Science.gov

Sample records for bombay duck harpodon

  1. Complete mitochondrial genome of the Bombay duck Harpodon nehereus (Aulopiformes, Synodontidae).

    PubMed

    Bo, Zhang; Xu, Tianjun; Wang, Rixin; Jin, Xiaoxiao; Sun, Yuena

    2013-12-01

    Bombay duck, Harpodon nehereus (Aulopiformes, Synodontidae), is a commercially important marine fish species in China. In this study, the complete mitochondrial genome of H. nehereus was firstly determined. The mitogenome (16 and 536 bp) comprises 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 putative control region. These mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of Aulopiformes.

  2. Improvement of cooking quality and gel formation capacity of Bombay duck (Harpodon nehereus) fish meat.

    PubMed

    Rupsankar, Chakrabarti

    2010-10-01

    High moisture content (89%) along with high enzymatic and bacteriological activity in Bombay duck (Harpodon nehereus) meat are responsible for short shelf life and disintegration of meat in cooking. Minimum solubility was at pH 5 (iso-electric point) of muscle protein. Citric acid- sodium citrate buffer (pH 5) with 0.2% potassium sorbate was very effective in reducing moisture in dressed fish and in increasing shelf life up to 4 days at ambient temperature (25-28 °C). Reduction in moisture in meat improved its cooking quality and gel formation capacity with increased protein content. Fish meat contained 1.0-1.5% NaCl and produced stronger gel by using 2% NaCl than conventionally prepared gel with 4% NaCl. Washing fish mince with cold water followed by pressing at pH 5, gave fish cake with more salt soluble protein and better gel strength (>500 gcm) than the same operation done at ambient temperature.

  3. Feeding habits and ontogenetic diet shifts of Bombay duck, Harpadon nehereus

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Jin, Xianshi

    2014-05-01

    Based on two bottom trawl surveys conducted in autumn 2000 and 2001, a total of 1106 stomach samples of Bombay duck Harpadon nehereus between 23-278 mm fork length were collected and analyzed. The results show that Bombay duck prey items consisted of 11 groups or 32 species, of which Apogon lineatus, Leptochela gracilis, Acetes chinensis, and Euphausia pacifi ca were the dominant prey species. Ontogenetic variations were found in feeding habits and feeding activity of Bombay duck. Feeding activity was highest in fish smaller than 50 mm, lowest in fish between 50 and 99 mm, and then increased with increasing size thereafter. As Bombay duck size increased, fish prey increased in importance, whereas euphausiids and decapods decreased in importance. Different trophic guilds were observed in feeding habits across the examined size range. Bombay duck smaller than 50 mm were zooplanktivores, mainly feeding on zooplankton and fish larva; those between 50 and 149 mm were generalist predators, mainly feeding on pelagic shrimps, demersal shrimps and fishes; and those larger than 150 mm were piscivores, mainly feeding on fishes.

  4. Bombay, India

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Formerly known as Bombay, the city of Mumbai is situated on India's west coast, on the Arabian Sea, roughly 500 km (310 miles) south of the Tropic of Cancer. Its large harbor and ideal location facing Africa, Europe, and the Middle East make it an excellent city for trade. Sometimes referred to as the 'Gateway of India,' Mumbai handles more than one third of the country's foreign trade. The city supports a population of more than 12 million people in an area of roughly 619 square km (239 square miles). The port was acquired in 1534 by Portugal, which named it Bom Bahia, meaning 'beautiful bay.' Originally, the city rested upon seven small islands, mostly basaltic bedrock from earlier lava flows. These islands are now connected to one another by reclaimed land, but each island, or neighborhood, still retains a distinct identity within the city. (For more details, visit Welcome to Bombay: The Gateway of India.) The blue-grey pixels in this false-color image are urban areas. The dark green areas are heavily vegetated surfaces while the light brown regions are more sparsely vegetated. This image of Mumbai was acquired by the Enhanced Thematic Mapper plus (ETM+), flying aboard the Landsat 7 satellite. July 23, 2002, marks the 30th anniversary of the Landsat program. (Click to read the press release-Celebrating 30 Years of Imaging the Earth.) The Landsat program has been particularly instrumental in tracking land use and land cover changes-such as increased urban growth-over the last three decades. Image courtesy Ron Beck, USGS EROS Data Center Satellite Systems Branch

  5. Bombay, India

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Formerly known as Bombay, the city of Mumbai is situated on India's west coast, on the Arabian Sea, roughly 500 km (310 miles) south of the Tropic of Cancer. Its large harbor and ideal location facing Africa, Europe, and the Middle East make it an excellent city for trade. Sometimes referred to as the 'Gateway of India,' Mumbai handles more than one third of the country's foreign trade. The city supports a population of more than 12 million people in an area of roughly 619 square km (239 square miles). The port was acquired in 1534 by Portugal, which named it Bom Bahia, meaning 'beautiful bay.' Originally, the city rested upon seven small islands, mostly basaltic bedrock from earlier lava flows. These islands are now connected to one another by reclaimed land, but each island, or neighborhood, still retains a distinct identity within the city. (For more details, visit Welcome to Bombay: The Gateway of India.) The blue-grey pixels in this false-color image are urban areas. The dark green areas are heavily vegetated surfaces while the light brown regions are more sparsely vegetated. This image of Mumbai was acquired by the Enhanced Thematic Mapper plus (ETM+), flying aboard the Landsat 7 satellite. July 23, 2002, marks the 30th anniversary of the Landsat program. (Click to read the press release-Celebrating 30 Years of Imaging the Earth.) The Landsat program has been particularly instrumental in tracking land use and land cover changes-such as increased urban growth-over the last three decades. Image courtesy Ron Beck, USGS EROS Data Center Satellite Systems Branch

  6. We Love Bombay!

    ERIC Educational Resources Information Center

    Mehta, Shital

    2006-01-01

    The author of this article, an art teacher, describes a lesson in which her elementary school students used acrylics to paint a cityscape of Bombay, India. After seeing huge canvas paintings at an art gallery, the students wanted to paint their own. They performed an exercise in which they closed their eyes, thought about the city, and listed all…

  7. Despotic Ducks

    ERIC Educational Resources Information Center

    Darling, Randi A.

    2008-01-01

    This field experiment is designed to test for despotic behavior in Mallards ("Anas platyrhynchos"), and to examine how ducks distribute themselves relative to their resources. Students present Mallards with food patches differing in profitability in order to examine whether ducks distribute themselves ideal freely or ideal despotically. Students…

  8. Para Bombay phenotype--a case report.

    PubMed

    Mathai, J; Sulochana, P V; Sathyabhama, S

    1997-10-01

    Bombay phenotype is peculiar in that red cells are not agglutinated by antisera A, B or H; while serum contains anti A, B and H. Existence of modifying genes at independent loci with variable expression of ABO genes is postulated. We report here a case of partial suppression where antigens could be detected by elution tests and unlike classical Bombay type, normal amount of appropriate blood group substances were present in saliva. This case of para Bombay phenotype was detected as a result of discrepancy in cell and serum group ng. This highlights the importance of both forward and reverse grouping in ABO testing.

  9. Prevalence of obesity in Bombay.

    PubMed

    Dhurandhar, N V; Kulkarni, P R

    1992-05-01

    Obesity has been reported in developed as well as developing countries. However, data on a large sample of the Indian population are lacking. This study analysed the prevalence of obesity among 1,784 adults in Bombay from various sections of society. Since the prevalence of obesity depends upon the criteria used, prevalence was judged by three criteria viz. percentage excess of body weight, body mass index, and body fat content. The data were classified and analysed according to occupation, age group, income, diet type, and also with respect to family history of obesity. The three methods gave a different prevalence of obesity. In general, the criterion of body mass index under-estimated, and body fat content over-estimated the prevalence as compared to that obtained by percentage excess body weight. An extremely high prevalence of obesity was found in all sub-groups of the sample. As judged by a body mass index of 25 and above, male students had the lowest (10.7%) and male medical doctors had the highest (53.1%) prevalence of obesity. Prevalence was highest for the age group 31-50 years for males and females, and declined on either side of this age range. Prevalence was directly proportional to financial income, and subjects with a family history of obesity had a greater prevalence of obesity compared to those without. This study indicates the gravity of the problem of obesity in Bombay, and provides directions for nutritional planning in the future.

  10. Clinical Patterns of Candida Infections in Bombay.

    PubMed

    Dalal, J Pratiba; Kelkar, S S

    1980-01-01

    One hundred consecutive cases of candidiasis in Bombay were studied. In each case the suspicion was confirmed by isolation typing of the Candida species. The clinical was as follows: vulvo-vaginitis 30%; intertrigo 18%; onychia and paronychia 12%; thrush 16%; generalised cutaneous candidasis 8%, enteritis 3%; bronchitis 12% and urinary tract infection 1%. When compared to a study carried out in Bombay in 1966, there was an increase in the frequency of disseminated cutaneous candidiasis and a reduction in the cases of intertrigo and onychia and paronychia.

  11. Ducks Overboard!

    ERIC Educational Resources Information Center

    Weiland, Ingrid; Sheffield, Caroline

    2013-01-01

    The authors open this article with a description of an incident that happened in 1992, when 28,800 rubber bath toys (i.e., ducks, frogs, turtles, and beavers) fell off a cargo ship in the middle of the Pacific Ocean. In 2009, these rubber bath toys were still washing ashore on beaches all around the world. This science instruction can be used with…

  12. Ducks Overboard!

    ERIC Educational Resources Information Center

    Weiland, Ingrid; Sheffield, Caroline

    2013-01-01

    The authors open this article with a description of an incident that happened in 1992, when 28,800 rubber bath toys (i.e., ducks, frogs, turtles, and beavers) fell off a cargo ship in the middle of the Pacific Ocean. In 2009, these rubber bath toys were still washing ashore on beaches all around the world. This science instruction can be used with…

  13. Molecular basis for H blood group deficiency in Bombay (Oh) and para-Bombay individuals.

    PubMed Central

    Kelly, R J; Ernst, L K; Larsen, R D; Bryant, J G; Robinson, J S; Lowe, J B

    1994-01-01

    The penultimate step in the biosynthesis of the human ABO blood group oligosaccharide antigens is catalyzed by alpha-(1,2)-fucosyltransferase(s) (GDP-L-fucose: beta-D-galactoside 2-alpha-L-fucosyltransferase, EC 2.4.1.69), whose expression is determined by the H and Secretor (SE) blood group loci (also known as FUT1 and FUT2, respectively). These enzymes construct Fuc alpha 1-->2Gal beta-linkages, known as H determinants, which are essential precursors to the A and B antigens. Erythrocytes from individuals with the rare Bombay and para-Bombay blood group phenotypes are deficient in H determinants, and thus A and B determinants, as a consequence of apparent homozygosity for null alleles at the H locus. We report a molecular analysis of a human alpha-(1,2)-fucosyltransferase gene, thought to correspond to the H blood group locus, in a Bombay pedigree and a para-Bombay pedigree. We find inactivating point mutations in the coding regions of both alleles of this gene in each H-deficient individual. These results define the molecular basis for H blood group antigen deficiency in Bombay and para-Bombay phenotypes, provide compelling evidence that this gene represents the human H blood group locus, and strongly support a hypothesis that the H and SE loci represent distinct alpha-(1,2)-fucosyltransferase genes. Candidate sequences for the human SE locus are identified by low-stringency Southern blot hybridization analyses, using a probe derived from the H alpha-(1,2)-fucosyltransferase gene. Images PMID:7912436

  14. Molecular basis for H blood group deficiency in Bombay (Oh) and para-Bombay individuals.

    PubMed

    Kelly, R J; Ernst, L K; Larsen, R D; Bryant, J G; Robinson, J S; Lowe, J B

    1994-06-21

    The penultimate step in the biosynthesis of the human ABO blood group oligosaccharide antigens is catalyzed by alpha-(1,2)-fucosyltransferase(s) (GDP-L-fucose: beta-D-galactoside 2-alpha-L-fucosyltransferase, EC 2.4.1.69), whose expression is determined by the H and Secretor (SE) blood group loci (also known as FUT1 and FUT2, respectively). These enzymes construct Fuc alpha 1-->2Gal beta-linkages, known as H determinants, which are essential precursors to the A and B antigens. Erythrocytes from individuals with the rare Bombay and para-Bombay blood group phenotypes are deficient in H determinants, and thus A and B determinants, as a consequence of apparent homozygosity for null alleles at the H locus. We report a molecular analysis of a human alpha-(1,2)-fucosyltransferase gene, thought to correspond to the H blood group locus, in a Bombay pedigree and a para-Bombay pedigree. We find inactivating point mutations in the coding regions of both alleles of this gene in each H-deficient individual. These results define the molecular basis for H blood group antigen deficiency in Bombay and para-Bombay phenotypes, provide compelling evidence that this gene represents the human H blood group locus, and strongly support a hypothesis that the H and SE loci represent distinct alpha-(1,2)-fucosyltransferase genes. Candidate sequences for the human SE locus are identified by low-stringency Southern blot hybridization analyses, using a probe derived from the H alpha-(1,2)-fucosyltransferase gene.

  15. The para-Bombay phenotype in Chinese persons.

    PubMed

    Lin-Chu, M; Broadberry, R E; Tsai, S J; Chiou, P W

    1987-01-01

    The para-Bombay phenotype occurs more frequently in Oriental than in white populations. This report describes the immunohematologic findings in 20 cases of the para-Bombay phenotype detected over a period of about 15 months in the Chinese population of Taiwan.

  16. Grumman JF-1 Duck

    NASA Technical Reports Server (NTRS)

    1934-01-01

    Grumman JF-1 Duck: The Grumman JF-1 Duck was in service with the NACA at Langley during the summer of 1934. The JF-1 was notably different from the later J2F Duck in that the JF-1 had a shorter central float. The NACA used the JF-1 in part as a propeller testbed aircraft.

  17. The Bombay blood group: are we out of risk?

    PubMed

    Dipta, T F; Hossain, A Z

    2011-07-01

    The Bombay blood group is a rare blood group, phenotypes of this group lacking H antigen on the red cell membrane and have anti-H in the serum. It fails to express any A, B or H antigen on their red cells or other tissues. The existence of a human H/h genetic polymorphism was first established by Bhende et al. As first discovery in Bombay (Mumbai), in India in 1952, so the name of this rare blood group is known as Bombay blood group. People having Bombay phenotype are mostly confined to the Southeast Asia. Around 179 persons in India with a frequency of 1 in 10,000 have "Bombay Blood group". A high level of consanguinity present among the parents of the Bombay phenotype. The classic Bombay phenotype has been reported in those of Indian descendent. It is quite rare in Caucasian with an incidence of 1 in 250,000. As because in our country there is routine practice of "only forward or cell type grouping" using finger prick method by voluntary blood donors organization and various blood banks; so there is tremendous chance of misinterpretation or unexploration of this Bombay blood group. When misdiagnosed, this Bombay group can cause fatal haemolytic transfusion reaction. For this reason our suggestion is to incorporate "routine serum typing or reverse grouping confirmation" along with 'O' cell control in reverse grouping procedure in every Transfusion Medicine Department or Blood Bank or Blood Donor Centers and this practice should be mandatory to reduce the risk of fatal haemolytic transfusion reaction. In this view we will highlight the incidence, molecular biology and clinical significance of this rare and fatal blood group.

  18. A Bangladeshi family with three sisters 'Bombay' or Oh phenotype.

    PubMed

    Rahman, M; Abdullah, A Z; Husain, M; Hague, K M; Hossain, M M

    1990-12-01

    Three sisters in a same family (MIAH FAMILY) are of 'Bombay' phenotype. These being the first known female examples of 'Bombay' blood group have been detected in Bangladesh. As predicted by current theory their red cells are Le(a+b-) and their saliva do not contain any of the antigens A, B and H except Lea substance. Family studies showed that individuals with 'Bombay' or Oh phenotype may have A or B gene which are not expressed. This very particular type of blood is one of the rarest in any other parts of world except in India. Due to the presence of anti-H antibody in the plasma of Oh phenotype, when considering such patients for transfusion only blood of identical Bombay type can be safely transfused.

  19. H-deficient blood groups ( Bombay) of Reunion Island.

    PubMed Central

    Gerard, G; Vitrac, D; Le Pendu, J; Muller, A; Oriol, R

    1982-01-01

    Forty-two H-deficient individuals (lacking H antigen on erythrocytes) with anti-H in their sera were found on Reunion Island. A, B, and AB Bombay subjects had small but detectable amounts of A and/or B antigens on erythrocytes. All the H-deficient phenotypes tested were nonsecretors of ABH in their saliva, and one-third were Lewis negative. Fifty-three of the 108 (49%) unaffected members in the 14 Bombay pedigrees analyzed were se/se, showing that the families were selected for the nonsecretor trait, and suggesting that the Bombay probands used to select the families have se/se genotype. In accordance with this concept, all the children from Bombay nonsecretor x unaffected nonsecretor matings were se/se. Segregation of H and Se is compatible with the genetic model proposing that Se and H are closely linked structural genes, and the analysis of the present and previously published Bombay pedigrees strongly supports this model. PMID:7180848

  20. H-deficient blood groups ( Bombay) of Reunion Island.

    PubMed

    Gerard, G; Vitrac, D; Le Pendu, J; Muller, A; Oriol, R

    1982-11-01

    Forty-two H-deficient individuals (lacking H antigen on erythrocytes) with anti-H in their sera were found on Reunion Island. A, B, and AB Bombay subjects had small but detectable amounts of A and/or B antigens on erythrocytes. All the H-deficient phenotypes tested were nonsecretors of ABH in their saliva, and one-third were Lewis negative. Fifty-three of the 108 (49%) unaffected members in the 14 Bombay pedigrees analyzed were se/se, showing that the families were selected for the nonsecretor trait, and suggesting that the Bombay probands used to select the families have se/se genotype. In accordance with this concept, all the children from Bombay nonsecretor x unaffected nonsecretor matings were se/se. Segregation of H and Se is compatible with the genetic model proposing that Se and H are closely linked structural genes, and the analysis of the present and previously published Bombay pedigrees strongly supports this model.

  1. Pediatric patient with Bombay blood group: A rare case report

    PubMed Central

    Bhar (Kundu), Sudeshna; De, Anisha; Saha, Anindita; Bhattacharyya, Chiranjib

    2015-01-01

    Bombay blood group is a rare blood group in which there is the absence of H antigen and presence of anti-H antibodies. At the time of blood grouping, this blood group mimics O blood group due to the absence of H antigen, but it shows incompatibility with O group blood during cross matching. Serum grouping or reverse grouping are essential for confirmation of the diagnosis. Patients carrying this blood group can receive blood only from a person with this blood group. Reported cases of anesthesia in the pediatric patient with Bombay blood group are relatively rare. Here, we present successful anesthetic management along with intraoperative blood transfusion in a pediatric patient with Bombay blood group posted for ovarian cystectomy. PMID:26240554

  2. Wide variety of point mutations in the H gene of Bombay and para-Bombay individuals that inactivate H enzyme.

    PubMed

    Kaneko, M; Nishihara, S; Shinya, N; Kudo, T; Iwasaki, H; Seno, T; Okubo, Y; Narimatsu, H

    1997-07-15

    The H genes, encoding an alpha1,2fucosyltransferase, which defines blood groups with the H structure, of four Bombay and 13 para-Bombay Japanese individuals were analyzed for mutations. Four Bombay individuals were homologous for the same null H allele, which is inactivated by a single nonsense mutation at position 695 from G to A (G695A), resulting in termination of H gene translation. The allele inactivated by the G695A was designated h1. The other 13 para-Bombay individuals possessed a trace amount of H antigens on erythrocytes regardless of their secretor status. Sequence analysis of their H genes showed four additional inactivated H gene alleles, h2, h3, h4, and h5. The h2 allele possesed a single base deletion at position 990 G (990-del). The h3 and h4 alleles possessed a single missense mutation, T721C, which changes Tyr 241 to His, and G442T, which changes Asp148 to Tyr, respectively. The h5 allele possessed two missense mutations, T460C (Tyr154to His) and G1042A (Glu348to Lys). The h2, h3, h4, and h5 enzymes directed by these alleles were not fully inactivated by the deletion and the missense mutations expressing some residual enzyme activity resulting in synthesis of H antigen on erythrocytes. Thirteen para-Bombay individuals whose erythrocytes retained a trace amount of H antigen were determined to be heterozygous or homozygous for at least one of h2, h3, h4, or h5 alleles. This clarified that the levels (null to trace amount) of H antigen expression on erythrocytes of Bombay and para-Bombay individuals are determined solely by H enzyme activity. These mutations found in the Japanese H alleles differ from a nonsense mutation found in the Indonesian population. To determine the roles of the H, Se, and Le genes in the expression of H antigen in secretions and Lewis blood group antigen on erythrocytes, the Lewis and secretor genes were also examined in these Bombay and para-Bombay individuals. The Lewis blood group phenotype, Le(alpha- b+), was determined

  3. Management of a rare blood type: Oh "Bombay" in pregnancy.

    PubMed

    Katz, A R; Ali, V; Ross, P J; Gammon, E

    1981-06-01

    A rare blood type, Oh "Bombay," was observed in a 30-year-old Indian primigravida. The genetic mode of inheritance is discussed. The obstetric management, with anticipation for the need for blood transfusion, is outlined and the use of autotransfusion for patients with rare blood type is emphasized.

  4. Do black ducks and wood ducks habituate to aircraft disturbance?

    USGS Publications Warehouse

    Conomy, J.T.; Dubovsky, J.A.; Collazo, J.A.; Fleming, W.J.

    1998-01-01

    Requests to increase military aircraft activity in some training facilities in the United States have raised the need to determine if waterfowl and other wildlife are adversely affected by aircraft disturbance. We hypothesized that habituation was a possible proximate factor influencing the low proportion of free-ranging ducks reacting to military aircraft activities in a training range in coastal North Carolina during winters 1991 and 1992. To test this hypothesis, we subjected captive, wild-strain American black ducks (Anas rubripes) and wood ducks (Aix sponsa) to actual and simulated activities of jet aircraft. In the first experiment, we placed black ducks in an enclosure near the center of aircraft activities on Piney Island, a military aircraft target range in coastal North Carolina. The proportion of times black ducks reacted (e.g., alert posture, fleeing response) to visual and auditory aircraft activity decreased from 38 to 6% during the first 17 days of confinement. Response rates remained stable at 5.8% thereafter. In the second experiment, black ducks and wood ducks were exposed to 6 different recordings of jet noise. The proportion of times black ducks reacted to noise decreased (P 0.05) in time-activity budgets of black ducks between pre-exposure to noise and 24 hr after first exposure. Unlike black ducks, wood duck responses to jet noise did not decrease uniformly among experimental groups following initial exposure to noise (P = 0.01). We conclude that initial exposure to aircraft noise elicits behavioral responses from black ducks and wood ducks. With continued exposure of aircraft noise, black ducks may become habituated. However, wood ducks did not exhibit the same pattern of response, suggesting that the ability of waterfowl to habituate to aircraft noise may be species specific.

  5. American Black Duck

    USGS Publications Warehouse

    Longcore, Jerry R.; Clugston, David A.; Mac, Michael J.; Opler, Paul A.; Puckett Haecker, Catherine E.; Doran, Peter D.

    1998-01-01

    The American black duck, with its brownish-black plumage and iridescent violet speculum, is one of the wariest of all the large dabbling ducks (Kortright 1942; Fig. 1). The black duck’s distribution is confined to eastern North America but extends into Manitoba. The black duck breeds in a variety of habitat types, from the brackish coastal marshes of North Carolina to the open boreal forests of northern Quebec and Labrador (Bellrose 1976). In acidic bogs, beaver streams, and sluggish riverine and floodplain habitats of the boreal forest, the black duck’s dark plumage (males and females have similar plumage) blends with the dark organic-stained waters of forested wetlands (Fig. 2).

  6. Transfusion reaction in a case with the rare Bombay blood group.

    PubMed

    Shahshahani, Hayedeh Javadzadeh; Vahidfar, Mohamad Reza; Khodaie, Seyed Ali

    2013-01-01

    Bombay phenotype is extremely rare in Caucasian with an incidence of 1 in 250,000. When individuals with the Bombay phenotype need blood transfusion, they can receive only autologous blood or blood from another Bombay blood group. Transfusing blood group O red cells to them can cause a fatal hemolytic transfusion reaction. In this study, we report a case with the rare Bombay blood group that was misdiagnosed as the O blood group and developed a hemolytic transfusion reaction. This highlights the importance of both forward and reverse typing in ABO blood grouping and standard cross-matching and performing standard pretransfusion laboratory tests in hospital blood banks.

  7. Transfusion reaction in a case with the rare Bombay blood group

    PubMed Central

    Shahshahani, Hayedeh Javadzadeh; Vahidfar, Mohamad Reza; Khodaie, Seyed Ali

    2013-01-01

    Bombay phenotype is extremely rare in Caucasian with an incidence of 1 in 250,000. When individuals with the Bombay phenotype need blood transfusion, they can receive only autologous blood or blood from another Bombay blood group. Transfusing blood group O red cells to them can cause a fatal hemolytic transfusion reaction. In this study, we report a case with the rare Bombay blood group that was misdiagnosed as the O blood group and developed a hemolytic transfusion reaction. This highlights the importance of both forward and reverse typing in ABO blood grouping and standard cross-matching and performing standard pretransfusion laboratory tests in hospital blood banks. PMID:23559776

  8. The DUCK Manual.

    DTIC Science & Technology

    1985-06-01

    the form (AND goal, goal, ... goal) For instance, if you type (AND (BIG ?X) (GREEN ?X) ( RUTABAGA ?X)) then Duck will try to find an assertion (BIG thing...GREEN THING9) ( RUTABAGA THINGg) then the program would set ?X to THIN~g, and this value would be printed. Duck has found a single object that...qualifies as a big green rutabaga . One obstacle to this tidy scenario is that the database might also contain these assertions: (BIG THING80) (GREEN THINGSO

  9. The Lame Duck Superintendent.

    ERIC Educational Resources Information Center

    Keane, William G.; Follo, Eric

    1995-01-01

    According to a survey of 46 recently departed Michigan school superintendents, departing superintendents can announce their intention to leave and still maintain a viable leadership role. Lame-duck superintendents should help the board think through the superintendent-selection process and review possible promotions, recognize staff achievements,…

  10. The Lame Duck Superintendent.

    ERIC Educational Resources Information Center

    Keane, William G.; Follo, Eric

    1995-01-01

    According to a survey of 46 recently departed Michigan school superintendents, departing superintendents can announce their intention to leave and still maintain a viable leadership role. Lame-duck superintendents should help the board think through the superintendent-selection process and review possible promotions, recognize staff achievements,…

  11. No Duck Left behind

    ERIC Educational Resources Information Center

    Cooper, Sandi; Thomas, Julie; Motley, Tammy

    2011-01-01

    Recently, a group of fourth graders joined "Pintail Partners"--a year-long collaborative research effort of scientists, students, classroom teachers, preservice teachers, museum educators, and university professors. Students and teachers followed satellite tracking data (marking the pintail duck's spring migration) and interacted with scientists…

  12. No Duck Left behind

    ERIC Educational Resources Information Center

    Cooper, Sandi; Thomas, Julie; Motley, Tammy

    2011-01-01

    Recently, a group of fourth graders joined "Pintail Partners"--a year-long collaborative research effort of scientists, students, classroom teachers, preservice teachers, museum educators, and university professors. Students and teachers followed satellite tracking data (marking the pintail duck's spring migration) and interacted with scientists…

  13. [Genetic analysis of an individual with para-Bombay phenotype].

    PubMed

    Lin, Jia-jin; Huang, Ying; Zhu, Sui-yong

    2013-04-01

    To study genetic characteristics of an individual with para-Bombay phenotype and her family members. ABO and H antigens were detected with routine serological techniques.The entire coding region of FUT1 gene was amplified by polymerase chain reaction (PCR). PCR products was purified with enzymes digestion and directly sequenced. The RBCs of the proband did not agglutinate with H antibody. The proband therefore has a para-Bombay phenotype (Bmh). Direct sequencing indicated the FUT1 sequence of the proband contained a homozygous 547-552 del AG and heterozygous 814A>G mutation, which gave rise to two haplotypes of 547-552delAG, 547-552delAG and 814A>G. The ABO blood type of the proband' s mother and sisters were all B.Sequencing of the FUT1 gene has found heterozygous 547-552 del AG, 814A>G mutations in the mother and elder sister, and heterozygous 547-552 del AG mutation in her younger sister. The FUT1 547-552 del AG and 814 A>G mutations of the proband were inherited from her mother. A complex mutation of the FUT1 gene consisting of 547-55 del AG and 814 A>G has been identified in an individual with para-Bombay phenotype.

  14. Acute Hemolytic Transfusion Reaction in a Patient with Bombay Phenotype: Implications for ABO Grouping.

    PubMed

    Malhotra, Sheetal; Dhawan, Hari Krishan; Jain, Ashish; Sachdev, Suchet; Marwaha, Neelam

    2014-09-01

    Bombay blood group is a rare phenotype that is characterized serologically by absence of H, A and B antigens on red cell surface and presence of corresponding antibodies in the serum. We report a case of 45-year old patient having Bombay blood group phenotype who experienced an acute reaction due to transfusion of mismatched blood unit.

  15. Wild Duck Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    On April 7, 2005, the Deep Impact spacecraft's Impactor Target Sensor camera recorded this image of M11, the Wild Duck cluster, a galactic open cluster located 6 thousand light years away. The camera is located on the impactor spacecraft, which will image comet Tempel 1 beginning 22 hours before impact until about 2 seconds before impact. Impact with comet Tempel 1 is planned for July 4, 2005.

  16. Wild Duck Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    On April 7, 2005, the Deep Impact spacecraft's Impactor Target Sensor camera recorded this image of M11, the Wild Duck cluster, a galactic open cluster located 6 thousand light years away. The camera is located on the impactor spacecraft, which will image comet Tempel 1 beginning 22 hours before impact until about 2 seconds before impact. Impact with comet Tempel 1 is planned for July 4, 2005.

  17. [Overview on duck virus hepatitis A].

    PubMed

    Ren, Liqian; Li, Jing; Bi, Yuhai; Chen, Can; Zhang, Dabing; Liu, Wenjun

    2012-07-01

    This article describes the nomenclature, history and genetic evolution of duck hepatitis A virus, and updates the epidemiology, clinical symptom and surveillances of duck virus hepatitis A. It also summarizes the present status and progress of duck virus hepatitis A and illustrated the necessity and urgency of its research, which provides rationale for the control of duck hepatitis A virus disease in China.

  18. Capture methods for Musk Ducks

    USGS Publications Warehouse

    McCracken, K.G.; Hemmings, J.; Paton, D.C.; Afton, A.D.

    2003-01-01

    Musk Ducks Biziura lobata are endemic to wetlands, river systems and coastal oceanic waters of temperate Australia. Individuals of this species are difficult to capture because of their excellent swimming and diving abilities and frequent use of deep-water habitats. Night-lighting, baited clover-leaf traps and walk-in-nest-traps were used to capture Musk Ducks at Murray Lagoon, Cape Gantheaume Conservation Park, Kangaroo Island, South Australia. These techniques should be useful for capturing Musk Ducks at other locations in Australia.

  19. Bombay phenotype in two North Indian brothers: a case report.

    PubMed

    Kaur, Paramjit; Basu, Sabita; Bedi, Ravneet Kaur; Kaur, Gagandeep

    2007-10-01

    Bombay phenotype is unique in the aspect that the red cells are not agglutinated by antisera A, B and H. However the serum of such individuals contains anti A, B and strongly reactive anti H which agglutinates red cells of 'O' group individuals through a wide thermal range. The blood specimen of a 35 year old male donor who donated blood for the first time was subjected to detailed cell and serum grouping. There was a discrepancy between the results. The possibility of Bombay phenotype was considered and the sample was tested with anti H lectin. Further confirmation of blood group and secretor status was done from a reference laboratory. Family studies showed the same blood group in the elder sibling of the propositus. The present case highlights the significance of correlating cell and serum grouping results. Moreover, this blood group is very rare in North India. Family studies revealed the propositus to possess the B gene which was suppressed in the donor but expressed in the offsprings. The use of anti H in discrepant blood grouping results is recommended.

  20. Duck viral enteritis in domestic muscovy ducks in Pennsylvania

    USGS Publications Warehouse

    Davison, S.; Converse, K.A.; Hamir, A.N.; Eckroade, R.J.

    1993-01-01

    Duck viral enteritis (DVE) outbreaks occurred at two different locations in Pennsylvania in 1991 and 1992. In the first outbreak, four ducks died out of a group of 30 domestic ducks; in the second outbreak, 65 ducks died out of a group of 114 domestic ducks, and 15 domestic geese died as well. A variety of species of ducks were present on both premises, but only muscovy ducks (Cairina moschata) died from the disease. On necropsy, gross lesions included hepatomegaly with petechial hemorrhages, petechial hemorrhages in the abdominal fat, petechial hemorrhages on the epicardial surface of the heart, and multifocal to coalescing areas of fibrinonecrotic material over the mucosal surface of the trachea, esophagus, intestine, and cloaca. Histologically, the liver had random multifocal areas of necrosis and eosinophilic intranuclear inclusion bodies in hepatocytes. DVE virus was isolated and identified using muscovy duck embryo fibroblast inoculation and virus neutralization. /// En dos sitios diferentes se presentaron brotes de enteritis viral de los patos en el estados de Pensilvania en los a??os 1991 y 1992. En el primer brote, cuatro de un lote de 30 patos murieron mientras que en el segundo brote murieron 65 patos de un lote de 114 patos y 15 gansos. En ambas localidades exist?-a una variedad de especies de patos, sin embargo, s??lamente los patos almizcleros (Cairina moschata) murieron. A la necropsia, las lesiones macrosc??picas incluyeron hepatomegalia con hemorragias petequiales, hemorragias petequiales en la grasa abdominal y en la superficie del epicardio, y ?!reas multifocales o coalescentes de material fibrinonecr??tico sobre la superficie de la mucosa de la tr?!quea, es??fago, intestino y cloaca. Histol??gicamente, el h?-gado mostraba ?!reas multifocales de necrosis y cuerpos de inclusi??n intranucleares eosinof?-licos en los hepatocitos. El virus de la enteritis viral de los patos fue aislado e identificado usando fibroblasto de embriones de pato almizclero

  1. A rare case of haemolytic disease of newborn with Bombay phenotype mother

    PubMed Central

    Shastry, Shamee; Lewis, Leslie E.; Bhat, Sudha S.

    2013-01-01

    We are reporting a rare case of severe hemolytic disease of newborn (HDN) with Bombay phenotype mother. A retrospective study of a case with severe haemolytic disease of newborn with Bombay phenotype mother was done. Blood grouping, antibody screening, and lectin study was done on the blood sample of the baby and mother to confirm the diagnosis. Hematological and biochemical parameters were obtained from the hospital laboratory information system for the analysis. Blood group of the baby was A positive, direct antiglobulin test was negative. Blood group of the mother was confirmed to be Bombay phenotype, Hematological parameters showed all the signs of ongoing hemolysis and the bilirubin level was in the zone of exchange transfusion. Due to the unavailability of this rare phenotype blood unit, baby was managed conservatively. Anticipating the fetal anemia and HDN with mothers having Bombay phenotype and prior notification to the transfusion services will be of great help in optimizing the neonatal care and outcome. PMID:24014949

  2. A rare case of haemolytic disease of newborn with Bombay phenotype mother.

    PubMed

    Shastry, Shamee; Lewis, Leslie E; Bhat, Sudha S

    2013-07-01

    We are reporting a rare case of severe hemolytic disease of newborn (HDN) with Bombay phenotype mother. A retrospective study of a case with severe haemolytic disease of newborn with Bombay phenotype mother was done. Blood grouping, antibody screening, and lectin study was done on the blood sample of the baby and mother to confirm the diagnosis. Hematological and biochemical parameters were obtained from the hospital laboratory information system for the analysis. Blood group of the baby was A positive, direct antiglobulin test was negative. Blood group of the mother was confirmed to be Bombay phenotype, Hematological parameters showed all the signs of ongoing hemolysis and the bilirubin level was in the zone of exchange transfusion. Due to the unavailability of this rare phenotype blood unit, baby was managed conservatively. Anticipating the fetal anemia and HDN with mothers having Bombay phenotype and prior notification to the transfusion services will be of great help in optimizing the neonatal care and outcome.

  3. Emergency dilatation and curettage in a patient with Bombay blood group.

    PubMed

    Ali, Muhammad Asghar; Sohaib, Muhammad

    2014-08-01

    Bombay blood group is a rare autosomal recessive phenotype within the ABO blood group. It represents genetically suppressed A, B and H genes. When considering such patients for transfusion, only blood of identical Bombay type can be safely transfused. We are reporting a patient having Bombay phenotypic blood, underwent emergency dilatation and curettage with active per vaginal bleeding due to retained products of placenta. There are numerous anaesthetic considerations, including emergency surgery with hemodynamic instability due to ongoing blood loss, dilutional coagulopathy as well as presence of Bombay phenotype that severely limit the possibility of red blood cell transfusion. Only four donors were registered with the blood bank of the institution and none was traceable. It becomes a real challenge for the anesthesiologist to manage such type of patients without having units of red packed cell which management is described hereby.

  4. Resurgence of malaria in Bombay (Mumbai) in the 1990s: a historical perspective.

    PubMed

    Kamat, V

    2000-06-01

    Bombay has achieved extraordinary success in controlling its malaria problem for nearly six decades by relying primarily on legislative measures and non-insecticidal methods of mosquito abatement. In 1992, however, malaria reemerged in Bombay with a vengeance. During 1992-1997, the city witnessed a manifold increase in the number of malaria cases diagnosed and treated by the public health system. The large number of malaria patients treated by private practitioners was not recorded by the municipal malaria surveillance system during this period. In 1995, at the peak of the resurgence, public health officials of the Municipal Corporation of Greater Bombay (MCGB) confirmed that 170 persons in the city had died due to malaria. The crisis was unprecedented in Bombay's modern public health history. In response to intense criticism from the media, the city's public health officials attributed the resurgence to the global phenomenon of mosquito-vector resistance to insecticides, and Plasmodium resistance to antimalarial chemoprophylaxis and treatment. Local scientists who investigated the problem offered no support to this explanation. So what might explain the resurgence? What factors led the problem to reach an epidemic level in a matter of two or three years? In addressing the above principal questions, this paper adopts a historical perspective and argues that in the resurgence of malaria in Bombay in the 1990s, there is an element of the 'presence of the past'. In many ways the present public health crisis in Bombay resembles the health scenario that characterized the city at the turn of the 19th century. It is possible to draw parallels between the early public health history of malaria control in Bombay, which was punctuated by events that followed the bubonic plague epidemic of 1896, and the present-day malaria epidemic punctuated by the threat of a plague epidemic in 1994. As such, the paper covers a long period, of almost 100 years. This time-depth is used to

  5. Brazil The Duck Lagoon

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This Multi-angle Imaging SpectroRadiometer (MISR) image of Brazil covers an area of about 298 kilometers x 358 kilometers, and was captured by the instrument's vertical-viewing (nadir) camera on December 27, 2001. The 'Lagoa dos Patos', in the Brazilian state of Rio Grande do Sul, translates to 'the Duck Lagoon'. It was named by 16th century Jesuit settlers, who asked the King of Spain to grant them title to the lagoon so that they could breed ducks. The King consented, but revoked his edict when he discovered that the 'duck-pond' (measuring about 14,000 square kilometers) was one of the largest lagoonal systems in the world. Note the sediment plume emanating from the southern end of the lagoon. Sailors in the 16th century imagined this outlet to be the mouth of a large river. Early Portuguese explorers mistook the entrance to the lagoon for the mouth of a great river and called it the Rio Grande. A series of wave-like points and curls form 'cusps' on the inner shores of the lagoon. The lagoon's characteristics change with short-term tide-induced cyclic perturbations, and with longer term large scale meteorological conditions. The distinctive wavelike 'cusps' along the inner shores result from the circulation, erosion and accumulation of sediments driven by wind and tidal action. The El Nino Southern Oscillation (ENSO) circulation affects precipitation amount and continental runoff, thereby changing the contents of the lagoon waters. High rainfall and increased freshwater discharge during El Nino events correspond with elevated dissolved nutrient concentrations and increased phytoplankton growth. La Nina years are dry and the associated low rainfall reduces the freshwater recharge to the lagoon, causing an increase in salinity. Occasional blooms of toxic cyanobacteria (Microcystis aeruginosa), have been registered in the lagoon when nutrient concentrations are elevated. A number of reeds and grasses are important to the lagoon estuary, including widgeon grass

  6. Brazil The Duck Lagoon

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This Multi-angle Imaging SpectroRadiometer (MISR) image of Brazil covers an area of about 298 kilometers x 358 kilometers, and was captured by the instrument's vertical-viewing (nadir) camera on December 27, 2001. The 'Lagoa dos Patos', in the Brazilian state of Rio Grande do Sul, translates to 'the Duck Lagoon'. It was named by 16th century Jesuit settlers, who asked the King of Spain to grant them title to the lagoon so that they could breed ducks. The King consented, but revoked his edict when he discovered that the 'duck-pond' (measuring about 14,000 square kilometers) was one of the largest lagoonal systems in the world. Note the sediment plume emanating from the southern end of the lagoon. Sailors in the 16th century imagined this outlet to be the mouth of a large river. Early Portuguese explorers mistook the entrance to the lagoon for the mouth of a great river and called it the Rio Grande. A series of wave-like points and curls form 'cusps' on the inner shores of the lagoon. The lagoon's characteristics change with short-term tide-induced cyclic perturbations, and with longer term large scale meteorological conditions. The distinctive wavelike 'cusps' along the inner shores result from the circulation, erosion and accumulation of sediments driven by wind and tidal action. The El Nino Southern Oscillation (ENSO) circulation affects precipitation amount and continental runoff, thereby changing the contents of the lagoon waters. High rainfall and increased freshwater discharge during El Nino events correspond with elevated dissolved nutrient concentrations and increased phytoplankton growth. La Nina years are dry and the associated low rainfall reduces the freshwater recharge to the lagoon, causing an increase in salinity. Occasional blooms of toxic cyanobacteria (Microcystis aeruginosa), have been registered in the lagoon when nutrient concentrations are elevated. A number of reeds and grasses are important to the lagoon estuary, including widgeon grass

  7. 'Rubber Duck' on Ceres

    NASA Image and Video Library

    2017-10-12

    This image from NASA's Dawn spacecraft shows a group of craters, left of center, that resembles a rubber duck. Halki Crater, the "head," is 12 miles (20 kilometers) in diameter, while Telepinu Crater, the "body," is 19 miles (31 kilometers) across. They can be found in the global map of Ceres' names. The "beak" crater is unnamed. Halki and Telepinu have both been recently added to the list of official names for Ceres' geological features. They are both named after Hittite (Asia Minor) deities: the goddess of grain and the god of fertility and vegetation, respectively. Dawn acquired this picture on August 20, 2015, from its high-altitude mapping orbit at about 915 miles (1,470 kilometers) above the surface. The center coordinates of this image are 26 degrees north latitude, 339 degrees east longitude. https://photojournal.jpl.nasa.gov/catalog/PIA21909

  8. Postfledging survival of Laysan ducks

    USGS Publications Warehouse

    Reynolds, Michelle H.; Citta, John J.

    2007-01-01

    Precise and unbiased estimates of demographic parameters are necessary for effective population monitoring and to parameterize population models (e.g., population viability analyses). This is especially important for endangered species, where recovery planning and managers' decisions can influence species persistence. In this study, we used mark–recapture methods to estimate survival of fledged juveniles (hatch-yr [HY]) and adult (after-hatch-yr [AHY]) Laysan ducks (Anas laysanensis), an endangered anatid restricted to Laysan Island in the northwestern Hawaiian Islands. To better understand population dynamics, we examined how survival varied as a function of Laysan duck density during 1998–2004. Using random effects models, we also quantified process variation in survival, thereby quantifying the appropriate source of variation for future population models. The dataset supported variation in survival that was time (yr), age (AHY vs. HY), and sex specific. Due to small sample sizes, we did not examine time specificity in the survival of HY ducks. Survival of HY ducks was 0.832 (SE = 0.087) for females (n = 21) and 0.999 (SE < 0.001) for males (n = 15) during 1998–2001. Trends in time and density lacked support as sources of variation in the survival of AHY ducks during 1998–2004. After-hatch-year survival ranged from 0.792 (SE = 0.033) to 0.999 (SE < 0.001). Where we modeled survival as a random effect, annual survival for AHY females was 0.881 (SE = 0.017) and process variation (σS) was 0.034. For AHY males, annual survival (μS) was 0.906 (SE = 0.019) and process variation (σS) was 0.040. This information will improve existing population viability analysis models for Laysan ducks. We believe that monitoring the source and translocation populations will be paramount for increasing our understanding of Laysan duck dynamics, recovery planning, and population management.

  9. Pathobiology of avian influenza in domestic ducks

    USDA-ARS?s Scientific Manuscript database

    Domestic ducks are an important source of food and income in many parts of the world. The susceptibility of domestic ducks to avian influenza (AI) viruses varies depending on many factors, including the species and the age of the ducks, the virus strain, and management practices. Although wild wat...

  10. Detection of rare blood group, Bombay (Oh) phenotype patients and management by acute normovolemic hemodilution

    PubMed Central

    Shrivastava, Manisha; Navaid, Seema; Peethambarakshan, A.; Agrawal, Kalpana; Khan, Athar

    2015-01-01

    Background: Due to lack of correct blood grouping practices, the rare Bombay Oh phenotype may be missed, subjecting patients to the risk of severe hemolytic transfusion reaction. In the absence of blood donor registry, transfusion management of patients needing immediate surgery is a challenge. This study presents detection of rare Bombay Oh phenotype patients and their management by acute peri-operative acute normovolemic hemodilution (ANH) in a hospital from central India. Materials and Methods: Blood grouping of patients and blood donors with a standard tube method was carried out and samples identified as rare Bombay phenotype were confirmed by saliva inhibition test. Surgical management of cases needing transfusion was done by ANH, as per the British Committee for Standards in Hematology guidelines. Results: The incidence of Bombay phenotype was 0.002% or 1 in 51,924 in the study. Amongst three cases (patients) identified as Bombay phenotype, one was Bombay Oh, Rh negative. Two cases were missed in the first instance and one case actually did not require transfusion. In the absence of a blood donor registry for Bombay phenotype, the cases needing transfusion were successfully managed with ANH in the operation theatre. Conclusion: A simple test like blood grouping should be done with serious intention with incorporation of both forward and reverse grouping, so that no patient receives wrong blood leading to fatal hemolysis due to transfusion. ANH is a cost-effective transfusion option for suitable patients. Appropriate clinical decision making, use of strategies to decrease peri-operative blood losses and cost-effective country based planning could be more widely applied to improve clinical transfusion practice. PMID:25722578

  11. Detection of rare blood group, Bombay (Oh) phenotype patients and management by acute normovolemic hemodilution.

    PubMed

    Shrivastava, Manisha; Navaid, Seema; Peethambarakshan, A; Agrawal, Kalpana; Khan, Athar

    2015-01-01

    Due to lack of correct blood grouping practices, the rare Bombay Oh phenotype may be missed, subjecting patients to the risk of severe hemolytic transfusion reaction. In the absence of blood donor registry, transfusion management of patients needing immediate surgery is a challenge. This study presents detection of rare Bombay Oh phenotype patients and their management by acute peri-operative acute normovolemic hemodilution (ANH) in a hospital from central India. Blood grouping of patients and blood donors with a standard tube method was carried out and samples identified as rare Bombay phenotype were confirmed by saliva inhibition test. Surgical management of cases needing transfusion was done by ANH, as per the British Committee for Standards in Hematology guidelines. The incidence of Bombay phenotype was 0.002% or 1 in 51,924 in the study. Amongst three cases (patients) identified as Bombay phenotype, one was Bombay Oh, Rh negative. Two cases were missed in the first instance and one case actually did not require transfusion. In the absence of a blood donor registry for Bombay phenotype, the cases needing transfusion were successfully managed with ANH in the operation theatre. A simple test like blood grouping should be done with serious intention with incorporation of both forward and reverse grouping, so that no patient receives wrong blood leading to fatal hemolysis due to transfusion. ANH is a cost-effective transfusion option for suitable patients. Appropriate clinical decision making, use of strategies to decrease peri-operative blood losses and cost-effective country based planning could be more widely applied to improve clinical transfusion practice.

  12. An outbreak of duck viral enteritis (duck plague) in domestic Muscovy ducks (Cairina moschata domesticus) in Illinois.

    PubMed

    Campagnolo, E R; Banerjee, M; Panigrahy, B; Jones, R L

    2001-01-01

    Duck viral enteritis (DVE) was diagnosed in an outbreak of the disease in a resident population of Muscovy ducks (Cairina moschata domesticus) on a privately owned multispecies game bird production facility in Illinois, where it claimed 625 ducks. This disease condition had not been reported previously in domestic ducks in Illinois. Although other varieties and age groups of domestic waterfowl (i.e., black ducks, rhumen ducks, Pekin ducks, ducklings, and geese) were present on the game bird farm, the morbidity and mortality (100%) in this epornitic was solely limited to adult ducks of the Muscovy lineage. The clinical signs in the affected ducks were lethargy, diarrhea, dehydration, and death within 2-3 hr of onset of symptoms. Gross pathologic changes were nonspecific and included ecchymotic hemorrhage, effusion of fluid and blood within body cavities reflective of an acute systemic infectious disease. Light microscopic findings were necrosis of primarily digestive lining epithelium and variable lymphohistiocytic infiltration within mucosal and serosal connective tissues. Intranuclear inclusions resembling characteristic herpetic (i.e., Cowdry type A) inclusions were observed primarily in the digestive, respiratory, and reproductive tracts; liver; and spleen. Esophageal candidiasis, bacteriosis, and systemic Pasteurella anatipestifer infections, thought to be concurrent or opportunistic infections, were present in several ducks. DVE virus was demonstrated in infected Muscovy duck embryo fibroblast cells by direct DVE virus-specific fluorescent antibody staining.

  13. Behaviour and ecology of sea ducks

    USGS Publications Warehouse

    Goudie, R. Ian; Petersen, Margaret R.; Robertson, Gregory J.

    1999-01-01

    In November 1995... a full-day symposium on the biology of sea ducks was held. The papers in this volume were presented at this symposium. It is hoped that by synthesizing this information, more informed management decisions for sea ducks may emerge. The symposium contents help to emphasize the seriousness of some conservation issues facing sea ducks, notably the possible endangerment of the eastern population of Barrow's Goldeneye and the dwindling number of eider ducks in the Nearctic, while also providing new data on the behaviour and habitat use of this beautiful group of ducks.

  14. Mortality from duck plague virus in immunosuppressed adult mallard ducks

    SciTech Connect

    Goldberg, D.R.; Yuill, T.M.; Burgess, E.C. )

    1990-07-01

    Environmental contaminants contain chemicals that, if ingested, could affect the immunological status of wild birds, and in particular, their resistance to infectious disease. Immunosuppression caused by environmental contaminants, could have a major impact on waterfowl populations, resulting in increased susceptibility to contagious disease agents. Duck plague virus has caused repeated outbreaks in waterfowl resulting in mortality. In this study, several doses of cyclophosphamide (CY), a known immunosuppressant, were administered to adult mallards (Anas platyrhynchos) to determine if a resultant decrease in resistance to a normally sub-lethal strain of duck plague virus would occur, and induce mortality in these birds. Death occurred in birds given CY only, and in birds given virus and CY, but not in those given virus only. There was significantly greater mortality and more rapid deaths in the duck plague virus-infected groups than in groups receiving only the immunosuppressant. A positively correlated dose-response effect was observed with CY mortalities, irrespective of virus exposure. A fuel oil and a crude oil, common environmental contaminants with immunosuppressive capabilities, were tested to determine if they could produce an effect similar to that of CY. Following 28 days of oral oil administration, the birds were challenged with a sub-lethal dose of duck plague virus. No alteration in resistance to the virus (as measured by mortality) was observed, except in the positive CY control group.

  15. Mortality from duck plague virus in immunosuppressed adult mallard ducks

    USGS Publications Warehouse

    Goldberg, D.R.; Yuill, Thomas M.; Burgess, E.C.

    1990-01-01

    Environmental contaminants contain chemicals that, if ingested, could affect the immunological status of wild birds, and in particular, their resistance to infectious disease. Immunosuppression caused by environmental contaminants, could have a major impact on waterfowl populations, resulting in increased susceptibility to contagious disease agents. Duck plague virus has caused repeated outbreaks in waterfowl resulting in mortality. In this study, several doses of cyclophosphamide (CY), a known immunosuppressant, were administered to adult mallards (Anas platyrhynchos) to determine if a resultant decrease in resistance to a normally sub-lethal strain of duck plague virus would occur, and induce mortality in these birds. Death occurred in birds given CY only, and in birds given virus and CY, but not in those given virus only. There was significantly greater mortality and more rapid deaths in the duck plague virus-infected groups than in groups receiving only the immunosuppressant. A positively correlated dose-response effect was observed with CY mortalities, irrespective of virus exposure. A fuel oil and a crude oil, common environmental contaminants with immunosuppressive capabilities, were tested to determine if they could produce an effect similar to that of CY. Following 28 days of oral oil administration, the birds were challenged with a sub-lethal dose of duck plague virus. No alteration in resistance to the virus (as measured by mortality) was observed, except in the positive CY control group.

  16. The pathogenicity of novel duck reovirus in Cherry Valley ducks.

    PubMed

    Li, Ning; Hong, Tianqi; Wang, Yao; Wang, Youling; Yu, Kexiang; Cai, Yumei; Liu, Sidang; Wei, Liangmeng; Chai, Tongjie

    2016-08-30

    The novel duck reovirus (NDRV) is an emerging, contagious infection. To better realize the pathogenic mechanism of NDRV in ducks, an infection experiment was conducted. The resulting data demonstrated that typical gross lesions were observed in the infected ducks. NDRV was able to replicate in various tissues, leading to these pathological lesions, especially on the liver and spleen. Real-time quantitative PCR showed that the expression of most innate immune-related genes was up-regulated and the antiviral innate immune response could be established in both the liver and spleen. This study indicates that NDRV is a pantropic virus. To resist viral infection, several pathogen recognition receptors can cooperatively recognize NDRV and initiate innate immunity, but the responses are different between different tissues. As far as we know, this is the first systematic investigation of the pathogenicity of NDRV in Cherry Valley ducks based on the host's innate immunity, and these data will provide new insights into the further study of the disease.

  17. Perioperative management of patient with Bombay blood group undergoing mitral valve replacement

    PubMed Central

    Priye, Shio; Sathyanarayan, J; Shivaprakash, S; Reddy, Durgaprasad

    2015-01-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of stenotic mitral valve with Bombay phenotype who underwent minimal invasive right lateral thoracotomy for the replacement of the mitral valve. A male patient from Bangladesh presented to the hospital with New York Heart Association III symptoms. His medical evaluation revealed severe mitral valve stenosis and mild aortic valve regurgitation. The patient received erythropoietin, intravenous iron succinate and folic acid tablets. Autologous blood transfusion was carried out. The mitral valve was replaced with a prosthetic valve successfully. After weaning off from cardiopulmonary bypass, heparinisation was corrected with protamine. Post-operatively, the patient received autologous red blood cells. The patient recovered after 1-day of inotropic support with adrenaline and milrinone, and diuretics and was discharged on the 5th post-operative day. PMID:26903676

  18. Perioperative management of patient with Bombay blood group undergoing mitral valve replacement.

    PubMed

    Priye, Shio; Sathyanarayan, J; Shivaprakash, S; Reddy, Durgaprasad

    2015-12-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of stenotic mitral valve with Bombay phenotype who underwent minimal invasive right lateral thoracotomy for the replacement of the mitral valve. A male patient from Bangladesh presented to the hospital with New York Heart Association III symptoms. His medical evaluation revealed severe mitral valve stenosis and mild aortic valve regurgitation. The patient received erythropoietin, intravenous iron succinate and folic acid tablets. Autologous blood transfusion was carried out. The mitral valve was replaced with a prosthetic valve successfully. After weaning off from cardiopulmonary bypass, heparinisation was corrected with protamine. Post-operatively, the patient received autologous red blood cells. The patient recovered after 1-day of inotropic support with adrenaline and milrinone, and diuretics and was discharged on the 5(th) post-operative day.

  19. Duck shooting injuries in Southland, New Zealand.

    PubMed

    Watts, Martin; Densie, Ian

    2013-05-10

    Duck shooting is a common sport in New Zealand. The opening weekend is anticipated and celebrated, often with significant alcohol intake which is cause for concern, and potentially very dangerous. Hunters are annually warned about the dangers. There have been few duck shooting incidents which lead to injury or death. In the last decade two duck shooters in New Zealand have been killed, while 16 suffered non fatal gunshot injuries. We present a series of injuries identified during the 2012 duck shooting season in Southland Province.

  20. Identification of six new alleles at the FUT1 and FUT2 loci in ethnically diverse individuals with Bombay and Para-Bombay phenotypes.

    PubMed

    Storry, Jill R; Johannesson, Jannica S; Poole, Joyce; Strindberg, Johanna; Rodrigues, Maria J; Yahalom, Vered; Levene, Cyril; Fujita, Claudia; Castilho, Lilian; Hustinx, Hein; Olsson, Martin L

    2006-12-01

    The Bombay and para-Bombay phenotypes arise from mutations of the FUT1 gene that silence the gene or affect the efficiency of the encoded 2-alpha-fucosyltransferase. Samples from seven individuals of different geographic backgrounds whose red blood cells had an apparent Bombay or para-Bombay phenotype were investigated. Among these, novel FUT1 and FUT2 alleles were identified. Standard serologic techniques were used. Genomic DNA was sequenced with primers that amplified the coding sequence of FUT1 and the related secretor gene, FUT2. Routine ABO genotyping analysis was performed. Five new FUT1 alleles were identified that silenced FUT1 or weakened alpha2FucT1 activity. These were 35C>T, 269G>T (Ala11Val, Gly89Val); 421A>G (Trp140Stop); 538C>T, 1089T>G (Gln180Stop, Ala363Ala); 689A>C (Gln230Pro); and 917C>T (Thr305Ile). In addition, both homozygosity and heterozygosity for the previously reported mutation, 826C>T (Gln276Stop), were observed. Four of seven samples were homozygous for the silencing mutation 428A in FUT2. One new FUT2 allele was identified: 278C>T, 357C>T (Ala93Val, Asn119Asn). These results add to the growing database of apparently sporadic and random mutations in the FUT1 gene and confirm previous reports regarding the lack of ethnic bias. In contrast, our data reinforce the apparent maintenance of the common nonsecretor FUT2 alleles in the population.

  1. [Fut1 gene mutation for para-bombay blood type individual in Fujian Province of China].

    PubMed

    Huang, Hao-Bou; Fan, Li-Ping; Wai, Shi-Jin; Zeng, Feng; Lin, Hai-Yan; Zhang, Rong

    2010-10-01

    This study was aimed to investigate the molecular mechanisms for para-Bombay blood type individual in Fujian Province of China. The para-Bombay blood type of this individual was identified by routine serological techniques. The full coding region of alpha (1,2) fucosyltransferase (FUT1) gene of this individual was amplified by polymerase chain reaction (PCR), then the PCR product was cloned into T vector. The mutation in coding region of fut1 gene was identified by TA cloning, so as to explore the molecular mechanisms for para-Bombay blood type individual. The results indicated that the full coding region of fut1 gene was successfully amplified by PCR. AG deletion at position 547-552 on 2 homologous chromosomes was detected by TA cloning method, leading to a reading frame shift and a premature stop codon. It is concluded that genetic mutation of fut1 gene in this para-bombay blood type individual was h1h1 homozygotic type.

  2. The clinical significance of anti-H in an individual with the Oh (Bombay) phenotype.

    PubMed

    Davey, R J; Tourault, M A; Holland, P V

    1978-01-01

    To evaluate the clinical significance of anti-H present in individuals with the Oh (Bombay) phenotype, red blood cell 51chromium survival studies and related serological tests were undertaken in an Oh (Bombay) individual. A small sample of group O donor red blood cells was labeled with 51chromium and infused into the patient. The T 1/2 of the infused cells was six minutes, with two percent of the cells surviving at 24 hours. A similar study using the patient's own labeled red blood cells demonstrated 100 per cent survival at 24 hours. Initial laboratory studies indicated that the anti-H was active in saline at 4, 22 and 37 C and by the indirect antiglobulin test. Analysis of the antibody in both preand posttransfusion specimens showed it to have both IgM and IgG components. The anti-H titer at 37 C rose from 1:4 prior to the infusion of the O cells to 1:32 one week postinfusion, and a partial hemolysin appeared. Saliva inhibition studies demonstrated that the antibody was neutralizable prior to the group O exposure but was not neutralizable one week post exposure. We conclude that the anti-H present in this individual rapidly destroyed infused group O red blood cells. Individuals with the Oh (Bombay) phenotype should be transfused only with Oh (Bombay) blood.

  3. Bombay blood group: Is prevalence decreasing with urbanization and the decreasing rate of consanguineous marriage.

    PubMed

    Mallick, Sujata; Kotasthane, Dhananjay S; Chowdhury, Puskar S; Sarkar, Sonali

    2015-01-01

    Bombay blood group although rare is found to be more prevalent in the Western and Southern states of India, believed to be associated with consanguineous marriage. To estimate the prevalence of the Bombay blood group (Oh) in the urban population of Puducherry. To find the effect of urbanization on consanguineous marriage and to establish whether consanguinity plays a part in the prevalence of Oh group. To compare Oh group prevalence with that of other neighboring states, where population is not predominantly urban. This is a descriptive study in a tertiary care hospital in Puducherry, over a period of 6 years. All blood samples showing 'O' group were tested with anti-H lectin. Specialized tests like Adsorption Elution Technique, inhibition assay for determination of secretor status were performed on Oh positive cases. Any history of consanguineous marriage was recorded. All variables were categorical variable and percentage and proportions were calculated manually. Analysis of the results of 35,497 study subjects showed that the most common group was 'O' group constituting 14,164 (39.90%) of subjects. Only three "Oh" that is, Bombay phenotype (0.008%) were detected. Consanguinity was observed in two cases (66.66%). This study shows the prevalence of Bombay blood group representing the urban population of Puducherry, to be high (0.008%) and associated with consanguineous marriage (66.66%). Thus, consanguinity is still an important risk factor present, even in an urban population in Southern India.

  4. [Heart surgery in a female patient with blood group Oh (Bombay phenotype)].

    PubMed

    Schricker, K T; Neidhardt, B; Hacker, R; Kail, R

    1983-01-14

    A 62-year-old woman with stenosing coronary artery disease had the rare blood group Oh (Bombay phenotype). After prophylactic deep-freeze conservation of autologous blood, direct myocardial revascularization was successfully accomplished under extracorporeal circulation. Three deep-freeze units of erythrocyte concentrates were used. Both operation and postoperative wound healing progressed without complication.

  5. A case of Oh (Bombay) blood found in a Thai-Muslim patient.

    PubMed

    Sringarm, S; Sombatpanich, B; Chandanayingyong, D

    1977-12-01

    This is a report of a case of an inherited Lewis a + b - Oh (Bombay) blood found in a Thai-Muslim patient. The propositus and her brother inherited the suppressant xx (or hh) genes from her parents; the gene frequency could not be surveyed.

  6. Beyond the Beaten Track: Resettlement Initiatives of Pavement Dwellers and Slum Dwellers in Bombay.

    ERIC Educational Resources Information Center

    Patel, Sheela

    1988-01-01

    The Society for Promotion of Adult Resource Centres was created to alleviate the problem of railway settlement families and pavement dwellers in Bombay, India. The area resource center provides information, analysis of available resources, discussion of problems, and sharing of experiences. (JOW)

  7. Beyond the Beaten Track: Resettlement Initiatives of Pavement Dwellers and Slum Dwellers in Bombay.

    ERIC Educational Resources Information Center

    Patel, Sheela

    1988-01-01

    The Society for Promotion of Adult Resource Centres was created to alleviate the problem of railway settlement families and pavement dwellers in Bombay, India. The area resource center provides information, analysis of available resources, discussion of problems, and sharing of experiences. (JOW)

  8. Blood parasites of wood ducks

    USGS Publications Warehouse

    Herman, C.M.; Knisley, J.O.; Knipling, G.D.

    1971-01-01

    Examination of blood films from wood ducks (Aix sponsa) from several northeastern states revealed Haemoproteus, Leucocytozoon, Plasmodium and a typanosome. Haemoproteus occurred in all areas sampled and birds of the year from Massachusetts demonstrated the highest incidence during the last 2 weeks in August. Leucocytozoon was most prevalent in more northern areas. P. circumflexum and a trypanosome are reported for the first time from this host.

  9. Two prevalent h alleles in para-Bombay haplotypes among 250,000 Taiwanese.

    PubMed

    Chen, Ding-Ping; Tseng, Ching-Ping; Wang, Wei-Ting; Peng, Chien-Ting; Tsao, Kuo-Chien; Wu, Tsu-Lan; Lin, Kuan-Tsou; Sun, Chien-Feng

    2004-01-01

    Alpha(1,2)-fucosyltransferase catalyzes the transfer of fucose to the C-2 position of galactose on type II precursor substrate Gal beta1-4GlcNAc beta1-R. It plays an important biological role in the formation of H antigen, a precursor oligosaccharide for both A and B antigens on red blood cells. Aberration of alpha(1,2)-fucosyltransferase activity by gene mutations results in decreased synthesis of H antigen, leading to the para-Bombay phenotype. In this study, we collected about 250,000 blood samples in Taiwan during 5 yr and identified the subjects with para-Bombay phenotype. Then we analyzed the sequence of the alpha(1,2)-fucosyltransferase gene by direct sequencing and gene cloning methods, using the blood samples of 30 para-Bombay individuals and 30 control subjects who were randomly selected. The goals of this study were to search for new h alleles, to determine the h allele frequencies, and to test whether the sporadic theory is applicable in Taiwan. Six different h alleles (ha, 547-548 AG-del; hb, 880-881 TT-del; hc, R220C; hd, R220H; he, F174L; and hf, N327T) were observed. Two h alleles, he and hf, were newly discovered in Taiwan. The he allele has a nucleotide 522C>A point mutation, predicting the amino acid 174 substitution of Phe to Leu; the hf allele has missense mutation of nucleotide 980A>C, predicting the amino acid 327 substitution of Asn to Thr. Frequencies of the 6 alleles are ha 46.67%, hb 38.33%, hc 5.00%, hd 1.67%, he 3.33%, and hf 5.00%, respectively. These findings in the Taiwanese population confirm previous observations in other populations that the Bombay and para-Bombay phenotypes are due to diverse, sporadic, nonfunctional alleles, predominantly ha and hb, leading to H deficiency of red blood cells. In contrast to previous reports of non-prevalent associations of h alleles with para-Bombay phenotype, our results suggest a regional allele preference associated with para-Bombay individuals in Taiwan.

  10. Blood transfusion in the para-Bombay phenotype.

    PubMed

    Lin-Chu, M; Broadberry, R E

    1990-08-01

    The H-deficient phenotypes found in Chinese so far, have all been secretors of soluble blood group substances in saliva. The corresponding isoagglutinin activity (e.g. anti-B in OB(Hm) persons) has been found to be weak in all cases. To determine the clinical significance of these weak isoagglutinins 51Cr red cell survival tests were performed on three OB(Hm) individuals transfused with small volumes (4 ml) of groups B and O RBC. Rapid destruction of most of the RBC occurred whether or not the isoagglutinins of the OB(Hm) individuals were indirect antiglobulin test (IAGT) reactive. When a larger volume (54 ml packed RBC) of group B cells (weakly incompatible by IAGT) was transfused to another OB(Hm) individual with IAGT active anti-HI, the survival of the transfused RBC was 93% at 24 h, with 30% of the RBC remaining in the circulation at 28 d in contrast to 76% as would be expected if the survival was normal. Therefore when whole units of blood of normal ABO blood groups, compatible by IAGT, are transfused, the survival is expected to be almost normal. These weak isoagglutinins may not be very clinically significant and we suggest that when para-Bombay blood is not available, the compatibility testing for OA(Hm) persons should be performed with group A and group O packed RBC; OB(Hm) with group B and group O packed RBC: OAB(Hm) with groups A, B, AB and O packed RBC. For cross matching, the indirect antiglobulin test by a prewarmed technique should be used.

  11. Hybridization between white-headed ducks and introduced ruddy ducks in Spain.

    PubMed

    Muñoz-Fuentes, V; Vilà, C; Green, A J; Negro, J J; Sorenson, M D

    2007-02-01

    The ruddy duck, Oxyura jamaicensis, was introduced to Great Britain in the mid-20th century and has recently spread to other Western European countries. In Spain, ruddy ducks hybridize with the globally endangered white-headed duck, Oxyura leucocephala. We assessed the effects of hybridization on the Spanish white-headed ducks, which constitute 25% of the global population of this species, using a panel of eight nuclear intron markers, 10 microsatellite loci, and mtDNA control region sequences. These data allowed parental individuals, F(1) hybrids, and the progeny of backcrossing to be reliably distinguished. We show that hybrids between the two species are fertile and produce viable offspring in backcrosses with both parental species. To date, however, we found no extensive introgression of ruddy duck genes into the Spanish white-headed duck population, probably due to the early implementation of an effective ruddy duck and hybrid control programme. We also show that genetic diversity in the expanding European ruddy duck population, which was founded by just seven individuals, exceeds that of the native Spanish white-headed duck population, which recently recovered from a severe bottleneck. Unless effective control of ruddy ducks is continued, genetic introgression will compromise the unique behavioural and ecological adaptations of white-headed ducks and consequently their survival as a genetically and evolutionary distinct species.

  12. Action of glycosyl transferases upon "Bombay" (Oh) erythrocytes. Conversion to cells showing blood-group H and A specificities.

    PubMed

    Schenkel-Brunner, H; Prohaska, R; Tuppy, H

    1975-08-15

    Individuals of the rare "Bombay" (Oh) blood-group phenotype lacking, due to a genetic defect, the alpha(1-2)fucosyl transferase, which is responsible for converting blood-group H precursor substances to H-specific structures. Treatment with GDP-fucose and alpha(1-2)fucosyl transferase prepared from gastric mucosa of O individuals to transform native or ficin-treated "Bombay" erythrocytes into cells phenotypically resembling O cells. The transformation was achieved, however, after prior incubation of the "Bombay" erythrocytes with neuraminidase, indicating that blood-group H precursor molecules on the surface of these cells are masked by sialyl residues. Blood-group A specificity was conferred upon neuraminidase-treated "Bombay" cells by enzymatic transfer of alpha-N-acetylgalactosamine residues, in addition to alpha-fucose residues.

  13. Effect of age on the pathogenesis of duck tembusu virus in Cherry Valley ducks

    PubMed Central

    Li, Ning; Lv, Chuanwei; Yue, Ruichao; Shi, Ying; Wei, Liangmeng; Chai, Tongjie; Liu, Sidang

    2015-01-01

    The effect of host age on the outcome of duck tembusu virus (DTMUV) infection was studied in ducks. Three groups of Cherry Valley ducks at 1, 3, and 7 weeks of age were intramuscularly infected with DTMUV to systematically observe the clinical symptoms, pathological changes, tissue viral loads, and immune responses. Severe clinical symptoms and neurological dysfunction were observed in 1-week-old ducks as early as 2 days post infection (dpi) and some died at 5–7 dpi. Three weeks-old ducks showed similar but milder symptoms and no deaths. However, 7-weeks-old ducks showed only transient loss of appetite. Gross lesions gradually reduced in severity as ducks matured. One-week-old ducks showed endocardial hemorrhage, splenomegaly, swelling in the lymph follicles of the ileum, liver, and kidney swelling with degeneration, and meningeal hyperemia. Three-weeks-old ducks showed only mild pathological lesions. No visible lesions were observed in 7-weeks-old ducks. However, pathological histology analysis demonstrated all infected ducks displayed viral encephalitis. DTMUV could be detected in the brains of 1-week-old ducks as early as 1 dpi and virus titers of most organs in 1-week-old ducks were significantly higher than that of 3- and 7-weeks-old ducks at 3–5 dpi. The patterns of IFN-γ, IL-2, and serum neutralizing antibodies were similar, and there were significant difference between the youngest ducks and the older ducks at early infection stage (P < 0.05). More important is that although the antibody titers of all infected ducks were similar from 9 to 17 dpi, reduced clearance of virus was observed in the youngest groups comparing with the other two groups, indicating that immune system maturity was more important than the presence of neutralizing antibody. In summary, this study demonstrates that viral pathogenesis is strongest in 1-week-old ducks and the age-related immune response plays an important role in the pathogenesis of DTMUV in ducks. PMID:26106382

  14. Effect of age on the pathogenesis of duck tembusu virus in Cherry Valley ducks.

    PubMed

    Li, Ning; Lv, Chuanwei; Yue, Ruichao; Shi, Ying; Wei, Liangmeng; Chai, Tongjie; Liu, Sidang

    2015-01-01

    The effect of host age on the outcome of duck tembusu virus (DTMUV) infection was studied in ducks. Three groups of Cherry Valley ducks at 1, 3, and 7 weeks of age were intramuscularly infected with DTMUV to systematically observe the clinical symptoms, pathological changes, tissue viral loads, and immune responses. Severe clinical symptoms and neurological dysfunction were observed in 1-week-old ducks as early as 2 days post infection (dpi) and some died at 5-7 dpi. Three weeks-old ducks showed similar but milder symptoms and no deaths. However, 7-weeks-old ducks showed only transient loss of appetite. Gross lesions gradually reduced in severity as ducks matured. One-week-old ducks showed endocardial hemorrhage, splenomegaly, swelling in the lymph follicles of the ileum, liver, and kidney swelling with degeneration, and meningeal hyperemia. Three-weeks-old ducks showed only mild pathological lesions. No visible lesions were observed in 7-weeks-old ducks. However, pathological histology analysis demonstrated all infected ducks displayed viral encephalitis. DTMUV could be detected in the brains of 1-week-old ducks as early as 1 dpi and virus titers of most organs in 1-week-old ducks were significantly higher than that of 3- and 7-weeks-old ducks at 3-5 dpi. The patterns of IFN-γ, IL-2, and serum neutralizing antibodies were similar, and there were significant difference between the youngest ducks and the older ducks at early infection stage (P < 0.05). More important is that although the antibody titers of all infected ducks were similar from 9 to 17 dpi, reduced clearance of virus was observed in the youngest groups comparing with the other two groups, indicating that immune system maturity was more important than the presence of neutralizing antibody. In summary, this study demonstrates that viral pathogenesis is strongest in 1-week-old ducks and the age-related immune response plays an important role in the pathogenesis of DTMUV in ducks.

  15. D.U.C.K. Walking.

    ERIC Educational Resources Information Center

    Steller, Jenifer J.

    This manual presents a schoolwide walking program that includes aerobic fitness information, curriculum integration, and walking tours. "Discover and Understand Carolina Kids by Walking" is D.U.C.K. Walking. An aerobic walking activity, D.U.C.K. Walking has two major goals: (1) to promote regular walking as a way to exercise at any age;…

  16. Effects of radio packages on wild ducks

    USGS Publications Warehouse

    Gilmer, D.S.; Ball, I.J.; Cowardin, L.M.; Riechmann, J.H.

    1974-01-01

    A total of 211 wild, free-flying mallards (Anas platyrhynchos) and wood ducks (Aix sponsa) were equipped with breast-mounted radio packages during the breeding seasons of 1968-72. Known predation loss was 7.6 and 12.0 percent for mallards and wood ducks respectively, 60 percent occurred within 3 weeks of instrumentation. The highest predation rate for mallards was 0.0048 kills per tracking day and 0.0136 for wood ducks. A higher direct recovery rate for instrumented birds (19.5 percent) than noninstrumented birds (8.1 percent) was probably due to the novelty of the transmitter to hunters. Departure patterns and locations of direct recoveries were similar between radio-equipped and normal-banded birds. Among female wood ducks with radios, recovery rates were lower than expected. Hunters indicated that 84 percent of the instrumented ducks recovered were in good or excellent condition. Recaptures of ducks as long as 1 year after being equipped with radio packages indicated that feather wear and skin abrasion were not serious. A high rate for feeding on land by instrumented mallards was probably due to our ability to more easily locate and observe these birds in cover. Preening rates were higher for instrumented ducks. As the birds became adjusted to the package, preening decreased and feeding on water increased. Social and breeding behavior of instrumented ducks did not appear to be adversely affected by the radio package.

  17. Duck plague: a carrier state in waterfowl.

    PubMed

    Burgess, E C; Ossa, J; Yuill, T M

    1979-01-01

    Healthy waterfowl were found to be carriers of duck plague (DP) virus. Black ducks (Anas rubripes) and Canada geese (Branta canadensis) surviving a natural outbreak of DP at Coloma, Wisconsin, in 1973 yielded DP virus in cloacal swabs taken four years postinfection. Experimental infection of previously unexposed mallard ducks (Anas platyrhynochos) with the Coloma strain of DP virus CO-WI (73) also produced cloacal virus shedding for up to four years after infection. A second DP virus strain, LA-SD (73) from the Lake Andes, South Dakota, epornitic, was detected from cloacal swabs of pintail ducks (Anas acuta), gadwall ducks (Anas strepera), wood ducks (Aix sponsa), and Canada geese infected experimentally one year before. The frequency of swabs positive for DP virus varied between individuals within each of the tested species. The amount of detectable DP virus shed was about 100 plaqueforming units of virus percloacal swab. Oral erosions were present in all species tested except Canada geese and gadwall ducks. Erosions occurred at the openings of the sublingual salivary gland ducts. DP virus was isolated from erosions. All ducks with lesions proved to shed DP virus, although not necessarily at the time they had the lesion.

  18. Typhlocolitis associated with spirochaetes in duck flocks.

    PubMed

    Glávits, Róbert; Ivanics, Eva; Thuma, Akos; Kaszanyitzky, Eva; Samu, Péterné; Ursu, Krisztina; Dencso, László; Dán, Adám

    2011-02-01

    The aetiology of increased mortality observed in two breeder duck flocks (Flock A consisting of 3500 laying ducks and Flock B comprising 4300 laying ducks) during the first egg-laying season was studied. In Flocks A and B, 773 ducks and 715 ducks (18.4% and 16.6%) died within a 24-week and a 20-week period, respectively. Death was preceded by clinical signs including movement difficulties, lack of appetite and depression lasting for 1 to 2 days. Diarrhoea was not observed. On gross pathological examination, the ducks were found to have haemorrhagic to fibrinonecrotic typhlocolitis, renal degeneration accompanied by fibrosis and mineralization, hepatic and splenic amyloidosis, and swelling of some of the metatarsal and phalangeal joints. Histopathological and immunohistochemical examination consistently demonstrated spirochaetes in the mucous membrane of the affected large intestine. On the basis of their cultural and biochemical properties and polymerase chain reaction sequencing analysis, four out of seven spirochaete strains isolated from the ducks (Flock A) by culture on special media under anaerobic conditions were identified as Brachyspira hyodysenteriae, and five out of eight strains (Flock B) were identified as Brachyspira pilosicoli. This is the first report on the isolation of B. hyodysenteriae and B. pilosicoli from laying ducks affected by fibrinonecrotic typhlocolitis.

  19. Blood parasites from California ducks and geese

    USGS Publications Warehouse

    Herman, C.M.

    1951-01-01

    Blood smears were procured from 1,011 geese and ducks of 19 species from various locations in California. Parasites were found in 28 individuals. The parasites observed included Haemoproteus hermani, Leucocytozoon simondi, microfilaria, Plasmodium relictum (=P. biziurae), and Plasmodium sp. with elongate gametocytes. This is the first report of a natural infection with a Plasmodium in North American wild ducks.

  20. Sea ducks and aquaculture: the cadmium connection.

    PubMed

    Bendell, L I

    2011-03-01

    Elevated concentrations of cadmium have been reported in the kidneys of sea ducks that forage along the Pacific Northwest, and cadmium has been postulated as a possible cause of population declines. The blue mussel (Mytilus spp.) which occurs in dense numbers on aquaculture structures and are a primary prey item for sea ducks also contain elevated cadmium concentrations. To determine if foraging on mussels associated with aquaculture structures could pose a toxicological risk to sea ducks, amounts of cadmium ingested per body weight per day by a representative sea duck species, the surf scoter (Melanitta perspicillata), were estimated and compared to the reported avian cadmium NOAEL (no observable adverse effect level) and LOAEL (lowest observable adverse effect level). Results indicate that in some locations within the Pacific Northwest, sea ducks could be exposed to toxicologically significant levels of cadmium associated with mussels foraged from aquaculture structures. This raises the possibility that such exposure could be contributing to observed population declines in these species.

  1. Infectivity of Histomonas meleagridis in ducks.

    PubMed

    Callait-Cardinal, M P; Chauve, C; Reynaud, M C; Alogninouwa, T; Zenner, L

    2006-04-01

    The susceptibility of mule and muscovy ducks to "blackhead" disease caused by Histomonas meleagridis was studied, using an experimental intracloacal inoculation. Turkeys were used as controls. Morbidity, mortality and body weight gain were recorded regularly during the experiments. A direct examination of the caecal content was made to determine the absence or presence of the parasite. Gross and microscopic lesions were observed on days 7, 14, 21, 28 and 35 post infection to evaluate any clinical histomoniosis in ducks and to appraise the histomonad's carriage. A scoring system was developed both for gross and histological lesions of the caecum and liver. Infected mule and muscovy ducks (n = 83) never developed any clinical signs of histomoniasis. Weight gains of infected mule and muscovy ducks were similar to those of uninfected ducks. In 67% of the ducks (56/83), it was possible to demonstrate the parasite in the caecal content throughout the experiment. Typical macroscopic caecal lesions were observed in five of the ducks between days 7 and 21 post infection, with a caecal necropsy main lesion score (MLS = 1.6) less severe than that in turkeys (MLS = 2.9). Only caecal histological lesions occurred in six of the cases. Therefore, ducks do not seem to be a susceptible host for "blackhead" but may act as carrier animals for H. meleagridis. The virulence was apparently not changed, since 67% of turkeys (10/15) infected with the caecal content of positive ducks displayed classical signs of blackhead disease. Even if H. meleagridis alone does not represent a substantial danger in the duck production, its infectivity should to be taken into account in the transmission to more susceptible species.

  2. Survival and movements of molting male black ducks in Labrador

    USGS Publications Warehouse

    Bowman, Timothy D.; Longcore, J.R.

    1989-01-01

    We marked 26 flightless male American black ducks with transmitters during the post-nuptial molt in northern Labrabor to determine survival and movements. Twelve ducks remained in the watershed where marked and 11 ducks moved to different watersheds. The period survival rate (PSR) for these flightless males was 0.89 using the Kaplan-Meier estimator. Only 2 ducks were killed by predators. Death of these 2 ducks might have been influenced by our disturbance, thus we considered the PSR minimal.

  3. Experimental infection of duck origin virulent Newcastle disease virus strain in ducks.

    PubMed

    Dai, Yabin; Cheng, Xu; Liu, Mei; Shen, Xinyue; Li, Jianmei; Yu, Shengqing; Zou, Jianmin; Ding, Chan

    2014-07-17

    Newcastle disease (ND) caused by virulent Newcastle disease virus (NDV) is an acute, highly contagious and fatal viral disease affecting most species of birds. Ducks are generally considered to be natural reservoirs or carriers of NDV while being resistant to NDV strains, even those most virulent for chickens; however, natural ND cases in ducks have been gradually increasing in recent years. In the present study, ducks of different breeds and ages were experimentally infected with duck origin virulent NDV strain duck/Jiangsu/JSD0812/2008 (JSD0812) by various routes to investigate the pathogenicity of NDV in ducks. Six breeds (mallard, Gaoyou, Shaoxing, Jinding, Shanma, and Pekin ducks) were infected intramuscularly (IM) with JSD0812 strain at the dose of 5 × 108 ELD50. Susceptibility to NDV infection among breeds varied, per morbidity and mortality. Mallard ducks were the most susceptible, and Pekin ducks the most resistant. Fifteen-, 30-, 45-, 60-, and 110-day-old Gaoyou ducks were infected with JSD0812 strain at the dose of 5 × 108 ELD50 either IM or intranasally (IN) and intraocularly (IO), and their disease development, viral shedding, and virus tissue distribution were determined. The susceptibility of ducks to NDV infection decreased with age. Most deaths occurred in 15- and 30-day-old ducklings infected IM. Ducks infected IN and IO sometimes exhibited clinical signs, but seldom died. Clinical signs were primarily neurologic. Infected ducks could excrete infectious virus from the pharynx and/or cloaca for a short period, which varied with bird age or inoculation route; the longest period was about 7 days. The rate of virus isolation in tissues from infected ducks was generally low, even in those from dead birds, and it appeared to be unrelated to bird age and infection route. The results confirmed that some of the naturally occurring NDV virulent strains can cause the disease in ducks, and that ducks play an important role in the epidemiology of ND. The

  4. Experimental infection of duck origin virulent Newcastle disease virus strain in ducks

    PubMed Central

    2014-01-01

    Background Newcastle disease (ND) caused by virulent Newcastle disease virus (NDV) is an acute, highly contagious and fatal viral disease affecting most species of birds. Ducks are generally considered to be natural reservoirs or carriers of NDV while being resistant to NDV strains, even those most virulent for chickens; however, natural ND cases in ducks have been gradually increasing in recent years. In the present study, ducks of different breeds and ages were experimentally infected with duck origin virulent NDV strain duck/Jiangsu/JSD0812/2008 (JSD0812) by various routes to investigate the pathogenicity of NDV in ducks. Results Six breeds (mallard, Gaoyou, Shaoxing, Jinding, Shanma, and Pekin ducks) were infected intramuscularly (IM) with JSD0812 strain at the dose of 5 × 108 ELD50. Susceptibility to NDV infection among breeds varied, per morbidity and mortality. Mallard ducks were the most susceptible, and Pekin ducks the most resistant. Fifteen-, 30-, 45-, 60-, and 110-day-old Gaoyou ducks were infected with JSD0812 strain at the dose of 5 × 108 ELD50 either IM or intranasally (IN) and intraocularly (IO), and their disease development, viral shedding, and virus tissue distribution were determined. The susceptibility of ducks to NDV infection decreased with age. Most deaths occurred in 15- and 30-day-old ducklings infected IM. Ducks infected IN and IO sometimes exhibited clinical signs, but seldom died. Clinical signs were primarily neurologic. Infected ducks could excrete infectious virus from the pharynx and/or cloaca for a short period, which varied with bird age or inoculation route; the longest period was about 7 days. The rate of virus isolation in tissues from infected ducks was generally low, even in those from dead birds, and it appeared to be unrelated to bird age and infection route. Conclusions The results confirmed that some of the naturally occurring NDV virulent strains can cause the disease in ducks, and that ducks play an important

  5. Duck plague: carrier state and gross pathology in black ducks

    USGS Publications Warehouse

    Ossa, Jorge E.

    1975-01-01

    Duck plague (UP) is a highly fatal disease of ducks, geese, and swans (family Anatidae), produced by a reticulo-endotheliotrophic virus classified as a member of the Herpesvirus group. The disease was recognized in Europe in 1949. On the American continent, the disease was first diagnosed in the United States in 1967. Very little is known of DP virus ecology, particularly of the mechanisms of interepizootic survival and movement. The tendency of the IIerpesviruses to enter into a quiescent state after an overt or inapparent infection is a proven characteristic for most of the members of this group. Herpes simplex, which is the model of the Herpesviruses, is said to be the classical example of a persistent recurrent viral infection. Burnet and Williams (4) were the first to recognize this kind of relationship between herpes simplex and its host in 1939. Later, it was found that the reactivation of the virus can be brought on by a variety of stimuli either physiological (menstruation), pathological (anaphylactic shock), chemical (pesticides) or physical (sunburn). This same latency property has been proved for every member of this group of viruses which has been studied adequately, DP is among the few Herpesviruses for which the carrier state has not been demonstrated, but there is circumstantial evidence suggesting it. The carrier state for DP seems to be a likely explanation for the persistence and the particular pattern of movement of this disease.

  6. Avian Influenza Ecology in North Atlantic Sea Ducks: Not All Ducks Are Created Equal.

    PubMed

    Hall, Jeffrey S; Russell, Robin E; Franson, J Christian; Soos, Catherine; Dusek, Robert J; Allen, R Bradford; Nashold, Sean W; TeSlaa, Joshua L; Jónsson, Jón Eínar; Ballard, Jennifer R; Harms, Naomi Jane; Brown, Justin D

    2015-01-01

    Wild waterfowl are primary reservoirs of avian influenza viruses (AIV). However the role of sea ducks in the ecology of avian influenza, and how that role differs from freshwater ducks, has not been examined. We obtained and analyzed sera from North Atlantic sea ducks and determined the seroprevalence in those populations. We also tested swab samples from North Atlantic sea ducks for the presence of AIV. We found relatively high serological prevalence (61%) in these sea duck populations but low virus prevalence (0.3%). Using these data we estimated that an antibody half-life of 141 weeks (3.2 years) would be required to attain these prevalences. These findings are much different than what is known in freshwater waterfowl and have implications for surveillance efforts, AIV in marine environments, and the roles of sea ducks and other long-lived waterfowl in avian influenza ecology.

  7. Avian influenza ecology in North Atlantic sea ducks: Not all ducks are created equal

    USGS Publications Warehouse

    Hall, Jeffrey S.; Russell, Robin E.; Franson, J. Christian; Soos, Catherine; Dusek, Robert J.; Allen, R. Bradford; Nashold, Sean W.; Teslaa, Joshua L.; Jónsson, Jón Einar; Ballard, Jennifer R.; Harms, Naomi Jnae; Brown, Justin D.

    2015-01-01

    Wild waterfowl are primary reservoirs of avian influenza viruses (AIV). However the role of sea ducks in the ecology of avian influenza, and how that role differs from freshwater ducks, has not been examined. We obtained and analyzed sera from North Atlantic sea ducks and determined the seroprevalence in those populations. We also tested swab samples from North Atlantic sea ducks for the presence of AIV. We found relatively high serological prevalence (61%) in these sea duck populations but low virus prevalence (0.3%). Using these data we estimated that an antibody half-life of 141 weeks (3.2 years) would be required to attain these prevalences. These findings are much different than what is known in freshwater waterfowl and have implications for surveillance efforts, AIV in marine environments, and the roles of sea ducks and other long-lived waterfowl in avian influenza ecology.

  8. Avian Influenza Ecology in North Atlantic Sea Ducks: Not All Ducks Are Created Equal

    PubMed Central

    Hall, Jeffrey S.; Russell, Robin E.; Franson, J. Christian; Soos, Catherine; Dusek, Robert J.; Allen, R. Bradford; Nashold, Sean W.; TeSlaa, Joshua L.; Jónsson, Jón Eínar; Ballard, Jennifer R.; Harms, Naomi Jane; Brown, Justin D.

    2015-01-01

    Wild waterfowl are primary reservoirs of avian influenza viruses (AIV). However the role of sea ducks in the ecology of avian influenza, and how that role differs from freshwater ducks, has not been examined. We obtained and analyzed sera from North Atlantic sea ducks and determined the seroprevalence in those populations. We also tested swab samples from North Atlantic sea ducks for the presence of AIV. We found relatively high serological prevalence (61%) in these sea duck populations but low virus prevalence (0.3%). Using these data we estimated that an antibody half-life of 141 weeks (3.2 years) would be required to attain these prevalences. These findings are much different than what is known in freshwater waterfowl and have implications for surveillance efforts, AIV in marine environments, and the roles of sea ducks and other long-lived waterfowl in avian influenza ecology. PMID:26677841

  9. Habitats of North American sea ducks.

    USGS Publications Warehouse

    Derksen, Dirk V.; Petersen, Margaret R.; Savard, Jean-Pierre L.

    2015-01-01

    Breeding, molting, fall and spring staging, and wintering habitats of the sea duck tribe Mergini are described based on geographic locations and distribution in North America, geomorphology, vegetation and soil types, and fresh water and marine characteristics. The dynamics of habitats are discussed in light of natural and anthropogenic events that shape areas important to sea ducks. Strategies for sea duck habitat management are outlined and recommendations for international collaboration to preserve key terrestrial and aquatic habitats are advanced. We follow the definition of habitat advanced by Odum (1971), which is the place or space where an organism lives. Weller (1999) emphasized that habitats for waterbirds required presence of sufficient resources (i.e., food, water, cover, space) for maintenance during a portion of their annual cycle. Habitats exploited by North American sea ducks are diverse, widespread across the continent and adjacent marine waters and until recently, most were only superficially known. Even following a 15-year-long effort through the Sea Duck Joint Venture and U.S. and Canadian Endangered/Threatened Species programs to fund research focused on sea duck habitats there are still important gaps in our understanding of key elements required by some species during various life stages. Importantly, many significant habitats, especially staging and wintering sites, have been and continue to be destroyed or altered, largely as a result of anthropogenic effects. Our goal here is to develop a comprehensive summary of marine, freshwater, and terrestrial habitats and their characteristics by considering sea duck species with similar needs as groups (e.g., eiders) within the tribe Mergini. Additionally, this chapter will examine threats and changes to sea duck habitats from human-caused and natural events. Finally, we will evaluate conservation and management programs underway or available for maintenance and enhancement of habitats critical for

  10. Habitat Suitability Index Models: Mottled duck

    USGS Publications Warehouse

    Rorabaugh, James C.; Zwank, Phillip J.

    1983-01-01

    The mottled duck is a mallard-like resident species of the Gulf of Mexico coast, from the marshes of Pearl River on the Lou i si ana-Ht ss t ss ipp i border to the Al varado Lagoon near Veracruz, Mexico (Bell rose 1976). The highest densities of nesting mottl ed ducks are found in brackish to fresh coastal marshes (H. Bateman, Louisiana Department of Wildl ife and Fisheries, Baton Rouge; pers , comm.). Mottled ducks also inhabit prairie land near prairie potholes in Texas and flooded rice fields in Texas (Engel ing 1950) and Louisiana (Linscombe 1972).

  11. Hawaiian Duck's Future Threatened by Feral Mallards

    USGS Publications Warehouse

    Uyehara, Kimberly J.; Engilis, Andrew; Reynolds, Michelle

    2007-01-01

    Nearly 70 percent of Hawaii's native bird species are found nowhere else on Earth, and many of these species are declining or in danger of extinction. Although the Hawaiian Islands were once home to a remarkable diversity of waterfowl, only three species remain-the Hawaiian Goose (Nene), Laysan Duck, and Hawaiian Duck (Koloa maoli)-all Federally endangered. The Koloa maoli is the only Hawaiian bird threatened by 'genetic extinction' from hybridization with an invasive species-feral Mallard ducks. U.S. Geological Survey (USGS) biologists in Hawaii are working to find the causes of bird endangerment and ways to prevent extinction of the Koloa maoli and other threatened birds.

  12. Analysis of abietic acid and dehydroabietic acid residues in raw ducks and cooked ducks.

    PubMed

    Zhu, Yongzhi; Zhang, Suzhen; Geng, Zhiming; Wang, Daoying; Liu, Fang; Zhang, Muhan; Bian, Huan; Xu, Weimin

    2014-10-01

    Rosin was once widely used for removal of duck feathers in China and is still being used secretly in some poultry processing enterprises. Abietic acid (AA) and dehydroabietic acid (DHAA) are the major compounds of rosin. In the present study, 90 duck samples were collected for investigation of AA and DHAA residues. Abietic acid and DHAA were simultaneously detected in 13 out 40 raw ducks, 8 out of 26 water-boiled salted ducks, and 7 out of 24 roasted ducks, respectively. In positive samples, averages of AA were significantly higher than those of DHAA in positive samples of the 3 types of ducks (P < 0.05). Averages of AA and DHAA in positive raw ducks were significantly higher than those in positive roasted ducks (P < 0.05). The results indicated that almost one-third of raw ducks were defeathered by means of rosin-containing defeathering agent, and cooking processes could reduce the AA and DHAA residues to some extent, but could not eliminate them completely. ©2014 Poultry Science Association Inc.

  13. An outbreak of duck virus enteritis (duck plague) in a captive flock of mixed waterfowl

    USGS Publications Warehouse

    Montgomery, R.D.; Stein, G.; Novilla, M.N.; Hurley, Sarah S.; Fink, R.J.

    1981-01-01

    An outbreak of duck virus enteritis occurred in a flock of captive waterfowl composed of mallards (Anas platyrhynchos), black ducks (Anas rubripes), and Canada geese (Branta canadensis). Although all three species were housed together, morbidity and mortality were confined to the 227 black ducks and Canada geese, of which 180 died and the rest were left in a weakened condition. Lesions are given for 20 black ducks and 4 Canada geese dying from DVE. In addition, both horizontal and vertical transmission are discussed as possible sources of the virus that caused this outbreak.

  14. Urgent replacement of a mechanical mitral prosthesis in an anticoagulated patient with Bombay red blood cell phenotype.

    PubMed

    Nairn, Travis K; Giulivi, Antonio; Neurath, Doris; Tokessy, Melanie; Sia, Ying T; Ruel, Marc; Wilkes, Peter R H

    2010-06-01

    Bombay red blood cell phenotype is an extremely rare blood type for which patients can receive only autologous or Bombay phenotype red blood cells. We report a case of urgent repeat sternotomy for replacement of a mechanical mitral prosthesis in a patient with Bombay phenotype anticoagulated with warfarin, to emphasize the transfusion challenges in such patients. A male of Indian descent presented to hospital with New York Heart Association IV symptoms. His medical history revealed previous mitral valve replacement with a mechanical prosthesis in 2005 and Bombay phenotype blood. Preoperative transthoracic echocardiography demonstrated thrombus obstruction of the mitral prosthesis despite anticoagulation with warfarin. Right ventricular systolic pressure was >100 mmHg with 3+ tricuspid regurgitation. The patient's condition was temporized with diuretics, bronchodilators, and bi-level positive airway pressure ventilation while transfusion medicine and cardiac surgery were consulted for urgent surgery. The patient received vitamin K and prothrombin complex concentrate prior to repeat sternotomy and successful mitral prosthesis replacement. After cardiopulmonary bypass, heparinization was corrected with protamine and followed by a second dose of prothrombin complex concentrate and recombinant activated factor VIIa. Postoperatively, the patient received four units of packed red blood cells, two autologous units and two units of Bombay specific red blood cells. Right ventricular pressures stabilized at 40 mmHg following surgery. The patient recovered following several days of inotropic support with milrinone, diuretics, and bronchodilators. Patients with Bombay phenotype red blood cells present as type O, but they are unable to receive red blood cells from any phenotype other than Bombay phenotype. They are able to receive all other blood products, including fresh frozen plasma, cryoprecipitate, platelets, prothrombin complex concentrate, and recombinant activated factor

  15. Identification of a rare blood group, "Bombay (Oh) phenotype," in Bhuyan tribe of Northwestern Orissa, India.

    PubMed

    Balgir, R S

    2007-09-01

    Blood group serology plays a vital role in transfusion medicine. The Bombay (Oh) phenotype is characterized by the absence of A, B, and H antigens on red cells and occurs rarely, especially in tribal populations of India. This is a field-based random population study in the Bhuyan tribal community. The study reports three cases of the rare Bombay (Oh) phenotype for the first time in the Bhuyan tribe of Sundargarh district in North-Western Orissa. Taking informed consent, red blood cells of 836 Bhuyan subjects were tested with three antisera, i.e., anti-A, anti-B, and anti-H (lectin) for forward reaction. Agglutinations of plasma with A, B, and O (H) red cells (reverse reaction) were also tested for the presence or absence of antibodies in the serum. Specialized tests like absorption-elution, titration of naturally occurring antibodies at different temperatures, inhibition of anti-H by O saliva secretor, and determination of secretor status were performed. Three cases of a rare blood group, Bombay (Oh) phenotype, (2 out of 244 Khandayat Bhuyan and 1 out of 379 Paudi Bhuyan from Hemgiri and Lahunipara blocks, respectively) in the Bhuyan tribe of Sundargarh district in North-Western Orissa were detected, giving an incidence of 1 in 122 in Khandayat Bhuyan and 1 in 379 in Paudi Bhuyan, with an average of 1 in 278 among the Bhuyan tribal population. This incidence is high in comparison to earlier studies reported from India. The practice of tribal and territorial endogamy in a smaller effective populations (for example, there are only 3,521 individuals in Paudi Bhuyan) results in smaller marital distance and inbreeding, leading to increased homozygous expression of rare recessive genetic characters like the Bombay (Oh) phenotype. This study further testifies that the incidence is higher in those states of India where the consanguinity is a common practice.

  16. Bombay blood group: Is prevalence decreasing with urbanization and the decreasing rate of consanguineous marriage

    PubMed Central

    Mallick, Sujata; Kotasthane, Dhananjay S.; Chowdhury, Puskar S.; Sarkar, Sonali

    2015-01-01

    Context: Bombay blood group although rare is found to be more prevalent in the Western and Southern states of India, believed to be associated with consanguineous marriage. Aims: To estimate the prevalence of the Bombay blood group (Oh) in the urban population of Puducherry. To find the effect of urbanization on consanguineous marriage and to establish whether consanguinity plays a part in the prevalence of Oh group. To compare Oh group prevalence with that of other neighboring states, where population is not predominantly urban. Settings and Design: This is a descriptive study in a tertiary care hospital in Puducherry, over a period of 6 years. Materials and Methods: All blood samples showing ‘O’ group were tested with anti-H lectin. Specialized tests like Adsorption Elution Technique, inhibition assay for determination of secretor status were performed on Oh positive cases. Any history of consanguineous marriage was recorded. Statistical Analysis Used: All variables were categorical variable and percentage and proportions were calculated manually. Results: Analysis of the results of 35,497 study subjects showed that the most common group was ‘O’ group constituting 14,164 (39.90%) of subjects. Only three “Oh” that is, Bombay phenotype (0.008%) were detected. Consanguinity was observed in two cases (66.66%). Conclusions: This study shows the prevalence of Bombay blood group representing the urban population of Puducherry, to be high (0.008%) and associated with consanguineous marriage (66.66%). Thus, consanguinity is still an important risk factor present, even in an urban population in Southern India. PMID:26420929

  17. Treatment of acute myeloblastic leukaemia in a patient with Bombay blood type: a case report.

    PubMed

    Okamoto, Y; Tsuda, T; Matsunami, M; Hirose, T; Sakaguchi, R; Katayama, N; Ota, K

    2001-01-01

    A 62-year-old female was admitted to our hospital with suspected acute leukaemia and after investigation we diagnosed acute myeloblastic leukaemia (AML-M1). The patient's blood type was found to be the very rare Bombay type and surveillance of her relatives showed the same blood type in her male cousin on her mother's side. Alongside chemotherapy the patient received 4000 ml of frozen Bombay-type red cells, 1400 ml of concentrated red cells in manitol adenine phosphate solutions and 360 units of type O concentrated platelets without marked effects. The anti-H antibody was initially at 128 dilution but for unknown reasons increased to 2048 dilution after remission of AML-M1. About 3 months after hospitalization the patient died of Cryptococcus neoformans pneumonia despite strict precautions against infection. Although AML-M1 is a common adult leukaemia and is chemosensitive to anti-leukaemic drugs, neither AML-M1 in a patient with Bombay-type red cells nor its treatment with chemotherapy and transfusion with type Oh frozen red cells have previously been reported.

  18. [Molecular genetic basis for para-Bombay phenotypes in two cases].

    PubMed

    He, Yang-Ming; Xu, Xian-Guo; Zhu, Fa-Ming; Yan, Li-Xing

    2007-06-01

    This study was purposed to investigate the molecular genetics basis for para-Bombay phenotype. The para-Bombay phenotype of two probands was identified by routine serological techniques. The full coding region of alpha (1, 2) fucosyltransferase gene (FUT1 and FUT2) in the probands was amplified by polymerase chain reaction and the amplified fragments were directly sequenced, meanwhile the mutations of FUT1 were also identified by TOPO TA cloning sequence method. The results indicated that two heterozygous mutations were detected by directly sequencing in two probands: AG deletion at position 547 - 552 and C to T mutation at position 658. Two different mutations were confirmed to be true compound heterozygotes with each mutation on a separate homologous chromosome by TOPO TA cloning sequence method. AG deletion at position 547 - 552 caused a reading frame shift and a premature stop codon. C658T mutation resulted in Arg-->Cys at amino acid position 220. It is suggested that the FUT1 mutation of two probands are compound heterozygous mutation with different chromosomes, which are named h1h3 and may be the genetics basis of para-Bombay phenotype.

  19. [Formation of para-Bombay phenotype caused by homozygous or heterozygous mutation of FUT1 gene].

    PubMed

    Zhang, Jin-Ping; Zheng, Yan; Sun, Dong-Ni

    2014-02-01

    This study was aimed to explore the molecular mechanisms for para-Bombay phenotype formation. The H antigen of these individuals were identified by serological techniques. The full coding region of alpha (1, 2) fucosyltransferase (FUT1) gene of these individuals was amplified by high-fidelity polymerase chain reaction (PCR). PCR product was identified by TOPO cloning sequencing. Analysis and comparison were used to explore the mechanisms of para-bombay phenotype formation in individuals. The results indicated that the full coding region of FUT1 DNA was successfully amplified by PCR and gel electrophoresis. DNA sequencing and analysis found that h1 (547-552delAG) existed in one chromosome and h4 (35C > T) existed in the other chromosome of NO.1 individual. Meantime, h1 (547-552delAG) was found in two chromosomes of NO.2 and NO.3 individual. It also means that FUT1 gene of NO.1 individual was h1h4 heterozygote, FUT1 gene of NO.2 and NO.3 individuals were h1h1 homozygote. It is concluded that homozygous and heterozygous mutation of FUT1 gene can lead to the formation of para-Bombay phenotype.

  20. [Para-Bombay phenotype caused by combined heterozygote of two bases deletion on fut1 alleles].

    PubMed

    Ma, Kan-Rong; Tao, Shu-Dan; Lan, Xiao-Fei; Hong, Xiao-Zhen; Xu, Xian-Guo; Zhu, Fa-Ming; Lü, Hang-Jun; Yan, Li-Xing

    2011-02-01

    This study was purposed to investigate the molecular basis of a para-Bombay phenotype for screening and identification of rare blood group. ABO and H phenotypes of the proband were identified by serological techniques. The exon 6 to exon 7 of ABO gene and full coding region of α-1,2-fucosyltransferase (fut1) gene of the proband were analyzed by polymerase chain reaction and direct sequencing of the amplified fragments. The haplotype of compound heterozygote of fut1 was also identified by cloning sequencing. The results indicated that a rare para-Bombay phenotype was confirmed by serological techniques. Two deletion or insertion variant sites near nucleotide 547 and 880 were detected in fut1 gene. The results of cloning sequence showed that one haplotype of fut1 gene was two bases deletion at 547-552 (AGAGAG→AGAG), and another one was two bases deletion at position 880-882 (TTT→T). Both two variants caused a reading frame shift and a premature stop codon. It is concluded that a rare para-Bombay phenotype is found and confirmed in blood donor population. The molecular basis of this individual is compound heterozygote of two bases deletion on fut1 gene which weaken the activity of α-1, 2-fucosyltransferase.

  1. Breeding productivity of Smith Island black ducks

    USGS Publications Warehouse

    Haramis, G.M.; Jorde, Dennis G.; Olsen, G.H.; Stotts, D.B.; Harrison, M.K.; Perry, M.C.

    2002-01-01

    We investigated the breeding performance of American black ducks (Anas rubripes) on Smith Island, Chesapeake Bay, to improve our understanding of island black duck breeding ecology and to make management recommendations to enhance productivity. During 1995-96, we implanted 56 female black ducks with 20-g radio transmitters and tracked 35 of the individuals through the breeding season to locate nests, determine nest fate, and identify brood habitat. We also increased preseason banding efforts and compared capture characteristics over 12 years with those from the Deal Island Wildlife Management Area, a banding site on the mainland of Tangier Sound. A low rate of nesting (37%), lack of renesting, and poor hatching success (31%) indicated that island salt marsh habitats present a harsh environment for breeding black ducks. Black ducks located 11 of 13 nests (85%) in black needlerush (Juncus roemerianus) marsh where they were vulnerable to flooding from extreme tides and to egg predators. No nests were found on forested tree hammocks, a feature that distinguishes Smith Island from nearby South Marsh and Bloodsworth Islands. Nest predators included red foxes (Vulpes vulpes), herring gulls (Larus argentams), fish crows (Corvus ossifragus), and, potentially, Norway rats (Rattus norvegicus). Unlike mainland red foxes, foxes radio tracked on Smith Island were found to be capable swimmers and effective low marsh predators. We found shoreline meadows of widgeon grass (Ruppia maritima) to be important foraging sites for black ducks and suspected that the virtual absence of fresh water in this high salinity environment (1217+ ppt) to incur some cost in terms of growth and survival of ducklings. Preseason bandings revealed a high proportion of banded adults and a strong positive correlation in age ratios with the Deal Island banding site. This latter finding strongly suggests a negative universal effect of storm tides on nest success for Tangier Sound black ducks. Management to

  2. Floods on Duck and Little Duck Rivers and Grindstone Hollow, Hunt, Hickory Flat, and Wolf Creeks in the vicinity of Manchester, Tennessee. [Duck River; Little Duck River

    SciTech Connect

    Not Available

    1984-09-01

    This flood hazard report describes the extent and severity of the flood potential along selected reaches of the Duck and Little Duck Rivers, and Grindstone Hollow, Hunt, Hickory Flat, and Wolf Creeks in the vicinity of Manchester, Tennessee. The report was prepared by TVA as a result of a request from the city of Manchester for TVA technical assistance in evaluating alternative solutions to local flood problems. 5 references, 12 figures, 12 tables.

  3. Black ducks and DDE: Review and status

    USGS Publications Warehouse

    Longcore, J.R.; Stendell, R.C.

    1982-01-01

    Residues of DDE in wild black duck (Anas rubripes) wings or eggs are lower now than they were in the 1960s, and the mean shell thickness of eggs collected in 1978 has recovered to the pre-DDT use thickness. Mean DDE residues (ppm, wet wt) for eggs were: 1964, 2.93; 1971, 1.22; 1978, 0.65. Average DDE residues in wing pools were: 1965-66 and 1966-67 combined, 1.23; 1969-70, 1.42; 1972-73, 0.35 and 1976-77, 0.39. The threshold level of DDE in black duck foods for causing shell thinning is about 0.6 ppm, wet wt. Captive black ducks fed this dietary amount laid eggs with shells that were lighter in wt (-11.3%; P 0.05) for DDE-dosed birds, but this was caused by 1 unusually thin (0.283 mm) eggshell from a control hen. Our ad libitum diet, which equals the amount of DDE detected in some black duck foods, resulted in a mean DDE egg residue that was 4-6 ppm above the highest DDE residues detected in field-collected black duck eggs in 1964 (12.1 ppm) and 1971 (14.0). A comparison of documented effects of DDE in captive black ducks with DDE residues reported from wild black duck wing pools and eggs collected during 1964-78 suggests that reproductive success in wild black duck females was impaired in the 1960s and perhaps earlier.

  4. 'Victoria Crater' from 'Duck Bay'

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a cylindrical projection with geometric seam correction.

  5. 'Victoria Crater' from 'Duck Bay'

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a cylindrical projection with geometric seam correction.

  6. 1. OVERALL VIEW OF BROWN DUCK LAKE, LOOKING SOUTHWEST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERALL VIEW OF BROWN DUCK LAKE, LOOKING SOUTHWEST - High Mountain Dams in Upalco Unit, Brown Duck Lake Dam, Ashley National Forest, 4.4 miles North of Miners Gulch Campground, Mountain Home, Duchesne County, UT

  7. 2. OVERALL VIEW OF BROWN DUCK LAKE, LOOKING WEST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERALL VIEW OF BROWN DUCK LAKE, LOOKING WEST - High Mountain Dams in Upalco Unit, Brown Duck Lake Dam, Ashley National Forest, 4.4 miles North of Miners Gulch Campground, Mountain Home, Duchesne County, UT

  8. Campylobacter populations in wild and domesticated Mallard ducks (Anas platyrhynchos).

    PubMed

    Colles, Frances M; Ali, Jan S; Sheppard, Samuel K; McCarthy, Noel D; Maiden, Martin C J

    2011-10-01

    Identifying the Campylobacter genotypes that colonize farmed and wild ducks will help to assess the proportion of human disease that is potentially attributable to the consumption of duck meat and environmental exposure to duck faeces. Comparison of temporally and geographically matched farmed and wild ducks showed that they had different Campylobacter populations in terms of: (i) prevalence, (ii) Campylobacter species and (iii) diversity of genotypes. Furthermore, 92.4% of Campylobacter isolates from farmed ducks were sequence types (STs) commonly associated with human disease, in contrast to just one isolate from the wild ducks. Only one ST, ST-45, was shared between the two sources, accounting for 0.9% of wild duck isolates and 5% of farmed duck isolates. These results indicate that domestic 'niche' as well as host type may affect the distribution of Campylobacter, and that husbandry practises associated with intensive agriculture may be involved in generating a reservoir of human disease associated lineages.

  9. Campylobacter populations in wild and domesticated Mallard ducks (Anas platyrhynchos)

    PubMed Central

    Colles, Frances M; Ali, Jan S; Sheppard, Samuel K; McCarthy, Noel D; Maiden, Martin C J

    2011-01-01

    Identifying the Campylobacter genotypes that colonize farmed and wild ducks will help to assess the proportion of human disease that is potentially attributable to the consumption of duck meat and environmental exposure to duck faeces. Comparison of temporally and geographically matched farmed and wild ducks showed that they had different Campylobacter populations in terms of: (i) prevalence, (ii) Campylobacter species and (iii) diversity of genotypes. Furthermore, 92.4% of Campylobacter isolates from farmed ducks were sequence types (STs) commonly associated with human disease, in contrast to just one isolate from the wild ducks. Only one ST, ST-45, was shared between the two sources, accounting for 0.9% of wild duck isolates and 5% of farmed duck isolates. These results indicate that domestic ‘niche’ as well as host type may affect the distribution of Campylobacter, and that husbandry practises associated with intensive agriculture may be involved in generating a reservoir of human disease associated lineages. PMID:22164198

  10. A Bombay individual lacking H and Le antigens but expressing normal levels of alpha-2- and alpha-4-fucosyltransferases.

    PubMed

    Shechter, Y; Etzioni, A; Levene, C; Greenwell, P

    1995-09-01

    The rare Bombay phenotype is usually due to a primary genetic defect in an alpha-2- or alpha-4-fucosyltransferase. The present study was done to investigate a patient with normal transferases, who exhibits the Bombay phenotype. Red cells of the patient, his parents, and siblings were phenotyped for A, B, and H antigens. The presence of B, H, and Le transferases in serum and saliva was measured. The parents and siblings were all group B, Le(a-b-). The propositus was typed as Oh, Le(a-b-). His serum contained anti-A, anti-B, and anti-H. Normal levels of B, H, and Le transferases were found in all family members including the patient. In an unusual case, a person has the Bombay phenotype, but normal levels of transferases in serum and saliva. A general defect in fucose metabolism seems to be the primary abnormality in this case.

  11. Pathogenicity of duck plague and innate immune responses of the Cherry Valley ducks to duck plague virus.

    PubMed

    Li, Ning; Hong, Tianqi; Li, Rong; Guo, Mengjiao; Wang, Yao; Zhang, Jinzhou; Liu, Jiyuan; Cai, Yumei; Liu, Sidang; Chai, Tongjie; Wei, Liangmeng

    2016-08-24

    Duck plague caused by duck plague virus (DPV) is an acute and contagious disease. To better understand the pathogenic mechanism of duck plague virus in ducklings, an infection experiment was performed. Our results showed that typical symptoms were observed in the infected ducklings. DPV could replicate quickly in many tissues, leading to pathological lesions, especially on the spleen. Real-time quantitative PCR demonstrated that expression of many innate immune-related genes was mostly up-regulated in the brain, and the antiviral innate immune response was established, but not sufficient to restrict viral replication. In contrast, although the expression of many major pattern recognition receptors (PRRs) increased in the spleen, the expression of most cytokines was declined. Our study indicates that DPV is a pantropic virus that can replicate rapidly in tissues, causing serious pathological lesions but the immune responses are different in the spleen and brain. To our knowledge, this is the first report to systematically explore the expression profiles of the immune genes in the DPV-infected ducks. Our data provide a foundation for further study of the pathogenicity of duck plague.

  12. Yellow Ducks Overboard! A Lesson in Geography and World Citizenship

    ERIC Educational Resources Information Center

    Nagel, Paul; Beauboeuf, Donna

    2012-01-01

    This lesson was inspired by the book, "10 Little Rubber Ducks" by Eric Carle, which discusses ocean pollution. The book was inspired by an incident in 1992: A shipping container tumbled into the North Pacific Ocean, broke open, and 28,800 little rubber ducks (and other plastic bath toys) were lost at sea. The ducks were manufactured in China, and…

  13. Do All Ducks Lay Eggs? The Generic Overgeneralization Effect

    ERIC Educational Resources Information Center

    Leslie, Sarah-Jane; Khemlani, Sangeet; Glucksberg, Sam

    2011-01-01

    Generics are statements such as "tigers are striped" and "ducks lay eggs". They express general, though not universal or exceptionless, claims about kinds (Carlson & Pelletier, 1995). For example, the generic "ducks lay eggs" seems true even though many ducks (e.g. the males) do not lay eggs. The universally quantified version of the statement…

  14. Yellow Ducks Overboard! A Lesson in Geography and World Citizenship

    ERIC Educational Resources Information Center

    Nagel, Paul; Beauboeuf, Donna

    2012-01-01

    This lesson was inspired by the book, "10 Little Rubber Ducks" by Eric Carle, which discusses ocean pollution. The book was inspired by an incident in 1992: A shipping container tumbled into the North Pacific Ocean, broke open, and 28,800 little rubber ducks (and other plastic bath toys) were lost at sea. The ducks were manufactured in China, and…

  15. Do All Ducks Lay Eggs? The Generic Overgeneralization Effect

    ERIC Educational Resources Information Center

    Leslie, Sarah-Jane; Khemlani, Sangeet; Glucksberg, Sam

    2011-01-01

    Generics are statements such as "tigers are striped" and "ducks lay eggs". They express general, though not universal or exceptionless, claims about kinds (Carlson & Pelletier, 1995). For example, the generic "ducks lay eggs" seems true even though many ducks (e.g. the males) do not lay eggs. The universally quantified version of the statement…

  16. Occurrence of Campylobacter and Salmonella in ducks and duck eggs in Selangor, Malaysia.

    PubMed

    Nor Faiza, S; Saleha, A A; Jalila, A; Fauziah, N

    2013-03-01

    The importance of Campylobacter and Salmonella as foodborne pathogens is well recognised globally. A recent work in Penang found ducks in commercial farms were infected with these organisms. The aim of the study was to detect the presence of Campylobacter and Salmonella in ducks and Salmonella in duck eggs in farms in a small part of Selangor. Cloacal swabs were obtained from 75 ducks and 30 duck eggs from three farms. The isolation and identification of Campylobacter and Salmonella were done using conventional methods. Twelve percent of Campylobacter and 16.0% of Salmonella were isolated from the ducks sampled. Salmonella was absent on and in eggs. Campylobacter isolates consisted of 22% Campylobacter jejuni and the remaining was Campylobacter coli. Three Salmonella serovars identified were Salmonella Agona, S. Braenderup and S. Corvallis. The presence of Campylobacter and Salmonella in ducks may cause contamination of the meat during processing and handling which can constitute public health hazard. Moreover, the farm workers may be exposed to the organisms through contact with the infected animals.

  17. Prevalence of duck circovirus infection of subclinical pekin ducks in South Korea.

    PubMed

    Cha, Se-Yeoun; Song, Eu-Tteum; Kang, Min; Wei, Bai; Seo, Hye-Suk; Roh, Jae-Hee; Yoon, Ran-Hee; Moon, Oun-Kyoung; Jang, Hyung-Kwan

    2014-04-01

    An investigation was carried out to determine the prevalence and infection pattern of duck circovirus (DuCV) in subclinical Pekin ducks on South Korean duck farms. A total of 147 samples collected from 92 duck farms in five provinces were examined from 2011 to 2012. The overall prevalence of DuCV PCR-positive pooled bursa of Fabricius and liver samples was 21.8% (32/147). The prevalence of DuCV PCR-positive samples increased significantly in 3-week-old ducks compared with that in 1-week-old ducks (P<0.05). DuCV in association with Riemerella and Salmonella infections (10.9%; 16/147) occurred at the same level as infection with DuCV alone (10.9%; 16/147). In comparison of the relationship between bacterial diseases (salmonellosis, Riemerella infection) and morbidity in farms with and without DuCV, morbidity was higher in circovirus-positive farms (50%; 16/32) than in circovirus-negative farms (26.1%; 30/115). Our findings provide baseline information on the degree of DuCV infection and distribution and pattern of DuCV in ducks, and it is evident that DuCV can be associated with subclinical diseases and that subclinical infection could be economically important.

  18. Mycoplasma infection of ducks and geese.

    PubMed

    Stipkovits, L; Szathmary, S

    2012-11-01

    Production of ducks and geese in certain parts of the world is very important. Mycoplasma diseases cause significant losses to the duck and goose industry. This review summarizes the epidemiological, clinical, and pathomorphological characteristics of mycoplasma diseases of ducks and geese and the involvement of the various mycoplasma species in their pathogenesis. The role of mycoplasma infections in the development of clinical signs, pathological lesions, and mortality of challenged birds is demonstrated in challenge experiments. Transmission of mycoplasma in the ovary and eggs resulting in the reduction of egg production and an increase of embryo mortality has been shown in challenge experiments as well as in field studies. The susceptibility of many mycoplasma isolates of the most important mycoplasma species of duck and goose origin were tested and showed relatively high average minimum inhibitory concentrations of lincomycin, tilosin, oxytetracycline, chlortetracycline, and enrofloxacin but not for tiamulin. The successful treatment of mycoplasma infections with antibiotics in ducks and geese should be selected based on the minimum inhibitory concentration values against the mycoplasmas isolated from the flock.

  19. "Duck stamp" dollars reserve native prairie tracts

    USGS Publications Warehouse

    Higgins, K.F.

    1981-01-01

    Ducks and wetlands are inseparable in the prairies. Hunters know this, bird watchers know this, wildlife managers know this, and most importantly people who manage the croplands and rangelands know this. The 1,746 tracts of native prairie within these upland-wetland complexes known as Waterfowl Production Areas are not the only lands purchased with "duck stamp" dollars. Considerable acreages have also been purchased in central and southern parts of the United States to provide staging, resting, and wintering areas for waterfowl. Since 1934, when "duck stamps" were first sold, nearly 2.5 million acres of waterfowl habitats have been acquired or taken under easement within the United States with revenue from these sales. By purchasing "duck stamps", more than 2.2 million people provide over $16.5 million in annual revenue. It is certainly gratifying to know that some of the remaining native prairie remnants in the Northern Great Plains are being reserved for the future with "duck stamp" dollars.

  20. Complete genome sequence of duck Tembusu virus, isolated from Muscovy ducks in southern China.

    PubMed

    Zhu, Wanjun; Chen, Jidang; Wei, Chunya; Wang, Heng; Huang, Zhen; Zhang, Minze; Tang, Fengfeng; Xie, Jiexiong; Liang, Huanbin; Zhang, Guihong; Su, Shuo

    2012-12-01

    We report here the complete genomic sequence of the duck Tembusu virus (DTMUV) WJ-1 strain, isolated from Muscovy ducks. This is the first complete genome sequence of DTMUV reported in southern China. Compared with the other strains (TA, GH-2, YY5, and ZJ-407) that were previously found in eastern China, WJ-1 bears a few differences in the nucleotide and amino acid sequences. We found that there are 47 mutations of amino acids encoded by the whole open reading frame (ORF) among these five strains. The whole-genome sequence of DTMUV will help in understanding the epidemiology and molecular characteristics of duck Tembusu virus in southern China.

  1. Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

    PubMed

    Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

    2012-12-01

    We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

  2. An unusual anti-H lectin inhibited by milk from individuals with the Bombay phenotype.

    PubMed

    Joshi, S R; Vasantha, K; Robb, J S

    2005-01-01

    There are several lectins with anti-H specificity but few of them serve as useful reagents. An anti-H lectin, extracted from the seeds of the plant Momordica dioica Roxb. ex willd., was tested for its hemagglutination and inhibition properties, using standard serologic methods and panel RBCs, serum, saliva, milk, and oligosaccharides purified from milk. The extract displayed strongest agglutination with group O RBCs and was weakest with group A1B RBCs in a spectrum of O>A2>B>A2B>A1>A1B; the extract failed to react with the RBCs from 25 individuals with the Bombay (Oh) phenotype and was inhibited by H secretor saliva, hence it was characterized as anti-H. However, its inhibition by milk samples from five mothers with the Bombay phenotype called into question its specificity as anti-H. The lectin reacted as strongly with group O ii (adult) RBCs as with normal OI RBCs, ruling out its specificity as anti-HI. Hemagglutination inhibition was observed with 2'-fucosyllactose (Type 2 H) and lacto-N-fucopentose-I (Type 1 H), suggesting that the binding of the lectin had preference for H structures. However, inhibition by N-acetyllactosamine, lacto-Ntetraose, and lacto-N-neotetraose suggested that the lectin also recognized unsubstituted terminal beta-linked galactose units. The hemagglutinin property in the present lectin showed an unusual anti-H specificity. The lectin was inhibited by milk from Bombay phenotype individuals and certain milk oligosaccharides not specific for the H antigen.

  3. Assessment of the immune response to duck plague vaccinations.

    PubMed

    Kulkarni, D D; James, P C; Sulochana, S

    1998-01-01

    An experiment was conducted to assess the immune responses of ducks to duck plague (DP) vaccinations employing one commercial and one laboratory-adapted (LA) DP vaccines. Virus neutralisation and leucocyte migration-inhibition tests were conducted at regular intervals before and after vaccinations. Similarly, ducks in vaccinated and control groups were subjected to challenge infection with virulent DP virus. The commercial vaccine yielded a poor immune response and partial protection on challenge whereas satisfactory responses were obtained in ducks receiving two doses of LA vaccine. The humoral as well as cellular factors were stimulated indicating possible involvement of both the immune responses in the protection from duck plague.

  4. [Analysis on FUT1 and FUT2 gene of 10 para-Bombay individuals in China].

    PubMed

    Guo, Zhong-hui; Xiang, Dong; Zhu, Zi-yan; Wang, Jian-lian; Zhang, Jia-min; Liu, Xi; Shen, Wei; Chen, He-ping

    2004-10-01

    This is a study on the allele composing of ABO, FUT1 and FUT2 gene loci of 10 para-Bombay individuals in China. Ten samples coming from different districts of China were suspected of para-Bombay phenotype by primary serology tests. Routine and absorb-elution tests were conducted to identify their ABO type, and duplex polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied to getting their ABO genotype. Most of them were submitted to a test of their Lewis type as well. Then through direct DNA sequencing with PCR products of FUT1 and FUT2 genes, the genotypes of their H and SE gene loci were analyzed. It can be confirmed that the 10 samples are para-Bombay. All of their ABO genotypes are consistent with the serological absorb-elution results and the substances detected results in saliva. Seven out of 10 have recessive homozygous gene at their H locus. Each phenotype of h1h1 (nt547-552Deltaag), h2h2 (nt880-882Deltatt) and h4h4 (nt35 t-->c) are ascertained in 2 individuals; moreover, h3h3 (nt 658 c-->t) is identified in one individual. The rest are hh heterozygous individuals: one is h3/h(new-1); the other is h2/h(new-2); the last one is h1/h2. The h(new-1) (nt586 c-->t) allele has a point mutation at nt 586 C to T, which leads a nonsense mutation Gln(CAG) to stop (TAG).The second h (new-2) (nt328 g-->a) has an nt328 G to A missense mutation,which leads Ala (GCC),was replaced by Thr (ACC) at 110 amino acid position. All the 10 samples have Se (nt357 c-->t) synonymous mutation. One Bm(h) (B/O) individual with h4h4 phenotype has a Se(w)(nt357 c-->t; nt385 a-->t) allele, whose Lewis type is Le(a+b+). Moreover, the authors detected a (nt716 g-->a) mutation in two samples' Se gene. Four kinds of known h alleles (h1-h4), 2 kinds of novel non-functional FUT1 alleles, a Se(w) allele, and a novel SeG716A polymorphism in Chinese para-Bombay individuals were detected. At the same time, the authors noticed that all the 10 samples have the nt357 c

  5. Biotypes of Gardnerella vaginalis isolated from non-specific vaginitis patients in Bombay.

    PubMed

    Pandit, D V; Barve, S M; Deodhar, L P

    1989-11-01

    The incidence and prevalent biotypes of G. vaginalis in patients with non-specific vaginitis from Bombay, was studied. Of 300 patients screened, 105 were diagnosed to have nonspecific vaginitis (NSV). G. vaginalis was isolated from 71 per cent patients with NSV; 34.6 and 29.3 per cent G. vaginalis were belonging to biotypes 5 and 1 respectively. In 55 per cent patient, G. vaginalis was associated with anaerobes. None of the isolated strains of G. vaginalis was sensitive to 5 micrograms metronidazole disc whereas 93 per cent of the strains were sensitive to 50 micrograms metronidazole disc.

  6. Ducks: the "Trojan horses" of H5N1 influenza.

    PubMed

    Kim, Jeong-Ki; Negovetich, Nicholas J; Forrest, Heather L; Webster, Robert G

    2009-07-01

    Wild ducks are the main reservoir of influenza A viruses that can be transmitted to domestic poultry and mammals, including humans. Of the 16 hemagglutinin (HA) subtypes of influenza A viruses, only the H5 and H7 subtypes cause highly pathogenic (HP) influenza in the natural hosts. Several duck species are naturally resistant to HP Asian H5N1 influenza viruses. These duck species can shed and spread virus from both the respiratory and intestinal tracts while showing few or no disease signs. While the HP Asian H5N1 viruses are 100% lethal for chickens and other gallinaceous poultry, the absence of disease signs in some duck species has led to the concept that ducks are the "Trojan horses" of H5N1 in their surreptitious spread of virus. An important unresolved issue is whether the HP H5N1 viruses are maintained in the wild duck population of the world. Here, we review the ecology and pathobiology of ducks infected with influenza A viruses and ducks' role in the maintenance and spread of HP H5N1 viruses. We also identify the key questions about the role of ducks that must be resolved in order to understand the emergence and control of pandemic influenza. It is generally accepted that wild duck species can spread HP H5N1 viruses, but there is insufficient evidence to show that ducks maintain these viruses and transfer them from one generation to the next.

  7. Benefits, costs, and determinants of dominance in American black ducks

    USGS Publications Warehouse

    Hepp, G.R.

    1989-01-01

    Behavioural dominance was studied in captive American black ducks (Anas rubripes) during October-December 1984. Eighty ducks were marked individually, and groups of 10 ducks consisting of 5 adults (3 males and 2 females) and 5 juveniles (3 males and 2 females) were assigned to each of 8 experimental pens. Ducks in 4 pens received an ad libitum diet, and ducks in the other 4 pens were given a restricted diet. Dominance structure within pens was linear. Adults were dominant to young, and body mass had no influence on dominance rank. The effect of sex on dominance rank was age-specific. Adult males were dominant to adult females and to young black ducks of both sexes; however, dominance rank of young males did not differ from adult or young females. Paired adults were dominant to unpaired adults and to young individuals that were either paired or unpaired. Paired young black ducks were similar in dominance rank to unpaired adults and unpaired young indicating that pairing did not make these individuals more dominant. Ducks on the restricted diet gained less body mass than ducks on the ad libitum diet, but dominant and subordinate black ducks within treatment groups experienced similar changes in body mass during the early winter. Dominant black ducks interacted more frequently and were more likely to form pair bonds than subordinates, thus higher energy costs of dominant individuals may explain the poor relationship between physical condition and dominance rank. There was a significant positive association between the dominance ranks of pair members.

  8. The Sequential Tissue Distribution of Duck Tembusu Virus in Adult Ducks

    PubMed Central

    Wu, Li; Liu, Jinxiong; Chen, Pucheng; Jiang, Yongping; Ding, Leilei; Lin, Yuan; Li, Qimeng; He, Xijun; Chen, Qiusheng; Chen, Hualan

    2014-01-01

    In 2010, a novel Tembusu virus (TMUV) that caused a severe decrease in the egg production of ducks was isolated in southeast China. Given the novelty of this duck pathogen, little information is available regarding its pathogenesis. Here, we systematically investigated the replication kinetics of TMUV PTD2010 in adult male and female ducks. We found that PTD2010 was detectable in most of the parenchymatous organs as well as the oviduct and intestinal tract from days 1 to 7 after inoculation. Viral titers were maintained at high levels for at least 9 days in the spleen, kidney, bursa of Fabricius, brain, and ovary. No virus was detected in any of these organs or tissues at 18 days after inoculation. PTD2010, thus, causes systemic infections in male and female ducks; its replication kinetics show similar patterns in most organs, with the exception of the ovaries and testes. PMID:25215289

  9. The sequential tissue distribution of duck Tembusu virus in adult ducks.

    PubMed

    Wu, Li; Liu, Jinxiong; Chen, Pucheng; Jiang, Yongping; Ding, Leilei; Lin, Yuan; Li, Qimeng; He, Xijun; Chen, Qiusheng; Chen, Hualan

    2014-01-01

    In 2010, a novel Tembusu virus (TMUV) that caused a severe decrease in the egg production of ducks was isolated in southeast China. Given the novelty of this duck pathogen, little information is available regarding its pathogenesis. Here, we systematically investigated the replication kinetics of TMUV PTD2010 in adult male and female ducks. We found that PTD2010 was detectable in most of the parenchymatous organs as well as the oviduct and intestinal tract from days 1 to 7 after inoculation. Viral titers were maintained at high levels for at least 9 days in the spleen, kidney, bursa of Fabricius, brain, and ovary. No virus was detected in any of these organs or tissues at 18 days after inoculation. PTD2010, thus, causes systemic infections in male and female ducks; its replication kinetics show similar patterns in most organs, with the exception of the ovaries and testes.

  10. Assessment of potential shale gas resources of the Bombay, Cauvery, and Krishna-Godavari Provinces, India, 2011

    USGS Publications Warehouse

    ,

    2012-01-01

    Using a performance-based geologic assessment methodology, the U.S. Geological Survey estimated a technically recoverable mean volume of 6.1 trillion cubic feet of potential shale gas in the Bombay, Cauvery, and Krishna-Godavari Provinces of India.

  11. Survey of sociodemographic characteristics of tobacco use among 99,598 individuals in Bombay, India using handheld computers

    PubMed Central

    Gupta, P. C.

    1996-01-01

    OBJECTIVES: To study the diversity and sociodemographic characteristics of tobacco use in Bombay, India. DESIGN: Population-based, cross- sectional, house-to-house survey with face-to-face interviews in the city of Bombay during 1992-94. Data was input directly into a programmed, handheld computer (electronic diary). PARTICIPANTS: Permanent residents of the city of Bombay aged 35 years and older. MAIN OUTCOME MEASURES: Tobacco use in various smoking and smokeless forms. RESULTS: 99598 individuals were interviewed (60% women, 40% men). Among women, prevalence of tobacco use was high (57.5%) but almost solely in the smokeless form. Among men, 69.3% reported current tobacco use and 23.6% were smokers. The most common smokeless tobacco practice among women was mishri use (44.5% of smokeless users) and among men betel quid with tobacco (27.1%). About half of smokers used bidi and half smoked cigarettes. Chewing areca nut without tobacco was rare (< 0.5% of smokeless users). Educational level was inversely associated with tobacco use of all kinds except cigarette smoking. CONCLUSIONS: The pattern of tobacco use varies across India and, in Bombay, is very different from other areas. Using handheld computers to collect data in the field was successful. 


 PMID:8910992

  12. Exploring multiple sources of climatic information within personal and medical diaries, Bombay 1799-1828

    NASA Astrophysics Data System (ADS)

    Adamson, George

    2016-04-01

    Private diaries are being recognised as an important source of information on past climatic conditions, providing place-specific, often daily records of meteorological information. As many were not intended for publication, or indeed to be read by anyone other than the author, issues of observer bias are lower than some other types of documentary sources. This paper comprises an exploration of the variety of types of climatic information can be mined from a single document or set of documents. The focus of the analysis is three private and one medical diary kept by British colonists in Bombay, western India, during the first decades of the nineteenth century. The paper discusses the potential of the diaries for reconstruction of precipitation, temperature and extreme events. Ad-hoc temperature observations collected by the four observers prove to be particularly fruitful for reconstructing monthly extreme temperatures, with values comparable to more systematic observations collected during the period. This leads to a tentative conclusion that extreme temperatures in Bombay were around 5°C lower during the period than today, a difference likely predominantly attributable to the urban heat island effect.

  13. [Study on the molecular genetics basis for one para-Bombay phenotype].

    PubMed

    Hong, Xiao-Zhen; Shao, Xiao-Chun; Xu, Xian-Guo; Hu, Qing-Fa; Wu, Jun-Jie; Zhu, Fa-Ming; Fu, Qi-Hua; Yan, Li-Xing

    2005-12-01

    To investigate the molecular genetics basis for one para-Bombay phenotype, the red blood cell phenotype of the proband was characterized by standard serological techniques. Exon 6 and 7 of ABO gene, the entire coding region of FUT1 gene and FUT2 gene were amplified by polymerase chain reaction from genomic DNA of the proband respectively. The PCR products were purified by agarose gels and directly sequenced. The PCR-SSP and genescan were performed to confirm the mutations detected by sequencing. The results showed that the proband ABO genotype was A(102)A(102). Two heterozygous mutations of FUT1 gene, an A to G transition at position 682 and AG deletion at position 547-552 were detected in the proband. A682G could cause transition of Met-->Val at amino acid position 228, AG deletion at position 547-552 caused a reading frame shift and a premature stop codon. The FUT2 genotype was heterozygous for a functional allele Se(357) and a weakly functional allele Se(357), 385 (T/T homozygous at position 357 and A/T heterozygous at 385 position). It is concluded that the compound heterozygous mutation--a novel A682G missense mutation and a 547-552 del AG is the molecular mechanism of this para-Bombay phenotype.

  14. Molecular basis of Bombay phenotype in Mashhad, Iran: identification of a novel FUT1 deletion.

    PubMed

    Zanjani, D S; Afzal Aghaee, M; Badiei, Z; Mehrasa, R; Roodsarabi, A; Khayyami, M E; Shahabi, M

    2016-07-01

    Bombay phenotype is characterized by the lack of H substance both on red blood cell (RBC) surface and in body secretions. Mutations of fucosyltransferase 1 (FUT1) and fucosyltransferase 2 (FUT2) genes are resulted in this rare phenotype. Five unrelated patients were tested by hemagglutination and adsorption/elution techniques for the presence of ABH antigens. The saliva specimens were analysed by hemagglutination inhibition method. The exons 6 and 7 of ABO gene were sequenced to determine ABO genotype. The coding fragments of FUT1 and FUT2 were amplified and sequenced by specific primers. Serologic investigation confirmed Bombay phenotype in all individuals. FUT1 molecular analysis revealed a novel large deletion. Also two novel homozygous mutations were detected; one was a missense mutation (392T>C, L131P) and the other a three nucleotide deletion (668_670delACT, Y224del). FUT2 sequencing showed one reported null allele (428G>A, W143X) and one homozygous deletion of FUT2. Although FUT2 deletion has been reported, this is the first report of FUT1 deletion. Finding two FUT1 novel alleles in Iranian people is indicative of mutation diversity in this gene. © 2016 International Society of Blood Transfusion.

  15. Significance of serological monitoring in a Bombay Rh (D) negative phenotype pregnant woman: a case report.

    PubMed

    Jain, Ashish; Kumawat, Vijay; Patil, Sandeep S; Kumar, Praveen; Marwaha, Neelam; Sharma, Ratti Ram

    2012-12-01

    A 32 year old Indian female was referred to our hospital at 32 weeks of gestation because of difficulty in blood group determination and further antenatal care. The results of cell and serum grouping of her blood sample were suggestive of Bombay (O(h)) Rh (D) negative phenotype. An indirect antiglobulin test (IAT) using a pool of red cells from two Bombay Rh (D) positive blood donors gave negative result using the tube as well as the gel technique (LISS-Coombs Card, BioRad, Switzerland), thus ruling out anti-D antibody in her serum. The anti-H titer was 16 (tube technique) and with dithiothreitol (DTT) treated patient's serum the antibody screening was negative suggestive of IgM type of anti-H antibodies. Within the patient's family, only one member (younger sister) was of O(h) phenotype and also was Rh (D) negative. The baby was born vaginally at 38+6 weeks of gestation and was non-hydropic with a packed cell volume (PCV) of 55%. The baby's blood group was AB Rh (D) negative and the cord blood direct antiglobulin test (DAT) was negative. Thus, a careful serological testing of O(h) phenotype antenatal women especially with Rh (D) negative phenotype is of utmost importance in determining the isoimmunization status. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Urolithiasis in northeast Bombay: seasonal prevalence and chemical composition of stones.

    PubMed

    Hussain, F; Billimoria, F R; Singh, P P

    1990-01-01

    The seasonal prevalence of urinary calculus disease from the records of L.T. Municipal General Hospital, Sion, Bombay, which primarily caters services to poor people of Northeast Bombay, especially Dharavi slum area, is reported. The qualitative and quantitative compositions of stones collected from the patients of Dharavi slum area are also described. Interestingly, the prevalence of bladder stones (BSF) was lower than that of upper urinary tract stones (UUTSF) which suggests the possibility of involvement of environmental pollution. As regards total number of stone patients, a sharp fall in male BSF in March and increase in male UUTSF in November were evident. In females the number was maximum in April in both BSF and UUTSF. However, no recognizable pattern of seasonal variation was seen in operated stone patients indicating that metabolically active disease is unrelated to season. Prevalence of bladder stones in children was high and male/female ratio was about 5. All stones were of the mixed type. Infection was not a major contributor of stone growth. Calcium oxalate was the major constituent and ammonium acid urate was present in the majority of stones.

  17. Antileprosy measures in Bombay, India: an analysis of 10 years' work*

    PubMed Central

    Koticha, K. K.; Nair, P. R. R.

    1976-01-01

    Leprosy control measures adopted in Bombay consist of health education, case-detection, and treatment, and are carried out mainly by the Acworth Leprosy Hospital and its subsidiary, the Greater Bombay Leprosy Control Scheme. Although the data collected on different aspects of leprosy during the 10-year period 1963-72 are hospital-based and retrospective, their analysis provides a useful indicator of the possible situation in the field. Health education is provided by medical social workers, field staff, and physicians, and the significance of this activity in relation to early detection of leprosy is analysed. It is shown, however, that case-holding is a more urgent priority than case-detection. Trials have confirmed the effectiveness of chemoprophylaxis with dapsone for contacts of infectious index cases in crowded households. Comparison of annual expenditure per outpatient in leprosy clinics with that for inpatients in a leprosy hospital demonstrates greater cost-effectiveness of outpatient treatment. Some practical recommendations are made for leprosy control. PMID:827341

  18. Molecular genetic analysis of para-Bombay phenotypes in Chinese: a novel non-functional FUT1 allele is identified.

    PubMed

    Yip, S P; Chee, K Y; Chan, P Y; Chow, E Y D; Wong, H F

    2002-10-01

    The para-Bombay phenotype (also known as H-deficient secretor) is characterized by a lack of ABH antigens on red cells, but ABH substances are found in saliva. Molecular genetic analysis was performed for five Chinese individuals serologically typed as para-Bombay. ABO genotyping and mutational analysis of both FUT1 (or H) and FUT2 (or Se) loci were performed for these individuals using the polymerase chain reaction, single-strand conformation polymorphism analysis and direct DNA sequencing. The ABO genotypes of these para-Bombay individuals correlated with the types of ABH substances found in the saliva. Their FUT1 genotypes were h1h2 (three individuals), h2h2 (one individual) and h2h6 (one individual). Alleles h1 (547-552delAG) and h2 (880-882delTT) were known frameshift mutations, while h6 (522C > A) was a missense mutation (Phe174Leu) not previously reported. These three mutations were rare sequence variations, each with an allele frequency of less than 0.005. Phe174 might be functionally important because this residue is conserved from mouse to human. Their FUT2 genotypes were Se357se357,385 for the h2h6 individual and Se357Se357) for the others. Both FUT2 alleles were known: one functional (Se357) and one weakly functional (se357,385). That they carried at least one copy of a functional FUT2 allele was consistent with their secretor status. As FUT1 and FUT2 are adjacent on 19q13.3, there are three possible haplotypes in these para-Bombay individuals: h1-Se357; h2-Se357; and h6-se357,385. A novel non-functional FUT1 allele (522C > A, or Phe174Leu) was identified in a para-Bombay individual and on a se357,385 haplotype background.

  19. Victoria Crater from Duck Bay Stereo

    NASA Image and Video Library

    2006-09-28

    NASA Mars rover Opportunity edged closer to the top of the Duck Bay alcove along the rim of Victoria Crater overnight Sept. 27 to Sept. 28, and gained this vista of the crater. 3D glasses are necessary to view this image.

  20. Isolation and purification of duck liver ferritin.

    PubMed

    Díez, J M; Agapito, M T; Recio, J M

    1985-09-01

    A rapid method of purifying duck liver ferritin using high speed centrifugation and chromatography on Sephadex G-200 and Sepharose 6B is described. Protein and iron concentration for each step of purification is given. This method yields 0.12 mg of pure ferritin per gram of wet tissue.

  1. Habitat Suitability Index Models: Wood duck

    USGS Publications Warehouse

    Sousa, Patrick J.; Farmer, Adrian H.

    1983-01-01

    A review and synthesis of existing information were used to develop models for breeding and wintering habitats for the wood duck (Aix sponsa). The models are scaled to produce indices of habitat suitability between 0 (unsuitable habitat) and 1 (optimally suitable habitat). Habitat suitability indices are designed for use with Habitat Evaluation Procedures previously developed by the U.S. Fish and Wildlife Service.

  2. Evaluation and experimentation with duck management strategies

    USGS Publications Warehouse

    Nichols, J.D.; Johnson, F.A.

    1989-01-01

    Our knowledge of the effects of hunting regulations on duck populations has been based largely on retrospective studies of historical data. We have reached the limits of what can be learned in this way. Future knowledge gains will likely come about only through experimentation and adaptive management.

  3. The midwinter survey of black ducks, locally and regionally

    USGS Publications Warehouse

    Jorde, Dennis G.; Stotts, D.B.; Perry, M.C.

    2002-01-01

    The Midwinter Waterfowl Inventory (MWI) has been conducted consistently in Maryland since 1955 and in Virginia since 1957. Maryland currently focuses surveys in 30 segments along the Chesapeake Bay, Potomac River, and Atlantic Coast, whereas Virginia focuses on 22 segments centered over the eastern shore of Chesapeake Bay and along the tidewater areas of Back Bay and western shore tributaries. Until 1980, the survey along the Potomac River was shared and sometimes duplicated by Maryland and Virginia but now is flown entirely by Maryland. The MWI number of black ducks wintering in Maryland shows a decreasing trend until 1983 when the trend reversed, possibly in response to restrictive hunting regulations. In Virginia, the MWI index of black ducks reached its lowest point in 1965 at just under 4,000 ducks, steadily increased to a peak of 18,000 black ducks in 1981, then began a steady decline to the present. The number of black ducks on the Potomac River reached a low of 400 ducks in 1971, 1984, and 1985 but generally attracts 500-1,500 ducks each year. The distribution of black ducks in the Bay has also changed from upper Bay areas to mid-Bay eastern shore sites and the Potomac River. Whereas the decline in black ducks seems to be related to hunting, the redistribution of black ducks in Maryland seems to be associated with habitat changes in water quality and the decline of submerged aquatic vegetation.

  4. Factors limiting traditional household duck production in Bangladesh.

    PubMed

    Hoque, M A; Skerratt, L F; Rahman, M A; Beg, A B M Rabiul Alam; Debnath, N C

    2010-10-01

    A cross sectional survey of duck production was carried out in 2002 on 771 traditional, semiscavenging household duck farms on the coastal Island of Hatia. We determined the socioeconomic characteristics of duck farmers and their management systems, identified the factors associated with egg production, and measured the level of selected duck diseases and current preventive strategies. Household family size varied from 1 to 14 individuals and women were the main caretakers of ducks. Around 34% of keepers were illiterate. Most duck products (eggs and meat; 85%) were sold at the local market. Duck houses were poorly ventilated and a variety of bedding materials were used. Feed was available in nearby scavenging areas; however, additional feed was frequently supplied by farmers. Almost all farmers (96%) ranked the rainy season as the best time for rearing ducks due to greater feed availability. The annual egg production was 79 eggs per layer with a weight of 48 g and a hatchability rate of 87%. Egg production varied by zone (p < 0.05). The odds of suboptimal egg production was 0.5 times lower in educated farmers (p = 0.001). The odds of suboptimal egg production was 2.5 times more likely in ducks that attained sexual maturity at >22 weeks (p<0.001). Most farmers ranked duck plague as the most important disease, followed by duck cholera, botulism, and duck viral hepatitis. Preventive vaccination was sporadic and used by few farmers (28%). There are significant opportunities for improved duck production on the Island of Hatia and in Bangladesh generally.

  5. [Water provisions for Muscovy ducks--behaviour at duck showers and modified plasson drinkers].

    PubMed

    Briese, Andreas; Hänsch, Friederike; Hartung, Jörg

    2009-01-01

    Feather pecking and cannibalism are serious problems in keeping Moscovy ducks. Prevention of feather pecking by regularly applied beak and claw trimming are increasingly criticised by the public. The recommendation of the Council of Europe (COE) for the keeping of Muscovy ducks in farming systems calls for environmental enrichment including water for preening and bathing after December 31,2010. A total of 126 female Muscovy ducks (not beak nor claw trimmed) from commercial breeding lines were kept for 63 resp. 70 days in four compartments with 15-16 ducks each during two production cycles. Two pens where equipped either with duck showers or open water facility (modified Plasson drinker). Water provisions were made available for the ducks four hours daily at working days from their fifth week of life until slaughter. Behaviour at the water provision was registered and analysed for the number of ducks being engaged with water (944 hours recordings over 59 days from four pens analysed in five-minute-intervals (11,540 observations). Additionally 858 feather preening bouts (five a day for each compartment) were analysed for the duration of feather preening behaviour at the water provision. From the fifth to the tenth week of life the mean percentage of animals of a pen was significantly higher at the open trough (trough: 8,3% (+/-5,37); shower: 4.9% (+/-6.1), Mann-Whitney p <0,01) and feather preening took significantly longer (trough: 134.4 sec (+/-154.8); shower: 111.2 sec (+/-152.0), Mann-Whitney p <0.01) than at the showers. Bout duration and percentage of animals observed at both water provisions increased with age. Nonetheless only ten percent of the feather preening behaviour exceeded five minutes. Most animals made use of water in the first hour of the time period when water was provided. In the first weeks of water provision open water troughs were used more often and preening behaviour was longer. When given the choice, younger ducks preferred open drinkers to

  6. Different outcomes of infection of chickens and ducks with a duck-origin H9N2 influenza A virus.

    PubMed

    Wang, J; Li, C C; Diao, Y X; Sun, X Y; Hao, D M; Liu, X; Ge, P P

    2014-01-01

    As the major aquatic and terrestrial hosts for avian influenza viruses (AIVs), ducks and chickens play a critical role in the evolution and spread of the H9N2 virus. However, the outcomes of infection of ducks and chickens with the H9N2 virus are not sufficiently documented. In this study, we compared the outcomes of infection of chickens and Peking ducks with a duck-origin H9N2 virus. The results showed that this virus caused more pronounced clinical signs and histological lesions in chickens. As for the virus shedding, chickens shed more virus in the trachea and less virus in the cloaca in levels of interferon (IFN) γ were found in the trachea of ducks compared with chickens, while comparison with ducks. As for cytokines, namely IFNs and interleukins (IL), higher higher levels of IFN-β, IFN-γ, IL-1β, and IL-6 were observed in the ileum of chickens compared with ducks. Eventually, serum hemagglutination-inhibition (HI) antibody titers were higher in chickens than in ducks. Taken together, ducks and chickens use different strategies in response to the H9N2 virus infection in tissues representing main replication sites of low-pathogenic AIVs. Given the different outcomes of the H9N2 virus infection in ducks and chickens, different measures should be taken in vaccination and treatment.

  7. A multiplex PCR for detection of six viruses in ducks.

    PubMed

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10(2) copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  8. The effects of irradiation on Beijing roast duck

    NASA Astrophysics Data System (ADS)

    Weiguo, Wang; Yongbao, Gu; Fengmei, Li; Ruiying, Zhou

    The irradiation technique combined with freezing has been used to control the microorganisms in Beijing roast duck. 60Co was chosen as the γ-ray source. The average absorbed dose was 2 kGy. After irradiation, the microbe counts reached the tolerable level. Compared with untreated ducks, the irradiated ones showed no remarkable change in nutrition, chemistry, vitamins etc. Preliminary indications are that irradiated frozen Beijing roast duck is wholesome.

  9. Liposomes containing recombinant E protein vaccine against duck Tembusu virus in ducks.

    PubMed

    Ma, Tengfei; Liu, Yongxia; Cheng, Jia; Liu, Yanhan; Fan, Wentao; Cheng, Ziqiang; Niu, Xudong; Liu, Jianzhu

    2016-04-27

    To obtain an effective vaccine candidate against duck Tembusu viral (DTMUV) disease which causes egg-drop and great economical loss in the Chinese duck industry, liposome vaccines containing recombinant E protein were prepared and assessed in this study. The recombinant plasmid (PET28a-E) was constructed and transformed into BL21 (DE3) cells to produce E proteins. The recombinant E proteins were purified and entrapped by liposomes through reverse-phase evaporation. Eighty-four cherry valley ducks were randomly divided into seven groups and inoculated intramuscularly at one- or seven-day-old with liposomes-E protein or Freund's adjuvant-E protein vaccine. Blood samples were collected from the first week to the tenth week for serum antibody, plasma for viremia, as well as oropharyngeal and cloacal swabs for virus shedding analyses after being challenged with a 10(2.4) 50% tissue culture infective dose (TCID50) of duck Tembusu virus. Results showed that serum antibody level of the liposomes vaccine was higher than the Freund's adjuvant vaccine, and inoculating twice was superior to once; furthermore, the viremia and virus shedding tests also proved that the liposomes vaccine can provide complete protection against DTMUV challenge. These results demonstrated that the liposomes-E protein vaccine could be used as a potential candidate vaccine to prevent DTMUV infection in ducks.

  10. Pathogenicity and genetic characterization of a duck Tembusu virus associated with egg-dropping in Muscovy ducks.

    PubMed

    Shen, Han-Qin; Lin, Wen-Cheng; Wang, Zhan-Xin; Zhang, Kai; Yan, Zhuan-Qiang; Zhou, Qing-Feng; Qin, Jian-Ping; Xie, Qing-Mei; Bi, Ying-Zuo; Chen, Feng

    2016-09-02

    Duck Tembusu virus (DTMUV) has spread to the major duck-farming region in China, causing acute egg-production drop in Chinese duck population. In this study, we characterized a DTMUV strain (named GD2014) isolated from an egg-production drop duck farm in Guangdong province, South China. The virus was pathogenic to Muscovy duck embryos and caused severe egg production drop for laying Muscovy ducks. The genome sequence of GD2014 shared 97-99% homologies with other waterfowl-origin Tembusu viruses, and shared 89% identities with MM1775 strain isolated from mosquito. Phylogenetic analysis of entire open reading frame (ORF), E gene and NS5 gene indicated that GD2014 belonged to Ntaya group. These results have implications for understanding the orgin, emergence and pathogenicity of DTMUV as well as for the development of vaccines and diagnostics based on epidemiological data.

  11. Studies on the quality of duck meat sausages during refrigeration.

    PubMed

    Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M

    2016-01-01

    Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating

  12. Riemerella anatipestifer infection in domestic ducks in Japan, 2014

    PubMed Central

    CHIKUBA, Takumi; UEHARA, Haru; FUMIKURA, Shintaro; TAKAHASHI, Ken; SUZUKI, Yoshihisa; HOSHINOO, Kaori; YAMAMOTO, Yu

    2016-01-01

    The outbreak of Riemerella anatipestifer (RA) infection has been confirmed in meat-type domestic ducks (Anas platyrhynchos) for the first time in 27 years in Japan. In January 2014, increased mortality in a 14- to 21-day-old duck flock was reported to veterinary officials by the owner. The affected ducks exhibited reduced movement, ataxia and dorsal recumbency with leg paddling. Pathological findings were typical for an RA infection. Fibrinous and heterophilic pericarditis, airsacculitis, perihepatitis, ventriculitis and meningitis were observed. The bacterial isolate from duck organs was identified as RA by PCR-based 16S ribosomal RNA sequencing. PMID:27373315

  13. Diagnosis of duck plague in waterfowl by polymerase chain reaction.

    PubMed

    Hansen, W R; Nashold, S W; Docherty, D E; Brown, S E; Knudson, D L

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  14. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  15. Lichenoid reaction associated with silver amalgam restoration in a Bombay blood group patient: A case report.

    PubMed

    Pawar, Rohini Rangarao; Mattigatti, Sudha S; Mahaparale, Rushikesh R; Kamble, Amit P

    2016-01-01

    The pathogenic relationship between the oral lichenoid reaction (OLR) and dental restorative materials has been confirmed many times. An OLR affecting oral mucosa in direct contact with an amalgam restoration represents a delayed, type IV, cell mediated immune response to mercury or one of the other constituents of the dental amalgam. Bombay blood group patients are more prone to this. A case of bilateral OLR is presented, which is present in relation to amalgam restoration. The lesion healed up after the replacement of restorations with an intermediate restorative material. The clinician should be aware of all the possible pathological etiologies of white lesions. If there is any doubt about the nature or management of a usual oral lesion, a referral to an appropriate specialist is mandatory.

  16. They have not heard of AIDS: HIV/AIDS awareness among married women in Bombay.

    PubMed

    Chatterjee, N

    1999-05-01

    Many married women in India have still not heard of AIDS despite increasing risks, intensive health education campaigns and widespread scientific and media attention. Cross-sectional survey data collected from 350 married women in Bombay, India, revealed that one out of three women had not heard of AIDS. The women who had not heard of AIDS had significantly fewer years of formal education, lower personal and family incomes, less exposure to the mass media and were more likely not to know of condoms in comparison to the women who had heard of AIDS. The results suggest that there are socio-economic barriers to health information. Specific interventions targeted to this group using specific channels of communication are urgently needed.

  17. Rambam-Hasharon syndrome of psychomotor retardation, short stature, defective neutrophil motility, and Bombay phenotype.

    PubMed

    Frydman, M; Etzioni, A; Eidlitz-Markus, T; Avidor, I; Varsano, I; Shechter, Y; Orlin, J B; Gershoni-Baruch, R

    1992-10-01

    We describe 2 Arab patients, both offspring of unrelated consanguineous matings, with unusual facial appearance, severe mental retardation, microcephaly, cortical atrophy, seizures, hypotonia, dwarfism, and recurrent infections with neutrophilia. Neutrophil motility was markedly decreased but the opsonophagocytic activity was normal. Both patients lack the red blood cell (RBC) H antigen and manifest the Bombay (hh) phenotype. Familial endocardial fibroelastosis and familial tetralogy of Fallot segregated independently in one family. The occurrence of the same syndrome in 2 unrelated families suggests that the various aspects of the disorder are the pleiotropic effects of a single mutation. Homozygosity-by-descent for a deletion involving contiguous genes may explain the findings in this syndrome. Alternatively, a mutation which involves an ubiquitous GDP fucose donor rather than the enzyme (alpha 2-L-fucosyltransferase) or its substrate (glcNAc) may account for the pleiotropic manifestations in this syndrome.

  18. Process modelling and simulation of underground coal gasification: A Review of work done at IIT Bombay

    NASA Astrophysics Data System (ADS)

    Sharma, Surabhi; Mahajani, Sanjay M.

    2017-07-01

    This paper presents the summary of the work performed over the last decade, at IIT Bombay by the UCG group. The overall objective is to determine the feasibility of a given coal for underground coal gasification and then determine the capacity of a single pair of well through modelling and simulation. It would help one to design a UCG facility for the desired rate of gas production. The simulator developed in this study seeks inputs on four important aspects: Kinetics of all the reactions under the conditions of interest, heat and mass transfer limitations, if any, the flow patterns inside the cavity and lastly the thermo-mechanical failure of the coal. Each of them requires detailed studies in laboratory. Indian Lignite from one of the reserves was chosen as a case study.

  19. Injection of duck recombinant follistatin fusion protein into duck muscle tissues stimulates satellite cell proliferation and muscle fiber hypertrophy.

    PubMed

    Liu, He-he; Wang, Ji-wen; Yu, Hai-yue; Zhang, Rong-ping; Chen, Xi; Jin, Hai-bo; Dai, Fei; Li, Liang; Xu, Feng

    2012-06-01

    Follistatin (FST) can inhibit the expression of myostatin, which is a predominant inhibitor of muscle development. The potential application of myostatin-based technology has been prompted in different ways in agriculture. We previously constructed an expression vector of duck FST and isolated the FST fusion protein. After the protein was purified and refolded, it was added to the medium of duck myoblasts cultured in vitro. The results show that the 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide value of the myoblasts in the duck FST treatment group is higher than that in the control group, which indicates that the duck FST fusion protein exhibits the biological activities that can accelerate myoblast proliferation. To further investigate the roles of duck FST on muscle development, we injected the protein into the duck muscle tissues in vivo. The results show that both the duck muscle fiber cross-sectional area and the satellite cell activation frequency are influenced more in the FST treatment group than they are in the control group. In addition to these phenomena, expression of MyoD and Myf5 were increased, and the expression of myostatin was decreased. Together, these results suggest the potential for using duck FST fusion protein to inhibit myostatin activity and subsequently to enhance muscle growth in vivo. The mechanism by which FST regulates muscle development in the duck is similar to that in mammals and fishes.

  20. Indigenous Muscovy ducks in Congo-Brazzaville. 1. A survey of indigenous Muscovy duck management in households in Dolisie City.

    PubMed

    Banga-Mboko, H; Maes, D; Leroy, P L

    2007-02-01

    A cross-sectional study by means of a questionnaire with open-ended questions and multiple-choice questions was used to collect data on the profile of duck keepers, husbandry practices, and performances, opportunities and constraints of Muscovy duck breeding in households (n = 88) in Dolisie city (Congo-Brazzaville). The study confirmed the common observations on traditional poultry keeping such as scavenging during the day and housing overnight. The flock size (7.7 +/- 3 ducks per unit) showed no specialization of husbandry (100% of surveyed flocks were kept for simultaneous production of ducklings, meat and eggs) and a high drake-to-duck ratio (1:3). The hatchability was close to 80.5% +/- 13%, whereas the average number of eggs was 13.2 +/- 5 per clutch. In addition, a high mortality (80%) was observed in ducklings, which was due to poor feeding, lack of veterinary care and housing conditions. Eggs and live ducks were sold by duck farmers in response to the family needs rather than market price. The three most important findings were as follows: (1) duck keepers were mainly men (80% versus 20% of women); (2) there was no evidence of taboo; and (3) the duck as an exotic bird was not proscribed by cultural beliefs, and therefore development of the Muscovy duck in Congo Brazzaville should be unhindered.

  1. A survey of North American migratory waterfowl for duck plague (duck virus enteritis) virus

    USGS Publications Warehouse

    Brand, Christopher J.; Docherty, Douglas E.

    1984-01-01

    A survey of migratory waterfowl for duck plague (DP) virus was conducted in the Mississippi and Central flyways during 1982 and in the Atlantic and Pacific flyways during 1983. Cloacal and pharyngeal swabs were collected from 3,169 migratory waterfowl in these four flyways, principally mallards (Anas platyrhynchos L.), black ducks (Anas rubripes Brewster), and pintails (Anas acuta L). In addition 1,033 birds were sampled from areas of recurrent DP outbreaks among nonmigratory and captive waterfowl, and 590 from Lake Andes National Wildlife Refuge, the site of the only known major DP outbreak in migratory waterfowl. Duck plague virus was not found in any of the samples. Results support the hypothesis that DP is not established in North American migratory waterfowl as an enzootic disease.

  2. Post-epizootic surveys of waterfowl for duck plague (duck virus enteritis)

    USGS Publications Warehouse

    Brand, C.J.; Docherty, D.E.

    1988-01-01

    Surviving birds from nine duck plague outbreaks in urban and confined waterfowl were sampled for duck plague (DP) virus and DP antibody during 1979-86. Duck plague virus was found in combined oral and cloacal swabs of birds from three outbreaks, and DP-neutralizing antibody was demonstrated in some birds from all nine outbreaks. Greater prevalence of DP antibody and higher titers were found in survivors from confined populations than from free-flying urban populations. Free-flying waterfowl from within 52 km of four DP outbreak sites were also sampled; virus was not found in any birds, but DP antibody was found in urban waterfowl in the vicinity of an outbreak in Potterville, Michigan. No evidence of exposure to or shedding of DP virus in migratory waterfowl was found in two regions where DP appears enzootic in urban and confined waterfowl (Eastern Shore of Maryland and the vicinity of Sacramento, California).

  3. Novel duck parvovirus identified in Cherry Valley ducks (Anas platyrhynchos domesticus), China.

    PubMed

    Li, Chuanfeng; Li, Qi; Chen, Zongyan; Liu, Guangqing

    2016-10-01

    An unknown infectious disease in Cherry Valley ducks (Anas platyrhynchos domesticus) characterized by short beak and strong growth retardation occurred in China during 2015. The causative agent of this disease, tentatively named duck short beak and dwarfism syndrome (DSBDS), as well as the evolutionary relationships between this causative agent and all currently known avian-origin parvoviruses were clarified by virus isolation, transmission electron microscope (TEM) observation, analysis of nuclear acid type, (RT-)PCR identification, whole genome sequencing, and NS1 protein sequences-based phylogenetic analyses. The results indicated that the causative agent of DSBDS is closely related with the goose parvovirus-like virus, which is divergent from all currently known avian-origin parvoviruses and should be a novel duck parvovirus (NDPV).

  4. Replication cycle of duck hepatitis A virus type 1 in duck embryonic hepatocytes.

    PubMed

    Yao, Fangke; Chen, Yun; Shi, Jintong; Ming, Ke; Liu, Jiaguo; Xiong, Wen; Song, Meiyun; Du, Hongxu; Wang, Yixuan; Zhang, Shuaibin; Wu, Yi; Wang, Deyun; Hu, Yuanliang

    2016-04-01

    Duck hepatitis A virus type 1 (DHAV-1) is an important agent of duck viral hepatitis. Until recently, the replication cycle of DHAV-1 is still unknown. Here duck embryonic hepatocytes infected with DHAV-1 were collected at different time points, and dynamic changes of the relative DHAV-1 gene expression during replication were detected by real-time PCR. And the morphology of hepatocytes infected with DHAV was evaluated by electron microscope. The result suggested that the adsorption of DHAV-1 saturated at 90 min post-infection, and the virus particles with size of about 50 nm including more than 20 nm of vacuum drying gold were observed on the infected cells surface. What's more, the replication lasted around 13 h after the early protein synthesis for about 5h, and the release of DHAV-1 was in steady state after 32 h. The replication cycle will enrich the data for DVH control and provide the foundation for future studies.

  5. A novel FUT1 allele was identified in a Chinese individual with para-Bombay phenotype.

    PubMed

    Xu, X; Tao, S; Ying, Y; Hong, X; He, Y; Zhu, F; Lv, H; Yan, L

    2011-12-01

    The para-Bombay phenotype is characterised by H-deficient or H partially deficient red blood cells (RBCs) in individuals who secrete ABH antigens in their saliva. Samples from an individual whose RBCs had an apparent para-Bombay phenotype and his family members were investigated and a novel FUT1 allele was identified. RBCs' phenotype was characterised by standard serologic technique. Genomic DNA was sequenced with primers that amplified the coding sequence of FUT1 and FUT2, respectively. Routine ABO genotyping analysis was performed. Haplotypes of FUT1 were identified by TOPO cloning sequencing. Recombination expression vectors of FUT1 mutation alleles were constructed and transfected into COS-7 cells. The pα-(1,2)-fucosyltransferase activity of expression protein was determined. B101/O02 genotype of the proband was correlated with ABH substances in saliva. The proband carried a new FUT1 allele which showed 35C/T, 235G/C and 682A/G heterozygote by directly DNA sequencing. Two haplotypes, 235C and 35T+682G, were identified by TOPO cloning sequencing and COS-7 cells transfected with five recombination vectors including wild-type, 35T, 235C, 682G and 35T+682G alleles were established respectively. The α-(1,2)-fucosyltransferase activities of cell lysates which had transfected with 35T, 235C, 682G and 35T+682G recombination vectors showed 79·45, 16·23, 80·32 and 24·59%, respectively, compared with that of the wild-type FUT1-transfected cell lysates. A novel FUT1 allele 235C was identified, which greatly diminished the activity of α-(1,2)-fucosyltransferase. © 2011 The Authors. Transfusion Medicine © 2011 British Blood Transfusion Society.

  6. OPEC ducks quota issue amid glut worries

    SciTech Connect

    Not Available

    1991-12-09

    This paper reports that the Organization of Petroleum Exporting Countries has ducked the question of reestablishing quotas despite the looming prospect of a second quarter oil price slide. OPEC ministers meeting in Vienna late last month approved continuing free-for-all production in the first quarter and ordered the ministerial monitoring committee to tackle the question of second quarter production levels when it meets in Geneva Feb. 12. Oil markets responded to the lack of action by dropping futures prices.

  7. The frequency of salmonellae on duck eggs.

    PubMed

    Baker, R C; Qureshi, R A; Sandhu, T S; Timoney, J F

    1985-04-01

    Total plate counts on washed duck eggs from a breeder farm on Long Island were less than 30/shell during the winter (January to February) of 1982. Clean unwashed eggs had counts less than 9 X 10(1)/shell, whereas dirty unwashed eggs had counts as high as 9 X 10(5)/shell. Our results showed that washing with a chlorine sanitizer (under commercial conditions) was highly effective in reducing surface bacterial counts on egg shells. Prolonged storage reduced bacterial counts on clean eggs, but it did not significantly affect loads on dirty eggs. No salmonellae could be detected on shells or in the magma of all eggs examined. In a second trial (March 1982) bacterial loads on washed and clean duck eggs from six different breeder farms were low, ranging from too few to count to 10(2)/shell. A higher proportion of dirty eggs were heavily contaminated with counts ranging from 10(5) to 10(6)/shell, but no salmonellae were detected either on shells or in magma. In the third trial (May 1982) bacterial determinations on eggs from breeder ducks that were not confined followed the pattern of the second trial. However, in this trial Salmonella enteritidis was detected on dirty egg shells in four of six farms. In a fourth trial (May 1983), bacterial loads on washed and nest-clean eggs from the same breeder farms (not confined) ranged between 10(2) to 10(3)/shell and 10(2) to 10(4)/shell, respectively. S. enteritidis and S. badar were recovered from washed, nest clean, and dirty eggs in two of six farms. We conclude that proper egg washing and confinement of duck breeders should minimize the problem of salmonellosis in ducklings.

  8. Harvest and dynamics of duck populations

    USGS Publications Warehouse

    Sedinger, James S.; Herzog, Mark P.

    2012-01-01

    The role of harvest in the dynamics of waterfowl populations continues to be debated among scientists and managers. Our perception is that interested members of the public and some managers believe that harvest influences North American duck populations based on calls for more conservative harvest regulations. A recent review of harvest and population dynamics of North American mallard (Anas platyrhynchos) populations (Pöysä et al. 2004) reached similar conclusions. Because of the importance of this issue, we reviewed the evidence for an impact of harvest on duck populations. Our understanding of the effects of harvest is limited because harvest effects are typically confounded with those of population density; regulations are typically most liberal when populations are greatest. This problem also exists in the current Adaptive Harvest Management Program (Conn and Kendall 2004). Consequently, even where harvest appears additive to other mortality, this may be an artifact of ignoring effects of population density. Overall, we found no compelling evidence for strong additive effects of harvest on survival in duck populations that could not be explained by other factors.

  9. Survival of postfledging female American black ducks

    USGS Publications Warehouse

    Longcore, J.R.; McAuley, D.G.; Frazer, C.

    1991-01-01

    We equipped 106 hatching-year (HY), female, black ducks (Anas rubripes) with transmitters during 1985-87 and monitored survival from late August to mid-December on a lightly hunted area on the Maine-New Brunswick border. The 1985-87 estimate of survival (hunting losses included) was 0.593, and when losses from hunting were censored it was 0.694. Survival in August-September was 0.987; by 31 October survival declined to 0.885, and by 30 November it was 0.718. Most nonhunting mortality was caused by predators (21/41, 53.2%); there were 14 deaths (34.1%) from mammals or unknown predators and 7 (17.1%) from raptors. Hunting caused 13 (31. 7%) deaths. Ducks with lowest mass had the lowest survival. The estimate of survival for postfledging female black ducks, when multiplied with interval survival rates for hunting, winter, and breeding periods, produced an annual survival estimate of 0.262, about 12% lower than that (0.38) based on analysis of banding data.

  10. [Two base deletion of the alpha (1,2) fucosyltransferase gene responsible for para-Bombay phenotype].

    PubMed

    Zhu, Fa-ming; Xu, Xian-guo; Hong, Xiao-zhen; Yan, Li-xing

    2004-06-01

    To probe into the molecular genetics basis for para-Bombay phenotype. Red blood cell phenotype of the proband was characterized by serological techniques. Exons 6 and 7 of ABO gene, the entire coding region of alpha(1,2) fucosyltransferase (FUT1) gene and FUT2 gene were amplified by polymerase chain reaction (PCR) from genomic DNA of the proband respectively. The PCR products were excised and purified from agarose gels and were directly sequenced. AG at 547-552 deletion homozygous allele was found in the proband, which caused a reading frame shift and a premature stop codon. Parents of proband were heterozygous carriers. Two base deletion at position 547-552 of alpha (1,2) fucosyltransferase gene may cause para-Bombay phenotype.

  11. A case of nearly mistaken AB para-Bombay blood group donor transplanted to a group 'O' recipient.

    PubMed

    Townamchai, Natavudh; Watanaboonyongcharoen, Phandee; Chancharoenthana, Wiwat; Avihingsanon, Yingyos

    2014-10-31

    Unintentional ABO mismatch kidney transplantation can cause detrimental hyperacute rejection. We report the first successful ABO incompatible kidney transplantation from an AB para-Bombay donor to O recipient. At the initial evaluation, the donor's ABO type was discordance on the cell typing and serum typing, which typed to be 'O' as cell typing and 'AB' as serum typing. At the second investigation, it was confirmed that the donor had a unique, rare but not uncommon blood type AB para-Bombay which was incompatible with the recipient's blood group. The kidney transplantation was successfully performed by an ABO incompatible preconditioning, double filtration plasmapheresis (DFPP) and rituximab. The serum creatinine at 12 months post-transplantation was 1.3 mg/dL. The pathology of the kidney biopsy showed no signs of rejection.

  12. Genomic analysis of para-Bombay individuals in south-eastern China: the possibility of linkage and disequilibrium between FUT1 and FUT2

    PubMed Central

    Zhang, Ai; Chi, Quan; Ren, Benchun

    2015-01-01

    Background The para-Bombay phenotype results from a variety of mutations in the α-(1,2)-fucosyltransferase gene (FUT1). We investigated samples from seven Chinese probands serologically typed as having the para-Bombay phenotype. Materials and methods The para-Bombay phenotype was identified by standard serological methods. Genetic mutations of FUT1 and FUT2 genes were analysed by DNA sequencing. Heterozygous mutations of FUT1 were identified by TOPO cloning sequencing. Blood samples from 331 randomly-selected Chinese donors were analysed with the SNaPshot system to distinguish five known mutations (Se C357T, A385T, G428A, G716A and FUT1 880delTT) in the FUT1 and FUT2 genes. The genetic characteristics of all para-Bombay probands identified in the Fujian Blood Centre, including those in the present study, were also summarised. Results Three FUT1 genotypes, h1/h1 (5 individuals), h1/h6 (1 individual) and h3/h2 (1 individual), and three FUT2 genotypes, Se357/Se357 (5 individuals), Se357/Se357, 385 (1 individual) and Se357/Se357, 716 (1 individual) were observed in seven para-Bombay probands. Among 331 donors, only one individual carried the G716A and 880delTT mutations in heterozygosity; this subjects FUT1 and FUT2 genotypes were H/h2 and Se357/Se357, 716, respectively. Conclusion The review of all para-Bombay probands identified in the Fujian Blood Centre showed that h1 and h2 are the predominant non-functional FUT1 alleles in Fujian para-Bombay individuals. Our data confirm the hypothesis that the h2 allele is linked to Se357, 716, and the concurrence of unique FUT1 and FUT2 mutations is geographically specific. PMID:25761312

  13. Genomic analysis of para-Bombay individuals in south-eastern China: the possibility of linkage and disequilibrium between FUT1 and FUT2.

    PubMed

    Zhang, Ai; Chi, Quan; Ren, Benchun

    2015-07-01

    The para-Bombay phenotype results from a variety of mutations in the α-(1,2)-fucosyltransferase gene (FUT1). We investigated samples from seven Chinese probands serologically typed as having the para-Bombay phenotype. The para-Bombay phenotype was identified by standard serological methods. Genetic mutations of FUT1 and FUT2 genes were analysed by DNA sequencing. Heterozygous mutations of FUT1 were identified by TOPO cloning sequencing. Blood samples from 331 randomly-selected Chinese donors were analysed with the SNaPshot system to distinguish five known mutations (Se C357T, A385T, G428A, G716A and FUT1 880delTT) in the FUT1 and FUT2 genes. The genetic characteristics of all para-Bombay probands identified in the Fujian Blood Centre, including those in the present study, were also summarised. Three FUT1 genotypes, h1/h1 (5 individuals), h1/h6 (1 individual) and h3/h2 (1 individual), and three FUT2 genotypes, Se(357)/Se(357) (5 individuals), Se(357)/Se(357, 385) (1 individual) and Se(357)/Se(357, 716) (1 individual) were observed in seven para-Bombay probands. Among 331 donors, only one individual carried the G716A and 880delTT mutations in heterozygosity; this subjects FUT1 and FUT2 genotypes were H/h2 and Se(357)/Se(357, 716), respectively. The review of all para-Bombay probands identified in the Fujian Blood Centre showed that h1 and h2 are the predominant non-functional FUT1 alleles in Fujian para-Bombay individuals. Our data confirm the hypothesis that the h2 allele is linked to Se(357, 716), and the concurrence of unique FUT1 and FUT2 mutations is geographically specific.

  14. Two missense mutations of H type alpha(1,2)fucosyltransferase gene (FUT1) responsible for para-Bombay phenotype.

    PubMed

    Wang, B; Koda, Y; Soejima, M; Kimura, H

    1997-01-01

    Rare individuals (Bombay and para-Bombay phenotypes) fail to express the A, B and H antigens on erythrocyte membranes because of a lack in the H gene (FUT1)-encoded alpha(1,2)fucosyltransferase activity. In this study, we have found a para-Bombay individual (Bmh) who expressed B and H antigens in saliva but not on red blood cells. The FUT1 alleles of this person contained two single base changes (T460C and G1042A) in the coding region relative to the wild type allele. These substitutions may result in changes in two amino acid residues (Y154H and E348K). Since the T460C and G1042A mutations destroy endonuclease RsaI and AvaI sites, respectively, we tested for these mutations using PCR-RFLP. Our findings indicated that this para-Bombay person was homozygous for the T460C and G1042A mutations, and that neither of these mutations was found in 136 randomly selected Japanese individuals. The measurement of the alpha(1,2)fucosyltransferase activity after transient expression of the FUT1 alleles in COS-7 cells indicated that the H-deficient allele-encoded enzyme had no detectable activity. Moreover, transfection by chimera FUT1 allele contains only the T460C mutation, or only the G1042A mutation, and yielded 1.0 or 9.3%, respectively, of the activities compared to transfection by the wild type allele. These results suggest that the two mutations in combination are responsible for the inactivation of the FUT1-encoded enzyme activity.

  15. Identification of a rare blood group, “Bombay (Oh) phenotype,” in Bhuyan tribe of Northwestern Orissa, India

    PubMed Central

    Balgir, R. S.

    2007-01-01

    BACKGROUND: Blood group serology plays a vital role in transfusion medicine. The Bombay (Oh) phenotype is characterized by the absence of A, B, and H antigens on red cells and occurs rarely, especially in tribal populations of India. AIMS AND OBJECTIVES: This is a field-based random population study in the Bhuyan tribal community. The study reports three cases of the rare Bombay (Oh) phenotype for the first time in the Bhuyan tribe of Sundargarh district in North-Western Orissa. MATERIALS AND METHODS: Taking informed consent, red blood cells of 836 Bhuyan subjects were tested with three antisera, i.e., anti-A, anti-B, and anti-H (lectin) for forward reaction. Agglutinations of plasma with A, B, and O (H) red cells (reverse reaction) were also tested for the presence or absence of antibodies in the serum. Specialized tests like absorption-elution, titration of naturally occurring antibodies at different temperatures, inhibition of anti-H by O saliva secretor, and determination of secretor status were performed. RESULTS: Three cases of a rare blood group, Bombay (Oh) phenotype, (2 out of 244 Khandayat Bhuyan and 1 out of 379 Paudi Bhuyan from Hemgiri and Lahunipara blocks, respectively) in the Bhuyan tribe of Sundargarh district in North-Western Orissa were detected, giving an incidence of 1 in 122 in Khandayat Bhuyan and 1 in 379 in Paudi Bhuyan, with an average of 1 in 278 among the Bhuyan tribal population. This incidence is high in comparison to earlier studies reported from India. CONCLUSIONS: The practice of tribal and territorial endogamy in a smaller effective populations (for example, there are only 3,521 individuals in Paudi Bhuyan) results in smaller marital distance and inbreeding, leading to increased homozygous expression of rare recessive genetic characters like the Bombay (Oh) phenotype. This study further testifies that the incidence is higher in those states of India where the consanguinity is a common practice. PMID:21957358

  16. [Analysis of alpha-1,2-fucosyltransferase gene mutations in a Chinese family with para-Bombay phenotype].

    PubMed

    Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Ying, Yan-ling; Tao, Su-dan; He, Yan-min; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

    2010-06-01

    To investigate the molecular genetic basis of para-Bombay phenotype in a Chinese family. ABO and H phenotypes of the proband and his pedigree were characterized by serological techniques. The exons 6 and 7 of the ABO gene and full coding region of alpha-1,2-fucosyltransferase (FUT1) gene of the pedigree were analyzed by polymerase chain reaction and direct sequencing of the amplified fragments. The haplotypes of compound heterozygote of the FUT1 gene were also analyzed by cloning sequencing. Three para-Bombay phenotypes were identified in nine family members by serological technology. Three heterozygous variants (35C/T, 235G/C and 682A/G) were found in FUT1 gene of the proband, and the hapotype of FUT1 gene was h(235C)/h(35T+628G)according to the cloning sequencing. The alleles h(235C)and h(35T+628G) caused G79R, A12V and M228V amino acid substitutions in alpha-1,2-fucosyltransferase, respectively. A novel 235G>C mutation of FUT1 gene which was associated with para-Bombay phenotype was found in the Chinese pedigree.

  17. An Alu-mediated large deletion of the FUT2 gene in individuals with the ABO-Bombay phenotype.

    PubMed

    Koda, Y; Soejima, M; Johnson, P H; Smart, E; Kimura, H

    2000-01-01

    Recently, we have found an allelic deletion of the secretor alpha(1,2)fucosyltransferase (FUT2) gene in individuals with the classical Bombay phenotype of the ABO system. The FUT2 gene consists of two exons separated by an intron that spans approximately 7 kb. The first exon is noncoding, whereas exon 2 contains the complete coding sequence. Since the 5' breakpoint of the deletion has previously been mapped to the single intron of FUT2, we have cloned the junction region of the deletion in a Bombay individual by cassette-mediated polymerase chain reaction. In addition, the region from the 3' untranslated region of FUT2 to the 3' breakpoint sequence has been amplified from a control individual. DNA sequence analysis of this region indicates that the 5' breakpoint is within a free left Alu monomer (FLAM-C) sequence that lies 1.3 kb downstream of exon 1, and that the 3' breakpoint is within a complete Alu element (AluSx) that is positioned 1.5 kb downstream of exon 2. The size of the deletion is estimated to be about 10 kb. There is a 25-bp sequence identity between the reference DNA sequences surrounding the 5' and 3' breakpoints. This demonstrates that an Alu-mediated large gene deletion generated by unequal crossover is responsible for secretor alpha(1,2)fucosyltransferase deficiency in Indian Bombay individuals.

  18. Bombay phenotype is associated with reduced plasma-VWF levels and an increased susceptibility to ADAMTS13 proteolysis.

    PubMed

    O'Donnell, James S; McKinnon, Thomas A J; Crawley, James T B; Lane, David A; Laffan, Michael A

    2005-09-15

    ABO blood group is an important determinant of plasma von Willebrand factor antigen (VWF:Ag) levels, with lower levels in group O. Previous reports have suggested that ABO(H) sugars affect the susceptibility of VWF to ADAMTS13 (a disintegrin and metalloproteinase with thrombospondin type-1 repeats-13) cleavage. To further test this hypothesis, we collected plasma from individuals with the rare Bombay blood group. VWF:Ag levels were significantly lower in Bombay patients (median, 0.69 IU/mL) than in groups AB, A, or B (P < .05) and lower than in group O individuals (median, 0.82 IU/mL). Susceptibility of purified VWF fractions to recombinant ADAMTS13 cleavage, assessed using VWF collagen-binding assay (VWF:CB), was increased in Bombays compared with either group O or AB. Increasing urea concentration (0.5 to 2 M) increased the cleavage rate for each blood group but eliminated the differences between groups. We conclude that reduction in the number of terminal sugars on N-linked glycan increases susceptibility of globular VWF to ADAMTS13 proteolysis and is associated with reduced plasma VWF:Ag and VWF:CB levels.

  19. Point mutations and deletion responsible for the Bombay H null and the Reunion H weak blood groups.

    PubMed

    Fernandez-Mateos, P; Cailleau, A; Henry, S; Costache, M; Elmgren, A; Svensson, L; Larson, G; Samuelsson, B E; Oriol, R; Mollicone, R

    1998-01-01

    Definition of the molecular basis of the Reunion and the Bombay red cell and salivary H-deficient phenotypes. Sequence and expression of FUT1 and FUT2 genes from H-deficient individuals. Family segregation analysis of the mutations responsible for the fucosyltransferase defects of H, secretor and Lewis systems. The Indian red cell H null Bombay phenotype depends on a new mutation of the FUT1 gene. T725-->G changing Leu242-->Arg. Their salivary nonsecretor phenotype is secondary to a complete deletion of the FUT2 gene. The red cell H weak Reunion phenotype depends on another new mutation of FUT1, C349-->T which induces a change of His117-->Tyr. Their salivary nonsecretor phenotype is due to the known Caucasian inactivating mutation G428-->A. Single prevalent FUT1 and FUT2 point mutations and a deletion are responsible for the Indian Bombay H null and the Reunion H weak phenotypes found on Reunion island. This is in contrast with other H-deficient phenotypes where sporadic nonprevalent inactivating mutations are the rule.

  20. Dr John McLennan MD (Aberdeen), FRCP (Lond) (1801-1874) and the Medical School of Bombay that failed.

    PubMed

    Pandya, Sunil K

    2017-01-01

    In 1826, Dr John McLennan was asked by Governor Mounstuart Elphinstone of Bombay to set up the first school to teach modern medicine to Indian citizens. He was expected to create textbooks on a variety of subjects in local languages and teach medicine to poorly educated students in their native tongues. Despite his valiant efforts, the school was deemed a failure and was abolished by the Government in 1832. Sir Robert Grant, appointed Governor of Bombay in 1835, analysed records pertaining to this medical school and concluded that the school failed since Dr McLennan was not provided the assistance he needed and as his suggestions for access to a hospital to teach medicine were not heeded. Dr McLennan provided able support to Dr Charles Morehead on his appointment as Principal and Professor of Medicine at the newly created Grant Medical College in Bombay in 1845. Dr Morehead dedicated his classic 'Clinical researches on diseases in India' to Dr McLennan. Dr McLennan headed the Board of Examiners created to assess the competence of the first batch of medical students emerging from this College. The system of evaluation set up by him remains admirable. Dr McLennan retired from service as Physician-General, full of honours.

  1. Interactions between nesting pileated woodpeckers and wood ducks

    Treesearch

    Richard N. Conner; Clifford E. Shackelford; Daniel Saenz; Richard R. Schaefer

    2001-01-01

    We observed interactions between a nesting pair of pileated woodpeckers (Dryocopus pileatus) and what appeared to be four pairs of wood ducks (Aix sponsa). Wood ducks regularly approached and attempted to enter an active pileated woodpecker nest cavity that contained three fully feathered young pileated woodpeckers. The male...

  2. 78 FR 10201 - Proposed Information Collection; Electronic Duck Stamp Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-13

    ... buy a Federal migratory bird hunting and conservation stamp (Federal Duck Stamp) annually. The stamps are a vital tool for wetland conservation. Ninety-eight cents out of every dollar generated by the sale of Federal Duck Stamps goes directly to purchase or lease wetland habitat for protection in the...

  3. Duck plague epizootics in the United States, 1967-1995

    USGS Publications Warehouse

    Converse, K.A.; Kidd, Gregory A.

    2001-01-01

    In 1967, the first confirmed diagnosis of duck plague (DP) in the USA was made from pekin ducks (Anas platyrhynchos domesticus) on commercial duck farms on Long Island, New York. Within 10 mo, DP was confirmed as the cause of death in migratory waterfowl on a Long Island bay. This paper reviews 120 DP epizootics reported from 1967 to 1995 that involved waterfowl species native to North America or were reported in areas with free-flying waterfowl at risk. Duck plague epizootics occurred in 21 states with the greatest number reported in Maryland (29), New York (18), California (16), and Pennsylvania (13). The greatest frequency of epizootics (86%) was detected during the months of March to June. At least 40 waterfowl species were affected with the highest frequency of epizootics reported in captive or captive-reared ducks including muscovy ducks (Cairina moschata) (68%), mallard ducks (A. platyrhynchos) (18%) and black ducks (A. rubripes) (14%). The greatest number of waterfowl died in three epizootics that involved primarily migratory birds in 1967 and 1994 in New York (USA) and 1973 in South Dakota (USA). The greatest number of DP epizootics reported since 1967 appear to have involved flocks of non-migratory rather than migratory waterfowl; therefore, in our opinion it remains unknown if DP is enzootic in either non-migratory or migratory waterfowl.

  4. Haemoproteus greineri in wood ducks from the Atlantic flyway.

    PubMed

    Pung, O J; Maxwell, N E; Greiner, E C; Robinette, J R; Thul, J E

    1997-04-01

    Thin smears of blood were examined from 157 wood ducks (Aix sponsa) trapped at Savannah National Wildlife Refuge (South Carolina, USA) and Harris Neck National Wildlife Refuge (Georgia, USA) during spring and summer, 1994 and 1995. Thirteen wood ducks (8%) were infected with blood parasites. Eleven of these birds were infected with Haemoproteus nettionis, seven with Leucocytozoon simondi, and five with unidentified microfilariae. Additionally, eight wood ducks (5%) were infected with Haemoproteus greineri. This is the first record of H. greineri in anatids trapped along the Atlantic Flyway south of Labrador and the first record of this species in wood ducks. To further characterize the distribution of H. greineri in the wood duck, blood smears were examined from hatching year ducks trapped at 10 different Atlantic flyway locations during spring and summer, 1980 to 1983. Haemoproteus greineri was found in wood ducks trapped in all 10 locations which extend from 46 degrees N latitude in New Brunswick to 37 degrees N latitude in Virginia. These findings indicate that H. greineri is not exclusively boreal in distribution, but also is found, at least in wood ducks, along much of the Atlantic Flyway.

  5. Duck hunters' perceptions of risk for avian influenza, Georgia, USA.

    PubMed

    Dishman, Hope; Stallknecht, David; Cole, Dana

    2010-08-01

    To determine duck hunters'risk for highly pathogenic avian influenza, we surveyed duck hunters in Georgia, USA, during 2007-2008, about their knowledge, attitudes, and practices. We found they engage in several practices that could expose them to the virus. Exposures and awareness were highest for those who had hunted >10 years.

  6. Duck Hunters’ Perceptions of Risk for Avian Influenza, Georgia, USA

    PubMed Central

    Stallknecht, David; Cole, Dana

    2010-01-01

    To determine duck hunters’ risk for highly pathogenic avian influenza, we surveyed duck hunters in Georgia, USA, during 2007–2008, about their knowledge, attitudes, and practices. We found they engage in several practices that could expose them to the virus. Exposures and awareness were highest for those who had hunted >10 years. PMID:20678324

  7. Vaccination of domestic ducks against H5N1 HPAI

    USDA-ARS?s Scientific Manuscript database

    Domestic ducks play an important role in the epidemiology of H5N1 and H5N8 highly pathogenic avian influenza (HPAI) viruses, and therefore, successful control of HPAI in ducks is vital for the eradication of the disease in poultry. Vaccination can be used as a tool for supporting eradication by inc...

  8. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  9. Cygnet River virus, a novel orthomyxovirus from ducks, Australia.

    PubMed

    Kessell, Allan; Hyatt, Alex; Lehmann, Debra; Shan, Songhua; Crameri, Sandra; Holmes, Clare; Marsh, Glenn; Williams, Catherine; Tachedjian, Mary; Yu, Meng; Bingham, John; Payne, Jean; Lowther, Sue; Wang, Jianning; Wang, Lin-Fa; Smith, Ina

    2012-12-01

    A novel virus, designated Cygnet River virus (CyRV), was isolated in embryonated eggs from Muscovy ducks in South Australia. CyRV morphologically resembles arenaviruses; however, sequencing identified CyRV as an orthomyxovirus. The high mortality rate among ducks co-infected with salmonellae suggests that CyRV may be pathogenic, either alone or in concert with other infections.

  10. Molecular cloning and characterization of duck interleukin-17

    USDA-ARS?s Scientific Manuscript database

    Interleukin-17 (IL-17) belonging to the Th17 family is a proinflammatory cytokine produced by activated T cells. A 1034-bp cDNA encoding duck IL-17 (duIL-17) was cloned from ConA-activated splenic lymphocytes of ducks. The encoded protein, predicted to consisted of 169 amino acids, displayed a molec...

  11. The effects of harvest regulations on behaviors of duck hunters

    USGS Publications Warehouse

    Haugen, Matthew T.; Powell, Larkin A.; Vrtiska, Mark P.; Pope, Kevin L.

    2015-01-01

    Uncertainty exists as to how duck harvest regulations influence waterfowl hunter behavior. We used the U.S. Fish and Wildlife Service’s Parts Collection Survey to examine how harvest regulations affected behaviors of Central Flyway duck hunters. We stratified hunters into ranked groups based on seasonal harvest and identified three periods (1975–1984, 1988–1993, 2002–2011) that represented different harvest regulations (moderate, restrictive, and liberal, respectively; season length and daily bag limits smallest in restrictive seasons and largest in liberal seasons). We examined variability of seven measures of duck hunter behaviors across the periods: days harvesting ducks, daily harvest, hunter mobility, mallard (Anas platyrhynchos) selectivity, gender selectivity, daily female mallard harvest, and timing of harvest. Hunters reported harvesting ducks on more days, at a higher efficiency, and in slightly more counties during liberal seasons relative to restrictive and moderate seasons. We provide evidence to suggest that future regulation change will affect hunter behaviors.

  12. The relation of selenium to western duck sickness

    USGS Publications Warehouse

    Lakin, H.W.; Quortrup, E.R.; Hotchkiss, N.

    1944-01-01

    In 1936 Twomey and Twomey reported that 20-50 parts per million of selenium as sodium selenite in the drinking water produced poisoning in ducks in which the syndrome was identical with that produced by Clostridium botulinum type C, which had been considered the principal causative agent in western duck sickness (Kalmbach and Gunderson, 1934). In a more recent paper, Twomey, Twomey and Williams (1939) reported the analyses of a number of duck livers collected at various points near Great Salt Lake where the sickness is prevalent. These analyses show the presence of 7-148 p. p. m. of selenium, based on the oven-dried weight of the livers. In contrast, no selenium was found in duck livers obtained in Pennsylvania, where sickness has not been reported. As a result of these findings, a thorough investigation of the significance of selenium in outbreaks of western duck sickness was undertaken in the summer of 1940.

  13. Susceptibility of pekin and muscovy ducks to Haemoproteus nettionis.

    PubMed

    Sibley, L D; Werner, J K

    1984-04-01

    Domestic muscovy (Caririna moschata) and pekin (Anas platyrhynchos) ducklings were exposed to or injected with homogenates of Culicoides flies collected at White Pine, Michigan. Gametocytes of Haemoproteus nettionis were detected in both species of ducks at 16 days post-exposure. Culicoides downesi was indicated as a vector of H. nettionis in northern Michigan. Blood infections occurred with a higher prevalence and reached a higher intensity in muscovy ducks. Endogenous tissue stages of H. nettionis were located in endothelial cells of the lung and occasionally in the heart and spleen. Attempts to infect domestic ducklings by blood or tissue inoculations from wood ducks (Aix sponsa) infected with H. nettionis were not successful, even though schizonts of H. nettionis were seen in these wood ducks at necropsy. No morbidity or mortality was observed in any ducks infected with H. nettionis.

  14. Epidemiology and molecular characterisation of duck hepatitis A virus from different duck breeds in Egypt.

    PubMed

    Erfan, Ahmed M; Selim, Abdullah A; Moursi, Mohamed K; Nasef, Soad A; Abdelwhab, E M

    2015-06-12

    Duck hepatitis virus (DHV) is an acute highly contagious disease of ducklings caused by three distinct serotypes of duck hepatitis A virus (DHAV), a member of the RNA family Picornaviridae, where serotype 1 is the most widespread serotype worldwide. To date, little if any is known about the prevalence and genetic characterisation of DHAV outside Asia. The current study describes surveillance on DHV in 46 commercial duck farms in Egypt with a history of high mortality in young ducklings from 3 to 15 day-old from 2012 to 2014. Clinical samples were examined by generic RT-PCR assays followed by partial sequence analysis of the 5'UTR, VP1 and 3D genes of the vaccine strain and 15 field viruses. The overall positive rate was 37% (n=17/46). All duck breeds (Pekin, Muscovy, Mallard and Green Winged) were susceptible to the disease with mortality ranged from 15% to 96.7%. Sequence and phylogenetic analyses indicated that the Egyptian strains cluster in the DHAV serotype 1 with Asian viruses and distinguishable from the vaccine strains. So far, this is the first report on the genetic characterisation of DHAV in Egypt. This study may be useful to better understand the epidemiology and evolution of DHAV. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Expression and immunohistochemical distribution of duck plague virus glycoprotein gE in infected ducks.

    PubMed

    Chang, Hua; Cheng, Anchun; Wang, Mingshu; Xiang, Jun; Xie, Wei; Shen, Fuxiao; Jia, Renyong; Zhu, Dekang; Luo, Qihui; Zhou, Yi; Chen, Xiaoyue

    2011-03-01

    To determine the distribution of duck plague virus (DPV) gE protein in paraformaldehyde-fixed, paraffin-embedded tissues of experimentally DPV-infected ducks, an indirect immunoperoxidase assay was established to detect glycoprotein E (gE) protein for the first time. The rabbit anti-His-gE serum, raised against the recombinant His-gE fusion protein expressed in Escherichia coli BL21 (DE3), was prepared and purified. Western blotting and indirect immunofluorescence analysis showed that the anti-His-gE serum had a high level of reactivity and specificity and could be used as the first antibody for further experiments to study the distribution of DPV gE protein in DPV-infected tissues. A number of DPV gE proteins were distributed in the bursa of Fabricius, thymus, spleen, liver, esophagus, duodenum, jejunum, ileum, and kidney of DPV-infected ducks and a few DPV gE were distributed in the Harders glands, myocardium, cerebrum, and lung, whereas the gE was not seen in the skin, muscle, and pancreas. Moreover, DPV gE was expressed abundantly in the cytoplasm of lymphocytes, reticulum cells, macrophages, epithelial cells, and hepatocytes. The present study may be useful not only for describing the characteristics of gE expression and distribution in infected ducks but also for understanding the pathogenesis of DPV.

  16. Apoptosis induction in duck tissues during duck hepatitis A virus type 1 infection.

    PubMed

    Sheng, X D; Zhang, W P; Zhang, Q R; Gu, C Q; Hu, X Y; Cheng, G F

    2014-03-01

    To investigate the role of apoptosis in duck viral hepatitis pathogenesis, 4- and 21-d-old ducks were inoculated with duck hepatitis A virus serotype 1 and killed at 2, 6, 12, 24, and 48 h postinfection. TdT-mediated dUTP nick-end labeling was used to detect apoptosis cells. Expression profiles of apoptosis-related genes including caspase-3, -8, -9, and Bcl-2 in spleen, bursa of Fabricius, liver, and the quantity of virus in blood were examined using real-time PCR. The TdT-mediated dUTP nick-end labeling analysis indicated there was a significant difference of apoptotic cells between treatments and controls. The same difference also appeared in virus amount variation in blood during infection. Gene expression analysis revealed that the apoptosis-related gene expression profile was different in the 2 groups, and also different between various organs. This study suggested that apoptosis may play an important role in duck hepatitis A virus serotype 1 infection, and apoptosis suppression might facilitate virus multiplication, resulting in the highest virus concentration in the host.

  17. Extraction and Analysis of Mega Cities’ Impervious Surface on Pixel-based and Object-oriented Support Vector Machine Classification Technology: A case of Bombay

    NASA Astrophysics Data System (ADS)

    Yu, S. S.; Sun, Z. C.; Sun, L.; Wu, M. F.

    2017-02-01

    The object of this paper is to study the impervious surface extraction method using remote sensing imagery and monitor the spatiotemporal changing patterns of mega cities. Megacity Bombay was selected as the interesting area. Firstly, the pixel-based and object-oriented support vector machine (SVM) classification methods were used to acquire the land use/land cover (LULC) products of Bombay in 2010. Consequently, the overall accuracy (OA) and overall Kappa (OK) of the pixel-based method were 94.97% and 0.96 with a running time of 78 minutes, the OA and OK of the object-oriented method were 93.72% and 0.94 with a running time of only 17s. Additionally, OA and OK of the object-oriented method after a post-classification were improved up to 95.8% and 0.94. Then, the dynamic impervious surfaces of Bombay in the period 1973-2015 were extracted and the urbanization pattern of Bombay was analysed. Results told that both the two SVM classification methods could accomplish the impervious surface extraction, but the object-oriented method should be a better choice. Urbanization of Bombay experienced a fast extending during the past 42 years, implying a dramatically urban sprawl of mega cities in the developing countries along the One Belt and One Road (OBOR).

  18. An investigation of duck circovirus and co-infection in Cherry Valley ducks in Shandong Province, China.

    PubMed

    Zhang, Xingxiao; Jiang, Shijin; Wu, Jiaqiang; Zhao, Qin; Sun, Yani; Kong, Yibo; Li, Xiaoxia; Yao, Meiling; Chai, Tongjie

    2009-01-13

    The co-infection of duck circovirus (DuCV) with Riemerella anatipestifer (RA) or/and Escherichia coli (E. coli) or/and duck hepatitis virus I (DHV-I) in Cherry Valley ducks in China's Shandong Province was investigated by using polymerase-chain-reaction (PCR)-based methods. For this study, 742 ducks sampled at random from 70 duck farms during 2006-2007 were examined using PCR and dot-blot hybridisation (DBH) tests. Overall the DuCV infection rate was 33.29%. Compared with those at 2 weeks of age, the ducks at 3-4 weeks of age were more susceptible to DuCV infection. Compared with the DuCV-negative ones, the DuCV-positive ducks had a higher rate of infection by DHV-I (25.5% vs. 7.475%), RA (23.48% vs. 8.28%) and E. coli (16.19% vs. 4.85%). This investigation shows that DuCV infection is common in Cherry Valley ducks on some farms in Shandong Province.

  19. Evidence of possible vertical transmission of Tembusu virus in ducks.

    PubMed

    Zhang, Ying; Li, Xiuli; Chen, Hao; Ti, Jinfeng; Yang, Guoping; Zhang, Lu; Lu, Yunjian; Diao, Youxiang

    2015-09-30

    In 2013, Tembusu virus (TMUV) infection was successively observed on several breeding duck farms in Shandong province, China. Affected ducks showed consistently acute anorexia, diarrhea and egg production drop. 125 hatching eggs produced by TMUV infected breeding ducks from four duck farms were collected. Among them, 35 hatching eggs were selected randomly from all before incubation for vitelline membrane samples collection. The rest of 90 hatching eggs were incubated routinely. As a result, 16 hatching eggs were found non-embryonated, 28 duck embryos died during incubation and 46 newly hatched ducklings were obtained. Vitelline membranes of non-embryonated hatching eggs, vitelline membrane, brain or liver samples of dead embryos and brain samples of newly hatched ducklings were collected for virus detection. Samples collected from one egg, embryo or duckling were treated as one. Consequently, 18 of 35 (51.43%) hatching eggs, 2 of 16 (12.50%) non-embryonated duck eggs, 17 of 28 (60.71%) dead duck embryos and 5 of 46 (10.87%) newly hatched ducklings were detected positive for TMUV using NS3-based RT-PCR. Overall, 42 of 125 (33.6%) eggs were positive for TMUV. A virus strain, designated as TMUV-SDDE, was isolated from one of these dead duck embryos which were detected TMUV positive. The results of phylogenetic analysis showed that E gene of TMUV-SDDE virus was closely related to other TMUV strains isolated in China during 2010-2013. Pathogenicity studies showed that TMUV-SDDE strain was virulent to ducklings. This is the first report that TMUV is isolated from duck embryos. The findings provide evidence of possible vertical transmission of TMUV from breeding ducks to ducklings.

  20. ALERT-India 1981-89: nine years' experience of leprosy control in the slums of Bombay.

    PubMed

    Samy, A A; Mancheril, J; Manek, K P; McDougall, A C

    1991-09-01

    Bombay has a population of about 8 million people, one-half of whom live in slums. In 1981, ALERT-India started its first leprosy control project in N, S and T Wards of Greater Bombay Municipal Corporation covering an area of 122 sq km in the north-eastern suburbs of Vidhyavihar, Ghatkopar, Vikhroli, Kanjurmarg, Bhandup and Mulund, with a total population of 1,100,000 according to the 1981 census. In the 9 years of operation, over 12,000 patients have been registered and treated and of these 7425 have been released from treatment, having satisfactorily completed courses of chemotherapy. However, over 1000 cases are still identified every year by house-to-house or school surveys, or by self-reporting, including a considerable percentage in children. The origin, development, staff structure, operational procedure, administration and recording system of ALERT-India are described in detail, with emphasis on what has been accomplished with purely outpatient facilities, using paramedical workers, all of whom have received inservice training from Government recognized training centres for their specific tasks. The account includes a brief description of an expansion of the organization's work into townships in New Bombay, where preliminary surveys in 1988 confirmed the presence of leprosy cases and the need for treatment facilities. The discussion addresses: 1, the better use of the large volume of statistical information which has been collected by ALERT-India during the past 9 years, with emphasis on its value in assessing the impact on the control programme and modifying future policy; 2, the need to radically examine the present policy of survey, versus an 'education campaign approach' with regard to increasing early case-detection and self-reporting; 3, the establishment of a central coordinating body for leprosy control in Bombay to exchange information, coordinate efforts and formulate a future plan of action, the latter in association with the National Leprosy

  1. Expression and distribution of the duck enteritis virus UL51 protein in experimentally infected ducks.

    PubMed

    Shen, Chanjuan; Cheng, Anchun; Wang, Mingshu; Xu, Chao; Jia, Renyong; Chen, Xiaoyue; Zhu, Dekang; Luo, Qihui; Cui, Hengmin; Zhou, Yi; Wang, Yin; Xu, Zhiwen; Chen, Zhengli; Wang, Xiaoyu

    2010-06-01

    To determine the expression and distribution of tegument proteins encoded by duck enteritis virus (DEV) UL51 gene in tissues of experimentally infected ducks, for the first time, an immunoperoxidase staining method to detect UL51 protein (UL51p) in paraffin-embedded tissues is reported. A rabbit anti-UL51 polyclonal serum, raised against a recombinant 6-His-UL51 fusion protein expressed in Escherichia coli, was prepared, purified, and used as primary antibodies. Fifty-eight 30-day-old DEV-free ducks were intramuscularly inoculated with the pathogenic DEV CHv strain as infection group, and two ducks were selected as preinfection group. The tissues were collected at sequential time points between 2 and 480 hr postinoculation (PI) and prepared for immunoperoxidase staining. DEV UL51p was first found in the spleen and liver at 8 hr PI; in the bursa of Fabricius and thymus at 12 hr PI; in the Harders glands, esophagus, small intestine (including the duodenum, jejunum, and ileum), and large intestine (including the caecum and rectum) at 24 hr PI; in the glandularis ventriculus at 48 hr PI; and in the pancreas, cerebrum, kidney, lung, and myocardium at 72 hr PI. Throughout the infection process, the UL51p was not seen in the muscle. Furthermore, the intensity of positive staining of DEV UL51p antigen in various tissues increased sharply from 8 to 96 hr PI, peaked during 120-144 hr PI, and then decreased steadily from 216 to 480 hr PI, suggesting that the expressional levels of DEV UL51p in systemic organs have a close correlation with the progression of duck virus enteritis (DVE) disease. A number of DEV UL51p was distributed in the bursa of Fabricius, thymus, spleen, liver, esophagus, small intestine, and large intestine of DEV-infected ducks, whereas less DEV UL51p was distributed in the Harders glands, glandularis ventriculus, cerebrum, kidney, lung, pancreas, and myocardium of DEV-infected ducks. Moreover, DEV UL51p can be expressed in the cytoplasm of various types

  2. Red fox predation on breeding ducks in midcontinent North America

    USGS Publications Warehouse

    Sargeant, Alan B.; Allen, Stephen H.; Eberhardt, Robert T.

    1984-01-01

    Red fox (Vulpes vulpes) predation on nesting ducks was assessed by examining 1,857 adult duck remains found at 1,432 fox rearing dens from 1968 to 1973. Dabbling ducks were much more vulnerable to foxes than diving ducks. Dabbling ducks (1,798) found at dens consisted of 27% blue-winged teals (Anas discors), 23% mallards (A. platyrhynchos), 20% northern pintails (A. acuta), 9% northern shovelers (Spatula clypeata), 8% gadwalls (A. strepera), 3% green-winged teals (A. crecca), 2% American wigeons (A. americana), and 10% unidentified. Relative abundance of individual species and nesting chronology were the most important factors affecting composition of ducks taken by foxes. Seventy-six percent of 1,376 adult dabbling ducks and 40% of 30 adult diving ducks for which sex was determined were hens. In western North Dakota and western South Dakota, 65% of mallard and northern pintail remains found at dens were hens compared with 76% in eastern North Dakota and eastern South Dakota (P < 0.05). Percentage hens varied among the 5 most common dabbling ducks found at dens. In eastern North Dakota and eastern South Dakota, where predation on ducks was greatest, an average of 64% of gadwall, 73% of northern pintail, 81% of blue-winged teal, 81% of mallard, and 90% of northern shoveler remains found at dens were hens. Percentage hens among duck remains found at dens increased as the duck nesting season progressed. Numbers of adult ducks found at individual dens ranged from 0 to 67. The average number of ducks found in and around den entrances was used as an index of fox predation rates on ducks. Predation rate indices ranged from 0.01 duck/den in Iowa to 1.80 ducks/den in eastern North Dakota. Average annual predation rate indices for dabbling ducks in a 3-county intensive study area in eastern North Dakota were closely correlated with May pond numbers (r = 0.874, P < 0.10) and duck population size (r = 0.930, P < 0.05), but all species were not affected in the same manner or to

  3. Complete genome sequence of a novel flavivirus, duck tembusu virus, isolated from ducks and geese in china.

    PubMed

    Yun, Tao; Zhang, Dabing; Ma, Xuejun; Cao, Zhenzhen; Chen, Liu; Ni, Zheng; Ye, Weicheng; Yu, Bin; Hua, Jionggang; Zhang, Yan; Zhang, Cun

    2012-03-01

    Duck tembusu virus (DTMUV) is an emerging agent that causes a severe disease in ducks. We report herein the first complete genome sequences of duck tembusu virus strains YY5, ZJ-407, and GH-2, isolated from Shaoxing ducks, breeder ducks, and geese, respectively, in China. The genomes of YY5, ZJ-407, and GH-2 are all 10,990 nucleotides (nt) in length and encode a putative polyprotein of 3,426 amino acids. It is flanked by a 5' and a 3' noncoding region (NCR) of 94 and 618 nt, respectively. Knowledge of the whole sequence of DTMUV will be useful for further studies of the mechanisms of virus replication and pathogenesis.

  4. Band reporting probablilities of mallards, American black ducks, and wood ducks in eastern North America

    USGS Publications Warehouse

    Garrettson, Pamela R.; Raftovich, Robert V.; Hines, James; Zimmerman, Guthrie S.

    2014-01-01

    Estimates of band reporting probabilities are used for managing North American waterfowl to convert band recovery probabilities into harvest probabilities, which are used to set harvest regulations. Band reporting probability is the probability that someone who has shot and retrieved a banded bird will report the band. This probability can vary relative to a number of factors, particularly the inscription on the band and the ease with which it can be reported. Other factors, such as geographic reporting region, and species and sex of the bird may also play a role. We tested whether reporting probabilities of wood ducks (Aix sponsa) and American black ducks (black ducks; Anas rubripes) differed from those of mallards (Anas platyrhynchos) and whether band reporting varied geographically or by the sex of the banded bird. In the analysis of spatially comparable wood duck and mallard data, a band reporting probability of 0.73 (95% CI = 0.67–0.78) was appropriate for use across species, sex, and reporting region within the United States. In the black duck–mallard comparison, the band reporting probability of black ducks in Eastern Canada (0.50, 95% CI = 0.44–0.57) was lower than in the Eastern United States (0.73, 95% CI = 0.62–0.83). These estimates reflected an increase in overall band reporting probability following the addition of a toll-free telephone number to band inscriptions. Lower reporting in Eastern Canada may be because of cultural, linguistic, or logistical barriers.

  5. Different Duck Species Infected Intramuscularly with Duck-Origin Genotype IX APMV-1 Show Discrepant Mortality and Indicate Another Fatal Genotype APMV-1 to Ducks.

    PubMed

    Fu, Guanghua; Cheng, Longfei; Fu, Qiuling; Qi, Baomin; Chen, Cuiteng; Shi, Shaohua; Chen, Hongmei; Wan, Chunhe; Liu, Rongchang; Huang, Yu

    2017-03-01

    Isolations of genotype IX (gIX) avian paramyxovirus type 1 (APMV-1) from various bird species have been more common recently, with isolates showing variable pathogenicity in different species of poultry. Here we sequenced the genome of a Muscovy duck origin gIX virus strain XBT14 and characterized the virulence and pathogenicity of this isolate in chickens and ducks. The genome sequence of strain XBT14 is 15,192 nt in length, containing multiple basic amino acids at the fusion protein cleavage site. The XBT14 strain shared 91.6%-91.9% nucleotide identities with early-genotype viruses (such as genotype III and IV) and shared 85.3%-85.9% nucleotide homologies with later genotype viruses (such as genotype VII). Pathogenicity tests showed that strain XBT14 could cause death in different duck breeds with a mortality rate of 44.4% in Muscovy duck, 25.9% in Sheldrake, and 11.1% in Cherry Valley duck, respectively. Similar mortality discrepancies were also observed in different ducks when infected with chicken-origin gIX virus strain F48E8. These results indicate that XBT14-like velogenic gIX APMV-1 (such as XBT14, F48E8, and GD09-2) could cause fatal infection in duck, and genotype IX is another genotype velogenic to duck as well as genotype VII. Accompanied by genetic differences in the vaccine strains or dominant strains prevailing in poultry, the virulent XBT14-like gIX viruses might become potentially endemic strains in poultry in the future.

  6. Determinants of breeding distributions of ducks

    USGS Publications Warehouse

    Johnson, D.H.; Grier, J.W.

    1988-01-01

    The settling of breeding habitat by migratory waterfowl is a topic of both theoretical and practical interest. We use the results of surveys conducted annually during 1955-81 in major breeding areas to examine the factors that affect the distributions of 10 common North American duck species. Three patterns of settling are described: homing, opportunistic, and flexible. Homing is generally more pronounced among species that use more stable (more predictable) wetlands, such as the redhead (Aythya americana), canvasback (A. valisineria), lesser scaup (A. affinis), mallard (Anas platyrhynchos), gadwall (Anas strepera), and northern shoveler (Anas clypeata). Opportunistic settling is more prevalent among species that use less stable (less predictable) wetlands, such as northern pintail (Anas acuta) and blue-winged teal (Anas discors). Flexible settling is exhibited to various degrees by most species.The 10 species are shown to fall along a natural ordination reflecting different life history characteristics. Average values of indices of r- and K-selection indicated that pintail, mallard, blue-winged teal, and shoveler have the most features associated with unstable or unpredictable environments. Gadwall, American wigeon (Anas americana), and green-winged teal (Anas crecca) were intermediate, and attributes of the diving ducks were associated with the use of stable or predictable environments.Some species--notably mallard, gadwall, blue-winged teal, redhead, and canvasback--tend to fill available breeding habitat first in the central portions of their range, and secondly in peripheral areas. Other species--American wigeon, green-winged teal, northern shoveler, northern pintail, and lesser scaup--fill their habitat in the order it is encountered during spring migration.Age and sex classes within species vary in their settling pattern. Some of this variation can be predicted from the mating systems of ducks in which breeding females, especially successful ones, have a

  7. Ducks launch into flight at KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A flock of ducks launch into the morning sky in the Merritt Island National Wildlife Refuge at Kennedy Space Center. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  8. Efficiency of methionine retention in ducks.

    PubMed

    Adeola, Olayiwola

    2007-03-01

    The accretion of methionine and protein as a function of methionine intake was assessed in growing ducks between 22 and 42 d post-hatching. Four graded doses of dl-methionine at 0, 0 x 5, 1 x 0 or 1 x 5 g/kg diet were added to a methionine-limiting basal diet and fed to four replicate groups of four ducks each. The growth and efficiency of food use for growth increased linearly (P<0 x 05) as a function of methionine intake. The accretion of body protein increased (P<0 x 001) from 87 x 5 to 182 x 2 g, and that of methionine from 1616 to 3125 mg, over the 21 d period as dietary methionine increased. The accretion rate of methionine in the body (y, mg/d) as a function of methionine intake (x, mg/d) of ducks fed diets containing supplemental methionine at 0, 0 x 5, 1 x 0 or 1 x 5 g/kg diet from day 22 to day 42 post-hatching gave the regression equation: y=-148 x 86 (se 32 x 558)+0 x 312 (se 0 x 0384)X, r2=0 x 8253. For protein accretion rate in the body (y, mg/d) as a function of methionine intake (x, mg/d), the regression equation was: y= -9782 (se 2204)+19 x 505 (se 2 x 5994)x, r2=0 x 8009. There was a linear relationship between methionine (y, mg/d) and protein (x, mg/d) accretion in ducks that was described by the equation y=12 x 757 (se 7 x 4019)+0 x 01 525 (se 0 x 00 107)x, r2=0 x 9355. The results of these studies suggest a constant utilisation of methionine over the range 2 x 4-3 x 9 g digestible methionine/kg diet, with an efficiency of 31 %. Furthermore, the results suggest a quantitative relationship of 15 mg methionine for every gram of protein accretion.

  9. Ducks launch into flight at KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A flock of ducks launch into the morning sky in the Merritt Island National Wildlife Refuge at Kennedy Space Center. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  10. Effects of dietary vanadium in mallard ducks

    USGS Publications Warehouse

    White, D.H.; Dieter, M.P.

    1978-01-01

    Adult mallard ducks fed 0, 1, 10, or 100 ppm vanadyl sulfate in the diet were sacrificed after 12 wk on treatment; tissues were analyzed for vanadium. No birds died during the study and body weights did not change. Vanadium accumulated to higher concentrations in the bone and liver than in other tissues. Concentrations in bones of hens were five times those in bones of drakes, suggesting an interaction between vanadium and calcium mobilization in laying hens. Vanadium concentrations in most tissues were significantly correlated and increased with treatment level. Lipid metabolism was altered in laying hens fed 100 ppm vanadium. Very little vanadium accumulated in the eggs of laying hens.

  11. Use of elevated nest baskets by ducks

    USGS Publications Warehouse

    Doty, H.A.; Lee, F.B.; Kruse, A.D.

    1975-01-01

    Open-top nest baskets were mounted on upright metal poles in various wetlands to assess the value of baskets as a potential technique for increasing duck nest success. Observations were made from 1966-1968 in North and South Dakota, Minnesota, and Wisconsin and were continued through 1973 in North Dakota. Baskets were used most readily in the prairie pothole region; of the 1,038 basket nest sites provided during 1966-68, 392 contained clutches of eggs (38 percent), and 324 (83 percent) hatched. Mallards (Anas platyrhynchos) initiated 98 percent of these nests. Factors affecting nest success included human disturbance, nesting material, egg freezing, and avian predation.

  12. Second nestings of the wood ducks

    USGS Publications Warehouse

    McGilvrey, F.B.

    1966-01-01

    This is a description of the renesting of two Wood Ducks (Aix sponsa) after hatching broods. I can find but two previous records of such behavior. Barnes (Auk, 65: 449, 1948) reported an incident of a hand-reared bird nesting in the wild in Indiana. This female was unable to get her brood out of the nest box, and subsequently hatched a second brood. Hester (SE Wildlife Conf., 1962; 8 pp., mimeo.) in North Carolina had records of four hens that renested after hatching first broods. Three of these brought off second broods.

  13. [Serological and molecular analysis of a case with para-Bombay phenotype caused by a h(328)(nt328G to A) mutation].

    PubMed

    Geng, Wei; Gao, Huanhuan; Liu, Peiyan; Feng, Zhihui

    2017-06-10

    To explore the serological characteristics and molecular basis for an individual with para-Bombay phenotype. Blood type of the proband was determined with routine serological methods. Exons 6 and 7 of the ABO gene and coding regions of the FUT1 and FUT2 genes were amplified by PCR and sequenced. The para-Bombay phenotype was confirmed to be of Ah-secretion type. The genotype of the individual was determined as A102/O01. Position 328 of the FUT1 gene was mutated from A to G, resulting in replacement of Alanine (Ala) at position 110 by Threonine (Thr). The G to A mutation of nt328 of the FUT1 gene probably underlies the para-Bombay phenotype in this individual.

  14. Multiple losses of flight and recent speciation in steamer ducks.

    PubMed

    Fulton, Tara L; Letts, Brandon; Shapiro, Beth

    2012-06-22

    Steamer ducks (Tachyeres) comprise four species, three of which are flightless. The flightless species are believed to have diverged from a flying common ancestor during the Late Pleistocene; however, their taxonomy remains contentious. Of particular interest is the previously unstudied population of flying steamer ducks in the Falkland Islands. We present the first genetic data from this insular population, and illustrate that the flying and flightless steamer ducks on the Falkland Islands are genetically indistinguishable, in contrast to their traditional classification as separate species. The three species that reside in continental South America form a genetically distinct lineage from the Falkland Island ducks. The Falkland steamer ducks diverged from their continental relatives 2.2-0.6 million years ago, coincident with a probable land bridge connecting the Falkland Islands to the mainland. The three continental species share a common ancestor approximately 15 000 years ago, possibly owing to isolation during a recent glacial advance. The continental steamer duck species are not reciprocally monophyletic, but show some amount of genetic differentiation between them. Each lineage of Tachyeres represents a different stage between flight and flightlessness. Their phylogenetic relationships suggest multiple losses of flight and/or long-term persistence of mixed-flight capability. As such, steamer ducks may provide a model system to study the evolution of flightlessness.

  15. Fall food habits of ducks near Santee Refuge, South Carolina

    USGS Publications Warehouse

    McGilvrey, F.B.

    1966-01-01

    During the 1961 waterfowl hunting season, 360 stomachs of 10 duck species were collected from hunters near the Santee National Wildlife Refuge, Lake Marion, South Carolina. Based on percentage of total volume, 20 of the most important foods are listed. The six most important duck species in the kill were: mallard (Anas platyrhynchos), wood duck (Aix sponsa), widgeon (Mareca americam), pintail (Anas acuta) , black duck ( Anas rubripes) , and green-winged teal (Anas carolinensis). Six plant species made up 5 percent or more of the total volume of food items found in the stomachs of all ducks. Only seeds of oaks (Quercus sp.), corn, sweet gum (Liquidambar Styraciflua), and buttonbush (Cephalanthus occidentalis) were consumed. Some seed, but mostly the vegetative portions of hydrochloa (Hydrochloa carolinensis) and only the vegetative portions of southern rice cutgrass (Leersia hexandra) were taken. The more important game ducks concentrated on the refuge farmlands when water levels were below 72 feet mean sea level (msl). When levels reached 75 feet msl, natural foods became available, ducks dispersed from refuge areas, and hunting success increased greatly.

  16. Properties of duck meat sausages supplemented with cereal flours.

    PubMed

    Yang, H S; Ali, M S; Jeong, J Y; Moon, S H; Hwang, Y H; Park, G B; Joo, S T

    2009-07-01

    Duck meat sausages were prepared using 10% beef fat (FDS) and 10% hydrated cereal flours including rice (RDS), wheat, corn, millet, and barley to replace fat. Control duck sausages (DS) were also prepared only with duck meat and duck meat plus 10% beef fat. Results showed that protein and fat contents significantly decreased and total expressible fluid reduced with the addition of cereal flours in duck sausage batters. The FDS had higher fat content and lower pH compared with others. Duck sausages with 10% supplemented wheat flour showed the lowest cooking loss among sausages and had similar redness and chroma values to FDS and DS. Texture analysis indicated that hardness of duck sausage significantly decreased when cereal flours and beef fat were added. In particular, RDS showed the lowest values for all texture measurements compared with others. Result of moisture absorption capacity suggested that the decrease in hardness in RDS was due to higher moisture retention for rice flour treatment. Sensory evaluation indicated that DS had significantly lower overall acceptability than RDS, due to its off-flavor, whereas RDS had higher overall acceptability than DS.

  17. Evidence of possible vertical transmission of duck circovirus.

    PubMed

    Li, Zhiguo; Wang, Xin; Zhang, Ruihua; Chen, Junhao; Xia, Linlin; Lin, Shaoli; Xie, Zhijing; Jiang, Shijin

    2014-11-07

    To test the hypothesis that duck circovirus (DuCV) may be vertically transmitted from infected breeder ducks to their ducklings, we investigated 120 newly hatched ducklings, 30 dead duck embryos and 80 non-embryonated duck eggs with the duplex polymerase chain reaction (PCR). DuCV DNA was present in 15 newly hatched ducklings, 4 duck embryos and 3 non-embryonated eggs. Four ducklings from two flocks were co-infected by DuCV-1 and DuCV-2, three ducklings from three flocks were DuCV-1 single infection, and eight ducklings from six flocks were DuCV-2 single infection. One duck embryo and one non-embryonated egg were positive for both DuCV-1 and DuCV-2 DNAs, one embryo for DuCV-1 DNA, and two embryos and two non-embryonated eggs for DuCV-2 DNA. The findings provide evidence of possible vertical transmission of DuCV and simultaneous transmission of DuCV-1 and DuCV-2 from breeder ducks to ducklings.

  18. Genetic characterization of Duck Hepatitis A Viruses isolated in China.

    PubMed

    Li, Jing; Bi, Yuhai; Chen, Can; Yang, Limin; Ding, Chan; Liu, Wenjun

    2013-12-26

    In recent years, the spread of Duck Hepatitis A Viruses (DHAVs) has represented a serious threat and significant economic impact in duck industry of China. The sixteen reported DHAV isolates (15 DHAV-1 strains and one DHAV-3) were identified from infected ducks with clinical symptoms in China between 2009 and 2012. In the present study, the virulence of these viruses and complete sequences of the virion protein 1 (VP1) genes of the 16 DHAVs were characterized. The median embryonic lethal doses (ELD50) of the second generation duck embryo allantoic fluid of the 16 DHAV isolates were calculated on duck and chicken embryos. The results demonstrated that the various DHAV-1 strains have shown different pathogenic ability in embryos, and duck eggs were more susceptible to DHAV than chicken eggs. The histopathological examination revealed significant signs of virus infection, severe vacuolation, and hepatocyte necrosis. Phylogenetic analyses indicated that the 15 DHAV-1 viruses display significant correlation in their geographic distribution. The DHAV-1 strains isolated from Shandong Province were more evolutionarily divergent than the JX strains. There were two hypervariable regions in the VP1 protein, which may determine the virulence of DHAV-1 isolates in chicken eggs but not virulence in duck eggs. These results demonstrate the genetic and biological diversity of DHAVs in China and aid in understanding the epidemiology and evolution of DHAVs.

  19. Multiple losses of flight and recent speciation in steamer ducks

    PubMed Central

    Fulton, Tara L.; Letts, Brandon; Shapiro, Beth

    2012-01-01

    Steamer ducks (Tachyeres) comprise four species, three of which are flightless. The flightless species are believed to have diverged from a flying common ancestor during the Late Pleistocene; however, their taxonomy remains contentious. Of particular interest is the previously unstudied population of flying steamer ducks in the Falkland Islands. We present the first genetic data from this insular population, and illustrate that the flying and flightless steamer ducks on the Falkland Islands are genetically indistinguishable, in contrast to their traditional classification as separate species. The three species that reside in continental South America form a genetically distinct lineage from the Falkland Island ducks. The Falkland steamer ducks diverged from their continental relatives 2.2–0.6 million years ago, coincident with a probable land bridge connecting the Falkland Islands to the mainland. The three continental species share a common ancestor approximately 15 000 years ago, possibly owing to isolation during a recent glacial advance. The continental steamer duck species are not reciprocally monophyletic, but show some amount of genetic differentiation between them. Each lineage of Tachyeres represents a different stage between flight and flightlessness. Their phylogenetic relationships suggest multiple losses of flight and/or long-term persistence of mixed-flight capability. As such, steamer ducks may provide a model system to study the evolution of flightlessness. PMID:22319122

  20. A full annual cycle modeling framework for American black ducks

    USGS Publications Warehouse

    Robinson, Orin J.; McGowan, Conor; Devers, Patrick K.; Brook, Rodney W.; Huang, Min; Jones, Malcom; McAuley, Daniel G.; Zimmerman, Guthrie S.

    2016-01-01

    American black ducks (Anas rubripes) are a harvested, international migratory waterfowl species in eastern North America. Despite an extended period of restrictive harvest regulations, the black duck population is still below the population goal identified in the North American Waterfowl Management Plan (NAWMP). It has been hypothesized that density-dependent factors restrict population growth in the black duck population and that habitat management (increases, improvements, etc.) may be a key component of growing black duck populations and reaching the prescribed NAWMP population goal. Using banding data from 1951 to 2011 and breeding population survey data from 1990 to 2014, we developed a full annual cycle population model for the American black duck. This model uses the seven management units as set by the Black Duck Joint Venture, allows movement into and out of each unit during each season, and models survival and fecundity for each region separately. We compare model population trajectories with observed population data and abundance estimates from the breeding season counts to show the accuracy of this full annual cycle model. With this model, we then show how to simulate the effects of habitat management on the continental black duck population.

  1. Genetic characterization of a novel astrovirus in Pekin ducks.

    PubMed

    Liao, Qinfeng; Liu, Ning; Wang, Xiaoyan; Wang, Fumin; Zhang, Dabing

    2015-06-01

    Three divergent groups of duck astroviruses (DAstVs), namely DAstV-1, DAstV-2 (formerly duck hepatitis virus type 3) and DAstV-3 (isolate CPH), and other avastroviruses are known to infect domestic ducks. To provide more data regarding the molecular epidemiology of astroviruses in domestic ducks, we examined the prevalence of astroviruses in 136 domestic duck samples collected from four different provinces of China. Nineteen goose samples were also included. Using an astrovirus-specific reverse transcription-PCR assay, two groups of astroviruses were detected from our samples. A group of astroviruses detected from Pekin ducks, Shaoxing ducks and Landes geese were highly similar to the newly discovered DAstV-3. More interestingly, a novel group of avastroviruses, which we named DAstV-4, was detected in Pekin ducks. Following full-length sequencing and sequence analysis, the variation between DAstV-4 and other avastroviruses in terms of lengths of genome and internal component was highlighted. Sequence identity and phylogenetic analyses based on the amino acid sequences of the three open reading frames (ORFs) clearly demonstrated that DAstV-4 was highly divergent from all other avastroviruses. Further analyses showed that DAstV-4 shared low levels of genome identities (50-58%) and high levels of mean amino acid genetic distances in the ORF2 sequences (0.520-0.801) with other avastroviruses, suggesting DAstV-4 may represent an additional avastrovirus species although the taxonomic relationship of DAstV-4 to DAstV-3 remains to be resolved. The present works contribute to the understanding of epidemiology, ecology and taxonomy of astroviruses in ducks. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Habitat Suitability Index Models: American black duck (wintering)

    USGS Publications Warehouse

    Lewis, James C.; Garrison, Russell L.

    1984-01-01

    INTRODUCTION The American black duck, commonly known as the black duck, is migratory and has a wide geographic range. American black ducks breed from Cape Hatteras, North Carolina, west to the Mississippi River and north through the eastern Canadian boreal forest (Bellrose 1976). The winter range extends from the Rio Grande River on the Texas coast, northeast to Lake Michigan, east to Nova Scotia, south to Florida, and west to Texas (Wright 1954). American black ducks arrive on their wintering habitats between September and early December and remain there until February to April (Bellrose 1976). Their preferred habitat varies considerably through the wintering range. Habitat use appears related to food availability, freedom from disturbance, weather, and often upon the presence of large bodies of open water. These interrelated elements are essential for meeting the energy demands and other nutritional requirements of black ducks in response to the rigors of cold weather and migration. In the Atlantic Flyway, winter populations of American black ducks concentrate in marine and estuarine wetlands (U.S. Fish and Wildlife Service 1979). They use salt marshes and small tidal bays for feeding and loafing areas. In wintering areas north of Chesapeake Bay, American black ducks frequently feed on tidal flats and rest in emergent wetlands or on ice-free bays, rivers, and coastal reservoirs. In the Chesapeake bay area, migrant and wintering American black ducks occupy a wide variety of habitats (Stewart 1962). They strongly favor brackish bays with extensive adjacent agricultural lands. Estuarine bays, coastal salt marshes, tidal fresh marshes, and adjacent impoundments receive high usage. American black ducks also concentrate in forested wetlands in and adjacent to estuaries in the South Atlantic Flyway, especially in Virginia and North Carolina.

  3. A starling-deterrent wood duck nest box

    USGS Publications Warehouse

    McGilvrey, F.B.; Uhler, F.M.

    1971-01-01

    In many parts of the United States, the starling (Sturnus vulgaris) has I become a serious competitor for nest boxes erected for wood ducks (Aix sponsa). Research at the Patuxent Wildlife Research Center and at Eastern Neck National Wildlife Refuge near Rock Hall, Maryland, demonstrated that horizontal nest structures with semicircular entrance holes 11 inches in diameter were acceptable to nesting wood ducks but discouraged nesting by starlings. Starlings seemed to prefer boxes in open impoundments to those in wooded impoundments, whereas wood ducks seemed to show no preference.

  4. A solitary case of duck plague in a wild mallard

    USGS Publications Warehouse

    Wobeser, G.; Docherty, D.E.

    1987-01-01

    Duck plague was diagnosed on the basis of pathology and virus isolation in a wild female mallard Anas platyrhynchos found dead near Saskatoon, Saskatchewan. Day-old Pekin ducklings and one of two adult mallards died with lesions typical of duck plague following inoculation of tissue from the wild bird. This is believed to be the only reported case of duck plague in a wild bird since a major outbreak occurred in South Dakota in 1973, and the fourth such report in North America.

  5. Long-term pair bonds in the Laysan Duck

    USGS Publications Warehouse

    Reynolds, M.H.; Breeden, J.H.; Vekasy, M.S.; Ellis, T.M.

    2009-01-01

    We describe long-term pair bonds in the endangered Laysan Duck (Anas laysanensis), a dabbling duck endemic to the Hawaiian Archipelago. Individually marked birds were identified on Laysan Island between 1998 and 2006 (n = 613 marked adults). We recorded pair bonds while observing marked birds, and documented within and between year mate switches and multi-year pair bonds. Twenty pairs banded before 2001 had stable pair bonds lasting ???5 years with a maximum enduring pair bond of nine breeding seasons. Understanding reproductive strategy, including mate retention, would aid conservation planning and management efforts for the Laysan Duck. Further study is needed to characterize the social system of this endangered species.

  6. Factors influencing depredation of artificial duck nests

    USGS Publications Warehouse

    Esler, Daniel N.; Grand, James B.

    1993-01-01

    Because artificial nests can facilitate controlled experiments of nest success, we used them to assess whether human visitation, nest density, vegetation structure, and proximity to habitat edge could affect depredation of duck nests on Yukon Flats National Wildlife Refuge, Alaska. More (P < 0.01) nests in a plot visited daily (100%) were depredated than those in plots visited at intervals of 7 (40%), 14 (35%), or 28 days (45%). More (P < 0.01) nests were depredated in a plot with 10 nests/ha (95%) than nests in a plot of a lower density (2/ha; 40%). Vegetation height, vegetation density, distance to a wetland, distance to forest edge, or distance to the nearest ecotone did not differ (P > 0.05) between depredated and undisturbed nests. We suggest that daily visitation of duck nests increases depredation, but longer intervals, typical of most nest studies, do not. High nesting densities, which could occur when flooding limits nesting habitat, may result in higher depredation rates.

  7. AFLP fingerprinting for paternity testing in ducks.

    PubMed

    Huang, C-W; Cheng, Y-S; Rouvier, R; Yang, K-T; Wu, C-P; Huang, M-C

    2007-06-01

    1. The accuracy and reproducibility of AFLP fingerprinting was investigated in the duck (Anas Platyrhynchos), using a multicolour fluorescent labeling technique. The fluorescent labelling fragments were separated on a capillary electrophoresis-base ABI PRISM 3100 Genetic Analyzer. 2. A total of 337 AFLP peaks with 103 of them being polymorphic markers were generated by 16 sets consisting of EcoRI/TaqI primer pair combinations. The number and size range of AFLP polymorphisms detected per primer pair varied from 3 to 11 and 58 to 290 bp, respectively. About 30.6% (103/337) of AFLP peaks were detected polymorphisms, with an average of 6.4 polymorphic markers per primer pair. 3. The clear polymorphic peaks were amplified with EcoR+AC/Taq+AC primer combinations. The AFLP peaks showed high reproducibility. From the family testing, we found that the fingerprints of all the offspring were derived from one or other parent. Therefore, we conclude that AFLP fingerprinting might be a suitable method for duck paternity testing.

  8. Effects of body weight and age on the time and pairing of American black ducks

    USGS Publications Warehouse

    Hepp, G.R.

    1986-01-01

    I used captive young and adult American Black Ducks (Anas rubripes) during October-February 1984-1985 to test whether body weight and age affected time of pair-bond formation. Eighty ducks were marked individually, and 10 ducks (6 males and 4 females, half of each age class) were assigned to each of 8 experimental pens. Ducks in 4 pens received an ad libitum diet of commercial duck food, and ducks in the other 4 pens received a restricted ration of the same food. During early winter ducks in both groups gained weight, but ducks on the restricted diet gained less than birds on the ad libitum diet; peak winter weight of ducks on the ad libitum diet averaged 22% greater than initial body weight compared with 6.5% for ducks on the restricted diet. In late winter ducks on the restricted diet lost 28.7% of peak winter weight, and ducks on the ad libitum diet lost 19.3%. Weight loss of ducks on the ad libitum diet began before weather conditions became severe and coincided with a reduction in food consumption. This result supports the idea that weight loss of waterfowl in late winter is controlled endogenously. Individuals on the ad libitum diet paired earlier than those on the restricted diet, and pair bonds were stronger. Adults of both sexes paired earlier than young ducks, but differences for females were not significant statistically. Age and energy constraints are factors that can affect intraspecific variation in pairing chronology.

  9. Effects of body weight and age on the time and pairing of American black ducks

    USGS Publications Warehouse

    Hepp, G.R.

    1986-01-01

    I used captive young and adult American Black Ducks (Anas rubripes) during October-February 1984-1985 to test whether body weight and age affected time of pair-bond formation. Eighty ducks were marked individually, and 10 ducks (6 males and 4 females, half of each age class) were assigned to each of 8 experimental pens. Ducks in 4 pens received an ad libitum diet of commercial duck food, and ducks in the other 4 pens received a restricted ration of the same food. During early winter ducks in both groups gained weight, but ducks on the restricted diet gained less than birds on the ad libitum diet; peak winter weight of ducks on the ad libitum diet averaged 22% greater than initial body weight compared with 6.5% for ducks on the restricted diet. In late winter ducks on the restricted diet lost 28.7% of peak winter weight, and ducks on the ad libitum diet lost 19.3%. Weight loss of ducks on the ad libitum diet began before weather conditions became severe and coincided with a reduction in food consumption. This result supports the idea that weight loss of waterfowl in late winter is controlled endogenously. Individuals on the ad libitum diet paired earlier than those on the restricted diet, and pair bonds were stronger. Adults of both sexes paired earlier than young ducks, but differences for females were not significant statistically. Age and energy constraints are factors that can affect intraspecific variation in pairing chronology.

  10. Source and distribution of metals in urban soil of Bombay, India, using multivariate statistical techniques

    NASA Astrophysics Data System (ADS)

    Ratha, D. S.; Sahu, B. K.

    1993-11-01

    Simplification of a complex system of geochemical variables obtained from the soils of an industrialized area of Bombay is attempted by means of R-mode factor analysis. Prior to factor analysis, discriminant analysis was carried out taking rock and soil chemical data to establish the anthropogenic contribution of metals in soil. Trace elements (Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb, and Zn) are expressed in terms of three rotated factors. The factors mostly indicate anthropogenic sources of metals such as atmospheric fallout, emission from different industrial chimneys, crushing operations in quarries, and sewage sludges. Major elements (Na, Mg, Al, Si, P, K, Ca, Ti, Mn, and Fe) are also expressed in terms of three rotated factors indicating natural processes such as chemical weathering, presence of clay minerals, and contribution from sewage sludges and municipal refuse. Summary statistics (mean, standard deviation, skewness, and kurtosis) for the particle size distribution were interpreted as moderate dominance of fine particles. Mineralogical studies revealed the presence of montmorillonite, kaolinite, and illite types of clay minerals. Thus the present study provides information about the metal content entering into the soil and their level, sources, and distribution in the area.

  11. Mercury residues in wood ducks and wood duck foods in eastern Tennessee

    SciTech Connect

    Lindsay, R.C.; Dimmick, R.W.

    1983-04-01

    Liver, breast muscle and body fat from 50 juvenile and five adult wood ducks (Aix sponsa) collected on the Holston River, Tennessee were analyzed for total mercury content. Black fly larvae (Simulium vittatum) sago pondweed (Potamogeton pectinatus), tapegrass (Vallisneria americanus), water stargrass (Heteranthera dubia), Elodea canadensis, and river bottom sediments were also analyzed to elucidate the distribution of mercury in the wood duck's environment. Liver tissues of juveniles contained the highest mean concentration of mercury (0.42 ppm). Mercury in breast muscle and body fat of juveniles averaged 0.15 and 0.10 ppm, respectively. Residues in corresponding tissues of adults were lower. Of environmental components tested, sediments had the highest mean concentration (0.76 ppm). Black fly larvae and aquatic plants had mean levels below 0.10 ppm.

  12. Mercury residues in wood ducks and wood duck foods in eastern Tennessee.

    PubMed

    Lindsay, R C; Dimmick, R W

    1983-04-01

    Liver, breast muscle and body fat from 50 juvenile and five adult wood ducks (Aix sponsa) collected on the Holston River, Tennessee were analyzed for total mercury content. Black fly larvae (Simulium vittatum) sago pondweed (Potamogeton pectinatus), tapegrass (Vallisneria americanus), water stargrass (Heteranthera dubia), Elodea canadensis, and river bottom sediments were also analyzed to elucidate the distribution of mercury in the wood duck's environment. Liver tissues of juveniles contained the highest mean concentration of mercury (0.42 ppm). Mercury in breast muscle and body fat of juveniles averaged 0.15 and 0.10 ppm, respectively. Residues in corresponding tissues of adults were lower. Of environmental components tested, sediments had the highest mean concentration (0.76 ppm). Black fly larvae and aquatic plants had mean levels below 0.10 ppm.

  13. Genetic analysis of duck circovirus in Pekin ducks from South Korea.

    PubMed

    Cha, S-Y; Kang, M; Cho, J-G; Jang, H-K

    2013-11-01

    The genetic organization of the 24 duck circovirus (DuCV) strains detected in commercial Pekin ducks from South Korea between 2011 and 2012 is described in this study. Multiple sequence alignment and phylogenetic analyses were performed on the 24 viral genome sequences as well as on 45 genome sequences available from the GenBank database. Phylogenetic analyses based on the genomic and open reading frame 2/cap sequences demonstrated that all DuCV strains belonged to genotype 1 and were designated in a subcluster under genotype 1. Analysis of the capsid protein amino acid sequences of the 24 Korean DuCV strains showed 10 substitutions compared with that of other genotype 1 strains. Our analysis showed that genotype 1 is predominant and circulating in South Korea. These present results serve as incentive to add more data to the DuCV database and provide insight to conduct further intensive study on the geographic relationships among these virus strains.

  14. The prevalence of duck hepatitis A virus types 1 and 3 on Korean duck farms.

    PubMed

    Soliman, Mahmoud; Alfajaro, Mia Madel; Lee, Min-Hee; Jeong, Young-Ju; Kim, Deok-Song; Son, Kyu-Yeol; Kwon, Joseph; Choi, Jong-Soon; Lim, Jong-Soo; Choi, Jong-Sung; Lee, Tae-Uk; Cho, Kyoung-Oh; Kang, Mun-Il

    2015-02-01

    This study reports the prevalence of duck hepatitis A virus (DHAV) types 1 and 3 on Korean duck farms. By RT-nested PCR assays specific for DHAV-1 or DHAV-3, DHAV-1 was detected in 9 of 157 liver samples (5.7 %) from 2 of 30 farms (6.7 %), and DHAV-3 was positive in 104 of 157 liver samples (66.2 %) from 23 of 30 farms (76.7 %). Dual infections with DHAV-1 and DHAV-3 were detected in 23 of 157 samples (14.6 %) from 5 of 30 farms (16.7 %). The data indicate that DHAV-3 infections are prevalent and that DHAV-1 reemerged in Korea, resulting in dual infections on several farms. Our data will help to establish a vaccination policy against DHAV-1 and DHAV-3 in Korea.

  15. Generation of human induced pluripotent stem cells from a Bombay individual: Moving towards 'universal-donor' red blood cells

    SciTech Connect

    Seifinejad, Ali; Taei, Adeleh; Totonchi, Mehdi; Vazirinasab, Hamed; Hassani, Seideh Nafiseh; Aghdami, Nasser; Shahbazi, Ebrahim; Yazdi, Reza Salman; Salekdeh, Ghasem Hosseini; Baharvand, Hossein

    2010-01-01

    Bombay phenotype is one of the rare phenotypes in the ABO blood group system that fails to express ABH antigens on red blood cells. Nonsense or missense mutations in fucosyltransfrase1 (FUT1) and fucosyltransfrase2 (FUT2) genes are known to create this phenotype. This blood group is compatible with all other blood groups as a donor, as it does not express the H antigen on the red blood cells. In this study, we describe the establishment of human induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of a Bombay blood-type individual by the ectopic expression of established transcription factors Klf4, Oct4, Sox2, and c-Myc. Sequence analyses of fibroblasts and iPSCs revealed a nonsense mutation 826C to T (276 Gln to Ter) in the FUT1 gene and a missense mutation 739G to A (247 Gly to Ser) in the FUT2 gene in the Bombay phenotype under study. The established iPSCs resemble human embryonic stem cells in morphology, passaging, surface and pluripotency markers, normal karyotype, gene expression, DNA methylation of critical pluripotency genes, and in-vitro differentiation. The directed differentiation of the iPSCs into hematopoietic lineage cells displayed increased expression of the hematopoietic lineage markers such as CD34, CD133, RUNX1, KDR, {alpha}-globulin, and {gamma}-globulin. Such specific stem cells provide an unprecedented opportunity to produce a universal blood group donor, in-vitro, thus enabling cellular replacement therapies, once the safety issue is resolved.

  16. Heterogeneity of the human H blood group alpha(1,2)fucosyltransferase gene among para-Bombay individuals.

    PubMed

    Yu, L C; Yang, Y H; Broadberry, R E; Chen, Y H; Lin, M

    1997-01-01

    The para-Bombay phenotype has a relatively high frequency of about 1 in 8,000 Taiwanese. Studies were carried out on eight healthy and unrelated Taiwanese with the para-Bombay phenotype to cast light on its immunogenetic basis. Blood and saliva samples were tested with standard hemagglutination techniques. Salivary ABH substances were determined by hemagglutination inhibition. PCR techniques were used to amplify the coding region of the H genes. Five different h alleles, designated as h1, h2, h3, h4 and h5, were identified in the Taiwanese with the para-Bombay phenotype. The h1 allele loses one of the three AG repeats located at the nucleotides 547-552 of the H gene, whereas two of the three T repeats located at the nucleotides 880-882 are deleted in the h2 allele. The h3 allele contains a C658 to T missense mutation, whereas two missense mutations, C35 to T and A980 to C were identified in the h4 allele. A T460 to C missense is present in the h5 allele. The h5 allele was identified in an individual whose red blood cells contain blood group A antigen but not H antigen, and thus may be considered a weak variant of the H gene. So far no biologic relevance of the H antigen has been discovered, and its deficiency does not seem to produce any deleterious effects. There may be better understanding of the evolutionary basis for the polymorphisms at these loci after systematic study of different ethnic populations.

  17. Generation of human induced pluripotent stem cells from a Bombay individual: moving towards "universal-donor" red blood cells.

    PubMed

    Seifinejad, Ali; Taei, Adeleh; Totonchi, Mehdi; Vazirinasab, Hamed; Hassani, Seideh Nafiseh; Aghdami, Nasser; Shahbazi, Ebrahim; Yazdi, Reza Salman; Salekdeh, Ghasem Hosseini; Baharvand, Hossein

    2010-01-01

    Bombay phenotype is one of the rare phenotypes in the ABO blood group system that fails to express ABH antigens on red blood cells. Nonsense or missense mutations in fucosyltransfrase1 (FUT1) and fucosyltransfrase2 (FUT2) genes are known to create this phenotype. This blood group is compatible with all other blood groups as a donor, as it does not express the H antigen on the red blood cells. In this study, we describe the establishment of human induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of a Bombay blood-type individual by the ectopic expression of established transcription factors Klf4, Oct4, Sox2, and c-Myc. Sequence analyses of fibroblasts and iPSCs revealed a nonsense mutation 826C to T (276 Gln to Ter) in the FUT1 gene and a missense mutation 739G to A (247 Gly to Ser) in the FUT2 gene in the Bombay phenotype under study. The established iPSCs resemble human embryonic stem cells in morphology, passaging, surface and pluripotency markers, normal karyotype, gene expression, DNA methylation of critical pluripotency genes, and in-vitro differentiation. The directed differentiation of the iPSCs into hematopoietic lineage cells displayed increased expression of the hematopoietic lineage markers such as CD34, CD133, RUNX1, KDR, alpha-globulin, and gamma-globulin. Such specific stem cells provide an unprecedented opportunity to produce a universal blood group donor, in-vitro, thus enabling cellular replacement therapies, once the safety issue is resolved. Copyright 2009 Elsevier Inc. All rights reserved.

  18. Molecular basis for para-Bombay phenotypes in Chinese persons, including a novel nonfunctional FUT1 allele.

    PubMed

    Yan, Lixing; Zhu, Faming; Xu, Xianguo; Hong, Xiaozhen; Lv, Qinfeng

    2005-05-01

    The para-Bombay phenotype is characterized by H-deficient or H-partially deficient red blood cells (RBCs) in persons who secrete ABH antigens in their saliva. The studies that determined the genotypes for two Chinese individuals with the para-Bombay phenotype are described. RBC phenotypes were characterized by conventional serologic methods. Exons 6 and 7 of the ABO gene were amplified, as well as the entire coding region for FUT1 and FUT2, with four independence polymerase chain reactions (PCRs) from genomic DNA. PCR products were excised, purified from agarose gels, and sequenced directly. Mutations of FUT1 were identified by TOPO cloning sequencing. For both individuals, RBC ABO genotypes correlated with ABH substances in their saliva. One individual (a patient) had two heterozygous mutations of FUT1 by direct DNA sequencing, namely, a C-->T heterozygous mutation at position 293(C293T) and AG heterozygous deletion (CAGAGAG-->CAGAG) at position 547 to 552. These two mutations were confirmed to be compound heterozygotes; that is, each mutation was determined to be on a separate homologous chromosome by TOPO cloning sequencing. The FUT2 genotype was Se(357)Se(357). The other individual (a blood donor) had an AG deletion at position 547 to 552 homozygous allele in FUT1. The FUT2 genotype was Se(357)Se(357,385). C293T mutation can cause Thr/Met at amino acid position 98. AG deletion at position 547 to 552 caused a reading frameshift and a premature stop codon. A novel nonfunctional FUT1 allele C293T was identified in a person with the para-Bombay phenotype. This rare H-deficient phenotype may result from different nonfunctional alleles.

  19. Replication cycle of duck hepatitis A virus type 1 in duck embryonic hepatocytes

    SciTech Connect

    Yao, Fangke; Chen, Yun; Shi, Jintong; Ming, Ke; Liu, Jiaguo Xiong, Wen; Song, Meiyun; Du, Hongxu; Wang, Yixuan; Zhang, Shuaibin; Wu, Yi; Wang, Deyun; Hu, Yuanliang

    2016-04-15

    Duck hepatitis A virus type 1 (DHAV-1) is an important agent of duck viral hepatitis. Until recently, the replication cycle of DHAV-1 is still unknown. Here duck embryonic hepatocytes infected with DHAV-1 were collected at different time points, and dynamic changes of the relative DHAV-1 gene expression during replication were detected by real-time PCR. And the morphology of hepatocytes infected with DHAV was evaluated by electron microscope. The result suggested that the adsorption of DHAV-1 saturated at 90 min post-infection, and the virus particles with size of about 50 nm including more than 20 nm of vacuum drying gold were observed on the infected cells surface. What's more, the replication lasted around 13 h after the early protein synthesis for about 5 h, and the release of DHAV-1 was in steady state after 32 h. The replication cycle will enrich the data for DVH control and provide the foundation for future studies. - Highlights: • This is the first description of the replication cycle of DHAV-1. • Firstly find that DHAV-1 adsorption saturated at 90 min post-infection. • The replication lasted around 13 h after early protein synthesis for about 5 h. • The release of DHAV-1 was in steady state after 32 h.

  20. Bottom's Semiology: The Duck-Rabbit and Magritte's Pipe.

    ERIC Educational Resources Information Center

    Berthoff, Ann E.

    1993-01-01

    Explores how a dyadic understanding of perception cancels the validity it might have as a model for the linguistic process. Discusses commonly misunderstood exhibits in the gallery of perception studies--the duck-rabbit and Magritte's pipe. (RS)

  1. Bottom's Semiology: The Duck-Rabbit and Magritte's Pipe.

    ERIC Educational Resources Information Center

    Berthoff, Ann E.

    1993-01-01

    Explores how a dyadic understanding of perception cancels the validity it might have as a model for the linguistic process. Discusses commonly misunderstood exhibits in the gallery of perception studies--the duck-rabbit and Magritte's pipe. (RS)

  2. The complete mitochondrial genome of the Youxian duck.

    PubMed

    Lin, Qian; Qiu, Lei; Cao, Rong; Jiang, Gui-Tao; Dai, Qiu-Zhong; Zhang, Shi-Rui; Hou, De-Xing; He, Xi

    2016-01-01

    Youxian duck is one of the famous native breed in China. In this work we reported the complete mitochondrial genome sequence of the Youxian duck in Human Province for the first time. The total length of the mitogenome is 16,606 bp, with the base composition of 29.21% for A, 22.18% for T, 32.83% for C, 15.78% for G, in the order C > A > T > G feature occurring in the Youxian duck. It is made up of two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The complete mitochondrial genome sequence of Youxian duck will be useful for the phylogenetics of poultry, and be available as basic data for the genetics and breeding.

  3. The complete mitochondrial genome of the Linwu duck.

    PubMed

    Lin, Qian; Jiang, Gui-Tao; Yun, Long; Li, Guo-Jun; Dai, Qiu-Zhong; Zhang, Shi-Rui; Hou, De-Xing; He, Xi

    2016-01-01

    In this study, the complete mitochondrial genome sequence of the Linwu duck was first reported in Human Province, which was determined through PCR-based method. Linwu duck is one of the famous native breed in China. The total length of the mitogenome is 16,604 bp, with the base composition of 29.20% for A, 22.21% for T, 32.82% for C, 15.78% for G, in the order C > A > T > G feature occurring in the Linwu duck. It is made up of 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The complete mitochondrial genome sequence of the Linwu duck in Human Province provides an important data for further study about genetic mechanism and breeding.

  4. Sex determination of duck embryos: observations on syrinx development

    USGS Publications Warehouse

    Wilson, Robert E.; Sonsthagen, Sarah A.; Franson, J. Christian

    2013-01-01

    Ducks exhibit sexual dimorphism in vocal anatomy. Asymmetrical ossification of the syrinx (bulla syringealis) is discernable at about 10 days of age in male Pekin duck (Anas platyrhynchos domestica) embryos, but information is lacking on the early development of the bulla in wild ducks. To evaluate the reliability of this characteristic for sexing developing embryos, we examined the syrinx of dead embryos and compared results with molecular sexing techniques in high arctic nesting Common Eiders (Somateria mollissima). Embryos 8 days or older were accurately (100%) sexed based on the presence/absence of a bulla, 2 days earlier than Pekin duck. The use of the tracheal bulla can be a valuable technique when sex identification of embryos or young ducklings is required.

  5. Do wintering Harlequin Ducks forage nocturnally at high latitudes?

    USGS Publications Warehouse

    Rizzolo, D.J.; Esler, Daniel; Roby, D.D.; Jarvis, R.L.

    2005-01-01

    We monitored radio-tagged Harlequin Ducks (Histrionicus histrionicus) to determine whether nocturnal feeding was part of their foraging strategy during winter in south-central Alaska. Despite attributes of our study site (low ambient temperatures, harsh weather, short day length) and study species (small body size, high daytime foraging rates) that would be expected to favor nocturnal foraging, we found no evidence of nocturnal dive-feeding. Signals from eight radio-tagged Harlequin Ducks never exhibited signal loss due to diving during a total of 780 minutes of nocturnal monitoring. In contrast, the same eight birds exhibited signal loss during 62 ± 7% (SE) of 5-minute diurnal monitoring periods (total of 365 minutes of monitoring). Our results suggest that Harlequin Ducks in south-central Alaska face a stringent time constraint on daytime foraging during midwinter. Harlequin Ducks wintering at high latitudes, therefore, may be particularly sensitive to factors that increase foraging requirements or decrease foraging efficiency.

  6. Studies on the ABH-Iso-Agglutinins in serum, saliva and milk from mothers with "Bombay" (Oh) phenotype.

    PubMed

    Joshi, S R; Vasantha, K; Iyer, Y S; Kulkarni, S; Jadhav, S

    2009-01-01

    ABO blood group iso-antibodies are naturally occurring antibodies found in serum and other body fluids. Serum, saliva and milk samples from 5 mothers identified as "Bombay" phenotype were tested for ABH-iso-antibodies by routine serological techniques. All the five mothers showed presence of iso-antibodies in the samples tested. Higher titer values in milk than their serum were observed on subjects whose samples were collected in immediate post-partum phase as compared to those whose samples were collected after a lapse of a few months. High titer iso-agglutinins against ABH antigens were detected in milk samples besides their presence in saliva as well as serum.

  7. Avian influenza, domestic ducks and rice agriculture in Thailand

    PubMed Central

    Gilbert, Marius; Xiao, Xiangming; Chaitaweesub, Prasit; Kalpravidh, Wantanee; Premashthira, Sith; Boles, Stephen; Slingenbergh, Jan

    2008-01-01

    Highly pathogenic avian influenza (HPAI) caused by H5N1 viruses has become a global scale problem which first emerged in southern China and from there spread to other countries in Southeast and East Asia, where it was first confirmed in end 2003. In previous work, geospatial analyses demonstrated that free grazing ducks played critical role in the epidemiology of the disease in Thailand in the winter 2004/2005, both in terms of HPAI emergence and spread. This study explored the geographic association between free grazing duck census counts and current statistics on the spatial distribution of rice crops in Thailand, in particular the crop calendar of rice production. The analysis was carried out using both district level rice statistics and rice distribution data predicted with the aid of remote sensing, using a rice-detection algorithm. The results indicated a strong association between the number of free grazing ducks and the number of months during which second-crop rice harvest takes place, as well as with the rice crop intensity as predicted by remote sensing. These results confirmed that free grazing duck husbandry was strongly driven by agricultural land use and rice crop intensity, and that this later variable can be readily predicted using remote sensing. Analysis of rice cropping patterns may provide an indication of the location of populations of free grazing ducks in other countries with similar mixed duck and rice production systems and less detailed duck census data. Apart from free ranging ducks and rice cropping, the role of hydrology and seasonality of wetlands and water bodies in the HPAI risk analysis is also discussed in relation to the presumed dry season aggregation of wild waterfowl and aquatic poultry offering much scope for virus transmission. PMID:18418464

  8. Avian influenza, domestic ducks and rice agriculture in Thailand.

    PubMed

    Gilbert, Marius; Xiao, Xiangming; Chaitaweesub, Prasit; Kalpravidh, Wantanee; Premashthira, Sith; Boles, Stephen; Slingenbergh, Jan

    2007-01-01

    Highly pathogenic avian influenza (HPAI) caused by H5N1 viruses has become a global scale problem which first emerged in southern China and from there spread to other countries in Southeast and East Asia, where it was first confirmed in end 2003. In previous work, geospatial analyses demonstrated that free grazing ducks played critical role in the epidemiology of the disease in Thailand in the winter 2004/2005, both in terms of HPAI emergence and spread. This study explored the geographic association between free grazing duck census counts and current statistics on the spatial distribution of rice crops in Thailand, in particular the crop calendar of rice production. The analysis was carried out using both district level rice statistics and rice distribution data predicted with the aid of remote sensing, using a rice-detection algorithm. The results indicated a strong association between the number of free grazing ducks and the number of months during which second-crop rice harvest takes place, as well as with the rice crop intensity as predicted by remote sensing. These results confirmed that free grazing duck husbandry was strongly driven by agricultural land use and rice crop intensity, and that this later variable can be readily predicted using remote sensing. Analysis of rice cropping patterns may provide an indication of the location of populations of free grazing ducks in other countries with similar mixed duck and rice production systems and less detailed duck census data. Apart from free ranging ducks and rice cropping, the role of hydrology and seasonality of wetlands and water bodies in the HPAI risk analysis is also discussed in relation to the presumed dry season aggregation of wild waterfowl and aquatic poultry offering much scope for virus transmission.

  9. Ecology and conservation of North American sea ducks

    USGS Publications Warehouse

    Savard, Jean-Pierre L.; Derksen, Dirk V.; Esler, Daniel N.; Eadie, John M.

    2015-01-01

    Harvest history The book presents a comprehensive synthesis of sea duck ecology, documents factors that have caused population declines of some species, and provides managers with measures to enhance recovery of depressed populations of sea ducks in North America. Capturing the current state of knowledge of this unique tribe, it provides a benchmark for where we are in conservation efforts and suggests future directions for researchers, managers, students, conservationists, and avian enthusiasts.

  10. Cygnet River Virus, a Novel Orthomyxovirus from Ducks, Australia

    PubMed Central

    Kessell, Allan; Hyatt, Alex; Lehmann, Debra; Shan, Songhua; Crameri, Sandra; Holmes, Clare; Marsh, Glenn; Williams, Catherine; Tachedjian, Mary; Yu, Meng; Bingham, John; Payne, Jean; Lowther, Sue; Wang, Jianning; Wang, Lin-Fa

    2012-01-01

    A novel virus, designated Cygnet River virus (CyRV), was isolated in embryonated eggs from Muscovy ducks in South Australia. CyRV morphologically resembles arenaviruses; however, sequencing identified CyRV as an orthomyxovirus. The high mortality rate among ducks co-infected with salmonellae suggests that CyRV may be pathogenic, either alone or in concert with other infections. PMID:23171630

  11. Updating movement estimates for American black ducks (Anas rubripes).

    PubMed

    Robinson, Orin J; McGowan, Conor P; Devers, Patrick K

    2016-01-01

    Understanding migratory connectivity for species of concern is of great importance if we are to implement management aimed at conserving them. New methods are improving our understanding of migration; however, banding (ringing) data is by far the most widely available and accessible movement data for researchers. Here, we use band recovery data for American black ducks (Anas rubripes) from 1951-2011 and analyze their movement among seven management regions using a hierarchical Bayesian framework. We showed that black ducks generally exhibit flyway fidelity, and that many black ducks, regardless of breeding region, stopover or overwinter on the Atlantic coast of the United States. We also show that a non-trivial portion of the continental black duck population either does not move at all or moves to the north during the fall migration (they typically move to the south). The results of this analysis will be used in a projection modeling context to evaluate how habitat or harvest management actions in one region would propagate throughout the continental population of black ducks. This analysis may provide a guide for future research and help inform management efforts for black ducks as well as other migratory species.

  12. Molecular characterization and expression analysis of the duck viperin gene.

    PubMed

    Zhong, Zifu; Ji, Yanhong; Fu, Yuguang; Liu, Bin; Zhu, Qiyun

    2015-10-01

    Viperin is well known as one of the interferon-stimulated genes involved in innate immunity. Recent studies showed that this gene is mainly responsible for antiviral response to a large variety of viral infections. In this study, we successfully cloned and characterized the complete coding sequence of duck viperin gene. The duck viperin gene encodes 363 amino acids (aa) and is highly similar to viperins from other species. Moreover, secondary and 3D structures were predicted, and these structures showed two main domains, one signal peptide, and one radical S-adenosyl methionine (SAM) domain. Additionally, the duck viperin expression was analyzed in vitro and in vivo, and analysis results indicated that the duck viperin can be strongly up-regulated by poly(I:C) and Newcastle disease virus in primary duck embryo fibroblast cells. Results also demonstrated that Newcastle disease virus significantly induced duck viperin expression in the spleen, kidneys, liver, brain, and blood. Our findings will contribute to future studies on the detailed functions and potential underlying mechanisms of this novel protein in innate immunity.

  13. Updating movement estimates for American black ducks (Anas rubripes)

    PubMed Central

    McGowan, Conor P.; Devers, Patrick K.

    2016-01-01

    Understanding migratory connectivity for species of concern is of great importance if we are to implement management aimed at conserving them. New methods are improving our understanding of migration; however, banding (ringing) data is by far the most widely available and accessible movement data for researchers. Here, we use band recovery data for American black ducks (Anas rubripes) from 1951–2011 and analyze their movement among seven management regions using a hierarchical Bayesian framework. We showed that black ducks generally exhibit flyway fidelity, and that many black ducks, regardless of breeding region, stopover or overwinter on the Atlantic coast of the United States. We also show that a non-trivial portion of the continental black duck population either does not move at all or moves to the north during the fall migration (they typically move to the south). The results of this analysis will be used in a projection modeling context to evaluate how habitat or harvest management actions in one region would propagate throughout the continental population of black ducks. This analysis may provide a guide for future research and help inform management efforts for black ducks as well as other migratory species. PMID:26989624

  14. Proportion of recovered duck bands that are reported

    USGS Publications Warehouse

    Martinson, R.K.

    1966-01-01

    Band-reporting rates (the proportion of duck bands recovered by hunters that are actually reported to the Bird Banding Laboratory) appear to have decreased between the late 1950's and early 1960's. About one-half the banded ducks bagged during the 1958-59 and 1959-60 hunting seasons were reported-a rate similar to those recorded in other studies conducted during the early and mid-1950's. Band-reporting rates were lower for the 1962-63 and 1962-64 hunting seasons; less than one-third of the banded ducks bagged were reported. This decrease in band-reporting rates was concurrent with significant changes in duck hunting regulations, the volume of duck banding, and the method used to relay information to the person who reports a band. Band-reporting rates differed for various species of ducks. In general, band-reporting rates were high on canvasbacks (Aythya valisineria), redheads (A. americana), and pintails Anas acuta) and low for teals (Anas discors and A. carolinensis).

  15. Cross-sectional serosurvey of avian influenza antibodies presence in domestic ducks of Kathmandu, Nepal.

    PubMed

    Karki, S; Lupiani, B; Budke, C M; Manandhar, S; Ivanek, R

    2014-09-01

    Kathmandu, Nepal has been classified as a high-risk area for highly pathogenic avian influenza (HPAI) by the Nepali Government. While ducks have an important role in the transmission of avian influenza viruses (AIV), including HPAI, seroprevalence of antibodies to AIV in domestic ducks of Kathmandu has never been assessed. The objectives of this study were (i) to estimate the prevalence of seroconversion to AIV in domestic ducks in major duck-raising areas of Kathmandu and (ii) to assess the effect of age, sex, presence of swine and the number of ducks on the farm on the carriage of antibodies to AIV in these ducks. From April through July of 2011, a cross-sectional study was conducted and a total of 310 ducks in the major duck-raising areas of Kathmandu were sampled. The estimated prevalence of AIV antibodies was 27.2% [95% confidence interval (CI): 24.6-29.5]. Of 62 enrolled farms, 42% had at least one seropositive duck. Half of the enrolled farms also kept pigs of which 52% had at least one seropositive duck. Bivariate analysis indicated association between ducks' seroconversion to AIV and their age, sex and farm size. However, the final multivariable model, after controlling for clustering of ducks within farms, identified age as the only significant risk factor. Based on this model, ducks older than 1 year of age were more likely to be seropositive compared to ducks <6 months of age [odds ratio = 2.17 (1.07-4.39)]. These results provide baseline information about the AIV seroprevalence in domestic ducks in the major duck-raising areas of Kathmandu and identify a high-risk group that can be targeted in surveillance activities. Future studies should be conducted to differentiate the subtypes of AIV present among domestic ducks in Kathmandu, with particular interest in the presence of HPAI viruses. © 2014 Blackwell Verlag GmbH.

  16. Monitoring the health and production of household Jinding ducks on Hatia Island of Bangladesh.

    PubMed

    Hoque, M A; Skerratt, L F; Rahman, M A; Alim, M A; Grace, D; Gummow, B; Rabiul Alam Beg, A B M; Debnath, N C

    2011-02-01

    Duck rearing is an important component of sustainable living in poor rural communities, especially as a source of subsistence. A study was conducted on 118 households (N = 1,373 Jinding ducks, Anas platyrhynchus) from December 2002 to February 2004 on Hatia Island in Bangladesh with the aim of identifying the factors that limit the health and production of Jinding ducks. Overall duck mortality was 29.3%, with disease (19.7%) being a more significant factor than predation (9.6%; p = 0.001). Duck mortality also varied significantly among study zones (p < 0.001). Common diseases were duck plague (21.1%) and duck cholera (32.1%). Helminth infection was prevalent, with endemic trematode (Prosthogonimus spp., Trichobilharzia spp., Echinostoma spp.) and nematode (Cyathostoma bronchialis, Amidostomum anseris, Heterakis gallinarum, Capillaria spp., and Echinuria spp.) infections and epidemic cestode infections due to Hymenolepsis setigera. The median egg production rate per duck per household was 93 for a 6-month laying period. The odds of diminished egg production (average ≤ 93 eggs per duck per household for a 6-month laying period) was 25.4 times higher in ducks that were kept in traditional duck houses (p < 0.001) and 14.2 times higher in ducks that experienced delays in the onset of sexual maturity (days 191 and 280; p < 0.001). Ducks that were provided snails for a shorter period of time over the laying period were 18.2 times more likely to produce fewer eggs than their longer fed peers (p = 0.002). In conclusion, duck mortalities due to diseases and predation and parasitic infections appear to be common constraints on household duck production on Hatia Island. Additionally, improving duck housing and providing longer nutritional supplementation with snails increased the production capabilities of household-raised Jinding ducks on Hatia Island.

  17. Fabrication of duck's feet collagen-silk hybrid biomaterial for tissue engineering.

    PubMed

    Kim, Soo Hyeon; Park, Hae Sang; Lee, Ok Joo; Chao, Janet Ren; Park, Hyun Jung; Lee, Jung Min; Ju, Hyung Woo; Moon, Bo Mi; Park, Ye Ri; Song, Jeong Eun; Khang, Gilson; Park, Chan Hum

    2016-04-01

    Collagen constituting the extracellular matrix has been widely used as biocompatible material for human use. In this study, we have selected duck's feet for extracting collagen. A simple method not utilizing harsh chemical had been employed to extract collagen from duck's feet. We fabricated duck's feet collagen/silk hybrid scaffold for the purpose of modifying the degradation rate of duck's feet collagen. This study suggests that extracted collagen from duck's feet is biocompatible and resembles collagen extracted from porcine which is commercially used. Duck's feet collagen is also economically feasible and it could therefore be a good candidate as a tissue engineering material. Further, addition of silk to fabricate a duck's feet collagen/silk hybrid scaffold could enhance the biostability of duck's feet collagen scaffold. Duck's feet collagen/silk scaffold increased the cell viability compared to silk alone. Animal studies also showed that duck's feet collagen/silk scaffold was more biocompatible than silk alone and more biostable than duck's feet or porcine collagen alone. Additionally, the results revealed that duck's feet collagen/silk hybrid scaffold had high porosity, cell infiltration and proliferation. We suggest that duck's feet collagen/silk hybrid scaffold could be used as a dermal substitution for full thickness skin defects.

  18. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A male pintail duck (foreground) paddles in the waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center while a female behind him bobs for food. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  19. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A male pintail duck (left) and female pintail (right) look like bookends on a glass-topped table in the winter waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  20. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Male (foreground) and female pintail ducks climb onto a grassy spot in the waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  1. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Two female pintail ducks search for food in the winter waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  2. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Male (foreground) and female pintail ducks climb onto a grassy spot in the waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  3. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A male pintail duck (left) and female pintail (right) look like bookends on a glass-topped table in the winter waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  4. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Two female pintail ducks search for food in the winter waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  5. Pintail ducks tread the waters of KSC

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A male pintail duck (foreground) paddles in the waters of the Merritt Island National Wildlife Refuge at Kennedy Space Center while a female behind him bobs for food. The pintails can be found in the marshes, prairie ponds and tundra of Alaska, Greenland and north and western United States; in the winter they range south and east to Central America and the West Indies, sometimes in salt marshes such as the refuge offers. The open water of the refuge provides wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds. The 92,000-acre refuge is also habitat for more than 310 species of birds, 25 mammals, 117 fishes and 65 amphibians and reptiles.

  6. Age determination of female redhead ducks

    USGS Publications Warehouse

    Dane, C.W.; Johnson, D.H.

    1975-01-01

    Eighty-seven fall-collected wings from female redhead ducks (Aythya americana) were assigned to the adult or juvenile group based on 'tertial' and 'tertial covert' shape and wear. To obtain spring age-related characters from these fall-collected groupings, we considered parameters of flight feathers retained until after the first breeding season. Parameters measured included: markings on and width of greater secondary coverts, and length, weight, and diameter of primary feathers. The best age categorization was obtained with discriminant analysis based on a combination of the most accurately measured parameters. This analysis, applied to 81 wings with complete measurements, resulted in only 1 being incorrectly aged and 3 placed in a questionable category. Discriminant functions used with covert markings and the three 5th primary parameters were applied to 30 known-age juvenile, hand-reared redhead females, 28 were correctly aged, none was incorrectly aged, and only 2 were placed in the questionable category.

  7. Duck Enteritis Virus Glycoprotein D and B DNA Vaccines Induce Immune Responses and Immunoprotection in Pekin Ducks

    PubMed Central

    Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

    2014-01-01

    DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466

  8. Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

    PubMed

    Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

    2014-01-01

    DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

  9. 'Victoria Crater' from 'Duck Bay' (Vertical Projection)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a vertical projection with geometric seam correction.

  10. 'Victoria Crater' from 'Duck Bay' (Polar Projection)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a polar projection with geometric seam correction.

  11. 'Victoria Crater' from 'Duck Bay' (Stereo)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    [figure removed for brevity, see original site] Figure 1

    [figure removed for brevity, see original site] Figure 2

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    The stereo-anaglyph view presented here is a cylindrical projection with geometric seam correction.

  12. Metal and sediment ingestion by dabbling ducks

    USGS Publications Warehouse

    Beyer, W.N.; Spann, J.; Day, D.

    1999-01-01

    The chemical analysis of intestinal digesta from hunter-killed carcasses or of wildlife scat is a promising means of estimating the exposure of wildlife to those environmental contaminants that, like lead, are poorly absorbed in the digestive tract. When evaluating contaminants at a site, biologists may find the results of this non-destructive approach more straightforward to interpret in terms of exposure to wildlife than would be analyses of soils, sediments, water, or wildlife tissues. To illustrate the approach, we collected digesta from 47 waterfowl shot by hunters at Prime Hook National Wildlife Refuge, in Delaware, USA. The waterfowl digesta contained an average of approximately 2.4% sediment, estimated from the Al concentrations in the digesta, a marker for sediment. Al concentrations were significantly correlated with concentrations of Cr (Spearman's rank correlation coefficient, r=0.57), V (r=0.70), Ni (r=0.31), and Pb (r=0.55), and we concluded that these metals were ingested mainly with sediment. American widgeon (Anas americana) ingested sediment at a rate of about four times that of three other species of dabbling ducks (Anas crecca, A. acuta, A. rubripes) and had several times the exposure to the sediment-associated metals. The digesta of one American black duck contained a high concentration of lead (70 mg/kg, dry wt.), presumably from lead shot, but none of the other samples had notably elevated metal concentrations. We suggest that scat and digesta be analyzed more widely by biologists and resource managers seeking a simple, inexpensive assessment of contaminants in local wildlife habitat.

  13. 'Victoria Crater' from 'Duck Bay' (Polar Projection)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a polar projection with geometric seam correction.

  14. 'Victoria Crater' from 'Duck Bay' (Vertical Projection)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    This view is presented as a vertical projection with geometric seam correction.

  15. 'Victoria Crater' from 'Duck Bay' (Stereo)

    NASA Technical Reports Server (NTRS)

    2006-01-01

    [figure removed for brevity, see original site] Figure 1

    [figure removed for brevity, see original site] Figure 2

    NASA's Mars rover Opportunity edged 3.7 meters (12 feet) closer to the top of the 'Duck Bay' alcove along the rim of 'Victoria Crater' during the rover's 952nd Martian day, or sol (overnight Sept. 27 to Sept. 28), and gained this vista of the crater. The rover's navigation camera took the seven exposures combined into this mosaic view of the crater's interior. This crater has been the mission's long-term destination for the past 21 Earth months.

    The far side of the crater is about 800 meters (one-half mile) away. The rim of the crater is composed of alternating promontories, rocky points towering approximately 70 meters (230 feet) above the crater floor, and recessed alcoves, such as Duck Bay. The bottom of the crater is covered by sand that has been shaped into ripples by the Martian wind. The rocky cliffs in the foreground have been informally named 'Cape Verde,' on the left, and 'Cabo Frio,' on the right.

    Victoria Crater is about five times wider than 'Endurance Crater,' which Opportunity spent six months examining in 2004, and about 40 times wider than 'Eagle Crater,' where Opportunity first landed. The great lure of Victoria is an expectation that the thick stack of geological layers exposed in the crater walls could reveal the record of past environmental conditions over a much greater span of time than Opportunity has read from rocks examined earlier in the mission.

    The stereo-anaglyph view presented here is a cylindrical projection with geometric seam correction.

  16. H-deficient Bombay and para-Bombay red blood cells are most strongly agglutinated by the galactophilic lectins of Aplysia and Pseudomonas aeruginosa that detect I and P1 antigens.

    PubMed

    Gilboa-Garber, N; Sudakevitz, D; Levene, C; Rahimi-Levene, N; Yahalom, V

    2006-01-01

    The galactophilic lectins Aplysia gonad lectin (AGL) and Pseudomonas aeruginosa lectin (PA-IL), which detect human I and P1 RBC antigens, were examined for hemagglutination of H+ (group O and B) and H-deficient (Bombay and para-Bombay phenotype) RBCs. The results were compared with those obtained using two other galactophilic lectins, Maclura pomifera lectin (MPL) and Arachis hypogaea (peanut) agglutinin (PNA), which share T-antigen affinity, and two fucose-binding H-specific lectins, Ulex europaeus (UEA-I) and Pseudomonas aeruginosa lectin (PA-IIL), as well as with those achieved with anti-I serum. The results revealed that, in contrast to UEA-I and PA-IIL, which preferentially agglutinated H+ RBCs, and to MPL and PNA, which similarly agglutinated all examined RBCs, AGL, PA-IL, and the anti-I serum agglutinated the H-deficient RBCs more strongly than did the H+ RBCs. These findings could be attributed to increased levels of I and P1 antigens on those RBCs resulting from the use of the free common H-type 2 precursor for their synthesis. Since both PA-IL and PA-IIL are regarded as potential pathogen adhesins, it would be interesting to statistically compare the sensitivities of individuals of H+ and H-deficient RBC populations to P. aeruginosa infections.

  17. [Study of a case with homozygous 35C>T and 658C>T mutations of FUT1 gene leading to a para-Bombay phenotype].

    PubMed

    Lin, Fengqiu; Sun, Changping; Wang, Hui; Zhang, Xu; Li, Jianping

    2015-12-01

    To explore the molecular mechanism for a case with para-Bombay phenotype caused by α-1,2-fucosyltransferase (FUT1) gene mutations. Blood phenotype of the propositus was determined by standard serological testing. Polymerase chain reaction-sequence specific primer (PCR-SSP) and direct sequencing of PCR product were used to analyze its ABO genotype. The PCR product of FUT1 gene was sequenced and analyzed. The phenotype of the propositus was initially detected as para-Bombay A type. Direct sequencing of ABO gene showed that the genotype of the proband was A101/O01 (261G/del), which was consistent with the result of PCR-SSP. Two homo-mutations, 35C>T and 658C>T, were detected in the FUT1 gene by sequencing, and the genotype was determined as h(35T+658T)/h(35T+658T). h(35T+658T)/h(35T+658T) is responsible for the para-Bombay phenotype of the propositus. The genotype is rare even in para-Bombay populations.

  18. Sensitivity of embryos of chicken, domestic duck, and common eider duck to polychlorinated and non-halogenated aromatic hydrocarbons

    SciTech Connect

    Brunstroem, B.

    1995-12-31

    Embryos of chicken (Gallus domesticus), domestic duck (Anas platyrhynchos), and common eider duck (Somateria mollissima) were exposed in ovo to PCBs and to polycyclic aromatic hydrocarbons. Two coplanar PCBs, 3,3{prime},4,4{prime}-tetrachlorobiphenyl (PCB {number_sign}77) and 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PCB {number_sign}126), were considerably more lethal and potent as inducers of 7-ethoxyresorufin O-deethylase (EROD) in chicken embryos (Gallus domesticus) than in embryos of the other two species. In chicken embryos, these compounds caused edema and eye and beak deformities. An artificial mixture of 18 PAHs which all have been detected in environmental samples, was slightly more toxic to embryos of the domestic duck and the common eider duck than to chicken embryos. The most potent compound in the mixture was benzo(k)fluoranthene. When chicken embryo livers were exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in vitro, EROD was induced by very low concentrations and the EC{sub 50} value obtained was 5 {times} 10{sup {minus}12} M. Livers from embryos of eider ducks and domestic ducks were 2--4 orders of magnitude less responsive to TCDD than chicken embryo livers in terms of EROD induction in vitro.

  19. Comparison of Bioactive Compounds and Quality Traits of Breast Meat from Korean Native Ducks and Commercial Ducks

    PubMed Central

    Kim, Sun Hyo; Heo, Kang Nyung

    2015-01-01

    The aim of this research was to compare the bioactive compound content and quality traits of breast meat from male and female Korean native ducks (KND) and commercial ducks (CD, Cherry Valley). Meat from three 6-wk old birds of each sex from KND and CD were evaluated for carcass and breast weights, pH, color, cooking loss, shear force, and bioactive compound (creatine, carnosine, anserine, betaine, and L-carnitine) content. KND showed significantly higher carcass weights than CD whereas no such difference (p>0.05) was found between male and female ducks. The breed and sex had no significant effects on the breast weight, pH value, and shear force. However, KND had significantly lower cooking loss values than did CD. Creatine, anserine, and L-carnitine contents were significantly higher in KND than in CD and were predominant in female ducks compared to males. The results of this study provide rare information regarding the amounts and the determinants of several bioactive compounds in duck meat, which can be useful for selection and breeding programs, and for popularizing indigenous duck meat. PMID:26761808

  20. Live Attenuated Vaccine Based on Duck Enteritis Virus against Duck Hepatitis A Virus Types 1 and 3

    PubMed Central

    Zou, Zhong; Ma, Ji; Huang, Kun; Chen, Huanchun; Liu, Ziduo; Jin, Meilin

    2016-01-01

    As causative agents of duck viral hepatitis, duck hepatitis A virus type 1 (DHAV-1) and type 3 (DHAV-3) causes significant economic losses in the duck industry. However, a licensed commercial vaccine that simultaneously controls both pathogens is currently unavailable. Here, we generated duck enteritis virus recombinants (rC-KCE-2VP1) containing both VP1 from DHAV-1 (VP1/DHAV-1) and VP1 from DHAV-3 (VP1/DHAV-3) between UL27 and UL26. A self-cleaving 2A-element of FMDV was inserted between the two different types of VP1, allowing production of both proteins from a single open reading frame. Immunofluorescence and Western blot analysis results demonstrated that both VP1 proteins were robustly expressed in rC-KCE-2VP1-infected chicken embryo fibroblasts. Ducks that received a single dose of rC-KCE-2VP1 showed potent humoral and cellular immune responses and were completely protected against challenges of both pathogenic DHAV-1 and DHAV-3 strains. The protection was rapid, achieved as early as 3 days after vaccination. Moreover, viral replication was fully blocked in vaccinated ducks as early as 1 week post-vaccination. These results demonstrated, for the first time, that recombinant rC-KCE-2VP1 is potential fast-acting vaccine against DHAV-1 and DHAV-3. PMID:27777571

  1. Viral nucleic acid synthesis and antigen accumulation in pancreas and kidney of Pekin ducks infected with duck hepatitis B virus.

    PubMed Central

    Halpern, M S; England, J M; Deery, D T; Petcu, D J; Mason, W S; Molnar-Kimber, K L

    1983-01-01

    Liver, pancreas, and kidney from Pekin ducks infected with duck hepatitis B virus (DHBV) were assayed for the presence of both viral antigen and replication-specific forms of viral nucleic acid. In young congenitally infected ducks, antigen was detectable in hepatocytes and bile duct epithelia, in kidney glomeruli and tubular epithelia, and in cells localized to pancreatic acini. In older experimentally infected ducks, antigen was detectable in hepatocytes, in glomeruli and tubular epithelia, and in cells localized to presumptive pancreatic alpha-islets. All but the glomeruli-associated viral antigen appeared to be localized to the cytoplasm of antigen-positive cells. Much of the glomeruli-associated antigen appeared to be extracellular and was detected in glomeruli that were positive for the accumulation of immunoglobulin, observations suggestive of the deposition of viral antigen-antibody complexes. As analyzed with bulk tissue, replication-specific forms of viral nucleic acid were detectable in liver and pancreas from the young congenitally infected ducks and in liver and kidney from the older experimentally infected ducks. Images PMID:6576362

  2. Hypertension in the Parsi community of Bombay: a study on prevalence, awareness and compliance to treatment

    PubMed Central

    Bharucha, Nadir E; Kuruvilla, Thomas

    2003-01-01

    Background Uncontrolled hypertension (HT) is an established risk factor for the development of vascular diseases. Prevalence varies in different communities and no such study has been conducted in the Parsi community living in Bombay, India. The objectives of this study were to determine the prevalence, awareness, compliance to medication and control of HT in this community. Method We used a 1 in 4 random selection of subjects who were ≥ 20 years of age. A questionnaire was administered and the blood pressure (BP) was measured by a doctor. HT was defined as diastolic blood pressure (DBP) ≥ 90 mm Hg ± systolic pressure (SBP) ≥ 140 mm Hg. Isolated systolic hypertension (ISH) was defined as SBP ≥ 160 mm Hg with DBP < 90 mm Hg. Subsequently, we reanalysed the data using current definition of ISH as SBP ≥ 140 mm Hg with DBP < 90 mm Hg. Results 2879 subjects ≥ 20 years of age were randomly selected of which 2415 (84%) participated in the study. The overall prevalence of HT in the community was 36.4%, of whom 48.5% were unaware of their hypertensive status. Of those aware of having HT, 36.4% were non-compliant with their anti-hypertensive drugs and only 13.6% had optimally controlled HT. Prevalence of ISH using the present criteria was 19.5% and 73% of hypertensives ≥ 60 years had ISH. Conclusion This study shows that prevalence of HT in the Parsi community is high and nearly half are unaware of their hypertensive status. ISH is the dominant form of HT in the elderly. Compliance to treatment is poor and optimal BP control is achieved in only a small minority. The study highlights the need for regular screening coupled with educational programs to detect and optimally treat HT in the community. PMID:12513697

  3. Biotransformation and detoxification of inorganic arsenic in Bombay oyster Saccostrea cucullata.

    PubMed

    Zhang, Wei; Guo, Zhiqiang; Zhou, Yanyan; Liu, Huaxue; Zhang, Li

    2015-01-01

    Arsenic (As) exists as the toxic inorganic forms in marine water and sediment, while marine oysters usually accumulate high As contents mostly as the less toxic organic forms. It has not yet been clear that how As is biotransformed in marine oysters. This study therefore investigated the biotransformation and detoxification of two inorganic As forms (As(III) and As(V)) in Bombay oyster Saccostrea cucullata after waterborne exposures for 30 days. Seven treatments of dissolved As exposure (clean seawater, 1, 5, 20 mg/L As(III), and 1, 5, 20 mg/L As(V)) were performed. Body As concentration increased significantly after all As exposure treatments except 1mg/L As(V). Total As, As(III), and As(V) concentration were positive correlated with glutathione-S-transferases (GST) activities, suggesting GST might play an important role in the As biotransformation and detoxification process. Organic As species were predominant in control and the low As exposed oysters, whereas a large fraction of As was remained as the inorganic forms in the high As exposed oysters, suggesting As could be biotransformed efficiently in the oysters in clean or light contaminated environment. The results of As speciation demonstrated the As biotransformation in the oysters included As(V) reduction, methylation to monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA), and subsequent conversion to arsenobetaine (AsB). More As was distributed in the subcellular metallothionein-like proteins fraction (MTLP) functioning sequestration and detoxification in the inorganic As exposed oysters, suggesting it was also a strategy for oysters against As stress. In summary, this study elucidated that marine oysters had high ability to accumulate, biotransform, and detoxify inorganic As.

  4. H-deficient blood groups of Reunion island. II. Differences between Indians (Bombay Phenotype) and whites (Reunion phenotype).

    PubMed

    Le Pendu, J; Gerard, G; Vitrac, D; Juszczak, G; Liberge, G; Rouger, P; Salmon, C; Lambert, F; Dalix, A M; Oriol, R

    1983-05-01

    Two variants of recessive, H-deficient nonsecretor individuals (h/h, se/se) were identified on Reunion Island: (1) H-negative individuals corresponding to the classical Bombay phenotypes (OhO, OhA, OhB, OhAB) who lack completely the H antigen on their red cells; all of them were Indian and had strong anti-H antibodies reacting with normal O and Oh red cells from whites; and (2) H-weak individuals (Oh, Ah, Bh, ABh). This phenotype represented the majority (85%) of the H-deficient phenotypes on Reunion Island, and all of them were white. They had only a weak expression of the H antigen and showed small but detectable amounts of ABH antigens on their red cells. Their anti-H antibodies reacted with normal O erythrocytes, but failed to react with Oh red cells, regardless of the ethnic origin of the donor. They were all from the same geographical area on the Island (Cilaos) and showed homogeneous titers of anti-H antibodies in sera. We propose to call this particular variant of weak H phenotype, belonging to the so-called para-Bombay series, Reunion.

  5. H-deficient blood groups of Reunion island. II. Differences between Indians (Bombay Phenotype) and whites (Reunion phenotype).

    PubMed Central

    Le Pendu, J; Gerard, G; Vitrac, D; Juszczak, G; Liberge, G; Rouger, P; Salmon, C; Lambert, F; Dalix, A M; Oriol, R

    1983-01-01

    Two variants of recessive, H-deficient nonsecretor individuals (h/h, se/se) were identified on Reunion Island: (1) H-negative individuals corresponding to the classical Bombay phenotypes (OhO, OhA, OhB, OhAB) who lack completely the H antigen on their red cells; all of them were Indian and had strong anti-H antibodies reacting with normal O and Oh red cells from whites; and (2) H-weak individuals (Oh, Ah, Bh, ABh). This phenotype represented the majority (85%) of the H-deficient phenotypes on Reunion Island, and all of them were white. They had only a weak expression of the H antigen and showed small but detectable amounts of ABH antigens on their red cells. Their anti-H antibodies reacted with normal O erythrocytes, but failed to react with Oh red cells, regardless of the ethnic origin of the donor. They were all from the same geographical area on the Island (Cilaos) and showed homogeneous titers of anti-H antibodies in sera. We propose to call this particular variant of weak H phenotype, belonging to the so-called para-Bombay series, Reunion. PMID:6859043

  6. Identification of a novel FUT1 allele with two mutations in a Chinese para-Bombay individual.

    PubMed

    Wang, Lixin; Huang, Chunyan; Wei, Zengzhen; Tan, Jinzhe; Qin, Li; Tian, Li

    2017-01-01

    The para-Bombay phenotype often results from a silenced β-D-galactoside 2-α-fucosyltransferase 1 (FUT1) gene (h/h) but an active FUT2 (Se/Se or Se/se) gene. We identified a para-Bombay phenotype with two novel mutations in the FUT1 gene and homozygous mutated FUT2 (se(357, 385) /se(357, 385) ) genes. Red blood cell phenotype was detected by using a standard serologic technique. The entire coding regions of the FUT1 and FUT2 genes were amplified and direct sequenced using genomic DNA. No ABH substance was detected on the surface of the proband's red blood cells. Anti-A, anti-B, and anti-H were identified in serum. Genetic studies indicated that the proband's ABO genotyping was A102/O01 and that the FUT2 phenotype was se(357, 385) /se(357,)(385) . The sample was homozygous for two FUT1 mutations: c.958insG and c.961G > A. Two novel FUT1 mutations have been identified in the proband's FUT1 gene. The insertion mutation in the FUT1 that caused a shift of the open reading frame and formed a termination codon early at Amino Acid Position 334 may be the main reason for H deficiency in this case. © 2016 AABB.

  7. Assessment of undiscovered oil and gas resources of the Assam, Bombay, Cauvery, and Krishna-Godavari Provinces, South Asia, 2011

    USGS Publications Warehouse

    Klett, T.R.; Schenk, Christopher J.; Wandrey, Craig J.; Charpentier, Ronald R.; Cook, Troy A.; Brownfield, Michael E.; Pitman, Janet K.; Pollastro, Richard M.

    2012-01-01

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated volumes of undiscovered, technically recoverable, conventional petroleum resources for the Assam, Bombay, Cauvery, and Krishna–Godavari Provinces, South Asia. The estimated mean volumes are as follows: (1) Assam Province, 273 million barrels of crude oil, 1,559 billion cubic feet of natural gas, and 43 million barrels of natural gas liquids; (2) Bombay Province, 1,854 million barrels of crude oil, 15,417 billion cubic feet of natural gas, and 498 million barrels of natural gas liquids; (3) Cauvery Province, 941 million barrels of crude oil, 25,208 billion cubic feet of natural gas, and 654 million barrels of natural gas liquids; and (4) Krishna–Godavari Province, 466 million barrels of crude oil, 37,168 billion cubic feet of natural gas, and 484 million barrels of natural gas liquids. The totals for the four provinces are 3,534 million barrels of crude oil, 79,352 billion cubic feet of natural gas, and 1,679 million barrels of natural gas liquids.

  8. The summary of FUT1 and FUT2 genotyping analysis in Chinese para-Bombay individuals including additional nine probands from Guangzhou in China.

    PubMed

    Luo, Guangping; Wei, Ling; Wang, Zhen; Luo, Hong; Zhao, Yang; Zhang, Runqing; Mo, Chunyan; Ji, Yanli

    2013-12-01

    The para-Bombay phenotype is characterized by the absence or weak expression of ABH antigens on the surface of red blood cells, but normal expression in saliva. The para-Bombay phenotype of the nine Chinese probands was identified by standard serologic techniques. The coding regions of FUT1 and FUT2 genes were amplified by polymerase chain reaction and then directly sequenced. ABO genotyping was performed by polymerase chain reaction with sequence-specific priming method. The FUT1 and FUT2 genotypes and the distribution in all reported Chinese para-Bombay individuals including our study were also summarized. Five FUT1 genotypes, h1h3 (n = 3), h1h2 (n = 3), h1h1 (n = 1), h3h3 (n = 1), and h2h3 (n = 1), and three functional FUT2 genotypes, Se(357) Se(357) (n = 4), Se(357) Se(357, 716) (n = 4), and Se(357) Se(357, 385) (n = 1) described before were identified in nine probands. The review of the literature shows that a total of 17 FUT1 alleles and four FUT2 alleles (Se(357), Se(357,716), Se(357 385), Se) have been identified in Chinese para-Bombay individuals. The four FUT1 alleles, h1 (547delAG), h2 (880delTT), h3 (C658T), and h4 (C35T; A980C) are most prevalent, which account for more than 90% of all allele counts and are essential to be involved when developing para-Bombay genotyping kit for Chinese. © 2013 American Association of Blood Banks.

  9. [Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified].

    PubMed

    Su, Yu qing; Wei, Tian-li; Yu, Qiong; Liang, Yan-lian; Li, Da-cheng

    2007-10-01

    Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay. Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H. The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status. A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

  10. Case report: epithelial intracytoplasmic herpes viral inclusions associated with an outbreak of duck virus enteritis

    USGS Publications Warehouse

    Barr, B.C.; Jessup, David A.; Docherty, Douglas E.; Lownestine, L.J.

    1992-01-01

    Several muscovy ducks from a free-roaming flock of 65 muscovy and mallard ducks died over a 3-week period. Three muscovy ducks were necropsied. Gross and microscopic changes were compatible with duck virus enteritis, and the virus was isolated. In addition to intranuclear viral inclusion bodies in several tissues, intracytoplasmic inclusion bodies were present in esophageal and cloacal epithelium, By electron microscopy, the membrane-bound intracytoplasmic inclusions were found to contain enveloped herpesvirus, and nuclei contained herpes viral nucleocapsids.

  11. Factors limiting the health of semi-scavenging ducks in Bangladesh.

    PubMed

    Hoque, M A; Skerratt, L F; Cook, A J C; Khan, S A; Grace, D; Alam, M R; Vidal-Diez, A; Debnath, N C

    2011-02-01

    Duck rearing is well suited to coastal and lowland areas in Bangladesh. It is an important component of sustainable livelihood strategies for poor rural communities as an additional source of household income. An epidemiological study was conducted during January 2005-June 2006 on 379 households in Chatkhil of the Noakhali District, Bangladesh which were using the recently devised "Bangladesh duck model". The overall objective of the study was to identify factors that significantly contributed to mortality and constrained productivity and to generate sufficient knowledge to enable establishment of a disease surveillance system for household ducks. The overall mortality was 15.0% in Chatkhil, with predation causing a significantly higher mortality compared with diseases (p < 0.001). Common diseases were duck plague and duck cholera. Morbid ducks frequently displayed signs associated with diseases affecting the nervous and digestive systems. Haemorrhagic lesions in various organs and white multiple foci on the liver were frequently observed in dead ducks. Epidemiological analysis with a shared frailty model that accounted for clustering of data by farm was used to estimate the association between survival time and risk factors. The overall mortality rate due to disease was significantly lower in vaccinated than in non-vaccinated ducks in all zones except zone 2 (p < 0.001). Only vaccinated ducks survived in zone 1. In conclusion, duck mortality and untimely sale of ducks appeared to be important constraints for household duck production in Chatkhil. Vaccination against duck plague appears to be an effective preventive strategy in reducing the level of associated duck mortality. A successful network was established amongst farmers and the surveillance team through which dead ducks, with accompanying information, were readily obtained for analysis. Therefore, there is an opportunity for establishing a long-term disease surveillance programme for rural ducks in Chatkhil

  12. Pathogeny of Fatigued Walking Condition in Pekin Ducks.

    PubMed

    Da Costa, M J; Oviedo-Rondón, E O; Wineland, M; Jeffrey, D

    2016-12-01

    Fatigued walking condition (FWC) in ducks is an important welfare and processing issue during the loading/unloading to the processing plant that can be related to heart and bone development. An experiment was conducted to evaluate the effects of incubation conditions on duck embryo bone and heart development and their subsequent effects on ducks showing FWC at market age. Four groups of 2500 Pekin duck eggs were subjected to combinations of two incubation temperature profiles (elevated [E] and normal [N]) and two eggshell conductance profiles (G) (reduced [GR] and normal [GN]). At hatch 10 ducklings from each treatment combination were sampled for heart, liver, residual yolk, and total body weight as well as relative weights (organ percentage of whole body weight). Femur, tibia, and tarsus length and weight were also obtained, and relative asymmetry (RA) was calculated for each leg section. At 35 days of age during unloading of the truck at the slaughter plant, five hens and five drakes demonstrating normal walking and FWC were sampled. Body, heart, and ventricular weights were obtained along with femur, tibia and tarsus length, weight, and RA. Bone strength was evaluated using a three-point bending test, and tibia ash content was assessed. At hatch duckling bone characteristics and organ weights were found to be primarily affected by GR conditions, while heart development in older ducks was mainly impacted by E incubation temperatures. Tibia and relative weight at 35 days were also increased by GR and E. Fatigued ducks presented heavier tibias with more RA and cortical thickness but lower ash percentage. In conclusion, the changes in bone development during incubation and posthatch life were related to duck FWC presence during transportation to the processing plant.

  13. Formation of heterocyclic amines during cooking of duck meat.

    PubMed

    Liao, G Z; Wang, G Y; Zhang, Y J; Xu, X L; Zhou, G H

    2012-01-01

    Heterocyclic amines (HAs) are an important class of food mutagens and carcinogens produced in meat cooked at high temperature. In the present study, the effects of various cooking methods: boiling, microwave cooking, charcoal-grilling, roasting, deep-frying and pan-frying on the formation of HAs in duck breast were studied. The various HAs formed during cooking were isolated by solid-phase extraction and analysed by HPLC. Results showed that both the varieties and contents of HAs and the cooking loss of duck breast increase along with increasing cooking temperature and time. Pan-fried duck breasts contained the highest amount of total HAs, followed by charcoal-grilling, deep-frying, roasting, microwave cooking and boiling. 9H-pyrido[3,4-b]indole (norharman) and 1-methyl-9H-pyrido[3,4-b]indole (harman) were detected in all of the cooked duck meat, with levels in the range of 0.1-33 ng g⁻¹. 2-Amino-1-methyl-6-phenylimidazo[4,5-f]pyridine (PhIP) was formed easily in duck meat cooked by pan-frying and charcoal-grilling in the range of 0.9-17.8 ng g⁻¹. 2-Amino-3-methylimidazo[4,5-f]quinoline (IQ) was identified in duck meat cooked by charcoal-grilling and pan-frying, in the range of 0.4-4.2 ng g⁻¹. 2-Amino-3,8-dimethyl-imidazo[4,5-f]quinoxaline (MeIQx) was detected in amounts below 4.5 ng g⁻¹ in duck meat cooked by charcoal-grilling, roasting, deep-frying and pan-frying. The other HAs were detected in amounts below 10 ng g⁻¹. Colour development increased with cooking temperature, but no correlation with HAs' content was observed.

  14. Experimental reproduction of an Enterococcus cecorum infection in Pekin ducks.

    PubMed

    Jung, Arne; Metzner, Martin; Köhler-Repp, Dagmar; Rautenschlein, Silke

    2013-12-01

    Enterococcus cecorum (EC) was thus far only known as a pathogen for broilers and broiler breeders. Recently there was evidence of EC field outbreaks in Pekin duck flocks in Germany. In this study we experimentally reproduced an EC infection in Pekin ducks. At 12 days post hatch, groups of Pekin ducks were infected orally, via the thoracic air sac or intravenously with 1.5 × 10(9) colony-forming units (CFU) of EC per bird or via the air sac with 8.5 × 10(5) or 8.5 × 10(7) CFU per bird. Ducks of the intravenously infected group showed 100% mortality after 2 days post infection. The air sac inoculated high-dose group exhibited a mortality rate of 67%. Birds that were infected with 8.5 × 10(5) and 8.5 × 10(7) CFU showed 6.7% mortality after 7 days post infection. Dead birds displayed pneumonia, airsacculitis, pericarditis and splenitis and EC was re-isolated from these organs. Surviving birds of all groups apart from the orally infected ducks demonstrated clinical signs such as huddling, reduced mobility and diarrhoea. Furthermore, they showed gross pathological lesions including airsacculitis and splenitis and lower bodyweights than the control group at necropsy on days 7, 14 and 21 post infection. The present study clearly confirms that EC is pathogenic for Pekin ducks after experimental infection via the intravenous route or the respiratory tract. EC therefore has to be considered as an emerging avian pathogen not only in broilers but also in Pekin ducks.

  15. Constitutive heterochromatin in chromosomes of duck hybrids and goose hybrids.

    PubMed

    Wójcik, E; Smalec, E

    2017-01-01

    Constitutive heterochromatin is a highly condensed fraction of chromatin in chromosomes. It is characterized by a high degree of polymorphism. Heterochromatin is located in the centromeric, telomeric, and interstitial parts of chromosomes. We used the CBG ( C: banding using B: arium hydroxide by G: iemsa) staining technique to identify heterochromatin in chromosomes. Analysis of karyotypes of F1 hybrids resulting from intergeneric hybridization of ducks (A. platyrhynchos × C. moschata) and interspecific crosses of geese (A. anser × A. cygnoides) were used to compare the karyotypes of 2 species of duck and 2 species of geese, as well as to compare the hybrids with the parent species. The localization of C-bands and their size were determined. In the duck hybrid, greater amounts of heterochromatin were noted in the homologous chromosomes from the duck A. platyrhynchos than in the chromosomes from the duck C. moschata. In the goose hybrid more heterochromatin was observed in the homologous chromosomes from the goose A. cygnoides than in the chromosomes from the goose A. anser. Comparison of chromosomes from the duck hybrid with chromosomes of the ducks A. platyrhynchos and C. moschata revealed nearly twice as much constitutive heterochromatin in the chromosomes of the hybrid. When chromosomes from the goose hybrid were compared with those of the geese A. anser and A. cygnoides, differences in the average content of heterochromatin were observed on only a few chromosomes. © 2016 Poultry Science Association Inc.

  16. Pathogenicity of two Egyptian H5N1 highly pathogenic avian influenza viruses in domestic ducks

    USDA-ARS?s Scientific Manuscript database

    Domestic ducks have been implicated in the dissemination and evolution of H5N1 highly pathogenic avian influenza (HPAI) viruses. Interestingly, the pathogenicity of H5N1 HPAI viruses in domestic ducks has increased over time with some viruses producing 100% mortality in ducks. These changes in vir...

  17. 50 CFR 21.54 - Control order for muscovy ducks in the United States.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 9 2012-10-01 2012-10-01 false Control order for muscovy ducks in the... and Otherwise Injurious Birds § 21.54 Control order for muscovy ducks in the United States. (a) Control of muscovy ducks. Anywhere in the contiguous United States except in Hidalgo, Starr, and Zapata...

  18. Duck liver-associated outbreak of Campylobacteriosis among humans, United Kingdom, 2011.

    PubMed

    Abid, Muhammad; Wimalarathna, Helen; Mills, Janette; Saldana, Luisa; Pang, Winnie; Richardson, Judith F; Maiden, Martin C J; McCarthy, Noel D

    2013-08-01

    Campylobacter- spp.-related gastroenteritis in diners at a catering college restaurant was associated with consumption of duck liver pâté. Population genetic analysis indicated that isolates from duck samples were typical of isolates from farmed poultry. Campylobacter spp. contamination of duck liver may present a hazard similar to the increasingly recognized contamination of chicken liver.

  19. Influence of raised plastic floors compared with pine shaving litter on environment and Pekin duck condition.

    PubMed

    Karcher, D M; Makagon, M M; Fraley, G S; Fraley, S M; Lilburn, M S

    2013-03-01

    Commercial poultry production management practices have been under increased public scrutiny driven by concerns for food safety and animal welfare. Within the United States, wood shavings and raised plastic floors are common flooring systems used in duck production. It is intuitive that each flooring type would present different management challenges influencing physical characteristics of growing ducks. This study evaluated the relationship between flooring type and duck condition during the winter. Random samples of 20 ducks from 5 predetermined areas (n = 100) were examined in commercial duck houses (n = 9, litter; n = 11, raised plastic slats). Ducks were assessed at 7, 21, and 32 d of age for eye, nostril, and feather cleanliness, feather and foot pad quality, and gait. The data were analyzed to determine the proportion of ducks with a given score. In both housing types, the proportion of 0 scores for foot pad quality improved during the production cycle (P < 0.0001). Feather hygiene declined with age in ducks reared on litter flooring, whereas ducks reared on slatted flooring had cleaner feathers at d 32 (P < 0.011). With the exception of foot pad scores, the majority of ducks had no detectable problems for any single trait. The only main effect due to flooring pertained to feather quality with the proportion of ducks having a 0 or 1 score greater in litter flooring systems than slats (P < 0.05). Overall, the condition of ducks reared, regardless of flooring system, was considered to be good.

  20. The biological control of Pomacea canaliculata population by rice-duck mutualism in paddy fields

    Treesearch

    Kiang Liang; Jia-en Zhang; Li Fang; Benliang Zaho; Mingzhu Luo; Prem Parajuli; Ying Ouyang

    2013-01-01

    Duck has been used as a non-chemical control method against Pomacea canaliculata Lamarck, but little is known about its principles that underlie the control of snail populations. An indoor experiment was initially used to observe the predation potential of ducks, followed by replicated field trials. In the indoor studies, ducks effectively preyed on...

  1. Epitope Identification and Application for Diagnosis of Duck Tembusu Virus Infections in Ducks.

    PubMed

    Li, Chenxi; Liu, Junyan; Shaozhou, Wulin; Bai, Xiaofei; Zhang, Qingshan; Hua, Ronghong; Liu, Jyung-Hurng; Liu, Ming; Zhang, Yun

    2016-11-10

    Duck Tembusu virus (DTMUV) causes substantial egg drop disease. DTMUV was first identified in China and rapidly spread to Malaysia and Thailand. The antigenicity of the DTMUV E protein has not yet been characterized. Here, we investigated antigenic sites on the E protein using the non-neutralizing monoclonal antibodies (mAbs) 1F3 and 1A5. Two minimal epitopes were mapped to (221)LD/NLPW(225) and (87)YAEYI(91) by using phage display and mutagenesis. DTMUV-positive duck sera reacted with the epitopes, thus indicating the importance of the minimal amino acids of the epitopes for antibody-epitope binding. The performance of the dot blotting assay with the corresponding positive sera indicated that YAEYI was DTMUV type-specific, whereas (221)LD/NLPW(225) was a cross-reactive epitope for West Nile virus (WNV), dengue virus (DENV), and Japanese encephalitis virus (JEV) and corresponded to conserved and variable amino acid sequences among these strains. The structure model of the E protein revealed that YAEYI and LD/NLPW were located on domain (D) II, which confirmed that DII might contain a type-specific non-neutralizing epitope. The YAEYI epitope-based antigen demonstrated its diagnostic potential by reacting with high specificity to serum samples obtained from DTMUV-infected ducks. Based on these observations, a YAEYI-based serological test could be used for DTMUV surveillance and could differentiate DTMUV infections from JEV or WNV infections. These findings provide new insights into the organization of epitopes on flavivirus E proteins that might be valuable for the development of epitope-based serological diagnostic tests for DTMUV.

  2. Epitope Identification and Application for Diagnosis of Duck Tembusu Virus Infections in Ducks

    PubMed Central

    Li, Chenxi; Liu, Junyan; Shaozhou, Wulin; Bai, Xiaofei; Zhang, Qingshan; Hua, Ronghong; Liu, Jyung-Hurng; Liu, Ming; Zhang, Yun

    2016-01-01

    Duck Tembusu virus (DTMUV) causes substantial egg drop disease. DTMUV was first identified in China and rapidly spread to Malaysia and Thailand. The antigenicity of the DTMUV E protein has not yet been characterized. Here, we investigated antigenic sites on the E protein using the non-neutralizing monoclonal antibodies (mAbs) 1F3 and 1A5. Two minimal epitopes were mapped to 221LD/NLPW225 and 87YAEYI91 by using phage display and mutagenesis. DTMUV-positive duck sera reacted with the epitopes, thus indicating the importance of the minimal amino acids of the epitopes for antibody-epitope binding. The performance of the dot blotting assay with the corresponding positive sera indicated that YAEYI was DTMUV type-specific, whereas 221LD/NLPW225 was a cross-reactive epitope for West Nile virus (WNV), dengue virus (DENV), and Japanese encephalitis virus (JEV) and corresponded to conserved and variable amino acid sequences among these strains. The structure model of the E protein revealed that YAEYI and LD/NLPW were located on domain (D) II, which confirmed that DII might contain a type-specific non-neutralizing epitope. The YAEYI epitope-based antigen demonstrated its diagnostic potential by reacting with high specificity to serum samples obtained from DTMUV-infected ducks. Based on these observations, a YAEYI-based serological test could be used for DTMUV surveillance and could differentiate DTMUV infections from JEV or WNV infections. These findings provide new insights into the organization of epitopes on flavivirus E proteins that might be valuable for the development of epitope-based serological diagnostic tests for DTMUV. PMID:27834908

  3. Characterization of duck H5N1 influenza viruses with differing pathogenicity in mallard (Anas platyrhynchos) ducks.

    PubMed

    Tang, Yinghua; Wu, Peipei; Peng, Daxin; Wang, Xiaobo; Wan, Hongquan; Zhang, Pinghu; Long, Jinxue; Zhang, Wenjun; Li, Yanfang; Wang, Wenbin; Zhang, Xiaorong; Liu, Xiufan

    2009-12-01

    A number of H5N1 influenza outbreaks have occurred in aquatic birds in Asia. As aquatic birds are the natural reservoir of influenza A viruses and do not usually show clinical disease upon infection, the repeated H5N1 outbreaks have highlighted the importance of continuous surveillance on H5N1 viruses in aquatic birds. In the present study we characterized the biological properties of four H5N1 avian influenza viruses, which had been isolated from ducks, in different animal models. In specific pathogen free (SPF) chickens, all four isolates were highly pathogenic. In SPF mice, the S and Y isolates were moderately pathogenic. However, in mallard ducks, two isolates had low pathogenicity, while the other two were highly pathogenic and caused lethal infection. A representative isolate with high pathogenicity in ducks caused systemic infection and replicated effectively in all 10 organs tested in challenged ducks, whereas a representative isolate with low pathogenicity in ducks was only detected in some organs in a few challenged ducks. Comparison of complete genomic sequences from the four isolates showed that the same amino acid residues that have been reported to be associated with virulence and host adaption/restriction of influenza viruses were present in the PB2, HA, NA, M and NS genes, while the amino acid residues at the HA cleavage site were diverse. From these results it appeared that the virulence of H5N1 avian influenza viruses was increased for ducks and that amino acid substitutions at the HA cleavage site might have contributed to the differing pathogenicity of these isolates in mallards. A procedure for the intravenous pathogenicity index test in a mallard model for assessing the virulence of H5/H7 subtype avian influenza viruses in waterfowl is described.

  4. Quantitation of mule duck in goose foie gras using TaqMan real-time Polymerase Chain Reaction.

    PubMed

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Hernández, Pablo E; Martín, Rosario

    2004-03-24

    A real-time quantitative Polymerase Chain Reaction (PCR) method has been developed for the quantitation of mule duck (Anas platyrhynchos x Cairina moschata) in binary duck/goose foie gras mixtures. The method combines the use of real-time PCR with duck-specific and endogenous control "duck + goose" primers to measure duck content and total foie gras content, respectively. Both PCR systems (duck-specific and duck + goose) were designed on the mitochondrial 12S ribosomal RNA gene (rRNA). The duck-specific system amplifies a 96 bp fragment from duck DNA, whereas the duck + goose system amplifies a 120 bp fragment from duck and goose DNA. The method measures PCR product accumulation through a FAM-labeled fluorogenic probe (TaqMan). The C(t) (threshold cycle) values obtained from the duck + goose system are used to normalize the ones obtained from the duck-specific system. Analysis of experimental duck/goose foie gras binary mixtures demonstrated the suitability of the assay for the detection and quantitation of duck in the range of 1-25%. This genetic marker can be very useful to avoid mislabeling or fraudulent species substitution of goose by duck in foie gras.

  5. A homogenous nature of native Chinese duck matrilineal pool

    PubMed Central

    2008-01-01

    Background China, with around 30 unique breeds, has a diverse duck genetic pool. Currently, there is no systematic report which investigates the genetic diversity, phylogenetic relationship, and matrilineal genetic structure of these domestic breeds and wild mallards (Anas platyrhynchos). Results In this study, we sequenced the mitochondrial DNA (mtDNA) control region segments in 278 domestic ducks (Anas platyrhynchos domestica) from 19 indigenous breeds/populations and 70 wild mallard samples and analyzed them together with the 101 control region sequences from published sources. Fifty-two samples were then sequenced for a cytochrome b (Cyt b) gene fragment to solidify the pattern emerged from the control region sequences. All domestic duck and wild mallard haplotypes were essentially indistinguishable and were clustered together in the phylogenetic tree. There was no geographic differentiation and breed/population-specific distribution of duck lineages. Conclusion Our results showed that unlike other domesticated farm animals in China such as chicken, cattle, goat, and yak with multiple matrilineal components, the matrilineal pool of Chinese ducks was homogenous. PMID:18957137

  6. Techniques for establishing local breeding populations of wood ducks

    USGS Publications Warehouse

    Doty, H.A.; Kruse, A.D.

    1972-01-01

    A study was conducted on the Arrowwood National Wildlife Refuge in east-central North Dakota to further evaluate a technique for establishing nesting wood ducks (Aix sponsa) by releasing propagated birds and installing nest houses. No wood duck nesting had been recorded previously in the area. During May-July 1968, 253 ducklings, hand-reared at the Northern Prairie Wildlife Research Center near Jamestown, North Dakota, were released when 9 to 16 days old into a 0.5-acre enclosure on the refuge, where they grew to flight stage and departed. Seventy-eight nest houses were installed in August on the refuge. About 76 percent of the ducks survived until late September, when southward migration began. The first-year band recovery rate by hunters of 4.7 percent was comparable to that of wild immature wood ducks. Most recoveries occurred between North Dakota and Minnesota in the north and Texas and Louisiana in the south. There were 16 nesting attempts, which produced 175 ducklings, by homing female wood ducks in the boxes in 1969. The number of nesting attempts increased to 34 in 1970, with a production of 311 ducklings.

  7. High duck nesting success in a predator-reduced environment

    USGS Publications Warehouse

    Duebbert, H.F.; Lokemoen, J.T.

    1980-01-01

    Duck nesting and production were studied during 1969-74 on a 51-ha field of undisturbed grass-legume cover and a surrounding 8.13-km2 area in north-central South Dakota. The principal mammalian predators of ducks were reduced within a 259-km2 zone from May 1969 through August 1971. Dabbling duck nest densities, hatching success, and breeding populations attained high levels. Seven duck species produced 1,062 nests on the 51-ha field during 6 years, 864 (81%) hatched, 146 (14%) were destroyed, and 52 (5%) had other fates. During 1970-72, when predator reduction was most effective, the hatching success for 756 nests was 94%. The number of mallard (Anas platyrhynchos) nests increased from 37 (0.7/ha) in 1969 to 181 (3.5/ha) in 1972. Mallard pairs increased from 2.8/km2 to 16.8/km2 on the 8.13-km2 area during the same period. A minimum of 7,250 ducklings hatched on the 51-ha field during the 6 years, including 2,342 ducklings in 1972. Exceptionally high duck nesting densities and hatching rates occurred when predators were controlled.

  8. Zoonotic echinostome infections in free-grazing ducks in Thailand.

    PubMed

    Saijuntha, Weerachai; Duenngai, Kunyarat; Tantrawatpan, Chairat

    2013-12-01

    Free-grazing ducks play a major role in the rural economy of Eastern Asia in the form of egg and meat production. In Thailand, the geographical location, tropical climate conditions and wetland areas of the country are suitable for their husbandry. These environmental factors also favor growth, multiplication, development, survival, and spread of duck parasites. In this study, a total of 90 free-grazing ducks from northern, central, and northeastern regions of Thailand were examined for intestinal helminth parasites, with special emphasis on zoonotic echinostomes. Of these, 51 (56.7%) were infected by one or more species of zoonotic echinostomes, Echinostoma revolutum, Echinoparyphium recurvatum, and Hypoderaeum conoideum. Echinostomes found were identified using morphological criteria when possible. ITS2 sequences were used to identify juvenile and incomplete worms. The prevalence of infection was relatively high in each region, namely, north, central, and northeast region was 63.2%, 54.5%, and 55.3%, respectively. The intensity of infection ranged up to 49 worms/infected duck. Free-grazing ducks clearly play an important role in the life cycle maintenance, spread, and transmission of these medically important echinostomes in Thailand.

  9. Duck harvest on public hunting areas in California

    USGS Publications Warehouse

    Gilmer, D.S.; Hicks, J.M.; Fleskes, J.P.; Connelly, D.P.

    1989-01-01

    We summarized hunter visits and success, and the magnitude and species composition of the duck harvest recorded on California public hunting areas (PHAs) during 1950-87. Hunter visits and harvest increased during 1950-74 as new PHAs were added, then declined concurrently with duck populations. Of six geographic regions, the Sacramento Valley, with numerous PHAs and the largest duck concentrations, accounted for the largest portion of PHA hunter visits (28%) and harvest (35%). Duck population levels, regulations, and hunter numbers affected PHA hunter success. Success was highest during 1955-59 but declined with no consistent trend after 1960. Species vulnerability, abundance, distribution, and hunter preference affected harvest composition. Northern pintails, Anas acuta, averaged 27% of the PHA harvest but declined in importance after 1974. Green-winged teal, A. crecca, the most important species in southern regions, averaged 21% of the PHA harvest. Mallards, A. platyrhynchos, averaged 16% of the PHA harvest but increased in importance after 1974 to become the most common duck bagged after 1983. PHA harvest comprised a small (4-16%) portion of the total state harvest. However, this portion increased from 1950-70 because of increased hunter visits to new PHAs and after 1970 because hunter success on PHAs did not decline as on other areas. PHA hunters tended to harvest fewer preferred species and more vulnerable species, as proportions of total bag, than did other hunters. The continued decline in numbers of waterfowl hunters presents important challenges for management of waterfowl areas in California.

  10. Zoonotic Echinostome Infections in Free-Grazing Ducks in Thailand

    PubMed Central

    Saijuntha, Weerachai; Duenngai, Kunyarat

    2013-01-01

    Free-grazing ducks play a major role in the rural economy of Eastern Asia in the form of egg and meat production. In Thailand, the geographical location, tropical climate conditions and wetland areas of the country are suitable for their husbandry. These environmental factors also favor growth, multiplication, development, survival, and spread of duck parasites. In this study, a total of 90 free-grazing ducks from northern, central, and northeastern regions of Thailand were examined for intestinal helminth parasites, with special emphasis on zoonotic echinostomes. Of these, 51 (56.7%) were infected by one or more species of zoonotic echinostomes, Echinostoma revolutum, Echinoparyphium recurvatum, and Hypoderaeum conoideum. Echinostomes found were identified using morphological criteria when possible. ITS2 sequences were used to identify juvenile and incomplete worms. The prevalence of infection was relatively high in each region, namely, north, central, and northeast region was 63.2%, 54.5%, and 55.3%, respectively. The intensity of infection ranged up to 49 worms/infected duck. Free-grazing ducks clearly play an important role in the life cycle maintenance, spread, and transmission of these medically important echinostomes in Thailand. PMID:24516271

  11. Food habits of diving ducks in the Carolinas

    USGS Publications Warehouse

    Perry, M.C.; Uhler, F.M.

    1982-01-01

    Food habits analyses were conducted on 264 diving ducks (7 species) from North and South Carolina during the 1970'S. The Baltic clam (Macoma balthica) was the predominant food among canvasbacks (Aythya valisineria) from the Pamlico River area, whereas sago pondweed (Potamogeton pectinatus) predominated in birds from impoundments in North and South Carolina. Shoalgrass (Halodule beaudettei) formed 100% of the gullet food and 99% of the gizzard food in redheads (Aythya americana) from Pamlico Sound. Lesser scaup (Aythya affinis) in North Carolina had fed predominantly on mollusks (Mulinia lateralis and Rangia cuneata), whereas widgeon grass (Ruppia maritima) was the predominant food in birds from South Carolina. In North Carolina, ring-necked ducks (Aythya collaris) fed mainly on vegetation, and greater scaup (Aythya marila), bufflehead (Bucephala albeola), and ruddy ducks (Oxyura jamaicensis) fed mainly on Mulinia lateralis. Food habits data from this study when compared with historical food habits of these species indicate that most diving duck species were feeding more on invertebrates and less on submerged aquatic vegetation than in the past. North and South Carolina have a diverse food supply and appear to offer waterfowl adequate wintering habitat based on these food habits studies. Present trends in wintering habitat, however, could adversely affect diving duck populations in the future.

  12. Hydropericardium Hepatitis Syndrome Emerged in Cherry Valley Ducks in China.

    PubMed

    Chen, H; Dou, Y; Zheng, X; Tang, Y; Zhang, M; Zhang, Y; Wang, Z; Diao, Y

    2017-08-01

    Since June 2015, a highly pathogenic disease occurred in duck flocks in China, causing pericardial effusion, enlarged discoloured liver, renal enlargement and haemorrhagic lung with a mortality ranging from 5% to 20%. Previous study confirmed that Fowl adenovirus group C (FAdV-C) and some field FAdVs isolates had been identified as causative agents of hydropericardium hepatitis syndrome (HHS) in chickens and geese world widely. In this study, we firstly report the isolation of FAdV-C from ducks with HHS. The two isolates, designated as SDSX and SDJX, were separated from liver samples using 9-day-old SPF chicken embryos and could cause severe cytopathic effects in duck and chicken embryonic kidney cells. The entire ORF sequences of hexon gene of the two isolates were amplified, sequenced and analysed by restriction fragment length polymorphism. Phylogenetic analysis of loop 1 sequences of hexon gene of FAdVs revealed that the two isolates were closely related to FAdV-C isolates, which could cause HHS in chickens. Experimental infection indicated that the isolate was high pathogenicity to 20-day-old ducks. Our study shows that the recently emerged HHS in ducks was caused by FAdV-C and may possess a potential risk to other poultry flocks. © 2016 Blackwell Verlag GmbH.

  13. Cloning and expression of Tsaiya duck liver fatty acid binding protein.

    PubMed

    Ko, Y H; Cheng, C H; Shen, T F; Ding, S T

    2004-11-01

    Liver basic fatty acid (FA)-binding protein (Lb-FABP) cDNA was cloned from the livers of laying Tsaiya ducks and used to generate probes for quantification of the Lb-FABP mRNA in Tsaiya ducks. The full-length Lb-FABP cDNA of the Tsaiya duck was highly homologous with that of the mallard (99%), chicken (88%), and iguana (73%). The amino acid sequence was also highly homologous to Lb-FABP found in birds and reptiles, indicating a similar function of the Tsaiya duck Lb-FABP to those species. The calculated molecular weight for the cloned duck Lb-FABP was 14,043g/mol. The Lb-FABP was highly expressed in the liver of laying Tsaiya ducks and not detectable in heart, ovary, intestine, or adipose tissues. The expression of Tsaiya duck Lb-FABP in the skeletal muscle was also detected, and the sequence was confirmed. The greater expression of the hepatic Lb-FABP in the egg-laying Tsaiya ducks than the prelaying ducks paralleled the higher FA use by the laying ducks. These results suggest that hepatic Lb-FABP may be needed for egg production when FA metabolism is high for the ducks. Feeding laying Tsaiya ducks with diets enriched with 2% docosahexaenoic acid (DHA) oil for 2 wk significantly increased hepatic DHA content compared with in ducks fed a 2% butter basal diet. There was no effect of dietary DHA enrichment on the expression of Lb-FABP in the liver of Tsaiya ducks. The results suggest that even though the Lb-FABP may be involved in hepatic FA metabolism, the effect of individual FA on liver Lb-FABP in laying Tsaiya ducks needs to be further studied.

  14. Sequence of events in natural infection of Pekin duck embryos with duck hepatitis B virus.

    PubMed Central

    Urban, M K; O'Connell, A P; London, W T

    1985-01-01

    The major mode of natural infection of duck hepatitis B virus (DHBV) in Pekin ducks is vertical transmission, with 95 to 100% of the embryos from DHBV-infected dams eventually becoming infected. Maternally transmitted virus is present in large quantities in the yolk of unincubated eggs and is taken up by the embryo during early development. Synthesis of DHBV DNA in the embryo begins at about 6 days of incubation and coincides with the formation of the liver. DHBV DNA synthesis is incomplete, however, until 8 to 10 days of incubation, as shown by comparing the electrophoretic patterns of DHBV-specific nucleic acid species from embryonic livers at successive stages of development. From 8 days of incubation and continuing throughout embryonic development, subviral particles, which resemble viral replication intermediates isolated from infected livers of post-hatch ducklings, appear in the circulation. These particles contain a polymerase activity that utilizes an RNA template to synthesize viral DNA. Our results suggest that certain host functions, which appear during embryonic development, may be required for DHBV replication and assembly. It is possible that in mammals a similar developmental process occurs. The failure to find human hepatitis B virus in the circulation of most babies, born to hepatitis B virus carrier women, in the first few weeks after birth may reflect such a process. Images PMID:4009791

  15. Quantitative Proteomic Analysis of Duck Ovarian Follicles Infected with Duck Tembusu Virus by Label-Free LC-MS

    PubMed Central

    Han, Kaikai; Zhao, Dongmin; Liu, Yuzhuo; Liu, Qingtao; Huang, Xinmei; Yang, Jing; An, Fengjiao; Li, Yin

    2016-01-01

    Duck Tembusu virus (DTMUV) is a newly emerging pathogenic flavivirus that has caused massive economic losses to the duck industry in China. DTMUV infection mainly results in significant decreases in egg production in egg-laying ducks within 1–2 weeks post infection. However, information on the comparative protein expression of host tissues in response to DTMUV infection is limited. In the present study, the cellular protein response to DTMUV infection in duck ovarian follicles was analyzed using nano-flow high-performance liquid chromatography-electrospray tandem mass spectrometry. Quantitative proteomic analysis revealed 131 differentially expressed proteins, among which 53 were up regulated and 78 were down regulated. The identified proteins were involved in the regulation of essential processes such as cellular structure and integrity, RNA processing, protein biosynthesis and modification, vesicle transport, signal transduction, and mitochondrial pathway. Some selected proteins that were found to be regulated in DTMUV-infected tissues were screened by quantitative real-time PCR to examine their regulation at the transcriptional level, western blot analysis was used to validate the changes of some selected proteins on translational level. To our knowledge, this study is the first to analyze the proteomic changes in duck ovarian follicles following DTMUV infection. The protein-related information obtained in this study may be useful to understand the host response to DTMUV infection and the inherent mechanism of DTMUV replication and pathogenicity. PMID:27066001

  16. The pathogenesis of duck virus enteritis in experimentally infected ducks: a quantitative time-course study using TaqMan polymerase chain reaction.

    PubMed

    Xuefeng, Qi; Xiaoyan, Yang; Anchun, Cheng; Mingshu, Wang; Dekang, Zhu; Renyong, Jia

    2008-06-01

    Duck virus enteritis is an acute and contagious herpesvirus infection of duck, geese and swans with high morbidity and mortality. The kinetics of viral DNA loads and immunohistochemical localization of virulent duck enteritis virus, as well as histopathological examination in various tissues of ducks following oral infection, were investigated. The time course for the appearance of viral antigen and tissue lesions in various tissues was coincident with the levels of duck enteritis virus at the various sites, suggesting that the levels of duck enteritis virus in systemic organs have a close correlation with the progression of disease. The abundance of target epithelial and lymphoid cells may contribute to the high levels of virus infection and replication in lymphoid and intestinal tissues.

  17. Lack of association among duck broodmates during migration and wintering

    USGS Publications Warehouse

    Martinson, R.K.; Hawkins, A.S.

    1968-01-01

    Male (Lensink, 1964: 19) and female ducks tend to return to the area where they last bred or were raised (Sowles, 1955). Band recovery data show a similar tendency for ducks to return to wintering areas (Stewart et al., 1958; Martinson, 1966). Wintering British Columbia Mallard (Anas platyrhynchos) populations may be definite associations of birds that breed in the same general locality, migrate together, and use the same wintering area (Munro, 1943). On the other hand Gollop (1965: 36-37) showed that Mallards reared in Saskatchewan or breeding there re- turned in subsequent years, but "neither migrated nor wintered as definite associations." He based his conclusions on recovery data from groups of Mallards banded on the same slough and from broodmates. His data showed, by date or area of recovery, that the birds migrated independently and sometimes to different wintering localities. This paper presents additional data suggesting that ducks banded as brood- mates may migrate independently.

  18. Hematozoa of wood ducks (Aix spons) in the Atlantic flyway.

    PubMed

    Thul, J E; Forrester, D J; Greiner, E C

    1980-07-01

    A total of 213 wood ducks (Aix sponsa) from 24 localities in 12 states in the Atlantic Flyway was examined for blood parasites in 1976 and 1977. Hematozoa were present in birds from every collection site from Virginia northward to Maine. Only one infection was detected in birds from North Carolina southward to Florida. Haemoproteus nettionis was the most common parasite, occurring in 56% of the northern wood ducks; Leucocytozoon simondi (20%), Plasmodium circumflexum (6%), and microfilariae (18%) were found also. Plasmodium, Leucocytozoon, and microfilariae were more commonly observed in juvenile birds than adults. There was no difference in prevalence between male and female ducks. The prevalence of each parasite species varied among collection sites in the northern states.

  19. Hematozoa of wood ducks (Aix sponsa) in Missouri.

    PubMed

    O'Dell, J P; Robbins, L W

    1994-01-01

    We examined 371 wood ducks (Aix sponsa) for hematozoa from two localities in Missouri (USA) in 1989 and 1990. Thirty-seven (10%) harbored one or more species of blood parasites. Haemoproteus nettionis was the most common parasite, occurring in 36 (10%) of the birds. Leucocytozoon simondi was found in two (0.5%) and microfilaria occurred in five (1%) of the wood ducks examined. Infections were more prevalent in adults (18%) than in immature birds (2%). There was no difference in prevalence between sex, location, or year. Based on seasonal prevalence, transmission probably did not occur at either location in the summer. Increased prevalence in the winter samples occurred after northern wood ducks migrated into the sample areas.

  20. Free-grazing ducks and highly pathogenic avian influenza, Thailand.

    PubMed

    Gilbert, Marius; Chaitaweesub, Prasit; Parakamawongsa, Tippawon; Premashthira, Sith; Tiensin, Thanawat; Kalpravidh, Wantanee; Wagner, Hans; Slingenbergh, Jan

    2006-02-01

    Thailand has recently had 3 epidemic waves of highly pathogenic avian influenza (HPAI); virus was again detected in July 2005. Risk factors need to be identified to better understand disease ecology and assist HPAI surveillance and detection. This study analyzed the spatial distribution of HPAI outbreaks in relation to poultry, land use, and other anthropogenic variables from the start of the second epidemic wave (July 2004-May 2005). Results demonstrate a strong association between H5N1 virus in Thailand and abundance of free-grazing ducks and, to a lesser extent, native chickens, cocks, wetlands, and humans. Wetlands used for double-crop rice production, where free-grazing duck feed year round in rice paddies, appear to be a critical factor in HPAI persistence and spread. This finding could be important for other duck-producing regions in eastern and southeastern Asian countries affected by HPAI.

  1. Movements of flightless long-tailed ducks during wing molt

    USGS Publications Warehouse

    Flint, P.L.; Lacroix, D.L.; Reed, J.A.; Lanctot, Richard B.

    2004-01-01

    We examined the movements of flightless Long-tailed Ducks (Clangula hyemalis) during the wing molt in the near-shore lagoons of the Beaufort Sea in Alaska. Estimates of site fidelity during the 21-day flightless period ranged from 1-100%, with considerable variation among locations and within locations among years. There was no effect of low-level experimental disturbance or an underwater seismic survey on site fidelity of molting Long-tailed Ducks. Birds molting along a relatively consistent habitat gradient were more likely to move than those molting in a fragmented habitat. While flocks of birds are consistently observed in the same locations, these data suggest considerable turnover within these aggregations. These results, in conjunction with other studies, suggest that forage is relatively uniformly distributed within lagoons. We conclude that habitat selection by molting Long-tailed Ducks is likely influenced by protection from wind and associated waves.

  2. [Molecular genetic diversity of Fujian domestic duck breeds].

    PubMed

    Li, Hui-fang; Li, Bi-chun; Ma, Yue-hui; Tang, Qing-ping; Chen, Kuan-wei; Tu, Yun-jie

    2007-02-01

    By using 28 micro-satellite markers with better polymorphism, this paper studied the genetic diversity of four Fujian provincial domestic duck breeds Jinding, Putian black, Liancheng white, and Shanma. According to the alleles frequencies, the polymorphic information content, average heterozygosity, anaqular genetic distance (DA) and Nei' s standard genetic distance (DS) for each breed were calculated. Based on DA and DS, four dendrograms were obtained by neighbor-joining (NJ) and UPGMA methods. The results showed that the average heterozygosity of the four duck breeds was 0. 5353, indicating that the protection of the genetic diversity of these breeds should be strengthened. The orders of the two types of genetic distances among the breeds were accordant, and the dendrograms were the same, reflecting that much more micro-satellite loci should be adopted to obtain more universal conclusions when the genetic diversity was analyzed. The phylogenetic relationships among the four duck breeds were in accordance with their economic types and ecological localities.

  3. Free-grazing Ducks and Highly Pathogenic Avian Influenza, Thailand

    PubMed Central

    Chaitaweesub, Prasit; Parakamawongsa, Tippawon; Premashthira, Sith; Tiensin, Thanawat; Kalpravidh, Wantanee; Wagner, Hans; Slingenbergh, Jan

    2006-01-01

    Thailand has recently had 3 epidemic waves of highly pathogenic avian influenza (HPAI); virus was again detected in July 2005. Risk factors need to be identified to better understand disease ecology and assist HPAI surveillance and detection. This study analyzed the spatial distribution of HPAI outbreaks in relation to poultry, land use, and other anthropogenic variables from the start of the second epidemic wave (July 2004–May 2005). Results demonstrate a strong association between H5N1 virus in Thailand and abundance of free-grazing ducks and, to a lesser extent, native chickens, cocks, wetlands, and humans. Wetlands used for double-crop rice production, where free-grazing duck feed year round in rice paddies, appear to be a critical factor in HPAI persistence and spread. This finding could be important for other duck-producing regions in eastern and southeastern Asian countries affected by HPAI. PMID:16494747

  4. Proteomic profile evolution during steatosis development in ducks.

    PubMed

    Bax, M L; Chambon, C; Marty-Gasset, N; Remignon, H; Fernandez, X; Molette, C

    2012-01-01

    We investigated a protein profile evolution during steatosis in ducks using 2-dimensional electrophoresis gels to better understand the mechanisms underlying liver steatosis at the level of hepatic proteins in waterfowl. Two-dimensional electrophoresis gels were performed in the liver at different stages of steatosis in the duck. Mule ducks were slaughtered after 0, 14, or 23 meals of overfeeding, according to commercial conditions. Thirty-one proteic spots were differentially expressed between 3 or 2 durations of overfeeding: 3 spots were differentially expressed between the 3 times and 28 spots were differentially expressed between 2 times. The identified proteins (14) could be regrouped into 5 categories: enzymes, translation factors, proteins involved in cell structure, proteins with antioxidant properties, and proteins that can link calcium. This study opens new research areas in the understanding of steatosis in waterfowl, such as cell structure and oxidative stress.

  5. Archiving California’s historical duck nesting data

    USGS Publications Warehouse

    Ackerman, Joshua T.; Herzog, Mark P.; Brady, Caroline; Eadie, John M.; Yarris, Greg S.

    2015-07-14

    With the conclusion of this project, most duck nest data have been entered, but all nest-captured hen data and other breeding waterfowl data that were outside the scope of this project have still not been entered and electronically archived. Maintaining an up-to-date archive will require additional resources to archive and enter the new duck nest data each year in an iterative process. Further, data proofing should be conducted whenever possible, and also should be considered an iterative process as there was sometimes missing data that could not be filled in without more direct knowledge of specific projects. Despite these disclaimers, this duck data archive represents a massive and useful dataset to inform future research and management questions.

  6. Increased body mass of ducks wintering in California's Central Valley

    USGS Publications Warehouse

    Fleskes, Joseph P.; Yee, Julie L.; Yarris, Gregory S.; Loughman, Daniel L.

    2016-01-01

    Waterfowl managers lack the information needed to fully evaluate the biological effects of their habitat conservation programs. We studied body condition of dabbling ducks shot by hunters at public hunting areas throughout the Central Valley of California during 2006–2008 compared with condition of ducks from 1979 to 1993. These time periods coincide with habitat increases due to Central Valley Joint Venture conservation programs and changing agricultural practices; we modeled to ascertain whether body condition differed among waterfowl during these periods. Three dataset comparisons indicate that dabbling duck body mass was greater in 2006–2008 than earlier years and the increase was greater in the Sacramento Valley and Suisun Marsh than in the San Joaquin Valley, differed among species (mallard [Anas platyrhynchos], northern pintail [Anas acuta], America wigeon [Anas americana], green-winged teal [Anas crecca], and northern shoveler [Anas clypeata]), and was greater in ducks harvested late in the season. Change in body mass also varied by age–sex cohort and month for all 5 species and by September–January rainfall for all except green-winged teal. The random effect of year nested in period, and sometimes interacting with other factors, improved models in many cases. Results indicate that improved habitat conditions in the Central Valley have resulted in increased winter body mass of dabbling ducks, especially those that feed primarily on seeds, and this increase was greater in regions where area of post-harvest flooding of rice and other crops, and wetland area, has increased. Conservation programs that continue to promote post-harvest flooding and other agricultural practices that benefit wintering waterfowl and continue to restore and conserve wetlands would likely help maintain body condition of wintering dabbling ducks in the Central Valley of California.

  7. Modelling the distribution of domestic ducks in Monsoon Asia

    PubMed Central

    Van Boeckel, Thomas P; Prosser, Diann; Franceschini, Gianluca; Biradar, Chandra; Wint, William; Robinson, Tim; Gilbert, Marius

    2011-01-01

    Domestic ducks are considered to be an important reservoir of highly pathogenic avian influenza (HPAI), as shown by a number of geospatial studies in which they have been identified as a significant risk factor associated with disease presence. Despite their importance in HPAI epidemiology, their large-scale distribution in monsoon Asia is poorly understood. In this study, we created a spatial database of domestic duck census data in Asia and used it to train statistical distribution models for domestic duck distributions at a spatial resolution of 1 km. The method was based on a modelling framework used by the Food and Agriculture Organisation to produce the Gridded Livestock of the World (GLW) database, and relies on stratified regression models between domestic duck densities and a set of agro-ecological explanatory variables. We evaluated different ways of stratifying the analysis and of combining the prediction to optimize the goodness of fit of the predictions. We found that domestic duck density could be predicted with reasonable accuracy (mean RMSE and correlation coefficient between log-transformed observed and predicted densities being 0.58 and 0.80, respectively), using a stratification based on livestock production systems. We tested the use of artificially degraded data on duck distributions in Thailand and Vietnam as training data, and compared the modelled outputs with the original high-resolution data. This showed, for these two countries at least, that these approaches could be used to accurately disaggregate provincial level (administrative level 1) statistical data to provide high resolution model distributions. PMID:21822341

  8. Modelling the distribution of domestic ducks in Monsoon Asia

    USGS Publications Warehouse

    Van Bockel, Thomas P.; Prosser, Diann; Franceschini, Gianluca; Biradar, Chandra; Wint, William; Robinson, Tim; Gilbert, Marius

    2011-01-01

    Domestic ducks are considered to be an important reservoir of highly pathogenic avian influenza (HPAI), as shown by a number of geospatial studies in which they have been identified as a significant risk factor associated with disease presence. Despite their importance in HPAI epidemiology, their large-scale distribution in Monsoon Asia is poorly understood. In this study, we created a spatial database of domestic duck census data in Asia and used it to train statistical distribution models for domestic duck distributions at a spatial resolution of 1km. The method was based on a modelling framework used by the Food and Agriculture Organisation to produce the Gridded Livestock of the World (GLW) database, and relies on stratified regression models between domestic duck densities and a set of agro-ecological explanatory variables. We evaluated different ways of stratifying the analysis and of combining the prediction to optimize the goodness of fit of the predictions. We found that domestic duck density could be predicted with reasonable accuracy (mean RMSE and correlation coefficient between log-transformed observed and predicted densities being 0.58 and 0.80, respectively), using a stratification based on livestock production systems. We tested the use of artificially degraded data on duck distributions in Thailand and Vietnam as training data, and compared the modelled outputs with the original high-resolution data. This showed, for these two countries at least, that these approaches could be used to accurately disaggregate provincial level (administrative level 1) statistical data to provide high resolution model distributions.

  9. Genetic Diversity Analysis of South and East Asian Duck Populations Using Highly Polymorphic Microsatellite Markers.

    PubMed

    Seo, Dongwon; Bhuiyan, Md Shamsul Alam; Sultana, Hasina; Heo, Jung Min; Lee, Jun Heon

    2016-04-01

    Native duck populations have lower productivity, and have not been developed as much as commercials duck breeds. However, native ducks have more importance in terms of genetic diversity and potentially valuable economic traits. For this reason, population discriminable genetic markers are needed for conservation and development of native ducks. In this study, 24 highly polymorphic microsatellite (MS) markers were investigated using commercial ducks and native East and South Asian ducks. The average polymorphic information content (PIC) value for all MS markers was 0.584, indicating high discrimination power. All populations were discriminated using 14 highly polymorphic MS markers by genetic distance and phylogenetic analysis. The results indicated that there were close genetic relationships among populations. In the structure analysis, East Asian ducks shared more haplotypes with commercial ducks than South Asian ducks, and they had more independent haplotypes than others did. These results will provide useful information for genetic diversity studies in ducks and for the development of duck traceability systems in the market.

  10. Genetic structure of Eurasian and North American mallard ducks based on mtDNA data.

    PubMed

    Hou, Z-C; Yang, F-X; Qu, L-J; Zheng, J-X; Brun, J-M; Basso, B; Pitel, F; Yang, N; Xu, G-Y

    2012-06-01

    To elucidate the origin and genetic structure of the domesticated duck in Eurasia and North America, we sequenced 114 duck D-loop sequences and retrieved 489 D-loop sequences from GenBank. In total, 603 ducks including 50 duck breeds/populations from eight countries (China, France, Russia, India, Kazakhstan, Mongolia, Thailand and USA) were used in this study. One hundred and thirty-four haplotypes and 81 variable sites were detected. H49 was the predominant haplotype, which was considered to be the same dominant haplotype found in the previous studies, and was found in 309 birds. The smallest values for both genetic differentiation index (F(ST), 0.04156) and the number of the net nucleotide substitutions between two populations (D(A), 0.00018) were observed between Eurasian domestic ducks and Eurasian mallards. No geography, breed or population clusters were observed in the Eurasian domestic ducks and mallards. Five haplotypes were shared by USA mallards and Eurasian domestic duck/Eurasian mallards. Only one haplotype (H49) was shared by Eurasian domestic ducks and China spot-billed ducks. By combining phylogenetic analyses, haplotype network profile, genetic distances and shared haplotypes, we can draw two major conclusions: (i) Eurasian and North American mallards show a clear geographic distribution pattern; (ii) Eurasian domestic ducks are derived from the Eurasian mallards, not from the spot-billed ducks. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  11. Phylogenetic and pathogenic characterization of novel adenoviruses isolated from long-tailed ducks (Clangula hyemalis).

    PubMed

    Counihan, Katrina L; Skerratt, Lee F; Franson, J Christian; Hollmén, Tuula E

    2015-11-01

    Novel adenoviruses were isolated from a long-tailed duck (Clangula hyemalis) mortality event near Prudhoe Bay, Alaska in 2000. The long-tailed duck adenovirus genome was approximately 27 kb. A 907 bp hexon gene segment was used to design primers specific for the long-tailed duck adenovirus. Nineteen isolates were phylogenetically characterized based on portions of their hexon gene and 12 were most closely related to Goose adenovirus A. The remaining 7 shared no hexon sequences with any known adenoviruses. Experimental infections of mallards with a long-tailed duck reference adenovirus caused mild lymphoid infiltration of the intestine and paint brush hemorrhages of the mucosa and dilation of the intestine. This study shows novel adenoviruses from long-tailed ducks are diverse and provides further evidence that they should be considered in cases of morbidity and mortality in sea ducks. Conserved and specific primers have been developed that will help screen sea ducks for adenoviral infections.

  12. Conditioned aversion of aluminum sulfate in black ducks

    USGS Publications Warehouse

    Sparling, D.W.

    1990-01-01

    Three experiments were conducted to determine if reduced consumption of foods with elevated Al levels by black ducks (Anas rubripes) was due to taste aversion, conditioned taste aversion or malaise. Black ducks preferred a diet with 1,000 ppm Al over a control diet but ate less of a diet with 5,000 ppm Al. Prior experience with the high Al diet enhanced preference for the control diet. Changes in body weight and food consumption through time suggested that aversion to the high Al diet was a conditioned response to mild malaise.

  13. The amino acid sequence of wood duck lysozyme.

    PubMed

    Araki, T; Torikata, T

    1999-01-01

    The amino acid sequence of wood duck (Aix sponsa) lysozyme was analyzed. Carboxymethylated lysozyme was digested with trypsin and the resulting peptides were sequenced. The established amino acid sequence had the highest similarity to duck III lysozyme with four amino acid substitutions, and had eighteen amino acid substitutions from chicken lysozyme. The valine at position 75 was newly detected in chicken-type lysozymes. In the active site, Tyr34 and Glu57 were found at subsites F and D, respectively, when compared with chicken lysozyme.

  14. Effects of petroleum hydrocarbons on hepatic function in the duck

    USGS Publications Warehouse

    Patton, J.F.; Dieter, M.P.

    1980-01-01

    1. The indocyanine green dye clearance test for hepatic function was determined in mallard ducks before and during the chronic ingestion (7 months) of representative paraffinic or aromatic petroleum hydrocarbons (PH).2. No mortality or visible symptoms of toxicity occured in any of the tests. Ingestion of 4000 ppm aromatic PH produced significant increases in liver (25%), plasma clearance of indocyanine green (33%) and hepatic blood flow (30%).3. Although the aromatics elicited a greater hepatic stress response than the paraffins, the ducks tolerated high concentrations of PH for extended periods.

  15. Phylogenetic constraint on male parental care in the dabbling ducks

    PubMed Central

    Johnson, K. P.; McKinney, F.; Sorenson, M. D.

    1999-01-01

    Phylogenetic constraint and inertia, i.e. limitations on future evolutionary trajectories imposed by previous adaptation, are often invoked to explain behavioural, morphological and physiological traits that defy explanation in an adaptive context. We reconstructed historical changes in male parental care behaviour in the dabbling ducks (family: Anatidae; tribe: Anatini) using a phylogeny based on mitochondrial DNA sequences. Male parental care is observed in many tropical and Southern hemisphere dabbling ducks but is lacking in all Northern hemisphere species. Southern hemisphere species that are very recently derived from Northern hemisphere ancestors, however, are exceptions to this general pattern. Lack of male parental care in these species can be attributed to phylogenetic constraint.

  16. Effects of petroleum hydrocarbons on hepatic function in the duck

    USGS Publications Warehouse

    Patton, J.F.; Dieter, M.P.

    1980-01-01

    1. The indocyanine green dye clearance test for hepatic function was determined in mallard ducks before and during the chronic ingestion (7 months) of representative paraffinic or aromatic petroleum hydrocarbons (PH). 2. No mortality or visible symptoms of toxicity occured in any of the tests. Ingestion of 4000 ppm aromatic PH produced significant increases in liver (25%), plasma clearance of indocyanine green (33%) and hepatic blood flow (30%). 3. Although the aromatics elicited a greater hepatic stress response than the paraffins, the ducks tolerated high concentrations of PH for extended periods.

  17. RNA-seq comparative analysis of Peking ducks spleen gene expression 24 h post-infected with duck plague virulent or attenuated virus.

    PubMed

    Liu, Tian; Cheng, Anchun; Wang, Mingshu; Jia, Renyong; Yang, Qiao; Wu, Ying; Sun, Kunfeng; Zhu, Dekang; Chen, Shun; Liu, Mafeng; Zhao, XinXin; Chen, Xiaoyue

    2017-09-13

    Duck plague virus (DPV), a member of alphaherpesvirus sub-family, can cause significant economic losses on duck farms in China. DPV Chinese virulent strain (CHv) is highly pathogenic and could induce massive ducks death. Attenuated DPV vaccines (CHa) have been put into service against duck plague with billions of doses in China each year. Researches on DPV have been development for many years, however, a comprehensive understanding of molecular mechanisms underlying pathogenicity of CHv strain and protection of CHa strain to ducks is still blank. In present study, we performed RNA-seq technology to analyze transcriptome profiling of duck spleens for the first time to identify differentially expressed genes (DEGs) associated with the infection of CHv and CHa at 24 h. Comparison of gene expression with mock ducks revealed 748 DEGs and 484 DEGs after CHv and CHa infection, respectively. Gene pathway analysis of DEGs highlighted valuable biological processes involved in host immune response, cell apoptosis and viral invasion. Genes expressed in those pathways were different in CHv infected duck spleens and CHa vaccinated duck spleens. The results may provide valuable information for us to explore the reasons of pathogenicity caused by CHv strain and protection activated by CHa strain.

  18. The effect of Tembusu virus infection in different week-old Cherry Valley breeding ducks.

    PubMed

    Lu, Yunjian; Dou, Yanguo; Ti, Jinfeng; Wang, Aihua; Cheng, Binghua; Zhang, Xin; Diao, Youxiang

    2016-08-30

    To study the effect of Tembusu virus (TMUV) infection on Cherry Valley Breeding ducks of different ages, 350 five-week-old ducks were divided into 14 groups. Ducks in seven experimental group were respectively infected with 1.265×10(5) mean embryo lethal dose (ELD50) of TMUV-AHQY strain (in 4.2mL) by intravenous route. Ducks in control groups were inoculated with Phosphate-buffered Saline (PBS) in the same way. Clinical symptoms, gross and microscopic lesions, viral loads and serum antibodies were detected and recorded for 20days after infection. Some ducks infected at 7 and 21 week s of age showed severe clinical symptoms including depression and inappetence, and no obvious clinical symptoms were seen in other week-old infected ducks. Severe gross lesions including hepatomegaly, meningeal congestion, myocardial hemorrhage, intestinal, myocardial and pulmonary edema were observed in ducks infected at 7, 18 and 21 weeks of age. No or mild gross lesions were observed in ducks infected at 14 and 16 weeks of age. The main microscopic lesions including hyperaemia, degeneration and necrosis of different cells and inflammatory cellular infiltration mainly consisting of mononuclear cells or lymphocytes were observed in ducks infected at 7 and 21 week of age. But relatively intact structures and rare lymphocytic infiltration were presented in ducks infected at 14 and 16 weeks of age. Viral antigen was more frequently observed in organ slices collected from 7 week-old infected ducks and few positive staining was found in 14 and 16 week-old infected ducks. Less viral loads in different tissues and swabs were detected by a quantitative real-time PCR assay. The level of viral loads in the tissues of ducks infected at 14 and 16 weeks of age was very lower than that of ducks infected at 7 and 21 weeks of age. Meanwhile, less viral copy numbers were detected in swab samples collected from 14 and 16 week-old infected ducks. Ducks infected at 14-week-old developed significantly

  19. Population ecology and harvest of the American black duck: a review

    USGS Publications Warehouse

    Rusch, D.H.; Ankney, C.D.; Boyd, H.; Longcore, J.R.; Montalbano, F.; Ringelman, J.K.; Stotts, V.D.

    1989-01-01

    1. The purpose of our review was to examine available data on population trends and current status of black ducks and trends in natality and survival and to relate these, where possible, to changes in habitat, predation, disease, contaminants, harvest, and hybridization with mallards. 2. The number of black ducks tallied in the winter survey has declined steadily over the past 30 years at an average rate of about 3%/ year. Reliability and precision of the survey are uncertain; it may not provide an adequate index to the continental population of black ducks. Breeding surveys are incomplete and sporadic, but black ducks have decreased in Ontario and increased in the Maritime Provinces and Quebec. 3. Recent declines in numbers of black ducks tallied in the winter survey are not unusual in magnitude or much different from those that have occurred among several other species of waterfowl. 4. At present, black ducks are not especially scarce relative to numbers of several other ducks in eastern North America. 5. There is no solid evidence of major decreases in quality or quantity of breeding habitat for black ducks in recent years; in some areas, habitat has improved. 6. Natural mortality of black ducks has not been well studied, but does not seem unusually high compared to other dabbling ducks. 7. Harvest rates of black ducks are similar to those of sympatric mallards as determined by banding analyses. 8. There is no strong evidence for direct effects of contaminants on black ducks, but some indirect effects through invertebrate food resources have been detected. 9. Age ratios in black ducks show no trend in the past 18 years. 10. The quality and quantity of wintering habitat for black ducks have decreased substantially in some areas. 11. Disease and other natural mortality that affect black ducks do .not occur in unusually high frequency. 12. A decline in harvest of black ducks has occurred; most of the decline has been in the United States, especially since

  20. Novel mutations, including a novel G659A missense mutation, of the FUT1 gene are responsible for the para-Bombay phenotype.

    PubMed

    Sun, C F; Lo, M D; Lee, C H; Chu, D C

    2000-10-01

    Para-Bombay phenotype, with an estimated incidence of 1 in 8000 in Taiwanese residents based on serological analysis, is caused by aberrant alpha(1,2)-fucosyltransferase function and hence diminished H-antigen synthesis. In an individual with para-Bombay phenotype, DNA sequencing revealed two missense mutations previously reported C658T mutation and a novel G659A mutation. Haplotype analysis with restriction enzyme digestion showed that the two mutations are located on opposing alleles of the H (FUT1) gene and lead to compound heterozygosity. Since no other known genetic changes were evident, it appears that the new missense mutation, G659A, is deleterious to the alpha(1,2)-fucosyltransferase function encoded by the H (FUT1) gene.

  1. Effect of age on the pathogenesis of DHV-1 in Pekin ducks and on the innate immune responses of ducks to infection.

    PubMed

    Song, Cuiping; Yu, Shengqing; Duan, Yunbing; Hu, Yue; Qiu, Xvsheng; Tan, Lei; Sun, Yingjie; Wang, Mingshu; Cheng, Anchun; Ding, Chan

    2014-05-01

    Duck hepatitis virus (DHV) affects 1-week-old but not 3-week-old ducks, and it causes a more severe disease in the younger ducks. These differences may be partially due to the host response to DHV infection. In order to understand this difference, we characterized the pathobiology of and innate immune response to DHV infection in 1-day-old (1D) and 3-week-old (3 W) ducks. Viral RNA was detected in duck livers at 24, 36 and 72 h after inoculation with DHV at a dose of 10(3) LD50. Virus-induced pathology ranged from no clinical signs to severe disease and death, and it was more severe in the 1D ducks. Infection with DHV induced up-regulation of gene expression of Toll-like receptor (TLR)-7, TLR3, retinoic-acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA-5), interleukin (IL)-6, interferon (IFN)-α, interferon-induced transmembrane protein 1 (IFITM1), interferon-stimulated gene 12 (ISG12), and 2'-5' oligoadenylate synthetase-like gene (OASL) in the livers of 3 W ducks. Of these, IL-6, OASL and ISG12 mRNA levels were more than 100-fold higher in infected 3 W ducks than in mock-infected ducks of the same age. These genes were induced much less in infected 1D ducklings. We present evidence that a lower level of viral replication in the hepatocytes of 3 W ducks, whose basal level of cytokines is higher than that in 1D ducklings, may be related to the strong innate immunity induced. From our data, we conclude that duck age plays an important role in the pathogenicity of and innate immune responses to DHV.

  2. Dioxins and furans linked to reproductive impairment in wood ducks

    SciTech Connect

    White, D.H.; Seginak, J.T. )

    1994-01-01

    A wetland in central Arkansas was contaminated with polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans and because the area was a major waterflow habitat, we studied the effects of the contamination on nesting wood ducks (Aix sponsa) during 1988-90. Residues in wood duck eggs, based on toxicity equivalency factors (TEFs) for combined compounds, ranged from 0.2 to 611 parts per trillion (ppt) wet mass (70% were the toxic isomer 2,3,7,8-tetrachlorodibenzo-p-dioxine [tetraCDD]) and were 50 times higher in eggs from near the point source than from an uncontaminated reference site 111 km away. Nest success, hatching success, and duckling production were suppressed (P < 0.05) at nesting sites 9 and 17 km downstream, as was hatching success 58 km downstream. Egg TEFs were inversely correlated (P < 0.001) with productivity in corresponding nests. In addition, tetraogenic effects occurred in ducklings at the more contaminated nesting site nearest the point source. The threshold range of toxicity (based on TEFs) where reduced productivity was evident in wood ducks was >20-50 ppt. Wood ducks were sensitive to dioxin and furan contamination, and we recommended it as an indicator species for monitoring biological impacts from these contaminants. 26 refs., 4 tabs.

  3. Lame Ducks Can Leave on Wings that Fly.

    ERIC Educational Resources Information Center

    Richter, Richard P.

    1995-01-01

    While a "lame duck" college president may have diminished authority, he may also enjoy an unusual opportunity to move the institution forward. Outgoing presidents who pursue a substantive agenda during their final months can calm fears and second-guessing, preserve institutional momentum, and conclude their term with the satisfaction of a job well…

  4. Duck nesting in intensively farmed areas of North Dakota

    USGS Publications Warehouse

    Higgins, K.F.

    1977-01-01

    A study to determine the major factors limiting duck nesting and production on intensively farmed areas in eastern North Dakota was conducted from 1969 through 1974. A total of 186 duck nests was found during searches on 6,018 ha of upland. Nest density per km2 for 5 major habitat types was 20.2 in untilled upland, 3.7 in standing grain stubble, 1.6 in mulched grain stubble, 1.2 in summer fallow, and 1.1 in growing grain. Pintails (Anas acuta) nested in cultivated cropland types in greater prevalence than other duck species. Nest densities were 12 times greater on untilled upland (20.2/km2) than on annually tilled cropland (1.7/km2), and hatched-clutch densities were 16 times greater on untilled upland (4.8/km2) than on annually tilled cropland (0.3/km2). Hatching success was greater on untilled upland (25%) than on tilled cropland (17%). Of 186 nests found, 77 percent did not hatch; 76 percent of the failures were attributed to predators and 19 percent to farming operations. Poor quality nesting cover, the result of intensive land use practices, and nesting failures caused by machinery and predators mainly mammals, were the principal factors limiting duck nesting and production on intensively farmed areas.

  5. Sublethal effects of chronic lead ingestion in mallard ducks

    USGS Publications Warehouse

    Finley, M.T.; Dieter, M.P.; Locke, L.N.

    1976-01-01

    Mallard drakes (Anas platyrhynchos) fed 1, 5, or 25 ppm lead nitrate were bled and sacrificed at 3-wk intervals. No mortality occurred, and the pathologic lesions usually associated with lead poisoning were not found. Changes in hematocrit and hemoglobin concentration did not occur. After 3-wk ducks fed 25 ppm lead exhibited a 40% inhibition of blood delta-aminolevulinic acid dehydratase activity that persisted through 12 wk exposure. After 12 wk treatment similar enzyme inhibition was present in the ducks fed 5 ppm lead. At 3 wk there was a small accumulation of lead (less than 1 ppm) in the liver and kidneys of ducks fed 25ppm lead; no further increases occurred throughout the exposure. No significant accumulation of lead occurred the the tibiae or wing bones. Groups of ducks fed 5 and 25 ppm diets for 12 wk were placed on clean feed and examined through a 12 wk posttreatment period. After 3 wk on clean diet delta-aminolevulinic acid dehydratase activity and lead concentrations in the blood had returned to pretreatment levels. Even though lead concentrations in the blood, soft organs and bone were low, a highly significant negative correlation between blood lead and blood enzyme activity was obtained. This enzyme bioassay should provide a sensitive and precise estimate for monitoring lead in the blood for waterflow.

  6. Avoidance behavior of young black ducks treated with chromium

    USGS Publications Warehouse

    Heinz, G.H.; Haseltine, S.D.

    1981-01-01

    Pairs of adult black ducks (Anas rubripes) were fed a diet containing 0, 20, or 200 ppm chromium in the form of chromium potassium sulfate. Ducklings from these pairs were fed the same diets as adults and were tested for their avoidance responses to a fright stimulus. Neither level of chromium had a significant effect on avoidance behavior.

  7. Dioxins and furans linked to reproductive impairment in wood ducks

    USGS Publications Warehouse

    White, D.H.; Seginak, J.T.

    1994-01-01

    A wetland in central Arkansas was contaminated with polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans and because the area was a major waterfowl habitat, we studied the effects of the contamination on nesting wood ducks (Aix sponsa) during 1988-90. Residues in wood duck eggs, based on toxicity equivalency factors (TEFs) for combined compounds, ranged from 0.2 to 611 parts per trillion (ppt) wet mass (70% were the toxic isomer 2,3,7,8-tetrachlorodibenzo-p-dioxin (tetraCDD)) and were 50 times higher in eggs from near the point source than from an uncontaminated reference site 111 km away. Nest success, hatching success, and duckling production were suppressed (P lt 0.05) at nesting sites 9 and 17 km downstream, as was hatching success 58 km downstream. Egg TEFs were inversely correlated (P lt 0.001) with productivity in corresponding nests. In addition, teratogenic effects occurred in ducklings at the more contaminated nesting site nearest the point source. The threshold range of toxicity (based on TEFs) where reduced productivity was evident in wood ducks was gt 20-50 ppt. Wood ducks were sensitive to dioxin and furan contamination, and we recommend it as an indicator species for monitoring biological impacts from these contaminants.

  8. Duck Tembusu virus exhibits neurovirulence in BALB/c mice.

    PubMed

    Li, Shuang; Li, Xiaoxia; Zhang, Lijiao; Wang, Yongyue; Yu, Xiuling; Tian, Kegong; Su, Wenliang; Han, Bo; Su, Jingliang

    2013-08-14

    Duck Tembusu virus is a member of the Ntaya group in the genus Flavivirus. The virus has been responsible for severe duck egg-drop syndrome in China since 2010. Its emergence and rapid spread have caused great economic loss for the poultry industry. The epidemiology of the virus infection and the potential threat to public health is of great concern because of the infective and zoonotic nature of flaviviruses. In this study, the pathogenicity of duck Tembusu virus in BALB/c mice was investigated. Infected mice developed clinical signs, including loss of appetite, ruffled hair, weight loss, disorientation, blindness and paralysis of hind limbs from six days post- infection following intracerebral inoculation. Morbidity was 100%, with mortality ranging from 20 to 80% in three- to eight-week-old mice. High virus titers were recovered from the brain, and the virus was distributed in several organs. Histologically, there was widespread non-suppurative encephalitis in the brain. Lymphocyte depletion in the spleen was observed, along with fatty degeneration in the liver and kidney. Our results demonstrate, for the first time, that duck Tembusu virus is highly neurovirulent in BALB/c mice. The mouse model used in this work was able to produce Tembusu virus infection and could be useful for elucidating some of the aspects of the pathophysiology of other flavivirus infections.

  9. 9. Looking northeast, foreground Clenny Run Road, duck pond and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Looking northeast, foreground Clenny Run Road, duck pond and Clenny Run, with intersection of State Routes 92 and 100 beyond, Brandywine Creek State Park in background, mixed deciduous trees along top of hill - Winterthur Farms, Intersection State Routes 92 & 100, Intersection State Routes 92 & 100, Winterthur, New Castle County, DE

  10. 8. View southeast, Route 100 (Montchanin Road) to left duck ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. View southeast, Route 100 (Montchanin Road) to left duck and large stand of old growth oak trees at back entrance to Winterthur center right. - Winterthur Farms, Intersection State Routes 92 & 100, Intersection State Routes 92 & 100, Winterthur, New Castle County, DE

  11. Lame Ducks Can Leave on Wings that Fly.

    ERIC Educational Resources Information Center

    Richter, Richard P.

    1995-01-01

    While a "lame duck" college president may have diminished authority, he may also enjoy an unusual opportunity to move the institution forward. Outgoing presidents who pursue a substantive agenda during their final months can calm fears and second-guessing, preserve institutional momentum, and conclude their term with the satisfaction of a job well…

  12. Estimation of L-threonine requirements for Longyan laying ducks.

    PubMed

    Fouad, A M; Zhang, H X; Chen, W; Xia, W G; Ruan, D; Wang, S; Zheng, C T

    2017-02-01

    A study was conducted to test six threonine (Thr) levels (0.39%, 0.44%, 0.49%, 0.54%, 0.59%, and 0.64%) to estimate the optimal dietary Thr requirements for Longyan laying ducks from 17 to 45 wk of age. Nine hundred Longyan ducks aged 17 wk were assigned randomly to the six dietary treatments, where each treatment comprised six replicate pens with 25 ducks per pen. Increasing the Thr level enhanced egg production, egg weight, egg mass, and the feed conversion ratio (FCR) (linearly or quadratically; p<0.05). The Haugh unit score, yolk color, albumen height, and the weight, percentage, thickness, and breaking strength of the eggshell did not response to increases in the Thr levels, but the albumen weight and its proportion increased significantly (p<0.05), whereas the yolk weight and its proportion decreased significantly as the Thr levels increased. According to a regression model, the optimal Thr requirement for egg production, egg mass, and FCR in Longyan ducks is 0.57%, while 0.58% is the optimal level for egg weight from 17 to 45 wk of age.

  13. Estimation of L-threonine requirements for Longyan laying ducks

    PubMed Central

    Fouad, A. M.; Zhang, H. X.; Chen, W.; Xia, W. G.; Ruan, D.; Wang, S.; Zheng, C. T.

    2017-01-01

    Objective A study was conducted to test six threonine (Thr) levels (0.39%, 0.44%, 0.49%, 0.54%, 0.59%, and 0.64%) to estimate the optimal dietary Thr requirements for Longyan laying ducks from 17 to 45 wk of age. Methods Nine hundred Longyan ducks aged 17 wk were assigned randomly to the six dietary treatments, where each treatment comprised six replicate pens with 25 ducks per pen. Results Increasing the Thr level enhanced egg production, egg weight, egg mass, and the feed conversion ratio (FCR) (linearly or quadratically; p<0.05). The Haugh unit score, yolk color, albumen height, and the weight, percentage, thickness, and breaking strength of the eggshell did not response to increases in the Thr levels, but the albumen weight and its proportion increased significantly (p<0.05), whereas the yolk weight and its proportion decreased significantly as the Thr levels increased. Conclusion According to a regression model, the optimal Thr requirement for egg production, egg mass, and FCR in Longyan ducks is 0.57%, while 0.58% is the optimal level for egg weight from 17 to 45 wk of age. PMID:27282968

  14. Suramin prevents duck hepatitis B virus infection in vivo.

    PubMed Central

    Offensperger, W B; Offensperger, S; Walter, E; Blum, H E; Gerok, W

    1993-01-01

    The effect of suramin on duck hepatitis B virus (DHBV) infection was investigated in vivo. Suramin pretreatment of Pekin ducklings completely prevented DHBV infection. In contrast, suramin given at the time of or after inoculation with DHBV did not inhibit viral infection, replication, or gene expression. These data indicate that suramin effectively blocks the early stages of DHBV infection in vivo. Images PMID:8363388

  15. In vitro cultivation and cryopreservation of duck embryonic hepatocytes.

    PubMed

    Schacke, M; Glück, B; Wutzler, P; Sauerbrei, A

    2009-04-01

    Hepatitis B-virucidal testing of biocides in quantitative suspension tests using duck hepatitis B virus (DHBV) requires primary duck embryonic hepatocytes for viral propagation. To improve the test system and availability of these cells, commercial culture plates with different growth surfaces were tested for cell cultivation and different approaches for cryopreservation of hepatocyte suspension were examined. After 12 days of culture, the largest amounts of hepatocytes were grown in CellBIND and TTP plates and CellBIND surface showed the lowest tendency of monolayer detachment nearly comparable with collagen 1-coated CELLCOAT plates. For cryopreservation of hepatocyte suspension, the use of growth medium supplemented with fetal calf serum (FCS) and dimethyl sulfoxide (ME(2)SO), FCS supplemented with ME(2)SO or cryosafe-1 as cryoprotective agents provided the highest rates of surviving cells after thawing. The freezing-thawing process did not significantly reduce the susceptibility of hepatocytes to infection with DHBV. In conclusion, plates without collagen 1 such as CellBIND are recommended for cultivation of primary duck embryonic hepatocytes in infectivity experiments of DHBV for virucidal testing of biocides. The use of cryopreserved hepatocytes is possible when freshly isolated cells from the liver of duck embryos are not available.

  16. Movement analysis of free-grazing domestic ducks in Poyang Lake, China: a disease connection

    PubMed Central

    Prosser, Diann J.; Palm, Eric C.; Takekawa, John. Y; Zhao, Delong; Xiao, Xiangming; Li, Peng; Liu, Ying; Newman, Scott H.

    2016-01-01

    Previous work suggests domestic poultry are important contributors to the emergence and transmission of highly pathogenic avian influenza throughout Asia. In Poyang Lake, China, domestic duck production cycles are synchronized with arrival and departure of thousands of migratory wild birds in the area. During these periods, high densities of juvenile domestic ducks are in close proximity to migratory wild ducks, increasing the potential for the virus to be transmitted and subsequently disseminated via migration. In this paper, we use GPS dataloggers and dynamic Brownian bridge models to describe movements and habitat use of free-grazing domestic ducks in the Poyang Lake basin and identify specific areas that may have the highest risk of H5N1 transmission between domestic and wild birds. Specifically, we determine relative use by free-grazing domestic ducks of natural wetlands, which are the most heavily used areas by migratory wild ducks, and of rice paddies, which provide habitat for resident wild ducks and lower densities of migratory wild ducks. To our knowledge, this is the first movement study on domestic ducks, and our data show potential for free-grazing domestic ducks from farms located near natural wetlands to come in contact with wild waterfowl, thereby increasing the risk for disease transmission. This study provides an example of the importance of movement ecology studies in understanding dynamics such as disease transmission on a complicated landscape. PMID:27695384

  17. Movement analysis of free-grazing domestic ducks in Poyang Lake, China: a disease connection.

    PubMed

    Prosser, Diann J; Palm, Eric C; Takekawa, John Y; Zhao, Delong; Xiao, Xiangming; Li, Peng; Liu, Ying; Newman, Scott H

    2016-01-01

    Previous work suggests domestic poultry are important contributors to the emergence and transmission of highly pathogenic avian influenza throughout Asia. In Poyang Lake, China, domestic duck production cycles are synchronized with arrival and departure of thousands of migratory wild birds in the area. During these periods, high densities of juvenile domestic ducks are in close proximity to migratory wild ducks, increasing the potential for the virus to be transmitted and subsequently disseminated via migration. In this paper, we use GPS dataloggers and dynamic Brownian bridge models to describe movements and habitat use of free-grazing domestic ducks in the Poyang Lake basin and identify specific areas that may have the highest risk of H5N1 transmission between domestic and wild birds. Specifically, we determine relative use by free-grazing domestic ducks of natural wetlands, which are the most heavily used areas by migratory wild ducks, and of rice paddies, which provide habitat for resident wild ducks and lower densities of migratory wild ducks. To our knowledge, this is the first movement study on domestic ducks, and our data show potential for free-grazing domestic ducks from farms located near natural wetlands to come in contact with wild waterfowl, thereby increasing the risk for disease transmission. This study provides an example of the importance of movement ecology studies in understanding dynamics such as disease transmission on a complicated landscape.

  18. Survey for West Nile virus antibodies in wild ducks, 2004-06, USA

    USGS Publications Warehouse

    Hofmeister, Erik K.; Jankowski, Mark D.; Goldberg, Diana R.; Franson, J. Christian

    2016-01-01

    Detection of West Nile virus (WNV) in ducks has been reported in North America in isolated cases of mortality in wild waterbirds and following outbreaks in farmed ducks. Although the virus has been noted as an apparent incidental finding in several species of ducks, little is known about the prevalence of exposure or the outcome of infection with WNV in wild ducks in North America. From 2004–06, we collected sera from 1,406 wild-caught American Wigeon (Anas americana), Mallard (Anas platyrhynchos), and Northern Pintail (Anas acuta) ducks at national wildlife refuges (NWRs) in North Dakota and Wood Ducks (Aix sponsa) at NWRs in South Carolina and Tennessee. We measured the prevalence of previous exposure to WNV in these ducks by measuring WNV antibodies and evaluated variation in exposure among species, age, and year. Additionally, we evaluated the performance of a commercial antibody to wild bird immunoglobulin in duck species that varied in their phylogenetic relatedness to the bird species the antibody was directed against. As determined by a screening immunoassay and a confirmatory plaque reduction neutralization assay, the prevalence of WNV antibody was 10%. In light of experimental studies that show ducks to be relatively resistant to mortality caused by WNV, the antibody prevalence we detected suggests that wild ducks may be less-frequently exposed to WNV than expected for birds inhabiting wetlands where they may acquire infection from mosquitoes.

  19. Pasteurella multocida-associated sinusitis in khaki Campbell ducks (Anas platyrhynchos).

    PubMed

    Songserm, Thaweesak; Viriyarampa, A Srisamai; Sae-Heng, Namdee; Chamsingh, Wilairat; Bootdee, Orawan; Pathanasophon, Pornpen

    2003-01-01

    Pasteurella multocida group B, serotype 3, was isolated from sinusitis-affected khaki Campbell ducks. To study the role of P. multocida in sinusitis, commercial khaki Campbell ducks were experimentally infected with P. multocida alone or combined with Escherichia coli. In Expt. 1, experimental ducks were infected with P. multocida intranasally or ocularly. A comparison was done by intranasal inoculation with pooled nasal discharge from the affected ducks or phosphate-buffered saline. The ducks intranasally inoculated with the nasal discharge or P. multocida showed sinusitis. In Expt. 2, E. coli alone or a combination of P. multocida and E. coli was intranasally inoculated into experimental ducks. The ducks intranasally inoculated with the combination of P. multocida and E. coli had sinusitis, the same as found in the field but less severe than that of the field cases. Pasteurella multocida was already present in litter/floor of duck farms. We concluded that P. multocida played a role in induction of sinusitis. However, the sinusitis in ducks may be initiated by poor management, especially in the brooding period of ducks.

  20. Movement analysis of free-grazing domestic ducks in Poyang Lake, China: A disease connection

    USGS Publications Warehouse

    Prosser, Diann J.; Palm, Eric C.; Takekawa, John Y.; Zhao, Delong; Xiao, Xiangming; Li, Peng; Liu, Ying; Newman, Scott H.

    2015-01-01

    Previous work suggests domestic poultry are important contributors to the emergence and transmission of highly pathogenic avian influenza throughout Asia. In Poyang Lake, China, domestic duck production cycles are synchronized with arrival and departure of thousands of migratory wild birds in the area. During these periods, high densities of juvenile domestic ducks are in close proximity to migratory wild ducks, increasing the potential for the virus to be transmitted and subsequently disseminated via migration. In this paper, we use GPS dataloggers and dynamic Brownian bridge models to describe movements and habitat use of free-grazing domestic ducks in the Poyang Lake basin and identify specific areas that may have the highest risk of H5N1 transmission between domestic and wild birds. Specifically, we determine relative use by free-grazing domestic ducks of natural wetlands, which are the most heavily used areas by migratory wild ducks, and of rice paddies, which provide habitat for resident wild ducks and lower densities of migratory wild ducks. To our knowledge, this is the first movement study on domestic ducks, and our data show potential for free-grazing domestic ducks from farms located near natural wetlands to come in contact with wild waterfowl, thereby increasing the risk for disease transmission. This study provides an example of the importance of movement ecology studies in understanding dynamics such as disease transmission on a complicated landscape.

  1. Effects of Maillard reaction on flavor and safety of Chinese traditional food: roast duck.

    PubMed

    Zhou, Yiming; Xie, Fan; Zhou, Xiaoli; Wang, Yuqiang; Tang, Wen; Xiao, Ying

    2016-04-01

    Roast duck is one kind of representative roast food whose flavor is mainly produced by the Maillard reaction. However, some potentially toxic compounds are generated in the thermal process and are a potential health risk. The aim of this work was to analyze the effects of the Maillard reaction on flavor and safety of a Chinese traditional food: roast duck. Ducks with different roasting times (0, 10, 20, 30, 40, 50 and 60 min) were analyzed. The 40 and 50 min roast ducks exhibited an acceptable degree of sensory attributes, but the 60 min roast duck showed the most abundant aroma compounds. Antioxidant activities were observed to increase with roasting, and the 60 min roast duck showed the highest antioxidant activities (1,1-diphenylpicryhydrazyl, 39.3 µmol Trolox g(-1) sample). The highest content of acrylamide (0.21 µg g(-1)) and 5-hydroxymethylfurfural (0.089 µg g(-1)) were detected in the 50 and 60 min roast duck extract, respectively. Furthermore, water extract from 60 min roast ducks manifested a higher lactose dehydrogenase release ratio (51.9%) and greatly increased cell apoptosis. The drastic Maillard reaction in duck induced by long roasting time could be advantageous for color, aroma and antioxidant activities in roast ducks, but might be not beneficial to health. © 2015 Society of Chemical Industry.

  2. Who Is Spreading Avian Influenza in the Moving Duck Flock Farming Network of Indonesia?

    PubMed

    Henning, Joerg; Pfeiffer, Dirk U; Stevenson, Mark; Yulianto, Didik; Priyono, Walujo; Meers, Joanne

    2016-01-01

    Duck populations are considered to be a reservoir of Highly pathogenic avian influenza (HPAI) virus H5N1 in some agricultural production systems, as they are able to shed the virus for several days without clinical signs. Countries endemically affected with HPAI in Asia are characterised by production systems where ducks are fed on post-harvest spilled rice. During this scavenging process it is common for ducks to come into contact with other duck flocks or wild birds, thereby providing opportunities for virus spread. Effective risk management for HPAI has been significantly compromised by a limited understanding of management of moving duck flocks in these countries, despite of a small number of recent investigations. Here, for the first time, we described the management of moving duck flocks and the structure of the moving duck flock network in quantitative terms so that factors influencing the risk of HPAIV transmission can be identified. By following moving duck flock farmers over a period of 6 months in Java, Indonesia, we were able to describe the movement of flocks and to characterise the network of various types of actors associated with the production system. We used these data to estimate the basic reproductive number for HPAI virus spread. Our results suggest that focussing HPAI prevention measures on duck flocks alone will not be sufficient. Instead, the role of transporters of moving duck flocks, hatcheries and rice paddy owners, in the spread of the HPAI virus needs to be recognised.

  3. SURVEY FOR WEST NILE VIRUS ANTIBODIES IN WILD DUCKS, 2004-06, USA.

    PubMed

    Hofmeister, Erik K; Jankowski, Mark D; Goldberg, Diana; Franson, J Christian

    2016-04-28

    Detection of West Nile virus (WNV) in ducks has been reported in North America in isolated cases of mortality in wild waterbirds and following outbreaks in farmed ducks. Although the virus has been noted as an apparent incidental finding in several species of ducks, little is known about the prevalence of exposure or the outcome of infection with WNV in wild ducks in North America. From 2004-06, we collected sera from 1,406 wild-caught American Wigeon ( Anas americana ), Mallard ( Anas platyrhynchos ), and Northern Pintail ( Anas acuta ) ducks at national wildlife refuges (NWRs) in North Dakota and Wood Ducks ( Aix sponsa ) at NWRs in South Carolina and Tennessee. We measured the prevalence of previous exposure to WNV in these ducks by measuring WNV antibodies and evaluated variation in exposure among species, age, and year. Additionally, we evaluated the performance of a commercial antibody to wild bird immunoglobulin in duck species that varied in their phylogenetic relatedness to the bird species the antibody was directed against. As determined by a screening immunoassay and a confirmatory plaque reduction neutralization assay, the prevalence of WNV antibody was 10%. In light of experimental studies that show ducks to be relatively resistant to mortality caused by WNV, the antibody prevalence we detected suggests that wild ducks may be less-frequently exposed to WNV than expected for birds inhabiting wetlands where they may acquire infection from mosquitoes.

  4. Who Is Spreading Avian Influenza in the Moving Duck Flock Farming Network of Indonesia?

    PubMed Central

    Henning, Joerg; Pfeiffer, Dirk U.; Stevenson, Mark; Yulianto, Didik; Priyono, Walujo; Meers, Joanne

    2016-01-01

    Duck populations are considered to be a reservoir of Highly pathogenic avian influenza (HPAI) virus H5N1 in some agricultural production systems, as they are able to shed the virus for several days without clinical signs. Countries endemically affected with HPAI in Asia are characterised by production systems where ducks are fed on post-harvest spilled rice. During this scavenging process it is common for ducks to come into contact with other duck flocks or wild birds, thereby providing opportunities for virus spread. Effective risk management for HPAI has been significantly compromised by a limited understanding of management of moving duck flocks in these countries, despite of a small number of recent investigations. Here, for the first time, we described the management of moving duck flocks and the structure of the moving duck flock network in quantitative terms so that factors influencing the risk of HPAIV transmission can be identified. By following moving duck flock farmers over a period of 6 months in Java, Indonesia, we were able to describe the movement of flocks and to characterise the network of various types of actors associated with the production system. We used these data to estimate the basic reproductive number for HPAI virus spread. Our results suggest that focussing HPAI prevention measures on duck flocks alone will not be sufficient. Instead, the role of transporters of moving duck flocks, hatcheries and rice paddy owners, in the spread of the HPAI virus needs to be recognised. PMID:27019344

  5. Missense mutation of FUT1 and deletion of FUT2 are responsible for Indian Bombay phenotype of ABO blood group system.

    PubMed

    Koda, Y; Soejima, M; Johnson, P H; Smart, E; Kimura, H

    1997-09-08

    The Bombay phenotype fails to express the ABH antigens of ABO blood group system on red blood cells and in secretions because of a lack in activities of the H gene (FUT1)- and Secretor gene (FUT2)-encoded alpha (1,2)fucosyltransferases. In this study, we have examined the FUT1 and the FUT2 from three unrelated Indian individuals with the Bombay phenotype. These three individuals were found to be homozygous for a T725G mutation in the coding region of the FUT1, which inactivated the enzyme activity. In addition, we did not detect any hybridized band corresponding to the FUT2 by Southern blot analysis using the catalytic domain of the FUT2 as a probe, indicating that the three individuals were homozygous for a gene deletion in the FUT2. These results suggest that the T725G mutation of FUT1 and the gene deletion of FUT2 are responsible for the classical Indian Bombay phenotype.

  6. A description of the management of itinerant grazing ducks in the Mekong river delta of Vietnam.

    PubMed

    Minh, Phan Q; Stevenson, M A; Schauer, B; Morris, R S; Quy, Tran D

    2010-04-01

    A cross-sectional survey of management practices of itinerant grazing ducks (known as field running ducks) was conducted during March 2008 in four districts of Can Tho and Bac Lieu provinces in the Mekong River Delta, Vietnam. The objective was to characterize the demographic structure of the itinerant grazing duck population and the management practices which might be related to the continuing outbreaks of H5N1 avian influenza in this region. Broiler duck flocks were owned by 55% of survey respondents, and layer flocks by 53%. Greater than 80% of ducks within 93% of villages and 99% of duck flocks were reported to have been vaccinated against H5N1 avian influenza, whereas only 19% of villages and 60% of chicken flocks had greater than 80% of chickens vaccinated. Fifty-nine percent of duck owners moved their ducks outside their home communes, whilst 37% and 28% of owners moved their ducks outside their home district and province, respectively. Larger flocks were more likely to be run outside their home district compared with smaller flocks. After adjusting for the effect of flock production type and district, the odds of an out-of-district field running duck flock movement was increased by a factor of 7.24 (95% CI 2.89-19.24) for households with flocks of more than 800 ducks, compared with flocks of less than 250. Most households sold ducks to traders (72%) or to neighbours (33%), whereas less than 20% sold their birds through markets. The findings of this study suggest that surveillance strategies for field running duck flocks should focus on layer flocks as well as larger flocks as they are more likely to be moved outside of their home district, facilitating long-distance disease spread.

  7. Temporal changes of populations and trophic relationships of wintering diving ducks in Chesapeake Bay

    USGS Publications Warehouse

    Perry, Matthew C.; Wells-Berlin, Alicia M.; Kidwell, David M.; Osenton, Peter C.

    2007-01-01

    Population and trophic relationships among diving ducks in Chesapeake Bay are diverse and complex as they include five species of bay ducks (Aythya spp.), nine species of seaducks (Tribe Mergini), and the Ruddy Duck (Oxyura jamaicensis). Here we considered the relationships between population changes and diet over the past half century to assess the importance of prey changes to wintering waterfowl in the Bay. Food habits of 643 diving ducks collected from Chesapeake Bay during 1999-2006 were determined by analyses of their gullet (esophagus and proventriculus) and gizzard contents and compared to historical data (1885-1979) of 1,541 diving ducks. Aerial waterfowl surveys, in general, suggest that six species of seaducks were more commonly located in the meso- to polyhaline areas of the Bay, whereas five species of bay ducks and Ruddy Ducks were in the oligo- to mesohaline areas. Seaducks fed on a molluscan diet of Hooked Mussel (Ischadium recurvum), Amethyst Gemclam (Gemma gemma), and Dwarf Surfclarn (Mulinia lateralis). Bay ducks and Ruddy Ducks fed more on Baltic Macoma (Macoma balthica), the adventive Atlantic Rangia (Rangia cuneata), and submerged aquatic vegetation (SAV). Mergansers were found over the widest salinity range in the Bay, probably because of their piscivorous diet. Each diving duck species appears to fill a unique foraging niche, although there is much overlap of selected prey. When current food habits are compared to historic data, only the Canvasback (Aythya valisineria) has had major diet changes, although SAV now accounts for less food volume for all diving duck species, except the Redhead (Aythya americana). Understanding the trophic-habitat relationships of diving ducks in coastal wintering areas will give managers a better understanding of the ecological effects of future environmental changes. Intensive restoration efforts on SAV and oyster beds should greatly benefit diving duck populations.

  8. Wetland dynamics influence mid-continent duck recruitment

    USGS Publications Warehouse

    Anteau, Michael J.; Pearse, Aaron T.; Szymankski, Michael L.

    2013-01-01

    Recruitment is a key factor influencing duck population dynamics. Understanding what regulates recruitment of ducks is a prerequisite to informed habitat and harvest management. Quantity of May ponds (MP) has been linked to recruitment and population size (Kaminski and Gluesing 1987, Raveling and Heitmeyer 1989). However, wetland productivity (quality) is driven by inter-annual hydrological fluctuations. Periodic drying of wetlands due to wet-dry climate cycles releases nutrients and increases invertebrate populations when wet conditions return (Euliss et al. 1999). Wetlands may also become wet or dry within a breeding season. Accordingly, inter-annual and intra-seasonal hydrologic variation potentially influence duck recruitment. Here, we examined influences of wetland quantity, quality, and intra-seasonal dynamics on recruitment of ducks. We indexed duck recruitment by vulnerability-corrected age ratios (juveniles/adult females) for mid-continent Gadwall (Anas strepera). We chose Gadwall because the majority of the continental population breeds in the Prairie Pothole Region (PPR), where annual estimates of MP exist since 1974. We indexed wetland quality by calculating change in MP (?MP) over the past two years (?MP = 0.6[MPt – MPt-1] + 0.4[MPt – MPt-2]). We indexed intra-seasonal change in number of ponds by dividing the PPR mean standardized precipitation index for July by MP (hereafter summer index). MP and ?MP were positively correlated (r = 0.65); therefore, we calculated residual ?MP (?MPr) with a simple linear regression using MP, creating orthogonal variables. Finally, we conducted a multiple regression to examine how MP, ?MPr, and summer index explained variation in recruitment of Gadwall from 1976–2010. Our model explained 67% of the variation in mid-continent Gadwall recruitment and all three hydrologic indices were positively correlated with recruitment (Figure 1). Type II semi-partial R2 estimates indicated that MP accounted for 41%, ?MPr

  9. Identification and Survey of a Novel Avian Coronavirus in Ducks

    PubMed Central

    Chen, Gui-Qian; Zhuang, Qing-Ye; Wang, Kai-Cheng; Liu, Shuo; Shao, Jian-Zhong; Jiang, Wen-Ming; Hou, Guang-Yu; Li, Jin-Ping; Yu, Jian-Min; Li, Yi-Ping; Chen, Ji-Ming

    2013-01-01

    The rapid discovery of novel viruses using next generation sequencing (NGS) technologies including DNA-Seq and RNA-Seq, has greatly expanded our understanding of viral diversity in recent years. The timely identification of novel viruses using NGS technologies is also important for us to control emerging infectious diseases caused by novel viruses. In this study, we identified a novel duck coronavirus (CoV), distinct with chicken infectious bronchitis virus (IBV), using RNA-Seq. The novel duck-specific CoV was a potential novel species within the genus Gammacoronavirus, as indicated by sequences of three regions in the viral 1b gene. We also performed a survey of CoVs in domestic fowls in China using reverse-transcription polymerase chain reaction (RT-PCR), targeting the viral nucleocapsid (N) gene. A total of 102 CoV positives were identified through the survey. Phylogenetic analysis of the viral N sequences suggested that CoVs in domestic fowls have diverged into several region-specific or host-specific clades or subclades in the world, and IBVs can infect ducks, geese and pigeons, although they mainly circulate in chickens. Moreover, this study provided novel data supporting the notion that some host-specific CoVs other than IBVs circulate in ducks, geese and pigeons, and indicated that the novel duck-specific CoV identified through RNA-Seq in this study is genetically closer to some CoVs circulating in wild water fowls. Taken together, this study shed new insight into the diversity, distribution, evolution and control of avian CoVs. PMID:24023656

  10. Identification and survey of a novel avian coronavirus in ducks.

    PubMed

    Chen, Gui-Qian; Zhuang, Qing-Ye; Wang, Kai-Cheng; Liu, Shuo; Shao, Jian-Zhong; Jiang, Wen-Ming; Hou, Guang-Yu; Li, Jin-Ping; Yu, Jian-Min; Li, Yi-Ping; Chen, Ji-Ming

    2013-01-01

    The rapid discovery of novel viruses using next generation sequencing (NGS) technologies including DNA-Seq and RNA-Seq, has greatly expanded our understanding of viral diversity in recent years. The timely identification of novel viruses using NGS technologies is also important for us to control emerging infectious diseases caused by novel viruses. In this study, we identified a novel duck coronavirus (CoV), distinct with chicken infectious bronchitis virus (IBV), using RNA-Seq. The novel duck-specific CoV was a potential novel species within the genus Gammacoronavirus, as indicated by sequences of three regions in the viral 1b gene. We also performed a survey of CoVs in domestic fowls in China using reverse-transcription polymerase chain reaction (RT-PCR), targeting the viral nucleocapsid (N) gene. A total of 102 CoV positives were identified through the survey. Phylogenetic analysis of the viral N sequences suggested that CoVs in domestic fowls have diverged into several region-specific or host-specific clades or subclades in the world, and IBVs can infect ducks, geese and pigeons, although they mainly circulate in chickens. Moreover, this study provided novel data supporting the notion that some host-specific CoVs other than IBVs circulate in ducks, geese and pigeons, and indicated that the novel duck-specific CoV identified through RNA-Seq in this study is genetically closer to some CoVs circulating in wild water fowls. Taken together, this study shed new insight into the diversity, distribution, evolution and control of avian CoVs.

  11. Complete genome sequence of the novel duck hepatitis B virus strain SCP01 from Sichuan Cherry Valley duck.

    PubMed

    Li, Qingqing; Jia, Renyong; Liu, Siyang; Wang, Mingshu; Zhu, Dekang; Chen, Shun; Liu, Mafeng; Yin, Zhongqiong; Jing, Bo; Cheng, Anchun

    2016-01-01

    The duck hepatitis B virus (DHBV) strain, designated SCP01, was isolated and identified from a Sichuan Cherry Valley duck in Southwestern China. To determine the origination and evolution of this isolated strain, we carried out complete genome sequencing of this strain. Sequencing of the nucleotide sequence of DHBV strain SCP01 revealed a genome size of 3021 bp that contained three open reading frames, designated as C, S, and P, which were consistent with those of other duck hepatitis B viruses nucleotide sequences available in the GenBank of NCBI. Sequence comparisons based on the full-length genomic sequences showed that the DHBV SCP01 strain had the highest similarity (99.64 %) with the sequence of strain DHBV-XY, but had a lower similarity (90.04 %) with the sequence of strain DHBV CH5 isolated from Southwestern China. Phylogenetic analysis revealed that the DHBV-XY and DHBV SCP01 formed a branch that was clearly distinct from the other strains. This study show that the DHBV SCP01 strain from Sichuan belonged to "Western" isolates, while the DHBV CH5 from Sichuan belonged to "Chinese" isolates. These data will promote further research into the evolutionary biology, epidemiology and pathobiology of hepadnavirus infections. In addition, continuing duck hepatitis B virus surveillance in poultry is critical to understand the patterns of DHBV infection, and to find further animal infection models to study HBV infection.

  12. Postcatastrophe population dynamics and density dependence of an endemic island duck

    USGS Publications Warehouse

    Seavy, N.E.; Reynolds, M.H.; Link, W.A.; Hatfield, J.S.

    2009-01-01

    Laysan ducks (Anas laysanensis) are restricted to approximately 9 km2 in the Northwestern Hawaiian Islands, USA. To evaluate the importance of density dependence for Laysan ducks, we conducted a Bayesian analysis to estimate the parameters of a Gompertz model and the magnitude of process variation and observation error based on the fluctuations in Laysan duck abundance on Laysan Island from 1994 to 2007. This model described a stationary distribution for the population at carrying capacity that fluctuates around a long-term mean of 456 ducks and is between 316 to 636 ducks 95% of the time. This range of expected variability can be used to identify changes in population size that warn of catastrophic events. Density-dependent population dynamics may explain the recovery of Laysan duck from catastrophic declines and allow managers to identify population monitoring thresholds.

  13. [Effects of rice-duck farming system on biotic populations in paddy field].

    PubMed

    Yu, Sheng-miao; Zhu, Lian-feng; Ouyang, You-nan; Xu, De-hai; Jin, Qian-yu

    2008-04-01

    A field experiment was conducted to study the effects of rice-duck farming on the related biotic populations in paddy field. The results showed that rice-duck farming had greater effects on the occurrence and damage of pests, pathogens and weeds, as well as the amount of pests' natural enemies in paddy field. The population of rice planthopper and leafhopper decreased by 64.8% and 78.5% after 12 and 42 days of duck-release, and the weeds decreased by 67.7% and 98.1% after 15 and 45 days of duck-release, respectively, compared with the control. The sheath blight index at the maximum tillering stage and full-heading stage in the rice-duck plots were 40.4% and 62.0% lower than those in the control plot, respectively. The population of spiders in duck-released field was increased obviously, which in turn decreased the damage of rice pests.

  14. Subacute toxic effects of dietary T-2 toxin in young mallard ducks.

    PubMed Central

    Hayes, M A; Wobeser, G A

    1983-01-01

    Young Mallard ducks (Anas platyrhynchos) were fed diets containing purified T-2 toxin at levels of 20 or 30 ppm for two or three weeks. Ingestion of T-2 toxin was associated with reduced weight gain and delayed development of adult plumage. Affected ducks developed caseonecrotic plaques throughout the upper alimentary tract, especially in oropharynx and ventriculus. Several ducks also developed severe ulcerative, proliferative esophagitis and proventriculitis. Generalized atrophy of all lymphoid tissues consistently occurred. The manifestations of T-2 mycotoxicosis in Mallard ducks were mostly attributable to irritant toxicity to the alimentary mucosa. The T-2 toxin caused neither hematopoietic suppression nor a hemorrhagic syndrome in ducks. These alimentary lesions of T-2 mycotoxicosis in ducks do not resemble diseases of native waterfowl presently being recognized in routine surveillance of waterfowl mortality in Saskatchewan. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6883185

  15. Desalted duck egg white peptides promote calcium uptake by counteracting the adverse effects of phytic acid.

    PubMed

    Hou, Tao; Liu, Weiwei; Shi, Wen; Ma, Zhili; He, Hui

    2017-03-15

    The structure of the desalted duck egg white peptides-calcium chelate was characterized by fluorescence spectroscopy, fourier transform infrared spectroscopy, and dynamic light scattering. Characterization results showed structural folding and aggregation of amino acids or oligopeptides during the chelation process. Desalted duck egg white peptides enhanced the calcium uptake in the presence of oxalate, phosphate and zinc ions in Caco-2 monolayers. Animal model indicated that desalted duck egg white peptides effectively enhanced the mineral absorption and counteracted the deleterious effects of phytic acid. These findings suggested that desalted duck egg white peptides might promote calcium uptake in three pathways: 1) desalted duck egg white peptides bind with calcium to form soluble chelate and avoid precipitate; 2) the chelate is absorbed as small peptides by enterocyte; and 3) desalted duck egg white peptides regulate the proliferation and differentiation of enterocytes through the interaction with transient receptor potential vanilloid 6 calcium channel.

  16. Prevalence of Opisthorchis viverrini-Like Fluke Infection in Ducks in Binh Dinh Province, Central Vietnam.

    PubMed

    Dao, Thanh Thi Ha; Abatih, Emmanuel Nji; Nguyen, Thanh Thi Giang; Tran, Ha Thi Lam; Gabriël, Sarah; Smit, Suzanne; Le, Phap Ngoc; Dorny, Pierre

    2016-06-01

    Following the first report of Opisthorchis viverrini infection in a domestic duck in Phu My District of Binh Dinh Province, Central Vietnam, many other cases were observed in the province. We determined the infection rate and intensity of O. viverrini infection in ducks in 4 districts of the province. A total of 178 ducks were randomly selected from 34 farms for examination of flukes in the liver and gall bladder. An infection rate of 34.3% (range 20.7-40.4% among districts) was found; the intensity of infection was 13.8 worms per infected duck (range 1-100). These findings show the role of ducks as a host for O. viverrini, duck genotype, which is sympatric with the human O. viverrini genotype in this province. It also stresses the need for investigations on the zoonotic potential and the life cycle of this parasite.

  17. Prevalence of Opisthorchis viverrini-Like Fluke Infection in Ducks in Binh Dinh Province, Central Vietnam

    PubMed Central

    Dao, Thanh Thi Ha; Abatih, Emmanuel Nji; Nguyen, Thanh Thi Giang; Tran, Ha Thi Lam; Gabriël, Sarah; Smit, Suzanne; Le, Phap Ngoc; Dorny, Pierre

    2016-01-01

    Following the first report of Opisthorchis viverrini infection in a domestic duck in Phu My District of Binh Dinh Province, Central Vietnam, many other cases were observed in the province. We determined the infection rate and intensity of O. viverrini infection in ducks in 4 districts of the province. A total of 178 ducks were randomly selected from 34 farms for examination of flukes in the liver and gall bladder. An infection rate of 34.3% (range 20.7-40.4% among districts) was found; the intensity of infection was 13.8 worms per infected duck (range 1-100). These findings show the role of ducks as a host for O. viverrini, duck genotype, which is sympatric with the human O. viverrini genotype in this province. It also stresses the need for investigations on the zoonotic potential and the life cycle of this parasite. PMID:27417094

  18. Vaccination of ducks with a whole-cell vaccine expressing duck hepatitis B virus core antigen elicits antiviral immune responses that enable rapid resolution of de novo infection.

    PubMed

    Miller, Darren S; Halpern, Michael; Kotlarski, Ieva; Jilbert, Allison R

    2006-05-10

    As a first step in developing immuno-therapeutic vaccines for patients with chronic hepatitis B virus infection, we examined the ability of a whole-cell vaccine, expressing the duck hepatitis B virus (DHBV) core antigen (DHBcAg), to target infected cells leading to the resolution of de novo DHBV infections. Three separate experiments were performed. In each experiment, ducks were vaccinated at 7 and 14 days of age with primary duck embryonic fibroblasts (PDEF) that had been transfected 48 h earlier with plasmid DNA expressing DHBcAg with and without the addition of anti-DHBcAg (anti-DHBc) antibodies. Control ducks were injected with either 0.7% NaCl or non-transfected PDEF. The ducks were then challenged at 18 days of age by intravenous inoculation with DHBV (5 x 10(8) viral genome equivalents). Liver biopsies obtained on day 4 post-challenge demonstrated that vaccination did not prevent infection of the liver as similar numbers of infected hepatocytes were detected in all vaccinated and control ducks. However, analysis of liver tissue obtained 9 or more days post-challenge revealed that 9 out of 11 of the PDEF-DHBcAg vaccinated ducks and 8 out of 11 ducks vaccinated with PDEF-DHBcAg plus anti-DHBc antibodies had rapidly resolved the DHBV infection with clearance of infected cells. In contrast, 10 out of 11 of the control unvaccinated ducks developed chronic DHBV infection. In conclusion, vaccination of ducks with a whole-cell PDEF vaccine expressing DHBcAg elicited immune responses that induced a rapid resolution of DHBV infection. The results establish that chronic infection can be prevented via the vaccine-mediated induction of a core-antigen-specific immune response.

  19. Efficacy assessment of an inactivated Tembusu virus vaccine candidate in ducks.

    PubMed

    Zhang, Lijiao; Li, Zhanhong; Zhang, Qingshui; Sun, Mengxu; Li, Shuang; Su, Wenliang; Hu, Xueying; He, Weiyong; Su, Jingliang

    2017-02-01

    Duck Tembusu virus (TMUV) is a recently identified pathogen that causes severe egg drop and neurological disease in domestic duck and goose flocks. The infection has spread across the China mainland since its outbreak in 2010. Effective vaccines are needed to fight the disease. In this work, we describe the development and laboratory assessment of a cell culture-derived, inactivated duck TMUV vaccine. The TMUV-JXSP strain was successfully propagated on a baby hamster kidney cell line (BHK-21), inactivated with beta-propiolactone (BPL) and emulsified with mineral oil. The efficacy of different vaccination schedules was assessed in laying ducks and table ducks using virus challenge experiments. Two doses of vaccine provided efficient protection against the virus challenge to avoid the egg production drop in laying ducks. An ELISA demonstrated that 97% (39/40) of ducks seroconverted on day 21 after one dose of the inactivated vaccine and that significant increases in antibody titers against the virus were induced after the second immunization. For table ducks, a single dose of vaccine immunization resulted in a protection index of 87% and significant reduction of viral loads in tissues. Sterilizing immunity can be attained after second immunization. Our results demonstrate that BHK-21 cell culture is suitable for duck TMUV propagation and that BPL-inactivated TMUV vaccine can provide a high level of protection from virus challenge in laying ducks and table ducks. These data provide a scientific basis for the development of an inactivated vaccine for the prevention of duck TMUV infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Evaluation of an aerial survey to estimate abundance of wintering ducks in Mississippi

    USGS Publications Warehouse

    Pearse, A.T.; Dinsmore, S.J.; Kaminski, R.M.; Reinecke, K.J.

    2008-01-01

    Researchers have successfully designed aerial surveys that provided precise estimates of wintering populations of ducks over large physiographic regions, yet few conservation agencies have adopted these probability-based sampling designs for their surveys. We designed and evaluated an aerial survey to estimate abundance of wintering mallards {Anas platyrhynchos), dabbling ducks (tribe Anatini) other than mallards, diving ducks (tribes Aythini, Mergini, and Oxyurini), and total ducks in western Mississippi, USA. We used design-based sampling of fixed width transects to estimate population indices (I??), and we used model-based methods to correct population indices for visibility bias and estimate population abundance (N??) for 14 surveys during winters 2002-2004. Correcting for bias increased estimates of mallards, other dabbling ducks, and diving ducks by an average of 40-48% among all surveys and contributed 48-61% of the estimated variance of N??. However, mean-squared errors were consistently less for N?? than I??. Estimates of N?? met our goals for precision (CV ??? 15%) in 7 of 14 surveys for mallards, 5 surveys for other dabbling ducks, no surveys for diving ducks, and 10 surveys for total ducks. Generally, we estimated more mallards and other dabbling ducks in mid- and late winter (Jan-Feb) than early winter (Nov-Dec) and determined that population indices from the late 1980s were nearly 3 times greater than those from our study. We developed a method to display relative densities of ducks spatially as an additional application of survey data. Our study advanced methods of estimating abundance of wintering waterfowl, and we recommend this design for continued monitoring of wintering ducks in western Mississippi and similar physiographic regions.

  1. Evaluation of an aerial survey to estimate abundance of wintering ducks in Mississippi

    USGS Publications Warehouse

    Pearse, A.T.; Dinsmore, S.J.; Kaminski, R.M.; Reinecke, K.J.

    2008-01-01

    Researchers have successfully designed aerial surveys that provided precise estimates of wintering populations of ducks over large physiographic regions, yet few conservation agencies have adopted these probability-based sampling designs for their surveys. We designed and evaluated an aerial survey to estimate abundance of wintering mallards {Anas platyrhynchos), dabbling ducks (tribe Anatini) other than mallards, diving ducks (tribes Aythini, Mergini, and Oxyurini), and total ducks in western Mississippi, USA. We used design-based sampling of fixed width transects to estimate population indices (I?), and we used model-based methods to correct population indices for visibility bias and estimate population abundance (N?) for 14 surveys during winters 2002-2004. Correcting for bias increased estimates of mallards, other dabbling ducks, and diving ducks by an average of 40-48% among all surveys and contributed 48-61% of the estimated variance of N?. However, mean-squared errors were consistently less for N? than I?. Estimates of N? met our goals for precision (CV < 15%) in 7 of 14 surveys for mallards, 5 surveys for other dabbling ducks, no surveys for diving ducks, and 10 surveys for total ducks. Generally, we estimated more mallards and other dabbling ducks in mid- and late winter (Jan-Feb) than early winter (Nov-Dec) and determined that population indices from the late 1980s were nearly 3 times greater than those from our study. We developed a method to display relative densities of ducks spatially as an additional application of survey data. Our study advanced methods of estimating abundance of wintering waterfowl, and we recommend this design for continued monitoring of wintering ducks in western Mississippi and similar physiographic regions.

  2. Prevalence and antibiotic resistance of Campylobacter, Salmonella, and L. monocytogenes in ducks: a review.

    PubMed

    Adzitey, Frederick; Huda, Nurul; Ali, Gulam Rusul Rahmat

    2012-06-01

    Campylobacter, Salmonella, and Listeria monocytogenes are important bacterial pathogens associated with gastroenteritis. The consumption of poultry meat and their products is considered as a major and leading source of human infection. While surveys of chicken meat and products, and its association with foodborne pathogens are widely available, such information on ducks is scarce. This survey examines the prevalence and antibiotic resistance of Campylobacter, Salmonella and L. monocytogenes isolated from ducks. Data obtained from key surveys are summarized. The observed prevalence of these pathogens and their resistance to various antibiotics varies from one study to the other. The mean prevalence (and range means from individual surveys) are duck 53.0% (0.0-83.3%), duck meat and parts 31.6% (12.5-45.8%), and duck rearing and processing environment 94.4% (92.0-96.7%) for Campylobacter spp. For Salmonella spp., the mean prevalence data are duck 19.9% (3.3-56.9%), duck meat and parts 28.4% (4.4-75.6%), duck egg, shell, and content 17.5% (0-4.17%), and duck rearing and processing environment 32.5% (10.5-82.6%). Studies on the prevalence and antibiotic resistance of L. monocytogenes in ducks are by far very rare compared to Campylobacter and Salmonella, although ducks have been noted to be a potential source for these foodborne pathogens. From our survey, ducks were more frequently contaminated with Campylobacter than Salmonella. Campylobacter and Salmonella spp. also exhibited varying resistance to multiple antibiotics.

  3. Water Resources of the Duck River Watershed, Tennessee

    USGS Publications Warehouse

    Knight, R.R.; Kingsbury, J.A.

    2007-01-01

    The U.S. Geological Survey began a study in 2003 in cooperation with the Tennessee Duck River Development Agency to assess the hydrology of the Duck River watershed from Normandy Dam downstream to Columbia, Tennessee. Ground-water-level data, spring-flow, bacteria samples, and streamflow were collected during this study to characterize the hydrology of the study area. The emphasis of this study was to characterize the temporal and spatial variability of the various components that make up streamflow in the Duck River in this study area. Water-level data from wells in the study area indicate a good hydraulic connection between the aquifer and the river, with little long-term storage of water following recharge events. Variations in spring flow and ground-water temperature at springs indicate that a large component of water issuing from springs has a short residence time in the aquifer for most of the springs monitored in the study area. Escherichia coli densities in samples collected from springs are similar to concentrations in samples from tributaries and the Duck River. Base-flow synoptic discharge measurements, flow-duration analysis of tributary streams, and streamflow accounting analysis indicate the portion of the watershed between Pottsville and Columbia yields more water than the portion between Shelbyville and Pottsville. Base-flow synoptic measurements show that Fountain Creek yields more water than other tributary basins in the study area, whereas base-flow synoptic measurements on the mainstem indicate that streamflow in the Duck River between Pottsville and Columbia could vary by 10 percent as the result of gaining and losing reaches. These results are applicable for average flow conditions that occurred during the study. Flow-duration analysis indicates that tributaries in this part of the watershed have a large component of ground-water contributing base flow. Streamflow accounting analysis for two periods of extended recession was used to determine

  4. [Intestinal nematodes of the Aythyini ducks in Western Pomerania].

    PubMed

    Kavetska, Katarzyna M

    2005-01-01

    Intestinal nematodes of the Aythyini ducks in Western Pomerania. Biology, including ecology, of the Aythyini renders them particularly attractive subjects of parasitological studies. The tribe is represented in Poland by 4 nesting species; two of them, Aythya fuligula and A. ferina, are very abundant game birds. However, their helminth fauna, including nematodes, is still very poorly known. This study was aimed at quantifying the structure of parasitic intestinal nematodes of the Western Pomeranian Aythyini. The study, performed in 1999-2004, involved a total of 71 ducks representing 3 species: A. ferina, A. fuligula, and A. marila. The nematodes, isolated from the intestines, were fixed in 75% ethyl alcohol and cleared in lactic acid. Among the 9668 helminth individuals found, 589 (6.1%) represented the phylum Nematoda. They were found in 57 ducks (80.3% of all the ducks examined). The nematodes belonged to the following 4 families: Amidostomatidae, Tetrameridae, Acuariidae, and Trichuridae. They were identified as representing 8 species, 2 genera (Amidostomoides sp. and Tetrameres sp.), and 1 subfamily (Capillariinae gen. sp.); in addition, 1 damaged individual could be identified as a nematode only. The highest prevalence (57.8%), at mean intensity (4.8 inds), was typical of Amidostomoides petrovi (Shakhtahtinskaya, 1956) Lomakin, 1991, while Tetrameres fissispina (Diesing, 1861) Travassos, 1914 occurred with the highest intensity (15.1 inds) and 12.7% prevalence. Nematodes of the subfamily Capillariinae occurred with a fairly high intensity (averaging 10.0 inds) as well, although their prevalence was not high, either (4.2% of all ducks were infected). The nematofauna studied was clearly dominated by A. petrovi, T. fissispina, and Capillaria anatis (Schrank, 1790). The total frequency of occurrence of those species was close to 80%; their dominance indices exceeded the threshold value of 0.1 and amounted to 1.6 (the dominant A. petrovi), 0.2, and 0.5 (the

  5. Comparative Study on the Nutritional Value of Pidan and Salted Duck Egg

    PubMed Central

    Kaewmanee, T.; Benjakul, S.

    2014-01-01

    Pidan and salted duck eggs are of nutritional rich alternative duck egg products which are predominantly consumed in China, Thailand, South Korea and other Chinese migrated countries. Both eggs are rich in proteins, lipids, unsaturated fatty acids and minerals. A Pidan whole egg contains 13.1% of protein, 10.7% of fat, 2.25% of carbohydrate and 2.3% of ash, whereas the salted duck egg contains 14% of protein, 16.6% of fat, 4.1% of carbohydrate and 7.5% of ash. The fresh duck egg contains a range of 9.30-11.80% of protein, 11.40-13.52% of fat, 1.50-1.74% of sugar and 1.10-1.17% of ash. Proteins, lipids, and ash contents are found to be greatly enhanced during the pickling and salting process of pidan and salted duck eggs. However, the alkaline induced aggregation of pidan leads to degradation and subsequent generation of free peptides and amino acids. Very few amino acids are found to be lost during the pickling and storage. However, no such losses of amino acids are reported in salted duck eggs during the salting process of 14 d. Phospholipids and cholesterol contents are lower in pidan oil and salted duck egg yolk oil. Thus, the pidan and salted duck eggs are nutritionally rich alternatives of duck egg products which will benefit the human health during consumption. PMID:26760738

  6. Comparative Study on the Nutritional Value of Pidan and Salted Duck Egg.

    PubMed

    Ganesan, P; Kaewmanee, T; Benjakul, S; Baharin, B S

    2014-01-01

    Pidan and salted duck eggs are of nutritional rich alternative duck egg products which are predominantly consumed in China, Thailand, South Korea and other Chinese migrated countries. Both eggs are rich in proteins, lipids, unsaturated fatty acids and minerals. A Pidan whole egg contains 13.1% of protein, 10.7% of fat, 2.25% of carbohydrate and 2.3% of ash, whereas the salted duck egg contains 14% of protein, 16.6% of fat, 4.1% of carbohydrate and 7.5% of ash. The fresh duck egg contains a range of 9.30-11.80% of protein, 11.40-13.52% of fat, 1.50-1.74% of sugar and 1.10-1.17% of ash. Proteins, lipids, and ash contents are found to be greatly enhanced during the pickling and salting process of pidan and salted duck eggs. However, the alkaline induced aggregation of pidan leads to degradation and subsequent generation of free peptides and amino acids. Very few amino acids are found to be lost during the pickling and storage. However, no such losses of amino acids are reported in salted duck eggs during the salting process of 14 d. Phospholipids and cholesterol contents are lower in pidan oil and salted duck egg yolk oil. Thus, the pidan and salted duck eggs are nutritionally rich alternatives of duck egg products which will benefit the human health during consumption.

  7. Molecular cloning and mRNA expression of duck invariant chain.

    PubMed

    Zhong, Dalian; Yu, Weiyi; Bao, Min; Xu, Zhiben; Li, Lin; Liu, Jing

    2006-04-15

    In the present study we identified a duck invariant chain (Ii) cDNA, named duck Ii-1, by RT-PCR and RACE. It was 1190 bp in length and contained a 669 bp open reading frame. An alternative transcript encoding a thyroglobulin (Tg)-containing form of Ii, named duck Ii-2, was also found in duck. The putative amino acid sequence of duck Ii-1 showed an 82% similarity to chicken Ii-1 and about 60% similarity to its mammalian homologues. The similarity of the Tg domain between duck and chicken Ii-2 was 96%, and about 70% between duck and mammalian Ii. The result of RT-PCR showed that Ii mRNA was extensively expressed in various tissues. High levels of both Ii-1 and Ii-2 mRNA were observed in the spleen and bursa of Fabricius. The predicted three-dimensional (3D) structures of duck Ii trimerization and Tg domain are similar to the corresponding regions of human Ii analyzed by comparative protein modeling. These findings indicate that the two isoforms of duck Ii, which strongly expressed in the major immune organs, share structural identity with human Ii.

  8. [Isolation of the influenza virus from ducks in the Aral Sea region].

    PubMed

    Chernetsov, Iu V; Slepushkin, A N; L'vov, D K; Miasnikova, I A; Khrokov, V V

    1980-01-01

    Influenza A/duck/Aralsk/1/78 virus was isolated from ducks in southwestern Kazakhstan. Typing of this virus neuraminidase indicated its appurtenance to the 2nd avian type. Hemagglutinin of A/duck/Aralsk/1/78 virus typed by the HI test showed no relationship with any one of the strains used in the test including H0, H1, H2, H3, Hsw1, Heq1, Heq2, viruses and strains with all 10 avian hemagglutinins. This suggests that hemagglutinin of A/duck/Aralsk/1/78 virus (Hav?Nav2) belongs to a new, hitherto unknown type.

  9. Microwave irradiation of nanohydroxyapatite from chicken eggshells and duck eggshells.

    PubMed

    Sajahan, Nor Adzliana; Wan Ibrahim, Wan Mohd Azhar

    2014-01-01

    Due to similarity in composition to the mineral component of bones and human hard tissues, hydroxyapatite with chemical formula Ca10(PO4)6(OH)2 has been widely used in medical field. Both chicken and duck eggshells are mainly composed of calcium carbonate. An attempt has been made to fabricate nanohydroxyapatite (nHA) by chicken (CES) and duck eggshells (DES) as calcium carbonate source (CaCO3). CES and DES were reacted with diammonium hydrogen [(NH4)2HPO4] solution and subjected to microwave heating at 15 mins. Under the effect of microwave irradiation, nHA was produced directly in the solution and involved in crystallographic transformation. Sample characterization was done using by X-ray diffraction (XRD), fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM).

  10. Haldane's rule and American black duck x mallard hybridization

    USGS Publications Warehouse

    Kirby, R.E.; Sargeant, G.A.; Shutler, D.

    2004-01-01

    Species ratios and rangewide distributions of American black ducks (Anas rubripes Brewster, 1902) and mallards (Anas platyrhynchos L., 1758) have undergone recent changes. Mechanisms behind these changes are not known with certainty, but recent investigations have focused on the possibility of competitive exclusion and the consequences of hybridization. Consequences of hybridization have been difficult to assess because of the difficulty in identifying hybrids beyond the F1 generation and lack of means to quantify introgression in wild populations. We documented a postmating isolating mechanism between the two species that follows Haldane's rule in controlled, interspecific matings in captive populations. Hybridization reduces the proportion of F1 females available to return to the breeding grounds in the subsequent year. This effect, although likely small in overall population consequences in any year, may be of local significance and may contribute to recent reports of range shifts in both American black ducks and mallards. ?? 2004 NRC.

  11. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  12. Microwave Irradiation of Nanohydroxyapatite from Chicken Eggshells and Duck Eggshells

    PubMed Central

    Sajahan, Nor Adzliana; Wan Ibrahim, Wan Mohd Azhar

    2014-01-01

    Due to similarity in composition to the mineral component of bones and human hard tissues, hydroxyapatite with chemical formula Ca10(PO4)6(OH)2 has been widely used in medical field. Both chicken and duck eggshells are mainly composed of calcium carbonate. An attempt has been made to fabricate nanohydroxyapatite (nHA) by chicken (CES) and duck eggshells (DES) as calcium carbonate source (CaCO3). CES and DES were reacted with diammonium hydrogen [(NH4)2HPO4] solution and subjected to microwave heating at 15 mins. Under the effect of microwave irradiation, nHA was produced directly in the solution and involved in crystallographic transformation. Sample characterization was done using by X-ray diffraction (XRD), fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM). PMID:25383364

  13. Food use and nutrition of black ducks nesting in Maine

    USGS Publications Warehouse

    Reinecke, K.J.; Owen, R.B.

    1980-01-01

    Based on 32 adult black ducks (Anas rubripes) collected during the nesting seasons of 1974-76, the proportion of macro invertebrates (as aggregate [average] percent of dry weight) in the diet of males, egg-laying females, and postlaying females was 60, 75, and 55%, respectivey. Sample sizes were small, and the differences associated with sex and reproductive condition were not signficant. Molluscs, Isopods, ephemeropteran and odonate nymphs, and coleopteran, trichopteran, and dipteran larvae contributed 74% of the dry weight and 64% of the gross energy ingested. Data from proximate analyses of 9 invertebrate and 9 plant foods were combined with food habits data to estimate the nutrients available to breeding hens. We concluded that females with access to an adequate amount of natural food including invertebrates and the seeds and tubers of aquatic plants would obtain sufficient minerals, protein, and energy for reproduction. Food quality does not appear to limit the density of black ducks nesting in Maine.

  14. The vaccine efficacy of recombinant duck enteritis virus expressing secreted E with or without PrM proteins of duck tembusu virus.

    PubMed

    Chen, Pucheng; Liu, Jinxiong; Jiang, Yongping; Zhao, Yuhui; Li, Qimeng; Wu, Li; He, Xijun; Chen, Hualan

    2014-09-15

    A newly emerged tembusu virus that causes egg-drop has been affecting ducks in China since 2010. Currently, no vaccine is available for this disease. A live attenuated duck enteritis virus (DEV; a herpesvirus) vaccine has been used routinely to control lethal DEV in ducks since the 1960s. Here, we constructed two recombinant DEVs by transfecting overlapping fosmid DNAs. One virus, rDEV-TE, expresses the truncated form of the envelope glycoprotein (TE) of duck tembusu virus (DTMUV), and the other virus, rDEV-PrM/TE, expresses both the TE and pre-membrane proteins (PrM). Animal study demonstrated that both recombinant viruses induced measurable anti-DTMUV neutralizing antibodies in ducks. After two doses of recombinant virus, rDEV-PrM/TE completely protected ducks from DTMUV challenge, whereas rDEV-TE only conferred partial protection. These results demonstrate that recombinant DEV expressing the TE and pre-membrane proteins is protective and can serve as a potential candidate vaccine to prevent DTMUV infection in ducks.

  15. Development and application of an indirect immunoperoxidase assay for the detection of Duck swollen head hemorrhagic disease virus antigen in Pekin ducks (Anas platyrhynchos).

    PubMed

    Li, Chuanfeng; Shen, Chanjuan; Cheng, Anchun; Wang, Mingshu; Zhang, Na; Zhou, Yi; Zhu, Dekang; Jia, Renyong; Luo, Qihui; Chen, Xiaoyue

    2010-01-01

    An improved indirect immunoperoxidase assay (IPA) was developed to detect antigens of Duck swollen head hemorrhagic disease virus (DSHDV) in paraformaldehyde-fixed, paraffin-embedded tissues of Pekin ducks (Anas platyrhynchos). This technique used an indirect streptavidin-alkaline phosphatase labeling system with polyclonal antiserum developed against purified DSHDV antigens. Specimens from the experimentally inoculated Pekin ducks with DSHDV and archived paraffin-embedded tissues from natural cases of Duck viral swollen head hemorrhagic disease (DVSHD) were examined by clinical and histological criteria. Positive staining was most widely observed in the cytoplasm of the following organs: immune, digestive, and urinary organs, heart, lung, and trachea, which corresponded to the intracellular distribution of reovirus. The DSHDV antigens were first detected at 4 hr postinoculation in the bursa of Fabricius of infected ducks. Therefore, this method was suitable for the early diagnosis of DVSHD. Immunoperoxidase staining was not present in tissues and organs of sham-inoculated ducks (negative control). The IPA developed in the current study is a convenient, sensitive, and specific means of detecting DSHDV and is applicable to routine diagnosis, retrospective studies, and prospective studies of DSHDV infection in ducks.

  16. Altered avoidance behavior of young black ducks fed cadmium

    USGS Publications Warehouse

    Heinz, G.H.; Haseltine, S.D.; Sileo, L.

    1983-01-01

    Pairs of adult black ducks (Anas rubripes) were fed a diet containing 0, 4 or 40 ppm cadmium as cadmium chloride. One-week-old ducklings that had been fed thc same dietary concentrations of cadmium as had their parents were tested for avoidance of a fright stimulus. Ducklings fed 4 ppm cadmium ran significantly farther from the stimulus than did controls or ducklings fed 40 ppm cadmium. Such an alteration in behavior could have harmful effects on wild birds.

  17. A cable-chain device for locating duck nests

    USGS Publications Warehouse

    Higgins, K.F.; Kirsch, L.M.; Ball, I.J.

    1969-01-01

    A cable-chain device towed between two vehicles was developed for locating occupied duck nests in brushy, herbaceous, and grassy cover types. Twenty-three of 29 previously located gadwall (Anas strepera) and blue-winged teal (A. discors) hens were flushed from their nests with the drag for an efficiency of 79 percent. Eighty acres of nesting cover can be searched in 4-6 hours by the method described.

  18. Sulfated polyanions do not inhibit duck hepatitis B virus infection.

    PubMed Central

    Offensperger, W B; Offensperger, S; Walter, E; Blum, H E; Gerok, W

    1991-01-01

    On the basis of the antiviral action of sulfated polyanions in human immunodeficiency virus and other viral infections, we studied the effect of dextran sulfate and heparin on duck hepatitis B virus infection. These agents do not affect viral uptake and replication in liver cells in vitro or in vivo. Sulfated polyanions, therefore, appear to have no potential for the treatment of hepadnavirus infections. Images PMID:1804020

  19. Effects of influenza A virus infection on migrating mallard ducks.

    PubMed

    Latorre-Margalef, Neus; Gunnarsson, Gunnar; Munster, Vincent J; Fouchier, Ron A M; Osterhaus, Albert D M E; Elmberg, Johan; Olsen, Björn; Wallensten, Anders; Haemig, Paul D; Fransson, Thord; Brudin, Lars; Waldenström, Jonas

    2009-03-22

    The natural reservoir of influenza A virus is waterfowl, particularly dabbling ducks (genus Anas). Although it has long been assumed that waterfowl are asymptomatic carriers of the virus, a recent study found that low-pathogenic avian influenza (LPAI) infection in Bewick's swans (Cygnus columbianus bewickii) negatively affected stopover time, body mass and feeding behaviour. In the present study, we investigated whether LPAI infection incurred ecological or physiological costs to migratory mallards (Anas platyrhynchos) in terms of body mass loss and staging time, and whether such costs could influence the likelihood for long-distance dispersal of the avian influenza virus by individual ducks. During the autumn migrations of 2002-2007, we collected faecal samples (n=10918) and biometric data from mallards captured and banded at Ottenby, a major staging site in a flyway connecting breeding and wintering areas of European waterfowl. Body mass was significantly lower in infected ducks than in uninfected ducks (mean difference almost 20 g over all groups), and the amount of virus shed by infected juveniles was negatively correlated with body mass. There was no general effect of infection on staging time, except for juveniles in September, in which birds that shed fewer viruses stayed shorter than birds that shed more viruses. LPAI infection did not affect speed or distance of subsequent migration. The data from recaptured individuals showed that the maximum duration of infection was on average 8.3 days (s.e. 0.5), with a mean minimum duration of virus shedding of only 3.1 days (s.e. 0.1). Shedding time decreased during the season, suggesting that mallards acquire transient immunity for LPAI infection. In conclusion, deteriorated body mass following infection was detected, but it remains to be seen whether this has more long-term fitness effects. The short virus shedding time suggests that individual mallards are less likely to spread the virus at continental or

  20. Breeding biology and habitat use of black ducks

    USGS Publications Warehouse

    Owen, R.; Longcore, J.; Ringelman, J.; Reinecke, K.; Hendrix, K.

    1989-01-01

    Forested wetlands are Important habitats for black ducks nesting in the Northeast. Invertebrates, with their high protein content, are primary foods of females during egg laying and for rapidly growing ducklings. Beaver-created and modified wetlands provide excellent habitat for feeding as well as protective cover. As these wetlands age, their quality declines after 7-10 years, and waterfowl use diminishes. Wetland availability and quality should be considered when managing beaver.

  1. Selenium accumulation in sea ducks wintering at Lake Ontario.

    PubMed

    Schummer, Michael L; Badzinski, Shannon S; Petrie, Scott A; Chen, Yu-Wei; Belzile, Nelson

    2010-04-01

    Numbers of wintering sea ducks, including buffleheads (Bucephala albeola; BUFF), common goldeneyes (Bucephala clangula; COGO), and long-tailed ducks (Clangula hyemalis; LTDU), increased substantially at Lake Ontario after Dreissenid mussels (Dreissena bugensis and D. polymorpha) colonized the Great Lakes. Invertebrates, including Dreissenid mussels, are major diving duck prey items that can transfer some trace elements, such as selenium (Se) to higher trophic levels. Se can be problematic for waterfowl and it often has been detected at elevated levels in organisms using the Great Lakes. There are, however, few data on hepatic Se concentrations in sea ducks, particularly during the winter at Lake Ontario. In this study, we evaluated interspecific differences and temporal trends in hepatic Se concentrations among BUFF (n = 77), COGO (n = 77), and LTDU (n = 79) wintering at Lake Ontario. All three species accumulated Se throughout winter, but COGO did so at a higher rate than did BUFF and LTDU. Overall, Se concentrations were higher in LTDU [mean = 22.7; 95% CI = 20.8-24.8 microg/g dry weight (dw)] than in BUFF ([mean = 12.3; 95% CI = 11.6-13.1 microg/g dw) and COGO ([mean = 12.0; 95% CI = 10.7-3.5 microg/g dw) throughout the winter. Se concentrations were deemed elevated (>33 microg/g dw) in 0%, 5%, and 19% of BUFF, COGO, and LTDU, respectively. Presently there are no data on Se toxicity end points for these species, so it is unclear how acquiring concentrations of these magnitudes affect their short- and long-term health or reproduction.

  2. Contaminants and sea ducks in Alaska and the circumpolar region

    USGS Publications Warehouse

    Henny, C.J.; Rudis, D.D.; Roffe, T.J.; Robinson-Wilson, E.

    1995-01-01

    We review nesting sea duck population declines in Alaska during recent decades and explore the possibility that contaminants may be implicated. Aerial surveys of the surf scoter (Melanitta perspicillata) , white-winged scoter (M. fusca) , black scoter (M. nigra) , oldsquaw (Clangula hyemalis) , spectacled eider (Somateria fischeri) , and Steller's eider (Polysticta stelleri) show long-term breeding population declines, especially the latter three species. The spectacled eider was recently classified threatened under the Endangered Species Act. In addition, three other diving ducks, which commonly winter in coastal areas, have declined from unknown causes. Large die-offs of all three species of scoters during molt, a period of high energy demand, were documented in August 1990, 1991, and 1992 at coastal reefs in southeastern Alaska. There was no evidence of infectious diseases in those scoters. The die-offs may or may not be associated with the long-term declines. Many scoters had elevated renal concentrations of cadmium (high of 375 ?g/g dry weight [dw]). Effects of cadmium in sea ducks are not well understood. Selenium concentrations in livers of nesting white-winged scoters were high ; however, the eggs they laid contained less selenium than expected based on relationships for freshwater bird species. Histological evaluation found a high prevalence of hepatocellular vacuolation (49%) , a degenerative change frequently associated with sublethal toxic insult. Cadmium and selenium mean liver concentrations were generally higher in those birds with more severe vacuolation ; however, relationships were not statistically significant. We do not know if sea duck population declines are related to metals or other contaminants.

  3. Contaminants and sea ducks in Alaska and the circumpolar region

    USGS Publications Warehouse

    Henny, Charles J.; Rudis, Deborah D.; Roffe, Thomas J.; Robinson-Wilson, Everett

    1995-01-01

    We review nesting sea duck population declines in Alaska during recent decades and explore the possibility that contaminants may be implicated. Aerial surveys of the surf scoter (Melanitta perspicillata), white-winged scoter (M. fusca), black scoter (M. nigra), oldsquaw (Clangula hyemalis), spectacled eider (Somateria fischeri), and Steller's eider (Polysticta stelleri) show long-term breeding population declines, especially the latter three species. The spectacled eider was recently classified threatened under the Endangered Species Act. In addition, three other diving ducks, which commonly winter in coastal areas, have declined from unknown causes. Large die-offs of all three species of scoters during molt, a period of high energy demand, were documented in August 1990, 1991, and 1992 at coastal reefs in southeastern Alaska. There was no evidence of infectious diseases in those scoters. The die-offs may or may not be associated with the long-term declines. Many scoters had elevated renal concentrations of cadmium (high of 375 μg/g dry weight [dw]). Effects of cadmium in sea ducks are not well understood. Selenium concentrations in livers of nesting white-winged scoters were high; however, the eggs they laid contained less selenium than expected based on relationships for freshwater bird species. Histological evaluation found a high prevalence of hepatocellular vacuolation (49%), a degenerative change frequently associated with sublethal toxic insult. Cadmium and selenium mean liver concentrations were generally higher in those birds with more severe vacuolation; however, relationships were not statistically significant. We do not know if sea duck population declines are related to metals or other contaminants.

  4. Molecular cloning of prolactin receptor of the Peking duck.

    PubMed

    Wang, J; Hou, S S; Huang, W; Yang, X G; Zhu, X Y; Liu, X L

    2009-05-01

    Prolactin receptor (PRLR) cDNA of Peking duck was cloned using reverse transcription-PCR methodology (GenBank accession no. EF502054). The duck PRLR (dPRLR) cDNA contains 2,439 bp including the ATG start codon and TAA stop that encodes 832 amino acid residues. The putative receptor protein had 2 strong hydrophobic stretches: one was the signal sequence in N-terminal region and the other was the single transmembrane region of 24 amino acid residues in the central portion. Excluding the signal sequence, the mature dPRLR contained 808 amino acid residues with a theoretical molecular mass of 91.5 kDa. The mature protein could be divided into 3 domains, extracellular domain (ECD), transmembrane domain, and intracellular domain. The ECD contained 2 homologous repeat units with approximately 67% amino acid sequence identity to each other. The membrane distal unit and proximal unit consisted of 204 and 212 amino acids, respectively. Each unit was similar to the singular ECD of the mammalian PRLR. The characteristic extracellular cysteines and the WSXWS motif of the cytokine receptor were conserved in both repeat units. The intracellular domain of dPRLR consisted of 368 amino acids at the C-terminus and contained 2 conserved regions-box 1 and box 2. The aforementioned characters of duck were all similar to chicken and mammalians, which implied that the dPRLR had same mechanism with other species. Sequence similarity analysis shows that the dPRLR shares approximately 45 to 97% amino identity and approximately 30 to 96% nucleic acid identity as compared with other species. Overall, the greatest sequence identity was found with goose PRLR. In a phylogenetic analysis, the duck PRLR was found to cluster with the PRLR of goose, turkey, chicken, and pigeon. Semiquantitative reverse transcription-PCR indicated that dPRLR mRNA was expressed in all 8 tissues. Expression in the kidney was greatest in varietals tissues.

  5. Contaminants and sea ducks in Alaska and the circumpolar region.

    PubMed Central

    Henny, C J; Rudis, D D; Roffe, T J; Robinson-Wilson, E

    1995-01-01

    We review nesting sea duck population declines in Alaska during recent decades and explore the possibility that contaminants may be implicated. Aerial surveys of the surf scoter (Melanitta perspicillata), white-winged scoter (M. fusca), black scoter (M. nigra), oldsqaw (Clangula hyemalis), spectacled eider (Somateria fischeri), and Steller's eider (Polysticta stellei) show long-term breeding population declines, especially the latter three species. The spectacled eider was recently classified threatened under the Endangered Species Act. In addition, three other diving ducks, which commonly winter in coastal areas, have declined from unknown causes. Large die-offs of all three species of scoters during molt, a period of high energy demand, were documented in August 1990, 1991, and 1992 at coastal reefs in southeastern Alaska. There was no evidence of infectious diseases in those scoters. The die-offs may or may not be associated with the long-term declines. Many scoters had elevated renal concentrations of cadmium (high of 375 micrograms/g dry weight [dw]). Effects of cadmium in sea ducks are not well understood. Selenium concentrations in livers of nesting white-winged scoters were high; however, the eggs they laid contained less selenium than expected based on relationships for freshwater bird species. Histological evaluation found a high prevalence of hepatocellular vacuolation (49%), a degenerative change frequently associated with sublethal toxic insult. Cadmium and selenium mean liver concentrations were generally higher in those birds with more severe vacuolation; however, relationships were not statistically significant. We do not know if sea duck population declines are related to metals or other contaminants. PMID:7556023

  6. Translocation and disease monitoring of wild laysan ducks

    USGS Publications Warehouse

    Reynolds, Michelle H.; Work, Thierry M.

    2007-01-01

    The Laysan duck (Anas laysanensis), also known as the Laysan teal because of its small size, is a critically endangered waterfowl species that once occurred widely across the Hawaiian Archipelago. For the past 150 years, however, it was restricted to a single population on Laysan, a 4-square-kilometer (1.5-square-mile) island with a hypersaline shallow lake. Laysan is part of the Hawaiian Islands National Wildlife Refuge in Papahanaumokuakea Marine National Monument. 

  7. A Duck Enteritis Virus-Vectored Bivalent Live Vaccine Provides Fast and Complete Protection against H5N1 Avian Influenza Virus Infection in Ducks ▿ † §

    PubMed Central

    Liu, Jinxiong; Chen, Pucheng; Jiang, Yongping; Wu, Li; Zeng, Xianying; Tian, Guobin; Ge, Jinying; Kawaoka, Yoshihiro; Bu, Zhigao; Chen, Hualan

    2011-01-01

    Ducks play an important role in the maintenance of highly pathogenic H5N1 avian influenza viruses (AIVs) in nature, and the successful control of AIVs in ducks has important implications for the eradication of the disease in poultry and its prevention in humans. The inactivated influenza vaccine is expensive, labor-intensive, and usually needs 2 to 3 weeks to induce protective immunity in ducks. Live attenuated duck enteritis virus (DEV; a herpesvirus) vaccine is used routinely to control lethal DEV infections in many duck-producing areas. Here, we first established a system to generate the DEV vaccine strain by using the transfection of overlapping fosmid DNAs. Using this system, we constructed two recombinant viruses, rDEV-ul41HA and rDEV-us78HA, in which the hemagglutinin (HA) gene of the H5N1 virus A/duck/Anhui/1/06 was inserted and stably maintained within the ul41 gene or between the us7 and us8 genes of the DEV genome. Duck studies indicated that rDEV-us78HA had protective efficacy similar to that of the live DEV vaccine against lethal DEV challenge; importantly, a single dose of 106 PFU of rDEV-us78HA induced complete protection against a lethal H5N1 virus challenge in as little as 3 days postvaccination. The protective efficacy against both lethal DEV and H5N1 challenge provided by rDEV-ul41HA inoculation in ducks was slightly weaker than that provided by rDEV-us78HA. These results demonstrate, for the first time, that recombinant DEV is suitable for use as a bivalent live attenuated vaccine, providing rapid protection against both DEV and H5N1 virus infection in ducks. PMID:21865383

  8. Efficient strategy for constructing duck enteritis virus-based live attenuated vaccine against homologous and heterologous H5N1 avian influenza virus and duck enteritis virus infection.

    PubMed

    Zou, Zhong; Hu, Yong; Liu, Zhigang; Zhong, Wei; Cao, Hangzhou; Chen, Huanchun; Jin, Meilin

    2015-04-16

    Duck is susceptible to many pathogens, such as duck hepatitis virus, duck enteritis virus (DEV), duck tembusu virus, H5N1 highly pathogenic avian influenza virus (HPAIV) in particular. With the significant role of duck in the evolution of H5N1 HPAIV, control and eradication of H5N1 HPAIV in duck through vaccine immunization is considered an effective method in minimizing the threat of a pandemic outbreak. Consequently, a practical strategy to construct a vaccine against these pathogens should be determined. In this study, the DEV was examined as a candidate vaccine vector to deliver the hemagglutinin (HA) gene of H5N1, and its potential as a polyvalent vaccine was evaluated. A modified mini-F vector was inserted into the gB and UL26 gene junction of the attenuated DEV vaccine strain C-KCE genome to generate an infectious bacterial artificial chromosome (BAC) of C-KCE (vBAC-C-KCE). The HA gene of A/duck/Hubei/xn/2007 (H5N1) was inserted into the C-KCE genome via the mating-assisted genetically integrated cloning (MAGIC) to generate the recombinant vector pBAC-C-KCE-HA. A bivalent vaccine C-KCE-HA was developed by eliminating the BAC backbone. Ducks immunized with C-KCE-HA induced both the cross-reactive antibodies and T cell response against H5. Moreover, C-KCE-HA-immunized ducks provided rapid and long-lasting protection against homologous and heterologous HPAIV H5N1 and DEV clinical signs, death, and primary viral replication. In conclusion, our BAC-C-KCE is a promising platform for developing a polyvalent live attenuated vaccine.

  9. A duck enteritis virus-vectored bivalent live vaccine provides fast and complete protection against H5N1 avian influenza virus infection in ducks.

    PubMed

    Liu, Jinxiong; Chen, Pucheng; Jiang, Yongping; Wu, Li; Zeng, Xianying; Tian, Guobin; Ge, Jinying; Kawaoka, Yoshihiro; Bu, Zhigao; Chen, Hualan

    2011-11-01

    Ducks play an important role in the maintenance of highly pathogenic H5N1 avian influenza viruses (AIVs) in nature, and the successful control of AIVs in ducks has important implications for the eradication of the disease in poultry and its prevention in humans. The inactivated influenza vaccine is expensive, labor-intensive, and usually needs 2 to 3 weeks to induce protective immunity in ducks. Live attenuated duck enteritis virus (DEV; a herpesvirus) vaccine is used routinely to control lethal DEV infections in many duck-producing areas. Here, we first established a system to generate the DEV vaccine strain by using the transfection of overlapping fosmid DNAs. Using this system, we constructed two recombinant viruses, rDEV-ul41HA and rDEV-us78HA, in which the hemagglutinin (HA) gene of the H5N1 virus A/duck/Anhui/1/06 was inserted and stably maintained within the ul41 gene or between the us7 and us8 genes of the DEV genome. Duck studies indicated that rDEV-us78HA had protective efficacy similar to that of the live DEV vaccine against lethal DEV challenge; importantly, a single dose of 10(6) PFU of rDEV-us78HA induced complete protection against a lethal H5N1 virus challenge in as little as 3 days postvaccination. The protective efficacy against both lethal DEV and H5N1 challenge provided by rDEV-ul41HA inoculation in ducks was slightly weaker than that provided by rDEV-us78HA. These results demonstrate, for the first time, that recombinant DEV is suitable for use as a bivalent live attenuated vaccine, providing rapid protection against both DEV and H5N1 virus infection in ducks.

  10. Goose Parvovirus and Circovirus Coinfections in Ornamental Ducks.

    PubMed

    Shehata, Awad A; Gerry, Dorrestein M; Heenemann, Kristin; Halami, Mohammed Y; Tokarzewski, Stanisław; Wencel, Peter; Vahlenkamp, Thomas W

    2016-06-01

    Clinical observations and diagnostic procedures carried out to elucidate the cause of high mortality in 2-8-wk-old ornamental ducks (mandarin, wood, falcated, and silver teal ducks) are described. At necropsy, ducklings showed general pallor of skeletal and heart muscles, subcutaneous gelatinous transudates, pericarditis, ascites, and severe edema and hyperemia of lungs. Histopathologic examination revealed that the most important changes were located in the crop, bursa of Fabricius, and lungs with presence of amorphic basic intracytoplasmic inclusions. No bacteria or fungi could be detected from affected organs and ascitic fluid. Viral diagnosis included molecular detection for the presence of goose parvovirus (GPV), circovirus, avian influenza, herpesviruses, paramyxovirus, reovirus, and polyomavirus. Both GPV and circovirus could be detected by real-time PCR and nested broad-spectrum PCR, respectively. Phylogenetically, full-length nucleotide sequence of GPV showed a close similarity ranging from 95.6% to 97.9% with European and Asian pathogenic GPV. On the other hand, the detected circovirus showed nucleotide identity of 90% to 98% with goose circoviruses (GoCVs). This is the first report of GoCVs and GPV in ornamental ducks. The concurrence of GPV and GoCV infections is thought to contribute to the high mortality.

  11. Effects of selenium on mallard duck reproduction and immune function

    SciTech Connect

    Whiteley, P.L.; Yuill, T.M.; Fairbrother, A.

    1989-11-01

    Selenium from irrigation drain water and coal-fired power stations is a significant environmental contaminant in some regions of the USA. The objectives were to examine whether selenium-exposed waterfowl had altered immune function, disease resistance, or reproduction. Pairs of adult mallards were exposed for 95-99 days on streams with sodium selenite-treated water at 10 and 30 ppb, or on untreated streams. Selenium biomagnified through the food chain to the ducks. Disease resistance was decreased in ducklings hatched on the streams and challenged with duck hepatitis virus 1 (DHV1) when 15-days old. Liver selenium concentrations for these ducklings on the 10 and 30 ppb streams was 3.6 and 7.6 ppm dry weight, respectively. Mortality of ducklings purchased when 7-days old, exposed to selenium for 14 days, and challenged when 22-days old was not affected. However, their selenium exposure was lower (liver selenium 4.1 ppm dry weight for the 30 ppb stream). Five parameters of immune function were measured in adult ducks. Phagocytosis of killed Pasteurella multocida by blood heterophils and monocytes, and blood monocyte concentrations were higher in adult males following 84 days exposure to 30 ppb selenium. Their liver selenium concentrations were 11.1 ppm dry weight after 95-99 days exposure.

  12. Meiotic recombination analysis in female ducks (Anas platyrhynchos).

    PubMed

    Pigozzi, M I; Del Priore, L

    2016-06-01

    Meiotic recombination in female ducks was directly studied by immunolocalization of MLH1 protein, a mismatch repair protein of mature recombination nodules. In total, 6820 crossovers were scored along the autosomal synaptonemal complexes in 122 meiotic nuclei. From this analysis we predict that the female map length of the duck is 2845 cM, with a genome wide recombination rate of 2 cM/Mb. MLH1-focus mapping along the six largest bivalents shows regional variations of recombination frequencies that can be linked to differences in chromosome morphology. From this MLH1 mapping it can be inferred that distally located markers will appear more separated in genetic maps than physically equidistant markers located near the centromeres on bivalents 1 and 2. Instead, markers at interstitial positions on the acrocentric bivalents 3-6 will appear more tightly linked than expected on the basis of their physical distance because recombination is comparatively lower at the mid region of these chromosomes. The present results provide useful information to complement linkage mapping in ducks and extend previous knowledge about the variation of recombination rates among domestic Galloanserae.

  13. Duck (Anas platyrhynchos) linkage mapping by AFLP fingerprinting.

    PubMed

    Huang, Chang-Wen; Cheng, Yu-Shin; Rouvier, Roger; Yang, Kuo-Tai; Wu, Chean-Ping; Huang, Hsiu-Lin; Huang, Mu-Chiou

    2009-03-17

    Amplified fragment length polymorphism (AFLP) with multicolored fluorescent molecular markers was used to analyze duck (Anas platyrhynchos) genomic DNA and to construct the first AFLP genetic linkage map. These markers were developed and genotyped in 766 F2 individuals from six families from a cross between two different selected duck lines, brown Tsaiya and Pekin. Two hundred and ninety-six polymorphic bands (64% of all bands) were detected using 18 pairs of fluorescent TaqI/EcoRI primer combinations. Each primer set produced a range of 7 to 29 fragments in the reactions, and generated on average 16.4 polymorphic bands. The AFLP linkage map included 260 co-dominant markers distributed in 32 linkage groups. Twenty-one co-dominant markers were not linked with any other marker. Each linkage group contained three to 63 molecular markers and their size ranged between 19.0 cM and 171.9 cM. This AFLP linkage map provides important information for establishing a duck chromosome map, for mapping quantitative trait loci (QTL mapping) and for breeding applications.

  14. Duck (Anas platyrhynchos) linkage mapping by AFLP fingerprinting

    PubMed Central

    Huang, Chang-Wen; Cheng, Yu-Shin; Rouvier, Roger; Yang, Kuo-Tai; Wu, Chean-Ping; Huang, Hsiu-Lin; Huang, Mu-Chiou

    2009-01-01

    Amplified fragment length polymorphism (AFLP) with multicolored fluorescent molecular markers was used to analyze duck (Anas platyrhynchos) genomic DNA and to construct the first AFLP genetic linkage map. These markers were developed and genotyped in 766 F2 individuals from six families from a cross between two different selected duck lines, brown Tsaiya and Pekin. Two hundred and ninety-six polymorphic bands (64% of all bands) were detected using 18 pairs of fluorescent TaqI/EcoRI primer combinations. Each primer set produced a range of 7 to 29 fragments in the reactions, and generated on average 16.4 polymorphic bands. The AFLP linkage map included 260 co-dominant markers distributed in 32 linkage groups. Twenty-one co-dominant markers were not linked with any other marker. Each linkage group contained three to 63 molecular markers and their size ranged between 19.0 cM and 171.9 cM. This AFLP linkage map provides important information for establishing a duck chromosome map, for mapping quantitative trait loci (QTL mapping) and for breeding applications. PMID:19291328

  15. Comparative Pharmacokinetics of Levofloxacin in Healthy and Renal Damaged Muscovy Ducks following Intravenous and Oral Administration

    PubMed Central

    Soliman, Ahmed

    2014-01-01

    The pharmacokinetics aspects of levofloxacin were studied in healthy and experimentally renal damaged Muscovy ducks after single intravenous (IV) and oral (PO) dose of 10 mg kg−1 bwt. Following IV administration, elimination half-life (t 1/2(β)) and mean residence time (MRT) were longer in renal damaged ducks than in healthy ones. Total clearance (Cltot) in renal damaged ducks (0.20 L kg−1 h−1) was significantly lower as compared to that in healthy ones (0.41 L kg−1 h−1). Following PO administration, the peak serum concentration (C max) was higher in renal damaged than in healthy ducks and was achieved at maximum time (t max) of 2.47 and 2.05 h, respectively. The drug was eliminated (t 1/2(el)) at a significant slower rate (3.94 h) in renal damaged than in healthy ducks (2.89 h). The pharmacokinetic profile of levofloxacin is altered in renal damaged ducks due to the increased serum levofloxacin concentrations compared with that in clinically healthy ducks. Oral administration of levofloxacin at 10 mg kg−1 bwt may be highly efficacious against susceptible bacteria in ducks. Also, the dose of levofloxacin should be reduced in renal damaged ducks. Pharmacokinetic/pharmacodynamic integration revealed significantly higher values for C max/MIC and AUC/MIC ratios in renal damaged ducks than in healthy ones, indicating the excellent pharmacokinetic characteristics of levofloxacin in renal damaged ducks. PMID:24707439

  16. Factors associated with Autumn rearing of duck broods in temperate North America

    USGS Publications Warehouse

    Krapu, G.L.; Brandt, D.A.; Beiser, J.A.

    2001-01-01

    Dabbling ducks Genus Anas occasionally nest during mid- and late summer in the Prairie Pothole Region (PPR) of midcontinent North America but little information is available on their Autumn-reared broods or those of other duck genera. Densities, species composition, and wetland habitat use by Autumn reared duck broods (age classes I and II) were determined on randomly distributed transects on a 3,735 km^2 study area in eastern North Dakota. Brood densities (SE) averaged 0.380.08, 0.300.08 and 0.230.10 broods km^-2 during 1993-95 with dabbling ducks accounting for 70, 44, and 9%, and diving ducks 30, 54, and 91% of sighted broods. The principal species were Blue-winged Teal Anas discors, 21%; Gadwall A. strepera, 11%; Mallard A. platyrhynchos, 7%; Redhead Aythya americana, 13%, and Ruddy Duck Oxyura jamaicensis, 35%. Of Blue-winged Teal and Mallard broods, 67% of each were located on seasonal ponds, and 50, 56, and 59% of Gadwall, Redhead and Ruddy Duck broods were on semi-permanent ponds. Interspecific variation in numbers of Autumn-reared broods resulted, in part, from intrinsic differences among species in capacity to nest during mid- and late summer. Survival of thousands of class I and II dabbling duck broods to mid-September during 1993-94 probably resulted from a combination of factors including an abundance of seasonal ponds, low rainfall, and limited cold weather through mid-September when brood surveys were conducted. Redheads and Ruddy Ducks do not terminate breeding under long daylengths in late spring so summer nesting accounts for a much larger portion of the annual nesting effort than in dabbling ducks except under drought conditions when ducks generally terminate reproduction by midspring.

  17. Experimental susceptibility of Wood Ducks (Aix sponsa) for West Nile virus

    USGS Publications Warehouse

    Hofmeister, Erik K.; Porter, Robert E.; Franson, J. Christian

    2015-01-01

    Detection of West Nile virus (WNV) has been reported in a variety of wild ducks in the US, but little is known about the pathogenesis and outcome of exposure of the disease in these species. Previous experimental studies of WNV in ducks either have challenged a small number of ducks with WNV or have tested domesticated ducks. To determine susceptibility and immune response, we challenged 7-wk-old Wood Ducks (Aix sponsa) with a 1999 American Crow (Corvus brachyrhynchos) isolate of WNV. Wood Ducks were susceptible to infection with the virus, and, although clinical signs or mortality were not observed, microscopic lesions were noted, particularly in the heart and brain. West Nile virus viremia peaked on day 2 postinfection (pi) at 104.54 plaque-forming units (PFU) of virus/mL serum and WNV was shed orally (between 102and 102.9 PFU per swab) and cloacally. Specific anti-WNV antibody response was rapid, with anti-WNV IgM detected on day 3 pi followed on day 5 pi by anti-WNV IgG. Neutralizing antibodies were detected by plaque-reduction neutralization assay in one duck on day 4 pi, and in all sampled ducks on day 5. These results indicate that Wood Ducks are susceptible to WNV, but it is unlikely that significant WNV mortality events occur in Wood Ducks or that ducks play a significant role in transmission. However, WNV viremia was sufficient, in theory, to infect mosquitoes, and oral and cloacal shedding of the virus may increase the risk of infection to other waterbirds.

  18. AIDS-related information exposure in the mass media and discussion within social networks among married women in Bombay, India.

    PubMed

    Chatterjee, N

    1999-08-01

    Married women are at high risk of acquiring HIV infection in India and health education remains the most feasible preventive tool in their context. In a survey conducted among 350 married women in Bombay, it was found that a majority had acquired information about AIDS from the mass media, especially television. Although 87% of women who knew of AIDS had been exposed to AIDS-related information in the mass media in the past four weeks, only 57% had discussed it within their social networks. Those with more exposure to AIDS information in the mass media were significantly more likely to discuss AIDS within social networks. The women were most likely to discuss AIDS with their husbands as a general social issue, followed by friends and family members and least likely to talk to husbands about AIDS as a personal issue relating to their sexual relationship. Increased frequency and duration of AIDS messages on television will have a positive influence on AIDS knowledge in this group.

  19. Inadequate protection of ducks and geese against H5N1 high pathogenicity avian influenza virus by a single vaccination

    USDA-ARS?s Scientific Manuscript database

    Ducks and geese are an important sustainable food source in developing countries. Few studies have been conducted to test vaccine efficacy in either ducks or geese. This study was conducted to investigate whether a single vaccination could protect White Pekin ducks and White Chinese geese against ...

  20. Differences between Pekin and Muscovy ducks in response to vaccination against HPAI H5N1 virus

    USDA-ARS?s Scientific Manuscript database

    Vaccination of domestic ducks against highly pathogenic avian influenza (HPAI) H5N1 has been done in Asia with mixed results. One of the observations from the field is that Muscovy ducks (Cairina moschata) respond differently to vaccination than other common domestic ducks (Anas sp.). The objectiv...

  1. The role of NS protein in the pathogenicity of HPAI H5N1 viruses in ducks

    USDA-ARS?s Scientific Manuscript database

    Until 2002, highly pathogenic avian influenza (HPAI) H5N1 viruses caused no disease or only mild respiratory infections in ducks. Since then, new viruses have emerged that cause systemic disease and high mortality in ducks and other waterfowl. Studies on HPAI virus pathogenicity in ducks have been...

  2. The pathobiology of highly pathogenic H5N2 avian influenza virus in Ruddy ducks and Lesser Scaup

    USDA-ARS?s Scientific Manuscript database

    The susceptibility and pathogenesis of avian influenza virus (AIV) has not been characterized in numerous duck species, especially diving ducks, some of which migrate across the continental U.S. The pathobiology of highly pathogenic (HP) H5N2 AIV was characterized in two diving duck species, Ruddy ...

  3. The effect of NS1 gene exchange on the pathogenicity of H5N1 HPAI viruses in ducks

    USDA-ARS?s Scientific Manuscript database

    Until 2002, H5N1 highly pathogenic avian influenza (HPAI) viruses caused only mild respiratory infections in ducks. Since then, new viruses have emerged that cause systemic disease and high mortality in ducks and other waterfowl. Studies on HPAI virus pathogenicity in ducks have been limited and t...

  4. Estimation of dietary arginine requirements for Longyan laying ducks.

    PubMed

    Xia, Weiguang; Fouad, Ahmed Mohamed; Chen, Wei; Ruan, Dong; Wang, Shuang; Fan, Qiuli; Wang, Ying; Cui, Yiyan; Zheng, Chuntian

    2017-01-01

    This study aimed to establish the arginine requirements of Longyan ducks from 17 to 31 wk of age based on egg production, egg quality, plasma, and ovarian indices, as well as the expression of vitellogenesis-related genes. In total, 660 Longyan ducks with similar body weight at 15 wk of age were assigned randomly to 5 treatments, each with 6 replicates of 22 birds, and fed a corn-corn gluten meal basal diet (0.66% arginine) supplemented with either 0, 0.20%, 0.40%, 0.60%, or 0.80% arginine. Dietary arginine did not affect egg production by laying ducks, but it increased (linear, P < 0.01) the egg weight at 22 to 31 and 17 to 31 wk of age. Dietary arginine increased the yolk color score (linearly, P < 0.05) and the yolk percentage (quadratic, P < 0.05), where the maximum values were obtained with 1.26% arginine. Dietary arginine affected the total shell percentage and shell thickness, with the highest values using 1.46% arginine (P < 0.01). The weight and number of small yellow follicles (SYFs) increased (quadratic, P < 0.05) with the dietary arginine level and there was a quadratic response (P < 0.05) in terms of the SYFs weight/ovarian weight; the highest values were obtained in ducks fed 1.26% arginine. The plasma arginine concentration exhibited a quadratic (P < 0.05) response to dietary arginine. The plasma progesterone concentration decreased (linear, P < 0.05) as dietary arginine increased. The mRNA abundance of the very low density lipoprotein receptor-b increased in the second large yellow follicle membranes (quadratic, P < 0.05) with the dietary arginine level, where the highest value occurred with 1.26% arginine. According to the regression model, the dietary arginine requirements for Longyan laying ducks aged 17 to 31 wk are 1.06%, 1.13%, 1.22%, and 1.11% to obtain the maximum yolk percentage, SYFs number, SYFs weight, and SYFs weight/ovarian weight, respectively. © 2016 Poultry Science Association Inc.

  5. Effects of ACTH, capture, and short term confinement on glucocorticoid concentrations in harlequin ducks (Histrionicus histrionicus)

    USGS Publications Warehouse

    Nilsson, P.B.; Hollmén, Tuula E.; Atkinson, S.; Mashburn, K.L.; Tuomi, P.A.; Esler, Daniel; Mulcahy, D.M.; Rizzolo, D.J.

    2008-01-01

    Little is known about baseline concentrations of adrenal hormones and hormonal responses to stress in sea ducks, although significant population declines documented in several species suggest that sea ducks are exposed to increased levels of environmental stress. Such declines have been observed in geographically distinct harlequin duck populations. We performed an adrenocorticotropic hormone (ACTH) challenge to evaluate adrenal function and characterize corticosterone concentrations in captive harlequin ducks and investigated the effects of capture, surgery, and short term confinement on corticosterone concentrations in wild harlequin ducks. Harlequin ducks responded to the ACTH challenge with an average three-fold increase in serum corticosterone concentration approximately 90??min post injection, and a four- to five-fold increase in fecal glucocorticoid concentration 2 to 4??h post injection. Serum corticosterone concentrations in wild harlequin ducks increased within min of capture and elevated levels were found for several hours post capture, indicating that surgery and confinement maintain elevated corticosterone concentrations in this species. Mean corticosterone concentrations in wild harlequin ducks held in temporary captivity were similar to the maximum response levels during the ACTH challenge in captive birds. However, large variation among individuals was observed in responses of wild birds, and we found additional evidence suggesting that corticosterone responses varied between hatch year and after hatch year birds. ?? 2008.

  6. Foraging habits of mallards and wood ducks in a bottomland hardwood forest in Texas

    Treesearch

    L. Christopher Miller; R. Montague Whitling; Michael S. Fountain

    2003-01-01

    Although winter foods of mallards (Anas platyrhyncos) and wood ducks (Aix sponsa) have been documented in several studies, no such research has been conducted in natural bottomland hardwood forests in eastern Texas. We collected 40 mallards and 38 wood ducks and sampled available foods in eastern Texas during winters 1987-1988 and...

  7. Protective efficacy of an inactivated vaccine against H9N2 avian influenza virus in ducks.

    PubMed

    Teng, Qiaoyang; Shen, Weixia; Liu, Qinfang; Rong, Guangyu; Chen, Lin; Li, Xuesong; Chen, Hongjun; Yang, Jianmei; Li, Zejun

    2015-09-17

    Wild ducks play an important role in the evolution of avian influenza viruses (AIVs). Domestic ducks in China are known to carry and spread H9N2 AIVs that are thought to have contributed internal genes for the recent outbreak of zoonotic H7N9 virus. In order to protect animal and public health, an effective vaccine is urgently needed to block and prevent the spread of H9N2 virus in ducks. We developed an inactivated H9N2 vaccine (with adjuvant Montanide ISA 70VG) based on an endemic H9N2 AIV and evaluated this vaccine in ducks. The results showed that the inactivated H9N2 vaccine was able to induce a strong and fast humoral immune response in vaccinated ducks. The hemagglutination inhibition titer in the sera increased fast, and reached its peak of 12.3 log2 at 5 weeks post-vaccination in immunized birds and remained at a high level for at least 37 weeks post-vaccination. Moreover, viral shedding was completely blocked in vaccinated ducks after challenge with a homologous H9N2 AIV at both 3 and 37 weeks post-vaccination. The results of this study indicate that the inactivated H9N2 vaccine induces high and prolonged immune response in vaccinated ducks and are efficacious in protecting ducks from H9N2 infection.

  8. Lead exposure affects health indices in free-ranging ducks in Argentina.

    PubMed

    Ferreyra, Hebe; Beldomenico, Pablo M; Marchese, Krysten; Romano, Marcelo; Caselli, Andrea; Correa, Ana I; Uhart, Marcela

    2015-05-01

    Numerous experiments under controlled conditions and extensive investigation of waterfowl die-offs have demonstrated that exposure to lead from spent gunshot is highly detrimental to the health of waterfowl. However, few studies have focused on examining the more subtle sub-lethal effects of lead toxicity on ducks in non-experimental settings. In our study, the health of ducks exposed to varying amounts of lead under natural conditions was assessed by correlating individual lead exposure with relevant indices of health. Based on hunter-killed wild ducks in Argentina, we measured spleen mass, body condition, examined bone marrow smears, and determined Ca and P in bone tissue. In free-ranging live-trapped ducks we determined basic hematology and aminolevulinic acid dehydratase activity. Using multivariate analyses, we found that, when controlling for the potential confounding effect of site type, year, duck species, body mass and age, lead levels in the liver were negatively associated with body condition and spleen mass. Spleen mass was also lower in ducks with higher lead levels in their bones. In live ducks, high blood lead levels were associated with low packed cell volume and red cell morphologic abnormalities. These findings suggest that, despite the lack of recorded lead-induced mortality in the region, lead exposure results in less conspicuous but still significant impacts on the health of ducks, which could have serious implications for their conservation. Moreover, this evidence further supports the need for urgently banning lead shot in the region.

  9. Sentinel model for influenza A virus monitoring in free-grazing ducks in Thailand.

    PubMed

    Boonyapisitsopa, Supanat; Chaiyawong, Supassama; Nonthabenjawan, Nutthawan; Jairak, Waleemas; Prakairungnamthip, Duangduean; Bunpapong, Napawan; Amonsin, Alongkorn

    2016-01-01

    Influenza A virus (IAV) can cause influenza in birds and mammals. In Thailand, free-grazing ducks are known IAV reservoirs and can spread viruses through frequent movements in habitats they share with wild birds. In this study, the sentinel model for IAV monitoring was conducted over 4 months in two free-grazing duck flocks. IAV subtypes H4N6 (n=1) and H3N8 (n=5) were isolated from sentinel ducks at the ages of 13 and 15 weeks. Clinical signs of depression and ocular discharge were observed in the infected ducks. Phylogenetic analysis and genetic characterization of the isolated IAVs indicated that all Thai IAVs were clustered in the Eurasian lineage and pose low pathogenic avian influenza characteristics. Serological analysis found that antibodies against IAVs could be detected in the ducks since 9-weeks-old. In summary, our results indicate that the sentinel model can be used for IAV monitoring in free-grazing duck flocks. Since free-grazing ducks are potential reservoirs and transmitters of IAVs, routine IAV surveillance in free-grazing duck flocks can be beneficial for influenza prevention and control strategies. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Tissue distribution of metals in white-fronted geese and spot-billed ducks from Korea.

    PubMed

    Kim, Jungsoo; Oh, Jong-Min

    2013-07-01

    This study presents concentrations of Fe, Zn, Mn, Cu, Pb and Cd in livers, kidneys, muscles and bones of white-fronted geese Anser albifrons (geese) and spot-billed ducks Anas poecilorhyncha (ducks). Iron in livers, kidneys and muscles, Zn in muscles, Mn and Cd in every tissue, Cu in livers, muscles and bones and Pb in bones differed between species, and there were significant differences among tissues in both species. Essential elements such as Fe, Zn, Mn and Cu concentrations were within the background levels. Lead concentrations in livers of 7 of 14 geese and 7 of 19 ducks and in bones of 4 of 19 ducks exceeded background concentrations for waterfowl (5 μg/g dw for the liver, 10 μg/g dw for the bone). Almost all samples of both species had the background Cd concentrations in the liver (33 of 33 geese and ducks) and kidney (14 geese and 18 ducks). Tissue concentrations of Cd were greater in geese than ducks. In contrast, tissue concentrations of Pb in bones were greater in ducks than in geese. These different trends for Cd and Pb reflect a short and/or long term difference in exposure and degree of accumulation of these metals.

  11. Determinants of pathogenicity of H5N1 highly pathogenic avian influenza viruses in ducks

    USDA-ARS?s Scientific Manuscript database

    Ducks have been implicated in the dissemination and evolution of the H5N1 highly pathogenic avian influenza (HPAI) viruses. The pathogenicity of H5N1 HPAI viruses in domestic ducks has increased over time with some viruses producing 100% mortality in very short time. The determinants of pathogenic...

  12. Pathogenicity of reassortant H5N1 highly pathogenic avian influenza viruses in domestic ducks

    USDA-ARS?s Scientific Manuscript database

    The pathogenicity of H5N1 highly pathogenic avian influenza (HPAI) viruses in domestic ducks has increased over time. These changes in virulence have been reported with viruses from countries with high population of domestic ducks, including Egypt. In order to understand which viral genes are contri...

  13. Toxicity of lead shot to wild black ducks and mallards fed natural foods

    SciTech Connect

    Chasko, G.G.; Hoehn, T.R.; Howell-Heller, P.

    1984-04-01

    This study was designed to determine the toxicity of ingested lead shot to wild black ducks (Anas rubripes) and mallards (Anas platyrhynchos) fed natural foods normally consumed in the fall in New England. The objectives were to document mortality, weight loss, lead levels in the wing bones and liver, and shot retention for ducks dosed with various amounts of lead shot.

  14. Increased virulence in ducks of H5N1 highly pathogenic avian influenza viruses from Egypt

    USDA-ARS?s Scientific Manuscript database

    The pathogenicity of H5N1 highly pathogenic avian influenza (HPAI) viruses in domestic ducks has increased over time. These changes in virulence have been reported with viruses from countries with high population of domestic ducks. Since 2006, H5N1 HPAI outbreaks in Egypt have been occurring in po...

  15. 78 FR 14413 - Requested Administrative Waiver of the Coastwise Trade Laws: Vessel LUCKY DUCK; Invitation for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-05

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Maritime Administration Requested Administrative Waiver of the Coastwise Trade Laws: Vessel LUCKY DUCK... of the vessel LUCKY DUCK is: Intended Commercial Use Of Vessel: ``The vessel is to be operated as a...

  16. Scavenging Ducks and Transmission of Highly Pathogenic Avian Influenza, Java, Indonesia

    PubMed Central

    Wibawa, Hendra; Morton, John; Usman, Tri Bhakti; Junaidi, Akhmad; Meers, Joanne

    2010-01-01

    In Java, Indonesia, during March 2007–March 2008, 96 farms with scavenging ducks that were not vaccinated against highly pathogenic avian influenza (HPAI) were monitored bimonthly. Bird-level (prevalence among individual birds) H5 seroprevalence was 2.6% for ducks and 0.5% for chickens in contact with ducks. At least 1 seropositive bird was detected during 19.5% and 2.0% of duck- and chicken-flock visits, respectively. Duck flocks were 12.4× more likely than chicken flocks to have seropositive birds. During 21.4% of farm visits, ≥1 sampled duck was H5 seropositive when all sampled in-contact chickens were seronegative. Subtype H5 virus was detected during 2.5% of duck-flock visits and 1.5% of chicken-flock visits. When deaths from HPAI infection occurred, H5 virus shedding occurred in apparently healthy birds on 68.8% of farms. Of 180 poultry deaths investigated, 43.9% were attributed to H5 virus. These longitudinal study results indicate that ducks are a source of infection for chickens and, potentially, for humans. PMID:20678318

  17. Epidemiologic Investigation of Riemerella anatipestifer in a Commercial Duck Company by Serotyping and DNA Fingerprinting

    USDA-ARS?s Scientific Manuscript database

    A commercial duck company that raises approximately two million Pekin ducks per year experienced an outbreak of Riemerella anatipestifer(RA)on nine farms over a one year period. Due to concerns that the bacteria was being spread from farm to farm, an investigation using serotyping and DNA fingerprin...

  18. Application of Faecalibacterium 16S rDNA genetic marker for accurate identification of duck faeces.

    PubMed

    Sun, Da; Duan, Chuanren; Shang, Yaning; Ma, Yunxia; Tan, Lili; Zhai, Jun; Gao, Xu; Guo, Jingsong; Wang, Guixue

    2016-04-01

    The aim of this study was to judge the legal duty of pollution liabilities by assessing a duck faeces-specific marker, which can exclude distractions of residual bacteria from earlier contamination accidents. With the gene sequencing technology and bioinformatics method, we completed the comparative analysis of Faecalibacterium sequences, which were associated with ducks and other animal species, and found the sequences unique to duck faeces. Polymerase chain reaction (PCR) and agarose gel electrophoresis techniques were used to verify the reliability of both human and duck faeces-specific primers. The duck faeces-specific primers generated an amplicon of 141 bp from 43.3 % of duck faecal samples, 0 % of control samples and 100 % of sewage wastewater samples that contained duck faeces. We present here the initial evidence of Faecalibacterium-based applicability as human faeces-specificity in China. Meanwhile, this study represents the initial report of a Faecalibacterium marker for duck faeces and suggests an independent or supplementary environmental biotechnology of microbial source tracking (MST).

  19. Pathological and epidemiological significance of goose haemorrhagic polyomavirus infection in ducks.

    PubMed

    Corrand, Léni; Gelfi, Jacqueline; Albaric, Olivier; Etievant, Mélanie; Pingret, Jean-Luc; Guerin, Jean-Luc

    2011-08-01

    Goose haemorrhagic polyomavirus (GHPV) is the viral agent of haemorrhagic nephritis enteritis of geese, a lethal disease of goslings. It was recently shown that GHPV can also be detected in Muscovy and mule ducks. The goal of the present study was to investigate the pathobiology of GHPV in ducks. In the first experiment, field isolates of GHPV from Muscovy or mule ducks were fully sequenced and compared with goose GHPV. These duck isolates were then used to inoculate 1-day-old goslings. Typical clinical signs and lesions of haemorrhagic nephritis enteritis of geese were reproduced, indicating that "duck-GHPV" isolates are virulent in geese. In the second experiment, 1-day-old and 21-day-old Muscovy ducklings were infected by a reference GHPV strain. In both cases, neither clinical signs nor histopathological lesions were observed. However, the virus was detected in cloacal bursae and sera, and serological responses were detected at 12 days post infection. These findings suggest firstly that one common genotype of GHPV circulates among ducks and geese, and secondly that ducks may be infected by GHPV but show no pathologic evidence of infection, whereas geese express clinical signs. GHPV infection should therefore be considered as being carried in ducks and of epidemiological relevance in cases of contact with goose flocks.

  20. Outcome of aggressive interactions between American black ducks and mallards during the breeding season

    USGS Publications Warehouse

    McAuley, D.G.; Clugston, D.A.; Longcore, J.R.

    1998-01-01

    Black duck (Anas rubripes) numbers have declined during the past several decades, while mallards (Anas platyrhynchos) have expanded their range eastward. Competitive exclusion of black ducks from wetlands by mallards has been proposed as a principal cause of the decline. We studied a sympatric population of black ducks and mallards in Maine during the early breeding season to document behavior and interactions. We observed 832 aggressive interactions; most (72%) were between members of the same species. When a choice was available, both species interacted more often with conspecifics than with the other species (P < 0.028). On wetlands that both species occupied simultaneously, numbers of interspecific interactions initiated by each species were similar (P = 0.47). The proportion of won (initiator displaces recipient of attack), lost (initiator displaced), and ?no change? outcomes of these interactions were different (P < 0.0001). Black ducks displaced mallards during 87.2%, lost none, and no change occurred during 12.8% of the interactions they initiated with mallards. Mallards displaced black ducks during 63.3%, were displaced by the black duck during 15%, and no change occurred during 21.7% of the interactions they initiated with black ducks. Displacement from wetlands was rare (38 of 229 interspecific interactions) and was equal between species. Mallards were neither more aggressive than nor behaviorally superior to black ducks.

  1. Evidence for Vertical Transmission of Novel Duck-Origin Goose Parvovirus-Related Parvovirus.

    PubMed

    Chen, H; Tang, Y; Dou, Y; Zheng, X; Diao, Y

    2016-06-01

    In 2015, novel duck-origin goose parvovirus-related parvovirus (N-GPV) infection progressively appeared in commercial Cherry Valley duck flocks in North China. Diseased ducks were observed to have beak atrophy and dwarfism syndrome (BADS). A previous study showed that a high seropositive rate for N-GPV indicated a latent infection in most breeder duck flocks. To investigate this possibility in hatching eggs collected from N-GPV-infected breeder ducks, 120 eggs were collected at various stages of embryonic development for viral DNA detection and an N-GPV-specific antibody test. N-GPV DNA was present in nine hatching eggs, eleven duck embryo and eight newly hatched ducklings. Of the newly hatched ducklings, 58.33% (21/36) were seropositive. Further, two isolates were obtained from a 12-day-old duck embryo and a newly hatched duckling. N-GPV infection did not reduce the fertilization rate and hatchability. These results indicate possible vertical transmission of N-GPV and suggest that it may be transmitted from breeder ducks to ducklings in ovo.

  2. Integration of Research with Long-Term Monitoring: Breeding Wood Ducks on the Savannah River Site

    SciTech Connect

    Kennamer, R.A.; Hepp, G.R.

    2000-10-01

    In 1981, long-term monitoring of breeding wood ducks was initiated. Females were marked and recaptured for 15 years and annual population parameters were developed. Precise parameter estimates were possible due to high capture rates. The results contribute to the long-term understanding of wood duck populations.

  3. Epidemiology of egg drop syndrome virus in ducks from South Korea.

    PubMed

    Cha, S-Y; Kang, M; Park, C-K; Choi, K-S; Jang, H-K

    2013-07-01

    Egg drop syndrome virus (EDSV) is an important pathogen of poultry that decreases egg production in chickens and causes respiratory disease in goslings. In 2011, we obtained serum samples from 139 domestic Pekin ducks, 416 one-day-old Pekin ducklings, and 75 wild ducks (67 mallards and 8 pintails) to survey their exposure to EDSV. A total of 123 of 139 sera (88.5%) from Pekin ducks, 396 of the ducklings (95.2%), and 16 of 67 mallards (23.9%) were positive. Field cases of EDSV in wild and domestic ducks were investigated. Six cases from domestic Pekin ducks were identified by PCR detection and were used for virus isolation and molecular analysis. Phylogenetic analyses of the partial hexon and full fiber genes showed that the D11-JW-012 and D11-JW-017 strains among 6 isolates belonged to different clusters compared with other known strains including the 127 strain. We assessed cell growth efficiency by hemagglutination (HA) titers and cytopathic effects in duck embryo liver cells and chicken embryo liver (CEL) cells to investigate host adaptation. The D11-JW-017 strain propagated more in chicken embryo liver than the D11-JW-012 strain and the field isolate from chickens. Our results demonstrate the high prevalence of EDSV in wild and domestic ducks in South Korea and provide information on EDSV from ducks that showed variable adaptability in chickens.

  4. Transmission dynamics of the recently-identified BYD virus causing duck egg-drop syndrome.

    PubMed

    Vaidya, Naveen K; Wang, Feng-bin; Zou, Xingfu; Wahl, Lindi M

    2012-01-01

    Baiyangdian (BYD) virus is a recently-identified mosquito-borne flavivirus that causes severe disease in ducks, with extremely rapid transmission, up to 15% mortality within 10 days and 90% reduction in egg production on duck farms within 5 days of infection. Because of the zoonotic nature of flaviviruses, the characterization of BYD virus and its epidemiology are important public health concerns. Here, we develop a mathematical model for the transmission dynamics of this novel virus. We validate the model against BYD outbreak data collected from duck farms in Southeast China, as well as experimental data obtained from an animal facility. Based on our model, the basic reproductive number of BYD virus is high (R(0) = 21) indicating that this virus is highly transmissible, consistent with the dramatic epidemiology observed in BYDV-affected duck farms. Our results indicate that younger ducks are more vulnerable to BYD disease and that ducks infected with BYD virus reduce egg production (to about 33% on average) for about 3 days post-infection; after 3 days infected ducks are no longer able to produce eggs. Using our model, we predict that control measures which reduce contact between mosquitoes and ducks such as mosquito nets are more effective than insecticides.

  5. Transmission Dynamics of the Recently-Identified BYD Virus Causing Duck Egg-Drop Syndrome

    PubMed Central

    Vaidya, Naveen K.; Wang, Feng-bin; Zou, Xingfu; Wahl, Lindi M.

    2012-01-01

    Baiyangdian (BYD) virus is a recently-identified mosquito-borne flavivirus that causes severe disease in ducks, with extremely rapid transmission, up to 15% mortality within 10 days and 90% reduction in egg production on duck farms within 5 days of infection. Because of the zoonotic nature of flaviviruses, the characterization of BYD virus and its epidemiology are important public health concerns. Here, we develop a mathematical model for the transmission dynamics of this novel virus. We validate the model against BYD outbreak data collected from duck farms in Southeast China, as well as experimental data obtained from an animal facility. Based on our model, the basic reproductive number of BYD virus is high (R0 = 21) indicating that this virus is highly transmissible, consistent with the dramatic epidemiology observed in BYDV-affected duck farms. Our results indicate that younger ducks are more vulnerable to BYD disease and that ducks infected with BYD virus reduce egg production (to about 33% on average) for about 3 days post-infection; after 3 days infected ducks are no longer able to produce eggs. Using our model, we predict that control measures which reduce contact between mosquitoes and ducks such as mosquito nets are more effective than insecticides. PMID:22529985

  6. Effects of ACTH, capture, and short term confinement on glucocorticoid concentrations in harlequin ducks (Histrionicus histrionicus).

    PubMed

    Nilsson, Peter B; Hollmén, Tuula E; Atkinson, Shannon; Mashburn, Kendall L; Tuomi, Pamela A; Esler, Daniel; Mulcahy, Daniel M; Rizzolo, Daniel J

    2008-03-01

    Little is known about baseline concentrations of adrenal hormones and hormonal responses to stress in sea ducks, although significant population declines documented in several species suggest that sea ducks are exposed to increased levels of environmental stress. Such declines have been observed in geographically distinct harlequin duck populations. We performed an adrenocorticotropic hormone (ACTH) challenge to evaluate adrenal function and characterize corticosterone concentrations in captive harlequin ducks and investigated the effects of capture, surgery, and short term confinement on corticosterone concentrations in wild harlequin ducks. Harlequin ducks responded to the ACTH challenge with an average three-fold increase in serum corticosterone concentration approximately 90 min post injection, and a four- to five-fold increase in fecal glucocorticoid concentration 2 to 4 h post injection. Serum corticosterone concentrations in wild harlequin ducks increased within min of capture and elevated levels were found for several hours post capture, indicating that surgery and confinement maintain elevated corticosterone concentrations in this species. Mean corticosterone concentrations in wild harlequin ducks held in temporary captivity were similar to the maximum response levels during the ACTH challenge in captive birds. However, large variation among individuals was observed in responses of wild birds, and we found additional evidence suggesting that corticosterone responses varied between hatch year and after hatch year birds.

  7. 75 FR 9316 - Migratory Bird Permits; Control of Muscovy Ducks, Revisions to the Waterfowl Permit Exceptions...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-01

    ... my opinion, way too many muscovy ducks hanging or hovering around aquatic ecosystem especially... endangered species or threatened species or result in the destruction or adverse modification of habitat... laws or regulations governing the removal or destruction of muscovy ducks or their nests or eggs. (2...

  8. Evaluation of chlorpyrifos transferred from contaminated feed to duck commodities and dietary risks to Chinese consumers.

    PubMed

    Li, Rui; Ji, Xiaofeng; He, Liang; Liu, Zhiqiang; Wei, Wei; Qiang, Mingrong; Wang, Qiang; Yuan, Yuwei

    2015-06-03

    The present study describes chlorpyrifos residues in duck commodities through the duck food chain, transfer factors, and dietary risks to Chinese consumers. After duck feeding experiments with pellet feed that lasted for 42 days, chlorpyrifos residues found in all samples collected from the ducks on maximum estimated dose group (3.20 mg/kg level) were from <0.0005 to 0.019 mg/kg. The residue levels of the fat, intestine, and tongue were obviously higher than those of the meat and other edible tissues. The transfer factors of all duck commodities were from 0.0001 to 0.0049 among different contamination levels, which indicated that chlorpyrifos had a low persistency in duck meat and metabolism organs. The chronic exposure assessment revealed that only 0.034-0.150% of the acceptable daily intake (ADI; 0-0.01 mg/kg/bw/day) of chlorpyrifos was consumed via the duck commodities for different age and gender groups in China. The acute exposure assessments of different age and gender groups were only 0.019-0.082% of the acute reference dose (ARfD; 0-0.1 mg/kg/bw). The results show that the single dietary exposure risk of chlorpyrifos raised by the intake of duck commodities was quite low in China.

  9. Threonine requirement of White Pekin ducks from hatch to 21 d of age.

    PubMed

    Xie, M; Zhang, L; Wen, Z G; Tang, J; Huang, W; Hou, S S

    2014-01-01

    1. A dose-response experiment with 5 dietary threonine concentrations (5.0, 5.8, 6.6, 7.4 and 8.2 g/kg) was conducted to estimate the threonine requirement of White Pekin ducks from hatch to 21 d of age. 2. A total of 240 one-d-old male White Pekin ducks were allotted to 5 experimental treatments and each treatment contained 6 replicate pens with 8 ducks per pen. Ducks were reared in raised wire-floor pens from hatch to 21 d of age. At 21 d of age, growth performance and intestinal morphology were determined. 3. The weight gain and feed intake of Pekin ducks increased and feed/gain of these birds decreased linearly or quadratically as dietary threonine increased from 5.0 to 8.2 g threonine/kg. Compared to ducks fed on diets containing 5.0 g threonine/kg, ducks given diets containing 7.4 g threonine/kg had higher villus height in duodenum, jejunum and ileum. 4. The threonine requirements for weight gain of White Pekin ducks from hatch to 21 d of age was estimated to be 6.72 g/kg when dietary crude protein concentration was 189.8 g/kg and threonine supply was critical for maintaining intestinal structure of these birds.

  10. Accumulation and loss of arsenic and boron, alone and in combination, in mallard ducks

    USGS Publications Warehouse

    Pendleton, G.W.; Whitworth, M.R.; Olsen, G.H.

    1995-01-01

    Study was conducted at the Patuxent Wildlife Research Center from June to October 1987. Adult mallard ducks were exposed to dietary concentrations of arsenic as sodium arsenate, boron as boric acid, or both; tissue accumulation and loss rates were estimated when the ducks were returned to uncontaminated food.

  11. Association of RIG-I with innate immunity of ducks to influenza

    PubMed Central

    Barber, Megan R. W.; Aldridge, Jerry R.; Webster, Robert G.; Magor, Katharine E.

    2010-01-01

    Ducks and wild waterfowl perpetuate all strains of influenza viruses in nature. In their natural host, influenza viruses typically cause asymptomatic infection and little pathology. Ducks are often resistant to influenza viruses capable of killing chickens. Here, we show that the influenza virus sensor, RIG-I, is present in ducks and plays a role in clearing an influenza infection. We show evidence suggesting that RIG-I may be absent in chickens, providing a plausible explanation for their increased susceptibility to influenza viruses compared with ducks. RIG-I detects RNA ligands derived from uncapped viral transcripts and initiates the IFN response. In this study, we show that the chicken embryonic fibroblast cell line, DF-1, cannot respond to a RIG-I ligand. However, transfection of duck RIG-I into DF-1 cells rescues the detection of ligand and induces IFN-β promoter activity. Additionally, DF-1 cells expressing duck RIG-I have an augmented IFN response resulting in decreased influenza replication after challenge with either low or highly pathogenic avian influenza virus. Implicating RIG-I in the antiviral response to an infection in vivo, we found that RIG-I expression is induced 200 fold, early in an innate immune response in ducks challenged with the H5N1 virus A/Vietnam/1203/04. Finding this natural disease resistance gene in ducks opens the possibility of increasing influenza resistance through creation of a transgenic chicken. PMID:20308570

  12. Avian influenza virus-induced regulation of duck fibroblast gene expression

    USDA-ARS?s Scientific Manuscript database

    Highly pathogenic avian influenza (HPAI) H5N1 viruses have been non-pathogenic in ducks causing no disease or mild respiratory infections. However, in 2002, new viruses emerged causing systemic disease and death. To better understand the differences in pathogenicity of HPAI viruses in ducks, we in...

  13. Gene expression responses to highly pathogenic avian influenza H5N1 virus infections in ducks

    USDA-ARS?s Scientific Manuscript database

    Differences in host response to infection with avian influenza (AI) viruses were investigated by identifying genes differentially expressed in tissues of infected ducks. Clear differences in pathogenicity were observed among ducks inoculated with five H5N1 HPAI viruses. Virus titers in tissues cor...

  14. Scavenging ducks and transmission of highly pathogenic avian influenza, Java, Indonesia.

    PubMed

    Henning, Joerg; Wibawa, Hendra; Morton, John; Usman, Tri Bhakti; Junaidi, Akhmad; Meers, Joanne

    2010-08-01

    In Java, Indonesia, during March 2007-March 2008, 96 farms with scavenging ducks that were not vaccinated against highly pathogenic avian influenza (HPAI) were monitored bimonthly. Bird-level (prevalence among individual birds) H5 seroprevalence was 2.6% for ducks and 0.5% for chickens in contact with ducks. At least 1 seropositive bird was detected during 19.5% and 2.0% of duck- and chicken-flock visits, respectively. Duck flocks were 12.4x more likely than chicken flocks to have seropositive birds. During 21.4% of farm visits, duck was H5 seropositive when all sampled in-contact chickens were seronegative. Subtype H5 virus was detected during 2.5% of duck-flock visits and 1.5% of chicken-flock visits. When deaths from HPAI infection occurred, H5 virus shedding occurred in apparently healthy birds on 68.8% of farms. Of 180 poultry deaths investigated, 43.9% were attributed to H5 virus. These longitudinal study results indicate that ducks are a source of infection for chickens and, potentially, for humans.

  15. Identification and expression analysis of duck interleukin-17D in Riemeralla anatipestifer infection

    USDA-ARS?s Scientific Manuscript database

    Interleukin (IL)-17D is a proinflammatory cytokine with limited information on its biological functions. Here we provide the description of the sequence, bioactivity, and mRNA expression profile of duck IL-17D homologue. A full-length duck IL-17D (duIL-17D) cDNA with a 624-bp coding region was ident...

  16. Pathogenicity of H5N1 HPAI viruses from Vietnam in chickens and ducks

    USDA-ARS?s Scientific Manuscript database

    Ducks and other wild aquatic birds are the natural reservoir of influenza type A viruses, and influenza viruses in these species normally is an asymptomatic infection. Even the viruses that are highly pathogenic for chickens typically can infect but do not cause disease in domestic ducks. However,...

  17. Effect of age on pathogenesis and innate immune responses in Pekin ducks infected with different H5N1 highly pathogenic avian influenza viruses

    USDA-ARS?s Scientific Manuscript database

    The pathogenicity of H5N1 highly pathogenic avian influenza (HPAI) viruses in domestic ducks varies between different viruses and is affected by the age of the ducks, with younger ducks presenting more severe disease. In order to better understand the pathobiology of H5N1 HPAI in ducks, including t...

  18. Assessing the waddle: An evaluation of a 3-point gait score system for ducks.

    PubMed

    Makagon, Maja M; Woolley, Rebecca; Karcher, Darrin M

    2015-08-01

    Impaired walking ability is an economically important welfare problem that affects poultry raised for meat production, including Pekin ducks. To gain a better understanding of the impacts of walking impairments on duck production, and to identify contributing variables and plausible remedies, an accurate measure of walking ability must first be defined. The viability of a 3-point gait score system for characterizing the walking abilities of Pekin ducks was evaluated. Specifically, we examined whether the qualitative gait score categories corresponded to quantitative gait parameter measures, and evaluated the inter- and intra-rater reliabilities of the gait score system. Commercial Pekin ducks aged 13 to 14 d (14 d; 248 ducks), 20 to 21 d (21 d; 350 ducks), and 30 to 32 d (31 d; 368 ducks), were video recorded and gait scored using a 3-point system (GS0 = best gait; GS2 = poor gait) as they crossed a Tekscan(®) gait analysis system. Gait structure parameters were calculated based on 4 steps made by each duck. The most prominent differences were observed at 21 d and 31 d of age between the ducks with GS0 and GS2, with GS2 scoring ducks walking a shorter total distance, having greater differences in the amount of pressure applied to the right versus left leg, and the amount of time spent standing on 2 feet between steps. Gait score reliabilities were calculated separately for observers who received minimal training (M, N = 10) and those who viewed and discussed the sample cases (V, N = 13). Both groups assessed the gait of ducks from video footage. Inter-rater reliability (Fleiss kappa) was lowest for 14 d old ducks (M: k = 0.47, T: k = 0.62), and best for the 32 d old ducks (V: k = 0.75; T: k = 0.8). Overall, intra-rater reliabilities (Pearson's correlation) were high and were unaffected by the scorer's level of training (M: r = 0.87; V: r = 0.87; t21 = 0.43). The results indicate that a 3-point gait score system is a promising tool for assessing the walking ability

  19. Lead gunshot pellet ingestion and tissue lead levels in wild ducks from Argentine hunting hotspots.

    PubMed

    Ferreyra, Hebe; Romano, Marcelo; Beldomenico, Pablo; Caselli, Andrea; Correa, Ana; Uhart, Marcela

    2014-05-01

    Lead poisoning in waterfowl due to ingestion of lead pellets is a long recognized worldwide problem but poorly studied in South America, particularly in Argentinean wetlands where duck hunting with lead gunshot is extensive. In 2008, we found high pellet ingestion rates in a small sample of hunted ducks. To expand our knowledge on the extent of lead exposure and to assess health risks from spent shot intake, during 2011 and 2012 we sampled 415 hunter-killed ducks and 96 live-trapped ducks. We determined the incidence of lead shot ingestion and lead concentrations in bone, liver and blood in five duck species: whistling duck (Dendrocygna bicolor), white-faced tree duck (D. viduata), black-bellied whistling-duck (D. autumnalis), rosy-billed pochard (Netta peposaca) and Brazilian duck (Amazonetta brasiliensis). The ingestion of lead shot was confirmed in 10.4% of the ducks examined (43/415), with a prevalence that varied by site and year, from 7.6% to 50%. All bone samples (n=382) and over 60% of liver samples (249/412) contained lead concentrations above the detection limit. The geometric mean lead concentration in tissues (mg/kg dry weight) was 0.31 (GSD=3.93) and 3.61 (GSD=4.02) for liver and bone, respectively, and 0.20 (GSD=2.55) in blood (mg/kg wet weight). Lead levels surpassed toxicity thresholds at which clinical poisoning is expected in 3.15% of liver samples, 23.8% of bones and 28% of blood samples. Ducks with ingested lead pellets were much more likely to have high levels of lead in their liver. Rosy-billed pochards were consistently more prone to ingesting lead shot than other duck species sampled. However, whistling ducks showed higher levels of lead in liver and bone. Our results suggest that lead from ammunition could become a substantial threat for the conservation of wild duck populations in Argentina. The replacement of lead by non-toxic shot would be a reasonable and effective solution to this problem.

  20. Assessment of potential shale oil and tight sandstone gas resources of the Assam, Bombay, Cauvery, and Krishna-Godavari Provinces, India, 2013

    USGS Publications Warehouse

    Klett, Timothy R.; Schenk, Christopher J.; Wandrey, Craig J.; Brownfield, Michael E.; Charpentier, Ronald R.; Tennyson, Marilyn E.; Gautier, Donald L.

    2014-01-01

    Using a well performance-based geologic assessment methodology, the U.S. Geological Survey estimated a technically recoverable mean volume of 62 million barrels of oil in shale oil reservoirs, and more than 3,700 billion cubic feet of gas in tight sandstone gas reservoirs in the Bombay and Krishna-Godavari Provinces of India. The term “provinces” refer to geologically defined units assessed by the USGS for the purposes of this report and carries no political or diplomatic connotation. Shale oil and tight sandstone gas reservoirs were evaluated in the Assam and Cauvery Provinces, but these reservoirs were not quantitatively assessed.

  1. Science, population ecology, and the management of the American black duck

    USGS Publications Warehouse

    Nichols, J.D.

    1991-01-01

    This essay deals with the relevance of some of the ideas of Romesburg (1981) to population ecology and management of the American black duck (Anas rubripes). Most investigations dealing with the effects of hunting regulations on black duck populations have used the hypothetico-deductive (H-D) approach of specifying a priori hypotheses and associated deduced predictions. These investigations have not used manipulative experimentation, however, but have involved severely constrained analyses of historical data and have thus produced weak inferences. The 1982 lawsuit over black duck hunting regulations, the current uncertainty about appropriate black duck management actions, and the frequent skirmishes in the published literature of black duck population ecology are natural consequences of these weak inferences. I suggest that we attempt to take advantage of management and other manipulations by treating them as an opportunity to learn something via experimentation, as recommended by Macnab (1983) and Walters (1986).

  2. Genetic characterization of an H5N1 avian influenza virus with neurovirulence in ducks.

    PubMed

    Zou, Wei; Yu, Zhengjun; Zhou, Hongbo; Tu, Jiagang; Jin, Meilin

    2009-04-01

    In this report, an H5N1 avian influenza virus, A/duck/Hubei/hangmei01/2006, which could lead to acute disease including neurovirulence and mortality in ducks, was isolated in brains of domestic ducks in spring of 2006. Molecular characterization of the genes revealed that this virus harbored the common characteristics of a highly pathogenic avian influenza (HPAI). Phylogenetic analyses demonstrated that this virus was a member of the Fujian-like virus sublineage. All eight genes except NA and PB2 had the closest genetic relatives to the human influenza virus A/China/GD01/2006. It might indicate that the virus A/duck/Hubei/hangmei01/2006 originated from southern China, resulting from the wild bird migration or poultry transportation, and indicate that more surveillance upon evolution and transmission of influenza viruses in ducks was urgent.

  3. American black duck summer range versus winter range: a dichotomy of riches

    USGS Publications Warehouse

    Longcore, J.R.; Perry, Matthew C.

    2002-01-01

    The status of the American black duck (Anas rubripes) population has more often been attributed to a single event than to multiple events over time and throughout space. The difference in the quality of the habitat, however defined, within breeding areas in the North and in the southerly wintering areas, especially Chesapeake Bay, also has been proposed as affecting black duck status. The obvious question is 'What variable cuts across all habitats, time, and space to affect black ducks?' This paper attempts to answer that question by examining the connectivity of seemingly unrelated variables and events associated with the black duck's summer range and its winter range relative to population change. Insights from examples of relations among these variables reveal how results may be confounded and even misleading. A perspective that may be required to ensure future black duck populations is discussed.

  4. Black Ducks and Their Chesapeake Bay Habitats: Proceedings of a Symposium

    USGS Publications Warehouse

    Perry, Matthew C.

    2002-01-01

    The symposium 'Black Ducks and Their Chesapeake Bay Habitats,' held October 4,2000, provided a forum for scientists to share research about the American black duck (Anas rubripes), an important breeding and wintering waterfowl species dependent upon the Chesapeake Bay habitats. American black ducks have declined significantly in the last 50 years and continue to be a species of management concern. The symposium, sponsored by the Wildfowl Trust of North America and the U.S. Geological Survey, highlighted papers and posters on a range of topics, from the traditional concerns of hunting, habitat, and hybridization to the more recent concerns of human disturbance and neophobia. Other presentations provided a historical perspective of black duck management. The direction that black duck conservation initiatives could and/or should take in the future was also discussed. As populations of humans in the Chesapeake Bay region continue to increase, we can expect that these subjects will receive increased discussion in the future.

  5. SELECTED HEMATOLOGIC AND PLASMA BIOCHEMISTRY ANALYSIS OF FERRUGINOUS DUCKS (AYTHYA NYROCA) IN ISRAEL.

    PubMed

    Avni-Magen, Nili; Gancz, Ady Y; Beaufrère, Hugues; Lublin, Avishai; Eshar, David

    2016-03-01

    The ferruginous duck (Aythya nyroca) is a medium-sized chestnut-colored diving duck that inhabits wetlands of Europe and Asia. In recent years, this species has been declining throughout much of Europe--a decline that is attributed mainly to destruction of natural habitats, and to hunting and pollution. The ferruginous duck is listed as "near threatened" by the International Union for Conservation of Nature, and as a critically endangered nesting species in Israel. In 2009, a captive-breeding/reintroduction program was established in Israel, aiming to increase the species' population. The objective of this study was to collect data on normal hematology and plasma biochemistry analytes of ferruginous ducks in order to promote the species' conservation. Blood was collected from 49 birds, and 27 analytes were quantified. Compared to most other anseriformes studied, the ferruginous ducks in this study had lower white blood cell counts, which were dominated by heterophils rather than by lymphocytes.

  6. Survival and band recovery rates of sympatric grey ducks and mallards in New Zealand

    USGS Publications Warehouse

    Caithness, T.; Williams, M.; Nichols, J.D.

    1991-01-01

    We used band recovery data from grey ducks (Anas superciliosa) and mallards. (A. platyrhynchos) banded sympatrically during 1957-74 to estimate annual survival and recovery rates. Young birds tended to have higher recovery rates and lower survival rates than adults for both species. Both species showed strong evidence of year-to-year variation in annual survival rates. Survival rates of male mallards were higher than those in females, as is typical for this species in North America, but there was no evidence of sex-specific survival differences in grey ducks. Recovery rate estimates for grey ducks were high and were significantly higher than those for mallards. However, survival rates did not differ significantly between the 2 species within any age-sex class. The similar survival rates, when mallard populations were increasing and grey ducks were decreasing, suggest that mallard reproductive rates have been greater than those of grey ducks.

  7. Hydrophobic duck feathers and their simulation on textile substrates for water repellent treatment.

    PubMed

    Liu, Yuyang; Chen, Xianqiong; Xin, J H

    2008-12-01

    Inspired by the non-wetting phenomena of duck feathers, the water repellent property of duck feathers was studied at the nanoscale. The microstructures of the duck feather were investigated by a scanning electron microscope (SEM) imaging method through a step-by-step magnifying procedure. The SEM results show that duck feathers have a multi-scale structure and that this multi-scale structure as well as the preening oil are responsible for their super hydrophobic behavior. The microstructures of the duck feather were simulated on textile substrates using the biopolymer chitosan as building blocks through a novel surface solution precipitation (SSP) method, and then the textile substrates were further modified with a silicone compound to achieve low surface energy. The resultant textiles exhibit super water repellent properties, thus providing a simple bionic way to create super hydrophobic surfaces on soft substrates using flexible material as building blocks.

  8. Distribution patterns of American black duck and mallard winter band recoveries

    USGS Publications Warehouse

    Diefenbach, D.R.; Nichols, J.D.; Hines, J.E.

    1988-01-01

    We compared the distribution patterns of winter band recoveries of American black ducks (Anas rubripes) and mallards (A. platyrhynchos) banded in the same breeding areas. Young black ducks wintered northeast of young mallards but no differences in distribution patterns were detected between adult birds of the 2 species. Mallards exhibited greater temporal variation in distribution patterns and less fidelity to wintering areas. We speculate that these differences in distribution patterns are related to different behavioral responses by mallards and black ducks to variation in resource availability. Black ducks may reduce energy expenditure during periods of extreme cold and wait for conditions to improve, whereas mallards may migrate to areas that are warmer of where more food is available. The availability of quality habitat may be critical to the survival of black ducks during harsh weather conditions because of their relative lack of migrational flexibility, whereas mallards may be able to respond by migrating to favorable environments.

  9. DDE thins eggshells and lowers reproductive success of captive black ducks

    USGS Publications Warehouse

    Longcore, J.R.; Samson, F.B.; Whittendale, T.W.

    1971-01-01

    Eggs of captive black ducks fed diets containing DDE at 10 and 30 ppm (dry weight) experienced significant shell thinning and an increase in shell cracking when compared to eggs of untreated black ducks. Eggshells from dosed ducks were: 18-24 percent thinner at the equator than shells from undosed ducks; 28-31 percent thinner at the cap; and 29-38 percent thinner at the apex. Shell cracking averaged 21 percent among eggs fram the 30 ppm DDE dosage and 10 percent among eggs from the 10 ppm dosage. Only 2 percent of the eggs from untreated black ducks were cracked. Survival of ducklings fram dosed parents in terms of 'percentage of 21-day ducklings of embryonated eggs' was 40-76 percent lower than survival of ducklings from undosed parents. Average DDE residues (wet weight) in eggs from hens fed 10 and 30 ppm DDE were 46 ppm and 144 ppm, respectively.

  10. Evaluations of duck habitat and estimation of duck population sizes with a remote-sensing-based system

    USGS Publications Warehouse

    Cowardin, Lewis M.; Shaffer, Terry L.; Arnold, Phillip M.

    1995-01-01

    During 1987-90, we used high-altitude photography, aerial videography, counts, and models to estimate sizes of breeding populations of dabbling ducks (Anatinae) and duck production and to identify duck habitat on U.S. Fish and Wildlife Service land and easements and on private land in the prairie pothole region of the United States. The study area contained about 3.1 million wetland basins (28,490 km2). Wetland area (ha per km2) was highest on service-owned land; wetland-basin density was greatest on service easements. Temporary and seasonal wetlands were underrepresented and lakes were overrepresented on service-owned land. Seventy-eight percent of all basins were less than 0.41 ha. Cropland dominated private land. Pond density decreased from 4.4/km2 in 1987 to 3.4/km2 in 1990 and pond area, from 7.2 ha/km2 to 2.7 ha/km2. The density of the blue-winged teal was greatest (3.4 pairs/km2) and was followed in magnitude by those of the mallard (2.1 pairs/km2), the gadwall (1.8 pairs/km2), the northern pintail (0.8 pairs/km2), and the redhead (0.8 pairs/km2). Duck density was consistently highest on service-owned land. The decline of breeding-population sizes in 1987-90 closely corresponded to losses of pond numbers and pond area. The density of breeding pairs per pond was inversely related to pond density, suggesting that breeding ducks tended to concentrate on the remaining ponds as drought intensified. The production of recruits followed the same pattern as breeding-population sizes. We estimated that 2.5% of the ducklings hatched on service-owned land, which was 1.3% of the study area; 19.6% hatched on service easements, which were 14.2% of the study area; and 77.9% hatched on private land, which was 84.6% of the study area. Various sources of bias and sampling error and improvements to the system are discussed.

  11. Tembusu virus infection in Cherry Valley ducks: the effect of age at infection.

    PubMed

    Sun, X Y; Diao, Y X; Wang, J; Liu, X; Lu, A L; Zhang, L; Ge, P P; Hao, D M

    2014-01-10

    Three groups of Cherry Valley ducks at 5 day, 2 week and 5 week of age were intranasally infected with the WFCL strain of Tembusu virus (TMUV) to investigate the effect of host age on the outcome of TMUV infection. For each age group, clinical signs, gross and microscopic lesions, viral copy numbers in tissues and serum neutralizing antibody titers were recorded. Age-related differences in the resistance to TMUV infection were observed with younger ducks being more susceptible. Some ducks infected at 5 day and 2 week of age developed severe clinical signs, including severe neurological dysfunction and death. However, subclinical signs and no mortality were observed in ducks infected at 5 week of age. A decline in the severity of gross and microscopic lesions was observed as ducks mature. Systemic infections were established in the three age groups post challenge. Higher viral copy numbers in the tissues, especially in vital organs such as the brain and the heart, were developed in the ducks infected at 5 day of age than older ducks, correlating with the severity of clinical signs and lesions in the tissues. Furthermore, ducks infected at 5 week of age developed significantly higher serum neutralizing antibody titers than ducks infected at 5 day of age as determined by serum neutralization test. Therefore, age-related differences in the resistance to TMUV infection should be considered when studying the pathogenicity, pathogenesis, formulation of the vaccination and therapy strategies of TMUV infection in ducks. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Characterization of Gut Microbiome Dynamics in Developing Pekin Ducks and Impact of Management System.

    PubMed

    Best, Aaron A; Porter, Amanda L; Fraley, Susan M; Fraley, Gregory S

    2016-01-01

    Little to no research has been conducted on the gut microbiome of the Pekin duck, yet over 24.5 million ducks are raised for human consumption each year in the United States alone. Knowledge of the microbiome could lead to an understanding of the effects of growing conditions such as the use of prebiotics, probiotics, and enzymes in feeding practices, the use of antibiotics, and the sources of pathogenic bacteria in diseased ducks. In order to characterize changes in the caecal microbiome that occur as ducks develop through a typical industry grow-out period, a 16S rRNA community analysis of caecal contents collected over a 6-week period was conducted using a next generation sequencing approach. Transitions in the composition of the caecal microbiome occurred throughout the lifespan, with a large shift during days 4 through 10 posthatch. Two major phyla of bacteria were found to be present within the caeca of aviary raised ducks, with the relative abundance of each phylum varying by age of the duck. Proteobacteria is dominant for the first 3 days of age, and Firmicutes increases and dominates beginning at day 4. Barn raised ducks contained a significant population of Bacteroidetes in addition to Proteobacteria and Firmicutes at later developmental time points, though this phylum was absent in aviary raised ducks. Genera containing pathogens of anseriformes most often found in industry settings were either absent or found as normal parts of the caecal microbial populations. The high level differences in phylum abundance highlight the importance of well-designed sampling strategies for microbiome based studies. Results showed clear distinctions between Pekin Duck caecal contents and those of Broiler Chickens and Turkey in a qualitative comparison. These data provide a reference point for studies of the Pekin Duck through industry grow-out ages, provide a foundation for understanding the types of bacteria that promote health, and may lead to improved methods to

  13. Insulin effect on lipogenesis and fat distribution in three genotypes of ducks during overfeeding.

    PubMed

    Gontier, Karine; André, Jean-Marc; Bernadet, Marie-Dominique; Ricaud, Karine; Davail, Stéphane

    2013-03-01

    In waterfowl, the response to overfeeding differs from one genotype to the other. Pekin ducks generally store lipids in the peripheral tissues while Muscovy and mule ducks promote hepatic lipid storage. A possible reason for these various susceptibilities to hepatic steatosis could be a difference in insulin sensitivity. We suggest a resistance to insulin in Pekin ducks. In the present work we investigate the action of insulin on glucose and lipid metabolisms for the three overfed genotypes. Regardless of the kind of genotype, all ducks appear to be sensitive to insulin: their glycemia is lower when the animals are treated with insulin. Insulin-treated Muscovy and Pekin ducks present a lower increase in total body weight (-16.5% for Muscovy; -8.3% for Pekin); and a significantly lower liver weight than the controls (-9.6% and -18.3%). The percentage of total lipids in the liver is higher in the controls than in the insulin-treated Pekin and mule ducks (respectively -40.4% and -34.7%), which means a decreased hepatic lipogenesis. Pekin ducks present a higher pectoral muscle weight when the individuals are insulin-treated (+9.7%). Lipoprotein lipase (LPL) activity appears to be significantly higher in insulin-treated Pekin and Muscovy ducks (1.39 and 3.38 times greater than controls). Insulin-treated mule ducks present a decrease of muscle and abdominal lipid storage compared to controls (-11.6% and -13.8%). In this experiment, exogenous insulin has induced an increase of lipid oxidation and has led to a less favorable use and storage of dietary glucose. The hypothesis of insulin-resistance of Pekin ducks is not verified. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Effects of alfalfa meal on growth performance and gastrointestinal tract development of growing ducks.

    PubMed

    Jiang, J F; Song, X M; Huang, X; Zhou, W D; Wu, J L; Zhu, Z G; Zheng, H C; Jiang, Y Q

    2012-10-01

    A study was conducted to evaluate effects of alfalfa meal on growth performance and gastrointestinal tract development of growing layer ducks to provide evidence for application of alfalfa meal in the duck industry. Two hundred and fifty-six healthy Shaoxing 7-wk old growing layer ducks were selected and randomly allocated to 1 of 4 dietary treatments based on corn and soybean meal and containing 0, 3, 6, and 9% of alfalfa meal for 8 wks. Each treatment consisted of 4 replicates of 16 ducks each. Briefly, birds were raised in separate compartments, and each compartment consisted of three parts: indoor floor house, adjacent open area and a connecting water area. The results showed: i) Growing ducks fed alfalfa meal diet were not significantly different in average daily gain, feed intake and gain-to-feed ratio from those fed no alfalfa diet (p>0.05). ii) Alfalfa meal increased the ratio crop, gizzard to live weight, caecum to live weight, the caecum index of growing ducks (p<0.05). iii) Villus height in duodenum and jejunum of growing ducks increased significantly with the increase of alfalfa meal levels (p<0.05). Crypt depth in duodenum and jejunum of growing ducks decreased significantly with the increase of alfalfa meal levels (p<0.05). This experiment showed that feeding of alfalfa meal to growing layer ducks could improve gastrointestinal tract growth and small intestinal morphology without effect on performance. This experiment provides evidence that alfalfa meal is a very valuable feedstuff for growing layer ducks.

  15. Experimental susceptibility of wood ducks (Aix sponsa) for West Nile virus.

    PubMed

    Hofmeister, Erik; Porter, Robert E; Franson, J Christian

    2015-04-01

    Detection of West Nile virus (WNV) has been reported in a variety of wild ducks in the US, but little is known about the pathogenesis and outcome of exposure of the disease in these species. Previous experimental studies of WNV in ducks either have challenged a small number of ducks with WNV or have tested domesticated ducks. To determine susceptibility and immune response, we challenged 7-wk-old Wood Ducks (Aix sponsa) with a 1999 American Crow (Corvus brachyrhynchos) isolate of WNV. Wood Ducks were susceptible to infection with the virus, and, although clinical signs or mortality were not observed, microscopic lesions were noted, particularly in the heart and brain. West Nile virus viremia peaked on day 2 postinfection (pi) at 10(4.54) plaque-forming units (PFU) of virus/mL serum and WNV was shed orally (between 10(2) and 10(2.9) PFU per swab) and cloacally. Specific anti-WNV antibody response was rapid, with anti-WNV IgM detected on day 3 pi followed on day 5 pi by anti-WNV IgG. Neutralizing antibodies were detected by plaque-reduction neutralization assay in one duck on day 4 pi, and in all sampled ducks on day 5. These results indicate that Wood Ducks are susceptible to WNV, but it is unlikely that significant WNV mortality events occur in Wood Ducks or that they play a significant role in transmission. However, WNV viremia was sufficient, in theory, to infect mosquitoes, and oral and cloacal shedding of the virus may increase the risk of infection to other waterbirds.

  16. Effects of Alfalfa Meal on Growth Performance and Gastrointestinal Tract Development of Growing Ducks

    PubMed Central

    Jiang, J. F.; Song, X. M.; Huang, X.; Zhou, W. D.; Wu, J. L.; Zhu, Z. G.; Zheng, H. C.; Jiang, Y. Q.

    2012-01-01

    A study was conducted to evaluate effects of alfalfa meal on growth performance and gastrointestinal tract development of growing layer ducks to provide evidence for application of alfalfa meal in the duck industry. Two hundred and fifty-six healthy Shaoxing 7-wk old growing layer ducks were selected and randomly allocated to 1 of 4 dietary treatments based on corn and soybean meal and containing 0, 3, 6, and 9% of alfalfa meal for 8 wks. Each treatment consisted of 4 replicates of 16 ducks each. Briefly, birds were raised in separate compartments, and each compartment consisted of three parts: indoor floor house, adjacent open area and a connecting water area. The results showed: i) Growing ducks fed alfalfa meal diet were not significantly different in average daily gain, feed intake and gain-to-feed ratio from those fed no alfalfa diet (p>0.05). ii) Alfalfa meal increased the ratio crop, gizzard to live weight, caecum to live weight, the caecum index of growing ducks (p<0.05). iii) Villus height in duodenum and jejunum of growing ducks increased significantly with the increase of alfalfa meal levels (p<0.05). Crypt depth in duodenum and jejunum of growing ducks decreased significantly with the increase of alfalfa meal levels (p<0.05). This experiment showed that feeding of alfalfa meal to growing layer ducks could improve gastrointestinal tract growth and small intestinal morphology without effect on performance. This experiment provides evidence that alfalfa meal is a very valuable feedstuff for growing layer ducks. PMID:25049501

  17. Genetic relationship of H3 subtype avian influenza viruses isolated from domestic ducks and wild birds in Korea and their pathogenic potential in chickens and ducks.

    PubMed

    Choi, Jun-Gu; Kang, Hyun-Mi; Kim, Min-Chul; Paek, Mi-Ra; Kim, Hye-Ryoung; Kim, Bang-Sil; Kwon, Jun-Hun; Kim, Jae-Hong; Lee, Youn-Jeong

    2012-03-23

    The H3 subtype avian influenza virus (AIV) is one of the most frequently isolated subtypes in domestic ducks, live poultry markets, and wild birds in Korea. In 2002-2009, a total of 45 H3 subtype AIVs were isolated from the feces of clinically normal domestic ducks (n=28) and wild birds (n=17). The most prevalent subtypes in domestic ducks were H3N2 (35.7%), H3N6 (35.7%), H3N8 (25.0%), and H3N1 (3.6%, novel subtype in domestic duck in Korea). In contrast, H3N8 (70.6%) is the most prevalent subtype in wild birds in Korea. In the phylogenetic analysis, HA genes of the Korean H3 AIVs were divided into 3 groups (Korean duck, wild bird 1, and wild bird 2) and all viruses of duck origin except one were clustered in a single group. However, other genes showed extensive diversity and at least 17 genotypes were circulating in domestic ducks in Korea. When the analysis expanded to viruses of wild bird origin, the genetic diversity of Korean H3 AIVs became more complicated. Extensive reassortments may have occurred in H3 subtype influenza viruses in Korea. When we inoculated chickens and ducks with six selected viruses, some of the viruses replicated efficiently without pre-adaptation and shed a significant amount of viruses through oropharyngeal and cloacal routes. This raised concerns that H3 subtype AIV could be a new subtype in chickens in Korea. Continuous surveillance is needed to prepare the advent of a novel subtype AIV in Korea. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Development of an indirect ELISA with epitope on nonstructural protein of Muscovy duck parvovirus for differentiating between infected and vaccinated Muscovy ducks.

    PubMed

    Yan, B; Ma, J-Z; Yu, T-F; Shao, S-L; Li, M; Fan, X-D

    2014-12-01

    The aim of this study was to develop an indirect enzyme-linked immunosorbent assay (i-ELISA) based on epitope AA503-509 (RANEPKE), which is on nonstructural protein of Muscovy duck parvovirus (MDPV). Sera (100) from negative and vaccinated Muscovy ducks were compared with infected sera (240) to establish the cut-off value of this i-ELISA. There was a significant difference between the positive and negative populations (P < 0·05). The adoption of this positive-negative threshold value for this i-ELISA assay resulted in specificity of 98·0%. This i-ELISA could be used as a diagnostic tool for differentiating infected Muscovy ducks from Muscovy ducks vaccinated with inactivated virus. In this study, we developed an i-ELISA based on epitope AA503-509 (RANEPKE), which is on nonstructural protein of MDPV. This i-ELISA could be used as a diagnostic tool for differentiating infected Muscovy ducks from Muscovy ducks vaccinated with inactivated virus. © 2014 The Society for Applied Microbiology.

  19. Identification of Microorganisms in Duck Meat Products Available in Korea and the Effect of High Hydrostatic Pressure

    PubMed Central

    Kim, Hyun-Joo; Jung, Samooel; Kwon, Joong-Ho; Heo, Kang Nyung

    2016-01-01

    The objective of this study was to investigate the microbial count of duck meat and duck meat products commercially available in Korea. High hydrostatic pressure (HHP) treatment was applied at 0.1, 300, 400, and 500 MPa for 5 min to enhance the microbiological safety of duck meats. The levels of total aerobic bacteria were in the ranges of 3.53-6.19 and 3.62-6.85 Log CFU/g in raw and smoked duck products, respectively. By DNA sequence analysis, we identified microorganisms responsible for spoilage, with the most common species in the raw and smoked duck products being Aeromonas spp. or Pseudomonas spp. and Leuconostoc mesenteroides, respectively. HHP treatment significantly reduced the levels of total aerobic bacteria in raw and smoked duck products. This study demonstrates that HHP treatment may be used to effectively improve the safety of raw and smoked duck meat products. PMID:27194939

  20. Identification of Microorganisms in Duck Meat Products Available in Korea and the Effect of High Hydrostatic Pressure.

    PubMed

    Kim, Hyun-Joo; Yong, Hae In; Lee, Hyun Jung; Jung, Samooel; Kwon, Joong-Ho; Heo, Kang Nyung; Jo, Cheorun

    2016-01-01

    The objective of this study was to investigate the microbial count of duck meat and duck meat products commercially available in Korea. High hydrostatic pressure (HHP) treatment was applied at 0.1, 300, 400, and 500 MPa for 5 min to enhance the microbiological safety of duck meats. The levels of total aerobic bacteria were in the ranges of 3.53-6.19 and 3.62-6.85 Log CFU/g in raw and smoked duck products, respectively. By DNA sequence analysis, we identified microorganisms responsible for spoilage, with the most common species in the raw and smoked duck products being Aeromonas spp. or Pseudomonas spp. and Leuconostoc mesenteroides, respectively. HHP treatment significantly reduced the levels of total aerobic bacteria in raw and smoked duck products. This study demonstrates that HHP treatment may be used to effectively improve the safety of raw and smoked duck meat products.

  1. The effects of environmental enrichment devices on feather picking in commercially housed Pekin ducks.

    PubMed

    Colton, S; Fraley, G S

    2014-09-01

    Like other poultry species, Pekin ducks occasionally show an auto-mutilation behavior referred to as feather picking. Self-picking can lead to further pecking by conspecifics and ultimately to reduced feather quality and poor overall health of the bird. Although the reasons underlying feather picking are not clear, it appears to occur when the ducks are transitioning between downy feathers and adult plumage, between 17 and 22 d of age. We hypothesized that giving Pekin ducks a substitute outlet for this behavior in the form of environmental enrichment devices (EED) would decrease feather picking and improve feather quality and duck health and welfare. The EED were plastic Wiffle-style balls, each threaded with 4 zip-ties. In the first experiment, we set out to determine that placement of EED would not induce fear or harmful behaviors. Five barns were each divided into 2 pens, holding an average combined total of approximately 4,500 ducks with one pen per barn used as control. Upon placement of the EED in one pen per barn, both pens were videotaped for a total of 2 h per day. The physical characteristics of 100 ducks per pen were scored at age 7, 21, 28, and 35. Results showed a decrease (P = 0.034) in both self-picking and conspecific-pecking in pens with EED compared with pens without EED. Although no differences in body condition scores were observed at 7 d of age, by d 21 ducks with EED showed better (P = 0.021) feather quality and cleanliness scores compared with ducks without EED. In a second experiment, we set out to determine if ducks had a color preference for blue/green, red, or white EED. Again, ducks with EED showed reduced (P = 0.038) feather picking compared with ducks without EED. Ducks interacted considerably more (P = 0.00089) frequently with blue/green EED then either red or white EED. These results suggest that providing environmental enrichment may minimize feather picking and improve feather quality and duck welfare.

  2. Nest and brood attentiveness in female black ducks

    USGS Publications Warehouse

    Ringelman, J.K.; Longcore, J.R.; Owen, R.B.

    1982-01-01

    Incubation rhythms and brood attentiveness of radio-marked Black Ducks (Anas rubripes) were studied in southcentral Maine during 1977-1980. Recess duration and frequency differed between three females nesting near wetlands (x = 82 min, 2.3 recesses/day) and two nesting at upland sites(x = 183 min, I. I recesses/day), but incubation constancy was similar for all birds (x = 86.7%). A fourth wetland-nesting female apparently responded to the absence of down and concealing cover at the nest site by taking shorter and fewer recesses (x= 34 min, 1.0 recesses/day) than did other wetland-nesters with typical nests. Wetland-nesters took longer recesses with increasing air temperature and following long incubation sessions. After their ducklings were two weeks old, two brood-rearing females began leaving their broods to forage on nearby wetlands. Duration of rearing recess (x = 56 min) and total recess time (x = 94 min/day) were less during this mid-rearing stage than during the latter part of rearing (x = 265 min, 488 min/day). The two hen-brood bonds terminated at 43 and 48 days. We suggest that small endogenous nutrient reserves and the low density of invertebrate foods, typical of Black Duck breeding habitat, were critical factors affecting the evolution of Black Duck incubation behavior. Bouts of inattention during brood rearing may have also evolved in relation to food requirements; by foraging on wetlands away from their broods, females avoid competing with offspring for common food resources.

  3. Salted and preserved duck eggs: a consumer market segmentation analysis.

    PubMed

    Arthur, Jennifer; Wiseman, Kelleen; Cheng, K M

    2015-08-01

    The combination of increasing ethnic diversity in North America and growing consumer support for local food products may present opportunities for local producers and processors in the ethnic foods product category. Our study examined the ethnic Chinese (pop. 402,000) market for salted and preserved duck eggs in Vancouver, British Columbia (BC), Canada. The objective of the study was to develop a segmentation model using survey data to categorize consumer groups based on their attitudes and the importance they placed on product attributes. We further used post-segmentation acculturation score, demographics and buyer behaviors to define these groups. Data were gathered via a survey of randomly selected Vancouver households with Chinese surnames (n = 410), targeting the adult responsible for grocery shopping. Results from principal component analysis and a 2-step cluster analysis suggest the existence of 4 market segments, described as Enthusiasts, Potentialists, Pragmatists, Health Skeptics (salted duck eggs), and Neutralists (preserved duck eggs). Kruskal Wallis tests and post hoc Mann-Whitney tests found significant differences between segments in terms of attitudes and the importance placed on product characteristics. Health Skeptics, preserved egg Potentialists, and Pragmatists of both egg products were significantly biased against Chinese imports compared to others. Except for Enthusiasts, segments disagreed that eggs are 'Healthy Products'. Preserved egg Enthusiasts had a significantly lower acculturation score (AS) compared to all others, while salted egg Enthusiasts had a lower AS compared to Health Skeptics. All segments rated "produced in BC, not mainland China" products in the "neutral to very likely" range for increasing their satisfaction with the eggs. Results also indicate that buyers of each egg type are willing to pay an average premium of at least 10% more for BC produced products versus imports, with all other characteristics equal. Overall

  4. Temporal flexibility of reproduction in temperate-breeding dabbling ducks

    USGS Publications Warehouse

    Krapu, Gary L.

    2000-01-01

    I compared nesting intervals during three consecutive years in five species of temperate-nesting dabbling ducks (Mallard [Anas platyrhynchos], Northern Pintail [Anas acuta], Northern Shoveler [Anas clypeata], Blue-winged Teal [Anas discors], Gadwall [Anas strepera]) and assessed whether differences existed in timing of refractoriness. Most nesting by females of all five species ended by the summer solstice. Nesting ended earliest for Northern Shovelers and Northern Pintails and latest for Gadwalls. Some Mallards, Blue-winged Teal, and Gadwalls continued to nest into mid- and late summer, whereas Northern Shovelers and Northern pintails did not. Mallards, Blue-winged Teal, and Gadwalls accounted for 99% (81 of 82) of flightless broods resulting from nests initiated during mid- or late summer in North Dakota and 98% (58 of 59) of flightless juveniles shot on or after 1 October by a random sample of duck hunters from across the United States. Early cessation of breeding by Northern Shovelers may have evolved in response to the species' limited flexibility in diet. Photorefractory mechanisms that limit most breeding to spring presumably evolved in response to severe constraints on reproductive success when nesting continued through summer(e.g. mortality of late-hatched young and molting females due to low temperatures). Interspecific differences in photosensitivity may account for variation in timing of cessation of nesting in late spring, but controlled experiments are needed to assess the possible role of non-photic influences. My results suggest that the refractory mechanisms controlling length of the breeding in temperate-nesting dabbling ducks are more varied and complex than previously thought, with non-photic influences (e.g. water conditions, food availability, food quality) having a larger role than indicated by earlier research.

  5. Modeling movement and fidelity of American black ducks

    USGS Publications Warehouse

    Zimpfer, N.L.; Conroy, M.J.

    2006-01-01

    Spatial relationships among stocks of breeding waterfowl can be an important component of harvest management. Prediction and optimal harvest management under adaptive harvest management (AHM) requires information on the spatial relationships among breeding populations (fidelity and inter-year exchange), as well as rates of movements from breeding to harvest regions. We used band-recovery data to develop a model to estimate probabilities of movement for American black ducks (Anas rubripes) among 3 Canadian breeding strata and 6 harvest regions (3 in Canada, and 3 in the United States) over the period 1965-1998. Model selection criteria suggested that models containing area-, year-, and age-specific recovery rates with area- and sex-specific movement rates were the best for modeling movement. Movement by males to southern harvest areas was variable depending on the originating area. Males from the western breeding area predominantly moved to the Mississippi Flyway or southern Atlantic Flyway (??ij = 0.353, SE = 0.0187 and ??ij = 0.473, SE = 0.037, respectively), whereas males that originated in the eastern and central breeding strata moved to the northern Atlantic flyway (??ij = 0.842, SE = 0.010 and ??ij = 0.578, SE = 0.0222, respectively). We used combined recoveries and recaptures in Program MARK to estimate fidelity to the 3 Canadian breeding strata. Information criteria identified a model containing sex- and age-specific fidelity for black ducks. Estimates of fidelity were 0.9695 (SE = 0.0249) and 0.9554 (SE = 0.0434) for adult males and females, respectively. Estimates of fidelity for juveniles were slightly lower at 0.9210 (SE = 0.0931) and 0.8870 (SE = 0.0475) for males and females, respectively. These models have application to the development of spatially stratified black duck harvest management models for use in AHM.

  6. Effects of different wavelengths of light on the biology, behavior, and production of grow-out Pekin ducks.

    PubMed

    Campbell, C L; Colton, S; Haas, R; Rice, M; Porter, A; Schenk, A; Meelker, A; Fraley, S M; Fraley, G S

    2015-08-01

    Previous research has shown that red light conditions may improve growth and decrease aggressive behaviors in chickens and turkeys; however, more recent studies suggest that blue-green light may improve production of broilers over red light. To date, no research has been conducted to examine whether different wavelengths of light have an impact on production in the Pekin duck. To determine this, we raised Pekin ducks under aviary conditions that were similar to standard commercial barns. The ducks were kept in 3 different pens: red light (approximately 625 nm), blue light (approximately 425 nm), and white light. Light sources in each pen were standardized to produce a peak energy at 1.6 × 10³ μM photons/m²/s at the level of the ducks' heads. Ducks were given ad libitum access to water and commercial duck diet, and were housed on pine shavings at a density of 0.43 m²/duck. Ducks were evaluated weekly for BW and condition and a subjective measure of the duck's anxiety levels was determined. We found that ducks housed under blue light had significantly (P < 0.01) reduced BW at every age until the end of the study (processing age; 35 d). Unlike ducks housed under red or white light, ducks housed in the blue pen showed a higher level of anxiety; while evaluators were in the pen a majority of them began panting, they were much less inquisitive than other ducks, they took longer to exhibit normal social behavior once evaluation was completed, and they frequently "swarmed" when no people were present. There were no differences in any measurements between the red and white-lighted pens. These data suggest that unlike the chicken, blue lights may be inappropriate for raising Pekin ducks in a commercial setting. © 2015 Poultry Science Association Inc.

  7. Production of chicken progeny (Gallus gallus domesticus) from interspecies germline chimeric duck (Anas domesticus) by primordial germ cell transfer.

    PubMed

    Liu, Chunhai; Khazanehdari, Kamal A; Baskar, Vijaya; Saleem, Shazia; Kinne, Joerg; Wernery, Ulrich; Chang, Il-Kuk

    2012-04-01

    The present study aimed to investigate the differentiation of chicken (Gallus gallus domesticus) primordial germ cells (PGCs) in duck (Anas domesticus) gonads. Chimeric ducks were produced by transferring chicken PGCs into duck embryos. Transfer of 200 and 400 PGCs resulted in the detection of a total number of 63.0 ± 54.3 and 116.8 ± 47.1 chicken PGCs in the gonads of 7-day-old duck embryos, respectively. The chimeric rate of ducks prior to hatching was 52.9% and 90.9%, respectively. Chicken germ cells were assessed in the gonad of chimeric ducks with chicken-specific DNA probes. Chicken spermatogonia were detected in the seminiferous tubules of duck testis. Chicken oogonia, primitive and primary follicles, and chicken-derived oocytes were also found in the ovaries of chimeric ducks, indicating that chicken PGCs are able to migrate, proliferate, and differentiate in duck ovaries and participate in the progression of duck ovarian folliculogenesis. Chicken DNA was detected using PCR from the semen of chimeric ducks. A total number of 1057 chicken eggs were laid by Barred Rock hens after they were inseminated with chimeric duck semen, of which four chicken offspring hatched and one chicken embryo did not hatch. Female chimeric ducks were inseminated with chicken semen; however, no fertile eggs were obtained. In conclusion, these results demonstrated that chicken PGCs could interact with duck germinal epithelium and complete spermatogenesis and eventually give rise to functional sperm. The PGC-mediated germline chimera technology may provide a novel system for conserving endangered avian species.

  8. A chaotic model for the plague epidemic that has occurred in Bombay at the end of the 19th century

    NASA Astrophysics Data System (ADS)

    Mangiarotti, Sylvain

    2015-04-01

    The plague epidemic that has occurred in Bombay at the end of the 19th century was detected in 1896. One year before, an Advisory Committee had been appointed by the Secretary of State for India, the Royal Society, and the Lister Institute. This Committee made numerous investigations and gathered a large panel of data including the number of people attacked and died from the plague, records of rat and flea populations, as well as meteorological records of temperature and humidity [1]. The global modeling technique [2] aims to obtain low dimensional models able to simulate the observed cycles from time series. As far as we know, this technique has been tried only to one case of epidemiological analysis (the whooping cough infection) based on a discrete formulation [3]. In the present work, the continuous time formulation of this technique is used to analyze the time evolution of the plague epidemic from this data set. One low dimensional model (three variables) is obtained exhibiting a limit cycle of period-5. A chaotic behavior could be derived from this model by tuning the model parameters. It provides a strong argument for a dynamical behavior that can be approximated by low dimensional deterministic equations. This model also provides an empirical argument for chaos in epidemics. [1] Verjbitski D. T., Bannerman W. B. & Kápadiâ R. T., 1908. Reports on Plague Investigations in India (May,1908), The Journal of Hygiene, 8(2), 161 -308. [2] Mangiarotti S., Coudret R., Drapeau L. & Jarlan L., 2012. Polynomial search and Global modelling: two algorithms for modeling chaos. Physical Review E, 86(4), 046205. [3] Boudjema G. & Cazelles B., 2003. Extraction of nonlinear dynamics from short and noisy time series. Chaos, Solitons and Fractals, 12, 2051-2069.

  9. A possible K-T boundary bolide impact site offshore near Bombay and triggering of rapid Deccan volcanism

    NASA Astrophysics Data System (ADS)

    Negi, J. G.; Agrawal, P. K.; Pandey, O. P.; Singh, A. P.

    1993-03-01

    The temporal coincidence of a major biological mass extinction (including dinosaurs), the well-known iridium excess anomaly at the Cretaceous-Tertiary (K-T) boundary and the eruption of Deccan flood basalts at about 65 Ma has aroused global interest among geologists and biologists. It is widely debated whether the mass extinction and iridium anomaly are due to an asteroid impact or the massive outpouring of extensive Deccan volcanism. An oval shaped unusual positive gravity anomaly (10 000 km 2 in area) near Bombay has attracted our attention during a search for an impact site near Deccan basalts. A detailed gravity interpretation indicates the presence of a fossil conduit structure of 12 km height extending from a shallow crust-mantle boundary (at 18 km) to an approximate depth of 6 km from the surface. The conduit structure, with a maximum diameter of about 35 km at its base, may originate from cracking of a weak pre-Deccan trap shallow upwarped mantle. The structure may have been caused by a bolide impact which triggered the eruption of massive flood basalts (Deccan traps) on the western margin of the fast-moving Indian plate. An impact in this locality can explain the sudden detachment of the arcuate Seychelles block from India as well as the large-scale reorganisation of plate boundaries in the Indian Ocean. Our hypothesis of impact-triggered volcanism at 65 Ma advocates a bimodal cause for the mass extinction at the K-T boundary. Extraordinary geothermal and structural conditions of the nearby region are also discussed as circumstantial evidence to support the twin-cause mechanism by weakened features and the presence of partial melt at subcrustal depth.

  10. Lead toxicosis and salt glands in domestic ducks

    SciTech Connect

    Buggiani, S.S.; Rindi, S.

    1980-01-01

    The supraorbital nasal glands (salt glands), although present in all birds, have an important functional significance in marine birds and water fowl. In these species, such organs are remarkably developed and it has been demonstrated these nasal glands provide an extra-renal pathway for the excretion of sodium chloride mostly when the environmental conditions oblige these birds to consume quantities of salt greater than their relative ability of renal clearance. In the light of these facts and knowing the interaction of lead on the ATP-ase activity, we have analyzed the nasal glands from domestic ducks lead-dosed, upon various experimental conditions.

  11. Uptake and retention of dietary cadmium in mallard ducks

    USGS Publications Warehouse

    White, D.H.; Finley, M.T.

    1978-01-01

    Adult mallard ducks fed 0, 2, 20, or 200 ppm of cadmium chloride in the diet were sacrificed at 30-day intervals and tissues were analyzed for cadmium. No birds died during the study and body weights did not change. The liver and kidney accumulated the highest levels of cadmium. Tissue residues were significantly correlated in all treatment groups and residues increased with treatment level. Hematocrits and hemoglobin concentrations were normal in all groups throughout the study. Little cadmium accumulated in eggs of laying hens, but egg production was suppressed in the group fed 200 ppm.

  12. Hatchability tests with eggs from captive wood ducks

    USGS Publications Warehouse

    Doty, H.A.

    1972-01-01

    The effect of diet and artificial incubation on fertility and hatchability of wood duck (Aix sponsa) eggs and survival of young was measured. Hatchability of eggs from hens fed a diet containing 37 percent protein was increased significantly (P <0.05) over that of hens fed a diet containing 17 percent protein. Hatchability was also significantly (P<0.005) greater for eggs incubated 10 days under hens before being placed in an incubator than for eggs placed in an incubator for the entire period. Ducklings that hatched from naturally started incubation survived at a much higher rate (P<0.001). Egg fertility was not affected by the diets.

  13. Age-class separation of blue-winged ducks

    USGS Publications Warehouse

    Hohman, W.L.; Moore, J.L.; Twedt, D.J.; Mensik, John G.; Logerwell, E.

    1995-01-01

    Accurate determination of age is of fundamental importance to population and life history studies of waterfowl and their management. Therefore, we developed quantitative methods that separate adult and immature blue-winged teal (Anas discors), cinnamon teal (A. cyanoptera), and northern shovelers (A. clypeata) during spring and summer. To assess suitability of discriminant models using 9 remigial measurements, we compared model performance (% agreement between predicted age and age assigned to birds on the basis of definitive cloacal or rectral feather characteristics) in different flyways (Mississippi and Pacific) and between years (1990-91 and 1991-92). We also applied age-classification models to wings obtained from U.S. Fish and Wildlife Service harvest surveys in the Mississippi and Central-Pacific flyways (wing-bees) for which age had been determined using qualitative characteristics (i.e., remigial markings, shape, or wear). Except for male northern shovelers, models correctly aged lt 90% (range 70-86%) of blue-winged ducks. Model performance varied among species and differed between sexes and years. Proportions of individuals that were correctly aged were greater for males (range 63-86%) than females (range 39-69%). Models for northern shovelers performed better in flyway comparisons within year (1991-92, La. model applied to Calif. birds, and Calif. model applied to La. birds: 90 and 94% for M, and 89 and 76% for F, respectively) than in annual comparisons within the Mississippi Flyway (1991-92 model applied to 1990-91 data: 79% for M, 50% for F). Exclusion of measurements that varied by flyway or year did not improve model performance. Quantitative methods appear to be of limited value for age separation of female blue-winged ducks. Close agreement between predicted age and age assigned to wings from the wing-bees suggests that qualitative and quantitative methods may be equally accurate for age separation of male blue-winged ducks. We interpret annual

  14. The Growth of Protein Crystals Using McDUCK

    NASA Technical Reports Server (NTRS)

    Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc

    1998-01-01

    Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals

  15. The Growth of Protein Crystals Using McDUCK

    NASA Technical Reports Server (NTRS)

    Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc

    1998-01-01

    Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals

  16. Eggshell breakage by incubating black ducks fed DDE

    USGS Publications Warehouse

    Longcore, J.R.; Samson, F.B.

    1973-01-01

    Black duck (Anas rubripes) hens fed 10 ppm dry weight (approximately 3 ppm wet weight) of p,p'-DDE in the diet laid eggs with shells 22 percent thinner at the equator, 30 percent thinner at the cap, and 33 percent thinner at the apex than those of controls. Natural incubation increased shell cracking more than fourfold as compared with mechanical incubation. Hens removed cracked eggs from nests, and one hen terminated incubation. Hens fed DDE produced one-fifth as many ducklings as controls. DDE in eggs of dosed hens averaged 64.9 ppm wet weight.

  17. Beach slopes of North Carolina: Salvo to Duck

    USGS Publications Warehouse

    Doran, Kara S.; Long, Joseph W.; Overbeck, Jacquelyn R.

    2015-01-01

    The National Assessment of Coastal Change Hazards project derives features of beach morphology from lidar elevation data for the purpose of understanding and predicting storm impacts to our nation's coastlines. This dataset defines mean beach slopes along the United States Southeast Atlantic Ocean from Salvo to Duck, North Carolina for data collected at various times between 1996 and 2012. For further information regarding data collection and/or processing methods refer to USGS Open-File Report 2015–1053 (http://pubs.usgs.gov/of/2015/1053/).

  18. Brood sizes of sympatric American black ducks and mallards in Maine

    USGS Publications Warehouse

    Longcore, J.R.; Clugston, D.A.; McAuley, D.G.

    1998-01-01

    The long-term decline of the American black duck (Anas rubripes) population has been attributed to lower productivity of black ducks that might have been excluded from fertile agricultural wetlands by mallards (Anas platyrhynchos). We monitored broods on 53 wetlands in 1993 and on 58 wetlands in 1994 to determine mean brood sizes of black ducks and mallards in forested and agricultural landscapes. Study wetlands were moderately to highly fertile. We monitored 94 black duck broods each year and 46 (1993) and 52 (1994) mallard broods until they reached Class IIc-III (near fledging). No differences existed (P = 0.71) in mean brood size between black ducks (1993, 3.95 ? 0.23; 1994, 4.59 ? 0.24) and mallards (1993, 3.96 ? 0.35; 1994, 5.00 ? 0.43) either year. Brood size for species; however, was different between years (P = 0.014) and among wetland sites (P = 0.001). Mean sizes of broods were larger (P < 0.05) on 2 large impoundment complexes (Lake Josephine and Lake Christina) compared with brood sizes on other wetlands in forested or agricultural landscapes. No differences (P 0.41) existed between mean Class IIc-III, brood sizes of black ducks and mallards whether species were alone or together on wetlands. Our data document that mallard productivity is similar to that of black ducks where they breed sympatrically in Maine.

  19. Hemato-biochemical and pathological changes on avian influenza in naturally infected domestic ducks in Egypt

    PubMed Central

    Mahmoud, Essam A.

    2015-01-01

    Aim: Few studies have been made in regard to avian influenza (AI) in ducks, thus the aim of this work was planned to investigate the hematological, biochemical, and pathological changes in domestic Egyptian ducks naturally infected with AI. Materials and Methods: 30 duck from private backyards 3-month-old 15 were clinically healthy (Group 1) and the other fifteen (Group 2) were naturally diseased with AI (H5N1). The disease was diagnosed by polymerase chain reaction as H5N1. Results: Duck showed cyanosis, subcutaneous edema of head and neck with nervous signs (torticollis). Hematological studies revealed a microcytic hypochromic anemia. Biochemical studies revealed a significant decrease in total protein, albumin and globulin concentration with significant increase of activities of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, Υ-glutamyl transpeptidase, lactic acid dehydrogenase and creatine phsphokinase. Prominent increase in creatinine and uric acid in addition to hypocalcemia and hyperphosphatemia were significantly detected in the infected ducks. Histopathological finding confirm these investigations. Conclusion: The highly pathogenic AIV (A/H5N1) became more severe infectious to ducks than before and causes nervous manifestations and blindness which were uncommon in ducks. Besides the significant increases of hepatic enzymes, brain, heart, and renal markers as a response to virus damage to these organs. PMID:27047014

  20. Advertising displays of male Musk Ducks indicate population subdivision across the Nullarbor Plain of Australia

    USGS Publications Warehouse

    McCracken, K.G.; Fullagar, P.J.; Slater, E.C.; Paton, D.C.; Afton, A.D.

    2002-01-01

    Acoustic advertising displays (n=75) of male Musk Ducks Biziura lobata were analysed at ten widely spaced geographic localities in South Australia, Victoria, and Western Australia. Vocalisations differed in a fixed, non-overlapping pattern between allopatric Musk Duck populations in southeastern and southwestern Australia. These findings suggest that Musk Duck populations are subdivided by the Nullarbor Plain, the arid treeless desert at the head of the Great Australian Bight. Three vocalisations performed by male Musk Ducks not previously reported in the literature were documented also. Vocalisations of captive Musk Ducks collected from different geographic regions (southeast and southwest) differed between regions from which captives originally were collected and were unlike those performed by wild birds. Based on calls of immature Musk Ducks, acoustic variation within regional populations and the apparent inability of captive Musk Ducks reared in isolation to develop the wild type adult call, regional dialects seemingly are acquired in a social context by repeated observance of adult males and some combination of social imprinting, learning, or practice.