathological evidence for HPV type 2 infection in three oral papillomas. Southern blot hybridization showed HPV 2a sequence in one lesion. Cells of the positive specimen appeared to contain high copy numbers of the viral DNA in an episomal state. In situ staining demonstrated virus capsid antigen in koilocytotic cells and surrounding cells in the hyperplastic epithelial layer. Two other specimens contained no HPV sequences by labeled probe of full length linear HPVs 2a, 6b, 11, 16, 18, 31 and 33 DNA under low stringency hybridization conditions. These results showed the possibility that HPV 2 plays a role in oral papilloma. PMID:9699941

[Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].

PubMed

Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

2004-01-01

18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

Enzymatic production of single-molecule FISH and RNA capture probes.

PubMed

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Risk assessment of transgenic apomictic tetraploid bahiagrass, cytogenetics, breeding behavior and performance of intra-specific hybrids.

PubMed

Sandhu, Sukhpreet; James, Victoria A; Quesenberry, Kenneth H; Altpeter, Fredy

2009-11-01

Pollen-mediated gene transfer from stress tolerant or herbicide-resistant transgenic plants may cause environmental or agronomic problems. Apomictic seed production found in some bahiagrass cultivars may serve as a natural transgene containment system. Under greenhouse conditions, the average gene transfer frequency from an herbicide-resistant apomictic tetraploid to a population of sexual diploid bahiagrass genotypes or apomictic tetraploid bahiagrass was 0.16% when the transgenic pollen donor was placed at 0.5-1.5 m distance from the non-transgenic pollen receptors. The herbicide-resistant hybrids were characterized for transgene integration, expression and ploidy, by Southern blot analysis, immuno-chromatography and flow cytometry, respectively. Hybrids resulting from open pollination of non-transgenic diploid female plants with transgenic tetraploid male plants were triploids or near-triploids, with 2n = 26-34. These hybrids displayed a wide range of phenotypic variability, including some non-persistent or non-flowering dwarf-type hybrids with good vigor, or hybrids with vegetative growth similar to non-transgenic plants, but with significantly reduced seed set. Non-flowering aneu-triploids with good vigor/field performance will provide the highest level of transgene containment. Embryo sac analysis of pollinated spikelets confirmed a high proportion of aborted ovules. An apospory-linked RFLP marker was detected in 13 of the 15 near-triploid hybrids. All flowering aneuploid hybrids displayed significantly reduced seed set, and none of the sexual near-triploid hybrids produced any seeds. All tetraploid gene transfer events carried the apospory-linked RFLP marker, suggesting that despite the presence of the aposporus locus, a low degree of sexuality co-exists in apomictic tetraploid cultivars. Thus, tetraploid apomictic bahiagrass does not provide complete transgene containment, although intra-specific gene transfer is drastically reduced compared to sexually reproducing perennial grasses.

Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

PubMed

Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

2006-01-01

In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.

Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes andmore » probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.« less

Role of the RS1 sequence of the cholera vibrio in amplification of the segment of plasmid DNA carrying the gene of resistance to tetracycline and the genes of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fil'kova, S.L.; Il'ina, T.S.; Gintsburg, A.L.

1988-11-01

The hybrid plasmid pCO107, representing cointegrate 14(2)-5(2) of two plasmids, an F-derivative (pOX38) and a PBR322-derivative (pCT105) with an RS1 sequence of the cholera vibrio cloned in its makeup, contains two copes of RS1 at the sites of union of the two plasmids. Using a tetracycline resistance marker (Tc/sup R/) of the plasmid pCT105, clones were isolated which have an elevated level of resistance to tetracycline (an increase of from 4- to 30-fold). Using restriction analysis and the Southern blot method of hybridization it was shown that the increase in the level of resistance of tetracycline is associated with themore » amplification of pCT105 portion of the cointegrate, and that the process of amplification is governed by the presence of direct repeats of the RS1 sequence at its ends. The increase in the number of copies of the pCT105 segment, which contains in its composition the genes of cholera toxin (vct), is accompanied by an increase in toxin production.« less

Telomere content measurement in human hematopoietic cells: Comparative analysis of qPCR and Flow-FISH techniques.

PubMed

Wand, Taylor; Fang, Mike; Chen, Christina; Hardy, Nathan; McCoy, J Philip; Dumitriu, Bogdan; Young, Neal S; Biancotto, Angélique

2016-10-01

Abnormal telomere lengths have been linked to cancer and other hematologic disorders. Determination of mean telomere content (MTC) is traditionally performed by Southern blotting and densitometry, giving a mean telomere restriction fragment (TRF) value for the total cell population studied. Here, we compared a quantitative Polymerase Chain Reaction approach (qPCR) and a flow cytometric approach, fluorescence in situ hybridization (Flow-FISH), to evaluate telomere content distribution in total patient peripheral blood mononuclear cells or specific cell populations. Flow-FISH is based on in situ hybridization using a fluorescein-labeled peptide nucleic acid (PNA) (CCCTAA) 3 probe and DNA staining with propidium iodide. We showed that both qPCR and Flow-FISH provide a robust measurement, with Flow-FISH measuring a relative content longer than qPCR at a single cell approach and that TRF2 fluorescence intensity did not correlate with MTC. Both methods showed comparable telomere content reduction with age, and the rate of relative telomere loss was similar. Published 2016 Wiley Periodicals Inc. This article is a US government work and, as such, is in the public domain in the United States of America. Published 2016 Wiley Periodicals Inc. This article is a US government work and, as such, is in the public domain in the United States of America.

[Progress of researches on mechanism of acupuncture therapy underlying improvement of acute cerebral hemorrhage].

PubMed

Wang, Fan; Wang, Hai-qiao; Dong, Gui-rong

2011-04-01

In the present paper, the authors review the progress of researches on the mechanism of acupuncture therapy underlying improvement of acute cerebral hemorrhage from experimental studies and research methods. The effects of acupuncture intervention mainly involve (1) lessening inflammatory reactions, (2) reducing impairment of free radicals and excitatory amino acids on cerebral neurons, (3) balancing release of vascular bioactive substances to increase regional cerebral blood flow, and (4) promoting repair and regeneration of the neural tissue, etc. In regard to the research methods, many new biological techniques such as biological molecular approaches, neuro-cellular chemical methods, reverse transcription-polymerase chain reaction (RT-PCR) or quantitative real time-PCR, situ hybridization, western blotting, electron microscope, etc., have been extensively applied to researches on the underlying mechanism of acupuncture therapy for cerebral infarction. In addition, the authors also pointed out that in spite of achieving some bigger progresses in experimental studies, most of the results basically reflect static, isolated and regional changes rather than dynamic and whole body changes. For this reason, more vivo research techniques and noninvasive research methods are highly recommended to be used in the future research on the underlying mechanisms of acupuncture therapy for acute cerebral ischemia.

Expression of the mRNAs encoding the limbic system-associated membrane protein (LAMP): II. Fetal rat brain.

PubMed

Pimenta, A F; Reinoso, B S; Levitt, P

1996-11-11

The limbic system-associated membrane protein (LAMP) is a 64-68 kDa neuronal surface glycoprotein expressed in cortical and subcortical regions of the limbic system of the adult and developing rat central nervous system (CNS). LAMP is a member of the immunoglobulin superfamily of cell adhesion molecules with three Ig domains and is highly conserved between rat and human. In this study, the temporal and spatial pattern of lamp gene expression during fetal rat development was analyzed by using Northern blot analysis and in situ hybridization. In Northern blot analysis, two lamp mRNA transcripts, 1.6 kb and 8.0 kb, identical in size to those present in the adult rat nervous system, were detected in developing neural tissue. In situ hybridization analysis showed close correlation, though not identity, between the expression of lamp mRNAs and the distribution of LAMP in limbic regions of the developing rat CNS, indicative of a more complex regulation of gene expression than was previously thought to be the case. The expression of lamp mRNAs is first detected on about embryonic day (E) 13. The hybridization signal is not seen in the proliferative ventricular zone at any level of the neuraxis, indicating that lamp is expressed in postmitotic neurons. In the cerebral cortex, lamp mRNAs are expressed in limbic cortical regions, such as the perirhinal cortex, prefrontal cortex, and cingulate cortex. In the hippocampus, the hybridization signal is observed in Ammon's horn by E18. The neostriatum, amygdaloid complex, and most hypothalamic areas express lamp mRNAs from early stages (E13-E14) in a pattern consistent with the onset of neurogenesis. The emerging patterns of lamp expression at the outset are similar to those seen in adult hypothalamus and dorsal thalamus. Although the hybridization signal is observed in some nonlimbic areas, including midbrain and hindbrain structures, intense labeling is evident in more classic limbic regions. The high levels of expression of lamp in limbic regions, beginning in early developmental stages, combined with the results of previous functional in vitro and in vivo studies, support a role for LAMP as a recognition molecule involved in the formation of limbic connections.

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

Automated capillary Western dot blot method for the identity of a 15-valent pneumococcal conjugate vaccine.

PubMed

Hamm, Melissa; Ha, Sha; Rustandi, Richard R

2015-06-01

Simple Western is a new technology that allows for the separation, blotting, and detection of proteins similar to a traditional Western except in a capillary format. Traditionally, identity assays for biological products are performed using either an enzyme-linked immunosorbent assay (ELISA) or a manual dot blot Western. Both techniques are usually very tedious, labor-intensive, and complicated for multivalent vaccines, and they can be difficult to transfer to other laboratories. An advantage this capillary Western technique has over the traditional manual dot blot Western method is the speed and the automation of electrophoresis separation, blotting, and detection steps performed in 96 capillaries. This article describes details of the development of an automated identity assay for a 15-valent pneumococcal conjugate vaccine, PCV15-CRM197, using capillary Western technology. Copyright © 2015 Elsevier Inc. All rights reserved.

Western Blot of Stained Proteins from Dried Polyacrylamide Gels

NASA Technical Reports Server (NTRS)

Gruber, Claudia; Stan-Lotter, Helga

1996-01-01

Western blotting of proteins is customarily performed following their separation on polyacrylamide gels, either prior to staining (1) or, as recently reported, following staining (2). We describe here Western blotting with stained gels, which had been dried and some of which had been stored for years. This procedure permits immunological analysis of proteins, to which antisera may have become available only later, or where the application of newly developed sensitive detection methods is desired. Once rehydration of the gels is achieved, proteins can be-transferred to blotting membranes by any appropriate protocol. Proteins stained with Coomassie Blue have to be detected with a non-chromogenic method, such as the film-based enhanced chemiluminescence (ECL)2) procedure (3). Silver stained proteins, which transfer in the colorless form, may be visualized by any detection method, although, because of the usually very low amounts of proteins, detection by ECL is preferable. Blotting of stained proteins from rehydrated gels is as rapid and as quantitative as from freshly prepared gels, in contrast to blotting from wet stained gels, which requires extensive washing and results in low transfer efficiency (2). Together with a photographic record of the gel pattern, unambiguous identification of immunoreactive proteins from complex mixtures is possible. Some further applications of this work are discussed.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Next-Generation Molecular Histology Using Highly Multiplexed Ion Beam Imaging (MIBI) of Breast Cancer Tissue Specimens for Enhanced Clinical Guidance

DTIC Science & Technology

2017-07-01

panels of MIBI multiplexed in situ detection reagents, and compare the quantitative data to the conventional clinically derived “one at a time” and...Measure standard curves for each analyte against western blots using cell lines and tumor samples. Compare quantitation dynamic ranges to...GSTM1, CD68, BAG1, ER, PGR, BCL2, SCUBE2, ACTB, GAPDH, RPLPO, GUS, TFRC) IIa. Compare hybridization results for mass tagged probe designs from both

The Use of Biotin to Demonstrate Immunohistochemistry, Western Blotting, and Dot Blots in University Practical Classes

ERIC Educational Resources Information Center

Millar, Thomas James; Knighton, Ronald; Chuck, Jo-Anne

2012-01-01

Immunological detection of proteins is an essential method to demonstrate to undergraduate biology students, however, is often difficult in resource and time poor student laboratory sessions. This method describes a failsafe method to rapidly and economically demonstrate this technique using biotinylated proteins or biotin itself as targets for…

Western blotting.

PubMed

Kurien, Biji T; Scofield, R Hal

2006-04-01

Western blotting (protein blotting or immunoblotting) is a powerful and important procedure for the immunodetection of proteins post-electrophoresis, particularly proteins that are of low abundance. Since the inception of the protocol for protein transfer from an electrophoresed gel to a membrane in 1979, protein blotting has evolved greatly. The scientific community is now confronted with a variety of ways and means to carry out this transfer. This review describes the various procedures that have been used to transfer proteins from a gel to a membrane based on the principles of simple diffusion, vacuum-assisted solvent flow and electrophoretic elution. Finally, a brief description of methods generally used to detect antigens on blots is also described.

Diverse mechanisms of plant resistance to cauliflower mosaic virus revealed by leaf skeleton hybridization.

PubMed

Melcher, U; Brannan, C M; Gardner, C O; Essenberg, R C

1992-01-01

Plants not hosts for cauliflower mosaic virus (CaMV) may prevent systemic CaMV infection by interfering with dissemination of infection through the plant or by preventing viral replication and maturation. Leaf skeleton hybridization allows distinction between these two barriers. The technique assesses the spatial distribution of CaMV in an inoculated leaf by hybridization of a skeleton of the leaf with a CaMV DNA probe. Leaves or leaflets of soybean, cucumber, peanut, tomato, lettuce, spinach, pepper, onion, wheat, maize and barley, inoculated with CaMV DNA or CaMV virions were processed for leaf skeleton hybridization either immediately after inoculation or two weeks thereafter. Autoradiographic images of soybean and cucumber skeletons had many dark spots suggesting that CaMV DNA replication and local spread had occurred. Images of onion leaf skeletons prepared two weeks after inoculation with CaMV DNA had fewer spots. To test whether these spots resulted from CaMV replication, DNA was extracted from inoculated onion leaves and analyzed by electrophoresis, blotting and hybridization. Molecules recovered two weeks after inoculation resembled those inoculated, indicating absence of replication. For the other species, we found no evidence of local spread of CaMV infections. Thus, many plant species resist systemic CaMV infection by preventing replication or local spread of CaMV, while others solely prevent systemic movement of infection.

Endopolygalacturonase in Apples (Malus domestica) and Its Expression during Fruit Ripening.

PubMed Central

Wu, Q.; Szakacs-Dobozi, M.; Hemmat, M.; Hrazdina, G.

1993-01-01

The activity of polygalacturonase (PG) has been detected in ripe McIntosh apples (Malus domestica Borkh. cv McIntosh) both by enzyme activity measurement and immunoblotting using an anti-tomato-PG antibody preparation. PG activity increased during fruit ripening and remained steady, or decreased slightly, after 5 months of controlled atmospheric storage. The enzyme had a relative molecular weight of 45,000 as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 56,000 to 61,000 when determined by gel filtration. Viscosity and reducing end group measurements with a commercial pectin preparation showed that the enzyme is endo acting. In RNA and DNA blot hybridization experiments, a full-length tomato PG cDNA hybridized with the apple RNA and DNA, showing the identity of genes encoding the activity of the enzyme in tomato and apple. PMID:12231813

Detection of Leishmania in Unaffected Mucosal Tissues of Patients with Cutaneous Leishmaniasis Caused by Leishmania (Viannia) Species

PubMed Central

Figueroa, Roger Adrian; Lozano, Leyder Elena; Romero, Ibeth Cristina; Cardona, Maria Teresa; Prager, Martin; Pacheco, Robinson; Diaz, Yira Rosalba; Tellez, Jair Alexander; Saravia, Nancy Gore

2016-01-01

Background Leishmania (Viannia) species are the principal cause of mucosal leishmaniasis. The natural history and pathogenesis of mucosal disease are enigmatic. Parasitological evaluation of mucosal tissues has been constrained by the invasiveness of conventional sampling methods. Methods We evaluated the presence ofLeishmania in the mucosa of 26 patients with cutaneous leishmaniasis and 2 patients with mucocutaneous leishmaniasis. Swab samples of the nasal mucosa, tonsils, and conjunctiva were analyzed using polymerase chain reaction with LV-B1 primers and Southern blot hybridization. Results Two patients with mucocutaneous leishmaniasis and 21 (81%) of 26 patients with cutaneous leishmaniasis had Leishmania kinetoplast minicircle DNA (kDNA) in mucosal tissues. kDNA was amplified from swab samples of nasal mucosa from 14 (58%) of 24 patients, tonsils from 13 (46%) of 28 patients, and conjunctiva from 6 (25%) of 24 patients. kDNA was detected in the mucosa of patients with cutaneous disease caused by Leishmania panamensis, Leishmania guyanensis, and Leishmania braziliensis. Conclusion The asymptomatic presence of parasites in mucosal tissues may be common in patients with Leishmania (Viannia) infection. PMID:19569974

Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

PubMed

Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

2013-08-01

Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

Screening differentially expressed genes in an amphipod (Hyalella azteca) exposed to fungicide vinclozolin by suppression subtractive hybridization.

PubMed

Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H

2014-01-01

Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.

Cinnamate-4-hydroxylase expression in arabidopsis. Regulation in response to development and the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bell-Lelong, D.A.; Cusumano, J.C.; Meyer, K.

1997-03-01

Cinnamate-r-hydroxylase (C4H) is the first Cyt P450-dependent monooxygenase of the phenylpropanoid pathway. To study the expression of this gene in Arabidopsis thaliana, a C4H cDNA clone from the Arabidopsis expressed sequence tag database was identified and used to isolate its corresponding genomic clone. The entire C4H coding sequence plus 2.9 kb of its promoter were isolated on a 5.4-kb HindIII fragment of this cosmid. Inspection of the promoter sequence revealed the presence of a number of putative regulatory motifs previously identified in the promoters of other phenylpropanoid pathway genes. The expression of C4H was analyzed by RNA blot hybridization analysismore » and in transgenic Arabidopsis carrying a C4H-{beta}-glucuronidase transcriptional fusion. C4H message accumulation was light-dependent, but was detectable even in dark-grown seedlings. Consistent with these data, C4H mRNA was accumulated to light-grown levels in etiolated det1-1 mutant seedlings. C4H is widely expressed in various Arabidopsis tissues, particularly in roots and cells undergoing lignification. The C4H-driven {beta}-glucuronidase expression accurately reflected the tissue-specificity and wound-inducibility of the C4H promoter indicated by RNA blot hybridization analysis. A modest increase in C4H expression was observed in the tt8 mutant of Arabidopsis. 77 refs., 5 figs.« less

Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain

NASA Technical Reports Server (NTRS)

Murashov, A. K.; Wolgemuth, D. J.

1996-01-01

We have examined the spatial pattern of expression of a member of the hsp70 gene family, hsp70.2, in the mouse central nervous system. Surprisingly, RNA blot analysis and in situ hybridization revealed abundant expression of an 'antisense' hsp70.2 transcript in several areas of adult mouse brain. Two different transcripts recognized by sense and antisense riboprobes for the hsp70.2 gene were expressed in distinct and only partially overlapping neuronal populations. RNA blot analysis revealed low levels of the 2.7 kb transcript of hsp70.2 in several areas of the brain, with highest signal in the hippocampus. Abundant expression of a slightly larger (approximately 2.8 kb) 'antisense' transcript was detected in several brain regions, notably in the brainstem, cerebellum, mesencephalic tectum, thalamus, cortex, and hippocampus. In situ hybridization revealed that the sense and antisense transcripts were both predominantly neuronal and localized to the same cell types in the granular layer of the cerebellum, trapezoid nucleus of the superior olivary complex, locus coeruleus and hippocampus. The hsp70.2 antisense transcripts were particularly abundant in the frontal cortex, dentate gyrus, subthalamic nucleus, zona incerta, superior and inferior colliculi, central gray, brainstem, and cerebellar Purkinje cells. Our findings have revealed a distinct cellular and spatial localization of both sense and antisense transcripts, demonstrating a new level of complexity in the function of the heat shock genes.

Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

PubMed

Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

2010-03-01

Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

Relative IGF-1 and IGF-2 gene expression in maternal and fetal tissues from diabetic swine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolverton, C.K.; Leaman, D.W.; White, M.E.

1990-02-26

Fourteen pregnant, crossbred gilts were utilized in this study. Seven gilts were injected with alloxan (50 mg/kg) at day 75 of gestation to induce diabetes. Gilts underwent caesarean section on day 105 of gestation. Samples were collected from maternal skeletal muscle, adipose tissue, uterus and endometrium; and from fetal skeletal muscle, adipose tissue, placenta, liver, lung, kidney, heart, brain and spleen. Tissues were frozen in liquid nitrogen for later analysis of IGF-1 and IGF-2 gene expression. Samples were pooled and total RNA was isolated using the guanidine isothiocynate method. Total mRNA was analyzed by dot blot hybridization. Blots were probedmore » with {sup 32}P-cDNA for porcine IGF-1 and rat IGF-2. IGF-1 gene expression in maternal tissues was unaffected by diabetes. Maternal diabetes increased IGF-2 mRNA in maternal adipose tissue but exhibited no effect in muscle or uterus. Expression of IGF-2 by maternal endometrium was decreased by diabetes. Maternal diabetes induced an increase in IGF-1 gene expression in muscle and placenta while causing an increase in IGF-2 expression in fetal liver and placenta. IGF-2 mRNA was lower in lung from fetuses of diabetic mothers than in controls. These results suggest that maternal diabetes alters IGF-1 and IGF-2 gene expression in specific tissues and differential regulation of these genes appears to exist in the mother and developing fetus.« less

Demonstration of interleukin-1 beta transcripts in acute myeloblastic leukemic cells by in situ hybridization.

PubMed

Nakamura, M; Kanakura, Y; Furukawa, Y; Ernst, T J; Griffin, J D

1990-07-01

The cells from some patients with acute myeloblastic leukemia will secrete autostimulatory cytokines in tissue culture without the addition of stimulators such as phorbol 12-myristate 13-acetate. Production of interleukin-1 beta (IL-1 beta), for example, has been observed in up to 50% of cases. In order to investigate the nature of the cell secreting IL-1 beta in AML, we used an antisense RNA probe to detect specific IL-1 beta transcripts in individual leukemic cells by in situ hybridization. In fresh, uncultured cells, IL-1 beta transcripts were observed in 1-40% of undifferentiated leukemic blast cells in 17 of 19 cases. In situ hybridization was at least as sensitive as Northern blot analysis in detecting IL-1 beta transcripts. No correlation of IL-1 beta transcript expression with FAB classification was observed. Normal blood and bone marrow mononuclear cells did not contain cells expressing IL-1 beta transcripts. These results support the concept that the regulation of cytokine genes in AML cells is aberrant.

The effect of growth medium salinity of Photobacterium damselae subsp. piscicida on the immune response of hybrid bass (Morone saxatilis x M. chrysops).

PubMed

Nitzan, S; Shwartsburd, B; Heller, E D

2004-02-01

Photobacterium damselae subsp. piscicida (P. damselae) was grown on various media and the effect of media salinity on certain immune responses of hybrid bass was studied. In Israel, pasteurellosis outbreaks have not been reported at water salinities below 1.38 per thousand. During vaccination experiments the salinity of the medium on which P. damselae is grown, was shown to affect stimulation of the immune system. No correlation was found between antibody response and protection. Bacterial envelopes separated by electrophoresis and subjected to western blot analysis revealed an antibody response against some protein bands. Band sequencing was performed to identify the protein stimulating the immune response. Sequence identity of 80% was seen in 10-amino-acid overlap of the 36-kDa band with a specific gene of alkalophilic Bacillus firmus. A preparation of P. damselae grown in a 2.5% NaCl medium at 25 degrees C is the most effective vaccine against pasteurellosis, providing hybrid bass with quite good protection.

A specific DNA probe which identifies Babesia bovis in whole blood.

PubMed

Petchpoo, W; Tan-ariya, P; Boonsaeng, V; Brockelman, C R; Wilairat, P; Panyim, S

1992-05-01

A genomic library of Babesia bovis DNA from the Mexican strain M was constructed in plasmid pUN121 and cloned in Escherichia coli. Several recombinants which hybridized strongly to radioactively labeled B. bovis genomic DNA in an in situ screening were selected and further analyzed for those which specifically hybridized to B. bovis DNA. It was found that pMU-B1 had the highest sensitivity, detecting 25 pg of purified B. bovis DNA, and 300 parasites in 10 microliters of whole infected blood, or 0.00025% parasitemia. pMU-B1 contained a 6.0 kb B. bovis DNA insert which did not cross-hybridize to Babesia bigemina, Trypanosoma evansi, Plasmodium falciparum, Anaplasma marginale, Boophilus microplus and cow DNA. In the Southern blot analysis of genomic DNA, pMU-B1 could differentiate between two B. bovis geographic isolates, Mexican strain M and Thai isolate TS4. Thus, the pMU-B1 probe will be useful in the diagnosis of Babesia infection in cattle and ticks, and in the differentiation of B. bovis strains.

Protein analysis through Western blot of cells excised individually from human brain and muscle tissue

PubMed Central

Koob, A.O.; Bruns, L.; Prassler, C.; Masliah, E.; Klopstock, T.; Bender, A.

2016-01-01

Comparing protein levels from single cells in tissue has not been achieved through Western blot. Laser capture microdissection allows for the ability to excise single cells from sectioned tissue and compile an aggregate of cells in lysis buffer. In this study we analyzed proteins from cells excised individually from brain and muscle tissue through Western blot. After we excised individual neurons from the substantia nigra of the brain, the accumulated surface area of the individual cells was 120,000, 24,000, 360,000, 480,000, 600,000 μm2. We used an optimized Western blot protocol to probe for tyrosine hydroxylase in this cell pool. We also took 360,000 μm2 of astrocytes (1700 cells) and analyzed the specificity of the method. In muscle we were able to analyze the proteins of the five complexes of the electron transport chain through Western blot from 200 human cells. With this method, we demonstrate the ability to compare cell-specific protein levels in the brain and muscle and describe for the first time how to visualize proteins through Western blot from cells captured individually. PMID:22402104

Protein analysis through Western blot of cells excised individually from human brain and muscle tissue.

PubMed

Koob, A O; Bruns, L; Prassler, C; Masliah, E; Klopstock, T; Bender, A

2012-06-15

Comparing protein levels from single cells in tissue has not been achieved through Western blot. Laser capture microdissection allows for the ability to excise single cells from sectioned tissue and compile an aggregate of cells in lysis buffer. In this study we analyzed proteins from cells excised individually from brain and muscle tissue through Western blot. After we excised individual neurons from the substantia nigra of the brain, the accumulated surface area of the individual cells was 120,000, 24,000, 360,000, 480,000, 600,000 μm2. We used an optimized Western blot protocol to probe for tyrosine hydroxylase in this cell pool. We also took 360,000 μm2 of astrocytes (1700 cells) and analyzed the specificity of the method. In muscle we were able to analyze the proteins of the five complexes of the electron transport chain through Western blot from 200 human cells. With this method, we demonstrate the ability to compare cell-specific protein levels in the brain and muscle and describe for the first time how to visualize proteins through Western blot from cells captured individually. Copyright © 2012 Elsevier Inc. All rights reserved.

Fluorescence-based Western blotting for quantitation of protein biomarkers in clinical samples.

PubMed

Zellner, Maria; Babeluk, Rita; Diestinger, Michael; Pirchegger, Petra; Skeledzic, Senada; Oehler, Rudolf

2008-09-01

Since most high throughput techniques used in biomarker discovery are very time and cost intensive, highly specific and quantitative analytical alternative application methods are needed for the routine analysis. Conventional Western blotting allows detection of specific proteins to the level of single isotypes while its quantitative accuracy is rather limited. We report a novel and improved quantitative Western blotting method. The use of fluorescently labelled secondary antibodies strongly extends the dynamic range of the quantitation and improves the correlation with the protein amount (r=0.997). By an additional fluorescent staining of all proteins immediately after their transfer to the blot membrane, it is possible to visualise simultaneously the antibody binding and the total protein profile. This allows for an accurate correction for protein load. Applying this normalisation it could be demonstrated that fluorescence-based Western blotting is able to reproduce a quantitative analysis of two specific proteins in blood platelet samples from 44 subjects with different diseases as initially conducted by 2D-DIGE. These results show that the proposed fluorescence-based Western blotting is an adequate application technique for biomarker quantitation and suggest possibilities of employment that go far beyond.

Development of a nanogold slot blot inhibition assay for the detection of antibodies against bovine herpesvirus type 1.

PubMed

Japolla, Greice; Cunha-Junior, Jair Pereira; Pajuaba, Ana Claudia Arantes Marquez; Taketomi, Ernesto Akio; Bührer-Sékula, Samira; Bataus, Luiz Artur Mendes; de Souza, Guilherme Rocha Lino

2018-06-01

Bovine herpesvirus type 1 (BoHV-1) is recognized as an important pathogen causing respiratory, reproductive, and neurological disorders in cattle and is associated with economic losses to animal industry. Accurate diagnostic methods are needed for prevention of disease transmission. While the virus neutralization test is considered the gold standard method, it requires maintenance of the virus and cell cultures, which is time consuming and expensive. Serological techniques such as enzyme-linked immunosorbent assay (ELISA) are widely applied, as these are easy to perform and provide quick results. In the present study, a nanogold slot blot inhibition assay was developed for the serological diagnosis of BoHV-1 and compared with standard ELISA and horseradish peroxidase (HRP) slot blot assays. Of 42 serum samples tested by ELISA, 32 (76.2%) were positive and 10 (23.8%), were negative. The sensitivity and specificity of the nanogold slot blot inhibition assay was similar to that observed for ELISA and HRP slot blot assays, and a strong correlation was observed between the tests. Thus, the nanogold slot blot inhibition assay may serve as an efficient and rapid alternative to ELISA in settings, where plate-reading equipment is lacking.

Identification of gene products suppressed by human immunodeficiency virus type 1 infection or gp120 exposure of primary human astrocytes by rapid subtraction hybridization.

PubMed

Su, Zao-Zhong; Kang, Dong-Chul; Chen, Yinming; Pekarskaya, Olga; Chao, Wei; Volsky, David J; Fisher, Paul B

2003-06-01

Neurodegeneration and human immunodeficiency virus type 1 (HIV-1)-associated dementia (HAD) are the major disease manifestations of HIV-1 colonization of the central nervous system (CNS). In the brain, HIV-1 replicates in microglial cells and infiltrating macrophages and it persists in a low-productive, noncytolytic state in astrocytes. Astrocytes play critical roles in the maintenance of the brain microenvironment, responses to injury, and in neuronal signal transmission, and disruption of these functions by HIV-1 could contribute to HAD. To better understand the potential effects of HIV-1 on astrocyte biology, the authors investigated changes in gene expression using an efficient and sensitive rapid subtraction hybridization approach, RaSH. Primary human astrocytes were isolated from abortus brain tissue, low-passage cells were infected with HIV-1 or mock infected, and total cellular RNAs were isolated at multiple time points over a period of 1 week. This approach is designed to identify gene products modulated early and late after HIV-1 infection and limits the cloning of genes displaying normal cell-cycle fluctuations in astrocytes. By subtracting temporal cDNAs derived from HIV-1-infected astrocytes from temporal cDNAs made from uninfected cells, 10 genes displaying reduced expression in infected cells, termed astrocyte suppressed genes (ASGs), were identified and their suppression was confirmed by Northern blot hybridization. Both known and novel ASGs, not reported in current DNA databases, that are down-regulated by HIV-1 infection are described. Northern blotting confirms suppression of the same panel of ASGs by treatment of astrocytes with recombinant HIV-1 envelope glycoprotein, gp120. These results extend our previous analysis of astrocyte genes induced or enhanced by HIV-1 infection and together they suggest that HIV-1 and viral proteins have profound effects on astrocyte physiology, which may influence their function in the CNS.

Induction of Syndecan-4 by Organic-Inorganic Hybrid Molecules with a 1,10-Phenanthroline Structure in Cultured Vascular Endothelial Cells.

PubMed

Hara, Takato; Kojima, Takayuki; Matsuzaki, Hiroka; Nakamura, Takehiro; Yoshida, Eiko; Fujiwara, Yasuyuki; Yamamoto, Chika; Saito, Shinichi; Kaji, Toshiyuki

2017-02-08

Organic-inorganic hybrid molecules constitute analytical tools used in biological systems. Vascular endothelial cells synthesize and secrete proteoglycans, which are macromolecules consisting of a core protein and glycosaminoglycan side chains. Although the expression of endothelial proteoglycans is regulated by several cytokines/growth factors, there may be alternative pathways for proteoglycan synthesis aside from downstream pathways activated by these cytokines/growth factors. Here, we investigated organic-inorganic hybrid molecules to determine a variant capable of analyzing the expression of syndecan-4, a transmembrane heparan-sulfate proteoglycan, and identified 1,10-phenanthroline ( o -Phen) with or without zinc (Zn-Phen) or rhodium (Rh-Phen). Bovine aortic endothelial cells in culture were treated with these compounds, and the expression of syndecan-4 mRNA and core proteins was determined by real-time reverse transcription polymerase chain reaction and Western blot analysis, respectively. Our findings indicated that o -Phen and Zn-Phen specifically and strongly induced syndecan-4 expression in cultured vascular endothelial cells through activation of the hypoxia-inducible factor-1α/β pathway via inhibition of prolyl hydroxylase-domain-containing protein 2. These results demonstrated an alternative pathway involved in mediating induction of endothelial syndecan-4 expression and revealed organic-inorganic hybrid molecules as effective tools for analyzing biological systems.

Genetic and physical analyses of Methylobacterium organophilum XX genes encoding methanol oxidation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Tam, P.E.; Bastien, C.A.

When allyl alcohol was used as a suicide substrate, spontaneous mutants and UV light- and nitrous acid-generated mutants of Methylobacterium organophilum XX were selected which grew on methylamine but not on methanol. There was no detectable methanol dehydrogenase (MDH) activity in crude extracts of these mutants, yet Western blots revealed that some mutants still produced MDH protein. Complementation of 50 mutants by a cosmid gene bank of M. organophilum XX demonstrated that three major regions of the genome, each of which was separated by a minimum of 40 kilobases, were required for expression of active MDH. By subcloning and Tn5more » insertion mutagenesis of subcloned fragments, at least 11 genes clustered within these three regions were subsequently identified. The identity of the MDH structural gene, which was initially determined by hybridization to the structural gene of Methylobacterium sp. strain AM1, was confirmed by Western blot analysis of an MDH-..beta..-galactosidase fusion protein.« less

Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody

PubMed Central

Fritzinger, Angela E.; Toney, Denise M.; MacLean, Rebecca C.; Marciano-Cabral, Francine

2006-01-01

Naegleria fowleri, the causative agent of primary amebic meningoencephalitis, is resistant to complement lysis. The presence of a complement regulatory protein on the surface of N. fowleri was investigated. Southern blot and Northern blot analyses demonstrated hybridization of a radiolabeled cDNA probe for CD59 to genomic DNA and RNA, respectively, from pathogenic N. fowleri. An 18-kDa immunoreactive protein was detected on the membrane of N. fowleri by Western immunoblot and immunofluorescence analyses with monoclonal antibodies for human CD59. Complement component C9 immunoprecipitated with the N. fowleri “CD59-like” protein from amebae incubated with normal human serum. In contrast, a gene or protein similar to CD59 was not detected in nonpathogenic, complement-sensitive N. gruberi amebae. Collectively, our studies suggest that a protein reactive with antibodies to human CD59 is present on the surface of N. fowleri amebae and may play a role in resistance to lysis by cytolytic proteins. PMID:16428768

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

Novel Platinum (Pt)-Vandetanib Hybrid Compounds: Design, Synthesis and Investigation of Anti-cancer Activity and Mechanism of Action

NASA Astrophysics Data System (ADS)

Fei, Rong

Purpose: Lung cancer is one of the most common cancers and non-small cell lung cancer (NSCLC) accounts for 80-85% of lung cancers. 70% of individuals with NSCLC harboring somatic mutations in exons of the epidermal growth factor receptor (EGFR) gene that encode tyrosine kinase domain. EGFR tyrosine kinase inhibitors (TKIs) are promising molecular targeted therapy for NSCLC with sensitizing EGFR mutations. However, secondary mutation of EGFR after treatment of TKIs develops resistance. Vandetanib is introduced to overcome erlotinib resistance as a multi-targeted TKI. However, its anticancer effect is still compromised by EGFR T790M mutation. Therefore, new molecular anticancer strategies are necessarily needed. In this study, vandetanib is incorporated with Pt-based anticancer agents as hybrid compounds, aiming to circumvent TKI resistance. Furthermore, hybrid compounds are investigated in cisplatin resistant problem to expect to overcome resistance by introduction of vandetanib. Methods: Three novel Pt-vandetanib hybrid compounds were synthesized and its physicochemical properties were characterized. Anticancer activity and cytotoxicity were evaluated by sulforhodamine B assay and lactate dehydrogenase release. Docking simulation was performed to investigate the interaction of compounds with EGFR harboring different mutations. Inhibition efficacy of hybrids to kinases was evaluated by kinase inhibition profiling service and cell-free kinase inhibition assay. Mechanistic studies on cytotoxicity activity of the hybrid compounds were carried out. DNA damage response of hybrid compounds was further investigated in KB cells. The cytotoxicity of hybrids was tested in cisplatin resistant KB CP20 cells. Mechanistic of anticancer activity was studied to test inhibition on oncoprotein CIP2Aand DNA damage. Results: Platinum-vandetanib hybrid compounds were synthesized and test to be stable under extracellular condition. Hybrids reacted with 5'-GMP2- and glutathione, and both of them formed mono-dentate adducts. Moreover, hybrid compounds exhibited low toxicity in human normal kidney cells. Compounds maintained the inhibition selectivity towards EGFR from the results of kinase inhibition profiling and cell-free kinase inhibition assay. Hybrids formed strong H-bond at D800 on EGFR. Pt-vandetanib hybrids were highly effective against HCC827 cells harboring sensitizing EGFR mutation. Importantly, relative resistant rate of hybrids were much smaller than vandetanib in H1975 cells. Western blot analysis results revealed that the hybrid compounds could efficiently inhibit EGFR phosphorylation in a dose dependent manner in HCC827. While, inhibition of p-EGFR was not as good as the original TKI in H1975 cells. However, the hybrid compounds induced DNA damage and caused apoptosis of the NSCLC cells. Both of the two pathways were contributed to cancer cell death and overcome vandetanib resistance. Pt-vandetanib hybrids showed little resistance in cisplatin resistant cell line KB-CP20. Drug accumulation evaluation revealed that cisplatin accumulation in CP20 cells decreased to one eighth of that in the parental KB3.1 cells. While hybrids maintained similar drug accumulation extent in both cells lines. Mechanistic study showed that hybrid compounds could induce DNA damage and cause apoptosis, whereas cisplatin failed to cause DNA damage in KB-CP20 cells. Oncoprotein CIP2A was overexpressed in CP20 cell and was ascribed to CDDP resistance. The hybrids inhibited CIP2A expression and downstream AKT phosphorylation. It was hypothesized that downregulation of CIP2A contributed to circumvention platinum resistance. Conclusion: Novel Pt-vandetanib hybrid compounds were able to overcome vandetanib resistance in H1975 cells by maintaining inhibition to the EGFR and inducing DNA damage and apoptosis. Moreover, Pt-vandetanib hybrid compounds behaved low toxicity and overcome cisplatin resistance by being "non-substrate" to efflux transporter and successfully causing DNA damage. Hybrids were found to downregulate oncogene CIP2A expression level. The novel Pt-vandetanib hybrid compounds are potent for further development.

A complete YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13) and refined localization of the SNRPN gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mutirangura, A.; Jayakumar, A.; Sutcliffe, J.S.

1993-12-01

Since a previous report of a partial YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13), a complete contig spanning approximately 3.5 Mb has been developed. YACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of [approximately]1 per 200 kb. Overlaps between YAC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of YAC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contigmore » between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/Angelman chromosome region contig are ordered as follows: cen-IR39-ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10-1-CMW1-tel. This YAC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. 36 refs., 2 figs., 2 tabs.« less

Rapid detection of 21-hydroxylase deficiency mutations by allele-specific in vitro amplification and capillary zone electrophoresis.

PubMed

Carrera, P; Barbieri, A M; Ferrari, M; Righetti, P G; Perego, M; Gelfi, C

1997-11-01

A quick diagnosis of the classic form of 21-hydroxylase deficiency (simple virilizing and salt wasting) is of great importance, especially for prenatal diagnosis and treatment in pregnancies at risk. A method for simultaneous detection of common point mutations in the P450c21 B gene is here proposed by combining a nested PCR amplification refractory mutation system (ARMS) with capillary zone electrophoresis (CZE) in sieving liquid polymers. In the first PCR, B genes are selectively amplified. In the nested reaction, ARMS-detected wild-type and mutated alleles are separately pooled and resolved by CZE. CZE is performed in coated capillaries in the presence of 30 g/L hydroxyethyl cellulose in the background electrolyte for size separation of the DNA analytes. For high-sensitivity detection the electrophoresis buffer contains the fluorescent dye SYBR Green I. Laser-induced fluorescence detection is obtained by excitation at 488 nm and signal collection at 520 nm. Specificity and reproducibility of the protocols were established by using samples from 75 Italian families with 21-hydroxylase deficiency already genotyped by allele-specific oligonucleotide hybridization or direct sequencing. Whereas dot-blot is time consuming because of the high number of hybridizations with radioactive probes, this present protocol is more rapid, giving sufficient separation on CZE after PCR reactions without preconcentration or desalting of samples.

The gene coding for the B cell surface protein CD19 is localized on human chromosome 16p11.

PubMed

Stapleton, P; Kozmik, Z; Weith, A; Busslinger, M

1995-02-01

The CD19 gene codes for one of the earliest markers of the human B cell lineage and is a target for the B lymphoid-specific transcription factor BSAP (Pax-5). The transmembrane protein CD19 has been implicated in controlling proliferation of mature B lymphocytes by modulating signal transduction through the antigen receptor. In this study, we have employed Southern blot and fluorescence in situ hybridization analyses to localize the CD19 gene to human chromosome 16p11.

Leukemia-associated gene rearrangements in blood mononuclears of subjects in long terms after radiation exposure.

PubMed

Butenko, Z A; Smirnova, I A; Zak, K P; Kishinskaja, E G; Janok, E A

2000-03-01

The results of electron microscopy and molecular genetic study of blood mononuclears of 220 clean-up workers after 7-10 years since Chernobyl accident are presented. An increase of lymphocytes with altered ultrastructure of nuclei and membrane has been observed. Structural polymorphism of leukemia associated bcr and rRNA genes has been analyzed using Southern blot hybridization. Allelic polymorphism of bcr gene with allele distribution characteristic of myeloid leukemia and rearrangements of rRNA genes have been revealed in 11,5% of clean-up workers under study.

Sex reversal in the mouse (Mus musculus) is caused by a recurrent nonreciprocal crossover involving the x and an aberrant y chromosome.

PubMed

Singh, L; Jones, K W

1982-02-01

Satellite DNA (Bkm) from the W sex-determining chromosome of snakes, which is related to sequences on the mouse Y chromosome, has been used to analyze the DNA and chromosomes of sex-reversed (Sxr) XXSxr male mice. Such mice exhibit a male-specific Southern blot Bkm hybridization pattern, consistent with the presence of Y-chromosome DNA. In situ hybridization of Bkm to chromosomes of XXSxr mice shows an aberrant concentration of related sequences on the distal terminus of a large mouse chromosome. The XYSxr carrier male, however, shows a pair of small chromosomes, which are presumed to be aberrant Y derivatives. Meiosis in the XYSxr mouse involves transfer of chromatin rich in Bkm-related DNA from the Y-Y1 complex to the X distal terminus. We suggest that this event is responsible for the transmission of the Sxr trait.

The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

PubMed Central

Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

1983-01-01

The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

Polymorphic human somatostatin gene is located on chromosome 3.

PubMed Central

Naylor, S L; Sakaguchi, A Y; Shen, L P; Bell, G I; Rutter, W J; Shows, T B

1983-01-01

Somatostatin is a 14-amino-acid neuropeptide and hormone that inhibits the secretion of several peptide hormones. The human gene for somatostatin SST has been cloned, and the sequence has been determined. This clone was used as a probe in chromosome mapping studies to detect the human somatostatin sequence in human-rodent hybrids. Southern blot analysis of 41 hybrids, including some containing translocations of human chromosomes, placed SST in the q21 leads to qter region of chromosome 3. Human DNAs from unrelated individuals were screened for restriction fragment polymorphisms detectable by the somatostatin gene probe. Two polymorphisms were found: (i) an EcoRI variant located at the 3' end of the gene, found in Caucasian, U.S. Black, and Asian populations with a frequency of approximately 0.10 and (ii) a BamHI variant in the intron, which occurs in Caucasians at a frequency of 0.13. Images PMID:6133281

Fiber type-specific analysis of AMPK isoforms in human skeletal muscle: advancement in methods via capillary nanoimmunoassay.

PubMed

Tobias, Irene S; Lazauskas, Kara K; Arevalo, Jose A; Bagley, James R; Brown, Lee E; Galpin, Andrew J

2018-04-01

Human skeletal muscle is a heterogeneous mixture of multiple fiber types (FT). Unfortunately, present methods for FT-specific study are constrained by limits of protein detection in single-fiber samples. These limitations beget compensatory resource-intensive procedures, ultimately dissuading investigators from pursuing FT-specific research. Additionally, previous studies neglected hybrid FT, confining their analyses to only pure FT. Here we present novel methods of protein detection across a wider spectrum of human skeletal muscle FT using fully automated capillary nanoimmunoassay (CNIA) technology. CNIA allowed a ~20-fold-lower limit of 5'-AMP-activated protein kinase (AMPK) detection compared with Western blotting. We then performed FT-specific assessment of AMPK expression as a proof of concept. Individual human muscle fibers were mechanically isolated, dissolved, and myosin heavy chain (MHC) fiber typed via SDS-PAGE. Single-fiber samples were combined in pairs and grouped into MHC I, MHC I/IIa, MHC IIa, and MHC IIa/IIx for expression analysis of AMPK isoforms α 1 , α 2 , β 1 , β 2 , γ 2 , and γ 3 with a tubulin loading control. Significant FT-specific differences were found for α 2 (1.7-fold higher in MHC IIa and MHC IIa/IIx vs. others), γ 2 (2.5-fold higher in MHC IIa vs. others), and γ 3 (2-fold higher in MHC IIa and 4-fold higher in MHC IIa/IIx vs. others). Development of a protocol that combines the efficient and sensitive CNIA technology with comprehensive SDS-PAGE fiber typing marks an important advancement in FT-specific research because it allows more precise study of the molecular mechanisms governing metabolism, adaptation, and regulation in human muscle. NEW & NOTEWORTHY We demonstrate the viability of applying capillary nanoimmunoassay technology to the study of fiber type-specific protein analysis in human muscle fibers. This novel technique enables a ~20-fold-lower limit of protein detection compared with traditional Western blotting methods. Combined with SDS-PAGE methods of fiber typing, we apply this technique to compare 5'-AMP-activated protein kinase isoform expression in myosin heavy chain (MHC) I, MHC I/IIa, MHC IIa, and MHC IIa/IIx fiber types.

Detection of Proteins on Blot Membranes

PubMed Central

Goldman, Aaron; Harper, Sandra; Speicher, David W.

2017-01-01

Staining of blot membranes enables the visualization of bound proteins. Proteins are usually transferred to blot membranes by electroblotting, by direct spotting of protein solutions, or by contact blots. Staining allows the efficiency of transfer to the membrane to be monitored. This unit describes protocols for staining proteins after electroblotting from polyacrylamide gels to blot membranes such as polyvinylidene difluoride (PVDF), nitrocellulose, or nylon membranes. The same methods can be used if proteins are directly spotted, either manually or using robotics. Protocols are included for seven general protein stains (amido black, Coomassie blue, Ponceau S, colloidal gold, colloidal silver, India ink, and MemCode) and three fluorescent protein stains (fluorescamine, IAEDANS, and SYPRO Ruby). Also included is an in-depth discussion of the different blot membrane types and the compatibility of different protein stains with downstream applications, such as immunoblotting or N-terminal Edman sequencing. PMID:27801518

Detection of Proteins on Blot Membranes.

PubMed

Goldman, Aaron; Harper, Sandra; Speicher, David W

2016-11-01

Staining of blot membranes enables the visualization of bound proteins. Proteins are usually transferred to blot membranes by electroblotting, by direct spotting of protein solutions, or by contact blots. Staining allows the efficiency of transfer to the membrane to be monitored. This unit describes protocols for staining proteins after electroblotting from polyacrylamide gels to blot membranes such as polyvinylidene difluoride (PVDF), nitrocellulose, or nylon membranes. The same methods can be used if proteins are directly spotted, either manually or using robotics. Protocols are included for seven general protein stains (amido black, Coomassie blue, Ponceau S, colloidal gold, colloidal silver, India ink, and MemCode) and three fluorescent protein stains (fluorescamine, IAEDANS, and SYPRO Ruby). Also included is an in-depth discussion of the different blot membrane types and the compatibility of different protein stains with downstream applications, such as immunoblotting or N-terminal Edman sequencing. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Cloning of genes required for hypersensitivity and pathogenicity in Pseudomonas syringae pv. aptata.

PubMed

Minardi, P

1995-01-01

A genomic library of Pseudomonas syringae pv. aptata strain NCPPB 2664, which causes bacterial blight of sugar beet, lettuce and other plants, was constructed in the cosmid vector pCPP31. The 13.4 kb EcoRI fragment of the cosmid pHIR11, containing the hrp (hypersensitive response and pathogenicity) gene cluster of the closely related bacterium Pseudomonas syringae pv. syringae strain 61, was used as a probe to identify a homologous hrp gene cluster in P. syringae pv. aptata. Thirty of 2500 cosmid clones, screened by colony hybridization, gave a strong hybridization signal with the probe, but none of these conferred to the non-pathogenic bacterium, Pseudomonas fluorescens, the ability to elicit the hypersensitive response (HR) in tobacco. Southern blot analysis of EcoRI-digested genomic DNA of P. syringae pv. aptata showed hybridizing bands of 12 kb and 4.4 kb. Only a 12 kb fragment hybridized in digests of the cosmids. Cosmid clone pCPP1069 was mutagenized with Tn10-minitet and marker-exchanged into the genome of P. syringae pv. aptata. Three resulting prototrophic mutant strains failed to elicit the HR in tobacco and to cause disease in lettuce. The DNA flanking the Tn10-minitet insertions from mutated derivatives of pCPP1069 hybridized with the 10.6 kb Bg/II fragment of pHIR11. These results indicate that P. syringae pv. aptata harbours hrp genes that are similar to, but arranged differently from, homologous hrp genes of P. syringae pv. syringae.

Correction of glucocerebrosidase deficiency after retroviral-mediated gene transfer into hematopoietic progenitor cells from patients with Gaucher disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fink, J.K.; Correll, P.H.; Perry, L.K.

1990-03-01

Retroviral gene transfer has been used successfully to correct the glucocerebrosidase (GCase) deficiency in primary hematopoietic cells from patients with Gaucher disease. For this model of somatic gene therapy, the authors developed a high-titer, amphotropic retroviral vector designated NTG in which the human GCase gene was driven by the mutant polyoma virus enhancer/herpesvirus thymidine kinase gene (tk) promoter (Py{sup +}/Htk). NTG normalized GCase activity in transduced Gaucher fibroblasts and efficiently infected human monocytic and erythroleukemic cell lines. RNA blot-hybridization (Northern blot) analysis of these hemaptopoietic cell lines showed unexpectedly high-level expression from the Moloney murine leukemia virus long terminal repeatmore » (Mo-MLV LTR) and levels of Py{sup +}/Htk enhancer/promoter-initiated human GCase RNA that approximated endogenous GCase RNA levels. Furthermore, NTG efficiently infected human hematopoietic progenitor cells. Detection of the provirus in approximately one-third of NTG-infected progenitor colonies that had not been selected in G418-containing medium indicates that relative resistance to G418 underestimated the actual gene transfer efficiency. Northern blot analysis of NTG-infected, progenitor-derived cells showed expression from both the Mo-MLV LTR and the Py{sup +}/Htk enhancer/promoter. NTG-transduced hematopoietic progenitor cells from patients with Gaucher disease generated progeny in which GCase activity has been normalized.« less

Isolation and expression of homeobox genes from the embryonic chicken eye.

PubMed

Dhawan, R R; Schoen, T J; Beebe, D C

1997-06-11

To identify homeobox-containing genes that may play a role in the differentiation of ocular tissues. Total RNA was isolated from microdissected chicken embryo eye tissues at 3.5 days of development (embryonic day 3.5; E3.5). An "anchor-oligo-dT primer" was used for the synthesis of cDNA. Degenerate oligonucleotides designed from highly-conserved sequences in the third helix of the homeobox and the "anchor-primer" were used to amplify cDNAs by polymerase chain reaction (PCR). PCR products were cloned and sequenced. The spatial and temporal expression of selected transcripts was mapped by whole-mount in situ hybridization and northern blot analysis. After sequencing eighteen clones we identified a member of the distal-less family (dlx-3) in cDNA from presumptive neural retina and three chicken homologs of the Xenopus "anterior neural fold" (Xanf-1) in cDNA from anterior eye tissue. Dlx transcripts were mapped by in situ hybridization. Expression began at Hamburger and Hamilton stage 14 (E2.5) and was widely distributed in embryonic mesenchyme on E3 and E4. Expression increased in the retina during early development and persisted until after hatching. The one anf clone selected for further study was not detected by in situ or northern blot analysis. It is feasible to isolate homeobox cDNAs directly from microdissected embryonic tissues. Chicken dlx-3 mRNA has a wider distribution in the embryo than expected, based on the expression of the mouse homolog. Dlx-3 may play a role in establishing or maintaining the differentiation of the retina.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Expression and imprinting of MAGEL2 suggest a role in Prader-willi syndrome and the homologous murine imprinting phenotype.

PubMed

Lee, S; Kozlov, S; Hernandez, L; Chamberlain, S J; Brannan, C I; Stewart, C L; Wevrick, R

2000-07-22

Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13. Affected individuals exhibit neonatal hypotonia, developmental delay and childhood-onset obesity. Necdin, a protein implicated in the terminal differentiation of neurons, is the only PWS candidate gene to reduce viability when disrupted in a mouse model. In this study, we have characterized MAGEL2 (also known as NDNL1), a gene with 51% amino acid sequence similarity to necdin and located 41 kb distal to NDN in the PWS deletion region. MAGEL2 is expressed predominantly in brain, the primary tissue affected in PWS and in several fetal tissues as shown by northern blot analysis. MAGEL2 is imprinted with monoallelic expression in control brain, and paternal-only expression in the central nervous system as demonstrated by its lack of expression in brain from a PWS-affected individual. The orthologous mouse gene (Magel2) is located within 150 kb of NDN:, is imprinted with paternal-only expression and is expressed predominantly in late developmental stages and adult brain as shown by northern blotting, RT-PCR and whole-mount RNA in situ hybridization. Magel2 distribution partially overlaps that of NDN:, with strong expression being detected in the central nervous system in mid-gestation mouse embryos by in situ hybridization. We hypothesize that, although loss of necdin expression may be important in the neonatal presentation of PWS, loss of MAGEL2 may be critical to abnormalities in brain development and dysmorphic features in individuals with PWS.

New hybrid conjugate gradient methods with the generalized Wolfe line search.

PubMed

Xu, Xiao; Kong, Fan-Yu

2016-01-01

The conjugate gradient method was an efficient technique for solving the unconstrained optimization problem. In this paper, we made a linear combination with parameters β k of the DY method and the HS method, and putted forward the hybrid method of DY and HS. We also proposed the hybrid of FR and PRP by the same mean. Additionally, to present the two hybrid methods, we promoted the Wolfe line search respectively to compute the step size α k of the two hybrid methods. With the new Wolfe line search, the two hybrid methods had descent property and global convergence property of the two hybrid methods that can also be proved.

Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

1988-07-01

The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

Cellular localization of thrombopoietin mRNA in the liver by in situ hybridization.

PubMed

Nomura, S; Ogami, K; Kawamura, K; Tsukamoto, I; Kudo, Y; Kanakura, Y; Kitamura, Y; Miyazaki, H; Kato, T

1997-07-01

The expression of thrombopoietin (TPO) mRNA is observed in several tissues, including liver, kidney, brain, skeletal muscle, intestine, spleen, and bone marrow. Among these organs, the highest expression of TPO mRNA is detected in the liver. We identified cells producing TPO by means of in situ hybridization of adult rat liver using digoxigenin-11-UTP-labeled cRNA probes. We found that the cells expressing TPO mRNA also expressed serum albumin mRNA. TPO mRNA was detected in parenchymal cells (hepatocytes) but not in non-parenchymal cells (including endothelial cells, epithelial cells, and so forth). To determine the location of TPO expression in embryogenesis, sections of fetal mice were further analyzed by in situ hybridization. TPO mRNA was detected only in hepatocytes of fetal liver, which was also the major site of hematopoiesis. The expression of TPO mRNA in fetal liver was observed from 12.5 days postcoitus. Northern blot analysis showed that mouse liver transcribed the same size of TPO mRNA in the fetus and in the adult. These results clearly demonstrate that hepatocytes are the primary site of TPO production in the liver from fetus to adult.

Enhanced resistance to citrus canker in transgenic mandarin expressing Xa21 from rice.

PubMed

Omar, Ahmad A; Murata, Mayara M; El-Shamy, Hesham A; Graham, James H; Grosser, Jude W

2018-04-01

Genetic engineering approaches offer an alternative method to the conventional breeding of Citrus sp. 'W. Murcott' mandarin (a hybrid of 'Murcott' and an unknown pollen parent) is one of the most commercially important cultivars grown in many regions around the world. Transformation of 'W. Murcott' mandarin was achieved by direct DNA uptake using a protoplast transformation system. DNA construct (pAO3), encoding Green Fluorescent Protein (GFP) and the cDNA of Xa21, a Xanthomonas resistance gene from rice, was used to transform protoplasts of 'W. Murcott' mandarin. Following citrus protoplast culture and regeneration, transformed micro calli were microscopically designated via GFP expression, physically isolated from non-transformed tissue, and cultured on somatic embryogenesis induction medium. More than 150 transgenic embryos were recovered and from them, ten transgenic lines were regenerated and cultured on rooting medium for shoot elongation. Transgenic shoots were micrografted and established in the greenhouse with 3-5 replicates per line. The insertion of Xa21 and GFP was confirmed by PCR and southern blot analysis. GFP expression was verified by fluorescence microscopy and western blot analysis revealed expression of Xa21 although it was variable among transgenic lines, as shown by RT-qPCR. Transgenic plants challenged with the citrus canker pathogen by syringe inoculation showed a reduction in lesion number and bacterial populations within lesions compared to non-transgenic control plants. Transgenic 'W. Murcott' mandarin lines with improved canker resistance via protoplast transformation from embryogenic callus with the Xa21 gene from rice are being evaluated under field conditions to validate the level of resistance.

Familial Mediterranean fever with a single MEFV mutation: Where is the second hit?

PubMed Central

Booty, Matthew G.; Chae, Jae Jin; Masters, Seth L.; Remmers, Elaine F.; Barham, Beverly; Lee, Julie M.; Barron, Karyl S.; Holland, Steve; Kastner, Daniel L.; Aksentijevich, Ivona

2009-01-01

Objective FMF has traditionally been considered an autosomal recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only one demonstrable MEFV mutation. Here, an extensive search for a second MEFV mutation was performed in 46 patients clinically diagnosed with FMF and carrying only one high-penetrance FMF mutation. Methods MEFV and other candidate genes were sequenced by standard capillary electrophoresis. The entire 15 kb MEFV genomic region was re-sequenced in 10 patients using a hybridization-based chip technology. MEFV gene expression levels were determined by qRT-PCR and pyrin protein levels were examined by Western blotting. Results A second MEFV mutation was not identified in any of the screened patients. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between single and double variant patients; however, FMF patients of both types showed higher protein expression compared to controls and non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare variants in a small number of patients, suggesting the possibility of digenic inheritance. Conclusion Our data underscore the existence of a significant subset of FMF patients who are carriers of only one MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of most common mutations appears sufficient in the presence of clinical symptoms to diagnose FMF and initiate a trial of colchicine. PMID:19479870

DNA Probes Show Genetic Variation in Cyanobacterial Symbionts of the Azolla Fern and a Closer Relationship to Free-Living Nostoc Strains than to Free-Living Anabaena Strains

PubMed Central

Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.

1990-01-01

Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182

Cholecystokinin and tyrosine hydroxylase messenger RNAs in neurons of rat mesencephalon: peptide/monoamine coexistence studies using in situ hybridization combined with immunocytochemistry.

PubMed

Seroogy, K; Schalling, M; Brené, S; Dagerlind, A; Chai, S Y; Hökfelt, T; Persson, H; Brownstein, M; Huan, R; Dixon, J

1989-01-01

The cellular localization of neurons expressing cholecystokinin (CCK) and tyrosine hydroxylase (TH) mRNAs was analysed in rat ventral mesencephalon using in situ hybridization techniques with both complementary DNA and synthetic oligonucleotide probes. Cell bodies distributed throughout the substantia nigra, ventral tegmental area, interfascicular nucleus, midline raphe nuclei, and central and ventral periaqueductal grey matter were found to contain CCK mRNA or TH mRNA as indicated by high densities of grains overlying the perikarya. The in situ hybridization technique was combined with immunocytochemistry on the same tissue section to localize the peptide or enzyme within its respective mRNA-containing somata. In addition, the presence of TH immunoreactivity was demonstrated within cell bodies labeled for CCK mRNA and immunostaining for CCK was detected within TH mRNA-containing neurons. In the medial geniculate nucleus a strong labeling for CCKmRNA was observed, in spite of the fact that so far no CCK-like immunoreactivity has been demonstrated in perikarya in this nucleus. The specificity of the probes was verified by RNA blot hybridization. These results confirm recent double-labeling immunocytochemical studies and further characterize the coexistence of CCK and TH at the level of their mRNAs as well as their post-translational products in a large population of mesencephalic dopamine neurons known to project to forebrain areas.

Deletion detection for diagnosis of Duchenne muscular dystrophy in the Japanese population--comparison between the polymerase chain reaction and the Southern blot analysis.

PubMed

Katayama, S; Takeshita, N; Yano, T; Ubagai, T; Qiu, X J; Katagiri, Y; Kubo, H; Hirakawa, S

1993-06-01

We compared the efficacy of the multiplex PCR with that of the cDNA analysis for detection of deletions of the DMD gene in the Japanese patients. Thirty males with DMD from 27 Japanese families were studied by the multiplex PCR, and 24 of them were also investigated by Southern blot analysis. We used five dystrophin cDNA probes for deletion analysis. A total of 19 regions were amplified by the PCR to detect deletions, 9 regions by the method of Chamberlain et al. and another 10 regions by the method of Beggs et al. Deletions were detected in 14 (52%) out of 27 DMD families by the PCR. Southern blot analysis detected deletions in 14 (64%) out of 22 families. Thirteen (93%) of the 14 DMD families with deletions detected by Southern blotting were also confirmed by the multiplex PCR. Provided care is taken in cases where the deletion is limited to a single exon, the multiplex PCR appears to be an efficient and useful alternative to conventional Southern blot analysis for detecting deletions during the prenatal and postnatal diagnosis of DMD.

Adaptation of signature-tagged mutagenesis to Escherichia coli K1 and the infant-rat model of invasive disease.

PubMed

Gonzalez, M D; Lichtensteiger, C A; Vimr, E R

2001-05-01

With the exception of the polysialic acid capsule (K1 antigen), little is known about other virulence factors needed for systemic infection by Escherichia coli K1, the leading cause of Gram-negative neonatal meningitis in humans. In this work, the functional genomics method of signature-tagged mutagenesis (STM) was adapted to E. coli K1 and the infant-rat model to identify non-capsule virulence genes. Validation of the method was demonstrated by the failure to recover a reconstructed acapsular mutant from bacterial pools used to systemically infect 5-day-old rats. Three new genes required for systemic disease were identified from a total of 192 mutants screened by STM (1.56% hit rate). Gut colonization, Southern blot hybridization, mixed-challenge infection, and DNA sequence analyses showed that the attenuating defects in the mutants were associated with transposon insertions in rfaL (O antigen ligase), dsbA (thiol:disulfide oxidoreductase), and a new gene, puvA (previously unidentified virulence gene A), with no known homologues. The results indicate the ability of STM to identify novel systemic virulence factors in E. coli K1.

Surface enhanced Raman scattering imaging of developed thin-layer chromatography plates.

PubMed

Freye, Chris E; Crane, Nichole A; Kirchner, Teresa B; Sepaniak, Michael J

2013-04-16

A method for hyphenating surface enhanced Raman scattering (SERS) and thin-layer chromatography (TLC) is presented that employs silver-polymer nanocomposites as an interface. Through the process of conformal blotting, analytes are transferred from TLC plates to nanocomposite films before being imaged via SERS. A procedure leading to maximum blotting efficiency was established by investigating various parameters such as time, pressure, and type and amount of blotting solvent. Additionally, limits of detection were established for test analytes malachite green isothiocyanate, 4-aminothiophenol, and Rhodamine 6G (Rh6G) ranging from 10(-7) to 10(-6) M. Band broadening due to blotting was minimal (∼10%) as examined by comparing the spatial extent of TLC-spotted Rh6G via fluorescence and then the SERS-based spot size on the nanocomposite after the blotting process. Finally, a separation of the test analytes was carried out on a TLC plate followed by blotting and the acquisition of distance × wavenumber × intensity three-dimensional TLC-SERS plots.

Application of PCR to a clinical and environmental investigation of a case of equine botulism.

PubMed

Szabo, E A; Pemberton, J M; Gibson, A M; Thomas, R J; Pascoe, R R; Desmarchelier, P M

1994-08-01

PCR for the detection of botulinum neurotoxin gene types A to E was used in the investigation of a case of equine botulism. Samples from a foal diagnosed with toxicoinfectious botulism in 1985 were reanalyzed by PCR and the mouse bioassay in conjunction with an environmental survey. Neurotoxin B was detected by mouse bioassay in culture enrichments of serum, spleen, feces, and intestinal contents. PCR results compared well with mouse bioassay results, detecting type B neurotoxin genes in these samples and also in a liver sample. Other neurotoxin types were not detected by either test. Clostridium botulinum type B was shown to be prevalent in soils collected from the area in which the foal was raised. Four methods were used to test for the presence of botulinum neurotoxin-producing organisms in 66 soil samples taken within a 5-km radius: PCR and agarose gel electrophoresis (types A to E), PCR and an enzyme-linked assay (type B), hybridization of crude alkaline cell lysates with a type B-specific probe, and the mouse bioassay (all types). Fewer soil samples were positive for C. botulinum type B by the mouse bioassay (15%) than by any of the DNA-based detection systems. Hybridization of a type B-specific probe to DNA dot blots (26% of the samples were positive) and PCR-enzyme-linked assay (77% of the samples were positive) were used for the rapid analysis of large numbers of samples, with sensitivity limits of 3 x 10(6) and 3,000 cells, respectively. Conventional detection of PCR products by gel electrophoresis was the most sensitive method (300-cell limit), and in the present environmental survey, neurotoxin B genes only were detected in 94% of the samples.

Application of PCR to a clinical and environmental investigation of a case of equine botulism.

PubMed Central

Szabo, E A; Pemberton, J M; Gibson, A M; Thomas, R J; Pascoe, R R; Desmarchelier, P M

1994-01-01

PCR for the detection of botulinum neurotoxin gene types A to E was used in the investigation of a case of equine botulism. Samples from a foal diagnosed with toxicoinfectious botulism in 1985 were reanalyzed by PCR and the mouse bioassay in conjunction with an environmental survey. Neurotoxin B was detected by mouse bioassay in culture enrichments of serum, spleen, feces, and intestinal contents. PCR results compared well with mouse bioassay results, detecting type B neurotoxin genes in these samples and also in a liver sample. Other neurotoxin types were not detected by either test. Clostridium botulinum type B was shown to be prevalent in soils collected from the area in which the foal was raised. Four methods were used to test for the presence of botulinum neurotoxin-producing organisms in 66 soil samples taken within a 5-km radius: PCR and agarose gel electrophoresis (types A to E), PCR and an enzyme-linked assay (type B), hybridization of crude alkaline cell lysates with a type B-specific probe, and the mouse bioassay (all types). Fewer soil samples were positive for C. botulinum type B by the mouse bioassay (15%) than by any of the DNA-based detection systems. Hybridization of a type B-specific probe to DNA dot blots (26% of the samples were positive) and PCR-enzyme-linked assay (77% of the samples were positive) were used for the rapid analysis of large numbers of samples, with sensitivity limits of 3 x 10(6) and 3,000 cells, respectively. Conventional detection of PCR products by gel electrophoresis was the most sensitive method (300-cell limit), and in the present environmental survey, neurotoxin B genes only were detected in 94% of the samples. Images PMID:7989554

[18S-25S rDNA variation in tissue culture of some Gentiana L. species].

PubMed

Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

2007-01-01

18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

[Genomic disorders in the mononuclear blood cells of those who worked in the cleanup of the accident at the Chernobyl Atomic Electric Power Station].

PubMed

Butenko, Z A; Smirnova, I A; Zak, K P; Mikhaĭlovskaia, E V; Ianok, E A; Kishinskaia, E G

1998-01-01

The results of molecular investigations of blood mononuclears from 120 clean-up workers after 7-9 years of Chernobyl accident with the total exposure radiation doses ranging from 5 to 76 cGr are presented. Structural polymorphism of the leukemia associated bcr and ribosomal RNA (rRNA) genes were studied using Southern blot hybridization. Allelic polymorphism of bcr gene with characteristic for leukemia allele distribution was detected in 16.6%. Rearrangements of rRNA genes were observed in 13% of Chernobyl accident clean-up workers.

Detection of Human Papillomavirus Type 16 DNA and Papillomavirus Genus‐specific Antigens in Vulva and Cervix from Patients with Bowenoid Papulosis

PubMed Central

Sugase, Motoyasu; Moriyama, Shin‐ichi; Hata, Satoru; Matsukura, Toshihiko

1989-01-01

The warty disordered lesions of the vulva in three female patients were diagnosed as Bowenoid papulosis on the basis of clinical and histopathological findings. In all three vulvar lesions, human Papillomavirus type 16 (HPV 16) DNA was identified hy Southern blot hybridization and Papillomavirus genus‐specific (PGS) antigen was detected in one case immunohistochemically. Furthermore, colposcopic examination revealed the presence of abnormal uterine cervical lesions in two cases. They were found to be intraepithelial neoplasia which harbored HPV 16 DNA and were positive for PGS antigen. PMID:2540130

Transformation of lettuce (Lactuca sativa) mediated by Agrobacterium tumefaciens.

PubMed

Michelmore, R; Marsh, E; Seely, S; Landry, B

1987-12-01

Lactuca sativa can be routinely transformed using Ti plasmids of Agrobacterium tumefaciens containing a chimeric kanamycin resistance gene (NOS.NPTII.NOS). Critical experimental variables were plant genotype, bacterial concentration, presence of a nurse culture and timing of transfers between tissue culture media. Transformation was confirmed by the ability to callus and root in the presence of kanamycin, nopaline production, and by hybridization in Southern blots. Transformation has been achieved with several Ti vectors. Several hundred transformed plants have been regenerated. Kanamycin resistance was inherited monogenically. Homozygotes can be selected by growing R2 seedlings on media containing G418.

Fluorescent Labeling of Proteins and Its Application to SDS-PAGE and Western Blotting.

PubMed

Alba, F Javier; Bartolomé, Salvador; Bermúdez, Antonio; Daban, Joan-Ramon

2015-01-01

This chapter describes very simple fluorescent methods developed in our laboratory allowing the rapid monitoring of total protein patterns on both sodium dodecyl sulfate (SDS) polyacrylamide gels and western blots. The noncovalent dye Nile red (9-diethylamino-5H-benzo[α]phenoxazine-5-one) is used for the sensitive staining of proteins in SDS gels. This method is compatible with the electroblotting of protein bands and with the staining of the resulting blot with the covalent dye MDPF (2-methoxy-2,4-diphenyl-3(2H)-furanone). These staining procedures are applied sequentially; there is no need to run a duplicate unstained gel for protein blotting. Furthermore, since only the adduct formed by the reaction of MDPF with proteins is fluorescent, there is no need to destain the membrane after protein labeling. In addition, MDPF staining is compatible with further immunodetection of specific bands with polyclonal antibodies. Finally, using the adequate conditions described below, MDPF staining does not preclude the N-terminal sequence analysis of proteins in selected bands.

Conditions that allow for effective transfer of membrane proteins onto nitrocellulose membrane in Western blots.

PubMed

Abeyrathne, Priyanka D; Lam, Joseph S

2007-04-01

A major hurdle in characterizing bacterial membrane proteins by Western blotting is the ineffectiveness of transferring these proteins from sodium dodecyl sulfate -- polyacrylamide gel electrophoresis (SDS-PAGE) gel onto nitrocellulose membrane, using standard Western blot buffers and electrophoretic conditions. In this study, we compared a number of modified Western blotting buffers and arrived at a composition designated as the SDS-PAGE-Urea Lysis buffer. The use of this buffer and specific conditions allowed the reproducible transfer of highly hydrophobic bacterial membrane proteins with 2-12 transmembrane-spanning segments as well as soluble proteins onto nitrocellulose membranes. This method should be broadly applicable for immunochemical studies of other membrane proteins.

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Physical mapping withing the tuberous sclerosis linkage group in region 9q32-q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, R.M.; Carter, N.P.; Griffiths, B.

1993-02-01

Pulsed-field gel electrophoresis and flow dot-blot analysis have been used to construct a physical map of the q32-q34 region of chromosome 9, where one of the loci responsible for tuberous sclerosis (TSC1) has been mapped by genetic linkage. Five linked groups of markers have been defined by pulsed-field gel electrophoresis. The orientation of these groups and the order of markers within them were determined by hybridization to flow-sorted dot blots derived from a panel of cell lines of chromosome 9 translocations to place probes proximal or distal to each breakpoint. The local map order 9q32-q34 derived by application of thismore » combination of techniques is as follows: centromere - ALAD-1.3 Mb-ORM/20 kb/D9S16-GSN-250 kb-C5-HXB-1.9 Mb-D9S21-AK1-1.4 Mb-SPTAN1-ASS-800-kb-ABL-2 Mb-D0S10/350 Kb/DBH-telomere. 48 refs., 6 figs., 4 figs.« less

Proteomic analysis of mature and immature ejaculated spermatozoa from fertile men

PubMed Central

Cui, Zhihong; Sharma, Rakesh; Agarwal, Ashok

2016-01-01

Dysfunctional spermatozoa maturation is the main reason for the decrease in sperm motility and morphology in infertile men. Ejaculated spermatozoa from healthy fertile men were separated into four fractions using three-layer density gradient. Proteins were extracted and bands were digested on a LTQ-Orbitrap Elite hybrid mass spectrometer system. Functional annotations of proteins were obtained using bioinformatics tools and pathway databases. Western blotting was performed to verify the expression levels of the proteins of interest. 1469 proteins were identified in four fractions of spermatozoa. The number of detected proteins decreased according to the maturation level of spermatozoa. During spermatozoa maturation, proteins involved in gamete generation, cell motility, energy metabolism and oxidative phosphorylation processes showed increasing expression levels and those involved in protein biosynthesis, protein transport, protein ubiquitination, and response to oxidative stress processes showed decreasing expression levels. We validated four proteins (HSP 70 1A, clusterin, tektin 2 and tektin 3) by Western blotting. The study shows protein markers that may provide insight into the ejaculated spermatozoa proteins in different stages of sperm maturation that may be altered or modified in infertile men. PMID:26510506

CIP, a cardiac Isl1-interacting protein, represses cardiomyocyte hypertrophy

PubMed Central

Huang, Zhan-Peng; Seok, Hee Young; Zhou, Bin; Chen, Jinghai; Chen, Jian-Fu; Tao, Yazhong; Pu, William T.; Wang, Da-Zhi

2012-01-01

Rationale Mammalian heart has minimal regenerative capacity. In response to mechanical or pathological stress, the heart undergoes cardiac remodeling. Pressure and volume overload in the heart cause increased size (hypertrophic growth) of cardiomyocytes. Whereas the regulatory pathways that activate cardiac hypertrophy have been well established, the molecular events that inhibit or repress cardiac hypertrophy are less known. Objective To identify and investigate novel regulators that modulate cardiac hypertrophy. Methods and Results Here, we report the identification, characterization and functional examination of CIP, a novel cardiac Isl1-interacting protein. CIP was identified from a bioinformatic search for novel cardiac-expressed genes in mouse embryonic hearts. CIP encodes a nuclear protein without recognizable motifs. Northern blotting, in situ hybridization and reporter gene tracing demonstrated that CIP is highly expressed in cardiomyocytes of developing and adult hearts. Yeast-two-hybrid screening identified Isl1, a LIM/homeodomain transcription factor essential for the specification of cardiac progenitor cells in the second heart field, as a co-factor of CIP. CIP directly interacted with Isl1 and we mapped the domains of these two proteins which mediate their interaction. We show that CIP represses the transcriptional activity of Isl1 in the activation of the MEF2C enhancer. The expression of CIP was dramatically reduced in hypertrophic cardiomyocytes. Most importantly, overexpression of CIP repressed agonist-induced cardiomyocyte hypertrophy. Conclusions Our studies therefore identify CIP a novel regulator of cardiac hypertrophy. PMID:22343712

Monitoring the Spatiotemporal Activities of miRNAs in Small Animal Models Using Molecular Imaging Modalities

PubMed Central

Baril, Patrick; Ezzine, Safia; Pichon, Chantal

2015-01-01

MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulate gene expression by binding mRNA targets via sequence complementary inducing translational repression and/or mRNA degradation. A current challenge in the field of miRNA biology is to understand the functionality of miRNAs under physiopathological conditions. Recent evidence indicates that miRNA expression is more complex than simple regulation at the transcriptional level. MiRNAs undergo complex post-transcriptional regulations such miRNA processing, editing, accumulation and re-cycling within P-bodies. They are dynamically regulated and have a well-orchestrated spatiotemporal localization pattern. Real-time and spatio-temporal analyses of miRNA expression are difficult to evaluate and often underestimated. Therefore, important information connecting miRNA expression and function can be lost. Conventional miRNA profiling methods such as Northern blot, real-time PCR, microarray, in situ hybridization and deep sequencing continue to contribute to our knowledge of miRNA biology. However, these methods can seldom shed light on the spatiotemporal organization and function of miRNAs in real-time. Non-invasive molecular imaging methods have the potential to address these issues and are thus attracting increasing attention. This paper reviews the state-of-the-art of methods used to detect miRNAs and discusses their contribution in the emerging field of miRNA biology and therapy. PMID:25749473

Monitoring the spatiotemporal activities of miRNAs in small animal models using molecular imaging modalities.

PubMed

Baril, Patrick; Ezzine, Safia; Pichon, Chantal

2015-03-04

MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulate gene expression by binding mRNA targets via sequence complementary inducing translational repression and/or mRNA degradation. A current challenge in the field of miRNA biology is to understand the functionality of miRNAs under physiopathological conditions. Recent evidence indicates that miRNA expression is more complex than simple regulation at the transcriptional level. MiRNAs undergo complex post-transcriptional regulations such miRNA processing, editing, accumulation and re-cycling within P-bodies. They are dynamically regulated and have a well-orchestrated spatiotemporal localization pattern. Real-time and spatio-temporal analyses of miRNA expression are difficult to evaluate and often underestimated. Therefore, important information connecting miRNA expression and function can be lost. Conventional miRNA profiling methods such as Northern blot, real-time PCR, microarray, in situ hybridization and deep sequencing continue to contribute to our knowledge of miRNA biology. However, these methods can seldom shed light on the spatiotemporal organization and function of miRNAs in real-time. Non-invasive molecular imaging methods have the potential to address these issues and are thus attracting increasing attention. This paper reviews the state-of-the-art of methods used to detect miRNAs and discusses their contribution in the emerging field of miRNA biology and therapy.

Post-staining electroblotting for efficient and reliable peptide blotting.

PubMed

Lee, Der-Yen; Chang, Geen-Dong

2015-01-01

Post-staining electroblotting has been previously described to transfer Coomassie blue-stained proteins from polyacrylamide gel onto polyvinylidene difluoride (PVDF) membranes. Actually, stained peptides can also be efficiently and reliably transferred. Because of selective staining procedures for peptides and increased retention of stained peptides on the membrane, even peptides with molecular masses less than 2 kDa such as bacitracin and granuliberin R are transferred with satisfactory results. For comparison, post-staining electroblotting is about 16-fold more sensitive than the conventional electroblotting for visualization of insulin on the membrane. Therefore, the peptide blots become practicable and more accessible to further applications, e.g., blot overlay detection or immunoblotting analysis. In addition, the efficiency of peptide transfer is favorable for N-terminal sequence analysis. With this method, peptide blotting can be normalized for further analysis such as blot overlay assay, immunoblotting, and N-terminal sequencing for identification of peptide in crude or partially purified samples.

Micro-shear bond strengths of adhesive resins to coronal dentin versus the floor of the pulp chamber.

PubMed

Toba, Shigemitsu; Veerapravati, Weeraporn; Shimada, Yasushi; Nikaido, Toru; Tagami, Junji

2003-09-01

To evaluate the micro-shear bond strengths to superficial coronal dentin and the floor of the pulp chamber using two dentin bonding systems and to compare the ultrastructure of the resin-dentin interface of the two regions. 30 non-carious molars were used to obtain 2 mm thick slabs of coronal dentin and dentin at the pulp chamber. The specimens in each region were divided into three sub-groups to be bonded as follows; Clearfil SE Bond was used according to the manufacturer's instructions, Single Bond was applied to either wet dentin (Blot dry Group) or air-dried dentin (Dry Group) after phosphoric acid etching. A resin composite cylinder 0.5 mm high and 0.75 mm in diameter formed using a vinyl tube was bonded to the dentin. Specimens were stored at 37 degrees C for 24 hours in water and then stressed in shear at a crosshead speed of 1 mm/minute. The data were analyzed with one-way ANOVA and Fisher's PLSD test at the 5% level of significance. In addition, the ultrastructure of cross-sectioned dentin surfaces, the conditioned dentin surface and the resin dentin interfaces were observed by SEM. The bond strengths of Clearfil SE Bond and the Single Bond Blot dry group were approximately 40 MPa in coronal dentin and 30 MPa in the dentin at the floor of the pulp chamber respectively. However, the bond strengths of Single Bond were significantly lower in the Dry condition (MPa) (P < 0.05). SEM observations revealed the thickness of the hybrid layer created by Clearfil SE Bond in coronal dentin and at the floor of the pulp chamber were less than 1.0 microm thick. For Single Bond, a 3-4 microm hybrid layer was created in coronal dentin, while a thinner hybrid layer was observed in the floor of the pulp chamber. Morphological and structural variations in dentin may have influenced the bond strengths of the bonding systems to the floor of the pulp chamber.

Expression of the serine/threonine kinase hSGK1 in chronic viral hepatitis.

PubMed

Fillon, Sophie; Klingel, Karin; Wärntges, Simone; Sauter, Martina; Gabrysch, Sabine; Pestel, Sabine; Tanneur, Valerie; Waldegger, Siegfried; Zipfel, Annette; Viebahn, Richard; Häussinger, Dieter; Bröer, Stefan; Kandolf, Reinhard; Lang, Florian

2002-01-01

The human serine/threonine kinase hSGK1 is expressed ubiquitously with highest transcript levels in pancreas and liver. This study has been performed to determine the hSGK1 distribution in normal liver and its putative role in fibrosing liver disease. HSGK1-localization was determined by in situ hybridization, regulation of hSGK1-transcription by Northern blotting, fibronectin synthesis and hSGK1 phosphorylation by Western blotting. In normal liver hSGK1 was mainly transcribed by Kupffer cells. In liver tissue from patients with chronic viral hepatitis, hSGK1 transcript levels were excessively high in numerous activated Kupffer cells and inflammatory cells localized within fibrous septum formations. HSGK1 transcripts were also detected in activated hepatic stellate cells. Accordingly, Western blotting revealed that tissue from fibrotic liver expresses excessive hSGK1 protein as compared to normal liver. TGF-beta1 (2 ng/ml) increases hSGK1 transcription in both human U937 macro-phages and HepG2 hepatoma cells. H(2)O(2) (0.3 mM) activated hSGK1 and increased fibronectin formation in HepG2 cells overexpressing hSGK1 but not in HepG2 cells expressing the inactive mutant hSGK1(K127R). In conclusion hSGK1 is upregulated by TGF-beta1 during hepatitis and may contribute to enhanced matrix formation during fibrosing liver disease. Copyright 2002 S. Karger AG, Basel

Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

PubMed Central

Sochorová, Jana; Coriton, Olivier; Kuderová, Alena; Lunerová, Jana; Chèvre, Anne-Marie; Kovařík, Aleš

2017-01-01

Background and aims Brassica napus (AACC, 2n = 38, oilseed rape) is a relatively recent allotetraploid species derived from the putative progenitor diploid species Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18). To determine the influence of intensive breeding conditions on the evolution of its genome, we analysed structure and copy number of rDNA in 21 cultivars of B. napus, representative of genetic diversity. Methods We used next-generation sequencing genomic approaches, Southern blot hybridization, expression analysis and fluorescence in situ hybridization (FISH). Subgenome-specific sequences derived from rDNA intergenic spacers (IGS) were used as probes for identification of loci composition on chromosomes. Key Results Most B. napus cultivars (18/21, 86 %) had more A-genome than C-genome rDNA copies. Three cultivars analysed by FISH (‘Darmor’, ‘Yudal’ and ‘Asparagus kale’) harboured the same number (12 per diploid set) of loci. In B. napus ‘Darmor’, the A-genome-specific rDNA probe hybridized to all 12 rDNA loci (eight on the A-genome and four on the C-genome) while the C-genome-specific probe showed weak signals on the C-genome loci only. Deep sequencing revealed high homogeneity of arrays suggesting that the C-genome genes were largely overwritten by the A-genome variants in B. napus ‘Darmor’. In contrast, B. napus ‘Yudal’ showed a lack of gene conversion evidenced by additive inheritance of progenitor rDNA variants and highly localized hybridization signals of subgenome-specific probes on chromosomes. Brassica napus ‘Asparagus kale’ showed an intermediate pattern to ‘Darmor’ and ‘Yudal’. At the expression level, most cultivars (95 %) exhibited stable A-genome nucleolar dominance while one cultivar (‘Norin 9’) showed co-dominance. Conclusions The B. napus cultivars differ in the degree and direction of rDNA homogenization. The prevalent direction of gene conversion (towards the A-genome) correlates with the direction of expression dominance indicating that gene activity may be needed for interlocus gene conversion. PMID:27707747

An optimized method for extraction and detection of Coconut cadang-cadang viroid(CCCVd) from oil palm.

PubMed

Mohammadi, M R; Vadamalai, G; Joseph, H

2010-01-01

Coconut cadong-cadong viroid (CCCVd) causes the Lethal cadang-cadang disease of coconut palms in the Philippines and it is recently reported to be associated with the orange spotting disease on oil palm in Malaysia. The low concentration of the viroid RNA in oil palm as well as the high content of polyphenols and polysaccharides in this plant which interfere with the purification steps makes it difficult to extract and detect this viroid from oil palm. A previously described method was modified and optimized for extraction and detection of CCCVd from infected oil palms. Briefly, 7 g of leaf material was homogenized in a mortar or a blender using liquid nitrogen. 10 ml of extraction buffer (100 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM EDTA) along with 100 mM 2-mercaptoethanol and 10 ml water saturated phenol was added to the frozen powder. After centrifuging at 4 degrees C, 4000 g for 30 min, the aqueous phase was extracted once more with phenol then once with chloroform-isoamyl alcohol (24:1). After adding sodium acetate, pH 5.6 to 200 mM, the mixture was precipitated with 2.5 vol ethanol overnight in -20 freezer and then the pellet was washed with 70% ethanol and air-dried. One milliliter of 8 M LiCl was added to the dried pellet and after shaking overnight at 4 degrees C and another centrifugation step the supernatant was collected and precipitated again with ethanol and then the resulting pellet was washed and air-dried. To carry out northern blotting, samples equivalent to 40 g of plant tissue were mixed with formamide buffer and loaded onto a 12% polyacrylamide gel containing 7 M urea and after separation by electrophoresis, were electroblotted onto membrane and fixed by UV cross-linking. Pre-hybridization and hybridization using hybridization buffer (50% formamide, 25%SSPE, 0.1% Ficol and PVP, 0.1 % SDS, 0.02 % DNA (5mg/ml)) was carried out at 45 degrees C for 90 min and 16 h, respectively followed by two low stringency washes (0.5 X SSC, 0.1% SDS, at room temperature for 5 min) and one high stringency wash (0.1X SSC, 0.1% SDS at 60 degrees C for 1 hour). In vitro synthesized DIG-labeled full-length CCCVd(-) RNA probe was used in hybridization step. DIG Nucleic Acid Detection Kit (Roche) instructions were followed for detection procedure and as a result the blue bands corresponding to the position of the viroid were appeared on the membrane. The result of this study showed the ability of DIG labeled probe in detection of the viroid and also provided a suitable extraction and hybridization method for the detection of CCCVd from oil palm.

Characterization by Suppression Subtractive Hybridization of Transcripts That Are Differentially Expressed in Leaves of Anthracnose-Resistant Ramie Cultivar.

PubMed

Xuxia, Wang; Jie, Chen; Bo, Wang; Lijun, Liu; Hui, Jiang; Diluo, Tang; Dingxiang, Peng

2012-01-01

For the purpose of screening putative anthracnose resistance-related genes of ramie ( Boehmeria nivea L. Gaud), a cDNA library was constructed by suppression subtractive hybridization using anthracnose-resistant cultivar Huazhu no. 4. The cDNAs from Huazhu no. 4, which were infected with Colletotrichum gloeosporioides , were used as the tester and cDNAs from uninfected Huazhu no. 4 as the driver. Sequencing analysis and homology searching showed that these clones represented 132 single genes, which were assigned to functional categories, including 14 putative cellular functions, according to categories established for Arabidopsis . These 132 genes included 35 disease resistance and stress tolerance-related genes including putative heat-shock protein 90, metallothionein, PR-1.2 protein, catalase gene, WRKY family genes, and proteinase inhibitor-like protein. Partial disease-related genes were further analyzed by reverse transcription PCR and RNA gel blot. These expressed sequence tags are the first anthracnose resistance-related expressed sequence tags reported in ramie.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

A novel cytochrome P450 gene (CYP4G25) of the silkmoth Antheraea yamamai: cloning and expression pattern in pharate first instar larvae in relation to diapause.

PubMed

Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi

2008-03-01

A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.

A polymorphic DNA marker that represents a conserved expressed sequence in the region of the Huntington disease gene.

PubMed Central

Hayden, M R; Hewitt, J; Wasmuth, J J; Kastelein, J J; Langlois, S; Conneally, M; Haines, J; Smith, B; Hilbert, C; Allard, D

1988-01-01

A polymorphic marker (D4S62) that is genetically closely linked to D4S10 and is in the region of the gene for Huntington disease is described. A four-allele polymorphism is detected when HincII-digested DNA is hybridized with D4S62. D4S62 maps, by Southern blot analysis using somatic-cell hybrids, to 4p16.1 closer to the centromere than does D4S10. The use of the polymorphisms detected by D4S62 increases the informativeness of markers close to the gene for Huntington disease and will be useful for preclinical diagnosis. D4S62 detects transcripts of approximately 6,000 nucleotides in rat, mouse, and monkey liver and brain. This represents the first demonstration of conserved expressed sequences close to the gene for Huntington disease. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 PMID:2892395

Calcium-binding proteins annexin A2 and S100A6 are sensors of tubular injury and recovery in acute renal failure.

PubMed

Cheng, Chao-Wen; Rifai, Abdalla; Ka, Shuk-Man; Shui, Hao-Ai; Lin, Yuh-Feng; Lee, Wei-Hwa; Chen, Ann

2005-12-01

Rise in cellular calcium is associated with acute tubular necrosis, the most common cause of acute renal failure (ARF). The mechanisms that calcium signaling induce in the quiescent tubular cells to proliferate and differentiate during acute tubular necrosis have not been elucidated. Acute tubular necrosis induced in mice by single intravenous injection of uranyl nitrate and examined after 1, 3, 7, and 14 days. Renal function was monitored and kidneys were evaluated by histology, immunohistochemistry, Western blotting, in situ hybridization, and real-time reverse transcription-polymerase chain reaction (RT-PCR). Models of folic acid induced-ARF and ischemic/reperfusion (I/R) injury were similarly investigated. Analysis of mRNA expression of intracellular calcium and phospholipid-binding proteins demonstrated selective expression of S100A6 and Annexin A2 (Anxa2) in the renal cortex with marked elevation on day 3, and gradually decline on day 7 and further attenuation on day 14. Similarly, the expression of both proteins, as demonstrated by immunohistochemistry and Western blot analysis, was increased and reached the peak level on day 7 and then gradually declined by day 14. Vimentin, a marker of dedifferentiated cells, was highly expressed during the recovery phase. Combined in situ hybridization immunohistochemistry revealed colocalization of both S100A6 and Anxa2 with proliferating cell nuclear antigen (PCNA). The universality of this phenomenon was confirmed in two other mouse acute tubular necrosis models, the ischemic-reperfusion injury and folic acid-induced ARF. Collectively, these findings demonstrate that S100A6 and Anxa2 expression, initiated in response to tubular injury, persist in parallel throughout the recovery process of tubular cells in acute renal failure.

Two pectin lyase genes, pnl-1 and pnl-2, from Colletotrichum gloeosporioides f. sp. malvae differ in a cellulose-binding domain and in their expression during infection of Malva pusilla.

PubMed

Wei, Yangdou; Shih, Jenny; Li, Jieran; Goodwin, Paul H

2002-07-01

Two pectin lyase genes, designated pnl-1 and pnl-2, were cloned from Colletotrichum gloeosporioides f. sp. malvae, a pathogen of round-leaved mallow (Malva pusilla). pnl-1 was isolated using cDNA from infected plant material; pnl-2 was isolated using cDNA from 3-day-old mycelia grown in mallow-cell-wall extract (MCWE) broth. pnl-1 is the first pectinase gene described thus far to encode a cellulose-binding domain (CBD), which is common in cellulases and xylanases, whereas pnl-2 encodes a pectin lyase that lacks a CBD. In pure culture, pnl-1 expression could be detected when purified pectin or glucose was the sole carbon source, but not when MCWE was the sole carbon source. The lack of pnl-1 expression appeared to be due to gene repression by some unknown factor(s) in the cell-wall extract. In contrast, expression of pnl-2 was detected in cultures when MCWE, but not when purified pectin or glucose, was the sole carbon source. In infected tissue, detection of pnl-1 expression by Northern-blot hybridization and by RT-PCR began with the onset of the necrotrophic phase of infection. Expression ofpnl-2 was not detectable by Northern-blot hybridization, but was observed byRT-PCR in both the biotrophic and necrotrophic phases of infection. The differences between pnl-1 and pnl-2 (i.e. pnl-1 encoding a CBD and differences in the expression patterns of both genes) may be related to the requirements of C. gloeosporioides f. sp. malvae to be able to grow in host tissue under the different conditions present during the biotrophic and necrotrophic phases of infection.

Simultaneous Detection of Bovine Theileria and Babesia Species by Reverse Line Blot Hybridization

PubMed Central

Gubbels, J. M.; de Vos, A. P.; van der Weide, M.; Viseras, J.; Schouls, L. M.; de Vries, E.; Jongejan, F.

1999-01-01

A reverse line blot (RLB) assay was developed for the identification of cattle carrying different species of Theileria and Babesia simultaneously. We included Theileria annulata, T. parva, T. mutans, T. taurotragi, and T. velifera in the assay, as well as parasites belonging to the T. sergenti-T. buffeli-T. orientalis group. The Babesia species included were Babesia bovis, B. bigemina, and B. divergens. The assay employs one set of primers for specific amplification of the rRNA gene V4 hypervariable regions of all Theileria and Babesia species. PCR products obtained from blood samples were hybridized to a membrane onto which nine species-specific oligonucleotides were covalently linked. Cross-reactions were not observed between any of the tested species. No DNA sequences from Bos taurus or other hemoparasites (Trypanosoma species, Cowdria ruminantium, Anaplasma marginale, and Ehrlichia species) were amplified. The sensitivity of the assay was determined at 0.000001% parasitemia, enabling detection of the carrier state of most parasites. Mixed DNAs from five different parasites were correctly identified. Moreover, blood samples from cattle experimentally infected with two different parasites reacted only with the corresponding species-specific oligonucleotides. Finally, RLB was used to screen blood samples collected from carrier cattle in two regions of Spain. T. annulata, T. orientalis, and B. bigemina were identified in these samples. In conclusion, the RLB is a versatile technique for simultaneous detection of all bovine tick-borne protozoan parasites. We recommend its use for integrated epidemiological monitoring of tick-borne disease, since RLB can also be used for screening ticks and can easily be expanded to include additional hemoparasite species. PMID:10325324

A novel protein phosphatase 2A (PP2A) is involved in the transformation of human protozoan parasite Trypanosoma cruzi.

PubMed Central

González, Jorge; Cornejo, Alberto; Santos, Marcia R M; Cordero, Esteban M; Gutiérrez, Bessy; Porcile, Patricio; Mortara, Renato A; Sagua, Hernán; Da Silveira, José Franco; Araya, Jorge E

2003-01-01

Here we provide evidence for a critical role of PP2As (protein phosphatase 2As) in the transformation of Trypanosoma cruzi. In axenic medium at pH 5.0, trypomastigotes rapidly transform into amastigotes, a process blocked by okadaic acid, a potent PP2A inhibitor, at concentrations as low as 0.1 microM. 1-Norokadaone, an inactive okadaic acid analogue, did not affect the transformation. Electron microscopy studies indicated that okadaic acid-treated trypomastigotes had not undergone ultrastructural modifications, reinforcing the idea that PP2A inhibits transformation. Using a microcystin-Sepharose affinity column we purified the native T. cruzi PP2A. The enzyme displayed activity against 32P-labelled phosphorylase a that was inhibited in a dose-dependent manner by okadaic acid. The protein was also submitted to MS and, from the peptides obtained, degenerate primers were used to clone a novel T. cruzi PP2A enzyme by PCR. The isolated gene encodes a protein of 303 amino acids, termed TcPP2A, which displayed a high degree of homology (86%) with the catalytic subunit of Trypanosoma brucei PP2A. Northern-blot analysis revealed the presence of a major 2.1-kb mRNA hybridizing in all T. cruzi developmental stages. Southern-blot analysis suggested that the TcPP2A gene is present in low copy number in the T. cruzi genome. These results are consistent with the mapping of PP2A genes in two chromosomal bands by pulsed-field gel electrophoresis and chromoblot hybridization. Our studies suggest that in T. cruzi PP2A is important for the complete transformation of trypomastigotes into amastigotes during the life cycle of this protozoan parasite. PMID:12737627

[Development of a hepatitis B virus carrier transgenic mice model].

PubMed

Caner, Müge; Arat, Sezen; Bircan, Rifat

2008-01-01

The studies for the development of transgenic mice models which provide important profits for the studies concerning immunopathogenesis of hepatitis B virus (HBV) infections are in progress since 20 years. For this purpose different lineages bearing whole HBV genome or selected viral genes have been developed and their usage in clarifying the HBV replication and pathogenesis mechanisms have been emphasized. The aim of this study was to develop and breed a HBV carrier mice model. In the study the full HBV genome has been transferred to mouse embryos by microinjection procedure. Following transgenic manipulation, the HBV carriers among the daughter mice have been detected by molecular methods in which HBV-DNA replication and expression have been shown. The manipulations for transgene transfers have been performed in TUBITAK Marmara Research Center Transgene Laboratory, Gebze, Istanbul. The HBV-DNA carrier mice have been demonstrated by polymerase chain reaction (PCR) using the DNA samples obtained from tail tissues and also by dot-blot hybridization of the mice sera. Integrated HBV-DNA has been detected by applying in-situ hybridization to the liver tissue sections. HBV-DNA expression has been shown by reverse transcriptase PCR method with total RNA molecules that have been isolated from the liver tissues of the HBV-DNA carrier mice. HBsAg has been detected in the liver by immunohistochemical method, and HBsAg and HBeAg have additionally been demonstrated by ELISA. HBV genome, expression of the genome and the expression products have been determined in approximately 10% of the mice of which HBV-DNA have been transferred. By inbreeding heterozygote carrier mice, homozygote HBV transgenic mice line have been obtained. These HBV transgenic mice are the first lineages developed in our country. It is hopefully thought that this HBV carrier transgenic mouse model may contribute to the studies on the pathogenesis of HBV infections which are important health problems in the world as well as in Turkey.

Simulation-Based Evaluation of Hybridization Network Reconstruction Methods in the Presence of Incomplete Lineage Sorting

PubMed Central

Kamneva, Olga K; Rosenberg, Noah A

2017-01-01

Hybridization events generate reticulate species relationships, giving rise to species networks rather than species trees. We report a comparative study of consensus, maximum parsimony, and maximum likelihood methods of species network reconstruction using gene trees simulated assuming a known species history. We evaluate the role of the divergence time between species involved in a hybridization event, the relative contributions of the hybridizing species, and the error in gene tree estimation. When gene tree discordance is mostly due to hybridization and not due to incomplete lineage sorting (ILS), most of the methods can detect even highly skewed hybridization events between highly divergent species. For recent divergences between hybridizing species, when the influence of ILS is sufficiently high, likelihood methods outperform parsimony and consensus methods, which erroneously identify extra hybridizations. The more sophisticated likelihood methods, however, are affected by gene tree errors to a greater extent than are consensus and parsimony. PMID:28469378

Expression of mRNAs encoding ARPP-16/19, ARPP-21, and DARPP-32 in human brain tissue.

PubMed

Brené, S; Lindefors, N; Ehrlich, M; Taubes, T; Horiuchi, A; Kopp, J; Hall, H; Sedvall, G; Greengard, P; Persson, H

1994-03-01

In this study we have isolated and sequenced human cDNAs for the phosphoproteins DARPP-32, ARPP-21, and ARPP-16/19, and have compared these sequences to previously characterized bovine and rat cDNAs. In situ hybridization and Northern blot analysis with the human cDNA probes were used to study the expression of mRNAs encoding ARPP-16/19, ARPP-21, and DARPP-32 in human postmortem brain tissue. In situ hybridization was performed using horizontal whole hemisphere sections. Five representative levels of the brain ranging from 71 mm to 104 mm ventral to vertex were examined. All three probes showed distinct hybridization patterns in the caudate nucleus, putamen, nucleus accumbens, and the amygdaloid complex. For ARPP-16/19 mRNA, a hybridization signal comparable to the signal in caudate nucleus, putamen, and nucleus accumbens was also detected in the neocortex. ARPP-21 and DARPP-32 mRNA, on the other hand, were present in lower levels in neocortical regions. DARPP-32 mRNA was abundant in the cerebellar cortex at the level of the Purkinje cell layer. High levels of ARPP-16/19 and ARPP-21 mRNA were also found in the cerebellar cortex, where they were confined to deeper layers. The present result demonstrate that mRNAs for the three phosphoproteins are expressed in overlapping, but also distinct, areas of the human brain that in many cases coincide with previously described distribution of the dopamine D1 receptor.

Polymerase chain reaction and DNA probe hybridization to assess the efficacy of diminazene treatment in Trypanosoma brucei-infected cattle.

PubMed

Clausen, P H; Waiswa, C; Katunguka-Rwakishaya, E; Schares, G; Steuber, S; Mehlitz, D

1999-03-01

Four of eight Ankole longhorn cattle experimentally infected with Trypanosoma brucei were treated with 7 mg/kg diminazene aceturate (Berenil, Hoechst AG, Germany) at day 71 postinfection. The trypanocidal activity was monitored using polymerase chain reaction (PCR) and DNA probe hybridization. When extracted parasite DNA (without host DNA) was used, as little as 1 fg per reaction, which is equivalent to about 1-10% of the DNA in a single trypanosome, produced a specific product that was visible as a 177-bp band in an agarose gel. In infected cattle, specific PCR products could be amplified at as early as 1 day postinfection. PCR signals remained positive during infection, except in one sample, although aparasitemic phases occurred. In cases where treatment resulted in a significant clinical improvement, PCR signals disappeared at 3-4 days after the administration of the drug. By contrast, in cattle that showed clinical signs of CNS involvement after treatment, although aparasitemic, and died before the termination of the experiment, specific products could be amplified on several occasions following treatment. The PCR signals generated after treatment could be further enhanced by subsequent slot-blot hybridization with a T. brucei-specific DNA probe. We conclude that PCR coupled with DNA probe hybridization provides a highly sensitive tool for the assessment of therapeutic efficiency and disease progression in trypanosome infections, especially in chronic infections when the level of parasitemia is low or when trypanosomes are sequestered at cryptic sites.

A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana.

PubMed

McClure, B; Mou, B; Canevascini, S; Bernatzky, R

1999-11-09

Although S-locus RNases (S-RNases) determine the specificity of pollen rejection in self-incompatible (SI) solanaceous plants, they alone are not sufficient to cause S-allele-specific pollen rejection. To identify non-S-RNase sequences that are required for pollen rejection, a Nicotiana alata cDNA library was screened by differential hybridization. One clone, designated HT, hybridized strongly to RNA from N. alata styles but not to RNA from Nicotiana plumbaginifolia, a species known to lack one or more factors necessary for S-allele-specific pollen rejection. Sequence analysis revealed a 101-residue ORF including a putative secretion signal and an asparagine-rich domain near the C terminus. RNA blot analysis showed that the HT-transcript accumulates in the stigma and style before anthesis. The timing of HT-expression lags slightly behind S(C10)-RNase in SI N. alata S(C10)S(C10) and is well correlated with the onset of S-allele-specific pollen rejection in the style. An antisense-HT construct was prepared to test for a role in pollen rejection. Transformed (N. plumbaginifolia x SI N. alata S(C10)S(C10)) hybrids with reduced levels of HT-protein continued to express S(C10)-RNase but failed to reject S(C10)-pollen. Control hybrids expressing both S(C10)-RNase and HT-protein showed a normal S-allele-specific pollen rejection response. We conclude that HT-protein is directly implicated in pollen rejection.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

PubMed

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Natural hybrid of Leishmania infantum/L. donovani: development in Phlebotomus tobbi, P. perniciosus and Lutzomyia longipalpis and comparison with non-hybrid strains differing in tissue tropism.

PubMed

Seblova, Veronika; Myskova, Jitka; Hlavacova, Jana; Votypka, Jan; Antoniou, Maria; Volf, Petr

2015-11-25

Infection caused by parasites from L. donovani complex can manifest as a serious visceral disease or a self-healing milder cutaneous form. The different tropism and pathology in humans is caused by the interaction between parasites, host and vector determinants but the mechanisms are not well understood. In Cukurova region in Turkey we previously identified a major focus of cutaneous leishmaniasis caused by L. donovani/infantum hybrids (CUK strain) and isolated this parasite from the locally abundant sand fly, Phlebotomus tobbi. Here, we present the first experimental study with P. tobbi. We tested the susceptibility of this species to various Leishmania under laboratory conditions, characterized glycoproteins in the P. tobbi midgut putatively involved in parasite-vector interaction and compared the development of the CUK strain in the sand fly with one other dermotropic and three viscerotropic strains belonging to the L. donovani complex. Females of laboratory reared P. tobbi, P. perniciosus and Lutzomyia longipalpis were infected using membrane feeding on rabbit blood containing promastigotes of various Leishmania species with different tropisms. The individual guts were checked microscopically for presence and localization of Leishmania parasites; the number of parasites was assessed more precisely by qPCR. In addition, glycosylation of midgut proteins of P. tobbi was studied by lectin blotting of midgut lysate with lectins specific for terminal sugars of N-type and O-type glycans. High infection rates, heavy parasite loads and late-stage infection with colonization of the stomodeal valve were observed in P. tobbi infected by Leishmania major or L. infantum CUK hybrid. In parallel, lectin blotting revealed the presence of O-glycosylated proteins in the P. tobbi midgut. In P. perniciosus and L. longipalpis all five Leishmania strains tested developed well. In both vectors, significantly higher parasite numbers were detected by qPCR for dermotropic L. donovani from Cyprus, however, in all other parameters studied, including localization of infection and colonization of stomodeal valve, dermotropic and viscerotropic strains were not significantly different. We showed high susceptibility of P. tobbi to various Leishmania spp. This, together with the presence of O-glycosylated midgut proteins in their midguts demonstrate that P. tobbi is a permissive vector. Two dermotropic and three viscerotropic strains from the L. donovani complex developed late-stage infections in natural L. infantum vectors, P. perniciosus and L. longipalpis and none of the parameters studied seem to be linked with different tropism of parasites in the vertebrate host.

Fusion of Escherichia coli heat-stable enterotoxin and heat-labile enterotoxin B subunit.

PubMed

Guzman-Verduzco, L M; Kupersztoch, Y M

1987-11-01

The 3' terminus of the DNA coding for the extracellular Escherichia coli heat-stable enterotoxin (ST) devoid of transcription and translation stop signals was fused to the 5' terminus of the DNA coding for the periplasmic B subunit of the heat-labile enterotoxin (LTB) deleted of ribosomal binding sites and leader peptide. By RNA-DNA hybridization analysis, it was shown that the fused DNA was transcribed in vivo into an RNA species in close agreement with the expected molecular weight inferred from the nucleotide sequence. The translation products of the fused DNA resulted in a hybrid molecule recognized in Western blots (immunoblots) with antibodies directed against the heat-labile moiety. Anti-LTB antibodies coupled to a solid support bound ST and LTB simultaneously when incubated with ST-LTB cellular extracts. By [35S]cysteine pulse-chase experiments, it was shown that the fused ST-LTB polypeptide was converted from a precursor with an equivalent electrophoretic mobility of 20,800 daltons to an approximately 18,500-dalton species, which accumulated within the cell. The data suggest that wild-type ST undergoes at least two processing steps during its export to the culture supernatant. Blocking the natural carboxy terminus of ST inhibited the second proteolytic step and extracellular delivery of the hybrid molecule.

Molecular patterns of X chromosome-linked color vision genes among 134 menof European ancestry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drummond-Borg, M.; Deeb, S.S.; Motulsky, A.G.

1989-02-01

The authors used Southern blot hybridization to study X chromosome-linked color vision genes encoding the apoproteins of red and green visual pigments in 134 unselected Caucasian men. One hundred and thirteen individuals (84.3%) had a normal arrangement of their color vision pigment genes. All had one red pigment gene; the number of green pigment genes ranged from one to five with a mode of two. The frequency of molecular genotypes indicative of normal color vision (84.3%) was significantly lower than had been observed in previous studies of color vision phenotypes. Color vision defects can be due to deletions of redmore » or green pigment genes or due to formation of hybrid genes comprising portions of both red and green pigment genes. Characteristic anomalous patterns were seen in 15 (11.2%) individuals: 7 (5.2%) had patterns characteristic of deuteranomaly, 2 (1.5%) had patterns characteristic of deuteranopia, and 6 (4.5%) had protan patterns. Previously undescribed hybrid gene patterns consisting of both green and red pigment gene fragments in addition to normal red and green genes were observed in another 6 individuals (4.5%). Thus, DNA testing detected anomalous color vision pigment genes at a higher frequency than expected from phenotypic color vision tests.« less

Localization of complement factor H gene expression and protein distribution in the mouse outer retina

PubMed Central

Smit-McBride, Zeljka; Oltjen, Sharon L.; Radu, Roxana A.; Estep, Jason; Nguyen, Anthony T.; Gong, Qizhi

2015-01-01

Purpose To determine the localization of complement factor H (Cfh) mRNA and its protein in the mouse outer retina. Methods Quantitative real-time PCR (qPCR) was used to determine the expression of Cfh and Cfh-related (Cfhr) transcripts in the RPE/choroid. In situ hybridization (ISH) was performed using the novel RNAscope 2.0 FFPE assay to localize the expression of Cfh mRNA in the mouse outer retina. Immunohistochemistry (IHC) was used to localize Cfh protein expression, and western blots were used to characterize CFH antibodies used for IHC. Results Cfh and Cfhr2 transcripts were detected in the mouse RPE/choroid using qPCR, while Cfhr1, Cfhr3, and Cfhrc (Gm4788) were not detected. ISH showed abundant Cfh mRNA in the RPE of all mouse strains (C57BL/6, BALB/c, 129/Sv) tested, with the exception of the Cfh−/− eye. Surprisingly, the Cfh protein was detected by immunohistochemistry in photoreceptors rather than in RPE cells. The specificity of the CFH antibodies was tested by western blotting. Our CFH antibodies recognized purified mouse Cfh protein, serum Cfh protein in wild-type C57BL/6, BALB/c, and 129/Sv, and showed an absence of the Cfh protein in the serum of Cfh−/− mice. Greatly reduced Cfh protein immunohistological signals in the Cfh−/− eyes also supported the specificity of the Cfh protein distribution results. Conclusions Only Cfh and Cfhr2 genes are expressed in the mouse outer retina. Only Cfh mRNA was detected in the RPE, but no protein. We hypothesize that the steady-state concentration of Cfh protein is low in the cells due to secretion, and therefore is below the detection level for IHC. PMID:25684976

Novel actin crosslinker superfamily member identified by a two step degenerate PCR procedure.

PubMed

Byers, T J; Beggs, A H; McNally, E M; Kunkel, L M

1995-07-24

Actin-crosslinking proteins link F-actin into the bundles and networks that constitute the cytoskeleton. Dystrophin, beta-spectrin, alpha-actinin, ABP-120, ABP-280, and fimbrin share homologous actin-binding domains and comprise an actin crosslinker superfamily. We have identified a novel member of this superfamily (ACF7) using a degenerate primer-mediated PCR strategy that was optimized to resolve less-abundant superfamily sequences. The ACF7 gene is on human chromosome 1 and hybridizes to high molecular weight bands on northern blots. Sequence comparisons argue that ACF7 does not fit into one of the existing families, but represents a new class within the superfamily.

Probable Congenital Transmission of Reticuloendotheliosis Virus Caused by Vaccination with Contaminated Vaccines

PubMed Central

Zhu, Shufen; Guo, Wenlong; Sheng, Pengcheng; Wang, Zunmin; Zhao, Changliang; Zhao, Qingyou; Zhu, Ruiliang

2012-01-01

Contaminated vaccine is one unexpected and potential origin of virus infection. In order to investigate the most likely cause of disease in a broiler breeder company of Shandong Province, all 17 batches of live-virus vaccines used in the affected flocks and 478 tissue samples were tested by dot-blot hybridization, nested PCR, and IFA. The results suggested the outbreak of disease was most probably due to the vaccination of REV-contaminated MD-CVI988/Rispens vaccines and ND-LaSota+IB-H120 vaccines. Furthermore, the REV was probably transmitted to the commercial chickens through congenital transmission. PMID:22912872

Estrogen receptor mRNA in mineralized tissues of rainbow trout: calcium mobilization by estrogen.

PubMed

Armour, K J; Lehane, D B; Pakdel, F; Valotaire, Y; Graham, R; Russell, R G; Henderson, I W

1997-07-07

RT-PCR was undertaken on total RNA extracts from bone and scales of the rainbow trout, Oncorhynchus mykiss. The rainbow trout estrogen receptor (ER)-specific primers used amplified a single product of expected size from each tissue which, using Southern blotting, strongly hybridized with a 32P-labelled rtER probe under stringent conditions. These data provide the first in vivo evidence of ER mRNA in bone and scale tissues of rainbow trout and suggest that the effects of estrogen observed in this study (increased bone mineral and decreased scale mineral contents, respectively) may be mediated directly through ER.

Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkin, D.J.; Jones, C.; Kimbro, K.S.

1993-07-01

Indoleamine 2,3-dioxygenase (IDO) is the first enzyme in the catabolic pathway for tryptophan. This extrahepatic enzyme differs from the hepatic enzyme, tryptophan 2,3-dioxygenase (TDO), in molecular as well as enzymatic characteristics, although both enzymes catalyze the same reaction: cleavage of tryptophan into N-formylkynurenine. The induction of IDO by IFN-[gamma] plays a role in the antigrowth effect of IFN-[gamma] in cell cultures and in the inhibition of intracellular pathogens, e.g., Toxoplasma gondii and Chlamydia psittaci. Tryptophan is also the precursor for the synthesis of serotonin, and reduced levels of tryptophan and serotonin found in AIDS patients have been correlated with themore » presence of IFN-[gamma] and consequent elevation of IDO activity. The IDO enzyme has been purified and characterized, and its cDNA and genomic DNA clones have been isolated and analyzed. DNA from hybrid cells containing fragments of human chromosome 8 was used to determine the regional localization of the IDO gene on chromosome 8. The hybrids R30-5B and R30-2A contain 8p11 [yields] qter and 8q13 [yields] qter, respectively. Hybrid 229-3A contains the 8pter [yields] q11. The hybrid R30-2A was negative for the IDO gene, whereas R30-5B and 229-3A were positive as analyzed by PCR and verified by Southern blotting. Only the region close to the centromere is shared by R30-5B and 229-3A hybrids. The results indicate that the IDO gene is located on chromosome 8p11 [yields] q11.« less

Repair and recombination of X-irradiated plasmids in Xenopus laevis oocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sweigert, S.E.; Carroll, D.

1990-11-01

Plasmid DNA substrates were X-irradiated and injected into the nuclei of Xenopus laevis oocytes. After incubation for 20 h, DNA was recovered from the oocytes and analyzed simultaneously for repair and for intermolecular homologous recombination by electrophoresis and bacterial transformation. Oocyte-mediated repair of DNA strand breaks was observed with both methods. Using a repair-deficient mutant Escherichia coli strain and its repair-proficient parent as hosts for the transformation assay, we also demonstrated that oocytes repaired oxidative-type DNA base damage induced by X-rays. X-irradiation of a circular DNA stimulated its potential to recombine with a homologous linear partner. Recombination products were detectedmore » directly by Southern blot hybridization and as bacterial transformant clones expressing two antibiotic resistance markers originally carried separately on the two substrates. The increase in recombination was dependent on X-ray dose. There is some suggestion that lesions other than double-strand breaks contribute to the stimulation of oocyte-mediated homologous recombination. In summary, oocytes have considerable capacity to repair X-ray-induced damage, and some X-ray lesions stimulate homologous recombination in these cells.« less

Drought-tolerant rice germplasm developed from an Oryza officinalis transformation-competent artificial chromosome clone.

PubMed

Liu, R; Zhang, H H; Chen, Z X; Shahid, M Q; Fu, X L; Liu, X D

2015-10-29

Oryza officinalis has proven to be a natural gene reservoir for the improvement of domesticated rice as it carries many desirable traits; however, the transfer of elite genes to cultivated rice by conventional hybridization has been a challenge for rice breeders. In this study, the conserved sequence of plant stress-related NAC transcription factors was selected as a probe to screen the O. officinalis genomic transformation-competent artificial chromosome library by Southern blot; 11 positive transformation-competent artificial chromosome clones were subsequently detected. By Agrobacterium-mediated transformation, an indica rice variety, Huajingxian 74 (HJX74), was transformed with a TAC clone harboring a NAC gene-positive genomic fragment from O. officinalis. Molecular analysis revealed that the O. officinalis genomic fragment was integrated into the genome of HJX74. The transgenic lines exhibited high tolerance to drought stress. Our results demonstrate that the introduction of stress-related transformation-competent artificial chromosome clones, coupled with a transgenic validation approach, is an effective method of transferring agronomically important genes from O. officinalis to cultivated rice.

Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

PubMed Central

Siehnel, R J; Worobec, E A; Hancock, R E

1988-01-01

The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

Hybrid clone cells derived from human breast epithelial cells and human breast cancer cells exhibit properties of cancer stem/initiating cells.

PubMed

Gauck, Daria; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas

2017-08-02

The biological phenomenon of cell fusion has been associated with cancer progression since it was determined that normal cell × tumor cell fusion-derived hybrid cells could exhibit novel properties, such as enhanced metastatogenic capacity or increased drug resistance, and even as a mechanism that could give rise to cancer stem/initiating cells (CS/ICs). CS/ICs have been proposed as cancer cells that exhibit stem cell properties, including the ability to (re)initiate tumor growth. Five M13HS hybrid clone cells, which originated from spontaneous cell fusion events between M13SV1-EGFP-Neo human breast epithelial cells and HS578T-Hyg human breast cancer cells, and their parental cells were analyzed for expression of stemness and EMT-related marker proteins by Western blot analysis and confocal laser scanning microscopy. The frequency of ALDH1-positive cells was determined by flow cytometry using AldeRed fluorescent dye. Concurrently, the cells' colony forming capabilities as well as the cells' abilities to form mammospheres were investigated. The migratory activity of the cells was analyzed using a 3D collagen matrix migration assay. M13HS hybrid clone cells co-expressed SOX9, SLUG, CK8 and CK14, which were differently expressed in parental cells. A variation in the ALDH1-positive putative stem cell population was observed among the five hybrids ranging from 1.44% (M13HS-7) to 13.68% (M13HS-2). In comparison to the parental cells, all five hybrid clone cells possessed increased but also unique colony formation and mammosphere formation capabilities. M13HS-4 hybrid clone cells exhibited the highest colony formation capacity and second highest mammosphere formation capacity of all hybrids, whereby the mean diameter of the mammospheres was comparable to the parental cells. In contrast, the largest mammospheres originated from the M13HS-2 hybrid clone cells, whereas these cells' mammosphere formation capacity was comparable to the parental breast cancer cells. All M13HS hybrid clones exhibited a mesenchymal phenotype and, with the exception of one hybrid clone, responded to EGF with an increased migratory activity. Fusion of human breast epithelial cells and human breast cancer cells can give rise to hybrid clone cells that possess certain CS/IC properties, suggesting that cell fusion might be a mechanism underlying how tumor cells exhibiting a CS/IC phenotype could originate.

Identification of recombinant human EPO variants in greyhound plasma and urine by ELISA, LC-MS/MS and western blotting: a comparative study.

PubMed

Timms, Mark; Steel, Rohan; Vine, John

2016-02-01

The recombinant human erythropoietins epoetin alfa (Eprex®), darbepoetin (Aranesp®) and methoxy polyethylene glycol-epoetin beta (Mircera®) were administered to greyhounds for 7, 10 and 14 days respectively. Blood and urine samples were collected and analysed for erythropoietin by ELISA, LC-MS/MS and western blotting. Limits of confirmation in plasma for western blotting and LC-MS/MS methods ranged from a low of 2.5mIU/mL, and closely matched the sensitivity of ELISA screening. Copyright © 2015 John Wiley & Sons, Ltd.

Application of Whole Genome Expression Analysis to Assess Bacterial Responses to Environmental Conditions

NASA Astrophysics Data System (ADS)

Vukanti, R. V.; Mintz, E. M.; Leff, L. G.

2005-05-01

Bacterial responses to environmental signals are multifactorial and are coupled to changes in gene expression. An understanding of bacterial responses to environmental conditions is possible using microarray expression analysis. In this study, the utility of microarrays for examining changes in gene expression in Escherichia coli under different environmental conditions was assessed. RNA was isolated, hybridized to Affymetrix E. coli Genome 2.0 chips and analyzed using Affymetrix GCOS and Genespring software. Major limiting factors were obtaining enough quality RNA (107-108 cells to get 10μg RNA)and accounting for differences in growth rates under different conditions. Stabilization of RNA prior to isolation and taking extreme precautions while handling RNA were crucial. In addition, use of this method in ecological studies is limited by availability and cost of commercial arrays; choice of primers for cDNA synthesis, reproducibility, complexity of results generated and need to validate findings. This method may be more widely applicable with the development of better approaches for RNA recovery from environmental samples and increased number of available strain-specific arrays. Diligent experimental design and verification of results with real-time PCR or northern blots is needed. Overall, there is a great potential for use of this technology to discover mechanisms underlying organisms' responses to environmental conditions.

A hybrid of coumarin and phenylsulfonylfuroxan induces caspase-dependent apoptosis and cytoprotective autophagy in lung adenocarcinoma cells.

PubMed

Wang, Qian; Guo, Yalan; Jiang, Shanshan; Dong, Mengxue; Kuerban, Kudelaidi; Li, Jiyang; Feng, Meiqing; Chen, Ying; Ye, Li

2018-01-15

Lung adenocarcinoma is the most primary histologic subtype of non-small cell lung cancer (NSCLC). Compound 8b, a novel coumarin derivative with phenylsulfonylfuroxan group, shows significant antiproliferation activity against lung adenocarcinoma cell with low toxicity. This study aims to uncover the potential of compound 8b in relation to apoptosis as well as autophagy induction in lung adenocarcinoma cells. The cytotoxicity and apoptosis of A549 and H1299 cells induced by compound 8b were detected by MTT, microscope and western blot analysis. Autophagy was determined by TEM, confocal microscopy and western blot analysis. Akt/mTOR and Erk signaling pathway were also examined by western blot analysis. First, significant growth inhibition and caspase-dependent apoptosis were observed in compound 8b-treated A549 and H1299 cells. Then, we confirmed compound 8b-induced autophagy by autophagosomes formation, upregulated expression of autophagy-related protein LC3-II and autophagic flux. Importantly, abolishing autophagy using inhibitors and ATG5 siRNA enhanced the cytotoxicity of compound 8b, indicating the cytoprotective role of autophagy in lung adenocarcinoma. Further mechanistic investigations suggested that Akt/mTOR and Erk signaling pathways contributed to autophagy induction by compound 8b. This results demonstrate that compound 8b induces caspase-dependent apoptosis as well as cytoprotective autophagy in lung adenocarcinoma cells, which may provide scientific evidence for developing this furoxan-based NO-releasing coumarin derivative as a potential anti-lung adenocarcinoma therapeutic agents. Copyright © 2017 Elsevier GmbH. All rights reserved.

Evolutionarily conserved ELOVL4 gene expression in the vertebrate retina.

PubMed

Lagali, Pamela S; Liu, Jiafan; Ambasudhan, Rajesh; Kakuk, Laura E; Bernstein, Steven L; Seigel, Gail M; Wong, Paul W; Ayyagari, Radha

2003-07-01

The gene elongation of very long chain fatty acids-4 (ELOVL4) has been shown to underlie phenotypically heterogeneous forms of autosomal dominant macular degeneration. In this study, the extent of evolutionary conservation and the existence and localization of retinal expression of this gene was investigated across a wide variety of species. Southern blot analysis of genomic DNA and bioinformatic analysis using the human ELOVL4 cDNA and protein sequences, respectively, were performed to identify species in which ELOVL4 orthologues and/or homologues are present. Retinal RNA and protein extracts derived from different species were assessed by Northern hybridization and immunoblot techniques to assess evolutionary conservation of gene expression. Immunohistochemical analysis of tissue sections prepared from various mammalian retinas was performed to determine the distribution of ELOVL4 and homologous proteins within specific retinal cell layers. The existence of ELOVL4 sequence orthologues and homologues was confirmed by both Southern blot analysis and in silico searches of protein sequence databases. Phylogenetic analysis places ELOVL4 among a large family of known and putative fatty acid elongase proteins. Northern blot analysis revealed the presence of multiple transcripts corresponding to ELOVL4 homologues expressed in the retina of several different mammalian species. Conserved proteins were also detected among retinal extracts of different mammals and were found to localize predominantly to the photoreceptor cell layer within retinal tissue preparations. The ELOVL4 gene is highly conserved throughout evolution and is expressed in the photoreceptor cells of the retina in a variety of different species, which suggests that it plays a critical role in retinal cell biology.

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Birc7: A Late Fiber Gene of the Crystalline Lens

PubMed Central

De Maria, Alicia; Bassnett, Steven

2015-01-01

Purpose A distinct subset of genes, so-called “late fiber genes,” is expressed in cells bordering the central, organelle-free zone (OFZ) of the lens. The purpose of this study was to identify additional members of this group. Methods Fiber cells were harvested from various layers of the lens by laser micro-dissection and subjected to microarray, in situ hybridization, and Western blot analysis. Results Expression of Livin, a member of the inhibitor of apoptosis protein (IAP) family encoded by Birc7, was strongly upregulated in deep cortical fiber cells. The depth-dependent distribution of Livin mRNA was confirmed by quantitative PCR and in situ hybridization. The onset of Livin expression coincided with loss of organelles from primary fiber cells. Livin expression peaked at 1 month but was sustained even in aged lenses. Antibodies raised against mouse Livin labeled multiple bands on immunoblots, reflecting progressive proteolysis of the parent molecule during differentiation. Mice harboring a floxed Birc7 allele were generated and used to conditionally delete Birc7 in lens. Lenses from knockout mice grew normally and retained their transparency, suggesting that Livin does not have an indispensable role in fiber cell differentiation. Conclusions Birc7 is a late fiber gene of the mouse lens. In tumor cells, Livin acts as an antiapoptotic protein, but its function in the lens is enigmatic. Livin is a RING domain protein with putative E3 ubiquitin ligase activity. Its expression in cells bordering the OFZ is consistent with a role in organelle degradation, a process in which the ubiquitin proteasome pathway has been implicated previously. PMID:26218911

Genetic and Molecular Characterization of the I Locus of Phaseolus vulgaris

PubMed Central

Vallejos, C. Eduardo; Astua-Monge, Gustavo; Jones, Valerie; Plyler, Tammy R.; Sakiyama, Ney S.; Mackenzie, Sally A.

2006-01-01

The I locus of the common bean, Phaseolus vulgaris, controls the development of four different phenotypes in response to inoculation with Bean common mosaic virus, Bean common mosaic necrosis virus, several other related potyviruses, and one comovirus. We have generated a high-resolution linkage map around this locus and have aligned it with a physical map constructed with BAC clones. These clones were obtained from a library of the cultivar “Sprite,” which carries the dominant allele at the I locus. We have identified a large cluster of TIR–NBS–LRR sequences associated within this locus, which extends over a distance >425 kb. Bean cultivars from the Andean or Mesoamerican gene pool that contain the dominant allele share the same haplotypes as revealed by gel blot hybridizations with a TIR probe. In contrast, beans with a recessive allele display simpler and variable haplotypes. A survey of wild accessions from Argentina to Mexico showed that this multigene family has expanded significantly during evolution and domestication. RNA gel blot analysis indicated that the TIR family of genes plays a role in the response to inoculations with BCMV or BCMNV. PMID:16322513

Stable Membrane-Association of mRNAs in Etiolated, Greening and Mature Plastids.

PubMed

Legen, Julia; Schmitz-Linneweber, Christian

2017-08-31

Chloroplast genes are transcribed as polycistronic precursor RNAs that give rise to a multitude of processing products down to monocistronic forms. Translation of these mRNAs is realized by bacterial type 70S ribosomes. A larger fraction of these ribosomes is attached to chloroplast membranes. This study analyzed transcriptome-wide distribution of plastid mRNAs between soluble and membrane fractions of purified plastids using microarray analyses and validating RNA gel blot hybridizations. To determine the impact of light on mRNA localization, we used etioplasts, greening plastids and mature chloroplasts from Zea mays as a source for membrane and soluble extracts. The results show that the three plastid types display an almost identical distribution of RNAs between the two organellar fractions, which is confirmed by quantitative RNA gel blot analyses. Furthermore, they reveal that different RNAs processed from polycistronic precursors show transcript-autonomous distribution between stroma and membrane fractions. Disruption of ribosomes leads to release of mRNAs from membranes, demonstrating that attachment is likely a direct consequence of translation. We conclude that plastid mRNA distribution is a stable feature of different plastid types, setting up rapid chloroplast translation in any plastid type.

HIV‑2 antibody detection after indeterminate or negative HIV‑1 Western blot in Cuba, 2005-2008.

PubMed

Díaz, Dervel F; Ortiz, Eva; Martín, Dayamí; Nibot, Carmen; Rizo, Adis; Silva, Eladio

2012-01-01

INTRODUCTION Differentiating between HIV-1 and HIV-2 infection is the first step to understanding HIV transmission, epidemiology and pathogenesis in geographical areas where both viruses circulate. In Cuba, positive results in mixed HIV-1/2 screening assays are confirmed by HIV-1 Western blot. Indeterminate results constitute the main limitation of this test and HIV-2 infection is among their possible causes; hence the importance of second-stage screening and confirmatory tests for HIV-2 infection. OBJECTIVE Investigate the contribution of HIV-2 antibodies to negative or indeterminate HIV-1 Western blot results in serum samples from 2005 through 2008 in Cuba. METHODS HIV-2 reactivity was studied using the ELISA DAVIH-VIH-2 diagnostic kit (Cuba) in 1723 serum samples with negative or indeterminate results for HIV-1 Western blot from January 2005 through December 2008. Duplicate sera reactive by ELISA were confirmed by HIV-2 Western blot, results interpreted according to WHO criteria. The epidemiological interview established by Cuba's National Program for Prevention and Control Sexually-Transmitted Diseases and HIV/AIDS was applied to HIV-2 Western blot-positive patients. RESULTS Among all sera studied, HIV-2 ELISA identified 12 reactive serum samples (0.70%) and 1711 non-reactive (99.30%). Western blot analysis of the 12 ELISA-reactive samples confirmed two positive samples (16.67%), 4 negative (33.33%) and 6 indeterminate (50%). Positive samples reacted against the p16, p26, gp36, p53, p56, p68 and gp105 proteins. All 12 ELISA-reactive samples belonged to the HIV-1 Western blot indeterminate group. The two HIV-2-positive samples showed well defined reactivity to gp160, p53, p55 and p34 of HIV-1. HIV-1 seroconversion was observed in all 10 remaining samples during serological followup. CONCLUSIONS Two new HIV-2 seropositive cases were diagnosed using DAVIH-VIH-2 and HIV-2 Western blot in indeterminate HIV-1 Western blot samples. Results support the recommendation that HIV-2 Western blot be included in the diagnostic algorithm for HIV-1/2 to followup negative or indeterminate HIV-1 Western blot results. KEYWORDS Diagnosis, laboratory techniques and procedures, antibodies, HIV-2, Western blot, enzyme-linked immunosorbent assay, algorithm, Cuba.

An evaluation of new and established methods to determine T‐DNA copy number and homozygosity in transgenic plants.

PubMed Central

Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K.; Clemente, Tom E.

2016-01-01

Abstract Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL‐)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T‐DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL‐PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T‐DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T‐DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided. PMID:26670088

Reduction hybrid artifacts of EMG-EOG in electroencephalography evoked by prefrontal transcranial magnetic stimulation

NASA Astrophysics Data System (ADS)

Bai, Yang; Wan, Xiaohong; Zeng, Ke; Ni, Yinmei; Qiu, Lirong; Li, Xiaoli

2016-12-01

Objective. When prefrontal-transcranial magnetic stimulation (p-TMS) performed, it may evoke hybrid artifact mixed with muscle activity and blink activity in EEG recordings. Reducing this kind of hybrid artifact challenges the traditional preprocessing methods. We aim to explore method for the p-TMS evoked hybrid artifact removal. Approach. We propose a novel method used as independent component analysis (ICA) post processing to reduce the p-TMS evoked hybrid artifact. Ensemble empirical mode decomposition (EEMD) was used to decompose signal into multi-components, then the components were separated with artifact reduced by blind source separation (BSS) method. Three standard BSS methods, ICA, independent vector analysis, and canonical correlation analysis (CCA) were tested. Main results. Synthetic results showed that EEMD-CCA outperformed others as ICA post processing step in hybrid artifacts reduction. Its superiority was clearer when signal to noise ratio (SNR) was lower. In application to real experiment, SNR can be significantly increased and the p-TMS evoked potential could be recovered from hybrid artifact contaminated signal. Our proposed method can effectively reduce the p-TMS evoked hybrid artifacts. Significance. Our proposed method may facilitate future prefrontal TMS-EEG researches.

Nonenzymatic chemiluminescent detection and quantitation of total protein on Western and slot blots allowing subsequent immunodetection and sequencing.

PubMed

Alba, F J; Daban, J R

1997-10-01

We have studied the light emission efficiency of proteins labeled with different fluorescent dyes chemically excited by the bis(2,4,6-trichlorophenyl)oxalate (TCPO)-H2O2 reaction. Using this peroxyoxalate chemiluminescence system, the best results were obtained with proteins covalently labeled with 2-methoxy-2,4-diphenyl-3(2H)-furanone (MDPF). Blotted proteins on polyvinylidene difluoride (PVDF) membranes can be labeled rapidly with MDPF. Our results demonstrate that energy from the excited intermediate produced in the TCPO-H2O2 reaction can be efficiently transferred to MDPF-labeled proteins in solution and on PVDF membranes. Although this nonenzymatic chemiluminescent system produces a background emission that reduces the sensitivity, the method developed in this work allows detection of 5 ng of protein in blots after 5 min exposure to X-ray film. Chemiluminescence of MDPF-labeled proteins on Western and slot blots may also be detected and quantified using a charge-coupled device (CCD) camera or a storage phosphor imaging system. This chemiluminescent method allows the staining of the total electrophoretic pattern but does not preclude further N-terminal sequencing and immunodetection of specific bands.

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

1997-01-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, J.N.; Straume, T.; Bogen, K.T.

1997-04-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

Cloning and expression in Escherichia coli of Vibrio parahaemolyticus thermostable direct hemolysin and thermolabile hemolysin genes.

PubMed

Taniguchi, H; Ohta, H; Ogawa, M; Mizuguchi, Y

1985-05-01

Two hemolysin genes of Vibrio parahaemolyticus WP1, a thermostable direct (TSD) hemolysin gene and a thermolabile hemolysin gene, were cloned into the pBR322 vector in Escherichia coli K-12 C600. A large amount of the TSD hemolysin produced in E. coli K-12 accumulated in the periplasmic space. The TSD hemolysin gene was localized on a 0.9-kilobase HindIII-BamHI fragment by identifying qualitatively the production of the TSD hemolysin by a reverse passive hemagglutination assay in the osmotic shock fluid. The thermolabile hemolysin gene was isolated on a 1.3-kilobase HindIII-PstI fragment by selection with the hemolysin on blood agar. Southern blot hybridization and colony hybridization experiments indicated that the TSD hemolysin gene was present in the chromosomal DNA of 15 Kanagawa phenomenon-positive strains but not in 14 negative strains, whereas the thermolabile hemolysin gene was detected in all strains. No homologous DNA sequences to TSD and thermolabile hemolysin genes were detected in the chromosomes of Vibrio cholerae, Vibrio vulnificus, non-O1 V. cholerae, and Vibrio anguillarum.

Electroconvulsive shock increases preproenkephalin messenger RNA abundance in rat hypothalamus.

PubMed Central

Yoshikawa, K; Hong, J S; Sabol, S L

1985-01-01

Daily administration of electroconvulsive shock (ECS) to rats for 10 days increased the content of [Met5]enkephalin in the hypothalamus and the striatum by 64% and 45%, respectively. The effect of ECS on the relative abundance of mRNA coding for the enkephalin precursor preproenkephalin was investigated. Analysis by cell-free translation of polyadenylylated RNA and immunoprecipitation of preproenkephalin revealed ECS-elicited increases of 79% and 14% in preproenkephalin mRNA activity in the hypothalamus and striatum, respectively. ECS treatment did not affect the general translational activity of total polyadenylylated RNA from these brain regions. A 32P-labeled probe prepared from a rat preproenkephalin cDNA clone hybridized with an apparently single species of polyadenylylated RNA of approximately equal to 1450 nucleotides from both hypothalamus and striatum. Dot-blot hybridization of polyadenylylated RNA with the rat probe indicated that ECS elicits a 76% increase in the preproenkephalin mRNA abundance in the hypothalamus and no significant change in the striatum. These results suggest that ECS treatment leads to enhanced biosynthesis of the enkephalin precursor in hypothalamic neurons. Images PMID:2578669

Molecular Characterization of Plasmid-Mediated Oxytetracycline Resistance in Aeromonas salmonicida

PubMed Central

Adams, C. A.; Austin, B.; Meaden, P. G.; McIntosh, D.

1998-01-01

Using broth conjugation, we found that 19 of 29 (66%) oxytetracycline (OT)-resistant isolates of Aeromonas salmonicida transferred the OT resistance phenotype to Escherichia coli. The OT resistance phenotype was encoded by high-molecular-weight R-plasmids that were capable of transferring OT resistance to both environmental and clinical isolates of Aeromonas spp. The molecular basis for antibiotic resistance in OT-resistant isolates of A. salmonicida was determined. The OT resistance determinant from one plasmid (pASOT) of A. salmonicida was cloned and used in Southern blotting and hybridization experiments as a probe. The determinant was identified on a 5.4-kb EcoRI fragment on R-plasmids from the 19 OT-resistant isolates of A. salmonicida. Hybridization with plasmids encoding the five classes (classes A to E) of OT resistance determinants demonstrated that the OT resistance plasmids of the 19 A. salmonicida isolates carried the class A resistance determinant. Analysis of data generated from restriction enzyme digests showed that the OT resistance plasmids were not identical; three profiles were characterized, two of which showed a high degree of homology. PMID:9797265

Localization of the human mitochondrial citrate transporter protein gene to chromosome 22q11 in the DiGeorge syndrome critical region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heisterkamp, N.; Hoeve, J.T.; Groffen, J.

A high percentage of patients with DiGeorge syndrome and velo-cardio-facial syndrome have interstitial deletions on chromosome 22q11. The shortest region of overlap is currently estimated to be around 500 kb. Two segments of DNA from chromosome 22q11, located 160 kb apart, were cloned because they contained NotI restriction enzyme sites. In the current study we demonstrate that these segments are absent from chromosomes 22 carrying microdeletions of two different DiGeorge patients. Fluorescence in situ and Southern blot hybridization was further used to show that this locus is within the DiGeorge critical region. Phylogenetically conserved sequences adjacent to one of themore » two NotI sites hybridized to mRNAs in different human cell lines. cDNAs isolated with a probe from this segment showed it to contain the gene for the human mitochondrial citrate transporter protein. Deletion of this gene in DiGeorge may contribute to the mental deficiency seen in the patients. 35 refs., 5 figs.« less

5-Lipoxygenase gene expression in the thymus.

PubMed

Hostein, I; Dorion-Bonnet, F; Bloch, B; Vaillier, D; Juzan, M; Gualde, N

1992-09-01

Eicosanoids are arachidonic acid metabolites issued both the cyclooxygenase and the lipoxygenase pathways. Many of these products were reported to modulate the immune response. Since most of eicosanoids have a short half life they are considered as local immunomodulators. Interactions between eicosanoids and thymocytes appear to be complex within the thymus. It was reported that cyclooxegenase derivatives of arachidonic acid are produced in this primary lymphoid organ mostly by cells of the thymic microenvironment. On the other hand it is not yet clearly established (1) what is the location of the lipoxygenase-positive cells within the gland and (2) what is the ratio of cells producing lipoxygenase metabolites of arachidonic acid when compared to the whole thymocyte population. Using two oligonucleotides complementary to the rat 5-lipoxygenase mRNA we demonstrated (by both hybridization on Northern blots and in situ hybridization) the expression of the 5-lipoxygenase gene in the thymus. 5-lipoxygenase positive cells appear to be associated in "clusters" and are mostly located in the thymic cortex. It is likely that they belong to the thymic microenvironment.

Improved high-throughput quantification of luminescent microplate assays using a common Western-blot imaging system.

PubMed

Hawkins, Liam J; Storey, Kenneth B

2017-01-01

Common Western-blot imaging systems have previously been adapted to measure signals from luminescent microplate assays. This can be a cost saving measure as Western-blot imaging systems are common laboratory equipment and could substitute a dedicated luminometer if one is not otherwise available. One previously unrecognized limitation is that the signals captured by the cameras in these systems are not equal for all wells. Signals are dependent on the angle of incidence to the camera, and thus the location of the well on the microplate. Here we show that: •The position of a well on a microplate significantly affects the signal captured by a common Western-blot imaging system from a luminescent assay.•The effect of well position can easily be corrected for.•This method can be applied to commercially available luminescent assays, allowing for high-throughput quantification of a wide range of biological processes and biochemical reactions.

Amplification and chromosomal dispersion of human endogenous retroviral sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, P.E.; Martin, M.A.; Rabson, A.B.

1986-09-01

Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less

Characterization of the camel skin cell line Dubca.

PubMed

Klopries, M; Wernery, U; Kaaden, O R

1995-01-01

A skin fibroblast cell culture was established from a 2-month-old dromedary foetus. The cells were transformed by infection with SV40 and cloned in soft agar. The established cell line is now designated Dubca cells (Dubai camel) and has been in permanent culture for 95 passages. The cell culture was examined morphologically, chromosome preparations made and DNA fingerprinting performed by hybridization with the oligonucleotide probe (GTG)5. SV40 large T antigen was detected by western blotting. The viral host range was determined by infection with viruses of different families. Camelpox virus (CaPV) bovine herpesvirus-1 (BHV-1), vesicular stomatitis virus (VSV) and border disease virus (BDV) could be propagated in these cells.

Plasmid-encoded amikacin resistance in multiresistant strains of Klebsiella pneumoniae isolated from neonates with meningitis.

PubMed Central

Woloj, M; Tolmasky, M E; Roberts, M C; Crosa, J H

1986-01-01

Two multiresistant Klebsiella pneumoniae strains isolated from cerebrospinal fluid of human neonates were analyzed for their plasmid content. Two of the plasmids harbored by these strains, pJHCMW1 (11 kilobase pairs) and pJHCMW4 (75 kilobase pairs), carried genetic determinants for amikacin resistance. These plasmids also encoded resistance to kanamycin, tobramycin, and ampicillin which could be transferred to Escherichia coli by conjugation. Extracts from transconjugant derivatives carrying pJHCMW4 produced an acetyltransferase activity that acetylated all three aminoglycosides. Transconjugant derivatives carrying pJHCMW1 encoded both acetylating and phosphorylating activities. Southern blot hybridization analysis indicated considerable DNA homology between these two plasmids. Images PMID:3521478

Cross-reactivity of antigens and antibodies belonging to different pathogenic types of human papillomaviruses.

PubMed

Salyaev, R K; Rekoslavskaya, N I; Stolbikov, A S

2017-11-01

The analysis of the properties of a quadrivalent peroral vaccine against the cervical cancer, which was created in a plant expression system on the base of transgenic tomato fruits, by immunoassay and Western blot hybridization showed that the antibodies against human papilloma virus 16 L1 (HPV16 L1) actively interacted not only with the antigenic proteins HPV18 L1, HPV31 L1, and HPV45 L1, but also with the antigenic protein HPV6 L1, which belongs to another HPV family. Thus, new data on the possibility of crossreactivity between antibodies and antigens belonging to remote HPV families were obtained.

Chromosome Rearrangements Recovered following Transformation of Neurospora Crassa

PubMed Central

Perkins, D. D.; Kinsey, J. A.; Asch, D. K.; Frederick, G. D.

1993-01-01

New chromosome rearrangements were found in 10% or more of mitotically stable transformants. This was shown for transformations involving a variety of different markers, vectors and recipient strains. Breakpoints were randomly distributed among the seven linkage groups. Controls using untransformed protoplasts of the same strains contained almost no rearrangements. A study of molecularly characterized Am(+) transformants showed that rearrangements are frequent when multiple ectopic integration events have occurred. In contrast, rearrangements are absent or infrequent when only the resident locus is restored to am(+) by a homologous event. Sequences of the transforming vector were genetically linked to breakpoints in 6 of 10 translocations that were examined using Southern hybridization or colony blots. PMID:8349106

Efficient Agrobacterium-Mediated Transformation of Hybrid Poplar Populus davidiana Dode × Populus bollena Lauche

PubMed Central

Han, Xue; Ma, Shurong; Kong, Xianghui; Takano, Tetsuo; Liu, Shenkui

2013-01-01

Poplar is a model organism for high in vitro regeneration in woody plants. We have chosen a hybrid poplar Populus davidiana Dode × Populus bollena Lauche. By optimizing the Murashige and Skoog medium with (0.3 mg/L) 6-benzylaminopurine and (0.08 mg/L) naphthaleneacetic acid, we have achieved the highest frequency (90%) for shoot regeneration from poplar leaves. It was also important to improve the transformation efficiency of poplar for genetic breeding and other applications. In this study, we found a significant improvement of the transformation frequency by controlling the leaf age. Transformation efficiency was enhanced by optimizing the Agrobacterium concentration (OD600 = 0.8–1.0) and an infection time (20–30 min). According to transmission electron microscopy observations, there were more Agrobacterium invasions in the 30-day-old leaf explants than in 60-day-old and 90-day-old explants. Using the green fluorescent protein (GFP) marker, the expression of MD–GFP fusion proteins in the leaf, shoot, and root of hybrid poplar P. davidiana Dode × P. bollena Lauche was visualized for confirmation of transgene integration. Southern and Northern blot analysis also showed the integration of T-DNA into the genome and gene expression of transgenic plants. Our results suggest that younger leaves had higher transformation efficiency (~30%) than older leaves (10%). PMID:23354481

Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.

PubMed

Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa

2008-10-01

A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.

Molecular cytogenetic analysis of Xq critical regions in premature ovarian failure

PubMed Central

2013-01-01

Background One of the frequent reasons for unsuccessful conception is premature ovarian failure/primary ovarian insufficiency (POF/POI) that is defined as the loss of functional follicles below the age of 40 years. Among the genetic causes the most common one involves the X chromosome, as in Turner syndrome, partial X deletion and X-autosome translocations. Here we report a case of a 27-year-old female patient referred to genetic counselling because of premature ovarian failure. The aim of this case study to perform molecular genetic and cytogenetic analyses in order to identify the exact genetic background of the pathogenic phenotype. Results For premature ovarian failure disease diagnostics we performed the Fragile mental retardation 1 gene analysis using Southern blot technique and Repeat Primed PCR in order to identify the relationship between the Fragile mental retardation 1 gene premutation status and the premature ovarion failure disease. At this early onset, the premature ovarian failure affected patient we detected one normal allele of Fragile mental retardation 1 gene and we couldn’t verify the methylated allele, therefore we performed the cytogenetic analyses using G-banding and fluorescent in situ hybridization methods and a high resolution molecular cytogenetic method, the array comparative genomic hybridization technique. For this patient applying the G-banding, we identified a large deletion on the X chromosome at the critical region (ChrX q21.31-q28) which is associated with the premature ovarian failure phenotype. In order to detect the exact breakpoints, we used a special cytogenetic array ISCA plus CGH array and we verified a 67.355 Mb size loss at the critical region which include total 795 genes. Conclusions We conclude for this case study that the karyotyping is definitely helpful in the evaluation of premature ovarian failure patients, to identify the non submicroscopic chromosomal rearrangement, and using the array CGH technique we can contribute to the most efficient detection and mapping of exact deletion breakpoints of the deleted Xq region. PMID:24359613

The role of human papillomavirus in p16-positive oral cancers.

PubMed

Belobrov, Simone; Cornall, Alyssa M; Young, Richard J; Koo, Kendrick; Angel, Christopher; Wiesenfeld, David; Rischin, Danny; Garland, Suzanne M; McCullough, Michael

2018-01-01

The aim of this study was to identify the presence and frequency of human papillomavirus (HPV) nucleic acid in p16-positive oral squamous cell carcinomas (OSCCs), to assess whether the virus was transcriptionally active and to assess the utility of p16 overexpression as a surrogate marker for HPV in OSCC. Forty-six OSCC patients treated between 2007 and 2011 with available formalin-fixed paraffin-embedded (FFPE) specimens were included. Twenty-three patients were positive for p16 by immunohistochemistry (IHC) and these were matched with 23 patients with p16-negative tumours. Laser capture microdissection of the FFPE OSCC tissues was undertaken to isolate invasive tumour tissue. DNA was extracted and tested for high-risk HPV types using a PCR-ELISA method based on the L1 SPF10 consensus primers, and a real-time PCR method targeting HPV-16 and HPV-18 E6 region. Genotyping of HPV-positive cases was performed using a reverse line blot hybridization assay (Inno-LiPA). RNAScope ® (a chromogenic RNA in situ hybridization assay) was utilized to detect E6/E7 mRNA of known high-risk HPV types for detection of transcriptionally active virus. HPV DNA was found in 3 OSCC cases, all of which were p16 IHC-positive. Two cases were genotyped as HPV-16 and one as HPV-33. Only one of the HPV-16 cases was confirmed to harbour transcriptionally active virus via HPV RNA ISH. We have shown that the presence of transcriptionally active HPV rarely occurs in OSCC and that p16 is not an appropriate surrogate marker for HPV in OSCC cases. We propose that non-viral mechanisms are responsible for the majority of IHC p16 overexpression in OSCC. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Power Source Status Estimation and Drive Control Method for Autonomous Decentralized Hybrid Train

NASA Astrophysics Data System (ADS)

Furuya, Takemasa; Ogawa, Kenichi; Yamamoto, Takamitsu; Hasegawa, Hitoshi

A hybrid control system has two main functions: power sharing and equipment protection. In this paper, we discuss the design, construction and testing of a drive control method for an autonomous decentralized hybrid train with 100-kW-class fuel cells (FC) and 36-kWh lithium-ion batteries (Li-Batt). The main objectives of this study are to identify the operation status of the power sources on the basis of the input voltage of the traction inverter and to estimate the maximum traction power control basis of the power-source status. The proposed control method is useful in preventing overload operation of the onboard power sources in an autonomous decentralized hybrid system that has a flexible main circuit configuration and a few control signal lines. Further, with this method, the initial cost of a hybrid system can be reduced and the retrofit design of the hybrid system can be simplified. The effectiveness of the proposed method is experimentally confirmed by using a real-scale hybrid train system.

Performance analysis of AES-Blowfish hybrid algorithm for security of patient medical record data

NASA Astrophysics Data System (ADS)

Mahmud H, Amir; Angga W, Bayu; Tommy; Marwan E, Andi; Siregar, Rosyidah

2018-04-01

A file security is one method to protect data confidentiality, integrity and information security. Cryptography is one of techniques used to secure and guarantee data confidentiality by doing conversion to the plaintext (original message) to cipher text (hidden message) with two important processes, they are encrypt and decrypt. Some researchers proposed a hybrid method to improve data security. In this research we proposed hybrid method of AES-blowfish (BF) to secure the patient’s medical report data into the form PDF file that sources from database. Generation method of private and public key uses two ways of approach, those are RSA method f RSA and ECC. We will analyze impact of these two ways of approach for hybrid method at AES-blowfish based on time and Throughput. Based on testing results, BF method is faster than AES and AES-BF hybrid, however AES-BF hybrid is better for throughput compared with AES and BF is higher.

A hybrid neural learning algorithm using evolutionary learning and derivative free local search method.

PubMed

Ghosh, Ranadhir; Yearwood, John; Ghosh, Moumita; Bagirov, Adil

2006-06-01

In this paper we investigate a hybrid model based on the Discrete Gradient method and an evolutionary strategy for determining the weights in a feed forward artificial neural network. Also we discuss different variants for hybrid models using the Discrete Gradient method and an evolutionary strategy for determining the weights in a feed forward artificial neural network. The Discrete Gradient method has the advantage of being able to jump over many local minima and find very deep local minima. However, earlier research has shown that a good starting point for the discrete gradient method can improve the quality of the solution point. Evolutionary algorithms are best suited for global optimisation problems. Nevertheless they are cursed with longer training times and often unsuitable for real world application. For optimisation problems such as weight optimisation for ANNs in real world applications the dimensions are large and time complexity is critical. Hence the idea of a hybrid model can be a suitable option. In this paper we propose different fusion strategies for hybrid models combining the evolutionary strategy with the discrete gradient method to obtain an optimal solution much quicker. Three different fusion strategies are discussed: a linear hybrid model, an iterative hybrid model and a restricted local search hybrid model. Comparative results on a range of standard datasets are provided for different fusion hybrid models.

The complete sequence and structural analysis of human apolipoprotein B-100: relationship between apoB-100 and apoB-48 forms.

PubMed Central

Cladaras, C; Hadzopoulou-Cladaras, M; Nolte, R T; Atkinson, D; Zannis, V I

1986-01-01

We have isolated and sequenced overlapping cDNA clones covering the entire sequence of human apolipoprotein B-100 (apoB-100). DNA sequence analysis and determination of the mRNA transcription initiation site by S1 nuclease mapping showed that the apoB mRNA consists of 14,112 nucleotides including the 5' and 3' untranslated regions which are 128 and 301 nucleotides respectively. The DNA-derived protein sequence shows that apoB-100 is 513,000 daltons and contains 4560 amino acids including a 24-amino-acid-long signal peptide. The mol. wt of apoB-100 implies that there is one apoB molecule per LDL particle. Computer analysis of the predicted secondary structure of the protein showed that some of the potential alpha helical and beta sheet structures are amphipathic, whereas others have non-amphipathic neutral to apolar character. These latter regions may contribute to the formation of the lipid-binding domains of apoB-100. The protein contains 25 cysteines and 20 potential N-glycosylation sites. The majority of cysteines are distributed in the amino terminal portion of the protein. Four of the potential glycosylation sites are in predicted beta turn structures and may represent true glycosylation positions. ApoB lacks the tandem repeats which are characteristic of other apolipoproteins. The mean hydrophobicity the mean value of H1 and helical hydrophobic moment the mean value of microH profiles of apoB showed the presence of several potential helical regions with strong polar character and high hydrophobic moment. The region with the highest hydrophobic moment, between amino acid residues 3352 and 3369, contains five closely spaced, positively charged residues, and has sequence homology to the LDL receptor binding site of apoE. This region is flanked by three neighbouring regions with positively charged amino acids and high hydrophobic moment that are located between residues 3174 and 3681. One or more of these closely spaced apoB sequences may be involved in the formation of the LDL receptor-binding domain of apoB-100. Blotting analysis of intestinal RNA and hybridization of the blots with carboxy apoB cDNA probes produced a single 15-kb hybridization band whereas hybridization with amino terminal probes produced two hybridization bands of 15 and 8 kb. Our data indicate that both forms of apoB mRNA contain common sequences which extend from the amino terminal of apoB-100 to the vicinity of nucleotide residue 6300. These two messages may have resulted from differential splicing of the same primary apoB mRNA transcript. Images Fig. 4. Fig. 6. PMID:3030729

On Hybrid and mixed finite element methods

NASA Technical Reports Server (NTRS)

Pian, T. H. H.

1981-01-01

Three versions of the assumed stress hybrid model in finite element methods and the corresponding variational principles for the formulation are presented. Examples of rank deficiency for stiffness matrices by the hybrid stress model are given and their corresponding kinematic deformation modes are identified. A discussion of the derivation of general semi-Loof elements for plates and shells by the hybrid stress method is given. It is shown that the equilibrium model by Fraeijs de Veubeke can be derived by the approach of the hybrid stress model as a special case of semi-Loof elements.

Efficient parameter estimation in longitudinal data analysis using a hybrid GEE method.

PubMed

Leung, Denis H Y; Wang, You-Gan; Zhu, Min

2009-07-01

The method of generalized estimating equations (GEEs) provides consistent estimates of the regression parameters in a marginal regression model for longitudinal data, even when the working correlation model is misspecified (Liang and Zeger, 1986). However, the efficiency of a GEE estimate can be seriously affected by the choice of the working correlation model. This study addresses this problem by proposing a hybrid method that combines multiple GEEs based on different working correlation models, using the empirical likelihood method (Qin and Lawless, 1994). Analyses show that this hybrid method is more efficient than a GEE using a misspecified working correlation model. Furthermore, if one of the working correlation structures correctly models the within-subject correlations, then this hybrid method provides the most efficient parameter estimates. In simulations, the hybrid method's finite-sample performance is superior to a GEE under any of the commonly used working correlation models and is almost fully efficient in all scenarios studied. The hybrid method is illustrated using data from a longitudinal study of the respiratory infection rates in 275 Indonesian children.

A hybrid perturbation Galerkin technique with applications to slender body theory

NASA Technical Reports Server (NTRS)

Geer, James F.; Andersen, Carl M.

1989-01-01

A two-step hybrid perturbation-Galerkin method to solve a variety of applied mathematics problems which involve a small parameter is presented. The method consists of: (1) the use of a regular or singular perturbation method to determine the asymptotic expansion of the solution in terms of the small parameter; (2) construction of an approximate solution in the form of a sum of the perturbation coefficient functions multiplied by (unknown) amplitudes (gauge functions); and (3) the use of the classical Bubnov-Galerkin method to determine these amplitudes. This hybrid method has the potential of overcoming some of the drawbacks of the perturbation method and the Bubnov-Galerkin method when they are applied by themselves, while combining some of the good features of both. The proposed method is applied to some singular perturbation problems in slender body theory. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the degree of applicability of the hybrid method to broader problem areas is discussed.

A hybrid perturbation Galerkin technique with applications to slender body theory

NASA Technical Reports Server (NTRS)

Geer, James F.; Andersen, Carl M.

1987-01-01

A two step hybrid perturbation-Galerkin method to solve a variety of applied mathematics problems which involve a small parameter is presented. The method consists of: (1) the use of a regular or singular perturbation method to determine the asymptotic expansion of the solution in terms of the small parameter; (2) construction of an approximate solution in the form of a sum of the perturbation coefficient functions multiplied by (unknown) amplitudes (gauge functions); and (3) the use of the classical Bubnov-Galerkin method to determine these amplitudes. This hybrid method has the potential of overcoming some of the drawbacks of the perturbation method and the Bubnov-Galerkin method when they are applied by themselves, while combining some of the good features of both. The proposed method is applied to some singular perturbation problems in slender body theory. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the degree of applicability of the hybrid method to broader problem areas is discussed.

Regulation of neuropeptide Y gene expression in rat brain.

PubMed

Lindefors, N; Brené, S; Herrera-Marschitz, M; Persson, H

1990-01-01

NPY mRNA expression was studied in rat brain using in situ hybridization and RNA blot analysis. Transsynaptic regulation of NPY gene expression was specifically studied in caudate-putamen and frontoparietal (somatosensory) cortex of rats with unilateral lesion of midbrain dopamine neurons and in sham-injected animals. NPY mRNA expression in these two brain regions and the regulation of midbrain dopamine neurons were compared with that of SOM, PPT, CCK and GAD mRNA expression. Neurons expressing NPY and SOM mRNA showed a similar distribution and the expression of both NPY and SOM appears to be regulated by dopamine in a similar fashion. Following a unilateral dopamine deafferentation, the numerical density of both NPY and SOM mRNA expressing neurons almost doubled in the lesioned rat caudate-putamen with no change in the average grain density over positive neurons. Hence, in the intact caudate-putamen dopamine appears to normally suppress expression of these two neuropeptide genes. An activation of both NPY and SOM mRNA expression in many non- or low-expressing neurons is seen when the level of dopamine is decreased. In the frontoparietal cortex, on the other hand, dopamine appears to stimulate NPY and SOM gene expression. RNA blot analysis shows clear-cut changes of NPY mRNA levels in both caudate-putamen and frontoparietal cortex consistent with the changes observed using in situ hybridization. No evidence was found for a change in CCK mRNA expression by the dopamine deafferentation, while PPT mRNA expression decreased in the deafferented caudate-putamen. Consequently, dopamine exerts dissimilar effects on the expression of different neuropeptide genes, that in turn do not respond in the same way in different brain regions. Indirect evidence is also presented indicating that dopamine regulates NPY mRNA expression in a subpopulation of neurons that possibly also express GAD mRNA, both in caudate-putamen and in frontoparietal cortex.

Analysis of Sigma Receptor (σR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice

PubMed Central

Ola, M. Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Summary The type 1 sigma receptor (σR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for σR1 have been shown to afford neuroprotective against overstimulation of the NMDA receptor. σR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express σ1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. σR1 was analyzed in cells using semiquantitative RT-PCR and in tissues σR1 by semiquantitative RT-PCR, in situ hybridization, western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that σR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding σR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of σR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of σR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of σR1 showed a similar pattern of σR1 protein expression between control and diabetic retina. These studies demonstrate that σR1 is expressed under hyperglycemic conditions in vitro and in vivo. PMID:12425939

Analysis of sigma receptor (sigmaR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice.

PubMed

Ola, M Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B

2002-11-15

The type 1 sigma receptor (sigmaR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for sigmaR1 have been shown to afford neuroprotection against overstimulation of the NMDA receptor. sigmaR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express sigmaR1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. sigmaR1 was analyzed in cells using semiquantitative RT-PCR and in tissues by semiquantitative RT-PCR, in situ hybridization, Western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that sigmaR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding sigmaR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of sigmaR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of sigmaR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of sigmaR1 showed a similar pattern of sigmaR1 protein expression between control and diabetic retina. These studies demonstrate that sigmaR1 is expressed under hyperglycemic conditions in vitro and in vivo.

A deletion mutation at the ep locus causes low seed coat peroxidase activity in soybean.

PubMed

Gijzen, M

1997-11-01

The Ep locus severely affects the amount of peroxidase enzyme in soybean seed coats. Plants containing the dominant Ep allele accumulate large amounts of peroxidase in the hourglass cells of the sub-epidermis. Homozygous recessive epep genotypes do not accumulate peroxidase in the hourglass cells and are much reduced in total seed coat peroxidase activity. To isolate the gene encoding the seed coat peroxidase and to determine whether it corresponds to the Ep locus, a cDNA library was constructed from developing seed coats and an abundant 1.3 kb peroxidase transcript was cloned. The corresponding structural gene was also isolated from a genomic library. Sequence analysis shows that the seed coat peroxidase is translated as a 352 amino acid precursor protein of 38 kDa. Processing of a putative 26 amino acid signal sequence results in a mature protein of 326 residues with a calculated mass of 35 kDa and a pl of 4.4. Using probes derived from the cDNA, genomic DNA blot hybridization and polymerase chain reaction analysis detected polymorphisms that distinguished EpEp and epep genotypes. Co-segregation of the polymorphisms in an F2 population from a cross of EpEp and epep plants shows that the Ep locus encodes the seed coat peroxidase protein. Comparison of Ep and ep alleles indicates that the recessive gene lacks 87 bp of sequence encompassing the translation start codon. Analysis by RNA blot hybridization shows that epep plants have drastically reduced amounts of peroxidase transcript compared with EpEp plants. The peroxidase mRNA is abundant in seed coat tissues of EpEp plants during the late stages of seed maturation, and could also be detected in root tissues, but not in the flower, embryo, pod or leaf. The results indicate that the lack of peroxidase accumulation in seed coats of homozygous recessive epep plants is due to a mutation of the structural gene that reduces transcript abundance.

Papillomavirus, p53 alteration, and primary carcinoma of the vulva.

PubMed

Pilotti, S; D'Amato, L; Della Torre, G; Donghi, R; Longoni, A; Giarola, M; Sampietro, G; De Palo, G; Pierotti, M A; Rilke, F

1995-12-01

Twenty-nine samples from 28 cases of vulvar squamous cell carcinoma, of which 13 fulfilled the criteria of the bowenoid subtype (mean age 45 years, range 31-68) and 16 of the usual subtype of invasive squamous cell carcinoma (ISCC) (mean age 67.5 years, range 34-83) were investigated for human papillomavirus (HPV) DNA, TP53 alterations, and mdm2 and bcl-2 gene product deregulation. Microscopically all the bowenoid subtype cases (group I) showed a high-grade intraepithelial (VIN 3, carcinoma in situ) lesion associated with early invasive carcinoma in six cases and overt invasive carcinoma in one. By contrast, no evidence of early carcinoma was present in the ISCCs (group II). By in situ hybridization and/or Southern blot hybridization or polymerase chain reaction (PCR), HPV DNA was detected in all cases of group I and in four of 16 cases (25%) of group II, two only by Southern blot after PCR. By single-strand conformation polymorphism and immunocytochemistry only wild-type TP53 and absence of detectable p53 product, respectively, were found in all cases of group I, i.e., in high-risk HPV-positive carcinomas, whereas mutations and/or p53 overexpression accounted for 75% in group II, i.e., in mainly HPV-negative carcinomas. The TP53 gene mutations observed in invasive carcinomas were significantly related to node-positive cases (p = 0.04). Taken together and in agreement with in vitro data, these results support the view that an alteration of TP53, gained either by interaction with viral oncoproteins or by somatic mutations, is a crucial event in the pathogenesis of vulvar carcinomas, but that TP53 mutations are mainly associated with disease progression. Finally, a preliminary immunocytochemical analysis seems to speak against the possible involvement of both MDM2 and BCL-2 gene products in the development of vulvar carcinoma.

Novel diagnostic procedure for determining metastasis to sentinel lymph nodes in breast cancer using a semi-dry dot-blot method.

PubMed

Otsubo, Ryota; Oikawa, Masahiro; Hirakawa, Hiroshi; Shibata, Kenichiro; Abe, Kuniko; Hayashi, Tomayoshi; Kinoshita, Naoe; Shigematsu, Kazuto; Hatachi, Toshiko; Yano, Hiroshi; Matsumoto, Megumi; Takagi, Katsunori; Tsuchiya, Tomoshi; Tomoshige, Koichi; Nakashima, Masahiro; Taniguchi, Hideki; Omagari, Takeyuki; Itoyanagi, Noriaki; Nagayasu, Takeshi

2014-02-15

We developed an easy, quick and cost-effective detection method for lymph node metastasis called the semi-dry dot-blot (SDB) method, which visualizes the presence of cancer cells with washing of sectioned lymph nodes by anti-pancytokeratin antibody, modifying dot-blot technology. We evaluated the validity and efficacy of the SDB method for the diagnosis of lymph node metastasis in a clinical setting (Trial 1). To evaluate the validity of the SDB method in clinical specimens, 180 dissected lymph nodes from 29 cases, including breast, gastric and colorectal cancer, were examined. Each lymph node was sliced at the maximum diameter and the sensitivity, specificity and accuracy of the SDB method were determined and compared with the final pathology report. Metastasis was detected in 32 lymph nodes (17.8%), and the sensitivity, specificity and accuracy of the SDB method were 100, 98.0 and 98.3%, respectively (Trial 2). To evaluate the efficacy of the SDB method in sentinel lymph node (SLN) biopsy, 174 SLNs from 100 cases of clinically node-negative breast cancer were analyzed. Each SLN was longitudinally sliced at 2-mm intervals and the sensitivity, specificity, accuracy and time required for the SDB method were determined and compared with the intraoperative pathology report. Metastasis was detected in 15 SLNs (8.6%), and the sensitivity, specificity, accuracy and mean required time of the SDB method were 93.3, 96.9, 96.6 and 43.3 min, respectively. The SDB method is a novel and reliable modality for the intraoperative diagnosis of SLN metastasis. © 2013 UICC.

John Butcher and hybrid methods

NASA Astrophysics Data System (ADS)

Mehdiyeva, Galina; Imanova, Mehriban; Ibrahimov, Vagif

2017-07-01

As is known there are the mainly two classes of the numerical methods for solving ODE, which is commonly called a one and multistep methods. Each of these methods has certain advantages and disadvantages. It is obvious that the method which has better properties of these methods should be constructed at the junction of them. In the middle of the XX century, Butcher and Gear has constructed at the junction of the methods of Runge-Kutta and Adams, which is called hybrid method. Here considers the construction of certain generalizations of hybrid methods, with the high order of accuracy and to explore their application to solving the Ordinary Differential, Volterra Integral and Integro-Differential equations. Also have constructed some specific hybrid methods with the degree p ≤ 10.

[RDBH-method and big DyeTM terminator technology in accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster].

PubMed

Akperova, G A

2014-11-01

IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.

Genetic transformation of the yeast Dekkera/Brettanomyces bruxellensis with non-homologous DNA.

PubMed

Miklenić, Marina; Štafa, Anamarija; Bajić, Ana; Žunar, Bojan; Lisnić, Berislav; Svetec, Ivan-Krešimir

2013-05-01

Yeast Dekkera/Brettanomyces bruxellensis is probably the most common contaminant in wineries and ethanol production processes. The considerable economic losses caused by this yeast, but also its ability to produce and tolerate high ethanol concentrations, make it an attractive subject for research with potential for industrial applications. Unfortunately, efforts to understand the biology of D. bruxellensis and facilitate its broader use in industry are hampered by the lack of adequate procedures for delivery of exogenous DNA into this organism. Here we describe the development of transformation protocols (spheroplast transformation, LiAc/PEG method, and electroporation) and report the first genetic transformation of yeast D. bruxellensis. A linear heterologous DNA fragment carrying the kanMX4 sequence was used for transformation, which allowed transformants to be selected on plates containing geneticin. We found the spheroplast transformation method using 1M sorbitol as osmotic stabilizer to be inappropriate because sorbitol strikingly decreases the plating efficiency of both D. bruxellensis spheroplast and intact cells. However, we managed to modify the LiAc/ PEG transformation method and electroporation to accommodate D. bruxellensis transformation, achieving efficiencies of 0.6-16 and 10-20 transformants/microg DNA, respectively. The stability of the transformants ranged from 93.6% to 100%. All putative transformants were analyzed by Southern blot using the kanMX4 sequence as a hybridization probe, which confirmed that the transforming DNA fragment had integrated into the genome. The results of the molecular analysis were consistent with the expected illegitimate integration of a heterologous transforming fragment.

Guided particle swarm optimization method to solve general nonlinear optimization problems

NASA Astrophysics Data System (ADS)

Abdelhalim, Alyaa; Nakata, Kazuhide; El-Alem, Mahmoud; Eltawil, Amr

2018-04-01

The development of hybrid algorithms is becoming an important topic in the global optimization research area. This article proposes a new technique in hybridizing the particle swarm optimization (PSO) algorithm and the Nelder-Mead (NM) simplex search algorithm to solve general nonlinear unconstrained optimization problems. Unlike traditional hybrid methods, the proposed method hybridizes the NM algorithm inside the PSO to improve the velocities and positions of the particles iteratively. The new hybridization considers the PSO algorithm and NM algorithm as one heuristic, not in a sequential or hierarchical manner. The NM algorithm is applied to improve the initial random solution of the PSO algorithm and iteratively in every step to improve the overall performance of the method. The performance of the proposed method was tested over 20 optimization test functions with varying dimensions. Comprehensive comparisons with other methods in the literature indicate that the proposed solution method is promising and competitive.

Investigating a hybrid perturbation-Galerkin technique using computer algebra

NASA Technical Reports Server (NTRS)

Andersen, Carl M.; Geer, James F.

1988-01-01

A two-step hybrid perturbation-Galerkin method is presented for the solution of a variety of differential equations type problems which involve a scalar parameter. The resulting (approximate) solution has the form of a sum where each term consists of the product of two functions. The first function is a function of the independent field variable(s) x, and the second is a function of the parameter lambda. In step one the functions of x are determined by forming a perturbation expansion in lambda. In step two the functions of lambda are determined through the use of the classical Bubnov-Gelerkin method. The resulting hybrid method has the potential of overcoming some of the drawbacks of the perturbation and Bubnov-Galerkin methods applied separately, while combining some of the good features of each. In particular, the results can be useful well beyond the radius of convergence associated with the perturbation expansion. The hybrid method is applied with the aid of computer algebra to a simple two-point boundary value problem where the radius of convergence is finite and to a quantum eigenvalue problem where the radius of convergence is zero. For both problems the hybrid method apparently converges for an infinite range of the parameter lambda. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the applicability of the hybrid method to broader problem areas is discussed.

Hybrid power management system and method

NASA Technical Reports Server (NTRS)

Eichenberg, Dennis J. (Inventor)

2007-01-01

A system and method for hybrid power management. The system includes photovoltaic cells, ultracapacitors, and pulse generators. In one embodiment, the hybrid power management system is used to provide power for a highway safety flasher.

Hybrid Power Management System and Method

NASA Technical Reports Server (NTRS)

Eichenberg, Dennis J. (Inventor)

2008-01-01

A system and method for hybrid power management. The system includes photovoltaic cells, ultracapacitors, and pulse generators. In one embodiment, the hybrid power management system is used to provide power for a highway safety flasher.

Methods to Monitor DNA Repair Defects and Genomic Instability in the Context of a Disrupted Nuclear Lamina.

PubMed

Gonzalo, Susana; Kreienkamp, Ray

2016-01-01

The organization of the genome within the nuclear space is viewed as an additional level of regulation of genome function, as well as a means to ensure genome integrity. Structural proteins associated with the nuclear envelope, in particular lamins (A- and B-type) and lamin-associated proteins, play an important role in genome organization. Interestingly, there is a whole body of evidence that links disruptions of the nuclear lamina with DNA repair defects and genomic instability. Here, we describe a few standard techniques that have been successfully utilized to identify mechanisms behind DNA repair defects and genomic instability in cells with an altered nuclear lamina. In particular, we describe protocols to monitor changes in the expression of DNA repair factors (Western blot) and their recruitment to sites of DNA damage (immunofluorescence); kinetics of DNA double-strand break repair after ionizing radiation (neutral comet assays); frequency of chromosomal aberrations (FISH, fluorescence in situ hybridization); and alterations in telomere homeostasis (Quantitative-FISH). These techniques have allowed us to shed some light onto molecular mechanisms by which alterations in A-type lamins induce genomic instability, which could contribute to the pathophysiology of aging and aging-related diseases.

Association between diabetes type 1 and DQB1 alleles in a case-control study conducted in Montevideo, Uruguay.

PubMed

Mimbacas, Adriana; Pérez-Bravo, Francisco; Hidalgo, Pedro C; Javiel, Gerardo; Pisciottano, Carmen; Grignola, Rosario; Jorge, Ana María; Gallino, Juan Pablo; Gasagoite, Jackeline; Cardoso, Horacio

2003-03-31

We studied HLA DQB1 allele frequencies and the relative risk (RR) of various genotypes in 72 type 1 diabetic patients and 40 control individuals in Uruguay. This is a tri-racial (Caucasian, Black and Indo-American) mixed population. The products of the polymerase chain reaction amplifications were hybridized with oligonucleotides by allele-specific oligonucleotide reverse or dot blot methods. Significant differences between these two groups were observed only for allele DQB1*0302 (35%, RR = 7.34, P<0.001). The frequency of the alleles carrying a non-aspartic acid residue at position 57 was significantly higher in the diabetic patients (85 vs 53%, P<0.001). In contrast, the frequency of Asp alleles was negatively associated with type 1 diabetes (RR = 0.20, P<0.001). The genotype DQB1*0302/DQB1*0201 (33%, RR = 5.41, P<0.05) was positively associated with this disease. The genotype frequencies associated with type 1 diabetes in our population were significantly different from what is known for Caucasian and Black populations as well as compared with another admixed population, from Chile.

Development of a polyprobe to detect six viroids of pome and stone fruit trees.

PubMed

Lin, Liming; Li, Ruhui; Mock, Ray; Kinard, Gary

2011-01-01

A simple and sensitive dot blot hybridization assay using a digoxigenin-labeled cRNA polyprobe was developed for the simultaneous detection of six viroids that infect pome and stone fruit trees. The polyprobe was constructed by cloning sequentially partial sequences of each viroid into a single vector, with run-off transcription driven by the T7 promoter. All six viroids were detectable within a dilution range of 5(-3) to 5(-4) in total nucleic acid extracts from infected trees. Individual trees were co-inoculated to create mixed infections and all four pome fruit viroids and both stone fruit viroids could be detected in pear and peach trees, respectively, using the polyprobe. The results of the assays using the polyprobe were comparable to those using single probes. The methods were validated by testing geographically diverse isolates of viroids, as well as field samples from several collections in the US. The assay offers a rapid, reliable and cost-effective approach to the simultaneous detection of six fruit trees viroids and has the potential for routine use in quarantine, certification, and plant genebank programs where many samples are tested and distributed worldwide. Published by Elsevier B.V.

Ma2 antibodies: an evaluation of commercially available detection methods.

PubMed

Johannis, Wibke; Renno, Joerg H; Wielckens, Klaus; Voltz, Raymond

2011-01-01

Ma2 antibodies belong to the onconeuronal antibodies which define a "definite" paraneoplastic neurological syndrome (PNS). Because of the clinical relevance, use of two separate methods (indirect immunofluorescence technique--IFT--and immunoblot) is advocated; however, with an increasing number of commercially available assay systems, usually only one assay is performed. We compared IFT and three commercially available immunoblots (ravo Diagnostika, Euroimmun, Milenia Biotec) on sera from 35 patients with clinically suspected PNS. 17 were Ma2 antibody associated as defined by consensus result (showing positive reactivity in 2 assays), 18 were Ma2 antibody negative controls. Sensitivity/specificity for single assays were for IFT 94%/94%, for ravo Diagnostika PNS blot 88%/100%, for Euroimmun Neuronal Antigens Profile blot 100%/89%, and for Milenia Biotec MTR blot 94%/100%. Our data confirm, although all tests performed well, a combination of 2 independent assays is still advisable for Ma2 antibody detection in order to achieve higher sensitivity and specificity rates.

Methods to uncover an antibody epitope in the KPI domain of Alzheimer's amyloid precursor protein for immunohistochemistry in human brain.

PubMed

Campbell, E; Pearson, R C; Parkinson, D

1999-11-15

A novel polyclonal antibody (Ab993), specific for a KPI domain epitope of APP, was characterised for use in immunoprecipitation, Western blotting and immunohistochemistry. Conditioned medium from NTera2/D1 cells was used for immunoprecipitation and Western blots. Paraffin-embedded human brain sections were used for immunohistochemistry. The antibody recognised KPI-containing APP on Western blots after standard solubilisation but immunoprecipitation of soluble APP required reduction with 2-mercaptoethanol followed by alkylation of reduced sulphydryl bonds with sodium iodoacetate. Immunohistochemical staining of human brain sections was significantly enhanced by this pre-treatment. Microwaving of sections also increased immunolabelling, by a mechanism that was additive to reduction and alkylation. Incubation in 80% formic acid did not confer any enhancement of immunoreactivity. Ab993, applied with the methods reported here, is expected to be valuable in investigations of the pathogenesis of Alzheimer's disease to determine the source of the beta-amyloid peptide.

Lipid-binding analysis using a fat blot assay.

PubMed

Munnik, Teun; Wierzchowiecka, Magdalena

2013-01-01

Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.

The epidemiology of tick-borne haemoparasites as determined by the reverse line blot hybridization assay in an intensively studied cohort of calves in western Kenya

PubMed Central

Njiiri, Nyawira E.; Bronsvoort, B. Mark deC.; Collins, Nicola E.; Steyn, Helena C.; Troskie, Milana; Vorster, Ilse; Thumbi, S.M.; Sibeko, Kgomotso P.; Jennings, Amy; van Wyk, Ilana Conradie; Mbole-Kariuki, Mary; Kiara, Henry; Poole, E. Jane; Hanotte, Olivier; Coetzer, Koos; Oosthuizen, Marinda C.; Woolhouse, Mark; Toye, Philip

2015-01-01

The development of sensitive surveillance technologies using PCR-based detection of microbial DNA, such as the reverse line blot assay, can facilitate the gathering of epidemiological information on tick-borne diseases, which continue to hamper the productivity of livestock in many parts of Africa and elsewhere. We have employed a reverse line blot assay to detect the prevalence of tick-borne parasites in an intensively studied cohort of indigenous calves in western Kenya. The calves were recruited close to birth and monitored for the presence of infectious disease for up to 51 weeks. The final visit samples from 453 calves which survived for the study period were analyzed by RLB. The results indicated high prevalences of Theileria mutans (71.6%), T. velifera (62.8%), Anaplasma sp. Omatjenne (42.7%), A. bovis (39.9%), Theileria sp. (sable) (32.7%), T. parva (12.9%) and T. taurotragi (8.5%), with minor occurrences of eight other haemoparasites. The unexpectedly low prevalence of the pathogenic species Ehrlichia ruminantium was confirmed by a species-specific PCR targeting the pCS20 gene region. Coinfection analyses of the seven most prevalent haemoparasites indicated that they were present as coinfections in over 90% of the cases. The analyses revealed significant associations between several of the Theileria parasites, in particular T. velifera with Theileria sp. sable and T. mutans, and T. parva with T. taurotragi. There was very little coinfection of the two most common Anaplasma species, although they were commonly detected as coinfections with the Theileria parasites. The comparison of reverse line blot and serological results for four haemoparasites (T. parva, T. mutans, A. marginale and B. bigemina) indicated that, except for the mostly benign T. mutans, indigenous cattle seem capable of clearing infections of the three other, pathogenic parasites to below detectable levels. Although the study site was located across four agroecological zones, there was little restriction of the parasites to particular zones. PMID:25858115

BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

1998-01-01

We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

Expression of an insulin/interleukin-1 receptor antagonist hybrid gene in insulin-producing cell lines (HIT-T15 and NIT-1) confers resistance against interleukin-1-induced nitric oxide production.

PubMed Central

Welsh, N; Bendtzen, K; Welsh, M

1995-01-01

A hybrid gene consisting of the insulin gene enhancer/promoter region, the signal sequence, the insulin B- and C-chains, and the human interleukin-1 receptor antagonist (IL-1ra) gene was constructed. This hybrid gene was transfected together with the pSV2-neo construct into the insulin-producing cell lines HIT-T15 and NIT-1. One of the geneticin-selected clones, HITra2, expressed a 1.4-kb mRNA, which hybridized both to insulin and IL-1ra-cDNA in Northern blot analysis. Three proteins, with the mol wt 23, 17, and 14 kD, were immunoprecipitated with anti-IL-1ra antibodies from [35S]methionine-labeled HITra2 cells. Both at a low and at a high glucose concentration, 4-5 ng of IL-1ra/10(6) cells (ELISA) was released from these cells. On the other hand, a high glucose concentration evoked a three-fold increase in the release of insulin, suggesting that IL-1ra was released constitutively. Measured by nitrite production, transfected HIT, and NIT-1 cells exhibited a more than 10-fold decrease in IL-1 beta sensitivity. Since the conditioned culture media from the HITra2 cells exhibited an anti-IL-1 beta activity of only 0.5 U/ml, and mixed culture of HITra2 cells and isolated rat islets prevented IL-1 beta induced inhibition of insulin release, it is likely that IL-1ra acts locally at the cell surface. It is concluded that expression of a hybrid insulin/IL-1ra gene confers resistance to IL-1 and that this technique may be used to elucidate the role of IL-1 in autoimmune disorders such as insulin-dependent diabetes mellitus. Images PMID:7706480

Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

PubMed

Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

2016-05-15

A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of high-lysine rice via endosperm-specific expression of a foreign LYSINE RICH PROTEIN gene.

PubMed

Liu, Xin; Zhang, Cuicui; Wang, Xiurong; Liu, Qiaoquan; Yuan, Dingyang; Pan, Gang; Sun, Samuel S M; Tu, Jumin

2016-06-29

Lysine (Lys) is considered to be the first limiting essential amino acid in rice. Although there have been extensive efforts to improve the Lys content of rice through traditional breeding and genetic engineering, no satisfactory products have been achieved to date. We expressed a LYSINE-RICH PROTEIN gene (LRP) from Psophocarpus tetragonolobus (L.) DC using an endosperm-specific GLUTELIN1 promoter (GT1) in Peiai64S (PA64S), an elite photoperiod-thermo sensitive male sterility (PTSMS) line. The expression of the foreign LRP protein was confirmed by Western blot analysis. The Lys level in the transgenic rice seeds increased more than 30 %, the total amount of other amino acids also increased compared to wild-type. Persistent investigation of amino acids in 3 generations showed that the Lys content was significantly increased in seeds of transgenic rice. Furthermore, Lys content in the hybrid of the transgenic plants also had an approximate 20 % increase compared to hybrid control. At the grain-filling stage, we monitored the transcript abundance of many genes encoding key enzymes involved in amino acid metabolism, and the results suggested that reduced amino acid catabolism led to the accumulation of amino acids in the transgenic plants. The genetically engineered rice showed unfavorable grain phenotypes compared to wild-type, however, its hybrid displayed little negative effects on grain. Endosperm-specific expression of foreign LRP significantly increased the Lys content in the seeds of transgenic plant, and the the Lys increase was stably heritable with 3 generation investigation. The hybrid of the transgenic plants also showed significant increases of Lys content in the seeds. These results indicated that expression of LRP in rice seeds may have promising applications in improving Lys levels in rice.

Syntenic conservation of HSP70 genes in cattle and humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grosz, M.D.; Womack, J.E.; Skow, L.C.

1992-12-01

A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

Competitive Expression of Endogenous Wheat CENH3 May Lead to Suppression of Alien ZmCENH3 in Transgenic Wheat × Maize Hybrids.

PubMed

Chen, Wei; Zhu, Qilin; Wang, Haiyan; Xiao, Jin; Xing, Liping; Chen, Peidu; Jin, Weiwei; Wang, Xiu-E

2015-11-20

Uniparental chromosome elimination in wheat × maize hybrid embryos is widely used in double haploid production of wheat. Several explanations have been proposed for this phenomenon, one of which is that the lack of cross-species CENH3 incorporation may act as a barrier to interspecies hybridization. However, it is unknown if this mechanism applies universally. To study the role of CENH3 in maize chromosome elimination of wheat × maize hybrid embryos, maize ZmCENH3 and wheat αTaCENH3-B driven by the constitutive CaMV35S promoter were transformed into wheat variety Yangmai 158. Five transgenic lines for ZmCENH3 and six transgenic lines for αTaCENH3-B were identified. RT-PCR analysis showed that the transgene could be transcribed at a low level in all ZmCENH3 transgenic lines, whereas transcription of endogenous wheat CENH3 was significantly up-regulated. Interestingly, the expression levels of both wheat CENH3 and ZmCENH3 in the ZmCENH3 transgenic wheat × maize hybrid embryos were higher than those in the non-transformed Yangmai 158 × maize hybrid embryos. This indicates that the alien ZmCENH3 in wheat may induce competitive expression of endogenous wheat CENH3, leading to suppression of ZmCENH3 over-expression. Eliminations of maize chromosomes in hybrid embryos of ZmCENH3 transgenic wheat × maize and Yangmai 158 × maize were compared by observations on micronuclei presence, by marker analysis using maize SSRs (simple sequence repeats), and by FISH (fluorescence in situ hybridization) using 45S rDNA as a probe. The results indicate that maize chromosome elimination events in the two crosses are not significantly different. Fusion protein ZmCENH3-YFP could not be detected in ZmCENH3 transgenic wheat by either Western blotting or immnunostaining, whereas accumulation and loading of the αTaCENH3-B-GFP fusion protein was normal in αTaCENH3-B transgenic lines. As ZmCENH3-YFP did not accumulate after AM114 treatment, we speculate that low levels of ZmCENH3 protein in transgenic wheat may be one of the factors that lead to failure of suppression of maize chromatin elimination in ZmCENH3 transgenic wheat × maize hybrids. Copyright © 2015 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Personalised Information Services Using a Hybrid Recommendation Method Based on Usage Frequency

ERIC Educational Resources Information Center

Kim, Yong; Chung, Min Gyo

2008-01-01

Purpose: This paper seeks to describe a personal recommendation service (PRS) involving an innovative hybrid recommendation method suitable for deployment in a large-scale multimedia user environment. Design/methodology/approach: The proposed hybrid method partitions content and user into segments and executes association rule mining,…

Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

PubMed Central

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping.

PubMed

Lim, Yong Kwan; Choi, Jee-Hye; Park, Serah; Kweon, Oh Joo; Park, Ae Ja

2016-11-01

High-risk type human papilloma virus (HPV) is the most important cause of cervical cancer. Recently, real-time polymerase chain reaction and reverse blot hybridization assay-based HPV DNA genotyping kits are developed. So, we compared the performances of different three HPV genotyping kits using different analytical principles and methods. Two hundred positive and 100 negative cervical swab specimens were used. DNA was extracted and all samples were tested by the MolecuTech REBA HPV-ID, Anyplex II HPV28 Detection, and HPVDNAChip. Direct sequencing was performed as a reference method for confirming high-risk HPV genotypes 16, 18, 45, 52, and 58. Although high-level agreement results were observed in negative samples, three kits showed decreased interassay agreement as screening setting in positive samples. Comparing the genotyping results, three assays showed acceptable sensitivity and specificity for the detection of HPV 16 and 18. Otherwise, various sensitivities showed in the detection of HPV 45, 52, and 58. The three assays had dissimilar performance of HPV screening capacity and exhibited moderate level of concordance in HPV genotyping. These discrepant results were unavoidable due to difference in type-specific analytical sensitivity and lack of standardization; therefore, we suggested that the efforts to standardization of HPV genotyping kits and adjusting analytical sensitivity would be important for the best clinical performance. © 2016 Wiley Periodicals, Inc.

Novel expression of the stanniocalcin gene in fish.

PubMed

McCudden, C R; Kogon, M R; DiMattia, G E; Wagner, G F

2001-10-01

It is currently accepted that the fish stanniocalcin (STC) gene is expressed exclusively in the corpuscles of Stannius (CS), unique endocrine glands on the kidneys of bony fishes. In this study, we have re-examined the pattern of fish STC gene expression in the light of the recent evidence for widespread expression of the gene in mammals. Surprisingly, we found by Northern blotting that the fish gene was also expressed in the kidneys and gonads, in addition to the CS glands. Moreover, Southern blotting of RT-PCR products revealed STC mRNA transcripts in all tissues assayed, including brain, heart, gill, muscle and intestine. In situ hybridization studies using digoxigenin-labeled riboprobes localized STC mRNA to chondrocytes, and both mature and developing nephritic tubules. Immunocytochemical staining indicated that the STC protein was widespread in cells of the gill, kidney, brain, eye, pseudobranch and skin. We also characterized the salmon STC gene, establishing that it was comprised of five exons as opposed to four in mammals. A single transcription start site was identified by primer extension 99 bp upstream of the start codon. This is the first evidence of STC gene expression in fish tissues other than the CS glands and suggests that, as in mammals, fish STC operates via both local and endocrine pathways.

A rat genetic map constructed by representational difference analysis markers with suitability for large-scale typing.

PubMed Central

Toyota, M; Canzian, F; Ushijima, T; Hosoya, Y; Kuramoto, T; Serikawa, T; Imai, K; Sugimura, T; Nagao, M

1996-01-01

Representational difference analysis (RDA) was applied to isolate chromosomal markers in the rat. Four series of RDA [restriction enzymes, BamHI and HindIII; subtraction of ACI/N (ACI) amplicon from BUF/Nac (BUF) amplicon and vice versa] yielded 131 polymorphic markers; 125 of these markers were mapped to all chromosomes except for chromosome X. This was done by using a mapping panel of 105 ACI x BUF F2 rats. To complement the relative paucity of chromosomal markers in the rat, genetically directed RDA, which allows isolation of polymorphic markers in the specific chromosomal region, was performed. By changing the F2 driver-DNA allele frequency around the region, four markers were isolated from the D1Ncc1 locus. Twenty-five of 27 RDA markers were informative regarding the dot blot analysis of amplicons, hybridizing only with tester amplicons. Dot blot analysis at a high density per unit of area made it possible to process a large number of samples. Quantitative trait loci can now be mapped in the rat genome by processing a large number of samples with RDA markers and then by isolating markers close to the loci of interest by genetically directed RDA. Images Fig. 1 Fig. 3 Fig. 4 PMID:8632989

Demonstration of human T-cell lymphotropic virus type I (HTLV-I) from an HTLV-I seronegative south Indian patient with chronic, progressive spastic paraparesis.

PubMed

Nishimura, M; Mingioli, E; McFarlin, D E; Jacobson, S

1993-12-01

Here we describe a human T-cell lymphotropic virus type I (HTLV-I) seronegative patient from South India with a chronic, progressive spastic paraparesis from which HTLV-I has been isolated from peripheral blood lymphocytes. HTLV-I pol and tax viral sequences were detected in DNA from fresh peripheral blood lymphocytes (PBL) by polymerase chain reaction (PCR) and liquid hybridization techniques. Southern blot analysis of the PCR products demonstrated a low copy number of HTLV-I at the level of one viral copy per 10,000 fresh PBL. A long-term CD4+ T-cell line was established from PBL of this patient using recombinant interleukin-2, OKT3, and feeder cells. DNA from these cultured lines was amplified and portions of the HTLV-I long terminal repeat (U3), pol, env, and tax regions were sequenced (a total of 1,115 bp). The sequence data showed that the HTLV-I associated with this patient was 98.8% homologous to prototype HTLV-I. Southern blot analysis also confirmed the presence of full-length HTLV-I. These results indicate that HTLV-I can be demonstrated in an HTLV-I seronegative patient from South India with a chronic progressive neurological disorder.

Identification and characterization of jute LTR retrotransposons:

PubMed Central

Ahmed, Salim; Shafiuddin, MD; Azam, Muhammad Shafiul; Islam, Md. Shahidul; Ghosh, Ajit

2011-01-01

Long Terminal Repeat (LTR) retrotransposons constitute a significant part of eukaryotic genomes and play an important role in genome evolution especially in plants. Jute is an important fiber crop with a large genome of 1,250 Mbps. This genome is still mostly unexplored. In this study we aimed at identifying and characterizing the LTR retrotransposons of jute with a view to understanding the jute genome better. In this study, the Reverse Transcriptase domain of Ty1-copia and Ty3-gypsy LTR retrotransposons of jute were amplified by degenerate primers and their expressions were examined by reverse transcription PCR. Copy numbers of reverse transcriptase (RT) genes of Ty1-copia and Ty3-gypsy elements were determined by dot blot analysis. Sequence analysis revealed higher heterogeneity among Ty1-copia retrotransposons than Ty3-gypsy and clustered each of them in three groups. Copy number of RT genes in Ty1-copia was found to be higher than that of Ty3-gypsy elements from dot blot hybridization. Cumulatively Ty1-copia and Ty3-gypsy may constitute around 19% of the jute genome where two groups of Ty1-copia were found to be transcriptionally active. Since the LTR retrotransposons constitute a large portion of jute genome, these findings imply the importance of these elements in the evolution of jute genome. PMID:22016842

An advanced dual labeled gold nanoparticles probe to detect Cryptosporidium parvum using rapid immuno-dot blot assay.

PubMed

Thiruppathiraja, Chinnasamy; Kamatchiammal, Senthilkumar; Adaikkappan, Periyakaruppan; Alagar, Muthukaruppan

2011-07-15

The zoonotic protozoan parasite Cryptosporidium parvum poses a significant risk to public health. Due to the low infectious dose of C. parvum, remarkably sensitive detection methods are required for water and food industries analysis. However PCR affirmed sensing method of the causative nucleic acid has numerous advantages, still criterion demands for simple techniques and expertise understanding to extinguish its routine use. In contrast, protein based immuno detecting techniques are simpler to perform by a commoner, but lack of sensitivity due to inadequate signal amplification. In this paper, we focused on the development of a mere sensitive immuno detection method by coupling anti-cyst antibody and alkaline phosphatase on gold nanoparticle for C. parvum is described. Outcome of the sensitivity in an immuno-dot blot assay detection is enhanced by 500 fold (using conventional method) and visually be able to detect up to 10 oocysts/mL with minimal processing period. Techniques reported in this paper substantiate the convenience of immuno-dot blot assay for the routine screening of C. parvum in water/environmental examines and most importantly, demonstrates the potential of a prototype development of simple and inexpensive diagnostic technique. Copyright © 2011 Elsevier B.V. All rights reserved.

Preparation of colloidal gold for staining proteins electrotransferred onto nitrocellulose membranes.

PubMed

Yamaguchi, K; Asakawa, H

1988-07-01

This paper describes a simple method of preparing colloidal gold for staining protein blots. Colloidal gold was prepared from 0.005 or 0.01% HAuCl4 by the addition of formalin as a reductant and potassium hydroxide. Staining of small cell carcinoma tissue extract blotted onto nitrocellulose membranes with this colloidal gold solution resulted in the appearance of a large number of clear wine-red bands. The sensitivity of gold staining was 60 times higher than that of Coomassie brilliant blue staining and almost comparable to that of silver staining of proteins in polyacrylamide gel. The sensitivity of this method was also satisfactory in comparison with that of enzyme immunoblotting. The colloidal gold prepared by this method is usable for routine work.

Extension of D-H parameter method to hybrid manipulators used in robot-assisted surgery.

PubMed

Singh, Amanpreet; Singla, Ashish; Soni, Sanjeev

2015-10-01

The main focus of this work is to extend the applicability of D-H parameter method to develop a kinematic model of a hybrid manipulator. A hybrid manipulator is a combination of open- and closed-loop chains and contains planar and spatial links. It has been found in the literature that D-H parameter method leads to ambiguities, when dealing with closed-loop chains. In this work, it has been observed that the D-H parameter method, when applied to a hybrid manipulator, results in an orientational inconsistency, because of which the method cannot be used to develop the kinematic model. In this article, the concept of dummy frames is proposed to resolve the orientational inconsistency and to develop the kinematic model of a hybrid manipulator. Moreover, the prototype of 7-degree-of-freedom hybrid manipulator, known as a surgeon-side manipulator to assist the surgeon during a medical surgery, is also developed to validate the kinematic model derived in this work. © IMechE 2015.

Hybrid ODE/SSA methods and the cell cycle model

NASA Astrophysics Data System (ADS)

Wang, S.; Chen, M.; Cao, Y.

2017-07-01

Stochastic effect in cellular systems has been an important topic in systems biology. Stochastic modeling and simulation methods are important tools to study stochastic effect. Given the low efficiency of stochastic simulation algorithms, the hybrid method, which combines an ordinary differential equation (ODE) system with a stochastic chemically reacting system, shows its unique advantages in the modeling and simulation of biochemical systems. The efficiency of hybrid method is usually limited by reactions in the stochastic subsystem, which are modeled and simulated using Gillespie's framework and frequently interrupt the integration of the ODE subsystem. In this paper we develop an efficient implementation approach for the hybrid method coupled with traditional ODE solvers. We also compare the efficiency of hybrid methods with three widely used ODE solvers RADAU5, DASSL, and DLSODAR. Numerical experiments with three biochemical models are presented. A detailed discussion is presented for the performances of three ODE solvers.

Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides.

PubMed Central

Savva, D; Tárnoky, A L; Vickers, M F

1990-01-01

The molecular basis for albumin Kashmir was studied using the polymerase chain reaction to amplify a DNA fragment containing codon 501 in exon 12 of the human albumin gene. Southern blots of the amplified DNA were hybridized to oligonucleotide probes specific either for the normal allele of albumin or for albumin Kashmir. The results provide strong evidence that codon 501 in albumin Kashmir is AAG (lysine) instead of GAG (glutamic acid), thus confirming the protein sequences reported. This approach was used to characterize a bisalbuminaemic individual as a carrier for albumin Kashmir. Similar strategies may be devised to study the molecular basis and to identify carriers of other alloalbumins. Images Fig. 1. Fig. 2. PMID:2317208

Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

PubMed Central

Ampe, Frédéric

2000-01-01

Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria. PMID:10788405

Modulations of RNA sequences by cytokinin in pumpkin cotyledons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, C.; Ertl, J.; Chen, C.

1987-04-01

Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10/sup -4/ M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of (/sup 35/S) methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs aremore » modulated upward or downward by the hormone.« less

[Identification of genes that are specifically/preferentially expressed in developing cotton fibers by mRNA fluorescence differential display (FDD)].

PubMed

Sun, Jie; Li, Yuan-Li; Wang, Ruo-Hai; Xia, Gui-Xian

2004-01-01

Fluorescence differential display (FDD) technique was used to identify genes that are specifically or preferentially expressed in different developmental stages of cotton fiber cells. One hundred and nine differentially displayed cDNA fragments were isolated using 9, 21 and 27 DPA (days postanthesis) fibers as experimental materials. By a combination of two rounds of reverse Northern hybridization and Northern blot analyses, a number of such cDNA fragments were proved to represent fiber-specific/preferential genes. Sequencing determination and database searching indicated that most of these genes are novel. This work is an important step towards cloning the full-length cDNAs and characterizing the cellular functions of aforementioned genes in fiber development.

Novel Polyomavirus associated with Brain Tumors in Free-Ranging Raccoons, Western United States

PubMed Central

Dela Cruz, Florante N.; Giannitti, Federico; Li, Linlin; Woods, Leslie W.; Del Valle, Luis; Delwart, Eric

2013-01-01

Tumors of any type are exceedingly rare in raccoons. High-grade brain tumors, consistently located in the frontal lobes and olfactory tracts, were detected in 10 raccoons during March 2010–May 2012 in California and Oregon, suggesting an emerging, infectious origin. We have identified a candidate etiologic agent, dubbed raccoon polyomavirus, that was present in the tumor tissue of all affected animals but not in tissues from 20 unaffected animals. Southern blot hybridization and rolling circle amplification showed the episomal viral genome in the tumors. The multifunctional nuclear protein large T-antigen was detectable by immunohistochemical analyses in a subset of neoplastic cells. Raccoon polyomavirus may contribute to the development of malignant brain tumors of raccoons. PMID:23260029

Novel polyomavirus associated with brain tumors in free-ranging raccoons, western United States.

PubMed

Dela Cruz, Florante N; Giannitti, Federico; Li, Linlin; Woods, Leslie W; Del Valle, Luis; Delwart, Eric; Pesavento, Patricia A

2013-01-01

Tumors of any type are exceedingly rare in raccoons. High-grade brain tumors, consistently located in the frontal lobes and olfactory tracts, were detected in 10 raccoons during March 2010-May 2012 in California and Oregon, suggesting an emerging, infectious origin. We have identified a candidate etiologic agent, dubbed raccoon polyomavirus, that was present in the tumor tissue of all affected animals but not in tissues from 20 unaffected animals. Southern blot hybridization and rolling circle amplification showed the episomal viral genome in the tumors. The multifunctional nuclear protein large T-antigen was detectable by immunohistochemical analyses in a subset of neoplastic cells. Raccoon polyomavirus may contribute to the development of malignant brain tumors of raccoons.

Existence and stability, and discrete BB and rank conditions, for general mixed-hybrid finite elements in elasticity

NASA Technical Reports Server (NTRS)

Xue, W.-M.; Atluri, S. N.

1985-01-01

In this paper, all possible forms of mixed-hybrid finite element methods that are based on multi-field variational principles are examined as to the conditions for existence, stability, and uniqueness of their solutions. The reasons as to why certain 'simplified hybrid-mixed methods' in general, and the so-called 'simplified hybrid-displacement method' in particular (based on the so-called simplified variational principles), become unstable, are discussed. A comprehensive discussion of the 'discrete' BB-conditions, and the rank conditions, of the matrices arising in mixed-hybrid methods, is given. Some recent studies aimed at the assurance of such rank conditions, and the related problem of the avoidance of spurious kinematic modes, are presented.

Publisher Correction: N6-methyladenosine RNA modification regulates embryonic neural stem cell self-renewal through histone modifications.

PubMed

Wang, Yang; Li, Yue; Yue, Minghui; Wang, Jun; Kumar, Sandeep; Wechsler-Reya, Robert J; Zhang, Zhaolei; Ogawa, Yuya; Kellis, Manolis; Duester, Gregg; Zhao, Jing Crystal

2018-06-07

In the version of this article initially published online, there were errors in URLs for www.southernbiotech.com, appearing in Methods sections "m6A dot-blot" and "Western blot analysis." The first two URLs should be https://www.southernbiotech.com/?catno=4030-05&type=Polyclonal#&panel1-1 and the third should be https://www.southernbiotech.com/?catno=6170-05&type=Polyclonal. In addition, some Methods URLs for bioz.com, www.abcam.com and www.sysy.com were printed correctly but not properly linked. The errors have been corrected in the PDF and HTML versions of this article.

Protein Stains to Detect Antigen on Membranes.

PubMed

Dsouza, Anil; Scofield, R Hal

2015-01-01

Western blotting (protein blotting/electroblotting) is the gold standard in the analysis of complex protein mixtures. Electroblotting drives protein molecules from a polyacrylamide (or less commonly, of an agarose) gel to the surface of a binding membrane, thereby facilitating an increased availability of the sites with affinity for both general and specific protein reagents. The analysis of these complex protein mixtures is achieved by the detection of specific protein bands on a membrane, which in turn is made possible by the visualization of protein bands either by chemical staining or by reaction with an antibody of a conjugated ligand. Chemical methods employ staining with organic dyes, metal chelates, autoradiography, fluorescent dyes, complexing with silver, or prelabeling with fluorophores. All of these methods have differing sensitivities and quantitative determinations vary significantly. This review will describe the various protein staining methods applied to membranes after western blotting. "Detection" precedes and is a prerequisite to obtaining qualitative and quantitative data on the proteins in a sample, as much as to comparing the protein composition of different samples. "Detection" is often synonymous to staining, i.e., the reversible or irreversible binding by the proteins of a colored organic or inorganic chemical.

Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

PubMed

do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira

2012-04-01

Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p < 0.001). No differences were found between groups 1 and 2 (p > 0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

Photonic integrated circuits based on silica and polymer PLC

NASA Astrophysics Data System (ADS)

Izuhara, T.; Fujita, J.; Gerhardt, R.; Sui, B.; Lin, W.; Grek, B.

2013-03-01

Various methods of hybrid integration of photonic circuits are discussed focusing on merits and challenges. Material platforms discussed in this report are mainly polymer and silica. We categorize the hybridization methods using silica and polymer waveguides into two types, chip-to-chip and on-chip integration. General reviews of these hybridization technologies from the past works are reviewed. An example for each method is discussed in details. We also discuss current status of our silica PLC hybrid integration technology.

Establishment and characterization of a novel Hodgkin lymphoma cell line, AM-HLH, carrying the Epstein-Barr virus genome integrated into the host chromosome.

PubMed

Hayashida, Masahiko; Daibata, Masanori; Tagami, Erika; Taguchi, Takahiro; Maekawa, Fumiyo; Takeoka, Kayo; Fukutsuka, Katsuhiro; Shimomura, Daiki; Hayashi, Takamasa; Iwatani, Yoshinori; Ohno, Hitoshi

2017-12-01

We describe the establishment and characterization of a cell line, AM-HLH, obtained from a patient with Epstein-Barr virus-positive (EBV + ) nodular sclerosis-type Hodgkin lymphoma (HL). The cells were positive for CD2 and CD30 and negative for CD15. The immunoglobulin heavy- and κ light-chain genes were rearranged. The karyotype was of the triploid range. Southern blotting using the EBV terminal repeat probe detected 3 hybridizing bands that were identical to those of the parental HL material. The cells expressed EBV-encoded RNAs as well as latent genes (EBNA1, EBNA2, LMP1, and LMP2A) and lytic genes (BZLF1 and BALF2). Fluorescence in situ hybridization (FISH) with the cosmid pJB8 clone containing a fragment of EBV DNA as a probe revealed multiple hybridization signals at a marker chromosome. Additional FISH using whole chromosome painting and centromere probes in combination with multicolor FISH determined that multiple EBV copies were clustered within the chromosome 20 materials of the marker chromosome. Culture supernatants of AM-HLH contained IL-10 as measured by the bead-based immunoassay. It is possible that an integrated EBV genome and cellular genes on chromosome 20 were coamplified, leading to the enhanced expression of genes involved in cell growth control. The AM-HLH cell line will be useful to clarify the role of cytokines in the development of EBV + HL. Copyright © 2016 John Wiley & Sons, Ltd.

Chromosome localization of human genes for clathrin adaptor polypeptides AP2{beta} and AP50 and the clathrin-binding protein, VCP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Druck, T.; Gu, Y.; Prabhala, G.

1995-11-01

Clathrin-coated vesicles, involved in endocytosis and Golgi processing, have a surface lattice containing clathrin triskelia and stoichiometric amounts of additional components termed {open_quotes}assembly proteins,{close_quotes} or APs. The AP form at the plasma membrane, AP2, is composed of two large subunits of 100-115 kDa, denoted AP2{alpha} and AP2{beta}, a medium chain of 50 kDa, designated AP50, and a small chain. We have determined human chromosomal locations of genes for a large AP2{beta} (CLAPB1) and a medium (CLAPM1) AP subunit and of a novel clathrin-binding protein, VCP, that binds clathrin simultaneously with A1`s. Chromosomal in situ hybridization of a human genomic clonemore » demonstrated that the CLAPM1 gene mapped to chromosome region 3q28. The gene for the CLAPB1 large subunit was mapped to 17q11.2-q12 by PCR amplification of an AP2{beta} fragment from a panel of rodent-human hybrid DNAs. To map the human VCP sequence, a human-specific probe was made by RT-PCR of human mRNA using oligonucleotide primers from conserved regions of the porcine sequence. The amplified human fragment served as probe on Southern blots of hybrid DNAs to determine that the human VCP locus maps to chromosome region 9pter-q34. 13 refs., 2 figs.« less

Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

PubMed

He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

2012-06-01

The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

Transpositional reactivation of the Dart transposon family in rice lines derived from introgressive hybridization with Zizania latifolia.

PubMed

Wang, Ningning; Wang, Hongyan; Wang, Hui; Zhang, Di; Wu, Ying; Ou, Xiufang; Liu, Shuang; Dong, Zhenying; Liu, Bao

2010-08-26

It is widely recognized that interspecific hybridization may induce "genome shock", and lead to genetic and epigenetic instabilities in the resultant hybrids and/or backcrossed introgressants. A prominent component involved in the genome shock is reactivation of cryptic transposable elements (TEs) in the hybrid genome, which is often associated with alteration in the elements' epigenetic modifications like cytosine DNA methylation. We have previously reported that introgressants derived from hybridization between Oryza sativa (rice) and Zizania latifolia manifested substantial methylation re-patterning and rampant mobilization of two TEs, a copia retrotransposon Tos17 and a MITE mPing. It was not known however whether other types of TEs had also been transpositionally reactivated in these introgressants, their relevance to alteration in cytosine methylation, and their impact on expression of adjacent cellular genes. We document in this study that the Dart TE family was transpositionally reactivated followed by stabilization in all three studied introgressants (RZ1, RZ2 and RZ35) derived from introgressive hybridization between rice (cv. Matsumae) and Z. latifolia, while the TEs remained quiescent in the recipient rice genome. Transposon-display (TD) and sequencing verified the element's mobility and mapped the excisions and re-insertions to the rice chromosomes. Methylation-sensitive Southern blotting showed that the Dart TEs were heavily methylated along their entire length, and moderate alteration in cytosine methylation patterns occurred in the introgressants relative to their rice parental line. Real-time qRT-PCR quantification on the relative transcript abundance of six single-copy genes flanking the newly excised or inserted Dart-related TE copies indicated that whereas marked difference in the expression of all four genes in both tissues (leaf and root) were detected between the introgressants and their rice parental line under both normal and various stress conditions, the difference showed little association with the presence or absence of the newly mobilized Dart-related TEs. Introgressive hybridization has induced transpositional reactivation of the otherwise immobile Dart-related TEs in the parental rice line (cv. Matsumae), which was accompanied with a moderate alteration in the element's cytosine methylation. Significant difference in expression of the Dart-adjacent genes occurred between the introgressants and their rice parental line under both normal and various abiotic stress conditions, but the alteration in gene expression was not coupled with the TEs.

Generation of hybrid sinograms for the recovery of kV-CT images with metal artifacts for helical tomotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeon, Hosang; Park, Dahl; Kim, Wontaek

Purpose: The overall goal of this study is to restore kilovoltage computed tomography (kV-CT) images which are disfigured by patients’ metal prostheses. By generating a hybrid sinogram that is a combination of kV and megavoltage (MV) projection data, the authors suggest a novel metal artifact-reduction (MAR) method that retains the image quality to match that of kV-CT and simultaneously restores the information of metal prostheses lost due to photon starvation. Methods: CT projection data contain information about attenuation coefficients and the total length of the attenuation. By normalizing raw kV projections with their own total lengths of attenuation, mean attenuationmore » projections were obtained. In the same manner, mean density projections of MV-CT were obtained by the normalization of MV projections resulting from the forward projection of density-calibrated MV-CT images with the geometric parameters of the kV-CT device. To generate the hybrid sinogram, metal-affected signals of the kV sinogram were identified and replaced by the corresponding signals of the MV sinogram following a density calibration step with kV data. Filtered backprojection was implemented to reconstruct the hybrid CT image. To validate the authors’ approach, they simulated four different scenarios for three heads and one pelvis using metallic rod inserts within a cylindrical phantom. Five inserts describing human body elements were also included in the phantom. The authors compared the image qualities among the kV, MV, and hybrid CT images by measuring the contrast-to-noise ratio (CNR), the signal-to-noise ratio (SNR), the densities of all inserts, and the spatial resolution. In addition, the MAR performance was compared among three existing MAR methods and the authors’ hybrid method. Finally, for clinical trials, the authors produced hybrid images of three patients having dental metal prostheses to compare their MAR performances with those of the kV, MV, and three existing MAR methods. Results: The authors compared the image quality and MAR performance of the hybrid method with those of other imaging modalities and the three MAR methods, respectively. The total measured mean of the CNR (SNR) values for the nonmetal inserts was determined to be 14.3 (35.3), 15.3 (37.8), and 25.5 (64.3) for the kV, MV, and hybrid images, respectively, and the spatial resolutions of the hybrid images were similar to those of the kV images. The measured densities of the metal and nonmetal inserts in the hybrid images were in good agreement with their true densities, except in cases of extremely low densities, such as air and lung. Using the hybrid method, major streak artifacts were suitably removed and no secondary artifacts were introduced in the resultant image. In clinical trials, the authors verified that kV and MV projections were successfully combined and turned into the resultant hybrid image with high image contrast, accurate metal information, and few metal artifacts. The hybrid method also outperformed the three existing MAR methods with regard to metal information restoration and secondary artifact prevention. Conclusions: The authors have shown that the hybrid method can restore the overall image quality of kV-CT disfigured by severe metal artifacts and restore the information of metal prostheses lost due to photon starvation. The hybrid images may allow for the improved delineation of structures of interest and accurate dose calculations for radiation treatment planning for patients with metal prostheses.« less

Involvement of endoplasmic reticulum in hepatitis B virus replication.

PubMed

Xia, Weiliang; Shen, Yan; Xie, Haiyang; Zheng, Shusen

2006-11-01

The mitochondrial calcium and downstream proline-rich tyrosine kinase-2 (PyK2) signaling pathway are critical to hepatitis B virus (HBV) replication, and the endoplasmic reticulum (ER) plays an important role in intracellular calcium regulation. To investigate the role of ER in HBV replication, the HBV genome transfected HepG2.2.15 cells were treated by cyclosporine A (CsA), cyclopiazonic acid (CPA), ryanodine and U73122, which are all specific blockers of calcium channels located in either ER or mitochondria. The HBV replication level was evaluated by two methods: slot blot hybridization analysis of intracellular HBV DNA and real-time polymerase chain reaction (PCR) analysis of secreted HBV DNA in supernatant; the activation of PyK2 kinase was detected by Western blot analysis. Results indicated that the HBV replication was inhibited when mitochondrial permeability transition pore, ER Ca2+ -ATPase and ER inositol 1,4,5-trisphosphate receptor (IP3R) were blocked by CsA, CPA and U73122, respectively; but not inhibited when ER ryanodine receptor was blocked by ryanodine. The PyK2 phosphorylation level declined after treatment of 2 microg/ml CsA, 5 microM CPA and 25 microM U73122, but not changed apparently after 50 microM ryanodine treatment. Compared with monotreatment, a more powerful inhibitory effect was achieved when the CsA, CPA and U73122 were combined used in twosome or triple manner, while the HBV replication level did not change apparently when ryanodine combined with CsA, CPA or U73122. In conclusion, besides the mitochondria, the ER also participates in the HBV replication through calcium-PyK2 signaling pathway; the calcium channels of ER Ca2+ -ATPase and ER IP3R are responsible for this role; during this complicated process, an interaction between ER and mitochondria maybe involved.

Lack of NF1 gene expression in a sporadic schwannoma from a patient without neurofibromatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norton, K.K.; Dowton, B.; Silow-Santiago, I.

The neurofibromatosis type 1 (NF1) gene encodes a tumor suppressor protein, neurofibromin, which is expressed at high levels in Schwann cells and other adult tissues. Loss of NF1 gene expression has been reported in Schwann cell tumors (neurofibrosarcomas) from patients with NF1 and its loss is associated with increased proliferation of these cells. We examined one spinal schwannoma from a patient without clinical features of neurofibromatosis type 1 or 2. The tumor was a typical schwannoma confirmed by standard neuropathologic criteria and expressed S100 by immunocytochemistry. NF1 gene expression in this tumor was examined by in situ hybridization using anmore » NF1-specific riboprobe, Northern blot analysis and reverse-transcribed (RT) PCR. Little or no expression of NF1 RNA could be detected using these methods whereas abundant expression of S100, cyclophilin and beta-action RNA was found in the tumor. Fibroblast and Schwann cells were then individually cultured from this schwannoma and the RNA extracted for Northern blot and RT-PCR analysis. In these cultured Schwann cells both from early and late passages, abundant expression of NF1 RNA could be detected. It is unlikely that our culture technique preferentially expanded {open_quotes}normal{close_quotes} Schwann cells, since NF1 acts as a tumor suppressor gene and its presence would not confer any growth advantage over the tumor-derived, neurofibromin-negative Schwann cells which presumably have an increased proliferation rate. Similarly, the conditions used to expand these Schwann cells do not result in increased NF1 gene expression as shown in previous studies. These results suggest that, in some tumors, expression of the NF1 gene can be downregulated by factors produced within the tumor and that this type of tumor suppressor gene downregulation may represent another mechanism other than mutation for turning off the expression of these growth-suppressing genes and allowing for cell proliferation in tumors.« less

Periodic health examination, 1995 update: 1. Screening for human papillomavirus infection in asymptomatic women. Canadian Task Force on the Periodic Health Examination.

PubMed

Johnson, K

1995-02-15

To develop recommendations for practising physicians on the advisability of screening for human papillomavirus (HPV) infection in asymptomatic women. Visual inspection, Papanicolaou testing, colposcopy or cervicography, use of HPV group-specific antigen, DNA hybridization, dot blot technique, Southern blot technique or polymerase chain reaction followed by physical or chemical therapeutic intervention. Evidence for a link between HPV infection and cervical cancer, sensitivity and specificity of HPV screening techniques, effectiveness of treatments for HPV infection, and the social and economic costs incurred by screening. MEDLINE was searched for articles published between January 1966 to June 1993 with the use of the key words "papillomavirus," "cervix neoplasms," "mass screening," "prospective studies," "prevalence," "sensitivity," "specificity," "human" and "female." Proven cost-effective screening techniques that could lead to decreased morbidity or mortality were given a high value. The evidence-based methods and values of the Canadian Task Force on the Periodic Health Examination were used. Potential benefits are to prevent cervical cancer and eliminate HPV infection. Potential harmful effects include the creation of an unnecessary burden on the health care system and the labelling of otherwise healthy people as patients with a sexually transmitted disease for which therapy is generally ineffective. Potential costs would include expense of testing, increased use of colposcopy and treatment. There is fair evidence to exclude HPV screening (beyond Papanicolaou testing for cervical cancer) in asymptomatic women (grade D recommendation). The report was reviewed by members of the task force and three external reviewers who were selected to represent different areas of expertise. These guidelines were developed and endorsed by the task force, which is funded by Health Canada and the National Health Research and Development Program. The principal author (K.J.) was supported in part by the National Health Research and Development Program through a National Health Fellowship (AIDS).

Quantification of CSF cystatin C using liquid chromatography tandem mass spectrometry.

PubMed

Matsuda, Chikashi; Shiota, Yuri; Sheikh, Abdullah Md; Okazaki, Ryota; Yamada, Kazuo; Yano, Shozo; Minohata, Toshikazu; Matsumoto, Ken-Ichi; Yamaguchi, Shuhei; Nagai, Atsushi

2018-03-01

Cystatin C (CST3), a ubiquitously expressed cysteine protease inhibitor, is implicated in several neurological diseases. Here, we have developed an accurate CST3 measurement system based on liquid chromatography tandem mass spectrometry (LC-MS/MS). LC-MS/MS based measurement for CSF CST3 was validated by determination of assay precision, accuracy and recovery. The values were compared with those measured by immunoassay. Glycosylation of CST3 in CSF was analyzed by Western blotting and lectin blotting. Measuring standard CST3 by LC-MS/MS produced a linear standard curve that correlated with assigned values (r 2 =0.99). Both intra- and inter-assay variation was <10%. Although showed a correlation, the average CST3 concentration measured by LC-MS/MS was significantly higher than that of immunoassay. Western blotting showed the presence of a 25KDa species along with CST3 monomer (14KDa) in CSF. The volume of 25KDa species was decreased by deglycosylation. Lectin blotting revealed a 25KDa glycosylated protein in sialidase-treated CSF, which was decreased by deglycosylation. However, deglycosylation did not alter CST3 concentration measured by immunoassay. Our results suggest that LC-MS/MS-based CST3 measurement is a robust method with higher detection ability. Such method could be useful for the diagnosis and monitoring of neurological diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Method and apparatus for controlling hybrid powertrain system in response to engine temperature

DOEpatents

Martini, Ryan D; Spohn, Brian L; Lehmen, Allen J; Cerbolles, Teresa L

2014-10-07

A method for controlling a hybrid powertrain system including an internal combustion engine includes controlling operation of the hybrid powertrain system in response to a preferred minimum coolant temperature trajectory for the internal combustion engine.

Methicillin-Resistant Staphylococcus aureus: Comparison of Susceptibility Testing Methods and Analysis of mecA-Positive Susceptible Strains

PubMed Central

Sakoulas, George; Gold, Howard S.; Venkataraman, Lata; DeGirolami, Paola C.; Eliopoulos, George M.; Qian, Qinfang

2001-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) is responsible for an increasing number of serious nosocomial and community-acquired infections. Phenotypic heterogeneous drug resistance (heteroresistance) to antistaphylococcal beta-lactams affects the results of susceptibility testing. The present study compared the MRSA-Screen latex agglutination test (Denka Seiken Co., Ltd., Tokyo, Japan) for detection of PBP 2a with agar dilution, the VITEK-1 and VITEK-2 systems (bioMérieux, St. Louis, Mo.), and the oxacillin agar screen test for detection of MRSA, with PCR for the mecA gene used as the “gold standard” assay. Analysis of 107 methicillin-susceptible S. aureus (MSSA) isolates and 203 MRSA isolates revealed that the MRSA-Screen latex agglutination test is superior to any single phenotype-based susceptibility testing method, with a sensitivity of 100% and a specificity of 99.1%. Only one isolate that lacked mecA was weakly positive by the MRSA-Screen latex agglutination test. This isolate was phenotypically susceptible to oxacillin and did not contain the mecA gene by Southern blot hybridization. The oxacillin agar screen test, the VITEK-1 system, the VITEK-2 system, and agar dilution showed sensitivities of 99.0, 99.0, 99.5, and 99%, respectively, and specificities of 98.1, 100, 97.2, and 100%, respectively. The differences in sensitivity or specificity were not statistically significant. Oxacillin bactericidal assays showed that mecA- and PBP 2a-positive S. aureus isolates that are susceptible to antistaphylococcal beta-lactams by conventional methods are functionally resistant to oxacillin. We conclude that the accuracy of the MRSA-Screen latex agglutination method for detection of PBP 2a approaches the accuracy of PCR and is more accurate than any susceptibility testing method used alone for the detection of MRSA. PMID:11682512

Characterization and expression of amphioxus ApoD gene encoding an archetype of vertebrate ApoD proteins.

PubMed

Wang, Lei; Zhang, Shicui; Liu, Zhenhui; Li, Hongyan; Wang, Yongjun; Jiang, Shengjuan

2007-01-01

Here we report a homologue of the apolipoprotein D gene (AmphiApoD) in amphioxus, Branchiostoma belcheri tsingtauense, the first such finding in a basal chordate cephalochordate. The main features of the protein predicted from AmphiApoD are characteristic of the apolipoprotein D. Phylogenetic analysis places AmphiApoD at the base of the phylogenetic tree, suggesting that AmphiApoD is the archetype of the vertebrate ApoD genes. Both whole mount in situ hybridization and Northern blotting and RT-PCR as well as in situ hybridization histochemistry reveal that AmphiApoD is expressed in tissues derived from mesoderm and endoderm including notochord and hind-gut, which contrasts with the strong expression patterns of ApoD genes in the ectodermal derivatives in mammals and birds. The expression profiles of the ApoD gene may have been changed to be expressed in the endo-mesodermal derivatives in amphioxus after the vertebrate and cephalochordate lineages diverged; alternatively, the ApoD gene may first have been expressed in the endo-mesoderm during embryogenesis in the last common ancestor of all chordates, and subsequently came to be expressed in the ectodermal derivatives of vertebrates including mammals and birds.

Isolation of candidate genes for apomictic development in buffelgrass (Pennisetum ciliare).

PubMed

Singh, Manjit; Burson, Byron L; Finlayson, Scott A

2007-08-01

Asexual reproduction through seeds, or apomixis, is a process that holds much promise for agricultural advances. However, the molecular mechanisms underlying apomixis are currently poorly understood. To identify genes related to female gametophyte development in apomictic ovaries of buffelgrass (Pennisetum ciliare (L.) Link), Suppression Subtractive Hybridization of ovary cDNA with leaf cDNA was performed. Through macroarray screening of subtracted cDNAs two genes were identified, Pca21 and Pca24, that showed differential expression between apomictic and sexual ovaries. Sequence analysis showed that both Pca21 and Pca24 are novel genes not previously characterized in plants. Pca21 shows homology to two wheat genes that are also expressed during reproductive development. Pca24 has similarity to coiled-coil-helix-coiled-coil-helix (CHCH) domain containing proteins from maize and sugarcane. Northern blot analysis revealed that both of these genes are expressed throughout female gametophyte development in apomictic ovaries. In situ hybridizations localized the transcript of these two genes to the developing embryo sacs in the apomictic ovaries. Based on the expression patterns it was concluded that Pca21 and Pca24 likely play a role during apomictic development in buffelgrass.

Identification of differentially expressed genes in the oviduct of two rabbit lines divergently selected for uterine capacity using suppression subtractive hybridization.

PubMed

Ballester, M; Castelló, A; Peiró, R; Argente, M J; Santacreu, M A; Folch, J M

2013-06-01

Suppressive subtractive hybridization libraries from oviduct at 62 h post-mating of two lines of rabbits divergently selected for uterine capacity were generated to identify differentially expressed genes. A total of 438 singletons and 126 contigs were obtained by cluster assembly and sequence alignment of 704 expressed sequence tags (ESTs), of which 54% showed homology to known proteins of the non-redundant NCBI databases. Differential screening by dot blot validated 71 ESTs, of which 47 showed similarity to known genes. Transcripts of genes were functionally annotated in the molecular function and the biological process gene ontology categories using the BLAST2GO software and were assigned to reproductive developmental process, immune response, amino acid metabolism and degradation, response to stress and apoptosis terms. Finally, three interesting genes, PGR, HSD17B4 and ERO1L, were identified as overexpressed in the low line using RT-qPCR. Our study provides a list of candidate genes that can be useful to understanding the molecular mechanisms underlying the phenotypic differences observed in early embryo survival and development traits. © 2012 The Authors, Animal Genetics © 2012 Stichting International Foundation for Animal Genetics.

UV-VIS extinction spectra of gold particle coated by oligonucleotide shell

NASA Astrophysics Data System (ADS)

Bogatyrev, Vladimir A.; Vrublevsky, Stanislav A.; Trachuk, Lyubov A.; Khlebtsov, Nikolai G.

2005-06-01

We describe synthesis process of an oligonucleotide-functionalized colloidal gold marker CG-l5-T28, its optical properties and interaction with poly(A) in solution and on a solid-phase substrate. The marker is a complex of 15 nm diameter colloidal gold nanoparticles with covalently attached 5'-thiolated 28-base oligothymidine macromolecules. A positive hybridization reaction of the marker with poly(A) is observed by solid-phase analysis on hanging a spot color (from red to blue ) or on appearance of a red dye in dot-blot test as compared to control experiments with poly(U) target. The principles of spectrophotometric monitoring all stages of the marker preparation and application of spectrophotometry to detection of the polynucleotide hybridization in vitro are described. Experimental data were compared with theoretical calculations based on Mie theory for 2-layer model of gold core in polymeric shell with imaginary part of refractive index that typical for the real absorption spectra of NA. To explain the aggregation of CG-15-T28 caused by interaction with poly(A) in solution, we suggest a new model differing from a standard model of cross-linker binding.

Molecular identification and characterization of piroplasm species in Hokkaido sika deer (Cervus nippon yesoensis), Japan.

PubMed

Elbaz, Elzahara; Moustafa, Mohamed Abdallah Mohamed; Lee, Kyunglee; Mohamed, Wessam Mohamed Ahmed; Nakao, Ryo; Shimozuru, Michito; Sashika, Mariko; Younis, Emad Elsayed Ahmed; El-Khodery, Sabry Ahmed; Tsubota, Toshio

2017-08-01

Babesia and Theileria species are tick-borne protozoan parasites that have a veterinary and zoonotic importance. In order to investigate the prevalence and genetic diversity of these parasites, a total of 269 sika deer blood DNA samples collected from Hokkaido, Japan, were examined for Babesia and Theileria species by touch-down PCR targeting the 18S rRNA gene. Reverse line blot (RLB) hybridization was then used to detect 12 piroplasm species. The results revealed that 95.5% (257/269), 94.1% (253/269), 14.1% (38/269), 87.7% (236/269) and 11.5% (31/269) of the examined PCR products hybridized with the probes which were designed to detect all Babesia and Theileria spp., all Theileria spp., all Babesia spp., Theileria sp. Thrivae and Babesia divergens-like, respectively. The 18S rRNA gene partial sequences were divided into Theileria sp. Thrivae, T. capreoli, B. divergens-like and an undescribed Babesia species. This study showed the first detection of the undescribed Babesia sp. from Japan. Therefore, more studies are required to understand the ecology of the newly detected tick-borne pathogens in Hokkaido. Copyright © 2017 Elsevier GmbH. All rights reserved.

Characterization of experimentally induced, nonaflatoxigenic variant strains of Aspergillus parasiticus.

PubMed Central

Kale, S P; Cary, J W; Bhatnagar, D; Bennett, J W

1996-01-01

Six previously isolated, nonaflatoxigenic variants of Aspergillus parasiticus, designated sec mutants, were characterized morphologically by electron microscopy, biochemically by biotransformation studies with an aflatoxin precursor, and genetically by Northern (RNA) hybridization analysis of aflatoxin biosynthetic gene transcripts. Scanning electron micrographs clearly demonstrated that compared with the parental sec+ forms, the variant sec forms had an abundance of vegetative mycelia, orders of magnitude reduced number of conidiophores and conidia, and abnormal metulae. Conidiospores were detected in sec cultures only at higher magnifications (x 500), in contrast to the sec+ (wild-type) strain, in which abundant conidiospores (masking the vegetative mycelia) were observed at even lower magnifications (x 300). All sec+ forms, but none of the sec forms, showed bioconversion of sterigmatocystin to aflatoxins. Northern blots probed with pathway genes demonstrated lack of expression of both the aflatoxin biosynthetic pathway structural (nor-1 and omtA) and regulatory (aflR) genes in the sec forms; PCR and Southern hybridization analysis confirmed the presence of the genes in the sec genomes. Thus, the loss of aflatoxigenic capabilities in the sec form is correlated with alterations in the conidial morphology of the fungus, suggesting that the regulation of aflatoxin synthesis and conidiogenesis may be interlinked. PMID:8795232

Gibberellin induces alpha-amylase gene in seed coat of Ipomoea nil immature seeds.

PubMed

Nakajima, Masatoshi; Nakayama, Akira; Xu, Zheng-Jun; Yamaguchi, Isomaro

2004-03-01

Two full-length cDNAs encoding gibberellin 3-oxidases, InGA3ox1 and InGA3ox2, were cloned from developing seeds of morning glory (Ipomoea nil (Pharbitis nil) Choisy cv. Violet) with degenerate-PCR and RACEs. The RNA-blot analysis for these clones revealed that the InGA3ox2 gene was organ-specifically expressed in the developing seeds at 6-18 days after anthesis. In situ hybridization showed the signals of InGA3ox2 mRNA in the seed coat, suggesting that active gibberellins (GAs) were synthesized in the tissue, although no active GA was detected there by immunohistochemistry. In situ hybridization analysis for InAmy1 (former PnAmy1) mRNA showed that InAmy1 was also synthesized in the seed coat. Both InGA3ox2 and InAmy1 genes were expressed spatially overlapped without a clear time lag, suggesting that both active GAs and InAmy1 were synthesized almost simultaneously in seed coat and secreted to the integument. These observations support the idea that GAs play an important role in seed development by inducing alpha-amylase.

One-pot in situ redox synthesis of hexacyanoferrate/conductive polymer hybrids as lithium-ion battery cathodes.

PubMed

Wong, Min Hao; Zhang, Zixuan; Yang, Xianfeng; Chen, Xiaojun; Ying, Jackie Y

2015-09-14

An efficient and adaptable method is demonstrated for the synthesis of lithium hexacyanoferrate/conductive polymer hybrids for Li-ion battery cathodes. The hybrids were synthesized via a one-pot method, involving a redox-coupled reaction between pyrrole monomers and the Li3Fe(CN)6 precursor. The hybrids showed much better cyclability relative to reported Prussian Blue (PB) analogs.

Development of a Hybrid RANS/LES Method for Compressible Mixing Layer Simulations

NASA Technical Reports Server (NTRS)

Georgiadis, Nicholas J.; Alexander, J. Iwan D.; Reshotko, Eli

2001-01-01

A hybrid method has been developed for simulations of compressible turbulent mixing layers. Such mixing layers dominate the flows in exhaust systems of modem day aircraft and also those of hypersonic vehicles currently under development. The hybrid method uses a Reynolds-averaged Navier-Stokes (RANS) procedure to calculate wall bounded regions entering a mixing section, and a Large Eddy Simulation (LES) procedure to calculate the mixing dominated regions. A numerical technique was developed to enable the use of the hybrid RANS/LES method on stretched, non-Cartesian grids. The hybrid RANS/LES method is applied to a benchmark compressible mixing layer experiment. Preliminary two-dimensional calculations are used to investigate the effects of axial grid density and boundary conditions. Actual LES calculations, performed in three spatial directions, indicated an initial vortex shedding followed by rapid transition to turbulence, which is in agreement with experimental observations.

Effects of Reusing Gel Electrophoresis and Electrotransfer Buffers on Western Blotting.

PubMed

Heda, Ghanshyam D; Omotola, Oluwabukola B; Heda, Rajiv P; Avery, Jamie

2016-09-01

SDS-PAGE and Western blotting are 2 of the most commonly used biochemical methods for protein analysis. Proteins are electrophoretically separated based on their MWs by SDS-PAGE and then electrotransferred to a solid membrane surface for subsequent protein-specific analysis by immunoblotting, a procedure commonly known as Western blotting. Both of these procedures use a salt-based buffer, with the latter procedure consisting of methanol as an additive known for its toxicity. Previous reports present a contradictory view in favor or against reusing electrotransfer buffer, also known as Towbin's transfer buffer (TTB), with an aim to reduce the toxic waste. In this report, we present a detailed analysis of not only reusing TTB but also gel electrophoresis buffer (EB) on proteins of low to high MW range. Our results suggest that EB can be reused for at least 5 times without compromising the electrophoretic separation of mixture of proteins in an MW standard, BSA, and crude cell lysates. Additionally, reuse of EB did not affect the quality of subsequent Western blots. Successive reuse of TTB, on the other hand, diminished the signal of proteins of different MWs in a protein standard and a high MW membrane protein cystic fibrosis transmembrane-conductance regulator (CFTR) in Western blotting.

Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

NASA Astrophysics Data System (ADS)

Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

2014-03-01

This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

Identification of a novel interspecific hybrid yeast from a metagenomic spontaneously inoculated beer sample using Hi-C.

PubMed

Smukowski Heil, Caiti; Burton, Joshua N; Liachko, Ivan; Friedrich, Anne; Hanson, Noah A; Morris, Cody L; Schacherer, Joseph; Shendure, Jay; Thomas, James H; Dunham, Maitreya J

2018-01-01

Interspecific hybridization is a common mechanism enabling genetic diversification and adaptation; however, the detection of hybrid species has been quite difficult. The identification of microbial hybrids is made even more complicated, as most environmental microbes are resistant to culturing and must be studied in their native mixed communities. We have previously adapted the chromosome conformation capture method Hi-C to the assembly of genomes from mixed populations. Here, we show the method's application in assembling genomes directly from an uncultured, mixed population from a spontaneously inoculated beer sample. Our assembly method has enabled us to de-convolute four bacterial and four yeast genomes from this sample, including a putative yeast hybrid. Downstream isolation and analysis of this hybrid confirmed its genome to consist of Pichia membranifaciens and that of another related, but undescribed, yeast. Our work shows that Hi-C-based metagenomic methods can overcome the limitation of traditional sequencing methods in studying complex mixtures of genomes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Artificial mismatch hybridization

DOEpatents

Guo, Zhen; Smith, Lloyd M.

1998-01-01

An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

A Hybrid Location Method for Missile Security Team Positioning

DTIC Science & Technology

2007-01-01

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Hybrid Location Method for Missile Security...Bell and Weir A Hybrid Location Method for Missile Security Team Positioning Chief Master Sergeant Michael C. Dawson Air Force Logistics Management...problem oj locating security teams over a geographic area to maintain security Jor US Air Force Intercontinental Ballistic Missile Systems. A

Interpretation of biological and mechanical variations between the Lowry versus Bradford method for protein quantification.

PubMed

Lu, Tzong-Shi; Yiao, Szu-Yu; Lim, Kenneth; Jensen, Roderick V; Hsiao, Li-Li

2010-07-01

The identification of differences in protein expression resulting from methodical variations is an essential component to the interpretation of true, biologically significant results. We used the Lowry and Bradford methods- two most commonly used methods for protein quantification, to assess whether differential protein expressions are a result of true biological or methodical variations. MATERIAL #ENTITYSTARTX00026; Differential protein expression patterns was assessed by western blot following protein quantification by the Lowry and Bradford methods. We have observed significant variations in protein concentrations following assessment with the Lowry versus Bradford methods, using identical samples. Greater variations in protein concentration readings were observed over time and in samples with higher concentrations, with the Bradford method. Identical samples quantified using both methods yielded significantly different expression patterns on Western blot. We show for the first time that methodical variations observed in these protein assay techniques, can potentially translate into differential protein expression patterns, that can be falsely taken to be biologically significant. Our study therefore highlights the pivotal need to carefully consider methodical approaches to protein quantification in techniques that report quantitative differences.

Nucleic acid in-situ hybridization detection of infectious agents

NASA Astrophysics Data System (ADS)

Thompson, Curtis T.

2000-04-01

Limitations of traditional culture methods and newer polymerase chain reaction (PCR)-based methods for detection and speciation of infectious agents demonstrate the need for more rapid and better diagnostics. Nucleic acid hybridization is a detection technology that has gained wide acceptance in cancer and prenatal cytogenetics. Using a modification of the nucleic acid hybridization technique known as fluorescence in-situ hybridization, infectious agents can be detected in a variety of specimens with high sensitivity and specificity. The specimens derive from all types of human and animal sources including body fluids, tissue aspirates and biopsy material. Nucleic acid hybridization can be performed in less than one hour. The result can be interpreted either using traditional fluorescence microscopy or automated platforms such as micro arrays. This paper demonstrates proof of concept for nucleic acid hybridization detection of different infectious agents. Interpretation within a cytologic and histologic context is possible with fluorescence microscopic analysis, thereby providing confirmatory evidence of hybridization. With careful probe selection, nucleic acid hybridization promises to be a highly sensitive and specific practical diagnostic alternative to culture, traditional staining methods, immunohistochemistry and complicated nucleic acid amplification tests.

Application of Hybrid Along-Track Interferometry/Displaced Phase Center Antenna Method for Moving Human Target Detection in Forest Environments

DTIC Science & Technology

2016-10-01

ARL-TR-7846 ● OCT 2016 US Army Research Laboratory Application of Hybrid Along-Track Interferometry/ Displaced Phase Center...Research Laboratory Application of Hybrid Along-Track Interferometry/ Displaced Phase Center Antenna Method for Moving Human Target Detection...TYPE Technical Report 3. DATES COVERED (From - To) 2015–2016 4. TITLE AND SUBTITLE Application of Hybrid Along-Track Interferometry/ Displaced

Methods to Assess the Direct Interaction of C. jejuni with Mucins.

PubMed

Clyne, Marguerite; Duggan, Gina; Naughton, Julie; Bourke, Billy

2017-01-01

Studies of the interaction of bacteria with mucus-secreting cells can be complemented at a more mechanistic level by exploring the interaction of bacteria with purified mucins. Here we describe a far Western blotting approach to show how C. jejuni proteins separated by SDS PAGE and transferred to a membrane or slot blotted directly onto a membrane can be probed using biotinylated mucin. In addition we describe the use of novel mucin microarrays to assess bacterial interactions with mucins in a high-throughput manner.

Diffusive transfer to membranes as an effective interface between gel electrophoresis and mass spectrometry

NASA Astrophysics Data System (ADS)

Ogorzalek Loo, Rachel R.; Mitchell, Charles; Stevenson, Tracy I.; Loo, Joseph A.; Andrews, Philip C.

1997-12-01

Diffusive transfer was examined as a blotting method to transfer proteins from polyacrylamide gels to membranes for ultraviolet matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The method is well-suited for transfers from isoelectric focusing (IEF) gels. Spectra have been obtained for 11 pmol of 66 kDa albumin loaded onto an IEF gel and subsequently blotted to polyethylene. Similarly, masses of intact carbonic anhydrase and hemoglobin were obtained from 14 and 20 pmol loadings. This methodology is also compatible with blotting high molecular weight proteins, as seen for 6 pmol of the 150 kDa monoclonal antibody anti-[beta]-galactosidase transferred to Goretex. Polypropylene, Teflon, Nafion and polyvinylidene difluoride (PVDF) also produced good spectra following diffusive transfer. Only analysis from PVDF required that the membrane be kept wet prior to application of matrix. Considerations in mass accuracy for analysis from large-area membranes with continuous extraction and delayed extraction were explored, as were remedies for surface charging. Vapor phase CNBr cleavage was applied to membrane-bound samples for peptide mapping.

Environmentally friendly ultrosound synthesis and antibacterial activity of cellulose/Ag/AgCl hybrids.

PubMed

Dong, Yan-Yan; Deng, Fu; Zhao, Jin-Jin; He, Jing; Ma, Ming-Guo; Xu, Feng; Sun, Run-Cang

2014-01-01

This study aims to investigate the fabrication and property of cellulose/Ag/AgCl hybrids. In this article, preparation of cellulose/Ag/AgCl hybrids was reported using the cellulose solution, AgNO₃, AlCl₃·6H₂O with ultrasound agitation method. The cellulose solution was synthesized by the dissolution of the microcrystalline cellulose in NaOH/urea aqueous solution. Influences of the experimental parameters of ultrasound treatment time and ultrasonic intermittent on the hybrids were investigated. The phase, microstructure, thermal stability, and morphology of the hybrids were characterized by X-ray powder diffraction (XRD), Fourier transform infrared (FTIR) spectrometry, thermogravimetric analysis (TGA), differential thermal analysis (DTA), and scanning electron microscopy (SEM). Results showed the successful synthesis of cellulose/Ag/AgCl hybrids with good thermal stability. Moreover, the hybrids displayed desirable antimicrobial activities. Compared with other conventional methods, the rapid, green, and environmentally friendly ultrasound agitation method opens a new window to the high value-added applications of biomass. Copyright © 2013 Elsevier Ltd. All rights reserved.

The Probability of a Gene Tree Topology within a Phylogenetic Network with Applications to Hybridization Detection

PubMed Central

Yu, Yun; Degnan, James H.; Nakhleh, Luay

2012-01-01

Gene tree topologies have proven a powerful data source for various tasks, including species tree inference and species delimitation. Consequently, methods for computing probabilities of gene trees within species trees have been developed and widely used in probabilistic inference frameworks. All these methods assume an underlying multispecies coalescent model. However, when reticulate evolutionary events such as hybridization occur, these methods are inadequate, as they do not account for such events. Methods that account for both hybridization and deep coalescence in computing the probability of a gene tree topology currently exist for very limited cases. However, no such methods exist for general cases, owing primarily to the fact that it is currently unknown how to compute the probability of a gene tree topology within the branches of a phylogenetic network. Here we present a novel method for computing the probability of gene tree topologies on phylogenetic networks and demonstrate its application to the inference of hybridization in the presence of incomplete lineage sorting. We reanalyze a Saccharomyces species data set for which multiple analyses had converged on a species tree candidate. Using our method, though, we show that an evolutionary hypothesis involving hybridization in this group has better support than one of strict divergence. A similar reanalysis on a group of three Drosophila species shows that the data is consistent with hybridization. Further, using extensive simulation studies, we demonstrate the power of gene tree topologies at obtaining accurate estimates of branch lengths and hybridization probabilities of a given phylogenetic network. Finally, we discuss identifiability issues with detecting hybridization, particularly in cases that involve extinction or incomplete sampling of taxa. PMID:22536161

Hybrid Learning in Enhancing Communicative Skill in English

ERIC Educational Resources Information Center

Singaravelu, G.

2010-01-01

The present study highlights the effectiveness of Hybrid-Learning in enhancing communicative skill in English among the Trainees of Bachelor of education of School of Distance Education, Bharathiar University,Coimbatore. Hybrid learning refers to mixing of different learning methods or mixing two more methods for teaching learning process. It…

Bond additivity corrections for quantum chemistry methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

C. F. Melius; M. D. Allendorf

1999-04-01

In the 1980's, the authors developed a bond-additivity correction procedure for quantum chemical calculations called BAC-MP4, which has proven reliable in calculating the thermochemical properties of molecular species, including radicals as well as stable closed-shell species. New Bond Additivity Correction (BAC) methods have been developed for the G2 method, BAC-G2, as well as for a hybrid DFT/MP2 method, BAC-Hybrid. These BAC methods use a new form of BAC corrections, involving atomic, molecular, and bond-wise additive terms. These terms enable one to treat positive and negative ions as well as neutrals. The BAC-G2 method reduces errors in the G2 method duemore » to nearest-neighbor bonds. The parameters within the BAC-G2 method only depend on atom types. Thus the BAC-G2 method can be used to determine the parameters needed by BAC methods involving lower levels of theory, such as BAC-Hybrid and BAC-MP4. The BAC-Hybrid method should scale well for large molecules. The BAC-Hybrid method uses the differences between the DFT and MP2 as an indicator of the method's accuracy, while the BAC-G2 method uses its internal methods (G1 and G2MP2) to provide an indicator of its accuracy. Indications of the average error as well as worst cases are provided for each of the BAC methods.« less

[Comparison between old and new methods for detection of allergenic substances (egg and milk)].

PubMed

Watanabe, Hiroko; Akaboshi, Chie; Saita, Kiyotaka; Sekido, Haruko; Hashiguchi, Shigeki; Watabe, Kenjiro; Tanaka, Kouki

2011-01-01

The old ELISA method for detection of allergenic substances (egg and milk) in Kanagawa prefecture from 2003 to 2007, employed before improvement of the food allergen labeling system, yielded detection rates of 20% for egg and 30% for milk. In 2005, after improvement of the labeling system, the detection rate using the new ELISA in solutions containing 1% SDS and 7% 2-mercaptoethanol increased by about 10% for egg, but decreased by half for milk. There were 4 positive samples (over 10 µg/g) for both egg and milk proteins, on account of contamination by ingredients at the manufacturing line and the lack of proper food labeling. In 2009, the contamination levels of egg and milk proteins in labeled commercial foods were low. In a comparison between the new and old methods with the same samples, both the new ELISA and Western-blot analyses showed an increase in the detection rate of egg protein. In relation to milk protein, the detection rates were decreased with the new ELISA, although the ELISA detection rate and consistency rates with Western-blot analysis were increased. On the other hand, in the case of a protein content below 5 µg/g, it was impossible to determine ovomucoid and casein by Western-blot analysis.

EIT image reconstruction based on a hybrid FE-EFG forward method and the complete-electrode model.

PubMed

Hadinia, M; Jafari, R; Soleimani, M

2016-06-01

This paper presents the application of the hybrid finite element-element free Galerkin (FE-EFG) method for the forward and inverse problems of electrical impedance tomography (EIT). The proposed method is based on the complete electrode model. Finite element (FE) and element-free Galerkin (EFG) methods are accurate numerical techniques. However, the FE technique has meshing task problems and the EFG method is computationally expensive. In this paper, the hybrid FE-EFG method is applied to take both advantages of FE and EFG methods, the complete electrode model of the forward problem is solved, and an iterative regularized Gauss-Newton method is adopted to solve the inverse problem. The proposed method is applied to compute Jacobian in the inverse problem. Utilizing 2D circular homogenous models, the numerical results are validated with analytical and experimental results and the performance of the hybrid FE-EFG method compared with the FE method is illustrated. Results of image reconstruction are presented for a human chest experimental phantom.

Torque Characteristics Analysis of Hybrid Stepping Motor Using 3-D Finite Element Method

NASA Astrophysics Data System (ADS)

Kawase, Yoshihiro; Yamaguchi, Tadashi; Masuda, Tatsuya; Domeki, Hideo; Kobori, Masaru

Hybrid stepping motors are widely used for various electric instruments because of high torque, high accuracy and small step angle. It is necessary for the optimum design of hybrid stepping motors to analyze torque characteristics accurately. In this paper, a hybrid stepping motor is analyzed using the 3-D finite element method taking into account the rotation of the armature. The effects of the interlaminar gap in the core on the torque characteristics are clarified using the gap elements. The validity of our method is clarified by comparison between the calculated results and measured ones.

Nematode Species Identification-Current Status, Challenges and Future Perspectives for Cyathostomins.

PubMed

Bredtmann, Christina M; Krücken, Jürgen; Murugaiyan, Jayaseelan; Kuzmina, Tetiana; von Samson-Himmelstjerna, Georg

2017-01-01

Human and animal health is globally affected by a variety of parasitic helminths. The impact of co-infections and development of anthelmintic resistance requires improved diagnostic tools, especially for parasitic nematodes e.g., to identify resistant species or attribute pathological effects to individual species or particular species combinations. In horses, co-infection with cyathostomins is rather a rule than an exception with typically 5 to 15 species (out of more than 40 described) per individual host. In cyathostomins, reliable morphological species differentiation is currently limited to adults and requires highly specialized expertize while precise morphological identification of eggs and early stage larvae is impossible. The situation is further complicated by a questionable validity of some cyathostomins while others might actually represent cryptic species complexes. Several molecular methods using different target sequences were established to overcome these limitations. For adult worms, PCR followed by sequencing of mitochondrial genes or external or internal ribosomal RNA spacers is suitable to genetically confirm morphological identifications. The most commonly used method to differentiate eggs or larvae is the reverse-line-blot hybridization assay. However, both methods suffer from the fact that target sequences are not available for many species or even that GenBank® entries are unreliable regarding the cyathostomin species. Recent advances in proteomic tools for identification of metazoans including insects and nematodes of the genus Trichinella will be evaluated for suitability to diagnose cyathostomins. Future research should focus on the comparative analysis of morphological, molecular and proteomic data from the same cyathostomin specimen to optimize tools for species-specific identification.

Nematode Species Identification—Current Status, Challenges and Future Perspectives for Cyathostomins

PubMed Central

Bredtmann, Christina M.; Krücken, Jürgen; Murugaiyan, Jayaseelan; Kuzmina, Tetiana; von Samson-Himmelstjerna, Georg

2017-01-01

Human and animal health is globally affected by a variety of parasitic helminths. The impact of co-infections and development of anthelmintic resistance requires improved diagnostic tools, especially for parasitic nematodes e.g., to identify resistant species or attribute pathological effects to individual species or particular species combinations. In horses, co-infection with cyathostomins is rather a rule than an exception with typically 5 to 15 species (out of more than 40 described) per individual host. In cyathostomins, reliable morphological species differentiation is currently limited to adults and requires highly specialized expertize while precise morphological identification of eggs and early stage larvae is impossible. The situation is further complicated by a questionable validity of some cyathostomins while others might actually represent cryptic species complexes. Several molecular methods using different target sequences were established to overcome these limitations. For adult worms, PCR followed by sequencing of mitochondrial genes or external or internal ribosomal RNA spacers is suitable to genetically confirm morphological identifications. The most commonly used method to differentiate eggs or larvae is the reverse-line-blot hybridization assay. However, both methods suffer from the fact that target sequences are not available for many species or even that GenBank® entries are unreliable regarding the cyathostomin species. Recent advances in proteomic tools for identification of metazoans including insects and nematodes of the genus Trichinella will be evaluated for suitability to diagnose cyathostomins. Future research should focus on the comparative analysis of morphological, molecular and proteomic data from the same cyathostomin specimen to optimize tools for species-specific identification. PMID:28702376

Biomolecular hybrid material and process for preparing same and uses for same

DOEpatents

Kim, Jungbae [Richland, WA

2010-11-23

Disclosed is a composition and method for fabricating novel hybrid materials comprised of, e.g., carbon nanotubes (CNTs) and crosslinked enzyme clusters (CECs). In one method, enzyme-CNT hybrids are prepared by precipitation of enzymes which are subsequently crosslinked, yielding crosslinked enzyme clusters (CECs) on the surface of the CNTs. The CEC-enzyme-CNT hybrids exhibit high activity per unit area or mass as well as improved enzyme stability and longevity over hybrid materials known in the art. The CECs in the disclosed materials permit multilayer biocatalytic coatings to be applied to surfaces providing hybrid materials suitable for use in, e.g., biocatalytic applications and devices as described herein.

Cloning and expression of calmodulin gene in Scoparia dulcis.

PubMed

Saitoh, Daisuke; Asakura, Yuki; Nkembo, Marguerite Kasidimoko; Shite, Masato; Sugiyama, Ryuji; Lee, Jung-Bum; Hayashi, Toshimitsu; Kurosaki, Fumiya

2007-06-01

A homology-based cloning strategy yielded a cDNA clone, designated Sd-cam, encoding calmodulin protein from Scoparia dulcis. The restriction digests of genomic DNA of S. dulcis showed a single hybridized signal when probed with the fragment of this gene in Southern blot analyses, suggesting that Sd-cam occurs as a sole gene encoding calmodulin in the plant. The reverse-transcription polymerase chain reaction analysis revealed that Sd-cam was appreciably expressed in leaf, root and stem tissues. It appeared that transcription of this gene increased transiently when the leaf cultures of S. dulcis were treated with methyl jasmonate and calcium ionophore A23187. These results suggest that transcriptional activation of Sd-cam is one of the early cellular events of the methyl jasmonate-induced responses of S. dulcis.

Telomere erosion varies during in vitro aging of normal human fibroblasts from young and adult donors.

PubMed

Figueroa, R; Lindenmaier, H; Hergenhahn, M; Nielsen, K V; Boukamp, P

2000-06-01

The life span of normal fibroblasts in vitro (Hayflick limit) depends on donor age, and telomere shortening has been proposed as a potential mechanism. By quantitative fluorescence in situ hybridization and Southern blot analysis, we show progressive telomere loss to about 5 kb mean telomere restriction fragment length in fibroblasts from two adult donors within 40 population doublings, whereas in fibroblasts from two infant donors, telomere erosion is reduced, leaving a mean telomere restriction fragment length of approximately 7 kb at senescence (after approximately 60 population doublings). Aging of fibroblasts from both infant and adult donors was not accompanied by chromosomal abnormalities but was correlated with increased telomere repeat-binding factor 2 expression at both the protein and transcriptional level.

Physical map of the Brucella melitensis 16 M chromosome.

PubMed Central

Allardet-Servent, A; Carles-Nurit, M J; Bourg, G; Michaux, S; Ramuz, M

1991-01-01

We present the first restriction map of the Brucella melitensis 16 M chromosome obtained by Southern blot hybridization of SpeI, XhoI, and XbaI fragments separated by pulsed-field gel electrophoresis. All restriction fragments (a total of 113) were mapped into an open circle. The main difficulty in mapping involved the exceedingly high number of restriction fragments, as was expected considering the 59% G + C content of the Brucella genome. Several cloned genes were placed on this map, especially rRNA operons which are repeated three times. The size of the B. melitensis chromosome, estimated as 2,600 kb long in a previous study, appeared longer (3,130 kb) by restriction mapping. This restriction map is an initial approach to achieve a genetic map of the Brucella chromosome. Images PMID:2007548

Establishing paternity in Whooping Cranes (Grus americana) by DNA analysis

USGS Publications Warehouse

Longmire, Jonathan L.; Gee, George F.; Hardekopf, C.L.; Mark, G.A.

1992-01-01

DNA fingerprinting was used to study paternity and genetic variability within a captive flock of Whooping Cranes (Grus americana). Fingerprint patterns for 42 individuals were obtained by digesting genomic crane DNAs with HaeIII followed by electrophoresis, blotting, and hybridization to the M13 minisatellite probe. Despite finding reduced levels of genetic variation in the Whooping Crane due to a population "bottleneck," these polymorphisms were successfully used to determine paternity in six of seven cases of captive propagation where the maternal-offspring relationship was known, but where the sire was unknown. These determinations of paternity are required for effective genetic management of the crane flock. These results also revealed a number of heterozygous minisatellite loci that will be valuable in future assessments of genetic variability in this endangered species.

[Determination of mRNA-transcripts and heat shock proteins HSP70 and HSP90 in retina of the adult Spanish Ribbed Newt Pleurodeles waltl].

PubMed

Avdonin, P P; Markitantova, Yu V; Poplinskaya, V A; Grigoryan, E N

2013-01-01

Expression of genes and heat shock proteins in normal intact retina of the Spanish Ribbed Newt Pleurodeles waltl was studied using polymerase chain reaction, Western blot hybridization, and immunohistochemistry. It was shown that the proteins HSP70 and HSP90, as well as their encoding transcripts of relevant genes, are constitutively expressed in eye tissues. These proteins were distributed differentially, and they were characterized by expression of different levels in the retina: HSP70 dominated in the external retina, while HSP90 dominated in the internal one, in particular, in Muller glial cells and the optic nerve. Transcripts and heat shock proteins HSP70 and HSP90 were also found in the retinal pigment epithelium and eye growth zone.

Modulation of airway epithelial cell functions by Pidotimod: NF-kB cytoplasmatic expression and its nuclear translocation are associated with an increased TLR-2 expression

PubMed Central

2013-01-01

Background Recurrent respiratory infections are one of the most important causes of morbidity in childhood. When immune functions are still largely immature, the airway epithelium plays a primary defensive role since, besides providing a physical barrier, it is also involved in the innate and the adaptive immune responses. A study was therefore designed to evaluate in vitro whether pidotimod, a synthetic dipeptide able to stimulate the inflammatory and immune effector cells, could activate bronchial epithelial cell functions involved in response to infections. Methods BEAS-2B cell line (human bronchial epithelial cells infected with a replication-defective Adenovirus 12-SV40 virus hybrid) were cultured in the presence of pidotimod, with or without tumor necrosis factor (TNF)-α or zymosan to assess: a) intercellular adhesion molecule (ICAM)-1 expression, by flow cytometry; b) toll-like receptor (TLR)-2 expression and production, by immunofluorescence flow cytometry and western blotting; d) interleukin (IL)-8 release, by enzyme-linked immunosorbent assay (ELISA); e) activated extracellular-signal-regulated kinase (ERK1/2) phosphorylation and nuclear factor-kappa B (NF-kB) activation, by western blotting. Results The constitutive expression of ICAM-1 and IL-8 release were significant up-regulated by TNF-α (ICAM-1) and by TNF-α and zymosan (IL-8), but not by pidotimod. In contrast, an increased TLR-2 expression was found after exposure to pidotimod 10 and 100 μg/ml (p < 0.05) and to the association pidotimod 100 μg/ml + TNF-α (p < 0.05). Western blot analysis substantiated that the constitutive TLR-2 expression was significantly increased after exposure to all the stimuli. Finally, while a remarkable inhibition of TNF-α -induced ERK1/2 phosphorylation was observed in the presence of pidotimod, both TNF-α and pidotimod were effective in inducing NF-kB protein expression in the cytoplasm and its nuclear translocation. Conclusion Through different effects on ERK1/2 and NF-kB, pidotimod was able to increase the expression of TLR-2 proteins, surface molecules involved in the initiation of the innate response to infectious stimuli. The lack of effect on ICAM-1 expression, the receptor for rhinovirus, and on IL-8 release, the potent chemotactic factor for neutrophils (that are already present in sites of infection), may represent protective functions. If confirmed in vivo, these activities may, at least in part, clarify the mechanism of action of this molecule at airway level. PMID:23663325

An efficient method for hybrid density functional calculation with spin-orbit coupling

NASA Astrophysics Data System (ADS)

Wang, Maoyuan; Liu, Gui-Bin; Guo, Hong; Yao, Yugui

2018-03-01

In first-principles calculations, hybrid functional is often used to improve accuracy from local exchange correlation functionals. A drawback is that evaluating the hybrid functional needs significantly more computing effort. When spin-orbit coupling (SOC) is taken into account, the non-collinear spin structure increases computing effort by at least eight times. As a result, hybrid functional calculations with SOC are intractable in most cases. In this paper, we present an approximate solution to this problem by developing an efficient method based on a mixed linear combination of atomic orbital (LCAO) scheme. We demonstrate the power of this method using several examples and we show that the results compare very well with those of direct hybrid functional calculations with SOC, yet the method only requires a computing effort similar to that without SOC. The presented technique provides a good balance between computing efficiency and accuracy, and it can be extended to magnetic materials.

Structure and weights optimisation of a modified Elman network emotion classifier using hybrid computational intelligence algorithms: a comparative study

NASA Astrophysics Data System (ADS)

Sheikhan, Mansour; Abbasnezhad Arabi, Mahdi; Gharavian, Davood

2015-10-01

Artificial neural networks are efficient models in pattern recognition applications, but their performance is dependent on employing suitable structure and connection weights. This study used a hybrid method for obtaining the optimal weight set and architecture of a recurrent neural emotion classifier based on gravitational search algorithm (GSA) and its binary version (BGSA), respectively. By considering the features of speech signal that were related to prosody, voice quality, and spectrum, a rich feature set was constructed. To select more efficient features, a fast feature selection method was employed. The performance of the proposed hybrid GSA-BGSA method was compared with similar hybrid methods based on particle swarm optimisation (PSO) algorithm and its binary version, PSO and discrete firefly algorithm, and hybrid of error back-propagation and genetic algorithm that were used for optimisation. Experimental tests on Berlin emotional database demonstrated the superior performance of the proposed method using a lighter network structure.

Spatially extended hybrid methods: a review

PubMed Central

2018-01-01

Many biological and physical systems exhibit behaviour at multiple spatial, temporal or population scales. Multiscale processes provide challenges when they are to be simulated using numerical techniques. While coarser methods such as partial differential equations are typically fast to simulate, they lack the individual-level detail that may be required in regions of low concentration or small spatial scale. However, to simulate at such an individual level throughout a domain and in regions where concentrations are high can be computationally expensive. Spatially coupled hybrid methods provide a bridge, allowing for multiple representations of the same species in one spatial domain by partitioning space into distinct modelling subdomains. Over the past 20 years, such hybrid methods have risen to prominence, leading to what is now a very active research area across multiple disciplines including chemistry, physics and mathematics. There are three main motivations for undertaking this review. Firstly, we have collated a large number of spatially extended hybrid methods and presented them in a single coherent document, while comparing and contrasting them, so that anyone who requires a multiscale hybrid method will be able to find the most appropriate one for their need. Secondly, we have provided canonical examples with algorithms and accompanying code, serving to demonstrate how these types of methods work in practice. Finally, we have presented papers that employ these methods on real biological and physical problems, demonstrating their utility. We also consider some open research questions in the area of hybrid method development and the future directions for the field. PMID:29491179

Light-transmittance predictions under multiple-light-scattering conditions. I. Direct problem: hybrid-method approximation.

PubMed

Czerwiński, M; Mroczka, J; Girasole, T; Gouesbet, G; Gréhan, G

2001-03-20

Our aim is to present a method of predicting light transmittances through dense three-dimensional layered media. A hybrid method is introduced as a combination of the four-flux method with coefficients predicted from a Monte Carlo statistical model to take into account the actual three-dimensional geometry of the problem under study. We present the principles of the hybrid method, some exemplifying results of numerical simulations, and their comparison with results obtained from Bouguer-Lambert-Beer law and from Monte Carlo simulations.

Fast Construction of Near Parsimonious Hybridization Networks for Multiple Phylogenetic Trees.

PubMed

Mirzaei, Sajad; Wu, Yufeng

2016-01-01

Hybridization networks represent plausible evolutionary histories of species that are affected by reticulate evolutionary processes. An established computational problem on hybridization networks is constructing the most parsimonious hybridization network such that each of the given phylogenetic trees (called gene trees) is "displayed" in the network. There have been several previous approaches, including an exact method and several heuristics, for this NP-hard problem. However, the exact method is only applicable to a limited range of data, and heuristic methods can be less accurate and also slow sometimes. In this paper, we develop a new algorithm for constructing near parsimonious networks for multiple binary gene trees. This method is more efficient for large numbers of gene trees than previous heuristics. This new method also produces more parsimonious results on many simulated datasets as well as a real biological dataset than a previous method. We also show that our method produces topologically more accurate networks for many datasets.

A single-step simultaneous protein staining procedure for polyacrylamide gels and nitrocellulose membranes by Alta during western blot analysis.

PubMed

Pal, Jayanta K; Berwal, Sunil K; Soni, Rupali N

2012-01-01

A simple method for staining of proteins simultaneously on sodium dodecyl sulfate (SDS) polyacrylamide gels and nitrocellulose membranes by Alta during western blot analysis is described. A 5% solution of Alta, a commercially available cosmetic preparation, is added in the upper tank buffer during electrophoresis. On completion of electrophoresis, the gel is washed in distilled water and viewed on a white light plate and a transilluminator to photograph the protein profiles. The gel is processed for western blot transfer of proteins onto a nitrocellulose membrane, and upon completion, the protein profiles on the membrane are viewed and photographed as stated above. The membrane can then be processed for immunostaining as per the standard procedure. Thus, the staining procedure using Alta is simple, rapid (without any need of destaining), and cost-effective.

Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

2000-01-01

A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

Hybrid-DFT  +  V w method for band structure calculation of semiconducting transition metal compounds: the case of cerium dioxide.

PubMed

Ivády, Viktor; Gali, Adam; Abrikosov, Igor A

2017-11-15

Hybrid functionals' non-local exchange-correlation potential contains a derivative discontinuity that improves on standard semi-local density functional theory (DFT) band gaps. Moreover, by careful parameterization, hybrid functionals can provide self-interaction reduced description of selected states. On the other hand, the uniform description of all the electronic states of a given system is a known drawback of these functionals that causes varying accuracy in the description of states with different degrees of localization. This limitation can be remedied by the orbital dependent exact exchange extension of hybrid functionals; the hybrid-DFT  +  V w method (Ivády et al 2014 Phys. Rev. B 90 035146). Based on the analogy of quasi-particle equations and hybrid-DFT single particle equations, here we demonstrate that parameters of hybrid-DFT  +  V w functional can be determined from approximate theoretical quasi-particle spectra without any fitting to experiment. The proposed method is illustrated on the charge self-consistent electronic structure calculation for cerium dioxide where itinerant valence states interact with well-localized 4f atomic like states, making this system challenging for conventional methods, either hybrid-DFT or LDA  +  U, and therefore allowing for a demonstration of the advantages of the proposed scheme.

Enhanced Iron Uptake of Saccharomyces cerevisiae by Heterologous Expression of a Tadpole Ferritin Gene

PubMed Central

Shin, Young-Mi; Kwon, Tae-Ho; Kim, Kyung-Suk; Chae, Keon-Sang; Kim, Dae-Hyuk; Kim, Jae-Ho; Yang, Moon-Sik

2001-01-01

We genetically engineered Saccharomyces cerevisiae to express ferritin, a ubiquitous iron storage protein, with the major heavy-chain subunit of tadpole ferritin. A 450-kDa ferritin complex can store up to 4,500 iron atoms in its central cavity. We cloned the tadpole ferritin heavy-chain gene (TFH) into the yeast shuttle vector YEp352 under the control of a hybrid alcohol dehydrogenase II and glyceraldehyde-3-phosphate dehydrogenase promoter. We confirmed transformation and expression by Northern blot analysis of the recombinant yeast, by Western blot analysis using an antibody against Escherichia coli-expressed TFH, and with Prussian blue staining that indicated that the yeast-expressed tadpole ferritin was assembled into a complex that could bind iron. The recombinant yeast was more iron tolerant in that 95% of transformed cells, but none of the recipient strain cells, could form colonies on plates containing 30 mM ferric citrate. The cell-associated concentration of iron was 500 μg per gram (dry cell weight) of the recombinant yeast but was 210 μg per gram (dry cell weight) in the wild type. These findings indicate that the iron-carrying capacity of yeast is improved by heterologous expression of tadpole ferritin and suggests that this approach may help relieve dietary iron deficiencies in domesticated animals by the use of the engineered yeast as a feed and food supplement. PMID:11229922

Expression of hemagglutinin protein of Rinderpest virus in transgenic pigeon pea [Cajanus cajan (L.) Millsp.] plants.

PubMed

Satyavathi, V V; Prasad, V; Khandelwal, Abha; Shaila, M S; Sita, G Lakshmi

2003-03-01

Rinderpest virus is the causative agent of a devastating, often fatal disease in wild and domestic bovids that is endemic in Africa, the Middle East and South Asia. The existing live attenuated vaccine is heat-labile, and thus there is a need for the development of new strategies for vaccination. This paper reports the development of transgenic pigeon pea [ Cajanus cajun (L.) Millsp.] expressing one of the protective antigens, the hemagglutinin (H) protein of Rinderpest virus. A 2-kb fragment containing the coding region of the H protein was cloned into pBI121 and mobilized into Agrobacterium tumefaciensstrain EHA105. Embryonic axes and cotyledonary nodes from germinated seeds of pigeon pea were used for transformation. The presence of the transgene in transgenic plants was confirmed by Southern blots, and the specific transcription of the marker gene in the plants was demonstrated by reverse transcription-polymerase chain reaction. Integration of the H gene into the pigeon pea genome was confirmed by Southern hybridization. The expression of the H protein in the transgenic lines was confirmed by Western blot analysis using a polyclonal monospecific antibody to the H protein. The highest level of expression of the hemagglutinin protein in leaves of pigeon pea was 0.49% of the total soluble protein. The transgenic plants were fertile and the transgene expressed in the progeny.

Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

PubMed

Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

2013-10-01

Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

The gene expression database for mouse development (GXD): putting developmental expression information at your fingertips.

PubMed

Smith, Constance M; Finger, Jacqueline H; Kadin, James A; Richardson, Joel E; Ringwald, Martin

2014-10-01

Because molecular mechanisms of development are extraordinarily complex, the understanding of these processes requires the integration of pertinent research data. Using the Gene Expression Database for Mouse Development (GXD) as an example, we illustrate the progress made toward this goal, and discuss relevant issues that apply to developmental databases and developmental research in general. Since its first release in 1998, GXD has served the scientific community by integrating multiple types of expression data from publications and electronic submissions and by making these data freely and widely available. Focusing on endogenous gene expression in wild-type and mutant mice and covering data from RNA in situ hybridization, in situ reporter (knock-in), immunohistochemistry, reverse transcriptase-polymerase chain reaction, Northern blot, and Western blot experiments, the database has grown tremendously over the years in terms of data content and search utilities. Currently, GXD includes over 1.4 million annotated expression results and over 260,000 images. All these data and images are readily accessible to many types of database searches. Here we describe the data and search tools of GXD; explain how to use the database most effectively; discuss how we acquire, curate, and integrate developmental expression information; and describe how the research community can help in this process. Copyright © 2014 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

Diversity of ndo Genes in Mangrove Sediments Exposed to Different Sources of Polycyclic Aromatic Hydrocarbon Pollution▿

PubMed Central

Gomes, Newton C. Marcial; Borges, Ludmila R.; Paranhos, Rodolfo; Pinto, Fernando N.; Krögerrecklenfort, Ellen; Mendonça-Hagler, Leda C. S.; Smalla, Kornelia

2007-01-01

Polycyclic aromatic hydrocarbon (PAH) pollutants originating from oil spills and wood and fuel combustion are pollutants which are among the major threats to mangrove ecosystems. In this study, the composition and relative abundance in the sediment bacterial communities of naphthalene dioxygenase (ndo) genes which are important for bacterial adaptation to environmental PAH contamination were investigated. Three urban mangrove sites which had characteristic compositions and levels of PAH compounds in the sediments were selected. The diversity and relative abundance of ndo genes in total community DNA were assessed by a newly developed ndo denaturing gradient gel electrophoresis (DGGE) approach and by PCR amplification with primers targeting ndo genes with subsequent Southern blot hybridization analyses. Bacterial populations inhabiting sediments of urban mangroves under the impact of different sources of PAH contamination harbor distinct ndo genotypes. Sequencing of cloned ndo amplicons comigrating with dominant DGGE bands revealed new ndo genotypes. PCR-Southern blot analysis and ndo DGGE showed that the frequently studied nah and phn genotypes were not detected as dominant ndo types in the mangrove sediments. However, ndo genotypes related to nagAc-like genes were detected, but only in oil-contaminated mangrove sediments. The long-term impact of PAH contamination, together with the specific environmental conditions at each site, may have affected the abundance and diversity of ndo genes in sediments of urban mangroves. PMID:17905873

Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

NASA Technical Reports Server (NTRS)

Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

1993-01-01

An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

PubMed Central

Kubo, Kyoko; Lloyd, Karen G; F Biddle, Jennifer; Amann, Rudolf; Teske, Andreas; Knittel, Katrin

2012-01-01

Members of the highly diverse Miscellaneous Crenarchaeotal Group (MCG) are globally distributed in various marine and continental habitats. In this study, we applied a polyphasic approach (rRNA slot blot hybridization, quantitative PCR (qPCR) and catalyzed reporter deposition FISH) using newly developed probes and primers for the in situ detection and quantification of MCG crenarchaeota in diverse types of marine sediments and microbial mats. In general, abundance of MCG (cocci, 0.4 μm) relative to other archaea was highest (12–100%) in anoxic, low-energy environments characterized by deeper sulfate depletion and lower microbial respiration rates (P=0.06 for slot blot and P=0.05 for qPCR). When studied in high depth resolution in the White Oak River estuary and Hydrate Ridge methane seeps, changes in MCG abundance relative to total archaea and MCG phylogenetic composition did not correlate with changes in sulfate reduction or methane oxidation with depth. In addition, MCG abundance did not vary significantly (P>0.1) between seep sites (with high rates of methanotrophy) and non-seep sites (with low rates of methanotrophy). This suggests that MCG are likely not methanotrophs. MCG crenarchaeota are highly diverse and contain 17 subgroups, with a range of intragroup similarity of 82 to 94%. This high diversity and widespread distribution in subsurface sediments indicates that this group is globally important in sedimentary processes. PMID:22551871

Pathogenic role of mtDNA duplications in mitochondrial diseases associated with mtDNA deletions.

PubMed

Odoardi, Francesca; Rana, Michele; Broccolini, Aldobrando; Mirabella, Massimiliano; Modoni, Anna; D'Amico, Adele; Papacci, Manuela; Tonali, Pietro; Servidei, Serenella; Silvestri, Gabriella

2003-04-30

We estimated the frequency of multiple mtDNA rearrangements by Southern blot in 32 patients affected by mitochondrial disorders associated with single deletions in order to assess genotype-phenotype correlations and elucidate the pathogenic significance of mtDNA duplications. Muscle in situ hybridization studies were performed in patients showing mtDNA duplications at Southern blot. We found multiple rearrangements in 12/32 (37.5%) patients; in particular, mtDNA duplications were detected in 4/4 Kearns-Sayre syndrome (KSS), in 1 Pearson's syndrome, in 1/3 encephalomyopathies with progressive external ophthalmoplegia (PEO), and in 2/23 PEO. In situ studies documented an exclusive accumulation of deleted mtDNAs in cytochrome c oxidase negative fibers of patients with mtDNA duplications. The presence of mtDNA duplications significantly correlated with onset of symptoms before age 15 and occurrence of clinical multisystem involvement. Analysis of biochemical data documented a predominant reduction of complex III in patients without duplications compared to patients with mtDNA duplications. Our data indicate that multiple mtDNA rearrangements are detectable in a considerable proportion of patients with single deletions and that mtDNA duplications do not cause any oxidative impairment. They more likely play a pathogenic role in the determination of clinical expression of mitochondrial diseases associated with single mtDNA deletions, possibly generating deleted mtDNAs in embryonic tissues by homologous recombination. Copyright 2003 Wiley-Liss, Inc.

Psoriasin (S100A7) Expression and Invasive Breast Cancer

PubMed Central

Al-Haddad, Sahar; Zhang, Zi; Leygue, Etienne; Snell, Linda; Huang, Aihua; Niu, Yulian; Hiller-Hitchcock, Tamara; Hole, Kate; Murphy, Leigh C.; Watson, Peter H.

1999-01-01

Alteration of psoriasin (S100A7) expression has previously been identified in association with the transition from preinvasive to invasive breast cancer. In this study we have examined persistence of psoriasin mRNA and protein expression in relation to prognostic factors in a cohort of 57 invasive breast tumors, comprising 34 invasive ductal carcinomas and 23 other invasive tumor types (lobular, mucinous, medullary, tubular). We first developed an IgY polyclonal chicken antibody and confirmed specificity for psoriasin by Western blot in transfected cells and tumors. The protein was localized by immunohistochemistry predominantly to epithelial cells, with both nuclear and cytoplasmic staining, as well as occasional stromal cells in psoriatic skin and breast tumors; however, in situ hybridization showed that psoriasin mRNA expression was restricted to epithelial cells. In breast tumors, higher levels of psoriasin measured by reverse transcriptase-polymerase chain reaction and Western blot (93% concordance) were significantly associated with estrogen and progesterone receptor-negative status (P < 0.0001, P = 0.0003), and with nodal metastasis in invasive ductal tumors (P = 0.035), but not with tumor type or grade. Psoriasin expression also correlated with inflammatory infiltrates (all tumors excluding medullary, P = 0.0022). These results suggest that psoriasin may be a marker of aggressive behavior in invasive tumors and are consistent with a function as a chemotactic factor. PMID:10595935

Seroprevalence of bovine immunodeficiency virus and bovine leukemia virus in draught animals in Cambodia.

PubMed

Meas, S; Ohashi, K; Tum, S; Chhin, M; Te, K; Miura, K; Sugimoto, C; Onuma, M

2000-07-01

Since bovine immunodeficiency virus (BIV), known as bovine lentivirus, has been detected in dairy and beef cattle in various countries around the world, a prevalence study of antibodies to BIV and bovine leukemia virus (BLV) was conducted in draught animals in five provinces in Cambodia, where protozoan parasite infections were suspected in some animals. To clarify the status of draught animals including Haryana, Brahman, mixed-breed, local breed cattle and muscle water buffaloes, a total of 544 cattle and 42 buffaloes were tested, and 26.3 and 16.7%, respectively, were found positive for anti-BIV p26 antibodies determined by Western blotting. There were 5.3% positive for anti-BLV antibodies detected by immunodiffusion test among the cattle, but no reactors among buffaloes and no dual infection for both BIV and BLV was determined in this study. Peripheral blood mononuclear cells from BIV-seropositive cattle were found to have BIV-provirus DNA, as detected by polymerase chain reaction and subsequent Southern blot hybridization. This is the first evidence for the presence of BIV and BLV infections in draught animals in tropical countries such as Cambodia. This wide distribution of BIV suggests its association with problems in animal health as reported worldwide, and that a primary BIV infection can predispose death of affected animals by other aggressive pathogens or stresses.

Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

PubMed

Sasaya, T; Ishikawa, K; Koganezawa, H

2001-06-01

A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

Design and synthesis of organic-inorganic hybrid capsules for biotechnological applications.

PubMed

Shi, Jiafu; Jiang, Yanjun; Wang, Xiaoli; Wu, Hong; Yang, Dong; Pan, Fusheng; Su, Yanlei; Jiang, Zhongyi

2014-08-07

Organic-inorganic hybrid capsules, which typically possess a hollow lumen and a hybrid wall, have emerged as a novel and promising class of hybrid materials and have attracted enormous attention. In comparison to polymeric capsules or inorganic capsules, the hybrid capsules combine the intrinsic physical/chemical properties of the organic and inorganic moieties, acquire more degrees of freedom to manipulate multiple interactions, create hierarchical structures and integrate multiple functionalities. Thus, the hybrid capsules exhibit superior mechanical strength (vs. polymeric capsules) and diverse functionalities (vs. inorganic capsules), which may give new opportunities to produce high-performance materials. Much effort has been devoted to exploring innovative and effective methods for the synthesis of hybrid capsules that exhibit desirable performance in target applications. This tutorial review firstly presents a brief description of the capsular structure and hybrid materials in nature, then classifies the hybrid capsules into molecule-hybrid capsules and nano-hybrid capsules based upon the size of the organic and inorganic moieties in the capsule wall, followed by a detailed discussion of the design and synthesis of the hybrid capsules. For each kind of hybrid capsule, the state-of-the-art synthesis methods are described in detail and a critical comment is embedded. The applications of these hybrid capsules in biotechnological areas (biocatalysis, drug delivery, etc.) have also been summarized. Hopefully, this review will offer a perspective and guidelines for the future research and development of hybrid capsules.

A modified hybrid uncertain analysis method for dynamic response field of the LSOAAC with random and interval parameters

NASA Astrophysics Data System (ADS)

Zi, Bin; Zhou, Bin

2016-07-01

For the prediction of dynamic response field of the luffing system of an automobile crane (LSOAAC) with random and interval parameters, a hybrid uncertain model is introduced. In the hybrid uncertain model, the parameters with certain probability distribution are modeled as random variables, whereas, the parameters with lower and upper bounds are modeled as interval variables instead of given precise values. Based on the hybrid uncertain model, the hybrid uncertain dynamic response equilibrium equation, in which different random and interval parameters are simultaneously included in input and output terms, is constructed. Then a modified hybrid uncertain analysis method (MHUAM) is proposed. In the MHUAM, based on random interval perturbation method, the first-order Taylor series expansion and the first-order Neumann series, the dynamic response expression of the LSOAAC is developed. Moreover, the mathematical characteristics of extrema of bounds of dynamic response are determined by random interval moment method and monotonic analysis technique. Compared with the hybrid Monte Carlo method (HMCM) and interval perturbation method (IPM), numerical results show the feasibility and efficiency of the MHUAM for solving the hybrid LSOAAC problems. The effects of different uncertain models and parameters on the LSOAAC response field are also investigated deeply, and numerical results indicate that the impact made by the randomness in the thrust of the luffing cylinder F is larger than that made by the gravity of the weight in suspension Q . In addition, the impact made by the uncertainty in the displacement between the lower end of the lifting arm and the luffing cylinder a is larger than that made by the length of the lifting arm L .

Hybrid spread spectrum radio system

DOEpatents

Smith, Stephen F [London, TN; Dress, William B [Camas, WA

2010-02-09

Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.

Dot-Blot Immunoassay of Fasciola gigantica Infection using 27 kDa and Adult Worm Regurge Antigens in Egyptian Patients

PubMed Central

Kamel, Hanan H.; Saad, Ghada A.

2013-01-01

The purpose of the present study was to evaluate the potential role of the 27-Kilodalton (KDa) antigen versus Fasciola gigantica adult worm regurge antigens in a DOT-Blot assay and to assess this assay as a practical tool for diagnosis fascioliasis in Egyptian patients. Fasciola gigantica antigen of an approximate molecular mass 27-(KDa) was obtained from adult worms by a simple elution SDS-PAGE. A Dot-Blot was developed comparatively to adult worm regurge antigens for the detection of specific antibodies from patients infected with F. gigantica in Egypt. Control sera were obtained from patients with other parasitic infections and healthy volunteers to assess the test and compare between the antigens. The sensitivity, specificity, positive and negative predictive values of Dot-Blot using the adult worm regurge were 80%, 90%, 94.1%, and 69.2% respectively, while those using 27-KDa were 100% which confirms the diagnostic potential of this antigen. All patients infected with Fasciola were positive, with cross reactivity reported with Schistosoma mansoni serum samples. This 27-KDa Dot-Blot assay showed to be a promising test which can be used for serodiagnosis of fascioliasis in Egyptian patients especially, those presenting with hepatic disease. It is specific, sensitive and easy to perform method for the rapid diagnosis particularly when more complex laboratory tests are unavailable. PMID:23710084

Dot-blot immunoassay of Fasciola gigantica infection using 27 kDa and adult worm regurge antigens in Egyptian patients.

PubMed

Kamel, Hanan H; Saad, Ghada A; Sarhan, Rania M

2013-04-01

The purpose of the present study was to evaluate the potential role of the 27-Kilodalton (KDa) antigen versus Fasciola gigantica adult worm regurge antigens in a DOT-Blot assay and to assess this assay as a practical tool for diagnosis fascioliasis in Egyptian patients. Fasciola gigantica antigen of an approximate molecular mass 27-(KDa) was obtained from adult worms by a simple elution SDS-PAGE. A Dot-Blot was developed comparatively to adult worm regurge antigens for the detection of specific antibodies from patients infected with F. gigantica in Egypt. Control sera were obtained from patients with other parasitic infections and healthy volunteers to assess the test and compare between the antigens. The sensitivity, specificity, positive and negative predictive values of Dot-Blot using the adult worm regurge were 80%, 90%, 94.1%, and 69.2% respectively, while those using 27-KDa were 100% which confirms the diagnostic potential of this antigen. All patients infected with Fasciola were positive, with cross reactivity reported with Schistosoma mansoni serum samples. This 27-KDa Dot-Blot assay showed to be a promising test which can be used for serodiagnosis of fascioliasis in Egyptian patients especially, those presenting with hepatic disease. It is specific, sensitive and easy to perform method for the rapid diagnosis particularly when more complex laboratory tests are unavailable.

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

The combination of quantitative PCR and western blot detecting CP4-EPSPS component in Roundup Ready soy plant tissues and commercial soy-related foodstuffs.

PubMed

Xiao, Xiao; Wu, Honghong; Zhou, Xinghu; Xu, Sheng; He, Jian; Shen, Wenbiao; Zhou, Guanghong; Huang, Ming

2012-06-01

With the widespread use of Roundup Ready soy (event 40-3-2) (RRS), the comprehensive detection of genetically modified component in foodstuffs is of significant interest, but few protein-based approaches have been found useful in processed foods. In this report, the combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different RRS plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing both meat and plant protein concentrates. The validity of the 2 methods was confirmed first. We also showed that the CP4-EPSPS protein existed in different RRS plant tissues. In certain cases, the results from the western blot and the qPCR were not consistent. To be specific, at least 2 degraded fragments of CP4-EPSPS protein (35.5 and 24.6 kDa) were observed. For dried bean curd crust and deep-fried bean curd, a degraded protein fragment with the size of 24.6 kDa appeared, while cp4-epsps gene could not be traced by qPCR. In contrast, we found a signal of cp4-epsps DNA in 3 foodstuffs, including soy-containing ham cutlet product, meat ball, and sausage by qPCR, while CP4-EPSPS protein could not be detected by western blot in such samples. Our study therefore concluded that the combination of DNA- and protein-based methods would compensate each other, thus resulting in a more comprehensive detection from nucleic acid and protein levels. The combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different Roundup Ready soy (event 40-3-2) plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing a combination of both meat and plant protein concentrates. This study indicated that the combination of DNA- and protein-based methods would supplement each other for genetically modified detection from nucleic acid and protein levels. Accordingly, qPCR and western blot could be used in CP4-EPSPS detection in a wide variety of soy-related foodstuffs. © 2012 Institute of Food Technologists®

Hybrid statistics-simulations based method for atom-counting from ADF STEM images.

PubMed

De Wael, Annelies; De Backer, Annick; Jones, Lewys; Nellist, Peter D; Van Aert, Sandra

2017-06-01

A hybrid statistics-simulations based method for atom-counting from annular dark field scanning transmission electron microscopy (ADF STEM) images of monotype crystalline nanostructures is presented. Different atom-counting methods already exist for model-like systems. However, the increasing relevance of radiation damage in the study of nanostructures demands a method that allows atom-counting from low dose images with a low signal-to-noise ratio. Therefore, the hybrid method directly includes prior knowledge from image simulations into the existing statistics-based method for atom-counting, and accounts in this manner for possible discrepancies between actual and simulated experimental conditions. It is shown by means of simulations and experiments that this hybrid method outperforms the statistics-based method, especially for low electron doses and small nanoparticles. The analysis of a simulated low dose image of a small nanoparticle suggests that this method allows for far more reliable quantitative analysis of beam-sensitive materials. Copyright © 2017 Elsevier B.V. All rights reserved.

Genotype-independent and enhanced in planta Agrobacterium tumefaciens-mediated genetic transformation of peanut [Arachis hypogaea (L.)].

PubMed

Karthik, Sivabalan; Pavan, Gadamchetty; Sathish, Selvam; Siva, Ramamoorthy; Kumar, Periyasamy Suresh; Manickavasagam, Markandan

2018-04-01

Agrobacterium infection and regeneration of the putatively transformed plant from the explant remains arduous for some crop species like peanut. Henceforth, a competent and reproducible in planta genetic transformation protocol is established for peanut cv. CO7 by standardizing various factors such as pre-culture duration, acetosyringone concentration, duration of co-cultivation, sonication and vacuum infiltration. In the present investigation, Agrobacterium tumefaciens strain EHA105 harboring the binary vector pCAMBIA1301- bar was used for transformation. The two-stage selection was carried out using 4 and 250 mg l -1 BASTA ® to completely eliminate the chimeric and non-transformed plants. The transgene integration into plant genome was evaluated by GUS histochemical assay, polymerase chain reaction (PCR), and Southern blot hybridization. Among the various combinations and concentrations analyzed, highest transformation efficiency was obtained when the 2-day pre-cultured explants were subjected to sonication for 6 min and vacuum infiltrated for 3 min in Agrobacterium suspension, and co-cultivated on MS medium supplemented with 150 µM acetosyringone for 3 days. The fidelity of the standardized in planta transformation method was assessed in five peanut cultivars and all the cultivars responded positively with a transformation efficiency ranging from minimum 31.3% (with cv. CO6) to maximum 38.6% (with cv. TMV7). The in planta transformation method optimized in this study could be beneficial to develop superior peanut cultivars with desirable genetic traits.

Detection of human papillomavirus and Epstein-Barr virus DNA sequences in oral mucosa of HIV-infected patients by the polymerase chain reaction.

PubMed Central

Snijders, P. J.; Schulten, E. A.; Mullink, H.; ten Kate, R. W.; Jiwa, M.; van der Waal, I.; Meijer, C. J.; Walboomers, J. M.

1990-01-01

The presence of human papillomavirus (HPV) and Epstein-Barr virus (EBV) was analyzed in 21 oral biopsy specimens of HIV-infected patients using the polymerase chain reaction (PCR) method. Biopsies were categorized as hairy leukoplakia (HL) (n = 12), candidiasis (n = 3), oral warts (n = 2), and clinically normal epithelium (n = 4). For HPV detection a modified general primer-mediated PCR method (GP-PCR), which detects a broad spectrum of HPV genotypes at sub-picogram levels, was used. Human papillomavirus DNA was only found in two oral warts and was identified as HPV type 32. Epstein-Barr virus DNA was detected in 16 biopsy specimens, including the 12 HLs, 2 cases of candidiasis, and 2 samples of normal epithelium. Epstein-Barr virus positivity in HL could be confirmed by Southern blot analysis and DNA in situ hybridization using biotinylated DNA probes (bio-DISH). Epstein-Barr virus bio-DISH was also positive in one sample of normal epithelium from a patient with HL. The results indicate that HL is strongly associated with EBV and not with any of the common HPV types that react with general HPV primers in the PCR. However the detection of EBV in normal oral epithelium by PCR and bio-DISH suggests that the presence of this virus is not exclusively related to HL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2169191

Soldier caste-specific gene expression in the mandibular glands of Hodotermopsis japonica (Isoptera: Termopsidae)

PubMed Central

Miura, Toru; Kamikouchi, Azusa; Sawata, Miyuki; Takeuchi, Hideaki; Natori, Syunji; Kubo, Takeo; Matsumoto, Tadao

1999-01-01

Although “polymorphic castes” in social insects are well known as one of the most important phenomena of polyphenism, few studies of caste-specific gene expressions have been performed in social insects. To identify genes specifically expressed in the soldier caste of the Japanese damp-wood termite Hodotermopsis japonica, we employed the differential-display method using oligo(dT) and arbitrary primers, compared mRNA from the heads of mature soldiers and pseudergates (worker caste), and identified a clone (PCR product) 329 bp in length termed SOL1. Northern blot analysis showed that the SOL1 mRNA is about 1.0 kb in length and is expressed specifically in mature soldiers, but not in pseudergates, even in the presoldier induction by juvenile hormone analogue, suggesting that the product is specific for terminally differentiated soldiers. By using the method of 5′- and 3′-rapid amplification of cDNA ends, we isolated the full length of SOL1 cDNA, which contained an ORF with a putative signal peptide at the N terminus. The sequence showed no significant homology with any other known protein sequences. In situ hybridization analysis showed that SOL1 is expressed specifically in the mandibular glands. These results strongly suggest that the SOL1 gene encodes a secretory protein specifically synthesized in the mandibular glands of the soldiers. Histological observations revealed that the gland actually develops during the differentiation into the soldier caste. PMID:10570166

Battery control system for hybrid vehicle and method for controlling a hybrid vehicle battery

DOEpatents

Bockelmann, Thomas R [Battle Creek, MI; Hope, Mark E [Marshall, MI; Zou, Zhanjiang [Battle Creek, MI; Kang, Xiaosong [Battle Creek, MI

2009-02-10

A battery control system for hybrid vehicle includes a hybrid powertrain battery, a vehicle accessory battery, and a prime mover driven generator adapted to charge the vehicle accessory battery. A detecting arrangement is configured to monitor the vehicle accessory battery's state of charge. A controller is configured to activate the prime mover to drive the generator and recharge the vehicle accessory battery in response to the vehicle accessory battery's state of charge falling below a first predetermined level, or transfer electrical power from the hybrid powertrain battery to the vehicle accessory battery in response to the vehicle accessory battery's state of charge falling below a second predetermined level. The invention further includes a method for controlling a hybrid vehicle powertrain system.

A Sub-filter Scale Noise Equation far Hybrid LES Simulations

NASA Technical Reports Server (NTRS)

Goldstein, Marvin E.

2006-01-01

Hybrid LES/subscale modeling approaches have an important advantage over the current noise prediction methods in that they only involve modeling of the relatively universal subscale motion and not the configuration dependent larger scale turbulence . Previous hybrid approaches use approximate statistical techniques or extrapolation methods to obtain the requisite information about the sub-filter scale motion. An alternative approach would be to adopt the modeling techniques used in the current noise prediction methods and determine the unknown stresses from experimental data. The present paper derives an equation for predicting the sub scale sound from information that can be obtained with currently available experimental procedures. The resulting prediction method would then be intermediate between the current noise prediction codes and previously proposed hybrid techniques.

The expression of MDM2/CDK4 gene product in the differential diagnosis of well differentiated liposarcoma and large deep-seated lipoma

PubMed Central

Pilotti, S; Torre, G Della; Mezzelani, A; Tamborini, E; Azzarelli, A; Sozzi, G; Pierotti, M A

2000-01-01

Ordinary lipomas are cytogenetically characterized by a variety of balanced rearrangements involving chromosome segment 12q13–15, whereas well differentiated liposarcomas (WDL) show supernumerary ring and giant marker chromosomes, known to contain amplified 12q sequences. The tight correlation between the presence of ring chromosomes and both amplification and overexpression of MDM2 and CDK4 genes suggests the exploration of the possibility that immunocytochemistry (ICC) might assist in the differential diagnosis of lipoma-like well differentiated liposarcomas (LL-WDL) and large deep-seated lipomas (LDSL). For this purpose, 21 cases of the former and 19 cases of the latter tumours were analysed by ICC and, according to the availability of material, by molecular and cytogenetic approaches. All lipomas displayed a null MDM2/CDK4 phenotype, whereas all LL-WDL showed MDM2/CDK4 or CDK4 phenotypes. Southern blot analysis performed on 16 suitable cases, complemented by fluorescence in situ hybridization and classical cytogenetic analysis in 11 cases, was consistent with, and further supported the immunophenotyping data. In conclusion, MDM2/CDK4 product-based immunophenotyping appears to represent a valuable method for the categorization of arguable LDSL. © 2000 Cancer Research Campaign PMID:10755400

[Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

PubMed

Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

2006-05-01

The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

Clinical implication of elevated human cervical cancer oncogene-1 expression in esophageal squamous cell carcinoma.

PubMed

Liu, Ying; Li, Ke; Ren, Zhonghai; Li, Shenglei; Zhang, Hongyan; Fan, Qingxia

2012-07-01

The human cervical cancer oncogene 1 (HCCR-1), a novel human oncoprotein, has been shown to be upregulated in various human tumors and plays a critical role in tumorigenesis and tumor progression. Here, the authors investigated HCCR-1 level in esophageal squamous cell carcinoma (ESCC) tissues and assessed the correlation between HCCR-1 level and prognosis of the patients with ESCC. HCCR-1 levels were investigated by immunohistochemistry, in situ hybridization, real-time quantitative RT-PCR and Western blotting methods; Kaplan-Meier curve was used to evaluate the prognostic value of HCCR-1 level in patients with ESCC using log-rank test. HCCR-1 displayed high levels in ESCC tissues compared to squamous dysplasia tissues and normal esophageal epithelial tissues. No significant correlation was observed between the levels of HCCR-1 mRNA and protein and gender and age (all p>0.05) but obviously related to histological grade, clinical stage, and lymph node metastasis (all p<0.001). Moreover, the survival rate of the patients with low HCCR-1 levels was higher than that of the patients with high HCCR-1 levels (both p<0.05). These data demonstrate that HCCR-1 may be used as a novel predictor for the prognosis of the patients with ESCC.

Cellular and molecular analysis of mutagenesis induced by charged particles of defined linear energy transfer.

PubMed

Zhu, L X; Waldren, C A; Vannias, D; Hei, T K

1996-03-01

Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.

Cellular and molecular analysis of mutagenesis induced by charged particles of defined linear energy transfer

NASA Technical Reports Server (NTRS)

Zhu, L. X.; Waldren, C. A.; Vannias, D.; Hei, T. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Optimization the mechanical properties of coir-luffa cylindrica filled hybrid composites by using Taguchi method

NASA Astrophysics Data System (ADS)

Krishnudu, D. Mohana; Sreeramulu, D.; Reddy, P. Venkateshwar

2018-04-01

In the current study mechanical properties of particles filled hybrid composites have been studied. The mechanical properties of the hybrid composite mainly depend on the proportions of the coir weight, Luffa weight and filler weight. RSM along with Taguchi method have been applied to find the optimized parameters of the hybrid composites. From the current study it was observed that the tensile strength of the composite mainly depends on the coir percent than the other two particles.

Students' satisfaction to hybrid problem-based learning format for basic life support/advanced cardiac life support teaching.

PubMed

Chilkoti, Geetanjali; Mohta, Medha; Wadhwa, Rachna; Saxena, Ashok Kumar; Sharma, Chhavi Sarabpreet; Shankar, Neelima

2016-11-01

Students are exposed to basic life support (BLS) and advanced cardiac life support (ACLS) training in the first semester in some medical colleges. The aim of this study was to compare students' satisfaction between lecture-based traditional method and hybrid problem-based learning (PBL) in BLS/ACLS teaching to undergraduate medical students. We conducted a questionnaire-based, cross-sectional survey among 118 1 st -year medical students from a university medical college in the city of New Delhi, India. We aimed to assess the students' satisfaction between lecture-based and hybrid-PBL method in BLS/ACLS teaching. Likert 5-point scale was used to assess students' satisfaction levels between the two teaching methods. Data were collected and scores regarding the students' satisfaction levels between these two teaching methods were analysed using a two-sided paired t -test. Most students preferred hybrid-PBL format over traditional lecture-based method in the following four aspects; learning and understanding, interest and motivation, training of personal abilities and being confident and satisfied with the teaching method ( P < 0.05). Implementation of hybrid-PBL format along with the lecture-based method in BLS/ACLS teaching provided high satisfaction among undergraduate medical students.

Development of selectable marker free, insect resistant, transgenic mustard (Brassica juncea) plants using Cre/lox mediated recombination

PubMed Central

2013-01-01

Background Antibiotic/ herbicide resistant marker genes have been proven to be very useful in plant transformation for the initial selection of desired transgenic events. However, presence of these genes in the genetically modified crops may render the crop less acceptable to the consumers. Among several different approaches, the effectiveness of Cre/lox mediated recombination strategy for selectable marker gene (SMG) elimination has previously been demonstrated by different groups in several plants including Brassica. In the present study exploiting Cre/lox mediated recombination strategy, attempt has been made for selectable marker gene elimination from Allium sativum leaf agglutinin (ASAL) expressing Brassica plants with hemipteran insect resistant phenotype. Results Allium sativum leaf agglutinin (ASAL) linked with lox flanked hygromycin resistant (hpt) gene was introduced in mustard. Cre recombinase gene cassette was also integrated in separate event. A Cre/lox mediated recombination using crossing strategy was adopted to remove the hpt gene from the subsequent generation of selected hybrid events. Reciprocal crosses were made between T1ASAL-lox-hpt-lox and cre-bar plants. Marker gene elimination was confirmed in the resulting F1 hybrid progenies by PCR analysis, using hpt, cre and ASAL specific primers followed by Southern hybridization. In marker free plants, expression of ASAL was also confirmed by western blotting and ELISA analysis. Retention of functionality of expressed ASAL was investigated by agglutination assay using rabbit erythrocytes. Expressed ASAL was also found to be thermo-sensitive. In planta insect bioassay on F1 hybrid progenies exhibited detrimental effect on the performance of devastating target pest, Lipaphis erysimi. The F1 hybrid hpt negative, ASAL positive plants were allowed to self- fertilize to obtain F2 progeny plants. In some of these plants cre gene was found to be segregated out of the ASAL gene by genetic segregation yielding completely marker free plants. Conclusions The present study establishes the efficient expression of the newly introduced insect resistant ASAL gene even after Cre/lox mediated recombination resulting in elimination of selectable marker gene. PMID:24144281

Isolation and purification assay of ex vivo photosystem II D1 protein toward integrated biointeraction analysis.

PubMed

Muktiono, B; Schulten, C; Heemken, O; Gandrass, J; Prange, A; Schnabl, H; Cerboncini, C

2008-02-01

Protein extracts of photosystem II were prepared from leaf chloroplasts of different plant species by fast and nondenaturing methods. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blot analysis of the proteins obtained showed that the extracts were enriched by D1 proteins, which appeared putatively in association with the 33-kDa oxygen-evolving-complex subunits. In further isolation steps D1 proteins were purified using salt-gradient chromatography (fast protein liquid chromatography) and characterized by western blot and mass spectrometry.

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

PubMed

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Hybrid method of making an amorphous silicon P-I-N semiconductor device

DOEpatents

Moustakas, Theodore D.; Morel, Don L.; Abeles, Benjamin

1983-10-04

The invention is directed to a hydrogenated amorphous silicon PIN semiconductor device of hybrid glow discharge/reactive sputtering fabrication. The hybrid fabrication method is of advantage in providing an ability to control the optical band gap of the P and N layers, resulting in increased photogeneration of charge carriers and device output.

Evaluation of Hybrid Learning in a Construction Engineering Context: A Mixed-Method Approach

ERIC Educational Resources Information Center

Karabulut-Ilgu, Aliye; Jahren, Charles

2016-01-01

Engineering educators call for a widespread implementation of hybrid learning to respond to rapidly changing demands of the 21st century. In response to this call, a junior-level course in the Construction Engineering program entitled Construction Equipment and Heavy Construction Methods was converted into a hybrid learning model. The overarching…

Characterization of a species-specific repetitive DNA from a highly endangered wild animal, Rhinoceros unicornis, and assessment of genetic polymorphism by microsatellite associated sequence amplification (MASA).

PubMed

Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S

1999-03-04

We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.

Ensemble of hybrid genetic algorithm for two-dimensional phase unwrapping

NASA Astrophysics Data System (ADS)

Balakrishnan, D.; Quan, C.; Tay, C. J.

2013-06-01

The phase unwrapping is the final and trickiest step in any phase retrieval technique. Phase unwrapping by artificial intelligence methods (optimization algorithms) such as hybrid genetic algorithm, reverse simulated annealing, particle swarm optimization, minimum cost matching showed better results than conventional phase unwrapping methods. In this paper, Ensemble of hybrid genetic algorithm with parallel populations is proposed to solve the branch-cut phase unwrapping problem. In a single populated hybrid genetic algorithm, the selection, cross-over and mutation operators are applied to obtain new population in every generation. The parameters and choice of operators will affect the performance of the hybrid genetic algorithm. The ensemble of hybrid genetic algorithm will facilitate to have different parameters set and different choice of operators simultaneously. Each population will use different set of parameters and the offspring of each population will compete against the offspring of all other populations, which use different set of parameters. The effectiveness of proposed algorithm is demonstrated by phase unwrapping examples and advantages of the proposed method are discussed.

Multiplexed Western Blotting Using Microchip Electrophoresis.

PubMed

Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T

2016-07-05

Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.

Using Pool-seq to Search for Genomic Regions Affected by Hybrid Inviability in the copepod T. californicus.

PubMed

Lima, Thiago G; Willett, Christopher S

2018-05-11

The formation of reproductive barriers between allopatric populations involves the accumulation of incompatibilities that lead to intrinsic postzygotic isolation. The evolution of these incompatibilities is usually explained by the Dobzhansky-Muller model, where epistatic interactions that arise within the diverging populations, lead to deleterious interactions when they come together in a hybrid genome. These incompatibilities can lead to hybrid inviability, killing individuals with certain genotypic combinations, and causing the population's allele frequency to deviate from Mendelian expectations. Traditionally, hybrid inviability loci have been detected by genotyping individuals at different loci across the genome. However, this method becomes time consuming and expensive as the number of markers or individuals increases. Here, we test if a Pool-seq method can be used to scan the genome of F2 hybrids to detect genomic regions that are affected by hybrid inviability. We survey the genome of hybrids between 2 populations of the copepod Tigriopus californicus, and show that this method has enough power to detect even small changes in allele frequency caused by hybrid inviability. We show that allele frequency estimates in Pool-seq can be affected by the sampling of alleles from the pool of DNA during the library preparation and sequencing steps and that special considerations must be taken when aligning hybrid reads to a reference when the populations/species are divergent.

Production and molecular characterization of somatic hybrids between Pleurotus florida and Lentinula edodes.

PubMed

Mallick, Pijush; Sikdar, Samir Ranjan

2014-08-01

Nine inter-generic somatic hybrids named as pfle were produced through PEG-mediated protoplast fusion between Pleurotus florida and Lentinula edodes using double selection method. Hybridity of the newly developed strains was established on the basis of colony morphology, mycelial growth, hyphal traits, fruit-body productivity and inter single sequence repeat (ISSR) marker profiling. Hybrid population was assessed with different phenotypic variables by one-way analysis of variance. Principal component matrices were analyzed for the six phenotypic variables in scatter plot showing maximum positive correlation between each variable for all strains examined. Six ISSR primers generated 66 reproducible fragments with 98.48 % polymorphism. The dendrogram thus created based on unweighted pair-group method with mathematic averages method of clustering and Euclidean distance which exhibited three major groups between the parents and pfle hybrids. Though P. florida parent remained in one group but it showed different degrees of genetic distance with all the hybrid lines belonging to the other two groups while L. edodes was most distantly related to all the hybrid lines. L. edodes specific sequence-rich ISSR amplicon was recorded in all the hybrid lines and in L. edodes but not in P. florida. All the fruit body generating pfle hybrid lines could produce basidiocarp on paddy straw in sub-tropical climate and showed phenotypic resemblance to the P. florida parent.

Can human papillomavirus DNA testing of self-collected vaginal samples compare with physician-collected cervical samples and cytology for cervical cancer screening in developing countries?

PubMed Central

Bhatla, Neerja; Dar, Lalit; Patro, A. Rajkumar; Kumar, Pankaj; Kriplani, Alka; Gulati, Arti; Iyer, Venkateswaran K.; Mathur, Sandeep R.; Sreenivas, Vishnubhatla; Shah, Keerti V.; Gravitt, Patti E.

2013-01-01

Background To determine human papillomavirus (HPV) types by polymerase chain reaction (PCR)-reverse line blot assay and examine the concordance between HPV by Hybrid Capture 2 (HC2) and PCR on self-collected vaginal and physician-collected cervical samples and cytology. Methods This was a cross-sectional study of 546 sexually active women aged ≥30 years with persistent vaginal discharge, intermenstrual or postcoital bleeding or an unhealthy cervix. Participants self-collected vaginal samples (HPV-S) and physicians collected cervical samples for conventional Pap smear and HPV DNA (HPV-P) testing and performed colposcopy, with directed biopsy, if indicated. HPV testing and genotyping was done by HC2 and PCR reverse line blot assay. Concordance between HC2 and PCR results of self- and physician-collected samples was determined using a Kappa statistic (κ) and Chi-square test. Results Complete data were available for 512 sets with 98% of women providing a satisfactory self-sample. PCR detected oncogenic HPV in 12.3% of self- and 13.0% of physician-collected samples. Overall, there was 93.8% agreement between physician-collected and self-samples (κ = 76.31%, 95% confidence interval [CI]: 64.97–82.29%, p = 0.04)—complete concordance in 473 cases (57 positive, 416 negative), partial concordance in seven pairs and discordance in 32 pairs. The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of self-sampling for detection of cervical intraepithelial neoplasia (CIN)2+ disease were 82.5%, 93.6%, 52.4% and 98.4%, respectively; for physician-sampling they were 87.5%, 93.2%, 52.2% and 98.9%, respectively; and for cytology they were 77.5%, 87.3%, 34.1% and 97.9%, respectively. Concordance between HC2 and PCR was 90.9% for self-samples (κ = 63.7%, 95% CI: 55.2–72.2%) and 95.3% for physician-collected samples (κ = 80.4%, 95% CI: 71.8–89.0%). Conclusions Self-HPV sampling compares favourably with physician-sampling and cytology. A rapid, affordable, HPV self-test kit can be used as the primary method of cervical cancer screening in low-resource situations. PMID:19931499

Development of a time-resolved fluorometric method for observing hybridization in living cells using fluorescence resonance energy transfer.

PubMed Central

Tsuji, A; Sato, Y; Hirano, M; Suga, T; Koshimoto, H; Taguchi, T; Ohsuka, S

2001-01-01

We previously showed that a specific kind of mRNA (c-fos) was detected in a living cell under a microscope by introducing two fluorescently labeled oligodeoxynucleotides, each labeled with donor or acceptor, into the cytoplasm, making them hybridize to adjacent locations on c-fos mRNA, and taking images of fluorescence resonance energy transfer (FRET) (A. Tsuji, H. Koshimoto, Y. Sato, M. Hirano. Y. Sei-Iida, S. Kondo, and K. Ishibashi, 2000, Biophys. J. 78:3260-3274). On the formed hybrid, the distance between donor and acceptor becomes close and FRET occurs. To observe small numbers of mRNA in living cells using this method, it is required that FRET fluorescence of hybrid must be distinguished from fluorescence of excess amounts of non-hybridizing probes and from cell autofluorescence. To meet these requirements, we developed a time-resolved method using acceptor fluorescence decays. When a combination of a donor having longer fluorescence lifetime and an acceptor having shorter lifetime is used, the measured fluorescence decays of acceptors under FRET becomes slower than the acceptor fluorescence decay with direct excitation. A combination of Bodipy493/503 and Cy5 was selected as donor and acceptor. When the formed hybrid had a configuration where the target RNA has no single-strand part between the two fluorophores, the acceptor fluorescence of hybrid had a sufficiently longer delay to detect fluorescence of hybrid in the presence of excess amounts of non-hybridizing probes. Spatial separation of 10-12 bases between two fluorophores on the hybrid is also required. The decay is also much slower than cell autofluorescence, and smaller numbers of hybrid were detected with less interference of cell autofluorescence in the cytoplasm of living cells under a time-resolved fluorescence microscope with a time-gated function equipped camera. The present method will be useful when observing induced expressions of mRNA in living cells. PMID:11423432

A novel hybrid meta-heuristic technique applied to the well-known benchmark optimization problems

NASA Astrophysics Data System (ADS)

Abtahi, Amir-Reza; Bijari, Afsane

2017-03-01

In this paper, a hybrid meta-heuristic algorithm, based on imperialistic competition algorithm (ICA), harmony search (HS), and simulated annealing (SA) is presented. The body of the proposed hybrid algorithm is based on ICA. The proposed hybrid algorithm inherits the advantages of the process of harmony creation in HS algorithm to improve the exploitation phase of the ICA algorithm. In addition, the proposed hybrid algorithm uses SA to make a balance between exploration and exploitation phases. The proposed hybrid algorithm is compared with several meta-heuristic methods, including genetic algorithm (GA), HS, and ICA on several well-known benchmark instances. The comprehensive experiments and statistical analysis on standard benchmark functions certify the superiority of the proposed method over the other algorithms. The efficacy of the proposed hybrid algorithm is promising and can be used in several real-life engineering and management problems.

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

PubMed

Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

1999-11-01

von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in one family. In sum, FISH was found to be a simple and reliable method to detect VHL germline deletions and practically useful in cases where other methods of screening have failed to detect a VHL gene abnormality.

Composite materials and method of making

DOEpatents

Simmons, Kevin L [Kennewick, WA; Wood, Geoffrey M [North Saanich, CA

2011-05-17

A method for forming improved composite materials using a thermosetting polyester urethane hybrid resin, a closed cavity mold having an internal heat transfer mechanism used in this method, and the composite materials formed by this method having a hybrid of a carbon fiber layer and a fiberglass layer.

Multi-hybrid method for investigation of EM scattering from inhomogeneous object above a dielectric rough surface

NASA Astrophysics Data System (ADS)

Li, Jie; Guo, LiXin; He, Qiong; Wei, Bing

2012-10-01

An iterative strategy combining Kirchhoff approximation^(KA) with the hybrid finite element-boundary integral (FE-BI) method is presented in this paper to study the interactions between the inhomogeneous object and the underlying rough surface. KA is applied to study scattering from underlying rough surfaces, whereas FE-BI deals with scattering from the above target. Both two methods use updated excitation sources. Huygens equivalence principle and an iterative strategy are employed to consider the multi-scattering effects. This hybrid FE-BI-KA scheme is an improved and generalized version of previous hybrid Kirchhoff approximation-method of moments (KA-MoM). This newly presented hybrid method has the following advantages: (1) the feasibility of modeling multi-scale scattering problems (large scale underlying surface and small scale target); (2) low memory requirement as in hybrid KA-MoM; (3) the ability to deal with scattering from inhomogeneous (including coated or layered) scatterers above rough surfaces. The numerical results are given to evaluate the accuracy of the multi-hybrid technique; the computing time and memory requirements consumed in specific numerical simulation of FE-BI-KA are compared with those of MoM. The convergence performance is analyzed by studying the iteration number variation caused by related parameters. Then bistatic scattering from inhomogeneous object of different configurations above dielectric Gaussian rough surface is calculated and the influences of dielectric compositions and surface roughness on the scattering pattern are discussed.

Confirmation of the immunoreactivity of monoclonal anti-human C-terminal EGFR antibodies in bronze Corydoras Corydoras aeneus (Callichthyidae Teleostei) by Western Blot method.

PubMed

Mytych, Jennifer; Satora, Leszek; Kozioł, Katarzyna

2018-02-01

Bronze corydoras (Corydoras aeneus) uses the distal part of the intestine as accessory respiratory organ. Our previous study showed the presence of epidermal growth factor receptor (EGFR) cytoplasmic domain in the digestive tract of the bronze corydoras. In this study, using Western Blot method, we validated the results presented in the previous research. In detail, results of Western Blot analysis on digestive and respiratory part of bronze corydoras intestine homogenates confirmed the immunoreactivity of anti-cytoplasmic domain (C-terminal) human EGFR antibodies with protein band of approximately 180kDa (EGFR molecular weight). This indicates a high homology of EGFR domain between these species and the possibility of such antibody use in bronze corydoras. Statistically significantly higher EGFR expression was observed in the respiratory part of intestine when compared to the digestive part. This implies higher proliferation activity and angiogenesis of epithelium in this part of intestine, creating conditions for air respiration. Therefore, Corydoras aeneus may be considered as a model organism for the molecular studies of the mechanisms of epithelial proliferation initiation and inhibition depending on hypoxia and normoxia. Copyright © 2017. Published by Elsevier GmbH.

A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

PubMed

Yamamoto, F; Yamamoto, M

2004-07-01

We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

Negative inotropic effect of carbachol and interaction between acetylcholine receptor-operated potassium channel (K.ACh channel) and GTP binding protein in mouse isolated atrium--a novel methodological trial.

PubMed

Okada, Muneyoshi; Noma, Chihiro; Yamawaki, Hideyuki; Hara, Yukio

2013-01-01

Interaction between acetylcholine receptor-operated potassium channel (K.ACh channel) and GTP binding protein was examined by an immunoprecipitation-Western blotting system in mouse isolated atrium. The carbachol-induced negative inotropic action in indomethacin-pretreated mouse atrium was significantly inhibited by a K.ACh channel blocker, tertiapin or atropine. Kir3.1 K.ACh channel (Kir3.1) was immunoprecipitated with a mouse anti-Kir3.1 antibody. Coprecipitating Gβ with Kir3.1, detected by Western blotting, was significantly augmented by carbachol. Atropine, but not tertiapin, significantly inhibited the carbachol-induced coprecipitating Gβ with Kir3.1. The data indicate that immunoprecipitation with Kir3.1 and Western blotting of Gβ system is a useful method for assessing interaction between K.ACh channel and GTP binding protein in mouse atrium.

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

Development of a rapid diagnostic test for pertussis: direct detection of pertussis toxin in respiratory secretions.

PubMed Central

Friedman, R L; Paulaitis, S; McMillan, J W

1989-01-01

Monoclonal antibodies (MAb) were produced against the specific Bordetella pertussis antigen pertussis toxin (PT). In preliminary studies, one MAb (IB12) was selected and used in an enzyme-linked dot blot immunoassay to evaluate the ability of the method to detect known amounts of PT in control experiments and to test its potential for direct detection of PT in nasopharyngeal secretion (NP) specimens from patients with confirmed cases of whooping cough. The dot blot assay was able to detect PT at levels as low as 10 ng per dot in either buffer or control NP specimens. The assay demonstrated specificity, reacting only with dot blots of whole B. pertussis and not Bordetella bronchiseptica, Bordetella parapertussis, or other bacterial strains. In preliminary studies, NP aspirate, swab, and wash specimens were compared. The specimen of choice was found to be the NP aspirate, for which 100% positive results were found in the assay. These initial studies suggest that the dot blot immunoassay in which a MAb is used for direct detection of PT in NP specimens may be useful as a rapid diagnostic test for pertussis. Images PMID:2808670

Hybrid materials and methods for producing the same

DOEpatents

Luzzi, David E [Wallingford, PA; Smith, Brian W [Schelton, CT

2003-04-08

A hybrid material is provided which comprises a first single-walled nanotube having a lumen, and a fill molecule contained within the lumen of the single-walled nanotube. A method for producing the hybrid material is also provided wherein a single-walled nanotube is contacted with a fill molecule to cause the fill molecule to enter the lumen of the single-walled nanotube.

Hybrid materials and methods for producing the same

DOEpatents

Luzzi, David E [Wallingford, PA; Smith, Brian W [Philadelphia, PA

2008-02-19

A hybrid material is provided which comprises a first single-walled nanotube having a lumen, and a fill molecule contained within the lumen of the single-walled nanotube. A method for producing the hybrid material is also provided wherein a single-walled nanotube is contacted with a fill molecule to cause the fill molecule to enter the lumen of the single-walled nanotube.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations.

PubMed

Teh, L-K; Lee, T-Y; Tan, J A M A; Lai, M-I; George, E

2015-02-01

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations. Genotype identification of common β-thalassaemia mutations in Malays was carried out using Taqman genotyping assays. Results show that the Taqman assays allow mutation detection with DNA template concentrations as low as 2-100 ng. In addition, consistent reproducibility was observed in the Taqman assays when repeated eight times and at different time intervals. The developed sensitive Taqman assays allow molecular characterization of β-thalassaemia mutations in samples with low DNA concentrations. The Taqman genotyping assays have potential as a diagnostic tool for foetal blood, chorionic villi or pre-implantation genetic diagnosis where DNA is limited and precious. © 2014 John Wiley & Sons Ltd.

Schindler disease: the molecular lesion in the alpha-N-acetylgalactosaminidase gene that causes an infantile neuroaxonal dystrophy.

PubMed Central

Wang, A M; Schindler, D; Desnick, R

1990-01-01

Schindler disease is a recently recognized infantile neuroaxonal dystrophy resulting from the deficient activity of the lysosomal hydrolase, alpha-N-acetylgalctosaminidase (alpha-GalNAc). The recent isolation and expression of the full-length cDNA encoding alpha-GalNAc facilitated the identification of the molecular lesions in the affected brothers from family D, the first cases described with this autosomal recessive disease. Southern and Northern hybridization analyses of DNA and RNA from the affected homozygotes revealed a grossly normal alpha-GalNAc gene structure and normal transcript sizes and amounts. Therefore, the alpha-GalNAc transcript from an affected homozygote was reverse-transcribed, amplified by the polymerase chain reaction (PCR), and sequenced. A single G to A transition at nucleotide 973 was detected in multiple subclones containing the PCR products. This point mutation resulted in a glutamic acid to lysine substitution in residue 325 (E325K) of the alpha-GalNAc polypeptide. The base substitution was confirmed by dot blot hybridization analyses of PCR-amplified genomic DNA from family members with allele-specific oligonucleotides. Furthermore, transient expression of an alpha-GalNAc construct containing the E325K mutation resulted in the expression of an immunoreactive polypeptide which had no detectable alpha-GalNAc activity. Images PMID:2243144

Expression of a serine protease (motopsin PRSS12) mRNA in the mouse brain: in situ hybridization histochemical study.

PubMed

Iijima, N; Tanaka, M; Mitsui, S; Yamamura, Y; Yamaguchi, N; Ibata, Y

1999-03-20

Serine proteases are considered to play several important roles in the brain. In an attempt to find novel brain-specific serine proteases (BSSPs), motopsin (PRSS-12) was cloned from a mouse brain cDNA library by polymerase chain reaction (PCR). Northern blot analysis demonstrated that the postnatal 10-day mouse brain contained the most amount of motopsin mRNA. At this developmental stage, in situ hybridization histochemistry showed that motopsin mRNA was specifically expressed in the following regions: cerebral cortical layers II/III, V and VIb, endopiriform cortex and the limbic system, particularly in the CA1 region of the hippocampal formation. In addition, in the brainstem, the oculomotor nucleus, trochlear nucleus, mecencephalic and motor nuclei of trigeminal nerve (N), abducens nucleus, facial nucleus, nucleus of the raphe pontis, dorsoral motor nucleus of vagal N, hypoglossal nucleus and ambiguus nucleus showed motopsin mRNA expression. Expression was also found in the anterior horn of the spinal cord. The above findings strongly suggest that neurons in almost all motor nuclei, particularly in the brainstem and spinal cord, express motopsin mRNA, and that motopsin seems to have a close relation to the functional role of efferent neurons. Copyright 1999 Elsevier Science B.V.

Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warburton, P.E.; Gosden, J.; Lawson, D.

1996-04-15

Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize andmore » spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.« less

A Simple and Reliable Method for Hybridization of Homothallic Wine Strains of Saccharomyces cerevisiae

PubMed Central

Ramírez, Manuel; Peréz, Francisco; Regodón, José A.

1998-01-01

A procedure was developed for the hybridization and improvement of homothallic industrial wine yeasts. Killer cycloheximide-sensitive strains were crossed with killer-sensitive cycloheximide-resistant strains to get killer cycloheximide-resistant hybrids, thereby enabling hybrid selection and identification. This procedure also allows backcrossing of spore colonies from the hybrids with parental strains. PMID:9835605

Mass production of shortleaf x slash pine hybrids by pollinating unbagged female flowers

Treesearch

Philip C. Wakeley; O.O. Wells; T.E. Campbell

1966-01-01

A simple method of mass-producing shortleaf x slash pine hybrids was attempted. Large quantities of slash pine pollen were spread on unbagged shortleaf flowers in the hope of recovering a high percentage of hybrid progeny and thus materially reducing the cost of producing such hybrids by conventional controlled pollination. The hybrid is very promising, but, as Snyder...

A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals.

PubMed

Li, Suyi; Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji; Diao, Shu

2017-01-01

The noninvasive peripheral oxygen saturation (SpO 2 ) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO 2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis.

A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals

PubMed Central

Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji

2017-01-01

The noninvasive peripheral oxygen saturation (SpO2) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis. PMID:29250135

High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

PubMed

Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

2013-07-08

Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

Nano metal-organic framework (NMOF)-based strategies for multiplexed microRNA detection in solution and living cancer cells

NASA Astrophysics Data System (ADS)

Wu, Yafeng; Han, Jianyu; Xue, Peng; Xu, Rong; Kang, Yuejun

2015-01-01

MiRNAs are an emerging type of biomarker for diagnostics and prognostics. A reliable sensing strategy that can monitor miRNA expression in living cancer cells would be critical in view of its extensive advantages for fundamental research related to miRNA-associated bioprocesses and biomedical applications. Conventional miRNA sensing methods include northern blot, microarrays and real-time quantitative PCR. However, none of them is able to monitor miRNA levels expressed in living cancer cells in a real-time fashion. Some fluorescennt biosensors developed recently from carbon nanomaterials, such as single-walled carbon nanotubes (SWNTs), graphene oxide (GO), and carbon nanoparticles, have been successfully used for assaying miRNA in vitro; however the preparation processes are often expensive, complicated and time-consuming, which have motivated the research on other substitute and novel materials. Herein we present a novel sensing strategy based on peptide nucleic acid (PNA) probes labeled with fluorophores and conjugated with an NMOF vehicle to monitor multiplexed miRNAs in living cancer cells. The NMOF works as a fluorescence quencher of the labelled PNA that is firmly bound with the metal center. In the presence of a target miRNA, PNA is hybridized and released from the NMOF leading to the recovery of fluorescence. This miRNA sensor not only enables the quantitative and highly specific detection of multiplexed miRNAs in living cancer cells, but it also allows the precise and in situ monitoring of the spatiotemporal changes of miRNA expression.MiRNAs are an emerging type of biomarker for diagnostics and prognostics. A reliable sensing strategy that can monitor miRNA expression in living cancer cells would be critical in view of its extensive advantages for fundamental research related to miRNA-associated bioprocesses and biomedical applications. Conventional miRNA sensing methods include northern blot, microarrays and real-time quantitative PCR. However, none of them is able to monitor miRNA levels expressed in living cancer cells in a real-time fashion. Some fluorescennt biosensors developed recently from carbon nanomaterials, such as single-walled carbon nanotubes (SWNTs), graphene oxide (GO), and carbon nanoparticles, have been successfully used for assaying miRNA in vitro; however the preparation processes are often expensive, complicated and time-consuming, which have motivated the research on other substitute and novel materials. Herein we present a novel sensing strategy based on peptide nucleic acid (PNA) probes labeled with fluorophores and conjugated with an NMOF vehicle to monitor multiplexed miRNAs in living cancer cells. The NMOF works as a fluorescence quencher of the labelled PNA that is firmly bound with the metal center. In the presence of a target miRNA, PNA is hybridized and released from the NMOF leading to the recovery of fluorescence. This miRNA sensor not only enables the quantitative and highly specific detection of multiplexed miRNAs in living cancer cells, but it also allows the precise and in situ monitoring of the spatiotemporal changes of miRNA expression. Electronic supplementary information (ESI) available: Extra figures and tables. See DOI: 10.1039/c4nr05447d

A hybrid method for accurate star tracking using star sensor and gyros.

PubMed

Lu, Jiazhen; Yang, Lie; Zhang, Hao

2017-10-01

Star tracking is the primary operating mode of star sensors. To improve tracking accuracy and efficiency, a hybrid method using a star sensor and gyroscopes is proposed in this study. In this method, the dynamic conditions of an aircraft are determined first by the estimated angular acceleration. Under low dynamic conditions, the star sensor is used to measure the star vector and the vector difference method is adopted to estimate the current angular velocity. Under high dynamic conditions, the angular velocity is obtained by the calibrated gyros. The star position is predicted based on the estimated angular velocity and calibrated gyros using the star vector measurements. The results of the semi-physical experiment show that this hybrid method is accurate and feasible. In contrast with the star vector difference and gyro-assisted methods, the star position prediction result of the hybrid method is verified to be more accurate in two different cases under the given random noise of the star centroid.

Clinical application of a rapid method using agarose gel electrophoresis and Western blotting to evaluate von Willebrand factor protease activity.

PubMed

Kirzek, D M; Rick, M E

2001-03-01

A method for evaluating the activity of the von Willebrand factor (vWF) protease is described, and a clinical application is illustrated. The procedure utilizes gel electrophoresis, Western blotting, and luminographic detection methods to evaluate the distribution of vWF multimers before and after incubation of clinical samples under conditions that favor proteolysis by this enzyme. Physiologically, the high-molecular-weight multimers of vWF are cleaved by the vWF protease under conditions of high shear stress in parts of the arterial circulation; cleavage of vWF multimers is also observed after exposure of vWF to denaturing agents in vitro and thus can serve as a laboratory test for the activity of the protease. vWF protease activity is decreased or absent in patients with thrombotic thrombocytopenic purpura due to an inhibiting autoantibody, and this leads to high levels of noncleaved vWF and to life-threatening thrombosis, thrombocytopenia and anemia. The assay evaluates the activity of the protease by assessing the cleavage of vWF multimers after patient plasmas are incubated in vitro under denaturing conditions. With the use of these electrophoresis and Western blotting techniques, patient plasmas can be rapidly assessed for the activity of the vWF protease which may aid in the treatment strategy for these patients.

Template-free electrochemical nanofabrication of polyaniline nanobrush and hybrid polyaniline with carbon nanohorns for supercapacitors.

PubMed

Wei, Di; Wang, Haolan; Hiralal, Pritesh; Andrew, Piers; Ryhänen, Tapani; Hayashi, Yasuhiko; Amaratunga, Gehan A J

2010-10-29

Polyaniline (PANI) nanobrushes were synthesized by template-free electrochemical galvanostatic methods. When the same method was applied to the carbon nanohorn (CNH) solution containing aniline monomers, a hybrid nanostructure containing PANI and CNHs was enabled after electropolymerization. This is the first report on the template-free method to make PANI nanobrushes and homogeneous hybrid soft matter (PANI) with carbon nanoparticles. Raman spectroscopy was used to analyze the interaction between CNH and PANI. Electrochemical nanofabrication offers simplicity and good control when used to make electronic devices. Both of these materials were applied in supercapacitors and an improvement capacitive current by using the hybrid material was observed.

Template-free electrochemical nanofabrication of polyaniline nanobrush and hybrid polyaniline with carbon nanohorns for supercapacitors

NASA Astrophysics Data System (ADS)

Wei, Di; Wang, Haolan; Hiralal, Pritesh; Andrew, Piers; Ryhänen, Tapani; Hayashi, Yasuhiko; Amaratunga, Gehan A. J.

2010-10-01

Polyaniline (PANI) nanobrushes were synthesized by template-free electrochemical galvanostatic methods. When the same method was applied to the carbon nanohorn (CNH) solution containing aniline monomers, a hybrid nanostructure containing PANI and CNHs was enabled after electropolymerization. This is the first report on the template-free method to make PANI nanobrushes and homogeneous hybrid soft matter (PANI) with carbon nanoparticles. Raman spectroscopy was used to analyze the interaction between CNH and PANI. Electrochemical nanofabrication offers simplicity and good control when used to make electronic devices. Both of these materials were applied in supercapacitors and an improvement capacitive current by using the hybrid material was observed.

Modifying a standard method allows simultaneous extraction of RNA and protein, enabling detection of enzymes in the rat retina with low expressions and protein levels.

PubMed

Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David

2006-02-01

The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.

Method of producing a hybrid matrix fiber composite

DOEpatents

Deteresa, Steven J [Livermore, CA; Lyon, Richard E [Absecon, NJ; Groves, Scott E [Brentwood, CA

2006-03-28

Hybrid matrix fiber composites having enhanced compressive performance as well as enhanced stiffness, toughness and durability suitable for compression-critical applications. The methods for producing the fiber composites using matrix hybridization. The hybrid matrix fiber composites comprised of two chemically or physically bonded matrix materials, whereas the first matrix materials are used to impregnate multi-filament fibers formed into ribbons and the second matrix material is placed around and between the fiber ribbons that are impregnated with the first matrix material and both matrix materials are cured and solidified.

Overview of hybridization and detection techniques.

PubMed

Hilario, Elena

2007-01-01

A misconception regarding the sensitivity of nonradioactive methods for screening genomic DNA libraries often hinders the establishment of these environmentally friendly techniques in molecular biology laboratories. Nonradioactive probes, properly prepared and quantified, can detect DNA target molecules to the femtomole range. However, appropriate hybridization techniques and detection methods should also be adopted for an efficient use of nonradioactive techniques. Detailed descriptions of genomic library handling before and during the nonradioactive hybridization and detection are often omitted from publications. This chapter aims to fill this void by providing a collection of technical tips on hybridization and detection techniques.

CVD-MPFA full pressure support, coupled unstructured discrete fracture-matrix Darcy-flux approximations

NASA Astrophysics Data System (ADS)

Ahmed, Raheel; Edwards, Michael G.; Lamine, Sadok; Huisman, Bastiaan A. H.; Pal, Mayur

2017-11-01

Two novel control-volume methods are presented for flow in fractured media, and involve coupling the control-volume distributed multi-point flux approximation (CVD-MPFA) constructed with full pressure support (FPS), to two types of discrete fracture-matrix approximation for simulation on unstructured grids; (i) involving hybrid grids and (ii) a lower dimensional fracture model. Flow is governed by Darcy's law together with mass conservation both in the matrix and the fractures, where large discontinuities in permeability tensors can occur. Finite-volume FPS schemes are more robust than the earlier CVD-MPFA triangular pressure support (TPS) schemes for problems involving highly anisotropic homogeneous and heterogeneous full-tensor permeability fields. We use a cell-centred hybrid-grid method, where fractures are modelled by lower-dimensional interfaces between matrix cells in the physical mesh but expanded to equi-dimensional cells in the computational domain. We present a simple procedure to form a consistent hybrid-grid locally for a dual-cell. We also propose a novel hybrid-grid for intersecting fractures, for the FPS method, which reduces the condition number of the global linear system and leads to larger time steps for tracer transport. The transport equation for tracer flow is coupled with the pressure equation and provides flow parameter assessment of the fracture models. Transport results obtained via TPS and FPS hybrid-grid formulations are compared with the corresponding results of fine-scale explicit equi-dimensional formulations. The results show that the hybrid-grid FPS method applies to general full-tensor fields and provides improved robust approximations compared to the hybrid-grid TPS method for fractured domains, for both weakly anisotropic permeability fields and very strong anisotropic full-tensor permeability fields where the TPS scheme exhibits spurious oscillations. The hybrid-grid FPS formulation is extended to compressible flow and the results demonstrate the method is also robust for transient flow. Furthermore, we present FPS coupled with a lower-dimensional fracture model, where fractures are strictly lower-dimensional in the physical mesh as well as in the computational domain. We present a comparison of the hybrid-grid FPS method and the lower-dimensional fracture model for several cases of isotropic and anisotropic fractured media which illustrate the benefits of the respective methods.

A Hybrid RANS/LES Approach for Predicting Jet Noise

NASA Technical Reports Server (NTRS)

Goldstein, Marvin E.

2006-01-01

Hybrid acoustic prediction methods have an important advantage over the current Reynolds averaged Navier-Stokes (RANS) based methods in that they only involve modeling of the relatively universal subscale motion and not the configuration dependent larger scale turbulence. Unfortunately, they are unable to account for the high frequency sound generated by the turbulence in the initial mixing layers. This paper introduces an alternative approach that directly calculates the sound from a hybrid RANS/LES flow model (which can resolve the steep gradients in the initial mixing layers near the nozzle lip) and adopts modeling techniques similar to those used in current RANS based noise prediction methods to determine the unknown sources in the equations for the remaining unresolved components of the sound field. The resulting prediction method would then be intermediate between the current noise prediction codes and previously proposed hybrid noise prediction methods.

Wave-induced response of a floating two-dimensional body with a moonpool

PubMed Central

Fredriksen, Arnt G.; Kristiansen, Trygve; Faltinsen, Odd M.

2015-01-01

Regular wave-induced behaviour of a floating stationary two-dimensional body with a moonpool is studied. The focus is on resonant piston-mode motion in the moonpool and rigid-body motions. Dedicated two-dimensional experiments have been performed. Two numerical hybrid methods, which have previously been applied to related problems, are further developed. Both numerical methods couple potential and viscous flow. The semi-nonlinear hybrid method uses linear free-surface and body-boundary conditions. The other one uses fully nonlinear free-surface and body-boundary conditions. The harmonic polynomial cell method solves the Laplace equation in the potential flow domain, while the finite volume method solves the Navier–Stokes equations in the viscous flow domain near the body. Results from the two codes are compared with the experimental data. The nonlinear hybrid method compares well with the data, while certain discrepancies are observed for the semi-nonlinear method. In particular, the roll motion is over-predicted by the semi-nonlinear hybrid method. Error sources in the semi-nonlinear hybrid method are discussed. The moonpool strongly affects heave motions in a frequency range around the piston-mode resonance frequency of the moonpool. No resonant water motions occur in the moonpool at the piston-mode resonance frequency. Instead large moonpool motions occur at a heave natural frequency associated with small damping near the piston-mode resonance frequency. PMID:25512594

Immunoblotting assays for keratan sulfate.

PubMed

Yoon, Jung Hae; Brooks, Randolph; Halper, Jaroslava

2002-07-15

The detection of microquantities of glycosaminoglycans (GAGs) in biological samples has been hampered by the lack of sensitive methods. In this paper we describe the modification and development of three sensitive assays capable of detecting nanogram quantities of GAGs in biological samples. The first assay detects total GAGs. It is a modified Alcian blue dye precipitation assay in which the dye binds to the negatively charged GAGs in CsCl-fractionated extracts from chicken tendons. This assay compares favorably with the widely used uronic acid assay in terms of its sensitivity and ability to detect all classes of GAGs, including keratan sulfate (KS). Two other assays, dot-blotting and immunoblotting, detect KS in complex mixtures and can be easily adapted for the detection of other GAGs. Both take advantage of binding of carboxyl and sulfate groups of GAGs to trivalent neodymium. In dot-blotting, samples were directly blotted onto nitrocellulose membrane soaked in Nd(2)(SO(4))(3) buffer, and KS was detected with the monoclonal anti-KS 5-D-4 antibody and an avidin-biotin complex detection system. In immunoblotting, the samples were first separated in 28% polyacrylamide gels, transferred onto a Nd(2)(SO(4))(3)-soaked nitrocellulose membrane using a phosphate buffer system, and stained and developed using the same protocol as in dot-blotting. Whereas dot-blotting allows the use of very low quantities of samples because of its high sensitivity (lower detection limit was 5 ng), immunoblotting provides more specificity.

Asymmetric organic-inorganic hybrid membrane formation via block copolymer-nanoparticle co-assembly.

PubMed

Gu, Yibei; Dorin, Rachel M; Wiesner, Ulrich

2013-01-01

A facile method for forming asymmetric organic-inorganic hybrid membranes for selective separation applications is developed. This approach combines co-assembly of block copolymer (BCP) and inorganic nanoparticles (NPs) with non-solvent induced phase separation. The method is successfully applied to two distinct molar mass BCPs with different fractions of titanium dioxide (TiO2) NPs. The resulting hybrid membranes exhibit structural asymmetry with a thin nanoporous surface layer on top of a macroporous fingerlike support layer. Key parameters that dictate membrane surface morphology include the fraction of inorganics used and the length of time allowed for surface layer development. The resulting membranes exhibit both good selectivity and high permeability (3200 ± 500 Lm(-2) h(-1) bar(-1)). This fast and straightforward synthesis method for asymmetric hybrid membranes provides a new self-assembly platform upon which multifunctional and high-performance organic-inorganic hybrid membranes can be formed.

A hybridized formulation for the weak Galerkin mixed finite element method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mu, Lin; Wang, Junping; Ye, Xiu

This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less

A hybridized formulation for the weak Galerkin mixed finite element method

DOE PAGES

Mu, Lin; Wang, Junping; Ye, Xiu

2016-01-14

This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less

Hybrid daylight/light-emitting diode illumination system for indoor lighting.

PubMed

Ge, Aiming; Qiu, Peng; Cai, Jinlin; Wang, Wei; Wang, Junwei

2014-03-20

A hybrid illumination method using both daylight and light-emitting diodes (LEDs) for indoor lighting is presented in this study. The daylight can be introduced into the indoor space by a panel-integration system. The daylight part and LEDs are combined within a specific luminaire that can provide uniform illumination. The LEDs can be turned on and dimmed through closed-loop control when the daylight illuminance is inadequate. We simulated the illumination and calculated the indoor lighting efficiency of our hybrid daylight and LED lighting system, and compared this with that of LED and fluorescent lighting systems. Simulation results show that the efficiency of the hybrid daylight/LED illumination method is better than that of LED and traditional lighting systems, under the same lighting conditions and lighting time; the method has hybrid lighting average energy savings of T5 66.28%, and that of the LEDs is 41.62%.