Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone

PubMed Central

de Mesquita, Alessandro Queiroz; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-01-01

OBJECTIVE: To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. METHODS: The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. RESULTS: Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. CONCLUSION: We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density. PMID:27982167

Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone.

PubMed

Mesquita, Alessandro Queiroz de; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-11-01

To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density.

Performance of clinical referral criteria for bone densitometry in patients under 65 years of age assessed by spine bone mineral density

PubMed Central

Kayan, K; de Takats, D; Ashford, R; Kanis, J; McCloskey, E

2003-01-01

Background: A case finding strategy based on a number of established risk factors has been suggested by Royal College of Physicians' (RCP) guidelines to optimise bone densitometry referrals for assessment of osteoporosis. Objective: The performance of clinical referral criteria was examined in women and men aged <65 years referred for bone mineral density (BMD) assessment. Study design: Cross sectional observational study over six months. Results: Though BMD tended to be lower in patients with multiple criteria for referral, differences from those referred with a single criterion were not statistically significant. The overall prevalence of osteoporosis was higher than expected in both sexes, 11.6% in women and 27.5% in men (expected prevalences were 8% and <1% respectively). BMD was significantly lower in patients referred with a single criterion compatible with the RCP guidelines than in age matched controls or in those patients referred with non-RCP criteria (mean (SD) Z score –0.47(1.38) v 0.35(1.41), p<0.001). Low body mass index was also significantly associated with a lower than expected BMD. In contrast, spine BMD was higher than expected in those with self reported back pain, loss of height, or spinal curvature (p = NS). Conclusion: Most of the criteria recommended by the RCP performed well in identifying relatively younger patients with low BMD and osteoporosis. However, prior fractures and corticosteroid use did not reach statistical significance probably due to inclusion of all energy fractures, and current or past steroid use of unspecified dose or duration. Criteria like loss of height and/or spine curvature perform relatively poorly, reflecting the need for further investigation to better identify those needing BMD assessment. PMID:14612601

Comparison of autogenous cancellous bone grafting and extracorporeal shock wave therapy on osteotomy healing in the tibial tuberosity advancement procedure in dogs. Radiographic densitometric evaluation.

PubMed

Barnes, K; Lanz, O; Werre, S; Clapp, K; Gilley, R

2015-01-01

To compare optical values in the osteotomy gap created after a tibial tuberosity advancement (TTA) treated with autogenous cancellous bone graft, extracorporeal shock wave therapy, a combination of autogenous cancellous bone graft and extracorporeal shock wave therapy, and absence of both autogenous cancellous bone graft and extracorporeal shock wave therapy using densitometry. Dogs that were presented for surgical repair of a cranial cruciate ligament rupture were randomly assigned to one of four groups: TTA with autogenous cancellous bone graft (TTA-G), TTA with autogenous cancellous bone graft and extracorporeal shock wave therapy (TTA-GS), TTA with extracorporeal shock wave therapy (TTA-S), and TTA with no additional therapy (TTA-O). Mediolateral radiographs at zero, four and eight weeks after surgery were evaluated to compare healing of the osteotomy gap via densitometry. An analysis of variance was used to compare the densitometric values between groups. At four weeks after surgery, a significant difference in osteotomy gap density was noted between TTA-GS (8.4 millimetres of aluminium equivalent [mmAleq]) and TTA-S (6.1 mmAleq), and between TTA-GS (8.4 mmAleq) and TTA-O (6.4 mmAleq). There were no significant differences noted between any groups at the eight week re-evaluation. There were no significant differences in the osteotomy gap density at eight weeks after surgery regardless of the treatment modality used. The combination of autogenous cancellous bone graft and extracorporeal shock wave therapy may lead to increased radiographic density of the osteotomy gap in the first four weeks after surgery. Densitometry using an aluminium step wedge is a feasible method for comparison of bone density after TTA in dogs.

Clinical Guidelines for Management of Bone Health in Rett Syndrome Based on Expert Consensus and Available Evidence

PubMed Central

Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M.; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R.; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny

2016-01-01

Objectives We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. Methods An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Results Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. Conclusion A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity. PMID:26849438

Comparative effect of soy protein, soy isoflavones, and 17beta-estradiol on bone metabolism in adult ovariectomized rats.

PubMed

Cai, David J; Zhao, Yongdong; Glasier, Jennifer; Cullen, Diane; Barnes, Stephen; Turner, Charles H; Wastney, Meryl; Weaver, Connie M

2005-05-01

This study provided a comprehensive investigation on the effect of soy protein and soy isoflavones on both calcium and bone metabolism in virgin adult rats. The measurements included bone histology, calcium kinetic modeling, calcium balance, bone densitometry, and whole body densitometry. Results confirmed the bone-preserving effect of estrogen but did not support a bone-sparing role of soy isoflavones. Several animal and short-term human studies have indicated that soy protein isolate enriched with isoflavones may be used as an alternative therapy to estrogen replacement therapy. However, none of the previous studies have investigated this estrogenic effect on both calcium and bone metabolism in animals or humans, which is essential in ascertaining the mode of action of isoflavones. This study was designed to determine the effects of soy protein versus isoflavones on calcium and bone metabolism in an ovariectomized rat model. Unmated 6-month-old ovariectomized and sham-operated female Sprague-Dawley rats were randomly assigned to nine groups (16 rats/group) and pair-fed soy- or casein-based diets with or without isoflavones for 8 weeks. A reference group was administered estrogen through subcutaneous implants (20-35 pg/liter plasma). Bone densitometry, histomorphometry, and mechanical testing were used to study bone metabolism and quality. Calcium metabolism was studied using calcium tracer balance and kinetics. After ovariectomy, estrogen prevented bone loss in trabecular bone and suppressed formation on both trabecular and cortical bone surfaces. Isoflavones given as enriched soy protein isolate or supplements did not prevent trabecular bone loss. Combining isoflavones with estrogen had no additional benefits over estrogen alone. There were no differences in response to isoflavones caused by protein source. None of the treatments significantly affected either total Ca balance or (45)Ca absorption. However, soy protein showed significant effects on reducing urinary loss of Ca in animals, irrespective of isoflavone level, perhaps because of the lower amount of sulfur-containing amino acids in soy protein. Estrogen, but not isoflavones at the levels tested, suppressed bone remodeling in both trabecular and cortical bone after ovariectomy.

Is bone mineral density measurement using dual-energy X-ray absorptiometry affected by gamma rays?

PubMed

Xie, Liang-Jun; Li, Jian-Fang; Zeng, Feng-Wei; Jiang, Hang; Cheng, Mu-Hua; Chen, Yi

2013-01-01

The objective of this study was to determine whether the gamma rays emitted from the radionuclide effect bone mineral density (BMD) measurement. Nine subjects (mean age: 56 ± 17.96 yr) scheduled for bone scanning underwent BMD measurement using dual-energy X-ray absorptiometry (DXA) (Hologic/Discovery A) before and 1, 2, and 4 h after injection of technetium-99m-methylene diphosphonate (99mTc-MDP). Ten subjects (mean age: 41 ± 15.47 yr) scheduled for therapy of differentiated thyroid carcinoma with iodine-131 underwent BMD measurement before and 2 h after therapeutic radionuclide administration. All patients were given whole body BMD measurement, including head, arm, ribs, lumbar spine, pelvis, and leg sites. Besides, patients who referred to radioiodine therapy were given total hip and femoral neck BMD measurement as well. No statistically significant changes in BMD values were detected after 99mTc-MDP and iodine-131 administration for all measurement sites (p > 0.05), and individual difference of BMD before and after radionuclide imaging or therapy was less than the least significant change in lumbar spine, total hip, and femoral neck. In conclusion, BMD measurements are not influenced by the gamma rays emitted from technetium-99m and iodine-131. DXA bone densitometry may be performed simultaneously with bone scanning and radioiodine therapy. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Usefulness of the Trabecular Bone Score for assessing the risk of osteoporotic fracture.

PubMed

Redondo, L; Puigoriol, E; Rodríguez, J R; Peris, P; Kanterewicz, E

2018-04-01

The trabecular bone score (TBS) is an imaging technique that assesses the condition of the trabecular microarchitecture. Preliminary results suggest that TBS, along with the bone mineral density assessment, could improve the calculation of the osteoporotic fracture risk. The aim of this study was to analyse TBS values and their relationship with the clinical characteristics, bone mineral density and history of fractures of a cohort of posmenopausal women. We analysed 2,257 posmenopausal women from the FRODOS cohort, which was created to determine the risk factors for osteoporotic fracture through a clinical survey and bone densitometry with vertebral morphometry. TBS was applied to the densitometry images. TBS values ≤1230 were considered indicative of degraded microarchitecture. We performed a simple and multiple linear regression to determine the factors associated with this index. The mean TBS value in L1-L4 was 1.203±0.121. Some 55.3% of the women showed values indicating degraded microarchitecture. In the multiple linear regression analysis, the factors associated with low TBS values were age, weight, height, spinal T-score, glucocorticoid treatment, presence of type 2 diabetes and a history of fractures due to frailty. TBS showed microarchitecture degradation values in the participants of the FRODOS cohort and was associated with anthropometric factors, low bone mineral density values, the presence of fractures, a history of type 2 diabetes mellitus and the use of glucocorticoids. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.

Long-term therapy in COPD: any evidence of adverse effect on bone?

PubMed Central

Langhammer, Arnulf; Forsmo, Siri; Syversen, Unni

2009-01-01

Patients with COPD have high risk for osteoporosis and fractures. Hip and vertebral fractures might impair mobility, and vertebral fractures further reduce lung function. This review discusses the evidence of bone loss due to medical treatment opposed to disease severity and risk factors for COPD, and therapeutic options for the prevention and treatment of osteoporosis in these patients. A review of the English-language literature was conducted using the MEDLINE database until June 2009. Currently used bronchodilators probably lack adverse effect on bone. Oral corticosteroids (OCS) increase bone resorption and decrease bone formation in a dose response relationship, but the fracture risk is increased more than reflected by bone densitometry. Inhaled corticosteroids (ICS) have been associated with both increased bone loss and fracture risk. This might be a result of confounding by disease severity, but high doses of ICS have similar effects as equipotent doses of OCS. The life-style factors should be modified, use of regular OCS avoided and use of ICS restricted to those with evidenced effect and probably kept at moderate doses. The health care should actively reveal risk factors, include bone densitometry in fracture risk evaluation, and give adequate prevention and treatment for osteoporosis. PMID:19888355

Outcomes of bone density measurements in coeliac disease.

PubMed

Bolland, Mark J; Grey, Andrew; Rowbotham, David S

2016-01-29

Some guidelines recommend that patients with newly diagnosed coeliac disease undergo bone density scanning. We assessed the bone density results in a cohort of patients with coeliac disease. We searched bone density reports over two 5-year periods in all patients from Auckland District Health Board (2008-12) and in patients under 65 years from Counties Manukau District Health Board (2009-13) for the term 'coeliac.' Reports for 137 adults listed coeliac disease as an indication for bone densitometry. The average age was 47 years, body mass index (BMI) 25 kg/m(2), and 77% were female. The median time between coeliac disease diagnosis and bone densitometry was 261 days. The average bone density Z-score was slightly lower than expected (Z-score -0.3 to 0.4) at the lumbar spine, total hip and femoral neck, but 88-93% of Z-scores at each site lay within the normal range. Low bone density was strongly related to BMI: the proportions with Z-score <-2 for BMI <20, 20-25, 25-30, and >30 kg/m(2) were 28%, 15%, 6% and 0% respectively. Average bone density was normal, suggesting that bone density measurement is not indicated routinely in coeliac disease, but could be considered on a case-by-case basis for individuals with strong risk factors for fracture.

[Evaluation of bone mineral density in children with sickle cell disease].

PubMed

Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E

2015-04-01

To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

[Bone quantitative ultrasound].

PubMed

Matsukawa, Mami

2016-01-01

The conventional ultrasonic bone densitometry system can give us information of bone as ultrasonic wave velocity and attenuation. However, the data reflect both structural and material properties of bone. In order to focus only on the bone matrix properties without the effect of bone structure, studies of microscopic Brillouin scattering technique are introduced. The wave velocity in a trabecula was anisotropic and depended on the position and structure of the cancellous bone. The glycation also affected on the wave velocities in bone. As a new bone quality, the piezoelectricity of bone is also discussed.

Benefits for bone from resistance exercise and nutrition in long-duration spaceflight: Evidence from biochemistry and densitometry.

PubMed

Smith, Scott M; Heer, Martina A; Shackelford, Linda C; Sibonga, Jean D; Ploutz-Snyder, Lori; Zwart, Sara R

2012-09-01

Exercise has shown little success in mitigating bone loss from long-duration spaceflight. The first crews of the International Space Station (ISS) used the "interim resistive exercise device" (iRED), which allowed loads of up to 297 lb(f) (or 1337 N) but provided little protection of bone or no greater protection than aerobic exercise. In 2008, the Advanced Resistive Exercise Device (ARED), which allowed absolute loads of up to 600 lb(f) (1675 N), was launched to the ISS. We report dietary intake, bone densitometry, and biochemical markers in 13 crewmembers on ISS missions from 2006 to 2009. Of these 13, 8 had access to the iRED and 5 had access to the ARED. In both groups, bone-specific alkaline phosphatase tended to increase during flight toward the end of the mission (p = 0.06) and increased 30 days after landing (p < 0.001). Most markers of bone resorption were also increased in both groups during flight and 30 days after landing (p < 0.05). Bone densitometry revealed significant interactions (time and exercise device) for pelvis bone mineral density (BMD) and bone mineral content (p < 0.01), hip femoral neck BMD (p < 0.05), trochanter BMD (p < 0.05), and total hip BMD (p < 0.05). These variables were unchanged from preflight only for ARED crewmembers, who also returned from flight with higher percent lean mass and lower percent fat mass. Body mass was unchanged after flight in both groups. All crewmembers had nominal vitamin D status (75 ± 17 nmol/L) before and during flight. These data document that resistance exercise, coupled with adequate energy intake (shown by maintenance of body mass determined by dual-energy X-ray absorptiometry [DXA]) and vitamin D, can maintain bone in most regions during 4- to 6-month missions in microgravity. This is the first evidence that improving nutrition and resistance exercise during spaceflight can attenuate the expected BMD deficits previously observed after prolonged missions. Copyright © 2012 American Society for Bone and Mineral Research.

Quantitative data standardization of X-ray based densitometry methods

NASA Astrophysics Data System (ADS)

Sergunova, K. A.; Petraikin, A. V.; Petrjajkin, F. A.; Akhmad, K. S.; Semenov, D. S.; Potrakhov, N. N.

2018-02-01

In the present work is proposed the design of special liquid phantom for assessing the accuracy of quantitative densitometric data. Also are represented the dependencies between the measured bone mineral density values and the given values for different X-ray based densitometry techniques. Shown linear graphs make it possible to introduce correction factors to increase the accuracy of BMD measurement by QCT, DXA and DECT methods, and to use them for standardization and comparison of measurements.

Cough-induced rib fractures.

PubMed

Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H

2005-07-01

To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.

In situ micropillar compression reveals superior strength and ductility but an absence of damage in lamellar bone

NASA Astrophysics Data System (ADS)

Schwiedrzik, Jakob; Raghavan, Rejin; Bürki, Alexander; Lenader, Victor; Wolfram, Uwe; Michler, Johann; Zysset, Philippe

2014-07-01

Ageing societies suffer from an increasing incidence of bone fractures. Bone strength depends on the amount of mineral measured by clinical densitometry, but also on the micromechanical properties of the hierarchical organization of bone. Here, we investigate the mechanical response under monotonic and cyclic compression of both single osteonal lamellae and macroscopic samples containing numerous osteons. Micropillar compression tests in a scanning electron microscope, microindentation and macroscopic compression tests were performed on dry ovine bone to identify the elastic modulus, yield stress, plastic deformation, damage accumulation and failure mechanisms. We found that isolated lamellae exhibit a plastic behaviour, with higher yield stress and ductility but no damage. In agreement with a proposed rheological model, these experiments illustrate a transition from a ductile mechanical behaviour of bone at the microscale to a quasi-brittle response driven by the growth of cracks along interfaces or in the vicinity of pores at the macroscale.

76 FR 55069 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-06

... health problem primarily affecting the elderly and women after menopause. More specifically, the... automated bone mineral densitometry in a single examination. J Comput Assist Tomogr. 2011 Mar- Apr;35(2):212...

The results of a proximally-coated cementless femoral component in total hip replacement: a five- to 12-year follow-up.

PubMed

Kim, Y-H

2008-03-01

This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.

30years of DXA technology innovations.

PubMed

Glüer, Claus-C

2017-11-01

As the successor of Dual Photon Absorptiometry (DPA), Dual X-ray Absorptiometry (DXA) has seen 30years of continuous technological innovations. Implementation of measures for standardization and quality assurance made DXA a reliable and clinically useful approach. Its use in clinical multicenter drug studies in osteoporosis lead to general acceptance as the standard technique of bone densitometry. The limitations of DXA are well established. As a measure of areal bone mineral density (aBMD) it depends on bone size and is biased by overlaying soft tissue and calcified structures. To some extent these errors can be reduced by estimation of bone depth and/or lateral imaging. DXA based aBMD can be supplemented by additional information obtainable from DXA scans: geometric indices such as hip axis length or complex models like 2-D finite element analysis have been developed and tested. Given the drastic improvement in image quality current DXA scans can be used for Vertebral Fracture Analysis (VFA) or grading of Abdominal Aortic Calcifications. A textural measure, Trabecular Bone Score (TBS) provides independent information on fracture risk. DXA devices can also be used for assessments beyond bone density. Periprosthetic aBMD changes can be monitored to study the mechanical fitting of bone implants. Total body composition measurements are increasingly being used in studies on nutrition, obesity, and sarcopenia. 30years after its inception DXA is the undisputed standard imaging technique for the assessment of osteoporotic fracture risk with new applications beyond bone densitometry adding to its value. Copyright © 2017 Elsevier Inc. All rights reserved.

Application of a novel bone osteotomy plate leads to reduction in heat-induced bone tissue necrosis in sheep.

PubMed

Bekić, Marijo; Davila, Slavko; Hrskanović, Mato; Bekić, Marijana; Seiwerth, Sven; Erdeljić, Viktorija; Capak, Darko; Butković, Vladimir

2008-12-01

Previous studies have shown substantial effect thermal damage can have on new bone formation following osteotomy. In this study we evaluated the extent of thermal damage which occurs in four different methods of osteotomy and the effects it can have on bone healing. We further wanted to test whether a special osteotomy plate we constructed can lead to diminished heat generation during osteotomy and enhanced bone healing. The four methods evaluated included osteotomy performed by chisel, a newly constructed osteotomy plate, Gigly and oscillating saw. Twelve adult sheep underwent osteotomy performed on both tibiae. Bone fragments were stabilized using a fixation plate. Callus size was assessed using standard radiographs. Densitometry and histological evaluation were performed at 8 weeks following osteotomy. Temperature measurements were performed both in vivo during the operation, and ex vivo on explanted tibiae. The defects healed without complications and showed typical course of secondary fracture healing with callus ingrowth into the osteotomy gap. Radiographic examination of bone healing showed a tendency towards more callus formation in bones osteotomized using Gigly and oscillating saw, but this difference lacked significance. Use of Gigly and oscillating saw elicited much higher temperatures at the bone cortex surface, which subsequently lead to slightly impaired bone healing according to histological analysis. BMD was equal among all bones. In conclusion, the time required for complete healing of the defect differed depended greatly on the instruments used. The newly constructed osteotomy plate showed best results based on histological findings of capillary and osteoblast density.

Assessment of bone metabolism in premenopausal females with hyperthyroidism and hypothyroidism.

PubMed

Tuchendler, Dominika; Bolanowski, Marek

2013-01-01

Osteoporosis is one of the commonest metabolic diseases of bone. Its possible causes may include thyroid hormonal dysfunction. The objective of this study was to evaluate the effects of hyperthyroidism and hypothyroidism on osseous tissue metabolism in premenopausal women. 38 women with hyperthyroidism, 40 with hypothyroidism and 41 healthy women participated in this study. Initially after 6 and 12 months, each patient underwent selected hormonal, immunological and biochemical tests, measurement of concentrations of bone turnover markers and densitometry were also performed. On initial evaluation, lower cortical bone density was found in patients with hyperthyroidism (femoral neck). After 12 months, an increase in BMD was seen, but it was still lower than in the control group. Statistically significantly higher concentrations of bone turnover markers, decreasing from the sixth month of treatment, were noted only in the group with hyperthyroidism. Statistically significant differences were not noted in the femoral neck nor in the lumbar spine BMD in patients with hypothyroidism. Hyperthyroidism poses a negative effect on bone metabolism. Hypothyroidism in premenopausal females does not have any influence on bone density.

Dual Energy X-Ray Densitometry Apparatus and Method Using Single X-Ray Pulse

DTIC Science & Technology

1999-10-13

future bone fracture risk. Bone mineral loss is associated with aging and is more rapid in post-menopausal women. In addition, bone mineral loss is... parameters of the x-ray tube of Figures 1 and 2 illustrating, respectively, the calculated current, voltage and power; and Figures 4(a) and 4(d) are...assumed to be that of water. The bone mineral is hydroxyapatite (Ca5P30i3H) with an assumed density of 0.25 g/cm3 based on the lumbar vertebra metrology

National protocol for quality assurance in DXA-bone densitometry

NASA Astrophysics Data System (ADS)

Slavchev, A.; Avramova-Cholakova, S.; Vassileva, J.

2008-01-01

Osteoporosis becomes largely one of the most important socially significant and costly diseases. Modern techniques (DXA, US) are applied for bone densitometry. The paper presents a protocol for quality assurance especially of DXA-bone densitometers including quality control made in compliance with international standards (ISCD, IOF). The methodology has been tested in practice by measurements on site-functional assessment, entrance dose, radiation protection, calibration, in-vitro precision. It is expected to raise the quality of the diagnostic process in concert with the EU Medical Directive 97/43 particularly for population screening and sensitive groups. The protocol is an essential part of the National Program for constraining osteoporosis which has been elaborated at the Ministry of Health and at present under implementation throughout the country. It aims at reducing the risk, factors spreading, at diminishing the fracture risk the morbidity and the mortality from osteoporosis. An integral multidisciplinary approach to the problem solving is applied as well as training on three levels — doctors, patients, population, which effectively will contribute for obtaining real results in preventing osteoporosis.

Vitamin D and nutritional status are related to bone fractures in alcoholics.

PubMed

González-Reimers, Emilio; Alvisa-Negrín, Julio; Santolaria-Fernández, Francisco; Candelaria Martín-González, M; Hernández-Betancor, Iván; Fernández-Rodríguez, Camino M; Viña-Rodríguez, J; González-Díaz, Antonieta

2011-01-01

Bone fractures are common in alcoholics. To analyse which factors (ethanol consumption; liver function impairment; bone densitometry; hormone changes; nutritional status, and disrupted social links and altered eating habits) are related to bone fractures in 90 alcoholic men admitted to our hospitalization unit because of organic problems. Bone homoeostasis-related hormones were measured in patients and age- and sex-matched controls. Whole-body densitometry was performed by a Hologic QDR-2000 (Waltham, MA, USA) densitometer, recording bone mineral density (BMD) and fat and lean mass; nutritional status and liver function were assessed. The presence of prevalent fractures was assessed by anamnesis and chest X-ray film. Forty-nine patients presented at least one fracture. We failed to find differences between patients with and without fractures regarding BMD parameters. Differences regarding fat mass were absent, but lean mass was lower among patients with bone fracture. The presence of fracture was significantly associated with impaired subjective nutritional evaluation (χ² = 5.79, P = 0.016), lower vitamin D levels (Z = 2.98, P = 0.003) and irregular eating habits (χ² = 5.32, P = 0.02). Reduced lean mass and fat mass, and altered eating habits were more prevalent among patients with only rib fractures (n = 36) than in patients with multiple fractures and/or fractures affecting other bones (n = 13). These last were more closely related to decompensated liver disease. Serum vitamin D levels showed a significant relationship with handgrip strength (ρ = 0.26, P = 0.023) and lean mass at different parts of the body, but not with fat mass. By logistic regression analysis, only vitamin D and subjective nutritional evaluation were significantly, independently related with fractures. Prevalent fractures are common among heavy alcoholics. Their presence is related more closely to nutritional status, lean mass and vitamin D levels than to BMD. Lean mass is more reduced, nutritional status is more impaired and there is a trend to more altered eating habits among patients with rib fractures, whereas multiple fractures depend more heavily on advanced liver disease.

Physician visits and preventive care among Asian American and Pacific Islander long-term survivors of colorectal cancer, USA, 1996-2006.

PubMed

Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C

2014-03-01

Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.

Official Positions for FRAX® Bone Mineral Density and FRAX® simplification from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A

2011-01-01

Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Past and current weight change and forearm bone loss in middle-aged women: the Nord-Trøndelag Health Study, Norway.

PubMed

Forsmo, Siri; Langhammer, Arnulf; Schei, Berit

2009-01-01

The aim of this study was to investigate the association between bone loss and weight change before and concurrently to the assessment of forearm bone loss over 4.6 years in a population-based cohort of middle-aged women followed for more than 15 years. Among 8,856 women aged 45 to 60 years attending the first Nord-Trøndelag Health Study study, Norway (1984-1986), a 35% random sample was invited for forearm densitometry at Nord-Trøndelag Health Study 2 (1995-1997), and 2,188 women (78%) attended. After an average period of 4.6 years, they were subsequently invited for follow-up densitometry in 2001, and 1,421 women (67.8%) met. Weight and height were measured on all three occasions. During the total period of observation since baseline (15.5 y), the mean weight had increased by 3.4 kg, mostly in the youngest women. Weight loss had an accelerating and weight gain a decelerating effect on bone loss, and this was observed both for weight change occurring before the bone mineral density follow-up and for concurrent weight change. The relationship between prior weight gain or loss and bone loss seemed to persist, independent of the weight change observed during the period of bone loss assessment. Despite no mechanical impact of body weight on the forearm, weight loss in midlife women seems to be associated with a long-lasting negative effect on bone and vice versa for weight gain. This is presumably explained by humoral factors.

Determination of Small Animal Long Bone Properties Using Densitometry

NASA Technical Reports Server (NTRS)

Breit, Gregory A.; Goldberg, BethAnn K.; Whalen, Robert T.; Hargens, Alan R. (Technical Monitor)

1996-01-01

Assessment of bone structural property changes due to loading regimens or pharmacological treatment typically requires destructive mechanical testing and sectioning. Our group has accurately and non-destructively estimated three dimensional cross-sectional areal properties (principal moments of inertia, Imax and Imin, and principal angle, Theta) of human cadaver long bones from pixel-by-pixel analysis of three non-coplanar densitometry scans. Because the scanner beam width is on the order of typical small animal diapbyseal diameters, applying this technique to high-resolution scans of rat long bones necessitates additional processing to minimize errors induced by beam smearing, such as dependence on sample orientation and overestimation of Imax and Imin. We hypothesized that these errors are correctable by digital image processing of the raw scan data. In all cases, four scans, using only the low energy data (Hologic QDR-1000W, small animal mode), are averaged to increase image signal-to-noise ratio. Raw scans are additionally processed by interpolation, deconvolution by a filter derived from scanner beam characteristics, and masking using a variable threshold based on image dynamic range. To assess accuracy, we scanned an aluminum step phantom at 12 orientations over a range of 180 deg about the longitudinal axis, in 15 deg increments. The phantom dimensions (2.5, 3.1, 3.8 mm x 4.4 mm; Imin/Imax: 0.33-0.74) were comparable to the dimensions of a rat femur which was also scanned. Cross-sectional properties were determined at 0.25 mm increments along the length of the phantom and femur. The table shows average error (+/- SD) from theory of Imax, Imin, and Theta) over the 12 orientations, calculated from raw and fully processed phantom images, as well as standard deviations about the mean for the femur scans. Processing of phantom scans increased agreement with theory, indicating improved accuracy. Smaller standard deviations with processing indicate increased precision and repeatability. Standard deviations for the femur are consistent with those of the phantom. We conclude that in conjunction with digital image enhancement, densitometry scans are suitable for non-destructive determination of areal properties of small animal bones of comparable size to our phantom, allowing prediction of Imax and Imin within 2.5% and Theta within a fraction of a degree. This method represents a considerable extension of current methods of analyzing bone tissue distribution in small animal bones.

Effects of anticonvulsants and inactivity on bone disease in epileptics

PubMed Central

Murchison, Lilian E.; Bewsher, P. D.; Chesters, Marion; Gilbert, J.; Catto, G.; Law, Elizabeth; McKay, E.; Ross, H. S.

1975-01-01

No significant biochemical or radiological features of vitamin D deficiency were found in groups of juvenile and adult epileptics and control groups of non-epileptic patients in hospitals for the mentally retarded. There was evidence of hepatic enzyme induction in patients on anticonvulsants, in that urinary D-glucaric acid concentration and excretion were raised. No effect was found of prolonged anticonvulsant therapy on bone densitometry, but in children immobility was closely associated with decreased bone density. The evidence suggests that disuse osteoporosis is the major bone disease in these mentally retarded children. PMID:1161672

Preventive Care Screening in the Puerto Rican Geriatric Population: A Formative Evaluation of Patient Knowledge.

PubMed

Sepúlveda-Rivera, Vanessa; Donato-Santana, Christian; Diaz-Vega, Gil

2017-12-01

This study was meant to be the first step in bridging a gap in the literature concerning Puerto Rican geriatric patients' levels of knowledge concerning 4 preventive care screening tests: mammography, bone densitometry, colonoscopy, and lipid panels. Patients 65 years old and older were interviewed at the University of Puerto Rico (UPR), Medical Sciences Campus, primary care clinics. Fisher's exact test was used to assess knowledge status for each screening test. Fifty-three participants, 53% being women, took part in the study. All the women (100%) reported having knowledge about mammography screening as well as about bone densitometry scans (71%); 91% of the participants reported having knowledge concerning colonoscopy. Only 34% understood what information results from a lipid panel. The majority of the participants were not aware of precisely when each of the screening tests under discussion should be undertaken. For all the screenings, level of education and provider recommendation were associated with increased levels of knowledge (though statistically significant only for bone densitometry and lipid panels). Elderly Puerto Ricans appear to have knowledge about screening tests; however, there is an overall lack of knowledge about the timing of screening. Risk factors for this lack of knowledge are having a relatively lower level of education, the lack of healthcare-provider recommendation, and the lack of patient education. Understanding when to have tests is vital for interventions, in order to improve patient outcomes, which can include death from treatable conditions or diseases. Future research should include larger samples as well as studies of outcomes associated with these screening tests. These will help researchers and policymakers better understand this issue and aid in the development and implementation of interventions for both patients and physicians.

Relationship between metabolic syndrome and its components with bone densitometry in postmenopausal women.

PubMed

Abbasi, Mahnaz; Farzam, Seyed Amir; Mamaghani, Zahra; Yazdi, Zohreh

2017-11-01

Prevention of osteoporosis and bone fracture and the relationship between metabolic syndrome and bone density are controversial issues. The aim of this study was to evaluate the association between metabolic syndrome and its components with bone mineral density in post menopausal women referred for bone mineral density (BMD) test. A total of 143 postmenopausal women with at least one year of menopause experience participated in this cross-sectional study. Demographic and anthropometric characteristics for all participants were collected. Also, biochemical parameters including fasting blood sugar, Cholesterol (HDL and LDL), triglyceride were measured. Association between the components of metabolic syndrome and bone densitometry were analyzed by statistical methods. In this study, 72% of participants did not have metabolic syndrome. Among them, 43.4% and 28.7% had osteoporosis and normal density, respectively. Of remaining participants with metabolic syndrome, 12.6% and 15.4% had osteoporosis and normal density, respectively. Among the metabolic syndrome components, waist circumference, HDL cholesterol, and waist to hip ratio were significantly associated with bone mass (P<0.05). Osteoporotic women had lower waist circumference and waist to hip ratio and higher HDL than women without osteoporosis. On the other hand, women with metabolic syndrome did not have significant differences than women without metabolic syndrome in terms of lumbar and femoral neck density (P>0.05). Results from this study showed that metabolic syndrome and its components did not induce bone mass loss. The discrepancies of the studies in this area call for more large scale studies in population so as to prevent women problems in this area. Copyright © 2016 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Validation of Long Bone Mechanical Properties from Densitometry

NASA Technical Reports Server (NTRS)

Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)

1995-01-01

The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY

PubMed Central

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2015-01-01

Objective: To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. Methods: 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. Results: The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). Conclusion: US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age. PMID:27027001

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY.

PubMed

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2011-01-01

To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age.

Management of hypogonadism in adolescent girls and adult women with Prader-Willi syndrome.

PubMed

Eldar-Geva, Talia; Hirsch, Harry J; Pollak, Yehuda; Benarroch, Fortu; Gross-Tsur, Varda

2013-12-01

Prader-Willi syndrome (PWS) is a neurodevelopmental disorder characterized by an insatiable appetite, dysmorphic features, cognitive and behavioral difficulties, and hypogonadism. The heterogeneous reproductive hormone profiles indicate that some PWS women may have symptoms of hypoestrogenism, while others may potentially be fertile. We describe our experience in the assessment and treatment of hypogonadism in adolescents and adult females with PWS. The study population consisted of 20 PWS females, age ≥16 years (27.3 ± 7.9 years), followed in our clinic (12 deletion, 7 uniparental disomy, 1 imprinting-center defect). General physical examination, pubertal assessment, body mass index (BMI), gynecological examination, ultrasonography, bone densitometry, and hormonal profiles [FSH, LH, inhibin B, estradiol, prolactin, and TSH] were performed. The relevant assessed factors were: FSH and inhibin B, menstrual cycles (oligo/amenorrhea or irregular bleeding), ultrasound findings (endometrial thickness, uterine/ovarian abnormalities), BMI, bone densitometry, and patient/caregivers attitude. We classified seven women with inhibin B >20 ng/ml as potentially fertile. Following the assessment of the above factors, we recommended the individual-specific treatment; contraceptive pills, intra-uterine device, estrogen/progesterone replacement, and cyclic progesterone, in 3, 1, 4, and 1 patients, respectively. Four patients did not follow our recommendations due to poor compliance or family refusal. We recommended contraception pills for one 26-year-old woman with inhibin B and FSH levels 53 ng/ml and 6.4 IU/L; however, she refused treatment, conceived spontaneously and had an abortion. Guidelines for hormonal replacement therapy in PWS need to be tailored individually depending on physical development, hormonal profiles, bone density, and emotional and social needs of each PWS adolescent and adult. © 2013 Wiley Periodicals, Inc.

Standards and measurements for assessing bone health-workshop report co-sponsored by the International Society for Clinical Densitometry (ISCD) and the National Institute of Standards and Technology (NIST).

PubMed

Bennett, Herbert S; Dienstfrey, Andrew; Hudson, Lawrence T; Oreskovic, Tammy; Fuerst, Thomas; Shepherd, John

2006-01-01

This article reports and discusses the results of the recent ISCD-NIST Workshop on Standards and Measurements for Assessing Bone Health. The purpose of the workshop was to assess the status of efforts to standardize and compare results from dual-energy X-ray absorptiometry (DXA) scans, and then to identify and prioritize ongoing measurement and standards needs.

Effects of Curcumin on Bone Loss and Biochemical Markers of Bone Turnover in Patients with Spinal Cord Injury.

PubMed

Hatefi, Masoud; Ahmadi, Mohammad Reza Hafezi; Rahmani, Asghar; Dastjerdi, Masoud Moghadas; Asadollahi, Khairollah

2018-06-01

Osteoporosis is one of the most common problems of patients with spinal cord injuries (SCIs). The current study aimed to evaluate the antiosteoporotic effects of curcumin on densitometry parameters and biomarkers of bone turnovers among patients with SCI. The current controlled clinical trial was conducted among 100 patients with SCI referred to an outpatient clinic of rehabilitation in Ilam City, Iran, in 2013-2015. The intervention group received 110/mg/kg/day curcumin for 6 months and the control group received placebo. Bone mineral density (BMD) was measured in all patients. The level of procollagen type I N-terminal propeptide, serum carboxy-terminal telopeptide of type I collagen, osteocalcin, and bone-specific alkaline phosphates were compared before and after study. BMD indicators of lumbar, femoral neck, and total hip in the control group significantly decreased compared with the beginning of study. However, in the curcumin group, a significant increase was observed in BMD indicators of lumbar, femoral neck, and hip at the end of study compared with the beginning. There was also a significant difference between interventional and control groups for the mean BMD of femoral neck and hip at the end of study (0.718 ± 0.002 g/cm 2 vs. 0.712 ± 0.003 g/cm 2 and 0.742 ± 0.031 g/cm 2 vs. 0.692 ± 0.016 g/cm 2 , respectively). Curcumin, via modulation of densitometry indices and bone resorption markers, showed inhibitory effects on the process of osteoporosis. Treatment with curcumin was significantly associated with a decrease in the osteoporosis progression and bone turnover markers of patients with SCI after 6 months. Copyright © 2018 Elsevier Inc. All rights reserved.

Three Dimensional Cross-Sectional Properties From Bone Densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)

2001-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone in a single scan plane. Using three non-coplanar scans, we have extended the method to obtain the principal area Moments of inertia and orientations of the principal axes at each cross-section along the length of the scan. Various 5 aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of mass distribution. Factors considered included X-ray photon energy, initial scan orientation, the included angle of the 3 scans, and Imin/Imax ratios. Principal moments of inertia were accurate to within 3.1% and principal angles were within 1 deg. of the expected value for phantoms scanned with included angles of 60 deg. and 90 deg. at the higher X-ray photon energy. Low standard deviations in error also 10 indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 deg. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (Imin/Imax) values when various included angles are used make this technique viable for future in vivo studies.

Dual-energy imaging of bone marrow edema on a dedicated multi-source cone-beam CT system for the extremities

NASA Astrophysics Data System (ADS)

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-03-01

Purpose: Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods: Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results: For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion: Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities

PubMed Central

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-01-01

Purpose Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 – 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI. PMID:26045631

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities.

PubMed

Zbijewski, W; Sisniega, A; Stayman, J W; Thawait, G; Packard, N; Yorkston, J; Demehri, S; Fritz, J; Siewerdsen, J H

2015-02-21

Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

Evaluation of factors related to bone disease in Polish children and adolescents with cystic fibrosis.

PubMed

Sands, Dorota; Mielus, Monika; Umławska, Wioleta; Lipowicz, Anna; Oralewska, Beata; Walkowiak, Jarosław

2015-09-01

The aim of the study was to evaluate factors related to bone formation and resorption in Polish children and adolescents with cystic fibrosis and to examine the effect of nutritional status, biochemical parameters and clinical status on bone mineral density. The study group consisted of 100 children and adolescents with cystic fibrosis with a mean age 13.4 years old. Anthropometric measurements, included body height, body mass and body mass index (BMI); bone mineral densitometry and biochemical testing were performed. Bone mineral density was measured using a dual-energy X-ray absorption densitometer. Biochemical tests included serum calcium, phosphorus, parathyroid hormone and vitamin D concentrations, as well as 24-h urine calcium and phosphorus excretion. Pulmonary function was evaluated using FEV1%, and clinical status was estimated using the Shwachman-Kulczycki score. Standardized body height, body mass and BMI were significantly lower than in the reference population. Mean serum vitamin D concentration was decreased. Pulmonary disease was generally mild, with a mean FEV1% of 81%. Multivariate linear regression revealed that the only factors that had a significant effect on bone marrow density were BMI and FEV1%. There were no significant correlations between bone mineral density and the results of any of the biochemical tests performed. Nutritional status and bone mineral density were significantly decreased in children and adolescents with cystic fibrosis. In spite of abnormalities in biochemical testing, the factors that were found to have the strongest effect on bone mineral density were standardized BMI and clinical status. Copyright © 2015. Published by Elsevier Urban & Partner Sp. z o.o.

[Transversal study on the prevalence of Metabolic Bone Disease (MBD) and Home Parenteral Nutrition (HPN) in Spain: data from NADYA group].

PubMed

Martínez, C; Virgili, N; Cuerda, C; Chicharro, L; Gómez, P; Moreno, J M; Álvarez, J; Martí, E; Matía, P; Penacho, M A; Garde, C; De Luis, D; Gonzalo, M; Lobo, G

2010-01-01

Patients with intestinal failure who receive HPN are at high risk of developing MBD. The origin of this bone alteration is multifactorial and depends greatly on the underlying disease for which the nutritional support is required. Data on the prevalence of this disease in our environment is lacking, so NADYA-SEMPE group has sponsored this transversal study with the aim of knowing the actual MBD prevalence. Retrospective data from 51 patients from 13 hospitals were collected. The questionnaire included demographic data as well as the most clinically relevant for MBD data. Laboratory data (calciuria, PTH, 25 -OH -vitamin D) and the results from the first and last bone densitometry were also registered. Bone mineral density had only been assessed by densitometry in 21 patients at the moment HPN was started. Bone quality is already altered before HPN in a significant percentage of cases (52%). After a mean follow up of 6 years, this percentage increases up to 81%. Due to retrospective nature of the study and the low number of subjects included it has not been possible to determine the role that HPN plays in MBD etiology. Only 35% of patients have vitamin D levels above the recommended limits and the majority of them is not on specific supplementation. HPN is associated with very high risk of MBD, therefore, management protocols that can lead to early detection of the problem as well as guiding for follow up and treatment of these patients are needed.

The Influence of Reconstruction Kernel on Bone Mineral and Strength Estimates Using Quantitative Computed Tomography and Finite Element Analysis.

PubMed

Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K

2017-10-17

Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Fan-beam densitometry of the growing skeleton: are we measuring what we think we are?

PubMed

Cole, Jacqueline H; Scerpella, Tamara A; van der Meulen, Marjolein C H

2005-01-01

Magnification error in fan-beam densitometers varies with distance from the X-ray source to the bone measured and might obscure bone mineral changes in the growing skeleton. Magnification was examined by scanning aluminum rods of different shapes (square, rectangular, solid round, and hollow round) at four distances above the X-ray source in two orientations, with rods aligned parallel (SI) and perpendicular (ML) to the longitudinal axis of the scanning table. Measured area (cm(2)) decreased linearly with distance above the X-ray source for all rods in the SI orientation (p < 0.005). Measured mineral content (g) decreased linearly with distance but only for SI round rods (p < 0.0001) and for ML hollow round rods (p < 0.005). Area and mineral content decreased 1.6-1.8% per centimeter above the source for round rods. Measured mineral density (g/cm(2)) decreased linearly with distance from the source only for ML hollow round rods (p < 0.005). Variation in area, mineral content, and mineral density measurements was 6.6-6.9%, 6.9-7.5%, and 1.9-2.3%, respectively, for SI round rods. Magnification errors of this magnitude are problematic for clinical studies using fan-beam densitometry. Particularly in pediatric subjects, increases in soft tissue during normal growth could increase a bone's distance from the fan-beam source and result in apparent reductions in area and bone mineral content.

Advanced imaging of the macrostructure and microstructure of bone

NASA Technical Reports Server (NTRS)

Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.

2000-01-01

Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.

Bone mineral measurement using dual energy x ray densitometry

NASA Technical Reports Server (NTRS)

Smith, Steven W.

1989-01-01

Bone mineral measurements before and after space missions have shown that weightlessness greatly accelerates bone demineralization. Bone mineral losses as high as 1 to 3 percent per month were reported. Highly precise instrumentation is required to monitor this loss and thereby test the efficacy of treatment. During the last year, a significant improvement was made in Dual-Photon Absorptiometry by replacing the radioactive source with an x ray tube. Advantages of this system include: better precision, lower patient dose, better spacial resolution, and shorter scan times. The high precision and low radiation dose of this technique will allow detection of bone mineral changes of less than 1 percent with measurements conducted directly at the sites of interest. This will allow the required bone mineral studies to be completed in a shorter time with greater confidence.

Factors Influencing Quality of Life of Hungarian Postmenopausal Women Screened by Osteodensitometry

ERIC Educational Resources Information Center

Maroti-Nagy, Agnes; Paulik, Edit

2011-01-01

The aim of our study was to evaluate factors influencing health related quality of life in Hungarian postmenopausal women who underwent osteodensitometry. A questionnaire-based cross-sectional study was carried out; 359 women aged over 40 years were involved, attending the outpatient Bone Densitometry Centre of Szeged. Two kinds of tools were…

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Bisphosphonate Treatment for Children With Disabling Conditions

PubMed Central

Boyce, Alison M.; Tosi, Laura L.; Paul, Scott M.

2014-01-01

Fractures are a frequent source of morbidity in children with disabling conditions. The assessment of bone density in this population is challenging, because densitometry is influenced by dynamic forces affecting the growing skeleton and may be further confounded by positioning difficulties and surgical hardware. First-line treatment for pediatric osteoporosis involves conservative measures, including optimizing the management of underlying conditions, maintaining appropriate calcium and vitamin D intake, encouraging weight-bearing physical activity, and monitoring measurements of bone mineral density. Bisphosphonates are a class of medications that increase bone mineral density by inhibiting bone resorption. Although bisphosphonates are commonly prescribed for treatment of adult osteoporosis, their use in pediatric patients is controversial because of the lack of long-term safety and efficacy data. PMID:24368091

Quality initiatives: improving patient flow for a bone densitometry practice: results from a Mayo Clinic radiology quality initiative.

PubMed

Aakre, Kenneth T; Valley, Timothy B; O'Connor, Michael K

2010-03-01

Lean Six Sigma process improvement methodologies have been used in manufacturing for some time. However, Lean Six Sigma process improvement methodologies also are applicable to radiology as a way to identify opportunities for improvement in patient care delivery settings. A multidisciplinary team of physicians and staff conducted a 100-day quality improvement project with the guidance of a quality advisor. By using the framework of DMAIC (define, measure, analyze, improve, and control), time studies were performed for all aspects of patient and technologist involvement. From these studies, value stream maps for the current state and for the future were developed, and tests of change were implemented. Comprehensive value stream maps showed that before implementation of process changes, an average time of 20.95 minutes was required for completion of a bone densitometry study. Two process changes (ie, tests of change) were undertaken. First, the location for completion of a patient assessment form was moved from inside the imaging room to the waiting area, enabling patients to complete the form while waiting for the technologist. Second, the patient was instructed to sit in a waiting area immediately outside the imaging rooms, rather than in the main reception area, which is far removed from the imaging area. Realignment of these process steps, with reduced technologist travel distances, resulted in a 3-minute average decrease in the patient cycle time. This represented a 15% reduction in the initial patient cycle time with no change in staff or costs. Radiology process improvement projects can yield positive results despite small incremental changes.

Joint Official Positions of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®). Executive Summary of the 2010 Position Development Conference on Interpretation and use of FRAX® in clinical practice.

PubMed

Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René

2011-01-01

The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors affecting bone mineral density in postmenopausal women.

PubMed

Heidari, Behzad; Hosseini, Reza; Javadian, Yahya; Bijani, Ali; Sateri, Mohammad Hassan; Nouroddini, Haj Ghorban

2015-01-01

This study aimed to determine the relationship between bone mineral density (BMD) and demographic, biochemical, and clinical features according to BMD measurement sites. The results indicated that BMD correlates negatively with menopause duration, parity, and history of fractures but positively correlates with obesity, physical activity, education, and serum ferritin. Osteoporosis (OP) is an important cause of morbidity and mortality in the elderly people. The impacts of various factors on bone mineral density (BMD) differ across diverse population. We hypothesized that the influences of factors which affect BMD vary according to BMD measurement sites. The aim of this study was to determine the relationship between BMD in the femoral neck (FN) and lumbar spine (LS) with some common clinical, demographic, and biochemical parameters in postmenopausal women. In this cross-sectional case-control study, all postmenopausal women of the Amirkola Health and Ageing Project (AHAP) who performed bone densitometry were included. BMD at FN and LS was measured by DXA method. Data regarding clinical, demographic, and biochemical characteristics were provided. OP was diagnosed by the International Society for Clinical Densitometry criteria. Pearson correlation and multivariate regression analyses with simultaneous adjustment were performed to determine relationship. Five hundred thirty-seven women with mean age of 67.9 ± 6.7 years and mean menopause duration (MD) of 15.8 ± 5.1 years were studied. MD correlated negatively with FN-BMD and LS-BMD g/cm(2) (r = -0.405, p = 0.001 and r = -0.217, p = 0.001). Body mass index (BMI) correlated positively with FN and LS-BMD g/cm(2) (r = 0.397, p = 0.001 and r = 0.311, p = 0.001). The association of MD with risk of FN-OP was stronger than LS-OP. Obesity and metabolic syndrome (MS) and higher serum ferritin reduced the risk of OP at both LS and FN similarly, whereas the impacts of parity, prior fracture, high level of education, and physical activity were significantly different across BMD measurement sites. The results of this study indicated a significant association between OP and MD, obesity, parity, MS, history of fracture, serum ferritin, level of education, and physical activity. However, the direction and the strength of association varied across BMD measurement sites.

Recommendations for the clinical evaluation of agents for treatment of osteoporosis: consensus of an expert panel representing the American Society for Bone and Mineral Research (ASBMR), the International Society for Clinical Densitometry (ISCD), and the National Osteoporosis Foundation (NOF).

PubMed

Silverman, Stuart L; Cummings, Steven R; Watts, Nelson B

2008-01-01

A panel of experts representing ASBMR, NOF, and ISCD reviewed evidence and reached consensus that regulatory approval of treatments for osteoporosis should be based on trials with fracture endpoints, lasting 18-24 mo, and extending treatment to 5 yr; other indications could be approved based on BMD and turnover markers. In response to an FDA request for clinical trial guidance in osteoporosis, an expert panel was convened with representatives from the American Society of Bone and Mineral Research, the International Society of Clinical Densitometry, and the National Osteoporosis Foundation. The panel used a validated evidence-based expert panel process (the Rand Appropriateness Method) to address issues of trial duration, trial design, use of intermediate endpoints as outcomes, and use of placebo-controlled trials in high-risk patients. The panel concluded that placebo-controlled trials with fracture endpoints are appropriate and, with informed consent, are ethical for registration of new compounds. Trials may be 18-24 mo in duration for efficacy, assuming longer duration to 5 yr for safety and demonstration of sustained fracture reduction. Once fracture efficacy has been established for a particular agent, intermediate endpoints (e.g., BMD and bone turnover markers) may be used as outcomes for new indications other than corticosteroid-induced osteoporosis.

Cross-sectional structural parameters from densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.

2002-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone from a single X-ray projection across the bone width. Using three unique projections, we have extended the method to obtain the principal area moments of inertia and orientations of the principal axes at each scan cross-section along the length of the scan. Various aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of cross-sectional properties. Factors considered included X-ray photon energy, initial scan orientation, the angle spanned by the three scans (included angle), and I(min)/I(max) ratios. Principal moments of inertia were accurate to within +/-3.1% and principal angles were within +/-1 degrees of the expected value for phantoms scanned with included angles of 60 degrees and 90 degrees at the higher X-ray photon energy (140 kVp). Low standard deviations in the error (0.68-1.84%) also indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 degrees. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (I(min)/I(max)) values when various included angles are used make this technique viable for future in vivo studies.

Bone's mechanostat: a 2003 update.

PubMed

Frost, Harold M

2003-12-01

The still-evolving mechanostat hypothesis for bones inserts tissue-level realities into the former knowledge gap between bone's organ-level and cell-level realities. It concerns load-bearing bones in postnatal free-living bony vertebrates, physiologic bone loading, and how bones adapt their strength to the mechanical loads on them. Voluntary mechanical usage determines most of the postnatal strength of healthy bones in ways that minimize nontraumatic fractures and create a bone-strength safety factor. The mechanostat hypothesis predicts 32 things that occur, including the gross anatomical bone abnormalities in osteogenesis imperfecta; it distinguishes postnatal situations from baseline conditions at birth; it distinguishes bones that carry typical voluntary loads from bones that have other chief functions; and it distinguishes traumatic from nontraumatic fractures. It provides functional definitions of mechanical bone competence, bone quality, osteopenias, and osteoporoses. It includes permissive hormonal and other effects on bones, a marrow mediator mechanism, some limitations of clinical densitometry, a cause of bone "mass" plateaus during treatment, an "adaptational lag" in some children, and some vibration effects on bones. The mechanostat hypothesis may have analogs in nonosseous skeletal organs as well. Copyright 2003 Wiley-Liss, Inc.

Osteoporosis screening is unjustifiably low in older African-American women.

PubMed Central

Wilkins, Consuelo H.; Goldfeder, Jason S.

2004-01-01

BACKGROUND: More than one million Americans suffer osteoporotic fractures yearly, resulting in a marked increase in morbidity and mortality. Despite a decrease in bone mineral density with increasing age in all ethnic groups and both genders, preventative and therapeutics efforts in osteoporosis have been focused on caucasian and Asian women. This study assesses the osteoporosis screening practices and the frequency of low bone density in a primarily African-American population of older women. METHODS: Medical records of 252 women at risk for osteoporosis were reviewed for the diagnosis of osteoporosis, prior osteoporosis screening, prior breast cancer screening, and the use of calcium, vitamin D or estrogen. Subsequently, 128 women were assessed for risk factors for osteoporosis, and their bone mineral density was measured using a peripheral bone densitometer. RESULTS: Osteoporosis screening had been performed in 11.5% of the subjects. Of the women evaluated by peripheral bone densitometry, 44.5% of all women, 40.4% of African-American women, and 53.3% of caucasian women had abnormally low bone density measurements. The frequency of abnormal bone density increased with both increasing age and decreasing body mass index. CONCLUSIONS: Although few women in this population were previously screened for osteoporosis, low bone density occurred in African-American women at substantial rates. Increasing age and low body mass are important risk factors for low bone density in African-American women. Ethnicity should not be used as an exclusion criterion for screening for osteoporosis. PMID:15101666

Reconstruction of Canine Mandibular Bone Defects Using a Bone Transport Reconstruction Plate

PubMed Central

Elsalanty, Mohammed E.; Zakhary, Ibrahim; Akeel, Sara; Benson, Byron; Mulone, Timothy; Triplett, Gilbert R.; Opperman, Lynne A.

2010-01-01

Objectives Reconstruction of mandibular segmental bone defects is a challenging task. This study tests a new device used for reconstructing mandibular defects based on the principle of bone transport distraction osteogenesis. Methods Thirteen beagle dogs were divided into control and experimental groups. In all animals, a 3 cm defect was created on one side of the mandible. In eight control animals, the defect was stabilized with a reconstruction plate without further reconstruction and the animals were sacrificed two to three months after surgery. The remaining five animals were reconstructed with a bone transport reconstruction plate (BTRP), comprising a reconstruction plate with attached intraoral transport unit, and were sacrificed after one month of consolidation. Results Clinical evaluation, cone-beam CT densitometry, three-dimensional histomorphometry, and docking site histology revealed significant new bone formation within the defect in the distracted group. Conclusion The physical dimensions and architectural parameters of the new bone were comparable to the contralateral normal bone. Bone union at the docking site remains a problem. PMID:19770704

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment.

PubMed

Stagi, Stefano; Cavalli, Loredana; Seminara, Salvatore; de Martino, Maurizio; Brandi, Maria Luisa

2014-06-07

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed.

Ethnic Differences in Bone Health

PubMed Central

Zengin, Ayse; Prentice, Ann; Ward, Kate Anna

2015-01-01

There are differences in bone health between ethnic groups in both men and in women. Variations in body size and composition are likely to contribute to reported differences. Most studies report ethnic differences in areal bone mineral density (aBMD), which do not consistently parallel ethnic patterns in fracture rates. This suggests that other parameters beside aBMD should be considered when determining fracture risk between and within populations, including other aspects of bone strength: bone structure and microarchitecture, as well as muscle strength (mass, force generation, anatomy) and fat mass. We review what is known about differences in bone-densitometry-derived outcomes between ethnic groups and the extent to which they account for the differences in fracture risk. Studies are included that were published primarily between 1994 and 2014. A “one size fits all approach” should definitely not be used to understand better ethnic differences in fracture risk. PMID:25852642

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment

PubMed Central

2014-01-01

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed. PMID:24906390

Current methods and advances in bone densitometry

NASA Technical Reports Server (NTRS)

Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.

1995-01-01

Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.

[Epidemiologic variables in postmenopausal women].

PubMed

Murillo-Uribe, A; Carranza-Lira, S; Martínez-Trejo, N A; Santos González, J E

1999-10-01

The objective was to know the characteristics of presentation, its clinical aspects and the modification in the diagnostic tools in a selected population of Mexican women with spontaneous menopause. The age at menarche, age at menopause, marital status, age at marriage, number of pregnancies and occupation of 1,099 women with spontaneous menopause were studied. In 619 women which were not receiving nor had received hormone replacement therapy the clinical, laboratory such as glucose, lipids, hormones, bone remodeling biochemistry; and X ray studies such as densitometry and mammography were analyzed. The age average of menarche presentation was at 13 years, and that of spontaneous menopause at 48.1 years 78% were married, with an age at marriage of 23 years, 66% had home duties. The screening tests showed that 30% of patients required cardiovascular evaluation, 40% showed alterations on lipids levels and at least 40% had some alteration on bone remodeling biochemistry or in densitometry. The mammography was normal in 81%. This study showed that most of the data in these group of women were similar to those of other populations, and many of them need intensive surveillance and adequate therapeutic prescriptions to diminish risk factors.

FRAX(®) Bone Mineral Density Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A

2011-01-01

FRAX(®) is a fracture risk assessment algorithm developed by the World Health Organization in cooperation with other medical organizations and societies. Using easily available clinical information and femoral neck bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA), when available, FRAX(®) is used to predict the 10-year probability of hip fracture and major osteoporotic fracture. These values may be included in country specific guidelines to aid clinicians in determining when fracture risk is sufficiently high that the patient is likely to benefit from pharmacological therapy to reduce that risk. Since the introduction of FRAX(®) into clinical practice, many practical clinical questions have arisen regarding its use. To address such questions, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundations (IOF) assigned task forces to review the best available medical evidence and make recommendations for optimal use of FRAX(®) in clinical practice. Questions were identified and divided into three general categories. A task force was assigned to investigating the medical evidence in each category and developing clinically useful recommendations. The BMD Task Force addressed issues that included the potential use of skeletal sites other than the femoral neck, the use of technologies other than DXA, and the deletion or addition of clinical data for FRAX(®) input. The evidence and recommendations were presented to a panel of experts at the ISCD-IOF FRAX(®) Position Development Conference, resulting in the development of ISCD-IOF Official Positions addressing FRAX(®)-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Marrow Fat Quality Differences by Sex in Healthy Adults.

PubMed

Maciel, Jamilly G; de Araújo, Iana M; Carvalho, Adriana L; Simão, Marcelo N; Bastos, Clara M; Troncon, Luiz E A; Salmon, Carlos E G; de Paula, Francisco J A; Nogueira-Barbosa, Marcello H

Several studies have demonstrated the relationship between bone marrow adiposity (BMAT) and bone mass. 1 H magnetic resonance spectroscopy is a noninvasive technique able to assess both BMAT quantity and quality. The aim of our study was to perform quantitative and qualitative analyses of BMAT and to investigate its association with bone mineral density (BMD) in healthy nonobese volunteers. Fifty-one healthy volunteers, 21 men and 30 women, underwent 1.5 T 1 H magnetic resonance spectroscopy of the lumbar spine. BMD was determined by dual-energy X-ray absorptiometry of the lumbar spine. Correlation analysis was performed to evaluate association among lipids fractions, BMD, and age. The female and male volunteers had similar body mass index and BMD (p > 0.05). Our data demonstrated an inverse correlation of BMD and BMAT with age, with a stronger correlation of saturated lipids (r = 0.701; p < 0.0001) compared with unsaturated lipids (UL) (r = 0.278; p = 0.004). Importantly, female subjects had the highest amount of UL (confidence interval: 0.685%-1.722%; p < 0.001). Our study reports that men and women with similar BMD and body mass index have striking differences in bone marrow lipids composition, namely women have higher UL than men. In addition, we believe that our study brings new insights to the complex network involving BMAT and other factors that influence bone integrity. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Clinical Implications of Hip Flexion in the Measurement of Spinal Bone Mineral Density.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Kato, Hiroyuki

2016-01-01

The aim of this study was to investigate if differences in leg positioning affect spinal bone mineral density (BMD) measurements and the detection of low bone mass. Subjects included 1039 Japanese patients, 878 women and 161 men (mean ages: 67 and 71 years, respectively). Spinal BMD (L1-4) was measured using dual-energy X-ray absorptiometry (DXA) with patients lying in 2 different positions: (1) supine on the scanning table with hips flexed and knees flexed over a 90° support pad (the standard position) and (2) simply supine (the supine position). Predictive indices were calculated for spinal DXA acquired with patients in the supine position. A BMD T-score of -2.5 or lower was set as the threshold for low bone mass. For the standard and the supine positions during scanning in women, BMDs were 0.911 and 0.915 g/cm(2), respectively; in men, they were 1.117  and 1.124 g/cm(2), respectively. The estimated systematic bias in BMD between the positions was 0.42% (95% confidence interval: 0.24, 0.59; p = 0.009). Random errors in the densitometry measurements for the standard and supine positions were 0.66% and 0.84%, respectively. There was no significant difference between the errors (p= 0.164). The likelihood ratios of a positive and negative test for the detection of low bone mass following supine DXA were 121.0 and 0.066, respectively, compared with results acquired using the standard position. In conclusion, DXA measurements acquired with patients in the supine position slightly overestimated BMD vs the standard position. However, the clinical equivalency between the positioning methods for DXA is preserved to the extent that low bone mass can be reliably detected in the supine position. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Review of comparative studies between bone densitometry and quantitative ultrasound of the calcaneus in osteoporosis.

PubMed

Flöter, Michelle; Bittar, Cíntia Kelly; Zabeu, José Luis; Carneiro, Ana Carolina

2011-01-01

To assess the utility of quantitative ultrasound (QUS) of the calcaneus for diagnosing osteoporosis compared to the gold standard, bone densitometry using dual-emission X-ray absorptiometry (DXA), according to published reports. In this systematic review, the Medline/PUBMED, Medline Ovid and Journals@Ovid, and Wilson General Sciences Full Text database were used. The search strategy involved use of the following MeSH descriptors: [osteoporosis AND (densitometry OR ultrasonography)], and 39 articles published between 2001 and April 2010 were assessed. However, only six articles met the inclusion criteria: sensitivity and specificity of QUS, sample (women or men with no treatment or other disease likely to change bone mass index), devices used, comparative T-score between QUS of the calcaneus and DXA. The GE-Lunar Achilles and Hologic Sahara devices were used in most of the tests reported and were effective. All studies assessed compared QUS of the calcaneus to DXA of the lumbar spine or femoral neck, as the gold standard. QUS sensitivity ranged from 79% to 93% and specificity ranged from 28% to 90% when at the lower threshold. It is a controversial parameter, because the gold-standard threshold (T-score < -2.5, DXA) could not be used for QUS without errors in osteoporosis diagnosis. All studies had a threshold determined by the authors’ criteria, with a variability of -1.7 (pDXA T--score) and -2.4 for QUS, leading to the same prevalence of osteoporosis, and a T-score of < -3.65 for QUS was equivalent to a T-score < -2.5 for DXA. Based on the analysis of seven studies, we conclude that QUS of the calcaneus still cannot be used to confirm diagnosis of osteoporosis by comparing the results to those of patients who had already received such a diagnosis based on DXA. However, further research should be conducted in this area, because it is possible to improve the number diagnoses by varying the cutoff T-score. Furthermore, using QUS of the calcaneus was a helpful tool for assessing pathological fractures, whether or not they were associated with osteoporosis.

The anabolic effects of vitamin D-binding protein-macrophage activating factor (DBP-MAF) and a novel small peptide on bone.

PubMed

Schneider, Gary B; Grecco, Kristina J; Safadi, Fayez F; Popoff, Steven N

2003-01-01

Vitamin D-binding protein-macrophage activating factor (DBP-MAF) has previously been shown to stimulate bone resorption and correct the skeletal defects associated with osteopetrosis in two nonallelic mutations in rats. This same protein and a small fragment of the protein have now been shown to demonstrate an anabolic effect on the skeleton of both newborn and young adult, intact rats. The novel peptide fragment was synthetically produced based on the human amino acid sequence at the site of glycosylation in the third domain of the native protein (DBP). The peptide tested is 14 amino acids in length and demonstrates no homologies other than to that region of DBP. Newborn rats were injected i.p. with saline, peptide (0.4 ng/g body wt.) or DBP-MAF (2 ng/g body wt.) every other day from birth to 14 days of age. On day 16 the rats were euthanized and the long bones collected for bone densitometry by pQCT. After 2 weeks of treatment with either the whole protein (DBP-MAF) or the small peptide, bone density was significantly increased in the treated animals compared to the saline controls. Young adult female rats (180 grams) were given s.c. injections of saline or peptide (0.4 ng/g body wt. or 5 ng/g body wt.) every other day for 2 weeks; 2 days after the final injections, the rats were euthanized and the femurs and tibias collected for bone densitometry. Both doses of the peptide resulted in significant increases in bone density as determined by pQCT. Young adult rats were injected locally with a single dose of the peptide (1 microg) or saline into the marrow cavity of the distal femur. One week after the single injection, the bones were collected for radiographic and histological evaluation. The saline controls showed no evidence of new bone formation, whereas the peptide-treated animals demonstrated osteoinduction in the marrow cavity and osteogenesis of surrounding cortical and metaphyseal bone. These data suggest that DBP-MAF and the synthetic peptide represent therapeutic opportunities for the treatment of a number of bone diseases and skeletal disorders. Systemic administration could be used to treat osteoporosis and a number of other osteopenias, and local administration could be effective in fractures, bony defect repairs, spinal surgery, and joint replacement.

Osteoporosis Care in the United States After Declines in Reimbursements for DXA

PubMed Central

Hayes, Burton L.; Curtis, Jeffrey R.; Laster, Andrew; Saag, Kenneth; Tanner, S. Bobo; Liu, Caiqin; Womack, Catherine; Johnson, Karen C.; Khaliq, Fazila; Carbone, Laura D.

2015-01-01

In January 2007, in the United States (US), Medicare initiated a series of cuts to reimbursement for dual-energy X-ray absorptiometry (DXA) services performed in the nonfacility setting that by January 2010 reduced payments for these services by more than 60% compared with 2006 levels. The objectives of this study were to determine if a temporal association exists between Medicare Physician Fee Schedule changes in office-based DXA reimbursement and attendance at educational conferences for osteoporosis, physicians’ perceptions of changes in their medical practices, or national trends in retail prescription medications for osteoporosis in those aged 65 and older. Compared with the 2 yr before the decline in Medicare reimbursement for DXA (2005–2006), attendance at educational meetings for osteoporosis in the US declined in the 2 yr after these cuts (2007–2008) by 6%; declines in attendance were only present in meetings selective for bone densitometry. Survey participants reported changes in DXA services with approximately one-third indicating that they had either decreased the number of DXAs they performed or declined service contracts or hardware/software updates compared with 2005–2006. The number of retail prescriptions for Food and Drug Administratione–approved osteoporosis drugs (excluding estrogen compounds and raloxifene) in the age 65 and older population increased by 5.5% in the time period 2007–2008 compared with 2005–2006. However, in the last year of the study (2008), total retail prescriptions for these drugs experienced for the first time over the interval of the study, a decline (1.4%) compared with the previous year. This occurred despite a 2.6% increase in the US population age 65 and older. In conclusion, there were temporal associations noted between Medicare cuts in DXA payments in attendance at educational conferences for bone densitometry, self-report of office-based provision of DXA services in the US, and retail prescriptions for osteoporosis therapies. PMID:21029972

[Hearing and balance in metabolic bone diseases].

PubMed

Zatoński, Tomasz; Temporale, Hanna; Krecicki, Tomasz

2012-03-01

There are reports that hearing loss is one of the clinical manifestations of metabolic bone diseases. Demineralization can lead to a reduction in ossicular mass. Paget's disease can reveal loss of mineral density of the cochlear bone. Ear bone remodeling in osteoporosis is similar to the changes in otosclerosis. Moreover, osteoporosis, osteogenesis imperfecta and otosclerosis have a similar genetic mechanism. According to some researchers osteopenia and osteoporosis may well be associated with idiopathic benign positional vertigo (BPV). Dysfunction of the organ of hearing and balance in patients with renal insufficiency may be due to disturbances in calcium phosphate balance and renal osteodystrophy in the course of the disease. Proving the presence of hearing loss in patients with metabolic bone diseases may lead to determining the new indications for bone densitometry in some patients with hearing impairment. Furthermore, audiological examination in patients with osteoporosis may be important because of the impact of hearing loss on prognosis for patients with metabolic bone diseases.

Official Positions for FRAX® clinical regarding falls and frailty: can falls and frailty be used in FRAX®? From Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T

2011-01-01

Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Growth, body composition, and bone density following pediatric liver transplantation.

PubMed

Sheikh, Amin; Cundy, Tim; Evans, Helen Maria

2018-04-24

Patients transplanted for cholestatic liver disease are often significantly fat-soluble vitamin deficient and malnourished pretransplant, with significant corticosteroid exposure post-transplant, with increasing evidence of obesity and metabolic syndrome post-LT. Our study aimed to assess growth, body composition, and BMD in patients post-pediatric LT. Body composition and bone densitometry scans were performed on 21 patients. Pre- and post-transplant anthropometric data were analyzed. Bone health was assessed using serum ALP, calcium, phosphate, and procollagen-1-N-peptide levels. Median ages at transplant and at this assessment were 2.7 and 10.6 years, respectively. Physiological markers of bone health, median z-scores for total body, and lumbar spine aBMD were normal. Bone area was normal for height and BMAD at L3 was normal for age, indicating, respectively, normal cortical and trabecular bone accrual. Median z-scores for weight, height, and BMI were 0.6, -0.9, 1.8 and 0.6, 0.1, 0.8 pre- and post-transplant, respectively. Total body fat percentages measured on 21 body composition scans revealed 2 underweight, 7 normal, 6 overweight, and 6 obese. Bone mass is preserved following pediatric LT with good catch-up height. About 52% of patients were either overweight/obese post-transplant, potentially placing them at an increased risk of metabolic syndrome and its sequelae in later life. BMI alone is a poor indicator of nutritional status post-transplant. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Doping dose of salbutamol and exercise training: impact on the skeleton of ovariectomized rats.

PubMed

Bonnet, N; Laroche, N; Beaupied, H; Vico, L; Dolleans, E; Benhamou, C L; Courteix, D

2007-08-01

Previous studies in healthy rats have demonstrated a deleterious bone impact of beta-agonist treatment. The purpose of this study was to examine the trabecular and cortical effects of beta(2)-agonists at doping dose on treadmill exercising rats with estrogen deficiency. Adult female rats were ovariectomized (OVX; n = 44) or sham operated (n = 12). Then, OVX rats received a subcutaneous injection of salbutamol (SAB) or vehicle with (EXE) or without treadmill exercise for 10 wk. Bone mineral density (BMD) was analyzed by densitometry. Microcomputed tomography and histomorphometric analysis were performed to study trabecular bone structure and bone cell activities. After 10 wk, SAB rats presented a much more marked decrease of BMD and trabecular parameters. Exercise did not change the high level of bone resorption in OVX EXE SAB compared with OVX SAB group (both on COOH-terminal collagen cross-links and osteoclast number). These results confirm the deleterious effect of beta(2)-agonists on bone quantity (femoral BMD gain: OVX EXE, +6.8%, vs. OVX EXE SAB, -1.8%; P < 0.01) and quality (-8.0% of femoral trabecular thickness in OVX EXE SAB vs. OVX EXE), indicating that SAB suppresses the effect of EXE in OVX rats. Furthermore, we notice that the slight beneficial effect of exercise was mainly localized in the tibia. These findings indicate the presence of a bone alteration threshold below which there is no more alteration in structural bone quantity and quality. The negative effects of SAB on bone observed in this study in trained rats may indicate potential complications in doping female athletes with exercise-induced amenorrhea.

A high-fat diet can affect bone healing in growing rats.

PubMed

Yamanaka, Jéssica Suzuki; Yanagihara, Gabriela Rezende; Carlos, Bruna Leonel; Ramos, Júnia; Brancaleon, Brígida Batista; Macedo, Ana Paula; Issa, João Paulo Mardegan; Shimano, Antônio Carlos

2018-05-01

A high-fat diet (HFD) can have a negative effect on bone quality in young and old people. Although bone healing in children is normally efficient, there is no evidence that children who have a diet rich in fat have compromised bone fracture regeneration compared with children with recommended dietary fat levels. The purpose of the present study was to evaluate the effects of an HFD on bone healing in growing female rats. Twenty-six postweaning female Wistar rats were divided into two groups (13 animals per group): a standard diet (SD) group and an HFD (with 60% of energy from fat) group. The rats received the assigned diets for 5 weeks, and in the third week they were submitted to an osteotomy procedure of the left tibia. Body mass and feed intake were recorded during the experiment. One day before euthanasia, an insulin tolerance test was performed. After euthanasia, the tibiae were removed and analyzed by densitometry, mechanical testing, histomorphometry, stereology and immunohistochemistry. An HFD caused an adaptive response to maintain energetic balance by decreasing feed intake and causing insulin insensitivity. There was no change in bone mineral density, collagen amount and immunostaining for bone formation, but maximal load and stiffness were decreased in the HFD group. In addition, bone volume had a tendency to be higher in the SD group than in the HFD group. Compared with rats receiving an SD, growing rats receiving an HFD for 5 weeks had similar bone mineral density but altered mechanical properties at the osteotomy defect site.

Trace metal analysis by laser ablation-inductively coupled plasmamass spectrometry and x-ray K-edge densitometry of forensic samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonna Elizabeth

This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less

An update on childhood bone health: mineral accrual, assessment and treatment.

PubMed

Sopher, Aviva B; Fennoy, Ilene; Oberfield, Sharon E

2015-02-01

To update the reader's knowledge about the factors that influence bone mineral accrual and to review the advances in the assessment of bone health and treatment of bone disorders. Maternal vitamin D status influences neonatal calcium levels, bone mineral density (BMD) and bone size. In turn, BMD z-score tends to track in childhood. These factors highlight the importance of bone health as early as fetal life. Dual-energy x-ray absorptiometry is the mainstay of clinical bone health assessment in this population because of the availability of appropriate reference data. Recently, more information has become available about the assessment and treatment of bone disease in chronically ill pediatric patients. Bone health must become a health focus starting prenatally in order to maximize peak bone mass and to prevent osteoporosis-related bone disease in adulthood. Vitamin D, calcium and weight-bearing activity are the factors of key importance throughout childhood in achieving optimal bone health as BMD z-score tracks through childhood and into adulthood. Recent updates of the International Society for Clinical Densitometry focus on the appropriate use of dual-energy x-ray absorptiometry in children of all ages, including children with chronic disease, and on the treatment of pediatric bone disease.

The QUALYOR (QUalité Osseuse LYon Orléans) study: a new cohort for non invasive evaluation of bone quality in postmenopausal osteoporosis. Rationale and study design.

PubMed

Chapurlat, Roland; Pialat, Jean-Baptiste; Merle, Blandine; Confavreux, Elisabeth; Duvert, Florence; Fontanges, Elisabeth; Khacef, Farida; Peres, Sylvie Loiseau; Schott, Anne-Marie; Lespessailles, Eric

2017-12-27

The diagnostic performance of densitometry is inadequate. New techniques of non-invasive evaluation of bone quality may improve fracture risk prediction. Testing the value of these techniques is the goal of the QUALYOR cohort. The bone mineral density (BMD) of postmenopausal women who sustain osteoporotic fracture is generally above the World Health Organization definition for osteoporosis. Therefore, new approaches to improve the detection of women at high risk for fracture are warranted. We have designed and recruited a new cohort to assess the predictive value of several techniques to assess bone quality, including high-resolution peripheral quantitative computerized tomography (HRpQCT), hip QCT, calcaneus texture analysis, and biochemical markers. We have enrolled 1575 postmenopausal women, aged at least 50, with an areal BMD femoral neck or lumbar spine T-score between - 1.0 and - 3.0. Clinical risk factors for fracture have been collected along with serum and blood samples. We describe the design of the QUALYOR study. Among these 1575 women, 80% were aged at least 60. The mean femoral neck T-score was - 1.6 and the mean lumbar spine T-score was -1.2. This cohort is currently being followed up. QUALYOR will provide important information on the relationship between bone quality variables and fracture risk in women with moderately decreased BMD.

DXA in the assessment of subchondral bone mineral density in knee osteoarthritis--A semi-standardized protocol after systematic review.

PubMed

Sepriano, Alexandre; Roman-Blas, Jorge A; Little, Robert D; Pimentel-Santos, Fernando; Arribas, Jose María; Largo, Raquel; Branco, Jaime C; Herrero-Beaumont, Gabriel

2015-12-01

Subchondral bone mineral density (sBMD) contributes to the initiation and progression of knee osteoarthritis (OA). Reliable methods to assess sBMD status may predict the response of specific OA phenotypes to targeted therapies. While dual-energy X-ray absorptiometry (DXA) of the knee can determine sBMD, no consensus exists regarding its methodology. Construct a semi-standardized protocol for knee DXA to measure sBMD in patients with OA of the knee by evaluating the varying methodologies present in existing literature. We performed a systematic review of original papers published in PubMed and Web of Science from their inception to July 2014 using the following search terms: subchondral bone, osteoarthritis, and bone mineral density. DXA of the knee can be performed with similar reproducibility values to those proposed by the International Society for Clinical Densitometry for the hip and spine. We identified acquisition view, hip rotation, knee positioning and stabilization, ROI location and definition, and the type of analysis software as important sources of variation. A proposed knee DXA protocol was constructed taking into consideration the results of the review. DXA of the knee can be reliably performed in patients with knee OA. Nevertheless, we found substantial methodological variation across previous studies. Methodological standardization may provide a foundation from which to establish DXA of the knee as a valid tool for identification of SB changes and as an outcome measure in clinical trials of disease modifying osteoarthritic drugs. Copyright © 2015 Elsevier Inc. All rights reserved.

The peripheral quantitative computed tomographic and densitometric analysis of skeletal tissue in male Wistar rats after chromium sulfate treatment.

PubMed

Bieńko, Marek; Radzki, Radosław Piotr; Wolski, Dariusz

2017-09-21

This study evaluates the effects of three different doses of chromium sulphate on bone density and the tomographic parameters of skeletal tissue of rats. The experiment was performed on 40 male Wistar rats which received, by gavage, during 90 days, a chromium sulphate in either a daily dose of 400, 600 or 800 µg/kg BW. At the end of experiment, the rats were scanned using the densitometry method (DXA) to determine the bone mineral density, bone mineral content of total skeleton and vertebral column (L2-L4) and parameters of body composition (Lean Mass and Fat Mass). The isolated femora were scanned using peripheral a quantitative computed tomography method (pQCT) for a separate analysis of the trabecular and cortical bone tissue. The ultimate strength, work to ultimate and the Young modulus of femora was also investigated by the three-point bending test. The negative impact of chromium was observed in relation to bone tissue. All doses significantly decreased total skeleton density and mineral content, and also had impact upon the isolated femora and vertebral column. Trabecular volumetric bone mineral density and trabecular bone mineral content measured by pQCT in distal femur metaphysis were significantly lower in the experimental groups than in the control. Higher doses of chromium also significantly decreased values of ultimate strength and Young modulus in the investigated femora. The results of the experiment demonstrate that chromium sulphate is dose dependent, and exerts a disadvantageous effect on the skeleton, as it decreases bone density and resistance.

CONSENSUS STATEMENT BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY ON THE QUALITY OF DXA SCANS AND REPORTS.

PubMed

Licata, Angelo A; Binkley, Neil; Petak, Steven M; Camacho, Pauline M

2018-02-01

High-quality dual-energy X-ray absorptiometry (DXA) scans are necessary for accurate diagnosis of osteoporosis and monitoring of therapy; however, DXA scan reports may contain errors that cause confusion about diagnosis and treatment. This American Association of Clinical Endocrinologists/American College of Endocrinology consensus statement was generated to draw attention to many common technical problems affecting DXA report conclusions and provide guidance on how to address them to ensure that patients receive appropriate osteoporosis care. The DXA Writing Committee developed a consensus based on discussion and evaluation of available literature related to osteoporosis and osteodensitometry. Technical errors may include errors in scan acquisition and/or analysis, leading to incorrect diagnosis and reporting of change over time. Although the International Society for Clinical Densitometry advocates training for technologists and medical interpreters to help eliminate these problems, many lack skill in this technology. Suspicion that reports are wrong arises when clinical history is not compatible with scan interpretation (e.g., dramatic increase/decrease in a short period of time; declines in previously stable bone density after years of treatment), when different scanners are used, or when inconsistent anatomic sites are used for monitoring the response to therapy. Understanding the concept of least significant change will minimize erroneous conclusions about changes in bone density. Clinicians must develop the skills to differentiate technical problems, which confound reports, from real biological changes. We recommend that clinicians review actual scan images and data, instead of relying solely on the impression of the report, to pinpoint errors and accurately interpret DXA scan images. AACE = American Association of Clinical Endocrinologists; BMC = bone mineral content; BMD = bone mineral density; DXA = dual-energy X-ray absorptiometry; ISCD = International Society for Clinical Densitometry; LSC = least significant change; TBS = trabecular bone score; WHO = World Health Organization.

Official Positions for FRAX® clinical regarding biochemical markers from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

McCloskey, Eugene V; Vasikaran, Samuel; Cooper, Cyrus

2011-01-01

The best indirect evidence that increased bone turnover contributes to fracture risk is the fact that most of the proven therapies for osteoporosis are inhibitors of bone turnover. The evidence base that we can use biochemical markers of bone turnover in the assessment of fracture risk is somewhat less convincing. This relates to natural variability in the markers, problems with the assays, disparity in the statistical analyses of relevant studies and the independence of their contribution to fracture risk. More research is clearly required to address these deficiencies before biochemical markers might contribute a useful independent risk factor for inclusion in FRAX(®). Copyright © 2011. Published by Elsevier Inc.

Biochemical markers in the assessment of bone disease

NASA Technical Reports Server (NTRS)

Bikle, D. D.

1997-01-01

As the mean age of our population increases, increasing attention has been paid to the diseases associated with aging, including diseases of the skeleton such as osteoporosis. Effective means of treating and possibly preventing such skeletal disorders are emerging, making their early recognition an important goal for the primary care physician. Although bone density measurements and skeletal imaging studies remain of primary diagnostic importance in this regard, a large number of assays for biochemical markers of bone formation and resorption are being developed that promise to complement the densitometry measurements and imaging studies, providing an assessment of the rates of bone turnover and an earlier evaluation of the effects of therapy. In this review, emphasizing the recent literature, the major biochemical markers currently in use or under active investigation are described, and their application in a number of diseases of the skeleton including osteoporosis is evaluated.

Corneal Densitometry as a Tool to Measure Epithelial Ingrowth After Laser In Situ Keratomileusis.

PubMed

Adran, Daniel; Vaillancourt, Louis; Harissi-Dagher, Mona; Kruh, Jonathan N; Syed, Zeba A; Robinson, Steven; Melki, Samir

2017-04-01

This study evaluates the correlation between corneal densitometry and epithelial ingrowth (EI) after laser in situ keratomileusis (LASIK). Corneal densitometry of 3 patients who developed EI after LASIK was measured with the Oculus Pentacam. Corneal densitometry readings of each patient were obtained preoperatively and postoperatively after ingrowth was discovered. Densitometry was recorded at the central nest of opacity and at the leading edges of EI. For all patients, the most severe stages of EI observed on slit-lamp photographs correlated with the highest densitometry readings, with peak densitometry ranging from 73.3 to 95.1. These values were much higher than preoperative densitometry readings, which ranged from 21.8 to 27.2. In 2 cases, the Pentacam densitometry map revealed progression of EI toward the visual axis that was only faintly detectable or not detectable at all on the corresponding slit-lamp photographs. Corneal densitometry seems to be an objective measure of the severity and progression of EI after LASIK.

BMDO Technology Applications in Biomedicine

DTIC Science & Technology

1996-01-01

capacitance and low- noise detectors. NOVA’s systems could also be used for bone densitometry and panoramic dental X-rays. Potential Use to Medicine Dr...receiver coils, increasing signal-to- noise ratio by a factor of two in some cases. This change is especially important in low-strength MRI fields...ongoing in this area. Receivers for this technology must be even more sensitive than for conventional MRI, because the " noise " level in these tissue

Analysis of fracture healing in osteopenic bone caused by disuse: experimental study.

PubMed

Paiva, A G; Yanagihara, G R; Macedo, A P; Ramos, J; Issa, J P M; Shimano, A C

2016-03-01

Osteoporosis has become a serious global public health issue. Hence, osteoporotic fracture healing has been investigated in several previous studies because there is still controversy over the effect osteoporosis has on the healing process. The current study aimed to analyze two different periods of bone healing in normal and osteopenic rats. Sixty, 7-week-old female Wistar rats were randomly divided into four groups: unrestricted and immobilized for 2 weeks after osteotomy (OU2), suspended and immobilized for 2 weeks after osteotomy (OS2), unrestricted and immobilized for 6 weeks after osteotomy (OU6), and suspended and immobilized for 6 weeks after osteotomy (OS6). Osteotomy was performed in the middle third of the right tibia 21 days after tail suspension, when the osteopenic condition was already set. The fractured limb was then immobilized by orthosis. Tibias were collected 2 and 6 weeks after osteotomy, and were analyzed by bone densitometry, mechanical testing, and histomorphometry. Bone mineral density values from bony calluses were significantly lower in the 2-week post-osteotomy groups compared with the 6-week post-osteotomy groups (multivariate general linear model analysis, P<0.000). Similarly, the mechanical properties showed that animals had stronger bones 6 weeks after osteotomy compared with 2 weeks after osteotomy (multivariate general linear model analysis, P<0.000). Histomorphometry indicated gradual bone healing. Results showed that osteopenia did not influence the bone healing process, and that time was an independent determinant factor regardless of whether the fracture was osteopenic. This suggests that the body is able to compensate for the negative effects of suspension.

[Relationship among anthropometric and gluco-metabolic parameters, bone mineral density and endometriosis].

PubMed

Nava-González, Edna J; de la Garza-Casas, Yolanda E; Salazar-Montalvo, Raúl G; Gallegos-Cabriales, Esther C

2013-01-01

women with endometriosis may have a decreased bone mineral density (BMD). Several studies have shown that accumulation of adipose tissue profoundly affects BMD. It has also been documented that excess body fat is associated with risk of developing endometriosis. The aim was to analyze the relationship between BMD, fat mass, and the insulin-glucose axis in women with endometriosis. thirty women with a diagnosis of endometriosis established by surgery were enrolled to participate in an observational prospective study. Anthropometry was performed to determine body mass index, and a dual X-ray densitometry to collect data on body composition and BMD. Glucose and insulin determinations were performed. Women were divided in two groups: with normal weight (n = 18) or overweight (n = 12). For the analysis of the results, we used descriptive statistics and Pearson's test. normal weight/overweight: mean age 32.5/35.2 years; body mass index 21.5/30.2; adiposity index: 27.7 %/36.1 %; fat mass index: 35.4/45.8 %; overweight women showed a significant value with p < 0.05. overweight, high values of adiposity index and fat mass index were related to endometriosis. This could support the hypothesis about a common pathogenesis among endometriosis, osteoporosis, diabetes and obesity.

Association of unipedal standing time and bone mineral density in community-dwelling Japanese women.

PubMed

Sakai, A; Toba, N; Takeda, M; Suzuki, M; Abe, Y; Aoyagi, K; Nakamura, T

2009-05-01

Bone mineral density (BMD) and physical performance of the lower extremities decrease with age. In community-dwelling Japanese women, unipedal standing time, timed up and go test, and age are associated with BMD while in women aged 70 years and over, unipedal standing time is associated with BMD. The aim of this study was to clarify whether unipedal standing time is significantly associated with BMD in community-dwelling women. The subjects were 90 community-dwelling Japanese women aged 54.7 years. BMD of the second metacarpal bone was measured by computed X-ray densitometry. We measured unipedal standing time as well as timed up and go test to assess physical performance of the lower extremities. Unipedal standing time decreased with increased age. Timed up and go test significantly correlated with age. Low BMD was significantly associated with old age, short unipedal standing time, and long timed up and go test. Stepwise regression analysis revealed that age, unipedal standing time, and timed up and go test were significant factors associated with BMD. In 21 participants aged 70 years and over, body weight and unipedal standing time, but not age, were significantly associated with BMD. BMD and physical performance of the lower extremities decrease with older age. Unipedal standing time, timed up and go test, and age are associated with BMD in community-dwelling Japanese women. In women aged 70 years and over, unipedal standing time is significantly associated with BMD.

Reproducibility of CT bone densitometry: operator versus automated ROI definition.

PubMed

Louis, O; Luypaert, R; Kalender, W; Osteaux, M

1988-05-01

Intrasubject reproducibility with repeated determination of vertebral mineral density from a given set of CT images was investigated. The region of interest (ROI) in 10 patient scans was selected by four independent operators either manually or with an automated procedure separating cortical and spongeous bone, the operators being requested to interact in ROI selection. The mean intrasubject variation was found to be much lower with the automated process (0.3 to 0.6%) than with the conventional method (2.5 to 5.2%). In a second study, 10 patients were examined twice to determine the reproducibility of CT slice selection by the operator. The errors were of the same order of magnitude as in ROI selection.

Effect of the “protein diet” and bone tissue.

PubMed

Nascimento da Silva, Zoraide; Azevedo de Jesuz, Vanessa; De Salvo Castro, Eduardo; Soares da Costa, Carlos Alberto; Teles Boaventura, Gilson; Blondet de Azeredo, Vilma

2014-01-01

The aim of this study is to evaluate the effect of the hyperproteic diet consumption on bone tissue. The study was conducted during sixty days. Twenty eight Wistar albinus rats, adults, originated from Laboratory of Experimental Nutrition were divided in four groups: (n = 7); Control 1 (C1), Control 2 (C2), Hyperproteic 1 (HP1) e Hyperproteic 2 (HP2). The C2 and HP2 groups were submitted to 30% of food restriction. The hyperproteic diet was based on the Atkins diet and prepared to simulate the protein diet. At the end of the study the animals were anesthetized to performer bone densitometry analyses by DEXA and blood and tissue collection. Serum and bone minerals analyses were conducted by colorimetric methods in automated equipment. The total bone mineral density (BMD) of the pelvis and the spine of the food restriction groups (HP2 e C2) were lower (p < 0.05) than C1 e HP1 groups. While the femur BMD of the HP2 was lower (p < 0.05) related to others groups. It had been observed reduction (p < 0.05) in the medium point of the width of femur diaphysis and in bone calcium level in the hyperproteic groups (HP1 e HP2). It was observed similar effect on the osteocalcin level, that presented lower (p < 0.05) in the hyperproteic groups. The insulin level was lower only in HP2 and serum calcium of the HP1 and HP2 groups was lower than C1. The protein diet promotes significant bone change on femur and in the hormones levels related to bone synthesis and maintenance of this tissue.

Use of cone beam computed tomography in identifying postmenopausal women with osteoporosis.

PubMed

Brasileiro, C B; Chalub, L L F H; Abreu, M H N G; Barreiros, I D; Amaral, T M P; Kakehasi, A M; Mesquita, R A

2017-12-01

The aim of this study is to correlate radiometric indices from cone beam computed tomography (CBCT) images and bone mineral density (BMD) in postmenopausal women. Quantitative CBCT indices can be used to screen for women with low BMD. Osteoporosis is a disease characterized by the deterioration of bone tissue and the consequent decrease in BMD and increase in bone fragility. Several studies have been performed to assess radiometric indices in panoramic images as low-BMD predictors. The aim of this study is to correlate radiometric indices from CBCT images and BMD in postmenopausal women. Sixty postmenopausal women with indications for dental implants and CBCT evaluation were selected. Dual-energy X-ray absorptiometry (DXA) was performed, and the patients were divided into normal, osteopenia, and osteoporosis groups, according to the World Health Organization (WHO) criteria. Cross-sectional images were used to evaluate the computed tomography mandibular index (CTMI), the computed tomography index (inferior) (CTI (I)) and computed tomography index (superior) (CTI (S)). Student's t test was used to compare the differences between the indices of the groups' intraclass correlation coefficient (ICC). Statistical analysis showed a high degree of interobserver and intraobserver agreement for all measurements (ICC > 0.80). The mean values of CTMI, CTI (S), and CTI (I) were lower in the osteoporosis group than in osteopenia and normal patients (p < 0.05). In comparing normal patients and women with osteopenia, there was no statistically significant difference in the mean value of CTI (I) (p = 0.075). Quantitative CBCT indices may help dentists to screen for women with low spinal and femoral bone mineral density so that they can refer postmenopausal women for bone densitometry.

Texture analysis of clinical radiographs using radon transform on a local scale for differentiation between post-menopausal women with and without hip fracture

NASA Astrophysics Data System (ADS)

Boehm, Holger F.; Körner, Markus; Baumert, Bernhard; Linsenmaier, Ulrich; Reiser, Maximilian

2011-03-01

Osteoporosis is a chronic condition characterized by demineralization and destruction of bone tissue. Fractures associated with the disease are becoming an increasingly relevant issue for public health institutions. Prediction of fracture risk is a major focus research and, over the years, has been approched by various methods. Still, bone mineral density (BMD) obtained by dual-energy X-ray absorptiometry (DXA) remains the clinical gold-standard for diagnosis and follow-up of osteoporosis. However, DXA is restricted to specialized diagnostic centers and there exists considerable overlap in BMD results between populations of individuals with and without fractures. Clinically far more available than DXA is conventional x-ray imaging depicting trabecular bone structure in great detail. In this paper, we demonstrate that bone structure depicted by clinical radiographs can be analysed quantitatively by parameters obtained from the Radon Transform (RT). RT is a global analysis-tool for detection of predefined, parameterized patterns, e.g. straight lines or struts, representing suitable approximations of trabecular bone texture. The proposed algorithm differentiates between patients with and without fractures of the hip by application of various texture-metrics based on the Radon-Transform to standard x-ray images of the proximal femur. We consider three different regions-of-interest in the proximal femur (femoral head, neck, and inter-trochanteric area), and conduct an analysis with respect to correct classification of the fracture status. Performance of the novel approach is compared to DXA. We draw the conclusion that performance of RT is comparable to DXA and may become a useful supplement to densitometry for the prediction of fracture risk.

Noninvasive markers of bone metabolism in the rhesus monkey: normal effects of age and gender

NASA Technical Reports Server (NTRS)

Cahoon, S.; Boden, S. D.; Gould, K. G.; Vailas, A. C.

1996-01-01

Measurement of bone turnover in conditions such as osteoporosis has been limited by the need for invasive iliac bone biopsy to reliably determine parameters of bone metabolism. Recent advances in the area of serum and urinary markers of bone metabolism have raised the possibility for noninvasive measurements; however, little nonhuman primate data exist for these parameters. The purpose of this experiment was to define the normal range and variability of several of the newer noninvasive bone markers which are currently under investigation in humans. The primary intent was to determine age and gender variability, as well as provide some normative data for future experiments in nonhuman primates. Twenty-four rhesus macaques were divided into equal groups of male and female according to the following age groupings: 3 years, 5-10 years, 15-20 years, and > 25 years. Urine was collected three times daily for a four-day period and measured for several markers of bone turnoverm including pyridinoline (PYD), deoxypyrodinoline (DPD), hydroxyproline, and creatinine. Bone mineral density measurements of the lumbar spine were performed at the beginning and end of the study period. Serum was also obtained at the time of bone densitometry for measurement of osteocalcin levels by radioimmunoassay. There were no significant differences in bone mineral density, urine PYD, or urine DPD based on gender. Bone density was lowest in the youngest animals, peaked in the 15-20-year group, but again decreased in the oldest animals. The osteocalcin, PYD, and DPD levels followed an inversely related pattern to bone density. The most important result was the relative age insensitivity of the ratio of PYD:DPD in monkeys up to age 20 years. Since bone density changes take months or years to become measurable and iliac biopsies are invasive, the PYD/DPD marker ratio may have important implications for rapid noninvasive measurement of the effects of potential treatments for osteoporosis in the non-human primate model.

Official Positions for FRAX® clinical regarding smoking from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Dimai, Hans P; Chandran, Manju

2011-01-01

The worldwide prevalence of smoking has been estimated at about 50% in men, and 10% in women, with larger variations among different populations studied. Smoking has been shown to affect many organ systems resulting in severe morbidity and increased mortality. In addition, smoking has been identified as a predictor of ten-year fracture risk in men and women, largely independent of an individual's bone mineral density. This finding has eventually lead to incorporation of this risk factor into FRAX®, an algorithm that has been developed to calculate an individual's ten-year fracture risk. However, only little, or conflicting data is available on a possible association between smoking dose, duration, length of time after cessation, type of tobacco and fracture risk, limiting this risk factor's applicability in the context of FRAX®. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Automatic Estimation of Osteoporotic Fracture Cases by Using Ensemble Learning Approaches.

PubMed

Kilic, Niyazi; Hosgormez, Erkan

2016-03-01

Ensemble learning methods are one of the most powerful tools for the pattern classification problems. In this paper, the effects of ensemble learning methods and some physical bone densitometry parameters on osteoporotic fracture detection were investigated. Six feature set models were constructed including different physical parameters and they fed into the ensemble classifiers as input features. As ensemble learning techniques, bagging, gradient boosting and random subspace (RSM) were used. Instance based learning (IBk) and random forest (RF) classifiers applied to six feature set models. The patients were classified into three groups such as osteoporosis, osteopenia and control (healthy), using ensemble classifiers. Total classification accuracy and f-measure were also used to evaluate diagnostic performance of the proposed ensemble classification system. The classification accuracy has reached to 98.85 % by the combination of model 6 (five BMD + five T-score values) using RSM-RF classifier. The findings of this paper suggest that the patients will be able to be warned before a bone fracture occurred, by just examining some physical parameters that can easily be measured without invasive operations.

Whole-body vibration improves fracture healing and bone quality in rats with ovariectomy-induced osteoporosis.

PubMed

Butezloff, Mariana Maloste; Zamarioli, Ariane; Leoni, Graziela Bianchi; Sousa-Neto, Manoel Damião; Volpon, Jose Batista

2015-11-01

To investigate the effect of vibration therapy on the bone callus of fractured femurs and the bone quality of intact femurs in ovariectomized rats. Fifty-six rats aged seven weeks were divided into four groups: control with femoral fracture (CON, n=14), ovariectomized with femoral fracture (OVX, n=14), control with femoral fracture plus vibration therapy (CON+VT, n=14), and ovariectomized with femoral fracture plus vibration therapy (OVX+VT, n=14). Three months after ovariectomy or sham surgery, a complete fracture was produced at the femoral mid-diaphysis and stabilized with a 1-mm-diameter intramedullary Kirschner wire. X-rays confirmed the fracture alignment and fixation. Three days later, the VT groups underwent vibration therapy (1 mm, 60 Hz for 20 minutes, three times per week for 14 or 28 days). The bone and callus quality were assessed by densitometry, three-dimensional microstructure, and mechanical test. Ovariectomized rats exhibited a substantial loss of bone mass and severe impairment in bone microarchitecture, both in the non-fractured femur and the bone callus. Whole-body vibration therapy exerted an important role in ameliorating the bone and fracture callus parameters in the osteoporotic bone. Vibration therapy improved bone quality and the quality of the fracture bone callus in ovariectomized rats.

Spontaneous rib fractures.

PubMed

Katrancioglu, Ozgur; Akkas, Yucel; Arslan, Sulhattin; Sahin, Ekber

2015-07-01

Other than trauma, rib fracture can occur spontaneously due to a severe cough or sneeze. In this study, patients with spontaneous rib fractures were analyzed according to age, sex, underlying pathology, treatment, and complications. Twelve patients who presented between February 2009 and February 2011 with spontaneous rib fracture were reviewed retrospectively. The patients' data were evaluated according to anamnesis, physical examination, and chest radiographs. The ages of the patients ranged from 34 to 77 years (mean 55.91 ± 12.20 years), and 7 (58.4%) were male. All patients had severe cough and chest pain. The fractures were most frequently between 4th and 9th ribs; multiple rib fractures were detected in 5 (41.7%) patients. Eight (66.7%) patients had chronic obstructive pulmonary disease, 2 (16.7%) had bronchial asthma, and 2 (16.7%) had osteoporosis. Bone densitometry revealed a high risk of bone fracture in all patients. Patients with chronic obstructive pulmonary disease or bronchial asthma had been treated with high-dose steroids for over a year. Spontaneous rib fracture due to severe cough may occur in patients with osteoporosis, chronic obstructive pulmonary disease, or bronchial asthma, receiving long-term steroid therapy. If these patients have severe chest pain, chest radiography should be performed to check for bone lesions. © The Author(s) 2015.

Prevalence and Risk Factors of Osteoporosis in Women Referring to the Bone Densitometry Academic Center in Urmia, Iran

PubMed Central

Naz, Marzieh Saei Ghare; Ozgoli, Giti; Aghdashi, Mir Amir; Salmani, Fatemeh

2016-01-01

Background: Osteoporosis is one of the fastest growing health problems around the world. Several factors can affect this silent disease. The current study aimed to determine the prevalence and risk factors of osteoporosis in women in Urmia, a city in northwestern Iran. Methods: This cross-sectional study was performed on 360 non-pregnant women over the age of 15 who referred for bone density testing to the Urmia Imam Khomeini Academic Hospital. Data were collected by questionnaire, and bone mineral density of the femoral neck and lumbar spines L1- L4 was evaluated by dual X-ray absorptiometry. Results: The total prevalence of osteoporosis in this study was 42.2%; prevalence of osteoporosis among women 45 years old or less was 14.3% and over the age of 45 years was 50.7%. The factors such as level of education, history of bone fracture, disease history (rheumatoid arthritis, diabetes, high blood pressure), gravidity and parity values, duration of lactation (p<0.001), nutrition dimension of lifestyle (p=0.03), and green tea consumption (p=002) showed a statistically significant association with the bone mineral density. According to the regression model, age (OR=1.081), history of bone fracture (OR=2.75), and gravidity (OR=1.14) were identified as significant risk factors for osteoporosis, while the body mass index (OR=0.94) was identified as a protector against osteoporosis. Conclusion: The prevalence of osteoporosis in this study was high, and findings showed that the advancement of age, lifestyle, and reproductive factors (especially gravidity and duration of lactation) were determining factors for osteoporosis. Appropriate educational programs and interventions could help to increase the women’s peak bone mass therefore reducing their risk of developing osteoporosis. PMID:26925890

Single x-ray transmission system for bone mineral density determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jimenez-Mendoza, Daniel; Vargas-Vazquez, Damian; Espinosa-Arbelaez, Diego G.

2011-12-15

Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many differentmore » applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm{sup 2})], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.« less

Single x-ray transmission system for bone mineral density determination

NASA Astrophysics Data System (ADS)

Jimenez-Mendoza, Daniel; Espinosa-Arbelaez, Diego G.; Giraldo-Betancur, Astrid L.; Hernandez-Urbiola, Margarita I.; Vargas-Vazquez, Damian; Rodriguez-Garcia, Mario E.

2011-12-01

Bones are the support of the body. They are composed of many inorganic compounds and other organic materials that all together can be used to determine the mineral density of the bones. The bone mineral density is a measure index that is widely used as an indicator of the health of the bone. A typical manner to evaluate the quality of the bone is a densitometry study; a dual x-ray absorptiometry system based study that has been widely used to assess the mineral density of some animals' bones. However, despite the success stories of utilizing these systems in many different applications, it is a very expensive method that requires frequent calibration processes to work properly. Moreover, its usage in small species applications (e.g., rodents) has not been quite demonstrated yet. Following this argument, it is suggested that there is a need for an instrument that would perform such a task in a more reliable and economical manner. Therefore, in this paper we explore the possibility to develop a new, affordable, and reliable single x-ray absorptiometry system. The method consists of utilizing a single x-ray source, an x-ray image sensor, and a computer platform that all together, as a whole, will allow us to calculate the mineral density of the bone. Utilizing an x-ray transmission theory modified through a version of the Lambert-Beer law equation, a law that expresses the relationship among the energy absorbed, the thickness, and the absorption coefficient of the sample at the x-rays wavelength to calculate the mineral density of the bone can be advantageous. Having determined the parameter equation that defines the ratio of the pixels in radiographies and the bone mineral density [measured in mass per unit of area (g/cm2)], we demonstrated the utility of our novel methodology by calculating the mineral density of Wistar rats' femur bones.

Does a high dietary acid content cause bone loss, and can bone loss be prevented with an alkaline diet?

PubMed

Hanley, David A; Whiting, Susan J

2013-01-01

A popular concept in nutrition and lay literature is that of the role of a diet high in acid or protein in the pathogenesis of osteoporosis. A diet rich in fruit and vegetable intake is thought to enhance bone health as the result of its greater potassium and lower "acidic" content than a diet rich in animal protein and sodium. Consequently, there have been a number of studies of diet manipulation to enhance potassium and "alkaline" content of the diet to improve bone density or other parameters of bone health. Although acid loading or an acidic diet featuring a high protein intake may be associated with an increase in calciuria, the evidence supporting a role of these variables in the development of osteoporosis is not consistent. Similarly, intervention studies with a more alkaline diet or use of supplements of potassium citrate or bicarbonate have not consistently shown a bone health benefit. In the elderly, inadequate protein intake is a greater problem for bone health than protein excess. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Dietary coral calcium and zeolite protects bone in a mouse model for postmenopausal bone loss.

PubMed

Banu, Jameela; Varela, Erika; Guerra, Juan M; Halade, Ganesh; Williams, Paul J; Bahadur, Ali N; Hanaoka, Kokichi; Fernandes, Gabriel

2012-12-01

In patients diagnosed with osteoporosis, calcium is lost from bones making them weaker and easily susceptible to fractures. Supplementation of calcium is highly recommended for such conditions. However, the source of calcium plays an important role in the amount of calcium that is assimilated into bone. We hypothesize that naturally occurring coral calcium and zeolite may prevent ovariectomy-induced bone loss. We have measured bone loss in ovariectomized mice supplemented with coral calcium and Zeolite. Female C57BL/6 mice were either sham-operated or ovariectomized and fed diets containing coral calcium or zeolite for 6 months. Serum was analyzed for bone biochemical markers and cytokines. Bones were analyzed using dual x-ray absorbtiometry, peripheral quantitative computed tomography, and micro-computed tomography densitometry. In the distal femoral metaphysis, total bone and cortical bone mass was restored and the endocortical surface was significantly decreased in coral calcium and zeolite fed ovariectomized (OVX) mice. Trabecular number and the ratio of bone volume to total volume was higher in OVX mice after coral calcium and zeolite feeding, while trabecular separation decreased in the different treatment OVX groups. Coral calcium protected bone to a lesser extent in the proximal tibia and lumbar vertebrae. Overall, coral calcium and zeolite may protect postmenopausal bone loss. Copyright © 2012 Elsevier Inc. All rights reserved.

Response of the skeletal system to helicopter-unique vibration.

PubMed

Gearhart, J R

1978-01-01

An 18-month prospective skeletal system study was conducted on flying and nonflying personnel relative to chronic low-frequency vibration as experienced in helicopter flight. The aviators were initial entry students in rotary-wing training while the non-flying participants were beginning basic military training. Comparisons were made on the basis of anthropometric measurements, radiological studies, and bone mineral density changes as measured by photon absorption. The bone mineral densitometry showed no significant variation in the aviator group. A short-term 10% demineralization of the distal ulna in the non-flying group was noted immediately following the physical training. The final bone mineral density of basic training subjects returned to the initial level 18 months after the physical training. It was concluded that the helicopter aircrew members under study were exposed to levels of vibration below the threshold of vibration required to produce a measurable change in the skeletal system.

Osteoporosis: primary prevention in the community.

PubMed

Loh, K Y; Shong, H K

2007-10-01

The incidence of osteoporosis is increasing worldwide. It has great impact on the life of the elderly population. The most significant medical consequence of osteoporosis is fragility fracture which without proper treatment will cause severe medical and psychosocial complications. The overall cost in managing osteoporosis and its related fractures is escalating. Using bone densitometry to measure bone mineral density is useful in the diagnosis of osteoporosis but it is costly and not feasible in the community. Drugs such as estrogen replacement, raloxifene and calcitonin are effective in prevention and treatment of osteoporosis but they are also expensive. Identifying modifiable risk factors such as smoking, lack of exercise, low dietary calcium and vitamin D intake and healthy life style remain strategy in the primary prevention of osteoporosis in the community.

The effect of nutritional rickets on bone mineral density.

PubMed

Thacher, Tom D; Fischer, Philip R; Pettifor, John M

2014-11-01

Nutritional rickets is caused by impaired mineralization of growing bone. The effect of nutritional rickets on areal bone mineral density (aBMD) has not been established. Our objective was to determine if aBMD is lower in children with active rickets than in healthy control children. We expected that the reduction in aBMD would vary between the radial and ulnar metaphyses near the growth plates and the proximal diaphyses. Case-control study. Primary care outpatient department of a teaching hospital in Jos, Nigeria. Nigerian children with radiographically-confirmed rickets were compared with a reference group of control children without rickets from the same community. Forearm bone density measurements were performed in all children with pDXA. Age, sex, and height-adjusted bone density parameters were compared between children with rickets and control subjects. A total of 264 children with active rickets (ages 13-120 months) and 660 control children (ages 11-123 months) were included. In multivariate analyses controlling for height, age, and gender, rickets was associated with a 4% greater bone area and 7% lower aBMD of the radial and ulnar metaphyses compared with controls (P < .001). The effects of rickets on the diaphyses of the radius and ulna were more pronounced with an 11% greater bone area, 21% lower aBMD, and 24% lower bone mineral apparent density than controls (P < .001). In children with rickets, aBMD values were unrelated to dairy product intake or serum calcium, phosphorus, alkaline phosphatase, or 25-hydroxyvitamin D. Metaphyseal aBMD was positively associated with radiographic severity score, attributed to bone edge detection artifact by densitometry in active rickets. Rickets results in increased bone area and reduced aBMD, which are more pronounced in the diaphyseal than in the metaphyseal regions of the radius and ulna, consistent with secondary hyperparathyroidism, generalized osteoid expansion and impaired mineralization.

Challenges of Estimating Fracture Risk with DXA: Changing Concepts About Bone Strength and Bone Density.

PubMed

Licata, Angelo A

2015-07-01

Bone loss due to weightlessness is a significant concern for astronauts' mission safety and health upon return to Earth. This problem is monitored with bone densitometry (DXA), the clinical tool used to assess skeletal strength. DXA has served clinicians well in assessing fracture risk and has been particularly useful in diagnosing osteoporosis in the elderly postmenopausal population for which it was originally developed. Over the past 1-2 decades, however, paradoxical and contradictory findings have emerged when this technology was widely employed in caring for diverse populations unlike those for which it was developed. Although DXA was originally considered the surrogate marker for bone strength, it is now considered one part of a constellation of factors-described collectively as bone quality-that makes bone strong and resists fracturing, independent of bone density. These characteristics are beyond the capability of routine DXA to identify, and as a result, DXA can be a poor prognosticator of bone health in many clinical scenarios. New clinical tools are emerging to make measurement of bone strength more accurate. This article reviews the historical timeline of bone density measurement (dual X-ray absorptiometry), expands upon the clinical observations that modified the relationship of DXA and bone strength, discusses some of the new clinical tools to predict fracture risk, and highlights the challenges DXA poses in the assessment of fracture risk in astronauts.

Bone-marrow densitometry: Assessment of marrow space of human vertebrae by single energy high resolution-quantitative computed tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peña, Jaime A.; Damm, Timo; Bastgen, Jan

Purpose: Accurate noninvasive assessment of vertebral bone marrow fat fraction is important for diagnostic assessment of a variety of disorders and therapies known to affect marrow composition. Moreover, it provides a means to correct fat-induced bias of single energy quantitative computed tomography (QCT) based bone mineral density (BMD) measurements. The authors developed new segmentation and calibration methods to obtain quantitative surrogate measures of marrow-fat density in the axial skeleton. Methods: The authors developed and tested two high resolution-QCT (HR-QCT) based methods which permit segmentation of bone voids in between trabeculae hypothesizing that they are representative of bone marrow space. Themore » methods permit calculation of marrow content in units of mineral equivalent marrow density (MeMD). The first method is based on global thresholding and peeling (GTP) to define a volume of interest away from the transition between trabecular bone and marrow. The second method, morphological filtering (MF), uses spherical elements of different radii (0.1–1.2 mm) and automatically places them in between trabeculae to identify regions with large trabecular interspace, the bone-void space. To determine their performance, data were compared ex vivo to high-resolution peripheral CT (HR-pQCT) images as the gold-standard. The performance of the methods was tested on a set of excised human vertebrae with intact bone marrow tissue representative of an elderly population with low BMD. Results: 86% (GTP) and 87% (MF) of the voxels identified as true marrow space on HR-pQCT images were correctly identified on HR-QCT images and thus these volumes of interest can be considered to be representative of true marrow space. Within this volume, MeMD was estimated with residual errors of 4.8 mg/cm{sup 3} corresponding to accuracy errors in fat fraction on the order of 5% both for GTP and MF methods. Conclusions: The GTP and MF methods on HR-QCT images permit noninvasive localization and densitometric assessment of marrow fat with residual accuracy errors sufficient to study disorders and therapies known to affect bone marrow composition. Additionally, the methods can be used to correct BMD for fat induced bias. Application and testing in vivo and in longitudinal studies are warranted to determine the clinical performance and value of these methods.« less

Bone health status of postmenopausal Chinese women.

PubMed

Lo, Sue S T

2015-12-01

To evaluate the prevalence of osteoporosis in treatment-naïve postmenopausal women, their treatment adherence, and the risk factors for osteoporosis. Cross-sectional study of bone density reports, a self-administered health checklist, and computerised consultation records. Primary care sexual and reproductive health service in Hong Kong. Postmenopausal Chinese women who had never received osteoporosis treatment or hormone replacement therapy. Each woman completed a checklist of risk factors for osteoporosis, menopause age, history of hormone replacement therapy, and osteoporosis treatment prior to undergoing bone mineral density measurement at the postero-anterior lumbar spine and left femur. The consultation records of those with osteoporosis were reviewed to determine their treatment adherence. T-score at the spine and hip, presence or absence of risk factors for osteoporosis, and treatment adherence. Between January 2008 and December 2011, 1507 densitometries were performed for eligible women; 51.6% of whom were diagnosed with osteopenia and 25.7% with osteoporosis. The mean age of women with normal bone mineral density, osteopenia, and osteoporosis was 57.0, 58.0, and 59.7 years, respectively. Approximately half of them had an inadequate dietary calcium intake, performed insufficient weight-bearing exercise, or had too little sun exposure. Logistic regression analysis revealed that age, body mass index of <18.5 kg/m(2), parental history of osteoporosis or hip fracture, and duration of menopause were significant risk factors for osteoporosis. Among those with osteoporosis, 42.9% refused treatment, 30.7% complied with treatment, and 26.3% discontinued treatment or defaulted from follow-up. Those who refused treatment were significantly older. Osteoporosis is prevalent in postmenopausal women. Only 50% adopted primary prevention strategies. Almost 70% refused treatment or stopped prematurely.

[In vitro study with techniques of imaging of the composition of urinary calculi].

PubMed

Tellez Martínez-Fornés, M; Burgos Revilla, F J; Sáez Garrido, J C; Soria Descalzo, J; Barbero González, J; Sánchez Corral, J; Minaya Minaya, A; Vallejo Herrador, J

1997-02-01

Pre-treatment knowledge of the lithiasic composition can be useful to design the most appropriate therapeutic scheme for each kind of stone. The relationship between the stone's densitometry information provided by the different imaging techniques, conventional radiology (RX), computerized axial tomography (CAT) and dual energy radiographic densitometry (DO) is analyzed, as well as the elemental composition determined by the microanalysis of fragments obtained post-lithotrity using a scanning electronic microscope (SEM) associated to X-ray dispersion energy (XDE). 60 stones, 12 for each pure composition selected (calcium oxalate mono and dihydro, phosphocarbonate, magnesium ammonium phosphate and uric acid), were studied with XR, CAT and DO and were later subjected to lithofragmentation in vitro. Fragments analysis was carried out post-lithotrity with SEM associated to XDE. The X-ray does not allow to establish the composition of some calculi. CAT quantifies the mineral contents of the oxalocalcic and infective calculi and differentiates the uric acid from the other compositions because the mean density values are under 500 Hounsfield Units. DO evaluates the lithiasic content in phosphocarbonate salts which are structurally similar to bone hydroxyapatite.

FRAX(®) Clinical Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

McCloskey, Eugene V; Binkley, Neil

2011-01-01

The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.

INVESTIGATION OF BONE MINERALIZATION IN PATIENTS WITH CORONARY HEART DISEASE COMPLICATED BY CHRONIC HEART FAILURE, STAGE II-A.

PubMed

Krynytska, I; Marushchak, M; Zaets, T; Savchenko, I; Habor, H

2017-06-01

The majority of the studies have shown that individuals with cardiovascular diseases have a higher risk of experiencing bone loss and thus greater predisposition to risk of fracture. On the other hand there is growing evidence that individuals with low bone mass have higher mortality for cardiovascular events compared to patients with cardiovascular disease with normal bone mass. This research aims to investigate bone mineralization in patients with coronary heart disease complicated by stage II-A chronic heart failure. The study involved 33 men with coronary heart disease complicated by Stage II-A chronic heart failure. Bone mineral density was measured using dual energy x-ray densitometry of lumbar region of spine. Structural and functional changes of bone tissue of the lumbar spine have been found in 49,2% patients with coronary heart disease complicated by Stage II-A chronic heart failure, in particular, I stage of osteopenia - in 44,6%, II stage of osteopenia - in 27,7%, III stage of osteopenia - in 10,8% and osteoporosis - in 16,9%. It was established the same type of downward trend for BMD decreasing in L1 of patients with different stages of osteopenia, but in case of osteoporosis mineralization decreased equally in all vertebrae.

Nandrolone decanoate appears to increase bone callus formation in young adult rats after a complete femoral fracture.

PubMed

Guimarães, Ana Paula Franttini Garcia Moreno; Butezloff, Mariana Maloste; Zamarioli, Ariane; Issa, João Paulo Mardegan; Volpon, José Batista

2017-11-01

To evaluate the influence of nandrolone decanoate on fracture healing and bone quality in normal rats. Male rats were assigned to four groups (n=28/group): Control group consisting of animals without any intervention, Nandrolone decanoate (DN) group consisting of animals that received intramuscular injection of nandrolone decanoate, Fracture group consisting of animals with a fracture at the mid-diaphysis of the femur, and Fracture and nandrolone decanoate group consisting of animals with a femur fracture and treatment with nandrolone decanoate. Fractures were created at the mid-diaphysis of the right femur by a blunt trauma and internally fixed using an intramedullary steel wire. The DN was injected intramuscularly twice per week (10 mg/kg of body mass). The femurs were measured and evaluated by densitometry and mechanical resistance after animal euthanasia. The newly formed bone and collagen type I levels were quantified in the callus. The treated animals had longer femurs after 28 days. The quality of the intact bone was not significantly different between groups. The bone callus did show a larger mass in the treated rats. The administration of nandrolone decanoate did not affect the quality of the intact bone, but might have enhanced the bone callus formation.

Low-dose combined oral contraceptive use is associated with lower bone mineral content variation in adolescents over a 1-year period.

PubMed

Biason, Talita Poli; Goldberg, Tamara Beres Lederer; Kurokawa, Cilmery Suemi; Moretto, Maria Regina; Teixeira, Altamir Santos; Nunes, Hélio Rubens de Carvalho

2015-04-03

Low-dose combined oral contraceptives (COCs) can interfere with bone mass acquisition during adolescence. This study aimed to evaluate bone mineral density (BMD) and bone mineral content (BMC) in female adolescents taking a standard low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) over a 1-year period and to compare their data with those of healthy adolescents from the same age group not taking COCs. This was a non-randomized parallel-control study with a 1-year follow-up. Sixty-seven adolescents aged from 12 to 19 years, divided into COC users (n = 41) taking 20 μg ethinylestradiol/150 μg desogestrel and COC non-user controls (n = 26), were evaluated by bone densitometry examinations at baseline and after 12 months. Comparisons between the groups at the study onset were performed using the Mann-Whitney test with the significance level fixed at 5% or p < 0.05. Comparisons between the groups at the study onset and after 12 months were based on variations in the median percentages for bone mass variables. The COC users presented with low bone mass acquisition in the lumbar spine, and had BMD and BMC median variations of 2.07% and +1.57%, respectively, between the measurements at baseline and 12 months. The control group had median variations of +12.16% and +16.84% for BMD and BMC, respectively, over the same period. The total body BMD and BMC showed similar evolutions during the study in both groups. Statistical significance (p < 0.05) was seen for the BMC percentage variation between COC users and non-users. Use of a low-dose COC (ethinylestradiol 20 μg/desogestrel 150 μg) was associated with lower bone mass acquisition in adolescents during the study period. Registry Number, RBR-5h9b3c.

Methods for assessing fracture risk prediction models: experience with FRAX in a large integrated health care delivery system.

PubMed

Pressman, Alice R; Lo, Joan C; Chandra, Malini; Ettinger, Bruce

2011-01-01

Area under the receiver operating characteristics (AUROC) curve is often used to evaluate risk models. However, reclassification tests provide an alternative assessment of model performance. We performed both evaluations on results from FRAX (World Health Organization Collaborating Centre for Metabolic Bone Diseases, University of Sheffield, UK), a fracture risk tool, using Kaiser Permanente Northern California women older than 50yr with bone mineral density (BMD) measured during 1997-2003. We compared FRAX performance with and without BMD in the model. Among 94,489 women with mean follow-up of 6.6yr, 1579 (1.7%) sustained a hip fracture. Overall, AUROCs were 0.83 and 0.84 for FRAX without and with BMD, suggesting that BMD did not contribute to model performance. AUROC decreased with increasing age, and BMD contributed significantly to higher AUROC among those aged 70yr and older. Using an 81% sensitivity threshold (optimum level from receiver operating characteristic curve, corresponding to 1.2% cutoff), 35% of those categorized above were reassigned below when BMD was added. In contrast, only 10% of those categorized below were reassigned to the higher risk category when BMD was added. The net reclassification improvement was 5.5% (p<0.01). Two versions of this risk tool have similar AUROCs, but alternative assessments indicate that addition of BMD improves performance. Multiple methods should be used to evaluate risk tool performance with less reliance on AUROC alone. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Consensus and controversy regarding osteoporosis in the pediatric population.

PubMed

Bachrach, Laura Keyes

2007-09-01

To review current consensus and controversy surrounding the diagnosis and treatment of osteoporosis in childhood and adolescence. The medical literature was reviewed with emphasis on the importance of early skeletal health, risk factors for bone fragility, and the diagnosis and management of children at risk for osteoporosis. Childhood and adolescence are critical periods for optimizing bone growth and mineral accrual. Bone strength is determined by bone size, geometry, quality, and mass-variables that are influenced by genetic factors, activity, nutrition, and hormones. For children with genetic skeletal disorders or chronic disease, bone growth and mineral accrual may be compromised, increasing the lifetime risk of osteoporosis. The goal for the clinician is to identify children at greatest risk for future fragility fracture. Bone densitometry and turnover markers are challenging to interpret in children. Prevention and treatment of bone fragility in children are less well established than in adults. Optimizing nutrition and activity may not restore bone health, but the drug armamentarium is limited. Sex steroid replacement has not proven effective in restoring bone mass in patients with anorexia nervosa or exercise-associated amenorrhea. Bisphosphonates can increase bone mass and may reduce bone pain and fractures, most convincingly in patients with osteogenesis imperfecta. Further studies are needed to establish the safety, efficacy, and optimal drug, duration, and dosage in pediatric patients. Bone health during the first 2 decades contributes to the lifetime risk of osteoporosis. Further research is needed to develop evidence-based recommendations for the diagnosis and treatment of osteoporosis in childhood.

Scanning laser densitometry and color perimetry demonstrate reduced photopigment density and sensitivity in two patients with retinal degeneration.

PubMed

Tornow, R P; Stilling, R; Zrenner, E

1999-10-01

To test the feasibility of scanning laser densitometry with a modified Rodenstock scanning laser ophthalmoscope (SLO) to measure the rod and cone photopigment distribution in patients with retinal diseases. Scanning laser densitometry was performed using a modified Rodenstock scanning laser ophthalmoscope. The distribution of the photopigments was calculated from dark adapted and bleached images taken with the 514 nm laser of the SLO. This wavelength is absorbed by rod and cone photopigments. Discrimination is possible due to their different spatial distribution. Additionally, to measure retinal sensitivity profiles, dark adapted two color static perimetry with a Tübinger manual perimeter was performed along the horizontal meridian with 1 degree spacing. A patient with retinitis pigmentosa had slightly reduced photopigment density within the central +/- 5 degrees but no detectable photopigment for eccentricities beyond 5 degrees. A patient with cone dystrophy had nearly normal pigment density beyond +/- 5 degrees, but considerably reduced photopigment density within the central +/- 5 degrees. Within the central +/- 5 degrees, the patient with retinitis pigmentosa had normal sensitivity for the red stimulus and reduced sensitivity for the green stimulus. There was no measurable function beyond 7 degrees. The patient with cone dystrophy had normal sensitivity for the green stimulus outside the foveal center and reduced sensitivity for the red stimulus at the foveal center. The results of color perimetry for this patient with a central scotoma were probably influenced by eccentric fixation. Scanning laser densitometry with a modified Rodenstock SLO is a useful method to assess the human photopigment distribution. Densitometry results were confirmed by dark adapted two color static perimetry. Photopigment distribution and retinal sensitivity profiles can be measured with high spatial resolution. This may help to measure exactly the temporal development of retinal diseases and to test the success of different therapeutic treatments. Both methods have limitations at the present state of development. However, some of these limitations can be overcome by further improving the instruments.

Vitamin K and bone health.

PubMed

Hamidi, Maryam S; Gajic-Veljanoski, Olga; Cheung, Angela M

2013-01-01

Vitamin K has been purported to play an important role in bone health. It is required for the gamma-carboxylation of osteocalcin (the most abundant noncollagenous protein in bone), making osteocalcin functional. There are 2 main forms (vitamin K1 and vitamin K2), and they come from different sources and have different biological activities. Epidemiologic studies suggest a diet high in vitamin K is associated with a lower risk of hip fractures in aging men and women. However, randomized controlled trials of vitamin K1 or K2 supplementation in white populations did not increase bone mineral density at major skeletal sites. Supplementation with vitamin K1 and K2 may reduce the risk of fractures, but the trials that examined fractures as an outcome have methodological limitations. Large well-designed trials are needed to compare the efficacies of vitamin K1 and K2 on fractures. We conclude that currently there is not enough evidence to recommend the routine use of vitamin K supplements for the prevention of osteoporosis and fractures in postmenopausal women. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Methods and application of bone densitometry in clinical diagnosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahner, H.W.; Riggs, B.L.

1986-01-01

With the awareness of osteoporosis as a major health problem for an aging population, there is great interest in early recognition and treatment of abnormal bone loss. Effective prevention of bone loss has to occur prior to the occurrence of irreparable damage. Standard radiographic procedures are not sensitive enough for the task. Therefore, a number of alternative procedures to estimate bone loss have been developed over the years, ranging from efforts to quantitate information obtained from radiographic images to sophisticated procedures such as neutron activation analysis or procedures based on the Compton scatter phenomenon. Only two procedures, photon absorptiometry andmore » computed tomography (CT), have emerged as applicable for routine clinical use. In photon absorptiometry the entire bone mineral (cortical and trabecular bone) of a specific skeletal site is measured. CT allows measuring of bone mineral of trabecular or cortical bone alone. Normally, bone mass reaches a maximum in the third decade and then continuously declines. This age-related bone loss is greater in women in whom an accelerated rate of loss occurs at the menopause. When bone density reaches a critical fracture threshold, skeletal fractures occur (spine, hip, and distal long bones). The age at which this critical fracture threshold is reached depends on the maximal bone mass achieved in early adulthood and the rate of loss with increasing age. With the exception of NaF, present-day therapeutic efforts only retard or prevent bone loss but do not significantly add bone mineral to the skeleton. Recognition of high-risk groups and early treatment are therefore required. 79 references.« less

Impact of an osteoporosis specialized unit on bone health in breast cancer survivals treated with aromatase inhibitors.

PubMed

Martínez, Purificación; Galve, Elena; Arrazubi, Virginia; Sala, M Ángeles; Fernández, Seila; Pérez, Clara E; Arango, Juan F; Torre, Iñaki

2017-10-11

Considering the increased fracture risk in early breast cancer patients treated with aromatase inhibitors (AI), we assessed the impact of a preventive intervention conducted by a specialized osteoporosis unit on bone health at AI treatment start. Retrospective cohort of postmenopausal women who started treatment with AI after breast cancer surgical/chemotherapy treatment and were referred to the osteoporosis unit for a comprehensive assessment of bone health. Bone densitometry and fracture screening by plain X-ray were performed at the baseline visit and once a year for 5 years. The final record included 130 patients. At AI treatment start, 49% had at least one high-risk factor for fractures, 55% had osteopenia, and 39% osteoporosis. Based on the baseline assessment, 79% of patients initiated treatment with bisphosphonates, 88% with calcium, and 79% with vitamin D. After a median of 65 (50-77) months, 4% developed osteopenia or osteoporosis, and 14% improved their densitometric diagnosis. Fifteen fractures were recorded in 11 (8.5%) patients, all of them receiving preventive treatment (10 with bisphosphonates). During the follow-up period, patients with one or more high-risk factors for fracture showed a greater frequency of fractures (15% vs. 3%) and experienced the first fracture earlier than those without high-risk factors (mean of 99 and 102 months, respectively; P=0.023). The preventive intervention of a specialized unit at the start of AI treatment in breast cancer survivors allows the identification of patients with high fracture risk and may contribute to preventing bone events in these patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Osteopathia striata with cranial sclerosis: clinical, radiological, and bone histological findings in an adolescent girl.

PubMed

Ward, L M; Rauch, F; Travers, R; Roy, M; Montes, J; Chabot, G; Glorieux, F H

2004-08-15

Osteopathia striata with cranial sclerosis (OS-CS) is a rare skeletal dysplasia characterized by linear striations of the long bones, osteosclerosis of the cranium, and extra-skeletal anomalies. We provide a comprehensive description of the skeletal phenotype in a French-Canadian girl with a moderate to severe form of sporadic OS-CS. Multiple medical problems, including anal stenosis and the Pierre-Robin sequence, were evident in the first few years of life. At 14 years, she was fully mobile, with normal intellect and stature. She suffered chronic lower extremity pain in the absence of fractures, as well as severe headaches, unilateral facial paralysis, and bilateral mixed hearing loss. Biochemical indices of bone and mineral metabolism were within normal limits. Bone densitometry showed increased areal bone mineral density in the skull, trunk, and pelvis, but not in the upper and lower extremities. An iliac bone biopsy specimen revealed an increased amount of trabecular bone. Trabeculae were abnormally thick, but there was no evidence of disturbed bone remodeling. In a cranial bone specimen, multiple layers of periosteal bone were found that covered a compact cortical compartment containing tightly packed haversian canals. Bone lamellation was normal in both the iliac and skull samples. Osteoclast differentiation studies showed that peripheral blood osteoclast precursors from this patient formed functional osteoclasts in vitro. Thus, studies of bone metabolism did not explain why bone mass is increased in most skeletal areas of this patient. Cranial histology points to exuberant periosteal bone formation as a potential cause of the cranial sclerosis.

Establishing a method to measure bone structure using spectral CT

NASA Astrophysics Data System (ADS)

Ramyar, M.; Leary, C.; Raja, A.; Butler, A. P. H.; Woodfield, T. B. F.; Anderson, N. G.

2017-03-01

Combining bone structure and density measurement in 3D is required to assess site-specific fracture risk. Spectral molecular imaging can measure bone structure in relation to bone density by measuring macro and microstructure of bone in 3D. This study aimed to optimize spectral CT methodology to measure bone structure in excised bone samples. MARS CT with CdTe Medipix3RX detector was used in multiple energy bins to calibrate bone structure measurements. To calibrate thickness measurement, eight different thicknesses of Aluminium (Al) sheets were scanned one in air and the other around a falcon tube and then analysed. To test if trabecular thickness measurements differed depending on scan plane, a bone sample from sheep proximal tibia was scanned in two orthogonal directions. To assess the effect of air on thickness measurement, two parts of the same human femoral head were scanned in two conditions (in the air and in PBS). The results showed that the MARS scanner (with 90μm voxel size) is able to accurately measure the Al (in air) thicknesses over 200μm but it underestimates the thicknesses below 200μm because of partial volume effect in Al-air interface. The Al thickness measured in the highest energy bin is overestimated at Al-falcon tube interface. Bone scanning in two orthogonal directions gives the same trabecular thickness and air in the bone structure reduced measurement accuracy. We have established a bone structure assessment protocol on MARS scanner. The next step is to combine this with bone densitometry to assess bone strength.

Zinc deficiency reduces bone mineral density in the spine of young adult rats: a pilot study.

PubMed

Ryz, Natasha R; Weiler, Hope A; Taylor, Carla G

2009-01-01

The objective of this study was to investigate the effects of zinc deficiency initiated during adolescence on skeletal densitometry, serum markers of bone metabolism, femur minerals and morphometry in young adult rats. Ten-week-old male rats were fed a <1-mg Zn/kg diet (9ZD), a 5-mg Zn/kg diet (9MZD) or a 30-mg Zn/kg diet (9CTL) for up to 9 weeks. Analyses included bone mineral density, serum osteocalcin and C-terminal peptides of type I collagen, serum zinc, femur zinc, calcium and phosphorus, and femur morphometry. Bone mineral density was 14% lower in the spine of 9ZD, but was not altered in the whole body, tibia or femur, or in any of the aforementioned sites in 9MZD, compared to 9CTL. When adjusted for size, spine bone mineral apparent density was still 8% lower in 9ZD than 9CTL. Serum osteocalcin, a marker for bone formation, was approximately 33% lower in 9ZD compared to both 9MZD and 9CTL. The 9ZD and 9MZD had 57% lower femur zinc and 56-88% lower serum zinc concentrations compared to 9CTL. These findings indicate that severe zinc deficiency initiated during adolescence may have important implications for future bone health, especially with regards to bone consolidation in the spine. 2009 S. Karger AG, Basel.

Biomedical technology transfer. Applications of NASA science and technology

NASA Technical Reports Server (NTRS)

Harrison, D. C.

1980-01-01

Ongoing projects described address: (1) intracranial pressure monitoring; (2) versatile portable speech prosthesis; (3) cardiovascular magnetic measurements; (4) improved EMG biotelemetry for pediatrics; (5) ultrasonic kidney stone disintegration; (6) pediatric roentgen densitometry; (7) X-ray spatial frequency multiplexing; (8) mechanical impedance determination of bone strength; (9) visual-to-tactile mobility aid for the blind; (10) Purkinje image eyetracker and stabilized photocoalqulator; (11) neurological applications of NASA-SRI eyetracker; (12) ICU synthesized speech alarm; (13) NANOPHOR: microelectrophoresis instrument; (14) WRISTCOM: tactile communication system for the deaf-blind; (15) medical applications of NASA liquid-circulating garments; and (16) hip prosthesis with biotelemetry. Potential transfer projects include a person-portable versatile speech prosthesis, a critical care transport sytem, a clinical information system for cardiology, a programmable biofeedback orthosis for scoliosis a pediatric long-bone reconstruction, and spinal immobilization apparatus.

Corneal densitometry and its correlation with age, pachymetry, corneal curvature, and refraction.

PubMed

Garzón, Nuria; Poyales, Francisco; Illarramendi, Igor; Mendicute, Javier; Jáñez, Óscar; Caro, Pedro; López, Alfredo; Argüeso, Francisco

2017-12-01

To determine normative corneal densitometry values in relation to age, sex, refractive error, corneal thickness, and keratometry, measured using the Oculus Pentacam system. Three hundred and thirty-eight healthy subjects (185 men; 153 women) with no corneal disease underwent an exhaustive ocular examination. Corneal densitometry was expressed in standardized grayscale units (GSU). The mean corneal densitometry over the total area was 16.46 ± 1.85 GSU. The Pearson correlation coefficient for total densitometry was r = 0.542 (p < 0.001). Statistically significant differences were found between men and women for the total area (p = 0.006), with readings of 16.22 ± 1.54 GSU and 16.60 ± 1.83 GSU, respectively. When the cornea was divided into layers of different depths, a significant correlation was found for all layers and age: r = 0.447 (p < 0.001), r = 0.563 (p < 0.001), and r = 0.520 (p < 0.001) for the anterior, central, and posterior layers, respectively. However, when the cornea was divided into concentric annuli starting from the center of the cornea, densitometry was strongly correlated only with age in the 6-10-mm annulus (p < 0.001). Neither mean keratometry nor spherical equivalent was correlated with corneal densitometry in any zone of the cornea (p > 0.05). This is the first report of normative corneal densitometry values in relation to keratometry, corneal thickness, and spherical equivalent measured with the latest Oculus Pentacam software. Corneal densitometry increases with age, but corneal keratometry and refractive parameters do not affect light scattering in the human cornea.

Comparative evaluation of bovine derived hydroxyapatite and synthetic hydroxyapatite graft in bone regeneration of human maxillary cystic defects: a clinico-radiological study.

PubMed

Kattimani, Vivekanand S; Chakravarthi, Srinivas P; Neelima Devi, K Naga; Sridhar, Meka S; Prasad, L Krishna

2014-01-01

Bone grafts are frequently used in the treatment of bone defects. Bone harvesting can cause postoperative complications and sometimes does not provide a sufficient quantity of bone. Therefore, synthetic biomaterials have been investigated as an alternative to autogenous bone grafts. The aim of this study was to evaluate and compare bovine derived hydroxyapatite (BHA) and synthetic hydroxyapatite (SHA) graft material as bone graft substitute in maxillary cystic bony defects. Patients were analyzed by computerized densitometric study and digital radiography. In this study, 12 patients in each group were included randomly after clinical and radiological evaluation. The integration of hydroxyapatite was assessed with mean bone density, surgical site margin, and radiological bone formation characteristics, of the successful graft cases using computer densitometry and radio-visiograph. Statistical analysis was carried out using Mann-Whitney U-test, Wilcoxon matched pairs test and paired t-test. By the end of 24 th week, the grafted defects radiologically and statistically showed similar volumes of bone formation. However, the significant changes observed in the formation of bone and merging of material and surgical site margin at 1 st week to 1 st month. The results were significant and correlating with all the parameters showing the necessity of the grafting for early bone formation. However, the bone formation pattern is different in both BHA and SHA group at 3 rd month interval with significant P value. Both BHA and SHA graft materials are biocompatible for filling bone defects, showing less resorption and enhanced bone formation with similar efficacy. Our study showed maximum bone healing within 12 weeks of grafting of defects. The BHA is economical; however, price difference between the two is very nominal.

Dietary supplements and medical foods for osteopenia and osteoporosis.

PubMed

Morgan, Sarah L

2013-01-01

Dietary supplements, medical foods, and pharmaceutical agents are all used in the management of metabolic bone disease. The intended populations, governing regulations, safety standards scientific requirements, physician supervision, and distribution vary markedly between supplements, medical foods, and drugs. This article will review characteristics of dietary supplements and medical foods and their use in osteoporosis care. A study that compares the pharmacokinetics of a supplement and a medical food containing similar ingredients is used to contrast the categories of dietary supplements and medical foods. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Development and validation of a tool for identifying women with low bone mineral density and low-impact fractures: the São Paulo Osteoporosis Risk Index (SAPORI).

PubMed

Pinheiro, M M; Reis Neto, E T; Machado, F S; Omura, F; Szejnfeld, J; Szejnfeld, V L

2012-04-01

The performance of the São Paulo Osteoporosis Risk Index (SAPORI) was tested in 1,915 women from the original cohort, São Paulo Osteoporosis Study (SAPOS) (N = 4332). This new tool was able to identify women with low bone density (spine and hip) and low-impact fracture, with an area under the receiving operator curve (ROC) of 0.831, 0.724, and 0.689, respectively. A number of studies have demonstrated the clinical relevance of risk factors for identifying individuals at risk of fracture (Fx) and osteoporosis (OP). The SAPOS is an epidemiological study for the assessment of risk factors for Fx and low bone density in women from the community of the metropolitan area of São Paulo, Brazil. The aim of the present study was to develop and validate a tool for identifying women at higher risk for OP and low-impact Fx. A total of 4,332 pre-, peri-, and postmenopausal women were analyzed through a questionnaire addressing risk factors for OP and Fx. All of them performed bone densitometry at the lumbar spine and proximal femur (DPX NT, GE-Lunar). Following the identification of the main risk factors for OP and Fx through multivariate and logistic regression, respectively, the SAPORI was designed and subsequently validated on a second cohort of 1,915 women from the metropolitan community of São Paulo. The performance of this tool was assessed through ROC analysis. The main and significant risk factors associated with low bone density and low-impact Fx were low body weight, advanced age, Caucasian ethnicity, family history of hip Fx, current smoking, and chronic use of glucocorticosteroids. Hormonal replacement therapy and regular physical activity in the previous year played a protective role (p < 0.05). After the statistical adjustments, the SAPORI was able to identify women with low bone density (T-score ≤ -2 standard deviations) in the femur, with 91.4% sensitivity, 52% specificity, and an area under the ROC of 0.831 (p < 0.001). At the lumbar spine, the performance was similar (81.5% sensitivity, 50% specificity, and area under ROC of 0.724; p < 0.001). Regarding the identification of low-impact Fx, the sensitivity was 71%, the specificity was 52%, and the area under the ROC was 0.689 (p < 0.001). The SAPORI is a simple, useful, fast, practice, and valid tool for identifying women at higher risk for low bone density and osteoporotic fractures.

Construction and validation of a population-based bone densitometry database.

PubMed

Leslie, William D; Caetano, Patricia A; Macwilliam, Leonard R; Finlayson, Gregory S

2005-01-01

Utilization of dual-energy X-ray absorptiometry (DXA) for the initial diagnostic assessment of osteoporosis and in monitoring treatment has risen dramatically in recent years. Population-based studies of the impact of DXA and osteoporosis remain challenging because of incomplete and fragmented test data that exist in most regions. Our aim was to create and assess completeness of a database of all clinical DXA services and test results for the province of Manitoba, Canada and to present descriptive data resulting from testing. A regionally based bone density program for the province of Manitoba, Canada was established in 1997. Subsequent DXA services were prospectively captured in a program database. This database was retrospectively populated with earlier DXA results dating back to 1990 (the year that the first DXA scanner was installed) by integrating multiple data sources. A random chart audit was performed to assess completeness and accuracy of this dataset. For comparison, testing rates determined from the DXA database were compared with physician administrative claims data. There was a high level of completeness of this database (>99%) and accurate personal identifier information sufficient for linkage with other health care administrative data (>99%). This contrasted with physician billing data that were found to be markedly incomplete. Descriptive data provide a profile of individuals receiving DXA and their test results. In conclusion, the Manitoba bone density database has great potential as a resource for clinical and health policy research because it is population based with a high level of completeness and accuracy.

[Interaction between fluorine and zinc after long-term oral administration into the digestive system of rats].

PubMed

Mazurek-Mochol, Małgorzata

2002-01-01

Drug interactions are the side effect of administration of two or more drugs or a drug-food combination. Although some drug interactions are intentional and beneficial to the patient, the majority are unintentional and associated with a potentially harmful effect. The aim of this study was to search for interactions in rats between fluoride and zinc administered orally for 12 weeks and to elucidate any potential toxicological and therapeutic consequences. 60 male Wistar rats were divided into six groups of ten rats each and exposed to: 1. controls (distilled water); 2. sodium fluoride (NaF); 3. low-dose zinc (Zn); 4. high-dose zinc; 5. NaF + low-dose Zn; 6. NaF + high-dose Zn. At the end of the experiment the content of F- and Zn+ in serum, urine, incisors, femur and mandible was measured and densitometry of femoral bones was performed. Serum alkaline phosphatase, alanine and aspartate aminotransferase activities, as well as bilirubin and creatinine concentrations were determined to confirm non-toxicity of fluoride dose. Animals receiving NaF only demonstrated higher content of fluorine in serum, urine bones and teeth. Zinc concentrations in serum, urine, bones and teeth were elevated in rats receiving zinc with or without NaF. Fluorine accumulation in bones and teeth was reduced by Zn, but in general the effect lacked statistical significance. Zinc slightly reduced the concentrations of fluorine in serum and urine. Sodium fluoride slightly reduced the concentration of zinc in serum and urine. Bone mineral content (BMC) was significantly increased by NaF and was not further increased by co-administration of zinc. No changes in serum alkaline phosphatase, alanine and aspartate aminotransferase activities, bilirubin and creatinine concentrations were detected. In conclusion, simultaneous administration of fluorine and zinc may be beneficial for prevention and treatment of pathologic conditions in bones and teeth and is not accompanied by an increase in fluorine levels which could be responsible for toxicological symptoms.

Feasibility of simultaneous computed tomographic colonography and fully automated bone mineral densitometry in a single examination.

PubMed

Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol

2011-01-01

To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.

Unilateral vs bilateral hip bone mineral density measurement for the diagnosis of osteoporosis.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Mukaiyama, Keijiro; Kato, Hiroyuki

2014-01-01

It has not been established whether unilateral or bilateral hip dual-energy X-ray absorptiometry (DXA) is preferable for the diagnosis of osteoporosis. We investigated the discordance in DXA measurements in bilateral hips to determine whether unilateral DXA is valid for osteoporosis diagnosis. The subjects were 2964 Japanese patients without a previous diagnosis of primary osteoporosis. We measured bilateral femoral bone mineral density (BMD) and calculated indices, related to the unilateral results, for predicting contralateral hip osteoporosis. A likelihood ratio (LR) of a negative test (LR [-]) of less than 0.2 was considered to exclude the diagnosis. In the normal spinal BMD group, the sensitivity of unilateral DXA for women was 27-73% and LR (-) was 0.28-0.73; the sensitivity for men was 0-50% and LR (-) was 0.51-1.00; the diagnosis of contralateral osteoporosis was not excluded. Sensitivity increased and LR (-) increased with worsening spinal BMD status; however, LR (-) did not meet the cutoff for exclusion. We could exclude unilateral hip osteoporosis, in women only, by performing contralateral femoral DXA; this necessitated lowering the T-score cutoff from -2.5 to -2.0. Unilateral femoral DXA is not useful for excluding the diagnosis of contralateral hip osteoporosis. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

PubMed

Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

2016-02-01

Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. Copyright © 2015. Published by Elsevier Inc.

Mutiple Spontaneous Rib Fractures in Patient with Cushing's Syndrome.

PubMed

Lee, Hyun Jung; Je, Ji Hye; Seo, Ji Hye; Na, Young Ju; Yoo, Hye Jin

2014-11-01

Glucocorticoid (GC) excess, including Cushing's syndrome, is a common cause of secondary osteoporosis. Thirty to fifty percent of Cushing's syndrome patients experience non-traumatic fractures, which is often the presenting manifestation of Cushing's syndrome. However, there have been rare cases of Cushing's syndrome diagnosed only based upon bone manifestations. We describe a case of Cushing's syndrome that was diagnosed in a 44-year-old woman who initially visited our hospital due to multiple non-traumatic rib fractures. She did not exhibit any other manifestations of Cushing's syndrome such as moon face, buffalo hump or abdominal striae. Initially, we evaluated her for bone metastases from a cancer of unknown origin, but there was no evidence of metastatic cancer. Instead, we found a left adrenal incidentaloma. As a result of the hormone study, she was diagnosed as having Cushing's syndrome. Interestingly, her bony manifestation of Cushing's syndrome, which was evident in the bone scan and bone mineral densitometry, completely recovered after a left adrenalectomy. Therefore, the possibility of Cushing's syndrome as a cause of secondary osteoporosis should be considered in young patients with non-traumatic multiple fractures, with or without any other typical features of Cushing's syndrome.

Life satisfaction and bone mineral density among postmenopausal women: cross-sectional and longitudinal associations.

PubMed

Rauma, Päivi H; Koivumaa-Honkanen, Heli; Williams, Lana J; Tuppurainen, Marjo T; Kröger, Heikki P; Honkanen, Risto J

2014-01-01

The purpose of this study was to determine whether and how global life satisfaction is associated with bone mineral density (BMD) and bone loss. A total of 2167 women from a cohort of Finnish women born in 1932 to 1941 were included in the cross-sectional and 1147 women in the 10-year longitudinal part of the present study. Participants responded to a postal enquiry and underwent femoral BMD densitometry in 1999 (baseline) and 2009 (follow-up). During the follow-up, their life satisfaction was repeatedly measured using a four-item scale. Self-reported data on health, life-style, and medication were used to adjust the multivariate linear regression models. Mean (standard deviation) femoral BMD decreased over the 10-year follow-up from 880 (125) to 846 (122) mg/cm. In the multivariate model, life satisfaction (p = .028) and its improvement (p = .001) predicted reduced bone loss, whereas hospitalization due to depression predicted increased bone loss (B = -0.523 annual % change, standard error = 0.212, p = .014). These effects were independent of each other. Easily assessed global life satisfaction should be taken into account when effects of aging and prevention of osteoporosis as well as health promotion in postmenopausal women are considered.

BIOCHEMICAL ANALYSIS AND BONE REMODELING IN RESPONSE TO OOPHORECTOMY AND AQUATIC TRAINING

PubMed Central

SOUZA, HELENA RIBEIRO; GIROL, ANA PAULA; SCHIAVETO, ADRIANA PAULA SANCHEZ; GEROMEL, MAIRTO ROBERIS; IYOMASA, MELINA MIZUSAKI; ARRUDA, MAURÍCIO FERRAZ DE

2016-01-01

ABSTRACT Objective: To investigate whether swimming could prevent bone loss and could be indicated to assist in treatment of osteoporosis. Methods: Female rats were divided into 4 groups (n=6), two of them were oophorectomized. Animals from two groups, one oophorectomized and another not oophorectomized, underwent aquatic training for eight weeks. After training, the animals were sacrificed and their blood was collected for calcium and alkaline phosphatase serum dosage; the femur was removed and subjected to radiological and histological densitometry analysis to assess bone loss and osteoclast counting on femoral head and neck. Results: Increase in serum calcium was not observed. There was an increasing activity of alkaline phosphatase in the oophorectomized groups. The radiographs suggest that there was a greater bone mass density in the trained groups. Concerning histology, the trained groups had better tissue structural organization than the sedentary groups. In the oophorectomized and sedentary group, higher presence of osteoclasts was observed a. Conclusion: Exercise and oophorectomy did not promote changes in serum calcium levels. The decrease of sex steroids caused by oophorectomy was responsible for severe bone loss, but swimming exercise was able to reduce this loss. Oophorectomy promoted the proliferation of osteoclasts and the exercise proved to be able to diminish it. Level of Evidence I, Experimental Study. PMID:28149187

Official Positions for FRAX® clinical regarding rheumatoid arthritis from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Broy, Susan B; Tanner, S Bobo

2011-01-01

Rheumatoid arthritis is the only secondary cause of osteoporosis that is considered independent of bone density in the FRAX(®) algorithm. Although input for rheumatoid arthritis in FRAX(®) is a dichotomous variable, intuitively, one would expect that more severe or active disease would be associated with a greater risk for fracture. We reviewed the literature to determine if specific disease parameters or medication use could be used to better characterize fracture risk in individuals with rheumatoid arthritis. Although many studies document a correlation between various parameters of disease activity or severity and decreased bone density, fewer have associated these variables with fracture risk. We reviewed these studies in detail and concluded that disability measures such as HAQ (Health Assessment Questionnaire) and functional class do correlate with clinical fractures but not morphometric vertebral fractures. One large study found a strong correlation with duration of disease and fracture risk but additional studies are needed to confirm this. There was little evidence to correlate other measures of disease such as DAS (disease activity score), VAS (visual analogue scale), acute phase reactants, use of non-glucocorticoid medications and increased fracture risk. We concluded that FRAX(®) calculations may underestimate fracture probability in patients with impaired functional status from rheumatoid arthritis but that this could not be quantified at this time. At this time, other disease measures cannot be used for fracture prediction. However only a few, mostly small studies addressed other disease parameters and further research is needed. Additional questions for future research are suggested. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Effect of Positioning of the ROI on BMD of the Forearm and Its Subregions.

PubMed

Rosen, Elizabeth O; McNamara, Elizabeth A; Whittaker, LaTarsha G; Malabanan, Alan O; Rosen, Harold N

2018-03-21

Inconsistent positioning of patients and region of interest (ROI) is known to influence the precision of bone mineral density (BMD) measurements in the spine and hip. However, it is unknown whether minor shifts in the positioning of the ROI along the shaft of the radius affect the measurement of forearm BMD and its subregions. The ultradistal (UD-), mid-, one-third, and total radius BMDs of 50 consecutive clinical densitometry patients were acquired. At baseline the distal end of the ROI was placed at the tip of the ulnar styloid as usual, and then the forearm was reanalyzed 10 more times, each time shifting the ROI 1 mm proximally. No corrections for multiple comparisons were necessary since the differences that were significant were significant at p < 0.001. The UD-radius BMD increased as the ROI was shifted proximally; the increase was significant when shifted even 1 mm proximally (p < 0.001). These same findings held true for the mid- and total radius bone density, though the percent increase with moving proximally was significantly greater for the UD radius than for the other subregions. However, there was no significant change in the one-third radius BMD when shifted proximally 1-10 mm. Minor proximal shifts of the forearm ROI substantially affect the BMD of the UD-, mid- and total radius, while having no effect on the one-third radius BMD. Since the one-third radius is the only forearm region usually reported, minor proximal shifts of the ROI should not influence forearm BMD results significantly. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Partial hypopituitarism and Langerhans cell histiocytosis

PubMed Central

Balaguruswamy, S; Chattington, P D

2011-01-01

A case of multisystem Langerhans cell histiocytosis with pituitary involvement nearly 20 years after initial presentation. A 48-year-old man had histiocytosis X 22 years ago initially involving the groin; subsequently his external auditory meatus, scalp, gum, mandibular bone, perineum and axilla were involved and treated. The pituitary gland was involved 4 years ago. A thyrotropin-releasing hormone test showed delayed response suggestive of hypothalamic disease. Prolactin levels were normal. A gonadotropin-releasing hormone test showed impaired testosterone and gonadotrophin response in keeping with pituitary disease. A glucagon stimulation test showed an impaired growth hormone response but a normal cortisol increase. MRI pituitary showed an empty sella. There was no evidence of diabetes insipidus. Bone mineral densitometry was normal. He has partial hypopituitarism needing thyroxine and testosterone replacement. He also developed type 2 diabetes mellitus 9 years ago. He is closely monitored for any development of diabetes insipidus and the need for growth hormone supplementation. PMID:22715201

Analysis of correlation between initial alveolar bone density and apical root resorption after 12 months of orthodontic treatment without extraction

PubMed Central

Scheibel, Paula Cabrini; Ramos, Adilson Luiz; Iwaki, Lilian Cristina Vessoni; Micheletti, Kelly Regina

2014-01-01

OBJECTIVE: The aim of the present study was to investigate the correlation between initial alveolar bone density of upper central incisors (ABD-UI) and external apical root resorption (EARR) after 12 months of orthodontic movement in cases without extraction. METHODS: A total of 47 orthodontic patients 11 years old or older were submitted to periapical radiography of upper incisors prior to treatment (T1) and after 12 months of treatment (T2). ABD-UI and EARR were measured by means of densitometry. RESULTS: No statistically significant correlation was found between initial ABD-UI and EARR at T2 (r = 0.149; p = 0.157). CONCLUSION: Based on the present findings, alveolar density assessed through periapical radiography is not predictive of root resorption after 12 months of orthodontic treatment in cases without extraction. PMID:25715722

High prevalence of morphometric vertebral deformities in patients with inflammatory bowel disease.

PubMed

Heijckmann, Anna Caroline; Huijberts, Maya S P; Schoon, Erik J; Geusens, Piet; de Vries, Jolanda; Menheere, Paul P C A; van der Veer, Eveline; Wolffenbuttel, Bruce H R; Stockbrugger, Reinhold W; Dumitrescu, Bianca; Nieuwenhuijzen Kruseman, Arie C

2008-08-01

Earlier studies have documented that the prevalence of decreased bone mineral density (BMD) is elevated in patients with inflammatory bowel disease. The objective of this study was to investigate the prevalence of vertebral deformities in inflammatory bowel disease patients and their relation with BMD and bone turnover. One hundred and nine patients with Crohn's disease (CD) and 72 with ulcerative colitis (UC) (age 44.5+/-14.2 years) were studied. BMD of the hip (by dual X-ray absorptiometry) was measured and a lateral single energy densitometry of the spine for assessment of vertebral deformities was performed. Serum markers of bone resorption (carboxy-terminal cross-linked telopeptide of type I collagen) and formation (procollagen type I amino-terminal propeptide) were measured, and determinants of prevalent vertebral deformities were assessed using logistic regression analysis. Vertebral deformities were found in 25% of both CD and UC patients. Comparing patients with and without vertebral deformities, no significant difference was found between Z-scores and T-scores of BMD, or levels of serum carboxy-terminal cross-linked telopeptide of type I collagen and serum procollagen type I amino-terminal propeptide. Using logistic regression analysis the only determinant of any morphometric vertebral deformity was sex. The presence of multiple vertebral deformities was associated with older age and glucocorticoid use. The prevalence of morphometric vertebral deformities is high in CD and UC. Male sex, but neither disease activity, bone turnover markers, clinical risk factors, nor BMD predicted their presence. The determinants for having more than one vertebral deformity were age and glucocorticoid use. This implies that in addition to screening for low BMD, morphometric assessment of vertebral deformities is warranted in CD and UC.

Enhanced Precision of the New Hologic Horizon Model Compared With the Old Discovery Model Is Less Evident When Fewer Vertebrae Are Included in the Analysis.

PubMed

McNamara, Elizabeth A; Kilim, Holly P; Malabanan, Alan O; Whittaker, LaTarsha G; Rosen, Harold N

The International Society for Clinical Densitometry guidelines recommend using locally derived precision data for spine bone mineral densities (BMDs), but do not specify whether data derived from L1-L4 spines correctly reflect the precision for spines reporting fewer than 4 vertebrae. Our experience suggested that the decrease in precision with successively fewer vertebrae is progressive as more vertebrae are excluded and that the precision for the newer Horizon Hologic model might be better than that for the previous model, and we sought to quantify. Precision studies were performed on Hologic densitometers by acquiring spine BMD in fast array mode twice on 30 patients, according to International Society for Clinical Densitometry guidelines. This was done 10 different times on various Discovery densitometers, and once on a Horizon densitometer. When 1 vertebral body was excluded from analysis, there was no significant deterioration in precision. When 2 vertebrae were excluded, there was a nonsignificant trend to poorer precision, and when 3 vertebrae were excluded, there was significantly worse precision. When 3 or 4 vertebrae were reported, the precision of the spine BMD measurement was significantly better on the Hologic Horizon than on the Discovery, but the difference in precision between densitometers narrowed and was no longer significant when 1 or 2 vertebrae were reported. The results suggest that (1) the measurement of in vivo spine BMD on the new Hologic Horizon densitometer is significantly more precise than on the older Discovery model; (2) the difference in precision between the Horizon and Discovery models decreases as fewer vertebrae are included; (3) the measurement of spine BMD is less precise as more vertebrae are excluded, but still quite reasonable even when only 1 vertebral body is included; and (4) when 3 vertebrae are reported, L1-L4 precision data can reasonably be used to report significance of changes in BMD. When 1 or 2 vertebrae are reported, precision data for 1 or 2 vertebrae, respectively, should be used, because the exclusion of 2-3 vertebrae significantly worsens precision. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

A case of pathological rib fractures: focal osteolysis or osteoporosis?

PubMed

Vrbanić, T S L; Novak, S; Sestan, B; Tudor, A; Gulan, G

2008-03-01

This paper reports on a unique, previously unreported, successful outcome in the case of a patient with focal osteolytic lesions of the ribs as a first sign of osteoporosis. The lesions were detected by chance after acute cough-induced rib fractures were seen on plain chest radiographs. The diagnosis had to be approached as a diagnosis of exclusion since known causes of the osteolytic process had to be eliminated. The authors describe multiple focal osteolytic lesions with rib fractures appearing in a pattern that could be confused with metastases. Laboratory results were normal. Final diagnosis was based on plain radiography, bone scan and bone densitometry. Pharmacomedical treatments for osteoporosis were applied. The patient was observed between the year 2000 and 2005. Five years later radiological and bone scintigraphy revealed resolution of the lesion. We conclude that osteoporosis should be included in the differential diagnosis of asymptomatic focal osteolysis of the ribs with rib fractures as a complication of acute cough. The case suggests that focal osteolytic lesions of the ribs may regress over time and become scintigraphically inactive.

The soy isoflavones for reducing bone loss study: 3-yr effects on pQCT bone mineral density and strength measures in postmenopausal women.

PubMed

Shedd-Wise, Kristine M; Alekel, D Lee; Hofmann, Heike; Hanson, Kathy B; Schiferl, Dan J; Hanson, Laura N; Van Loan, Marta D

2011-01-01

Soy isoflavones exert inconsistent bone density-preserving effects, but the bone strength-preserving effects in humans are unknown. Our double-blind randomized controlled trial examined 2 soy isoflavone doses (80 or 120mg/d) vs placebo tablets on volumetric bone mineral density (vBMD) and strength (by means of peripheral quantitative computed tomography) in healthy postmenopausal women (46-63yr). We measured 3-yr changes in cortical BMD (CtBMD), cortical thickness (CtThk), periosteal circumference (PC), endosteal circumference (EC), and strength-strain index (SSI) at 1/3 midshaft femur (N=171), and trabecular BMD (TbBMD), PC, and SSI at 4% distal tibia (N=162). We found no treatment effect on femur CtThk, PC, or EC, or tibia TbBMD or PC. The strongest predictors (negative) of tibia TbBMD and SSI and femur CtBMD were timepoint and bone resorption; whole-body fat mass was protective of SSI. As time since last menstrual period (TLMP) increased (p=0.012), 120-mg/d dose was protective of CtBMD. The strongest predictors of femur SSI were timepoint, bone resorption, and TLMP (protective). Isoflavone tablets were negative predictors of SSI, but 80-mg/d dose became protective as bone turnover increased (p=0.011). Soy isoflavone treatment for 3yr was modestly beneficial for midshaft femur vBMD as TLMP increased and for midshaft femur SSI as bone turnover increased. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Bisphosphonate effects in rat unloaded hindlimb bone loss model: three-dimensional microcomputed tomographic, histomorphometric, and densitometric analyses.

PubMed

Barou, O; Lafage-Proust, M H; Martel, C; Thomas, T; Tirode, F; Laroche, N; Barbier, A; Alexandre, C; Vico, L

1999-10-01

The effects of antiresorptive drugs on bone loss remain unclear. Using three-dimensional microtomography, dual X-ray/densitometry, and histomorphometry, we evaluated tiludronate effects in the bone loss model of immobilization in tail-suspended rats after 7, 13, and 23 days. Seventy-eight 12-week-old Wistar male rats were assigned to 13 groups: 1 baseline group, and for each time point, 1 control group treated with vehicle and three tail-suspended groups treated with either tiludronate (0.5 or 5 mg/kg) or vehicle, administered s. c. every other day, during the last week before sacrifice. In primary spongiosa (ISP), immobilization-induced bone loss plateaued after day 7 and was prevented by tiludronate. In secondary spongiosa (IISP), bone loss appeared at day 13 with a decrease in trabecular thickness and trabecular number (Tb.N) as assessed by three-dimensional microtomography. Osteoclastic parameters did not differ in tail-suspended rats versus control rats, whereas bone formation showed a biphasic pattern: after a marked decrease at day 7, osteoblastic activity and recruitment normalized at days 13 and 23, respectively. At day 23, the 80% decrease in bone mass was fully prevented by high-dose tiludronate with an increase in Tb.N without preventing trabecular thinning. In summary, at day 7, tiludronate prevented bone loss in ISP. After day 13, tiludronate prevented bone loss in ISP and IISP despite a further decrease in bone formation. Thus, the preventive effects of tiludronate in this model may be related to the alteration in bone modeling with an increase in Tb.N in ISP and subsequently in IISP.

Collection of wood quality data by X-ray densitometry: a case study with three southern pines

Treesearch

Thomas L. Eberhardt; Lisa J. Samuelson

2015-01-01

X-ray densitometry is a technique often used in tree growth and wood quality studies to incrementally measure density (specific gravity) along a radial strip of wood. Protocols for this technique vary between laboratories because of differences in species, equipment, tree age, and other factors. Here, the application of X-ray densitometry is discussed in terms of a...

Social determinants of bone densitometry uptake for osteoporosis risk in patients aged 50yr and older: a systematic review.

PubMed

Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A

2012-01-01

The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between CT densitometry with a slice thickness of 0.5 mm and audiometry in otosclerosis.

PubMed

Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo

2006-06-01

The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.

The Factors Affecting Bone Density in Cirrhosis

PubMed Central

Hajiabbasi, Asghar; Shafaghi, Afshin; Fayazi, Haniyeh Sadat; Shenavar Masooleh, Irandokht; Hedayati Emami, Mohammad Hassan; Ghavidel Parsa, Pooneh; Amir Maafi, Alireza

2015-01-01

Background: Bone loss is common in cirrhosis. However, the prevalence of osteopenia and osteoporosis has been heterogeneous in different reports. Reduction in bone formation with or without increase in bone resorption appears to be responsible for bone loss in these patients. Objectives: We aimed to investigate bone loss in patients with cirrhosis at different anatomical sites and key factors that might affect it. Patients and Methods: In this cross-sectional study, 97 patients with cirrhosis who were referred to Razi Hospital, Rasht, Iran, from 2008 to 2010, were studied. Cirrhosis was diagnosed using biopsy and/or clinical and paraclinical findings. Bone mineral densitometry was done in L2 through L4 lumbar spine (LS) and femoral neck (FN), using dual-energy X-ray absorptiometry (DEXA) (QDR 1000, Hologic DEXA Inc, Waltham, Massachusetts, the United States). Statistical analysis was performed using SPSS 18. A P value < 0.05 was considered statistically significant. Results: A total of 97 patients with cirrhosis (55.7% male) and the mean age of 51 ± 13 years and median body mass index (BMI) of 22.7 kg/m2 were recruited over a two-year period. Etiologies of cirrhosis were hepatitis C (40.2%), hepatitis B (26.8%), cryptogenic (21.6%), and other causes (11.4%). Child A, B, and C, were seen in 16.5%, 47.4%, and 36.1% of patients, respectively. The DEXA results were abnormal in 78.4% of our participants (osteopenia, 45.4%; osteoporosis, 33%). BMI and calculated glomerular filtration rate (GFRc) had moderate positive and Child score had moderate negative significant correlation with T score in both anatomical sites. There was no significant association between abnormal DEXA and the causes of cirrhosis. The univariate analysis showed that the risk of abnormal results in DEXA was significantly higher in those with low BMI, current smoking, higher Child score, and low GFRc; however, in multivariate analysis, the abnormal results were more frequent in those with lower vitamin D, higher Child score, and less GFRc. Conclusions: Abnormal DEXA was highly prevalent among patients with cirrhosis. The risk of this finding was increased by lower vitamin D levels, advanced disease, and impaired renal function. PMID:25977695

Osteoporosis/osteopenia as an independent factor associated with periodontitis in postmenopausal women: a case-control study.

PubMed

Passos, J S; Vianna, M I P; Gomes-Filho, I S; Cruz, S S; Barreto, M L; Adan, L; Rösing, C K; Cerqueira, E M M; Trindade, S C; Coelho, J M F

2013-04-01

This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women. The findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth, showing that osteoporosis/osteopenia has had an influence on the progression of periodontitis. This study investigated whether osteoporosis/osteopenia has an influence on the progression of periodontitis in postmenopausal women and explored the effects of use of osteoporosis medication and tooth loss on this association. This case-control study involved 521 postmenopausal women, with minimum age of 50 years, in Feira de Santana, Bahia, Brazil. Sociodemographic characteristics, health conditions/medications, and lifestyle habits were recorded. A complete periodontal examination was performed and periodontitis was diagnosed. Bone mineral density was evaluated through lumbar spine and femoral bone densitometry, obtained using dual-energy X-ray absorptiometry. Logistic regression was used to calculate the strength of association between the occurrences of osteoporosis/osteopenia and periodontitis. Women with osteoporosis/osteopenia were twice as likely to present periodontitis, as were those with normal bone mineral density, even after adjusting for smoking, age, family income, and last visit to dentist (odds ratios (OR)adjusted=2.24, 95% CI [1.24-4.06], p=0.008). Among nonusers of osteoporosis medication (ORadjusted=2.51, 95% CI [1.33-4.73], p=0.004) and women with at least 10 remaining teeth (ORadjusted=2.50 95% CI [1.18-5.27], p=0.02), the odds ratio was higher and statistically significant. These findings highlight that postmenopausal women with osteoporosis/osteopenia had a greater chance of presenting periodontitis than those with normal bone mineral density, particularly among nonusers of osteoporosis medications and women with a greater number of remaining teeth.

Lean mass and fat mass have differing associations with bone microarchitecture assessed by high resolution peripheral quantitative computed tomography in men and women from the Hertfordshire Cohort Study.

PubMed

Edwards, Mark H; Ward, Kate A; Ntani, Georgia; Parsons, Camille; Thompson, Jennifer; Sayer, Avan A; Dennison, Elaine M; Cooper, Cyrus

2015-12-01

Understanding the effects of muscle and fat on bone is increasingly important in the optimisation of bone health. We explored relationships between bone microarchitecture and body composition in older men and women from the Hertfordshire Cohort Study. 175 men and 167 women aged 72-81 years were studied. High resolution peripheral quantitative computed tomography (HRpQCT) images (voxel size 82 μm) were acquired from the non-dominant distal radius and tibia with a Scanco XtremeCT scanner. Standard morphological analysis was performed for assessment of macrostructure, densitometry, cortical porosity and trabecular microarchitecture. Body composition was assessed using dual energy X-ray absorptiometry (DXA) (Lunar Prodigy Advanced). Lean mass index (LMI) was calculated as lean mass divided by height squared and fat mass index (FMI) as fat mass divided by height squared. The mean (standard deviation) age in men and women was 76 (3) years. In univariate analyses, tibial cortical area (p<0.01), cortical thickness (p<0.05) and trabecular number (p<0.01) were positively associated with LMI and FMI in both men and women. After mutual adjustment, relationships between cortical area and thickness were only maintained with LMI [tibial cortical area, β (95% confidence interval (CI)): men 6.99 (3.97,10.01), women 3.59 (1.81,5.38)] whereas trabecular number and density were associated with FMI. Interactions by sex were found, including for the relationships of LMI with cortical area and FMI with trabecular area in both the radius and tibia (p<0.05). In conclusion, LMI and FMI appeared to show independent relationships with bone microarchitecture. Further studies are required to confirm the direction of causality and explore the mechanisms underlying these tissue-specific associations. Copyright © 2015 Elsevier Inc. All rights reserved.

Physical activity and dark skin tone: protective factors against low bone mass in Mexican men.

PubMed

Vivanco-Muñoz, Nalleli; Jo, Talavera; Gerardo, Huitron-Bravo; Juan, Tamayo; Clark, Patricia

2012-01-01

A cross-sectional study was conducted on 268 Mexican men between the ages of 13 and 80 yr to evaluate the association of clinical factors related with bone mass. Men from high schools, universities, and retirement homes were invited to participate. Body mass index (BMI) was measured, and bone mineral density (BMD) was assessed using dual-energy X-ray absorptiometry for L1-L4 and total hip. Factors related to bone mass were assessed by questionnaire and analyzed using a logistic regression model. Demographic factors (age, education, and occupation), clinical data (BMI, skin tone, previous fracture, history of osteoporosis [OP], and history of fractures), and lifestyle variables (diet, physical activity, sun exposure, and smoking) were evaluated. Physical activity (≥ 60 min/5 times a week) reduced the risk for low BMD for age, osteopenia, and OP at the spine and total hip (odds ratio [OR]: 0.276; 95% confidence interval [CI]: 0.099-0.769; p=0.014; and OR: 0.184; 95% CI: 0.04-0.849; p=0.03, respectively). Dark skin tone was a protective factor, decreasing the risk by up to 70%. In this population of healthy Mexican men (aged 13-80 yr), dark skin and physical activity were protective factors against low bone mass. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Work- and travel-related physical activity and alcohol consumption: relationship with bone mineral density and calcaneal quantitative ultrasonometry.

PubMed

Sritara, Chanika; Thakkinstian, Ammarin; Ongphiphadhanakul, Boonsong; Pornsuriyasak, Prapaporn; Warodomwichit, Daruneewan; Akrawichien, Tawatchai; Vathesatogkit, Prin; Sritara, Piyamitr

2015-01-01

A number of healthy workers rarely exercise because of a lack of time or resources. Physical activity related to work and everyday travel may be more feasible, but evidence of its beneficial effect on bone health is scarce. We assessed if this form of physical activity was associated with higher bone mineral density (BMD) and stiffness index (SI) when adjusted for recreational physical activity, age, body mass index, smoking, alcohol consumption, education, and serum level of 25-hydroxyvitamin D. Healthy workers, aged 25-54 yr, of the Electricity Generating Authority of Thailand were surveyed. The outcomes were BMD (lumbar spine, femoral neck, and total hip) and calcaneal SI. Physical activity was estimated using the global physical activity questionnaire and considered active when >600 metabolic equivalent tasks (min). Of 2268 subjects, 74% were men. Active male subjects had significantly higher BMD at the femoral neck and total hip (p<0.005). However, the association was not significant with male lumbar spine BMD, male SI, or any bone parameters in women (p>0.05). In men, work and travel physical activity seems beneficial to male bone health; hence, it should be encouraged. Furthermore, smoking appeared harmful while moderate alcohol consumption was beneficial. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

A comparison of peripheral imaging technologies for bone and muscle quantification: a technical review of image acquisition

PubMed Central

Wong, A.K.O.

2016-01-01

The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses. PMID:27973379

A comparison of peripheral imaging technologies for bone and muscle quantification: a technical review of image acquisition.

PubMed

Wong, A K

2016-12-14

The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses.

A DXA Whole Body Composition Cross-Calibration Experience: Evaluation With Humans, Spine, and Whole Body Phantoms.

PubMed

Krueger, Diane; Libber, Jessie; Sanfilippo, Jennifer; Yu, Hui Jing; Horvath, Blaine; Miller, Colin G; Binkley, Neil

2016-01-01

New densitometer installation requires cross-calibration for accurate longitudinal assessment. When replacing a unit with the same model, the International Society for Clinical Densitometry recommends cross-calibrating by scanning phantoms 10 times on each instrument and states that spine bone mineral density (BMD) should be within 1%, whereas total body lean, fat, and %fat mass should be within 2% of the prior instrument. However, there is limited validation that these recommendations provide adequate total body cross-calibration. Here, we report a total body cross-calibration experience with phantoms and humans. Cross-calibration between an existing and new Lunar iDXA was performed using 3 encapsulated spine phantoms (GE [GE Lunar, Madison, WI], BioClinica [BioClinica Inc, Princeton, NJ], and Hologic [Hologic Inc, Bedford, MA]), 1 total body composition phantom (BioClinica), and 30 human volunteers. Thirty scans of each phantom and a total body scan of human volunteers were obtained on each instrument. All spine phantom BMD means were similar (within 1%; <-0.010 g/cm2 bias) between the existing and new dual-energy X-ray absorptiometry unit. The BioClinica body composition phantom (BBCP) BMD and bone mineral content (BMC) values were within 2% with biases of 0.005 g/cm2 and -3.4 g. However, lean and fat mass and %fat differed by 4.6%-7.7% with biases of +463 g, -496 g, and -2.8%, respectively. In vivo comparison supported BBCP data; BMD and BMC were within ∼2%, but lean and fat mass and %fat differed from 1.6% to 4.9% with biases of +833 g, -860 g, and -1.1%. As all body composition comparisons exceeded the recommended 2%, the new densitometer was recalibrated. After recalibration, in vivo bias was lower (<0.05%) for lean and fat; -23 and -5 g, respectively. Similarly, BBCP lean and fat agreement improved. In conclusion, the BBCP behaves similarly, but not identical, to human in vivo measurements for densitometer cross-calibration. Spine phantoms, despite good BMD and BMC agreement, did not detect substantial lean and fat differences observed using BBCP and in vivo assessments. Consequently, spine phantoms are inadequate for dual-energy X-ray absorptiometry whole body composition cross-calibration. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Lead exposure is a risk for worsening bone mineral density in middle-aged male workers.

PubMed

Akbal, Ayla; Tutkun, Engin; Yılmaz, Hınç

2014-09-01

Lead exposure linked to osteoporosis in women. However, there is no direct evidence whether lead exposure has effects on bone metabolism in middle-aged male subjects. Therefore, the present study investigated the relationship between bone mineral densitometry measurements, bone markers, endocrine hormones and blood lead levels. The present study included lead exposure patients (n: 30) and control subjects (n: 32). We recorded information on patient demographics and risk factors of osteoporosis. Blood lead levels were evaluated using Varian AA 240Z atomic absorption spectrophotometry. Bone mineral density measurements were measured using dual-energy X-ray absorptiometry. Each lumbar T and Z scores in the lead exposure group were lower than the control group. There were no significant differences in femur neck and femur total T and Z scores between two groups. Blood lead levels were also negatively correlated with lumbar 2-4 T score, total lumbar T score, lumbar 2-4 Z score and total lumbar Z score. Urinary hydroxyproline and urinary deoxypyridinoline levels in the lead exposure group were significantly higher compared to controls. Blood lead levels were strong, positively correlated with urinary deoxypyridinoline. Endocrine hormone levels and 1,25-dihydroxy-vitamin D3 levels were comparable between lead exposure and control group. Lead exposure in male workers is an important factor for deterioration in bone mineral density. We should be screening blood lead levels and history of lead exposure in male osteoporosis.

Comparison of the relationship between bone marrow adipose tissue and volumetric bone mineral density in children and adults.

PubMed

Shen, Wei; Velasquez, Gilbert; Chen, Jun; Jin, Ye; Heymsfield, Steven B; Gallagher, Dympna; Pi-Sunyer, F Xavier

2014-01-01

Several large-scale studies have reported the presence of an inverse relationship between bone mineral density (BMD) and bone marrow adipose tissue (BMAT) in adults. We aim to determine if there is an inverse relationship between pelvic volumetric BMD (vBMD) and pelvic BMAT in children and to compare this relationship in children and adults. Pelvic BMAT and bone volume (BV) was evaluated in 181 healthy children (5-17yr) and 495 healthy adults (≥18yr) with whole-body magnetic resonance imaging (MRI). Pelvic vBMD was calculated using whole-body dual-energy X-ray absorptiometry to measure pelvic bone mineral content and MRI-measured BV. An inverse correlation was found between pelvic BMAT and pelvic vBMD in both children (r=-0.374, p<0.001) and adults (r=-0.650, p<0.001). In regression analysis with pelvic vBMD as the dependent variable and BMAT as the independent variable, being a child or adult neither significantly contribute to the pelvic BMD (p=0.995) nor did its interaction with pelvic BMAT (p=0.415). The inverse relationship observed between pelvic vBMD and pelvic BMAT in children extends previous findings that found the inverse relationship to exist in adults and provides further support for a reciprocal relationship between adipocytes and osteoblasts. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Impact of Weight Loss With Intragastric Balloon on Bone Density and Microstructure in Obese Adults.

PubMed

Madeira, Eduardo; Madeira, Miguel; Guedes, Erika Paniago; Mafort, Thiago Thomaz; Moreira, Rodrigo Oliveira; de Mendonça, Laura Maria Carvalho; Lima, Inayá Correa Barbosa; Neto, Leonardo Vieira; de Pinho, Paulo Roberto Alves; Lopes, Agnaldo José; Farias, Maria Lucia Fleiuss

2018-03-21

The historical concept that obesity protects against bone fractures has been questioned. Weight loss appears to reduce bone mineral density (BMD); however, the results in young adults are inconsistent, and data on the effects of weight loss on bone microstructure are limited. This study aimed to evaluate the impact of weight loss using an intragastric balloon (IGB) on bone density and microstructure. Forty obese patients with metabolic syndrome (mean age 35.1 ± 7.3 yr) used an IGB continuously for 6 mo. Laboratory tests, areal BMD, and body composition measurements via dual-energy X-ray absorptiometry, and volumetric BMD and bone microstructure measurements via high-resolution peripheral quantitative computed tomography were conducted before IGB placement and after IGB removal. The mean weight loss was 11.5%. After 6 mo, there were significant increases in vitamin D and carboxyterminal telopeptide of type 1 collagen levels. After IGB use, areal BMD increased in the spine but decreased in the total femur and the 33% radius. Cortical BMD increased in the distal radius but tended to decrease in the distal tibia. The observed trabecular bone loss in the distal tibia contributed to the decline in the total volumetric BMD at this site. There was a negative correlation between the changes in leptin levels and the measures of trabecular quality in the tibia on high-resolution peripheral quantitative computed tomography. Weight loss may negatively impact bone microstructure in young patients, especially for weight-bearing bones, in which obesity has a more prominent effect. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Infant milk feeding influences adult bone health: a prospective study from birth to 32 years.

PubMed

Pirilä, Satu; Taskinen, Mervi; Viljakainen, Heli; Kajosaari, Merja; Turanlahti, Maila; Saarinen-Pihkala, Ulla M; Mäkitie, Outi

2011-04-27

Peak bone mass, attained by early adulthood, is influenced by genetic and life-style factors. Early infant feeding and duration of breastfeeding in particular, associate with several health-related parameters in childhood. The aim of this study was to examine whether the effects of early infant feeding extend to peak bone mass and other bone health characteristics at adult age. A cohort of 158 adults (76 males) born in Helsinki, Finland, 1975, prospectively followed up from birth, underwent physical examination and bone densitometry to study bone area, bone mineral content (BMC), and bone mineral density (BMD) at 32 years of age. Life-style factors relevant for bone health were recorded. For data analysis the cohort was divided into three equal-size groups according to the total duration of breastfeeding (BF): Short (≤3 months), Intermediate and Prolonged (≥7 months) BF groups. In males short BF is associated with higher bone area, BMC, and BMD compared to longer BF. Males in the Short BF group had on average 4.7% higher whole body BMD than males in the Prolonged BF group. In multivariate analysis, after controlling for multiple confounding factors, the influence of BF duration on adult bone characteristics persisted in males. Differences between the three feeding groups were observed in lumbar spine bone area and BMC, and whole body BMD (MANCOVA; p = 0.025, p = 0.013, and p = 0.048, respectively), favoring the Short BF group. In women no differences were observed. In men, early infant milk feeding may have a significant impact on adult bone health. A potential explanation is that the calcium and phosphate contents were strikingly higher in formula milk and commercial cow milk/cow milk dilutions as opposed to human milk. Our novel finding merits further studies to determine means to ensure optimal bone mass development in infants with prolonged breastfeeding.

First impressions of cardiovascular calcification treatment in hemodialysis patients with a new dialysis fluid containing sodium thiosulphate (STS).

PubMed

Yonova, Diana H; Vazelov, Evgueniy S; Trendafilov, Ivan I; Stoinova, Veselka V; Nedevska, Mariya T; Antonov, Simeon A

2014-04-01

Cardiovascular calcification (CVC) in hemodialysis patients (HDP) causes cardiovascular pathology. Up until now very few drugs and therapeutic interventions have been able to reduce cardiovascular calcium deposits in hemodialysis patients and the process requires more than a year. Our idea in this study was to test 2 calcium binders--sodium thiosulfate (STS) and dinatrium ethylene diamine tetraacetic acid (DNEDTA)--for prevention and treatment of cardiovascular calcification of hemodialysis patients, using both substances not as an intravenous infusion but by adding them to the liquid bicarbonate part of the dialysis fluid. 6 HDPs were treated with sodium thiosulphate (STS), 6 with dinatrium ethylene diamine tetraacetic acid (DNEDTA), and 6 patients served as controls. Electrolytes, liver function, markers of inflammation, oxidative stress, bone metabolism, spiral computed tomography (SCT) of coronary CVC and bone densitometry were performed twice (start and end of the study). Starting blood parameters were similar to the end (STS group). No toxic or side effects from STS were observed. Initially in the DNEDTA group all the patients had vomiting so we excluded DNEDTA from the study. SCT found a significant reduction of calcification in 4 patients (STS group) and retardation in 2 patients comparatively to controls. The first results are hopeful, but the number of the patients was small, so we are enlarging the enrollment in the expectation of corroborating our results soon.

Associated Factors of Bone Mineral Density and Osteoporosis in Elderly Males

PubMed Central

Heidari, Behzad; Muhammadi, Abdollah; Javadian, Yahya; Bijani, Ali; Hosseini, Reza; Babaei, Mansour

2016-01-01

Background Low bone mineral density and osteoporosis is prevalent in elderly subjects. This study aimed to determine the associated factors of bone mineral density and osteoporosis in elderly males. Methods All participants of the Amirkola health and ageing project cohort aged 60 years and older entered the study. Bone mineral density at femoral neck and lumbar spine was assessed by the dual energy X-ray absorptiometry (DXA) method. Osteoporosis was diagnosed by the international society for clinical densitometry criteria and the association of bone mineral density and osteoporosis with several clinical, demographic and biochemical parameters. Multiple logistic regression analysis was used to determine independent associations. Results A total of 553 patients were studied and 90 patients (16.2%) had osteoporosis at either femoral neck or lumbar spine. Diabetes, obesity, metabolic syndrome, overweight, and quadriceps muscle strength > 30 kg, metabolic syndrome, abdominal obesity and education level were associated with higher bone mineral density and lower prevalence of osteoporosis, whereas age, anemia, inhaled corticosteroids and fracture history were associated with lower bone mineral density and higher prevalence of osteoporosis (P = 0.001). After adjustment for all covariates, osteoporosis was negatively associated only with diabetes, obesity, overweight, and QMS > 30 kg and positively associated with anemia and fracture history. The association of osteoporosis with other parameters did not reach a statistical level. Conclusions The findings of the study indicate that in elderly males, diabetes, obesity and higher muscle strength was associated with lower prevalence of osteoporosis and anemia, and prior fracture with higher risk of osteoporosis. This issue needs further longitudinal studies. PMID:28835759

The role of bone shape in determining gender differences in vertebral bone mass.

PubMed

Barlow, Tricia; Carlino, Will; Blades, Heather Z; Crook, Jon; Harrison, Rachel; Arundel, Paul; Bishop, Nick J

2011-01-01

Dual-energy X-ray absorptiometry (DXA) measures of bone mineral density (BMD) in children fail to account for growth because bone depth is unmeasured. While multiple adjustment methods have been proposed using body or bone size, the effect of vertebral shape is relatively unknown. Our study aimed to determine gender differences in vertebral shape and their impact on areal BMD (aBMD). We recruited 189 children, including 107 boys, aged 4-17 years, who attended the emergency department due to trauma. None had fractured. Height, weight, Tanner stage, and DXA measurements of the lumbar spine (LS) and total body were obtained. Cylindrical models were used to predict relationships between vertebral width (VW) and areal density for a given vertebral area assuming uniform volumetric density. The actual relationships between VW, bone area, and aBMD for the LS in the children were then determined. The theoretical models predicted a positive relationship between width and areal density for a constant vertebral area. Actual vertebral measurements demonstrated that boys had greater VW for a given vertebral area but lower aBMD for a given VW than girls at any age. The most likely explanation for the apparent paradox was that vertebral cortical thickness relative to width was greater in girls. This difference remained after adjusting for lean mass, suggesting that bone's response to mechanical stimulation may vary between the sexes during growth with consequent evolutionary advantage for girls approaching reproductive age. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Handball Practice Enhances Bone Mass in Specific Sites Among Prepubescent Boys.

PubMed

Missawi, Kawther; Zouch, Mohamed; Chakroun, Yosra; Chaari, Hamada; Tabka, Zouhair; Bouajina, Elyès

2016-01-01

This investigation's purpose is to focus on the effects of practicing handball for at least 2 yr on bone acquisition among prepubescent boys. One hundred prepubescent boys aged 10.68 ± 0.85 yr were divided into 2 groups: 50 handball players (HP group) and 50 controls (C group). Bone mineral density (BMD), bone mineral content (BMC), and bone area (BA) were evaluated by using dual-photon X-ray absorptiometry on the whole body, lumbar spine (L2-L4), legs, arms, femoral necks, hips and radiuses. Results showed greater values of BMD in both right and left femoral neck and total hip in handball players than in controls. In addition, handball players had higher values of legs and right total hip BMC than controls without any obvious variation of BA measurement in all sites between groups. All results of the paired t-test displayed an obviously marked variation of bone mass parameters between the left and right sides in the trained group without any marked variation among controls. Data showed an increased BMD of the supporting sites between the left and the right leg among handball players. However, "BMC" results exhibited higher values in the right than in the left total hip, and in the right total radius than in the left correspondent site. In addition, differences in the "BA" measurements were observed in the left total hip and in the right arm. Specific bone sites are markedly stimulated by handball training in prepubescent boys. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Effect of age and disease on bone mass in Japanese patients with schizophrenia.

PubMed

Sugawara, Norio; Yasui-Furukori, Norio; Umeda, Takashi; Tsuchimine, Shoko; Fujii, Akira; Sato, Yasushi; Saito, Manabu; Furukori, Hanako; Danjo, Kazuma; Matsuzaka, Masashi; Takahashi, Ippei; Kaneko, Sunao

2012-02-20

There have been a limited number of studies comparing bone mass between patients with schizophrenia and the general population. The aim of this study was to compare the bone mass of schizophrenia patients with that of healthy subjects in Japan. We recruited patients (n = 362), aged 48.8 ± 15.4 (mean ± SD) years who were diagnosed with schizophrenia or schizoaffective disorder based on the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV). Bone mass was measured using quantitative ultrasound densitometry of the calcaneus. The osteosono-assessment index (OSI) was calculated as a function of the speed of sound and the transmission index. For comparative analysis, OSI data from 832 adults who participated in the Iwaki Health Promotion Project 2009 was used as representative of the general community. Mean OSI values among male schizophrenic patients were lower than those in the general population in the case of individuals aged 40 and older. In females, mean OSI values among schizophrenic patients were lower than those in the general community in those aged 60 and older. In an analysis using the general linear model, a significant interaction was observed between subject groups and age in males. Older schizophrenic patients exhibit lower bone mass than that observed in the general population. Our data also demonstrate gender and group differences among schizophrenic patients and controls with regard to changes in bone mass associated with aging. These results indicate that intervention programs designed to delay or prevent decreased bone mass in schizophrenic patients might be tailored according to gender.

Hypervitaminosis D: case report of pediatric osteoporosis secondary to cystic fibrosis.

PubMed

Cialdella, Pietro; Carella, Francesco

2011-09-01

The objective of the study is to evaluate alterations of bone metabolism in adolescence and adult CF, determining the rate of osteoporosis, osteopenia and vertebral and non-vertebral fractures. We took into account the clinical case of a child who right from the age of seven years has presented joint pain.The little girl was diagnosed with osteopenia taken with therapy of calcium and vitamin D; after few years despite treatment nephrocalcinosis and osteoporosis take over.It was examined a cohort of patients with cystic fibrosis of the southern Italy, 24 patients aged between 12 and 44 years, 12 females and 12 males with BMD assessment methods like dual energy X-rays (DXA) and calcaneal ultrasound densitometry in a few cases, ultrasonography was used jointly.From this case study we tried to establish the relationship between cystic fibrosis and osteoporosis etiopathogenetic, the adoptive therapy and the impact of therapies on patients.It was concluded that, given the high number of unrecognized patients with impaired bone mineralization, we must implement and integrate a more aggressive treatment with bisphosphonates and prevention programs that can combat the lifestyle and new eating habits of our young people that facilitate the loss of bone mass.

Bisphosphonates for prevention of postmenopausal osteoporosis.

PubMed

Ravn, Pernille

2002-02-01

Our studies showed that 5 mg alendronate per day was the lowest, most effective dose that persistently prevented bone loss in recently postmenopausal women with normal bone mass. The effect on bone mass and biochemical markers was found comparable to that of commonly recommended regimens of postmenopausal HRT, and 5 mg alendronate per day is suggested as a new option for prevention of postmenopausal osteoporosis. HRT must, however, still be considered the first choice for this indication because of additional beneficial effects on other organ systems. The effect of alendronate was unaffected by bone or fat mass status, but increased with increasing postmenopausal age. The implications were that alendronate stabilized bone mass to a comparable extent in women at particular risk of osteoporosis because of thin body habitus or low bone mass and in healthy postmenopausal women with normal bone mass. Calcium supplementation was insufficient to prevent bone loss and did not add an effect on bone metabolism when combined with alendronate treatment in recently postmenopausal women. The gastrointestinal risk and adverse event profile of 5 mg alendronate per day was comparable to that of placebo, and this dose of alendronate appeared safe for long-term use. Bone loss resumed at a normal postmenopausal rate promptly after withdrawal of alendronate in early postmenopausal women consistent with a substantial underlying natural bone loss during early menopause. Oral ibandronate increased bone mass at all skeletal regions in elderly postmenopausal women with low bone mass, and 2.5 mg ibandronate per day was the lowest dose with this effect. The results are indicative of ibandronate as an option for secondary prevention of postmenopausal osteoporosis, but longer-term phase III trials should be performed before ibandronate can be recommended for this indication. The study showed that 2.5 mg ibandronate per day was efficient for prevention of bone loss and increment in bone mass in a population of women at particular risk of osteoporosis because of low bone mass. There were no differences between 2.5 mg ibandronate per day and placebo in terms of side effects, including complaints from the gastrointestinal tract, and ibandronate appeared safe for longer-term use in this dosing. Bone loss resumed at a normal postmenopausal rate when treatment was withdrawn. The response in bone mass and biochemical markers indicated that 2.5 mg ibandronate per day is equivalent to 10 mg alendronate per day in postmenopausal women. Our studies of two recently developed biochemical markers, urine CTX and serum total OC, showed that bone turnover was lowest in the premenopausal period, where these biochemical markers furthermore revealed a negative association with bone mass. It indicated that increased bone turnover contributes to a small premenopausal bone loss and resulting lowered bone mass. In consistence, a small premenopausal bone loss was observed in some regions of the hip. The biochemical markers increased at the time of menopause, consistent with initiation of the postmenopausal bone loss, and became gradually more negatively associated with bone mass as time past the menopause increased. The biochemical markers were furthermore higher in postmenopausal women with low bone mass, consistent with the characterization of postmenopausal osteoporosis as a condition with increased bone turnover. Our results consistently indicated a central role of increased bone turnover for development of low bone mass and osteoporosis. It is, however, also important to stress that the associations between biochemical markers and bone mass were too weak to allow for a valid individual estimation of bone mass based on biochemical markers. In contrast, the biochemical markers were shown as valid tools for monitoring and prediction of treatment effect of bisphosphonates. CTX, NTX, and total OC revealed the best performance characteristics in this respect. Six months after start of treatment, the level of suppression of these biochemical markers of bone resorption and formation accurately reflected the size of the 1-2 year response in bone mass in groups of women treated with bisphosphonate. This was a clear advance over bone densitometry, which has a precision error in the area of the anticipated yearly bone mass response during bisphosphonate therapy. The relationship was consistent during treatment with alendronate or ibandronate and in younger or elderly postmenopausal women. In individual patients, cut-off values of an about 40% decrease in urine CTX or NTX and an about 20% decrease in total OC validly predicted long-term prevention of bone loss. The sensitivity of prediction was high, but the specificity low. This implicated that the biochemical markers could be used as an exact method to detect "responders" to therapy, whereas "non-responders" to bisphosphonate treatment should be detected with bone densitometry in patients who do not reveal a decrease below the cut-off value in the biochemical marker during treatment. However, before such approach can be generally recommended the cut-off values of the biochemical markers should be validated in future clinical trials of bisphosphonate. Postmenopausal osteoporosis develops slowly over many years and mainly becomes a significant individual and socio-economic health problem 1-3 decades after the menopause. Prevention of postmenopausal osteoporosis by bisphosphonates is therefore likely to imply a treatment regimen of at least a decade, as presently recommended for HRT (Consensus Development Statement 1997). However, future cost-effectiveness studies should reveal when bisphosphonate treatment should ideally be initiated. Our studies showed that the bisphosphonates were effective over the range from general recommendation (recently postmenopausal women with normal bone mass) to a reservation for women at particular risk of osteoporosis (elderly women, thin women, or women with osteopenia). Presently available biochemical markers could be used for groupwise and individual monitoring and prediction of treatment response. Most presently available biochemical markers, however, have the drawback of a low specificity. Recent studies of CTX measured in serum are promising, and indicate that this new biochemical marker might have overcome these drawbacks due to a pronounced response to treatment and a low long-term biological variation (Christgau et al. 1998b, Rosen et al. 1998, and 2000).

[Relationship between weight, body composition and bone mass in peritoneal dialysis].

PubMed

Negri, A L; Barone, R; Bogado, C E; Zanchetta, J R

2005-01-01

Patients in chronic dialysis show a decrease in total bone mass. The factors that determine this decrease are not well known. In normal populations weight and its compartments are important determinants of bone mass. We studied total bone mineral content (TBMC), a measure of bone mass, and body composition using DEXA densitometry in 65 patients (45 females and 20 males) who had been in peritoneal dialysis for a mean of 40.3 +/- 23.2 months. Forty-eight patients (73.8%) had been previously in hemodialysis. The mean total time in dialysis for these patients was 76.8 months. As a group patients showed a very significant positive correlation between TBMC and weight, height, and lean body mass. A negative correlation was found between TBMC with the time in dialysis and iPTH. In men we found significant simple positive correlations between TBMC and weight, height and lean body mass. In women we found simple positive correlations of TBMC with weight, height and lean body mass and a negative correlation with iPTH. In the multiple regression analysis, lean body mass was the only body composition parameter that had a significantly positive correlation with TBMC in men; in women only height correlated positively with TBMC and iPTH continued to correlate negatively with bone mass. When we considered pre and postmenopausal women separately, bone mass was correlated positively with height and lean body mass and negatively with iPTH in postmenopausal women and only with height in pre-menopausal females. We conclude that the lean body mass compartment. is the most important component of weight that determines TBMC in peritoneal dialysis patients particularly in males and postmenopausal women. In postmenopausal women, secondary hyperparathyroidism seems to be particularly detrimental on bone mass.

Bone Metabolism on ISS Missions

NASA Technical Reports Server (NTRS)

Smith, S. M.; Heer, M. A.; Shackelford, L. C.; Zwart, S. R.

2014-01-01

Spaceflight-induced bone loss is associated with increased bone resorption (1, 2), and either unchanged or decreased rates of bone formation. Resistive exercise had been proposed as a countermeasure, and data from bed rest supported this concept (3). An interim resistive exercise device (iRED) was flown for early ISS crews. Unfortunately, the iRED provided no greater bone protection than on missions where only aerobic and muscular endurance exercises were available (4, 5). In 2008, the Advanced Resistive Exercise Device (ARED), a more robust device with much greater resistance capability, (6, 7) was launched to the ISS. Astronauts who had access to ARED, coupled with adequate energy intake and vitamin D status, returned from ISS missions with bone mineral densities virtually unchanged from preflight (7). Bone biochemical markers showed that while the resistive exercise and adequate energy consumption did not mitigate the increased bone resorption, bone formation was increased (7, 8). The typical drop in circulating parathyroid hormone did not occur in ARED crewmembers. In 2014, an updated look at the densitometry data was published. This study confirmed the initial findings with a much larger set of data. In 42 astronauts (33 male, 9 female), the bone mineral density response to flight was the same for men and women (9), and those with access to the ARED did not have the typical decrease in bone mineral density that was observed in early ISS crewmembers with access to the iRED (Figure 1) (7). Biochemical markers of bone formation and resorption responded similarly in men and women. These data are encouraging, and represent the first in-flight evidence in the history of human space flight that diet and exercise can maintain bone mineral density on long-duration missions. However, the maintenance of bone mineral density through bone remodeling, that is, increases in both resorption and formation, may yield a bone with strength characteristics different from those that existed before space flight. Studies to assess bone strength after flight are underway at NASA, to better understand the results of bone remodeling. Studies are also underway to evaluate optimized exercise protocols and nutritional countermeasures. Regardless, there is clear evidence of progress being made to protect bone during spaceflight.

Bone metabolism of male rats chronically exposed to cadmium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzoska, Malgorzata M.; Moniuszko-Jakoniuk, Janina

2005-09-15

Recently, based on a female rat model of human exposure, we have reported that low-level chronic exposure to cadmium (Cd) has an injurious effect on the skeleton. The purpose of the current study was to investigate whether the exposure may also affect bone metabolism in a male rat model and to estimate the gender-related differences in the bone effect of Cd. Young male Wistar rats received drinking water containing 0, 1, 5, or 50 mg Cd/l for 12 months. The bone effect of Cd was evaluated using bone densitometry and biochemical markers of bone turnover. Renal handling of calcium (Ca)more » and phosphate, and serum concentrations of vitamin D metabolites, calcitonin, and parathormone were estimated as well. At treatment with 1 mg Cd/l, corresponding to the low environmental exposure in non-Cd-polluted areas, the bone mineral content (BMC) and density (BMD) at the femur and lumbar spine (L1-L5) and the total skeleton BMD did not differ compared to control. However, from the 6th month of the exposure, the Z score BMD indicated osteopenia in some animals and after 12 months the bone resorption very clearly tended to an increase. The rats' exposure corresponding to human moderate (5 mg Cd/l) and especially relatively high (50 mg Cd/l) exposure dose- and duration-dependently disturbed the processes of bone turnover and bone mass accumulation leading to formation of less dense than normal bone tissue. The effects were accompanied by changes in the serum concentration of calciotropic hormones and disorders in Ca and phosphate metabolism. It can be concluded that low environmental exposure to Cd may be only a subtle risk factor for skeletal demineralization in men. The results together with our previous findings based on an analogous model using female rats give clear evidence that males are less vulnerable to the bone effects of Cd compared to females.« less

Expanding the Description of Spaceflight Effects beyond Bone Mineral Density [BMD]: Trabecular Bone Score [TBS] in ISS Astronauts

NASA Technical Reports Server (NTRS)

Sibonga, J. D.; Spector, E. R.; King, L. J.; Evans, H. J.; Smith, S. A.

2014-01-01

Dual-energy x-ray absorptiometry [DXA] is the widely-applied bone densitometry method used to diagnose osteoporosis in a terrestrial population known to be at risk for age-related bone loss. This medical test, which measures areal bone mineral density [aBMD] of clinically-relevant skeletal sites (e.g., hip and spine), helps the clinician to identify which persons, among postmenopausal women and men older than 50 years, are at high risk for low trauma or fragility fractures and might require an intervention. The most recognized osteoporotic fragility fracture is the vertebral compression fracture which can lead to kyphosis or hunched backs typically seen in the elderly. DXA measurement of BMD however is recognized to be insufficient as a sole index for assessing fracture risk. DXA's limitation may be related to its inability to monitor changes in structural parameters, such as trabecular vs. cortical bone volumes, bone geometry or trabecular microarchitecture. Hence, in order to understand risks to human health and performance due to space exposure, NASA needs to expand its measurements of bone to include other contributors to skeletal integrity. To this aim, the Bone and Mineral Lab conducted a pilot study for a novel measurement of bone microarchitecture that can be obtained by retrospective analysis of DXA scans. Trabecular Bone Score (TBS) assesses changes to trabecular microarchitecture by measuring the grey color "texture" information extracted from DXA images of the lumbar spine. An analysis of TBS in 51 ISS astronauts was conducted to assess if TBS could detect 1) an effect of spaceflight and 2) a response to countermeasures independent of DXA BMD. In addition, changes in trunk body lean tissue mass and in trunk body fat tissue mass were also evaluated to explore an association between body composition, as impacted by ARED exercise, and bone microarchitecture. The pilot analysis of 51 astronaut scans of the lumbar spine suggests that, following an ISS mission, DXA BMD and TBS are detecting different effects of ARED exercise and of ARED + Bisphosphonate on the lumbar spine of astronauts. There is emerging evidence associating reduced TBS with terrestrial metabolic bone disorders where a TBS <1.200 is associated with "degraded" while > 1.350 is associated with "normal." However, it is not possible to conclude how the spaceflight-induced changes in TBS increase risk for vertebral fractures in the astronaut or if changes in body composition of the trunk region could be an indirect method of assessing exercise effect on bone microarchitecture. More importantly, this pilot analysis demonstrates a new, minimal risk approach for monitoring changes to vertebral bone microarchitecture. This method could help assess the combined skeletal effects of spaceflight with the effects of aging in the astronaut after return to Earth.

Direct Comparison of the Precision of the New Hologic Horizon Model With the Old Discovery Model.

PubMed

Whittaker, LaTarsha G; McNamara, Elizabeth A; Vath, Savoun; Shaw, Emily; Malabanan, Alan O; Parker, Robert A; Rosen, Harold N

2017-11-22

Previous publications suggested that the precision of the new Hologic Horizon densitometer might be better than that of the previous Discovery model, but these observations were confounded by not using the same participants and technologists on both densitometers. We sought to study this issue methodically by measuring in vivo precision in both densitometers using the same patients and technologists. Precision studies for the Horizon and Discovery models were done by acquiring spine, hip, and forearm bone mineral density twice on 30 participants. The set of 4 scans on each participant (2 on the Discovery, 2 on the Horizon) was acquired by the same technologist using the same scanning mode. The pairs of data were used to calculate the least significant change according to the International Society for Clinical Densitometry guidelines. The significance of the difference between least significant changes was assessed using a Wilcoxon signed-rank test of the difference between the mean square error of the absolute value of the differences between paired measurements on the Discovery (Δ-Discovery) and the mean square error of the absolute value of the differences between paired measurements on the Horizon (Δ-Horizon). At virtually all anatomic sites, there was a nonsignificant trend for the precision to be better for the Horizon than for the Discovery. As more vertebrae were excluded from analysis, the precision deteriorated on both densitometers. The precision between densitometers was almost identical when reporting only 1 vertebral body. (1) There was a nonsignificant trend for greater precision on the new Hologic Horizon compared with the older Discovery model. (2) The difference in precision of the spine bone mineral density between the Horizon and the Discovery models decreases as fewer vertebrae are included. (3) These findings are substantially similar to previously published results which had not controlled as well for confounding from using different subjects and technologists. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Area densitometry using rotating Scheimpflug photography for posterior capsule opacification and surface light scattering analyses.

PubMed

Minami, Keiichiro; Honbo, Masato; Mori, Yosai; Kataoka, Yasushi; Miyata, Kazunori

2015-11-01

To compare area densitometry analysis using rotating Scheimpflug photography in quantifications of posterior capsule opacification (PCO) and surface light scattering with previous anterior-segment analyzer measurement. Miyata Eye Hospital, Miyazaki, Japan. Prospective observational case series. Scheimpflug images of eyes with foldable intraocular lenses (IOLs) were obtained using rotating and fixed Scheimpflug photography. Area densitometry on the posterior and anterior surfaces was conducted for PCO and surface light scattering analyses, respectively, with an identical area size. Correlation between two measurements was analyzed using linear regression. The study included 105 eyes of 74 patients who received IOLs 1 to 18 years (mean, 4.9 ± 4.5 years) postoperatively. In the PCO analysis on the posterior IOL surface, there was a significant correlation between the two measurements (P < .001, R(2) = 0.60). In the surface light scattering analysis, a significant and higher correlation was obtained (P < .001, R(2) = 0.91) until the fixed Scheimpflug photography exhibited saturation due to intensive scatterings. Area densitometry combined with a rotating Scheimpflug photography was exchangeable to previously established densitometry measurement, and allowed successive evaluation in longer-term observations. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

High degree of discordance between three-dimensional and two-dimensional lumbar spine bone mineral density in Turner's syndrome.

PubMed

Lage, Andrea Z; Brandão, Cynthia A; Mendes, Judite R T; Huayllas, Martha K; Liberman, Bernardo; Mendonça, Berenice B; Costa, Elaine M F; Verreschi, Ieda T; Lazaretti-Castro, Marise

2005-01-01

Low bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA) has been described in Turner's syndrome (TS). One of the error factors of DXA is short stature, a common finding in TS patients. Aimed to evaluate the influence of a low stature on BMD, we compared the two-dimensional (2D) or conventional BMD (cBMD) with three-dimensional (3D) or volumetric BMD (vBMD) in 62 females (10 to 48 yr old) with TS diagnosis in a case control study. They were compared to 102 normal females (7 to 45 yr old) grouped by age-ranges. All patients were subjected to a lumbar spine densitometry by DXA in the PA and lateral projections, obtained the cBMD and vBMD and calculated for the apparent BMD (appBMD). In TS, the mean of Z-score for cBMD was significantly lower than that for vBMD and for appBMD (-2.31 +/- 1.42; -0.64 +/- 1.55; and -1.72 +/- 1.5; respectively). Most of the patients (83.8%) had a Z-score <-1 for cBMD, whereas the majority (58.1%) had a Z-score <-1 for vBMD. Concluding, the cBMD underestimates the bone mass of the lumbar spine in patients with TS inducing to false diagnoses of bone fragility. Volumetric BMD approached the bone mass of control patients, while appBMD just partially do that.

Comparison of DXA Scans and Conventional X-rays for Spine Morphometry and Bone Age Determination in Children.

PubMed

Hoyer-Kuhn, Heike; Knoop, Kai; Semler, Oliver; Kuhr, Kathrin; Hellmich, Martin; Schoenau, Eckhard; Koerber, Friederike

2016-01-01

Conventional lateral spine and hand radiographs are the standard tools to evaluate vertebral morphometry and bone age in children. Beside bone mineral density analyses, dual-energy X-ray absorptiometry (DXA) measurements with lower radiation exposure provide high-resolution scans which are not approved for diagnostic purposes. Data about the comparability of conventional radiographs and DXA in children are missing yet. The purpose of the trial was to evaluate whether conventional hand and spine radiographs can be replaced by DXA scans to diminish radiation exposure. Thirty-eight children with osteogenesis imperfecta or secondary osteoporosis or short stature (male, n=20; age, 5.0-17.0 yr) were included and assessed once by additional DXA (GE iDXA) of the spine or the left hand. Intraclass correlation coefficients (ICCs) were used to express agreement between X-ray and iDXA assessment. Evaluation of the spine morphometry showed reasonable agreement between iDXA and radiography (ICC for fish-shape, 0.75; for wedge-shape, 0.65; and for compression fractures, 0.70). Bone age determination showed excellent agreement between iDXA and radiography (ICC, 0.97). IDXA-scans of the spine in a pediatric population should be used not only to assess bone mineral density but also to evaluate anatomic structures and vertebral morphometry. Therefore, iDXA can replace some radiographs in children with skeletal diseases. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Interpregnancy interval as a risk factor for postmenopausal osteoporosis.

PubMed

Sahin Ersoy, Gulcin; Giray, Burak; Subas, Seda; Simsek, Ersin; Sakin, Onder; Turhan, Omer Talip; Bulut, Sadullah

2015-10-01

Bone mass loss associated with pregnancy and lactation is usually regained in the postpartum period. However, it is not known whether the bone loss is completely recovered in women with a shortened interpregnancy interval (IPI). The aim of this study was to analyze the effect of IPI and gynecological history on postmenopausal osteoporosis. The study was conducted among 537 postmenopausal women who were divided into two groups in accordance with the osteoporosis status. Prior to bone densitometry, the patients were questioned about reproductive history. Dual-energy X-ray absorptiometry was used to measure lumbar spinal, femur neck and total femoral bone mineral density. Association between IPI and postmenopausal osteoporosis was analyzed. The comparison of both groups according to the total duration of breastfeeding did not reveal a considerable variation (p=0.288). In the osteoporosis group the age and duration of menopause were found to be significantly higher (p<0.001) whereas the age of first pregnancy and IPI were notably lower in comparison to the controls group (p<0.001). Multivariate logistic regression analyses revealed that women who have 0-12 months interpregnancy interval have the highest risk for osteoporosis (OR: 4.306; 95% CI, 1.684-11.01). This analysis confirmed that the occurrence of first pregnancy under 27 years of age conveyed a higher risk for osteoporosis, as well. Shortened IPI may have a detrimental effect on bone mineral density in postmenopausal age. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A screening model for low bone mass in elderly Japanese men using quantitative ultrasound measurements: Fujiwara-Kyo Study.

PubMed

Minematsu, Akira; Hazaki, Kan; Harano, Akihiro; Iki, Masayuki; Fujita, Yuki; Okamoto, Nozomi; Kurumatani, Norio

2012-01-01

Screening for low bone mass is important to prevent fragility fractures in men as well as women, although men show a much lower prevalence of osteoporosis than women. The purpose of this study was to establish a screening model for low bone mineral density (BMD) using a quantitative ultrasound parameter and easily obtained objective indices for elderly Japanese men. We examined 1633 men (65-84 yr old) who were subjects of the Fujiwara-Kyo Study. Speed of sound (SOS) at the calcaneus was determined, and BMD was measured by dual-energy X-ray absorptiometry at the lumbar spine (LS), total hip (TH), and femoral neck (FN). Low BMD was defined as >1 standard deviation below the young adult mean, in accordance with World Health Organization criteria. We performed receiver operating characteristic (ROC) analysis to identify a better screening model incorporating SOS and determined the optimal cutoff value using Youden index. Prevalences of low BMD at the 3 skeletal sites were 27.8% (LS), 33.5% (TH), 48.6% (FN), and 43.3% at either LS or TH. The greatest area under the ROC curve (0.806, 95% confidence interval: 0.785-0.828) and smallest Akaike's information criterion were obtained in the multivariate model incorporating SOS, age, height, and weight for predicting low BMD at all skeletal sites. This model predicted low BMD at TH with the sensitivity of 0.726 and specificity of 0.739, whereas a similar model predicted low BMD at LS with much lower validity. We conclude that the multivariate model for TH could be used to screen for low BMD in elderly Japanese men. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

An ultrasound wearable system for the monitoring and acceleration of fracture healing in long bones.

PubMed

Protopappas, Vasilios C; Baga, Dina A; Fotiadis, Dimitrios I; Likas, Aristidis C; Papachristos, Athanasios A; Malizos, Konstantinos N

2005-09-01

An ultrasound wearable system for remote monitoring and acceleration of the healing process in fractured long bones is presented. The so-called USBone system consists of a pair of ultrasound transducers, implanted into the fracture region, a wearable device and a centralized unit. The wearable device is responsible to carry out ultrasound measurements using the axial-transmission technique and initiate therapy sessions of low-intensity pulsed ultrasound. The acquired measurements and other data are wirelessly transferred from the patient-site to the centralized unit, which is located in a clinical setting. The evaluation of the system on an animal tibial osteotomy model is also presented. A dataset was constructed for monitoring purposes consisting of serial ultrasound measurements, follow-up radiographs, quantitative computed tomography-based densitometry and biomechanical data. The animal study demonstrated the ability of the system to collect ultrasound measurements in an effective and reliable fashion and participating orthopaedic surgeons accepted the system for future clinical application. Analysis of the acquired measurements showed that the pattern of evolution of the ultrasound velocity through healing bones over the postoperative period monitors a dynamic healing process. Furthermore, the ultrasound velocity of radiographically healed bones returns to 80% of the intact bone value, whereas the correlation coefficient of the velocity with the material and mechanical properties of the healing bone ranges from 0.699 to 0.814. The USBone system constitutes the first telemedicine system for the out-hospital management of patients sustained open fractures and treated with external fixation devices.

Comparison and validation of methods to quantify Cry1Ab toxin from Bacillus thuringiensis for standardization of insect bioassays.

PubMed

Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D

2008-01-01

Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.

Changes in Astigmatism, Densitometry, and Aberrations After SMILE for Low to High Myopic Astigmatism: A 12-Month Prospective Study.

PubMed

Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper

2017-01-01

To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.

The usefulness of densitometry in predicting the composition and fragility of urolithiasis.

PubMed

Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael

2014-04-01

The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.

Mushroom Extracts Decrease Bone Resorption and Improve Bone Formation.

PubMed

Erjavec, Igor; Brkljacic, Jelena; Vukicevic, Slobodan; Jakopovic, Boris; Jakopovich, Ivan

2016-01-01

Mushroom extracts have shown promising effects in the treatment of cancer and various chronic diseases. Osteoporosis is considered one of the most widespread chronic diseases, for which currently available therapies show mixed results. In this research we investigated the in vitro effects of water extracts of the culinary-medicinal mushrooms Trametes versicolor, Grifola frondosa, Lentinus edodes, and Pleurotus ostreatus on a MC3T3-E1 mouse osteoblast-like cell line, primary rat osteoblasts, and primary rat osteoclasts. In an animal osteoporosis model, rats were ovariectomized and then fed 2 mushroom blends of G. frondosa and L. edodes for 42 days. Bone loss was monitored using densitometry (dual-energy X-ray absorptiometry) and micro computed tomography. In the concentration test, mushroom extracts showed no toxic effect on MC3T3-E1 cells; a dose of 24 µg/mL showed the most proliferative effect. Mushroom extracts of T. versicolor, G. frondosa, and L. edodes inhibited osteoclast activity, whereas the extract of L. edodes increased osteoblast mineralization and the production of osteocalcin, a specific osteoblastic marker. In animals, mushroom extracts did not prevent trabecular bone loss in the long bones. However, we show for the first time that the treatment with a combination of extracts from L. edodes and G. frondosa significantly reduced trabecular bone loss at the lumbar spine. Inhibitory properties of extracts from L. edodes on osteoclasts and the promotion of osteoblasts in vitro, together with the potential to decrease lumbar spine bone loss in an animal osteoporosis model, indicate that medicinal mushroom extracts can be considered as a preventive treatment and/or a supplement to pharmacotherapy to enhance its effectiveness and ameliorate its harmful side effects.

Bone health in long-term gastric cancer survivors: A prospective study of high-dose vitamin D supplementation using an easy administration scheme.

PubMed

Climent, Marta; Pera, Manuel; Aymar, Isabel; Ramón, José M; Grande, Luis; Nogués, Xavier

2018-07-01

Bone disease in long-term survivors after gastric cancer resection has received little research attention. This study aimed to investigate bone health after curative resection of gastric cancer and the consequences of high-dose vitamin D supplementation in patients with low levels of 25-(OH)-vitamin D. Disease-free patients at least 24 months after gastric cancer resection represented the study cohort. Serum markers of bone metabolism were assessed at baseline and at 3 and 12 months. Bone mineral density and presence of fractures were assessed by X-ray at baseline. Patients with 25-(OH)-vitamin D ≤30 ng/mL at baseline received 16,000 IU of vitamin D3 every 10 days during the 1-year follow-up. Forty patients were included in the study. Mean time from surgery was 48.9 (24-109) months. Vitamin D insufficiency and secondary hyperparathyroidism were observed in 38 and 20 patients, respectively. Densitometry showed osteoporosis in 14 women and seven men and prevalent fractures in 12 women and six men at baseline. After 3 months of vitamin D supplementation, 35 patients reached values of 25-(OH)-vitamin D over 30 ng/mL. After 12 months, 38 patients were in the normal range of 25-(OH)-vitamin D. At the same time, iPTH levels and markers of bone turnover (C-terminal cross-linked telopeptide of type-I collagen, serum concentrations of bone-specific alkaline phosphatase and osteocalcin) significantly decreased after vitamin D intervention. Oral administration of high doses of vitamin D is easily implemented and restored 25-(OH)-vitamin D and iPTH values, which are frequently disturbed after gastric cancer resection.

Osteoporosis, bone mineral density and CKD-MBD complex (I): Diagnostic considerations.

PubMed

Bover, Jordi; Ureña-Torres, Pablo; Torregrosa, Josep-Vicent; Rodríguez-García, Minerva; Castro-Alonso, Cristina; Górriz, José Luis; Laiz Alonso, Ana María; Cigarrán, Secundino; Benito, Silvia; López-Báez, Víctor; Lloret Cora, María Jesús; daSilva, Iara; Cannata-Andía, Jorge

2018-04-24

Osteoporosis (OP) and chronic kidney disease (CKD) independently influence bone and cardiovascular health. A considerable number of patients with CKD, especially those with stages 3a to 5D, have a significantly reduced bone mineral density leading to a high risk of fracture and a significant increase in associated morbidity and mortality. Independently of classic OP related to age and/or gender, the mechanical properties of bone are also affected by inherent risk factors for CKD ("uraemic OP"). In the first part of this review, we will analyse the general concepts regarding bone mineral density, OP and fractures, which have been largely undervalued until now by nephrologists due to the lack of evidence and diagnostic difficulties in the context of CKD. It has now been proven that a reduced bone mineral density is highly predictive of fracture risk in CKD patients, although it does not allow a distinction to be made between the causes which generate it (hyperparathyroidism, adynamic bone disease and/or senile osteoporosis, etc.). Therefore, in the second part, we will analyse the therapeutic indications in different CKD stages. In any case, the individual assessment of factors which represent a higher or lower risk of fracture, the quantification of this risk (i.e. using tools such as FRAX ® ) and the potential indications for densitometry in patients with CKD could represent an important first step pending new clinical guidelines based on randomised studies which do not exclude CKD patients, all the while avoiding therapeutic nihilism in an area of growing importance. Copyright © 2018 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

Analysis of the effects of growth hormone, exercise and food restriction on cancellous bone in different bone sites in middle-aged female rats.

PubMed

Banu, J; Orhii, P B; Okafor, M C; Wang, L; Kalu, D N

2001-06-01

The aim of this study is to determine the effects of growth hormone (GH), exercise (EX), GH+EX and food restriction on cancellous bone in middle-aged female rats. Female F344 rats aged 13 months were divided into (1) age-matched controls; (2) GH treated (2.5 mg/kg. 5 day/week); (3) EX (voluntary wheel running); (4) GH+EX; and (5) food restricted (FR) (fed 60% of the ad libitum food intake). The animals were treated for 18 weeks, at the end of which they were sacrificed. Cancellous bone and cortical bone in the fourth lumbar vertebra, proximal tibial metaphysis (PTM), distal femoral metaphysis (DFM) and femoral neck (NF) were analyzed using peripheral quantitative computerized tomography (pQCT) densitometry. Growth hormone increased cancellous bone area, cancellous bone mineral content, cortical bone area and cortical bone mineral content in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly after GH treatment. Exercise increased the cancellous bone area in the vertebra, PTM and DFM. Cortical bone area and cortical bone mineral content increased after EX in the vertebra, PTM, DFM and NF. No significant change was seen in the tibial muscle wet weight after EX. Growth hormone+EX increased cancellous bone area in the vertebra PTM and DFM but had no effect in neck of the femur. Cancellous bone mineral content, cortical bone area and cortical bone mineral content increased with GH+EX in the vertebra, PTM, DFM and NF. The tibial muscle wet weight was increased significantly with GH+EX. Food restriction decreased cancellous bone area and cancellous bone mineral content in all the bones studied. The decrease was statistically significant only at the distal femoral metaphysis. The tibial muscle wet weight decreased when compared with the age-matched control, but this decrease was not statistically significant. We conclude that the effect of the dose of GH used and the levels of voluntary wheel running EX used increased cancellous bone in intact rats; the effect of GH is much greater and different bones respond with varying intensities. The effects of combined treatment of GH and EX on cancellous bone are not always significantly higher than those of GH alone. FR at the level studied has a mostly negative effect on cancellous bone.

Quantification through TLC-densitometric analysis, repellency and anticholinesterase activity of the homemade extract of Indian cloves.

PubMed

Affonso, Raphael S; Lima, Josélia A; Lessa, Bruno M; Caetano, João V O; Obara, Marcos T; Nóbrega, Andréa B; Nepovimova, Eugenie; Musilek, Kamil; Kuca, Kamil; Slana, Gláucia B C A; França, Tanos C C

2018-02-01

The rise of the mosquitoes-transmitted diseases, like dengue, zika and chikungunya in Brazil in the last years has increased concerns on protection against mosquitoes bites. However, the prohibitive prices of the commercially available repellents for the majority of the Brazilian population has provoked a search for cheaper solutions, like the use of the homemade ethanolic extract of Indian clove (Syzygium aromaticum L.) as repellent, which has been reported as quite efficient by the local press. In order to verify this, we performed here the quantification of the main components of this extract through high-performance thin-layer chromatography (HPTLC)-densitometry and evaluated its efficiency as a repellent and its acetylcholinesterase (AChE) inhibition capacity. Our results have proved HPTLC-densitometry as an efficient and appropriate method for this quantification and confirmed the repellency activity, as well as its capacity of AChE inhibition. Copyright © 2017 John Wiley & Sons, Ltd.

Qualitative and quantitative analysis of seven oligosaccharides in Morinda officinalis using double-development HPTLC and scanning densitometry.

PubMed

Zhou, Bin; Chang, Jun; Wang, Ping; Li, Jie; Cheng, Dan; Zheng, Peng-Wu

2014-01-01

The quality of Morindaofficinalis, which has been used as a Yang-tonic agent for a long time in China, can be evaluated. A double-development high performance thin layer chromatography (HPTLC) method has been established to simultaneously analyze quality and quantity of seven inulin-type oligosaccharides (DP=3-9) in Morindaofficinalis. The chromatography was performed on a silica gel 60 plate with the 7:5:2:1 proportion (v/v) of n-butanol-isopropanol-water-acetic acid for the first and second developments, respectively. The bands were visualized by the reaction with aniline-diphenylamine-phosphoric acid solution and analyzed by densitometric TLC at 540 nm. Quantification of seven oligosaccharides was achieved by densitometry at 540 nm. The investigated standard sugar had good linearity (R2>0.99) within test ranges. The amounts of seven oligosaccharides were calculated by the relative correction factor (RCF). Therefore, the developed TLC method could be used for quality control of Morindaofficinalis.

Deficiency of retinaldehyde dehydrogenase 1 induces BMP2 and increases bone mass in vivo.

PubMed

Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W; Brown, Jonathan D; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J; Plutzky, Jorge

2013-01-01

The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1(-/-) ) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1(-/-) mice. In serum assays, Aldh1a1(-/-) mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1(-/-) mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1(-/-) mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1(-/-) mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling.

Assessment of Corneal Backward Light Scattering in Diabetic Patients.

PubMed

Özyol, Pelin; Özyol, Erhan

2016-10-03

To analyze corneal backward light scattering differences in patients with type 2 diabetes mellitus. We enrolled 43 eyes from 43 diabetic patients and 40 eyes from 40 healthy controls. Corneal backward light scattering was evaluated using densitometry measurements from different corneal layers and zones obtained using Scheimpflug tomography (PentacamHR). When densitometry values were divided by depth, anterior layer of diabetic corneas displayed significantly higher corneal backward light scattering values than controls (32.05, 95% confidence intervals [CI], 31.02-33.08 vs. 29.18, 95% CI, 27.60-30.76, P=0.024). Corneal densitometry measurements were also significantly higher in diabetic eyes compared with control eyes, when considered by concentric zones of total cornea in the 0 to 2 mm (21.65, 95% CI, 20.28-23.01 vs. 18.87 95% CI, 18.49-19.25, P=0.020), and anterior layer in the 0 to 2 mm (27.3, 95% CI, 25.04-29.56 vs. 22.31, 95% CI, 20.57-24.05, P<0.001), 2 to 6 mm (26.2, 95% CI, 24.99-27.41 vs. 22.4, 95% CI, 20.18-24.62, P<0.001) and 6 to 10 mm (32.19, 95% CI, 29.98-34.40 vs. 27.2, 95% CI, 25.39-29.01, P=0.022). There was excellent positive correlation between anterior total corneal densitometry measurements and duration of diabetes (r=0.802, P<0.001), although no significant correlation was observed with anterior total corneal densitometry measurements and hemoglobin A1c levels (r=0.080, P=0.621) in diabetic eyes. Backward light scattering values from the anterior layer of the cornea is greater in diabetic eyes than in controls. Anterior total corneal densitometry measurements show positive correlation with the duration of diabetes.

Effects of 2-oxoglutaric acid on bone morphometry, densitometry, mechanics, and immunohistochemistry in 9-month-old boars with prenatal dexamethasone-induced osteopenia.

PubMed

Tomaszewska, Ewa; Dobrowolski, Piotr; Bieńko, Marek; Prost, Łukasz; Szymańczyk, Sylwia; Zdybel, Adam

2015-11-01

The structural quality of the connective tissue is genetically determined and is influenced by hormonal and nutritional modification. An effect of a 2-Ox-rich diet on bone mineralization and structure and expression of non-collagenous protein in articular and growth cartilages of maternal dexamethasone-treated 9-month-old boars was considered in this study. Sows were treated i.m. with dexamethasone at the dose of 0.03 mg kg(-1) body weight every second day during the last 45 days of pregnancy. After the birth, the boars were divided into two groups: administered and not supplemented with 2-Ox for 9 months (0.4 g/kg body weight/day). Dexamethasone given during the prenatal time inhibited the growth and negatively influenced the mechanics, geometry and histomorphometrical parameters of long bones and cartilage irrespective of the diet. Moreover, maternal dexamethasone treatment resulted in expression of osteocalcin in the articular cartilage, and the diet rich in 2-Ox limited the OC expression. This study demonstrated that changes observed in adult boars initiated by dexamethasone treatment in the prenatal period were persistent and long-term use of alimentary 2-Ox supplementation can counteract only some of the destructive changes evoked by prenatal dexamethasone excess.

Pediatric data for dual X-ray absorptiometric measures of normal lumbar bone mineral density in children under 5 years of age using the lunar prodigy densitometer.

PubMed

Manousaki, D; Rauch, F; Chabot, G; Dubois, J; Fiscaletti, M; Alos, N

2016-09-07

Knowledge of physiological variations of bone mineral density (BMD) in newborns and infants is necessary to evaluate pathological changes associated with fractures. Limited reference data for children under 5 years old are available. This study provides normative data of lumbar BMD for the Lunar Prodigy in young children under 5 years old. We assessed cross-sectionally 155 healthy children (77 boys, 80% Caucasian), ranging in age from newborn to the age of 5 years. Lumbar bone mineral content (BMC) and areal BMD were measured by dual-energy X-ray absorptiometry using a Lunar Prodigy absorptiometer. Volumetric BMD was calculated using the Kroeger and Carter methods. BMC and areal BMD increased from birth to 5 years (p<0.001). Volumetric BMD did not change with age. BMD and BMC correlated with age, weight and height (R(2)≥0.85 for all), with a maximum gain between the ages of 1 and 4 years, which did not follow the same pattern as height velocity. We did not find significant sex difference for any of the three measured parameters. This study provides normative data for lumbar spine densitometry of infants and young children using the Lunar Prodigy DXA system.

Comparison of gamma densitometry and electrical capacitance measurements applied to hold-up prediction of oil–water flow patterns in horizontal and slightly inclined pipes

NASA Astrophysics Data System (ADS)

Perera, Kshanthi; Kumara, W. A. S.; Hansen, Fredrik; Mylvaganam, Saba; Time, Rune W.

2018-06-01

Measurement techniques are vital for the control and operation of multiphase oil–water flow in pipes. The development of such techniques depends on laboratory experiments involving flow visualization, liquid fraction (‘hold-up’), phase slip and pressure drop measurements. They provide valuable information by revealing the physics, spatial and temporal structures of complex multiphase flow phenomena. This paper presents the hold-up measurement of oil–water flow in pipelines using gamma densitometry and electrical capacitance tomography (ECT) sensors. The experiments were carried out with different pipe inclinations from  ‑5° to  +6° for selected mixture velocities (0.2–1.5 m s‑1), and at selected watercuts (0.05–0.95). Mineral oil (Exxsol D60) and water were used as test fluids. Nine flow patterns were identified including a new pattern called stratified wavy and mixed interface flow. As a third direct method, visual observations and high-speed videos were used for the flow regime and interface identification. ECT and gamma densitometry hold-up measurements show similar trends for changes in pipeline inclinations. Changing the pipe inclination affected the flow mostly at lower mixture velocities and caused a change of flow patterns, allowing the highest change of hold-up. ECT hold-up measurements overpredict the gamma densitometry measurements at higher input water cuts and underpredict at intermediate water cuts. Gamma hold-up results showed good agreement with the literature results, having a maximum deviation of 6%, while it was as high as 22% for ECT in comparison to gamma densitometry. Uncertainty analysis of the measurement techniques was carried out with single-phase oil flow. This shows that the measurement error associated with gamma densitometry is approximately 3.2%, which includes 1.3% statistical error and 2.9% error identified as electromagnetically induced noise in electronics. Thus, gamma densitometry can predict hold-up with a higher accuracy in comparison to ECT when applied to oil–water systems at minimized electromagnetic noise.

Evolutionary Origins of the Differences in Osteoporosis Risk in US Populations.

PubMed

Nelson, Dorothy A

2018-03-23

Over the past 50 years, it has been increasingly evident that there are population differences in bone mass and the risk of osteoporosis. In the United States, many studies have reported a lower prevalence of osteoporosis in African Americans compared with people of European descent. If we trace the trajectory of changes in lifeways from the earliest migrations of early Homo out of Africa over the past two million years or so, to include lower vitamin D levels in higher latitudes; more meat in the diet; increasing sedentism; and a longer lifespan/longer postmenopausal period, it is not surprising that osteoporosis occurs more frequently in populations of European descent. While many scholars have explored the apparent "paradox" of higher bone mass, lower vitamin D levels, and higher parathyroid hormone levels among African Americans, this brief review of evolutionary shifts that affected our species may change the approach to understanding the current population differences in the United States. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Normocalcemic primary hyperparathyroidism in clinical practice: an indolent condition or a silent threat?

PubMed Central

Marques, Thyciara Fontenele; Vasconcelos, Renata; Diniz, Erik; Rêgo, Daniela; Griz, Luiz; Bandeira, Francisco

2015-01-01

Objective To describe the characteristics of normocalcemic primary hyperparathyroidism (NPHPT) in patients seen for osteoporosis evaluation. Patients and methods We examined the records of 156 women who came to the hospital to be screened for osteoporosis. Measurements of total calcium, PTH, 25-hydroxy vitamin D, and β-C-telopeptide were recorded. Bone mineral density and T-scores were evaluated by densitometry of the lumbar spine, femoral neck and distal one-third of the radius. The latter was only measured in patients with primary hyperparathyroidism. Nephrolithiasis and bone fractures were documented by a review of the medical records. Results We identified 14 patients with NPHPT, accounting for 8.9% of the population studied. In the medical records, the occurrence of kidney stones was reported in 28.6% of the patients with NPHPT, in contrast with only 0.7% of the noncarriers. Regarding the presence of general fractures, 21.4% of the patients with NPHPT were affected versus 16.2% of noncarriers. Conclusion Data from our study suggest that NPHPT has a diverse phenotypic presentation, implying that this may not be an “indolent” disease. PMID:21881813

Serum Sclerostin in Hepatitis C Virus Infected Patients

PubMed Central

López-Prieto, Javier; Pelazas-González, Ricardo; Alemán-Valls, M.Remedios; José de la Vega-Prieto, María; Jorge-Ripper, Carlos; Durán-Castellón, M. Carmen; Santolaria-Fernández, F

2014-01-01

Background Sclerostin inhibits osteoblast functions, differentiations, and survival rates. As an endogenous inhibitor of the Wnt/β-catenin pathway, the sclerostin should be related to decreased bone masses, although several studies indicate opposite results. In addition, it may be related to insulin resistances and carbohydrate metabolisms, a relation shared with other markers of bone metabolisms, such as osteocalcin. Hepatitis C virus (HCV) infected patients may present osteoporosis, and frequently show liver steatosis, which is a consequence of insulin resistance. The behaviour of sclerostin in these patients is yet unknown. The aim of this work is to analyse the relationships between serum sclerostin and osteocalcin levels and bone mineral density (BMD), liver functions, the intensity of liver steatosis and biochemical markers of bone homeostasis and insulin resistance in HCV-infected patients. Methods Forty HCV patients with 20 years of age and gender-matching controls were included in this study and underwent bone densitometry. Serum sclerostin, osteocalcin, collagen telopeptide, adiponectin, leptin, insulin, resistin, tumor necrosis factor (TNF)-α, and interleukin (IL)-6 were determined. Liver fat was histomorphometrically assessed. Results Sclerostin levels were slightly higher in patients than in controls, and were directly related to BMD at different parts of the skeleton, also to the serum telopeptide, and to the liver steatosis and TNF-α. On the contrary, osteocalcin showed a significant direct relationship with serum adiponectin, and an inverse one with IL-6. Conclusions Serum sclerostin levels were within the normal range in HCV patients, and correlated directly with BMD and serum telopeptide. In addition, the relationships of sclerostin and osteocalcin with variables associated with insulin resistance suggested the role of bones for intermediary metabolisms. PMID:24707469

Body mass index and bone loss among postmenopausal women: the 10-year follow-up of the OSTPRE cohort.

PubMed

Saarelainen, Jarmo; Kiviniemi, Vesa; Kröger, Heikki; Tuppurainen, Marjo; Niskanen, Leo; Jurvelin, Jukka; Honkanen, Risto

2012-03-01

Obesity protects against osteoporosis, but the magnitude of this association has been difficult to assess from cross-sectional or short term studies. We examined the time course of bone loss as a function of body mass index (BMI) in early and late postmenopausal women. Our study population (n = 300) was a random sample of the population-based Kuopio Osteoporosis Risk Factor and Prevention (OSTPRE) Study, Finland. We excluded women without complete BMD results, premenopausal women during the second bone densitometry and women who had used hormone replacement therapy, bisphosphonates or calcitonin. BMI along with femoral neck and spinal bone mineral density (BMD) were assessed three times by dual-energy X-ray absorptiometry during a mean follow-up of 10.5 years (SD 0.5). The mean baseline age was 53.6 years (SD 2.8), time since menopause 2.9 years (SD 4.3) and BMI 27.3 kg/m(2) (SD 4.4). The data was analyzed by linear mixed models. Thus, we were able to approximate the bone loss up to 20 postmenopausal years. To illustrate, a woman with a baseline BMI of 20 kg/m(2) became osteopenic 2 (spine) and 4 (femoral neck) years after menopause, while obesity (BMI of 30 kg/m(2)) delayed the incidence of osteopenia by 5 (spine) and 9 (femoral neck) years, respectively. The delay was due to high baseline BMD of the obese, while bone loss rate was similar for both lean and obese subjects. This lean versus obese difference may also be partly due to altered X-ray attenuation due to fat mass.

Alveolar bone healing process in spontaneously hypertensive rats (SHR). A radiographic densitometry study

PubMed Central

MANRIQUE, Natalia; PEREIRA, Cassiano Costa Silva; GARCIA, Lourdes Maria Gonzáles; MICARONI, Samuel; de CARVALHO, Antonio Augusto Ferreira; PERRI, Sílvia Helena Venturoli; OKAMOTO, Roberta; SUMIDA, Doris Hissako; ANTONIALI, Cristina

2012-01-01

Hypertension is one of the most important public health problems worldwide. If undiagnosed or untreated, this pathology represents a systemic risk factor and offers unfavorable conditions for dental treatments, especially those requiring bone healing. Objectives The purpose of this study was to demonstrate, by analysis of bone mineral density (BMD), that the alveolar bone healing process is altered in spontaneously hypertensive rats (SHRs). Material and Methods Wistar rats and SHRs were submitted to extraction of the upper right incisor and were euthanized 7, 14, 21, 28 and 42 days after surgery. Right maxillae were collected, radiographed and analyzed using Digora software. BMD was expressed as minimum (min), middle (med) and maximum (max) in the medium (MT) and apical (AT) thirds of the dental alveolus. Results The results were compared across days and groups. Wistar showed difference in med and max BMD in the MT between 7 and 28 and also between 14 and 28 days. The AT exhibited significant difference in med and min BMD between 7 and 28 days, as well as difference in min BMD between 28 and 42 days. SHRs showed lower med BMD in the MT at 28 days when compared to 21 and 42 days. Differences were observed across groups in med and min BMD at day 28 in the MT and AT; and in max BMD at 14, 21 and 42 days in the MT. Conclusions These results suggest that the alveolar bone healing process is delayed in SHRs comparing with Wistar rats. PMID:22666841

Protective effect of myo-inositol hexaphosphate (phytate) on bone mass loss in postmenopausal women.

PubMed

López-González, Angel A; Grases, Félix; Monroy, Nieves; Marí, Bartolome; Vicente-Herrero, Ma Teófila; Tur, Fernando; Perelló, Joan

2013-03-01

The objective of this paper was to evaluate the relationship between urinary concentrations of InsP6, bone mass loss and risk fracture in postmenopausal women. A total of 157 postmenopausal women were included in the study: 70 had low (≤0.76 μM), 42 intermediate (0.76-1.42 μM) and 45 high (≥1.42 μM) urinary phytate concentrations. Densitometry values for neck were measured at enrollment and after 12 months (lumbar spine and femoral neck), and 10-year risk fracture was calculated using the tool FRAX(®). Individuals with low InsP6 levels had significantly greater bone mass loss in the lumbar spine (3.08 ± 0.65 % vs. 0.43 ± 0.55 %) than did those with high phytate levels. Moreover, a significantly greater percentage of women with low than with high InsP6 levels showed more than 2 % of bone mass loss in the lumbar spine (55.6 vs. 20.7 %). The 10-year fracture probability was also significantly higher in the low-phytate group compared to the high-phytate group, both in hip (0.37 ± 0.06 % vs 0.18 ± 0.04 %) and major osteoporotic fracture (2.45 ± 0.24 % vs 1.83 ± 0.11 %). It can be concluded that high urinary phytate concentrations are correlated with reduced bone mass loss in lumbar spine over 12 months and with reduced 10-year probability of hip and major osteoporotic fracture, indicating that increased phytate consumption can prevent development of osteoporosis.

Falls, fractures and bone density in Parkinson's disease - a cross-sectional study.

PubMed

Tassorelli, Cristina; Berlangieri, Mariangela; Buscone, Simona; Bolla, Monica; De Icco, Roberto; Baricich, Alessio; Pacchetti, Claudio; Cisari, Carlo; Sandrini, Giorgio

2017-04-01

Evidence suggests that falls and associated bone fractures are more frequent in patients suffering from Parkinson's disease (PD) than in the general population. In this cross-sectional study we evaluated the clinical and biochemical characteristics that are associated to falls, fractures and bone health in a population of PD subjects. Forty-two consecutive subjects suffering from idiopathic PD (mild-to-moderate severity) with/without falls in the previous year were included. They were characterized as regards functional independence, balance, fear of falling, bone density (ultrasound densitometry) and plasma levels of vitamin D. Twenty-one age- and sex-matched healthy subjects were evaluated as controls. We detected a greater degree of osteoporosis in PD subjects as compared to controls, more pronounced in males than in females (Z-score: M -3.8 ± 1.6, F -2.28 ± 0.92, p = 0.0006). A positive correlation was found between independence levels and bone density or vitamin D levels. Twenty seven patients (64%) reported falls in the previous year. These were associated to post-traumatic fractures in 16 subjects (59% of fallers). Women fell more than men (fallers: 20 F/7 M; non fallers: 4 F/11 M, χ² test p = 0.02), although the occurrence of post-traumatic fractures among fallers did not differ between sexes (F 11/9, M 5/2, χ² test p > 0.05). Fallers with post-traumatic fractures showed higher degrees of motor impairment. These findings confirm that falls and osteoporosis represent major health issues in PD, already in the middle stages of disease.

Qualitative identification of rigid gas permeable contact lens materials by densitometry.

PubMed

Arce, C G; Schuman, P D; Schuman, W P

1999-10-01

We describe a practical method to qualitatively identify polymethylmethacrylate (PMMA) and rigid gas permeable (RGP) contact lens materials. By progressive dilution of a saturated saline solution made with distilled or tap water and sodium chloride, we recorded comparative densitometry of rigid contact lens materials using a small hydrometer or by liquid displacement. The method was sensitive enough to separate the polymethylmethacrylate, all silicon-methacrylates, and all but two fluorine-containing silicon-methacrylates. The hydrometer had a precision of three decimals rounded to the nearest 0.005. There was only one RGP product that could have been confused with the PMMA material. Most silicon-methacrylates had lower densities than fluorine containing silicon-methacrylates. Only four of 25 products under 1.117 gm/cm3 contained fluorine. Densitometry with a hydrometer is an effective non-destructive method to identify RGP materials and to verify their quality. The method is easier when lens blanks are tested, but in spite of differences in shape, size, and weight, densitometry may also be used with new or used contact lenses. Its simplicity and low cost makes densitometry feasible for any contact lens laboratory or clinic to use on a routine basis. Only silicon-methacrylates had an inverse relationship between density and oxygen permeability. As the silicon content of the contact lens increases, the Dk increases and the density decreases.

Assessment of bone in Ehlers Danlos syndrome by ultrasound and densitometry.

PubMed

Dolan, A L; Arden, N K; Grahame, R; Spector, T D

1998-10-01

Ehlers Danlos syndrome (EDS) is an inherited disorder of connective tissue characterised by hyperextensible skin, joint laxity, and easy bruising. There are phenotypic similarities with osteogenesis imperfecta, but in EDS a tendency to fracture or altered bone mass has not previously been considered to be a cardinal feature. This case-control design study investigates whether 23 patients with EDS had differences in fracture rates, bone mass, and calcaneal ultrasound parameters compared with age and sex matched controls. 23 cases of EDS (mean (SD) age 38.5 (15.5)) were compared with 23 controls (mean age 37.8 (14.5)). A significant reduction in bone density measured by dual energy x ray absorptiometry was found at the neck of femur by 0.9 SD, p = 0.05, and lumbar spine by 0.74 SD, p = 0.02. At the calcaneum, broad band ultrasound attenuation and speed of sound were significantly reduced compared with controls by 0.95 SD (p = 0.004) and 0.49 SD (p = 0.004) for broad band ultrasound attenuation and speed of sound respectively. Broad band ultrasound attenuation and speed of sound remained significantly reduced after adjusting for bone mineral density (BMD). After adjusting for functional status (HAQ), age and sex, hypermobility was inversely correlated with broad band ultrasound attenuation and SOS, but not BMD at hip or spine. Previous fracture was 10 times more common in EDS (p < 0.001), with 86.9% of patients reporting a total of 47 low impact fractures, compared with 8.7% of controls. This study has identified a tendency of EDS patients to fracture, have low bone mass and abnormal bone structure. The aetiology is likely to be multifactorial, with an inherited structural element, accentuated by immobility or reduced exercise. This is one of the first clinical studies to suggest ultrasound can detect structural differences in bone, independent of dual energy x ray absorptiometry.

The Effect of Changing Scan Mode on Trabecular Bone Score Using Lunar Prodigy.

PubMed

Chen, Weiwen; Slattery, Anthony; Center, Jacqueline; Pocock, Nicholas

2016-10-01

Trabecular bone score (TBS) is a measure of gray scale homogeneity that correlates with trabecular microarchitecture and is an independent predictor of fracture risk. TBS is being increasingly used in the assessment of patients at risk of osteoporosis and has recently been incorporated into FRAX ® . GE Lunar machines acquire spine scans using 1 of 3 acquisition modes depending on abdominal tissue thickness (thin, standard, and thick). From a database review, 30 patients (mean body mass index: 30.8, range 26.2-34.1) were identified who had undergone lumbar spine DXA scans (GE Lunar Prodigy, software 14.10; Lunar Radiation Corporation, Madison, WI) in both standard mode and thick mode, on the same day with no repositioning. Lumbar spine bone mineral density (L1-L4) and TBS were derived from the 30 paired spine scans. There was no significant difference in lumbar spine bone mineral density between the 2 scanning modes. There were, however, significant higher TBS values from the spine scans acquired in thick mode compared to the TBS values derived from spine acquisitions in standard mode (mean TBS difference: 0.24 [20%], standard deviation ±0.10). In conclusion, these preliminary data suggest that TBS values acquired in the GE Lunar Prodigy are dependent on the scanning mode used. Further evaluation is required to confirm the cause and develop appropriate protocols. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[INVESTIGATION OF THE LEVEL OF MINERAL DENSITY OF SKELETAL OSSEOUS TISSUE IN PATIENTS WITH PERIODONTAL TISSUE DISEASES].

PubMed

Hodovana, O I

2015-01-01

Results of investigation of mineral density condition of skeletal osseous tissue in patients with inflammatory and dystrophic-inflammatory diseases of periodontal tissues with ultrasound densitometry method have been presented. Various changes of osseous tissue of skeletal bones have been detected: osteopenia, osteoporosis and osteosclerosis, which correlated with the severity of pathological process in periodontium. Analysis of the obtained results has been carried out depending on patients' sex as well as form and severity degree of the course of periodontal diseases. It has been established that the peak of detected impairments of mineral density in the skeleton is due to osteopenia, the degree of severity of which deteriorates with the severity of pathological process in periodontal tissues, especially in women.

Bone Mineral Changes in Epilepsy Patients During Initial Years of Antiepileptic Drug Therapy.

PubMed

Shiek Ahmad, Baemisla; O'Brien, Terence John; Gorelik, Alexandra; Hill, Keith David; Wark, John Dennis

2016-10-01

Antiepileptic drug (AED) therapy is associated with decreased bone mineral density; however, the time course for this development is unclear. The aim of this study was to evaluate bone mineral changes during the initial years of AED therapy in AED-naive, newly diagnosed epilepsy patients compared with non-AED users. In 49 epilepsy patients newly started on AEDs and in 53 non-AED users of both genders, bone mineral density (BMD) and bone mineral content were measured using dual-energy X-ray absorptiometry at baseline (within the first year of therapy) and at least 1 yr later. Bone changes between the 2 assessments, adjusted for age, height, and weight, were calculated as the annual rate of change. The median duration of AED therapy was 3.5 mo at baseline and 27.6 mo at follow-up. No overall difference was found in mean BMD and bone mineral content measures between user and nonuser cohorts in both cross-sectional baseline and the annual rate of change (p > 0.05). However, users on carbamazepine monotherapy (n = 11) had an increased annual rate of total hip (-2.1% vs -0.8%, p = 0.020) and femoral neck BMD loss (-2.1% vs -0.6%, p = 0.032) compared to nonusers. They also had a marginally higher rate of femoral neck BMD loss (-2.1%, p = 0.049) compared with valproate (-0.1%, n = 13) and levetiracetam users (+0.6%, n = 13). During the initial years of AED treatment for epilepsy, no difference was found in bone measures between AED users as a group and nonuser cohorts. However, the data suggested that carbamazepine monotherapy was associated with increased bone loss at the hip regions, compared to users of levetiracetam or valproate and nonusers. Larger studies of longer duration are warranted to better delineate the bone effects of specific AEDs, with further consideration of the role of early dual-energy X-ray absorptiometry scanning and careful AED selection in potentially minimizing the impact on bone health in these patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Determination of Flavonoids, Phenolic Acids, and Xanthines in Mate Tea (Ilex paraguariensis St.-Hil.)

PubMed Central

Bojić, Mirza; Simon Haas, Vicente; Maleš, Željan

2013-01-01

Raw material, different formulations of foods, and dietary supplements of mate demands control of the content of bioactive substances for which high performance thin layer chromatography (TLC), described here, presents simple and rapid approach for detections as well as quantification. Using TLC densitometry, the following bioactive compounds were identified and quantified: chlorogenic acid (2.1 mg/g), caffeic acid (1.5 mg/g), rutin (5.2 mg/g), quercetin (2.2 mg/g), and kaempferol (4.5 mg/g). The results obtained with TLC densitometry for caffeine (5.4 mg/g) and theobromine (2.7 mg/g) show no statistical difference to the content of total xanthines (7.6 mg/g) obtained by UV-Vis spectrophotometry. Thus, TLC remains a technique of choice for simple and rapid analysis of great number of samples as well as a primary screening technique in plant analysis. PMID:23841023

Estimating Body Composition in Adolescent Sprint Athletes: Comparison of Different Methods in a 3 Years Longitudinal Design

PubMed Central

Aerenhouts, Dirk

2015-01-01

A recommended field method to assess body composition in adolescent sprint athletes is currently lacking. Existing methods developed for non-athletic adolescents were not longitudinally validated and do not take maturation status into account. This longitudinal study compared two field methods, i.e., a Bio Impedance Analysis (BIA) and a skinfold based equation, with underwater densitometry to track body fat percentage relative to years from age at peak height velocity in adolescent sprint athletes. In this study, adolescent sprint athletes (34 girls, 35 boys) were measured every 6 months during 3 years (age at start = 14.8 ± 1.5yrs in girls and 14.7 ± 1.9yrs in boys). Body fat percentage was estimated in 3 different ways: 1) using BIA with the TANITA TBF 410; 2) using a skinfold based equation; 3) using underwater densitometry which was considered as the reference method. Height for age since birth was used to estimate age at peak height velocity. Cross-sectional analyses were performed using repeated measures ANOVA and Pearson correlations between measurement methods at each occasion. Data were analyzed longitudinally using a multilevel cross-classified model with the PROC Mixed procedure. In boys, compared to underwater densitometry, the skinfold based formula revealed comparable values for body fatness during the study period whereas BIA showed a different pattern leading to an overestimation of body fatness starting from 4 years after age at peak height velocity. In girls, both the skinfold based formula and BIA overestimated body fatness across the whole range of years from peak height velocity. The skinfold based method appears to give an acceptable estimation of body composition during growth as compared to underwater densitometry in male adolescent sprinters. In girls, caution is warranted when interpreting estimations of body fatness by both BIA and a skinfold based formula since both methods tend to give an overestimation. PMID:26317426

Effect of chronic smoking on lens nucleus as assessed by Pentacam HR lens densitometry in young adults.

PubMed

Pekel, Gökhan; Cetin, Ebru Nevin; Acer, Semra; Yagci, Ramazan; Altintas, Seher; Ongun, Gülin Tugba

2014-06-01

To evaluate the effects of chronic tobacco smoking on lens nucleus by Pentacam HR lens densitometry (LD) in young adults. Prospective cross-sectional case series. Thirty subjects (23 M, 7 F) who were chronic cigarette smokers (≥10 cigarettes/day for at least 2 years) (group 1) and another 30 subjects (23 M, 7 F) who did not smoke (group 2), were included in this study. The patients were matched for age and sex between the groups. The exclusion criteria were any history of ocular surgery, any systemic disorders and any ocular diseases except for mild refractive disorders. Lens densitometry measurements were done with the Pentacam HR (Oculus, Wetzlar, Germany). The Schirmer test and pachymetry measurements were also performed. Mean age of the patients for both groups was 28.90 ± 8.20 years (range: 18-40 years). Mean lens densitometry (LD) measurements of Group 1 (chronic cigarette smoking group) were higher than those of Group 2 (control group) in all LD techniques; however only mean "peak" LD measurements showed a statistically significant difference between these two groups (Group 1: 8.67 ± 0.61, Group 2: 8.44 ± 0.70, p = 0.04). The mean Schirmer test value was 12.43 ± 5.60 mm in Group 1 and 13.00 ± 4.26 mm in Group 2 (p = 0.55). The mean central corneal thickness (CCT) value was 564.23 ± 34.61 µm in Group 1 and 550.47 ± 32.94 µm in Group 2 (p = 0.03). The Pentacam HR LD seems to be an important option for the evaluation of lens nucleus in young adults, because it gives objective and quantitative data. Although chronic smoking increases lens nucleus density in young adults, the effect is not statistically significant when compared with the control group.

Use of Competitive PCR to Detect and Quantify Haplosporidium nelsoni Infection (MSX disease) in the Eastern Oyster (Crassostrea virginica).

PubMed

Day, J Michael; Franklin, Dean E.; Brown, Bonnie L.

2000-09-01

This study was undertaken to develop a quantitative polymerase chain reaction assay that would improve the utility of PCR for detecting Haplosporidium nelsoni (MSX), a serious parasite of the eastern oyster Crassostrea virginica. A competitive PCR sequence was generated from the H. nelsoni small subunit ribosomal DNA fragment, originally described by Stokes and colleagues, that was amplified by the same PCR primers and had similar amplification performance. Assays performed using competitor dilutions ranging from 0.05 to 500 pg/µl DNA were used to test oyster samples designated using histological techniques as having "light" or "heavy" MSX infections. Visual diagnoses were confirmed equally well with three methods: densitometry of ethidium-bromide-stained agarose, densitometry of SYBRGreen-stained polyacrylamide gels, and analysis by GeneScan 3.0 of fluorescent products detected in ultrathin gels. Oysters diagnosed as negative for MSX tested as negative or light by PCR. Oysters with light MSX infections generally had less than 5 pg/µl infectious DNA. Oysters with heavy infections generally corresponded to 5 pg/µl or greater competitor dilutions.

[The effects of increased dietary calcium intake on bone mineral density in long-term lactating women, and recovery of bone loss caused by long-term lactation with low calcium diet].

PubMed

Yoneyama, Kyoko; Ikeda, Junko

2004-12-01

The purpose of this study was to examine the efficacy of an increased calcium (Ca) diet for preventing bone mineral loss in long-term lactating women, considering bone metabolism, and recovery of bone loss caused by long-term lactation with low dietary Ca intake. Two groups of long-term (> 12 mon.) lactating women ... one with an enhanced Ca intake (Group M, n = 22) and the other with diet feeding no cow's milk and no milk products (Group N, n = 16) ... and a control group of 21 non-lactating postpartum women (Group C) were studied. Bone mineral density (BMD) was measured by ultrasonic bone densitometry. Stiffness calculated from the combined value of speed of sound and broadband ultrasound attenuation was used as an index of BMD. BMD and bone metabolic markers in urine and serum (only M and C groups) were assessed from 1 approximately 12 weeks postpartum (initial) at six-month intervals for a maximum of two years and changes were compared among the groups. 1. The mean (+/- SD) dietary Ca intake was 1032 (209) mg/day in the M group. 2. After lactating for one year, the N group demonstrated significant decrease in BMD, with both 1 and 2 babies, whereas the M group had no significant change. 3. The BMD in the N group returned to initial levels at 0.5 approximately 1 year post-weaning, 4. In the N group, compared with the M group, the urinary Hydroxyproline/creatinine ratio was significantly higher at the initial measurement and half a year thereafter, while urinary Ca/ creatinine ratio was significantly lower after a year. However, there were no significant differences between the M and C groups. 5. Serum bone alkaline phosphatase was significantly higher in the M group compared with the C group. Bone loss during long-term lactation can be prevented with adequate dietary Ca intake. Once lost, recovery to initial levels occurs 0.5 approximately 1 year post-weaning.

Characterisation of mineralisation of bone and cartilage: X-ray diffraction and Ca and Sr K α X-ray fluorescence microscopy

NASA Astrophysics Data System (ADS)

Bradley, D. A.; Muthuvelu, P.; Ellis, R. E.; Green, E. M.; Attenburrow, D.; Barrett, R.; Arkill, K.; Colridge, D. B.; Winlove, C. P.

2007-10-01

Bone is a dynamic structure, constantly remodelling in response to changing mechanical and environmental factors. This is particularly evident in the mineral component encrusting the collagenous framework. The mineral is principally in the form of calcium apatite, but calcium can exchange with strontium, both during the cellular processes of mineralisation and resorption and by passive exchange with the deposited crystals. Mineralisation is generally characterized by densitometry, but because of the differences in absorption cross sections of calcium and strontium it can be misleading in studies of composition. In this work we have used X-ray diffraction to identify calcium and strontium apatite and X-ray fluorescence to quantify strontium and calcium distribution. With the beam characteristics available from synchrotron radiation, this has enabled us to obtain microscopic resolution on thin sections of bone and cartilage from the equine metacarpophalangeal joint. Two issues have been investigated; the first is the distribution of mineral in the bone-cartilage interface and within individual trabeculae. In trabecular bone the ratio of strontium to calcium concentration was typically 0.0035 ± 0.0020, and higher by a factor of ∼3 at the periphery than in the centre of a trabeculum (possibly reflecting the more rapid turnover of mineral in the surface layer). In the dense subchondral bone the ratio was similar, approximately doubling in the calcified cartilage. The second objective was to explore the changes in mineralisation associated with development of osteoarthrosis. We analysed lesions showing cartilage thinning and changes in the trabecular organization and density of the underlying bone. At the centre of the lesion the ratio of strontium to calcium was much lower than that in normal tissue, although the calcified cartilage still showed a higher ratio than the underlying bone. In the superficially normal tissue around the lesion the calcified cartilage returned to a normal ratio much more rapidly than the underlying bone. These data demonstrate the complex relationship between changes in cartilage and the underlying bone.

Combat sports practice favors bone mineral density among adolescent male athletes.

PubMed

Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Neffeti, Fadoua; Najjar, Mohamed Fadhel; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair

2015-01-01

The aim of this study was to determine the impact of combat sports practice on bone mineral density (BMD) and to analyze the relationship between bone parameters and anthropometric measurements, bone markers, and activity index (AI). In other words, to detect the most important determinant of BMD in the adolescent period among combat sports athletes. Fifty athletes engaged in combat sports, mean age 17.1±0.2 yr, were compared with 30 sedentary subjects who were matched for age, height, and pubertal stage. For all subjects, the whole-body BMD, lumbar spine BMD (L2-L4), and BMD in the pelvis, arms, and legs was measured by dual-energy X-ray absorptiometry, and anthropometric measurements were evaluated. Daily calcium intake, bone resorption, and formation markers were measured. BMD measurements were greater in the combat sports athletes than in the sedentary group (p<0.01). Weight, body mass index, and lean body mass were significantly correlated with BMD in different sites. Daily calcium consumption lower than daily calcium intake recommended in both athletes and sedentary group. AI was strongly correlated with all BMD measurements particularly with the whole body, legs, and arms. Negative correlations were observed between bone markers and BMD in different sites. The common major predictor of BMD measurements was AI (p<0.0001). AI associated to lean body mass determined whole-body BMD until 74%. AI explained both BMD in arms and L2-L4 at 25%. AI associated to height can account for 63% of the variance in BMD legs. These observations suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the AI. Children and adolescents should be encouraged to participate in combat sports to maximize their bone accrual. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Interpretation and use of FRAX in clinical practice - position paper of the International Osteoporosis Foundation and the International Society for Clinical Densitometry

USDA-ARS?s Scientific Manuscript database

The International Osteoporosis Foundation (IOF) and the International Society for Clinical Densitometry (ISCD) appointed a joint Task Force to develop resource documents in order to make recommendations on how to improve FRAX and better inform clinicians who use FRAX. The Task Force met in November...

Role of ghrelin and insulin-like growth factor binding protein-3 in the development of osteoporosis in inflammatory bowel disease.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-07-01

A high prevalence of bone loss is observed in patients with inflammatory bowel disease (IBD). Leptin, ghrelin, insulin-like growth factor (IGF)-1, and IGF binding protein (IGFBP)-3 have been suggested to interfere in the bone metabolism. The aim of this study was to investigate the role of these peptides in the development of osteoporosis in IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy x-ray absorptiometry at the femoral neck and lumbar spine levels. Serum samples were collected from all patients and analyzed for concentrations of the aforementioned peptides by radioimmunoassay. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. Positive statistically significant correlations were found between body mass index (BMI), leptin, IGFBP-3 levels, and the bone mineral density (BMD) of the femoral neck and lumbar spine. Moreover, an inverse statistically significant correlation was found between BMD of the femoral neck and the lumbar spine, and age, duration of the disease, and ghrelin levels. Multivariate analysis revealed that the most significant factors associated with the BMD were age and BMI. A weak but statistically significant correlation was found between IGFBP-3 and femoral neck BMD (P=0.045) and between ghrelin and spine BMD (P=0.039). No correlation was observed between leptin and BMD. Low BMI is the most important independent risk factor for osteoporosis in IBD patients. There is no independent influence of leptin but ghrelin and IGFBP-3 may play a role in the bone metabolism in the IBD.

The effect of Amifostine prophylaxis on bone densitometry, biomechanical strength and union in mandibular pathologic fracture repair.

PubMed

Tchanque-Fossuo, Catherine N; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S; Weiss, Daniela M; Buchman, Steven R

2013-11-01

Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine's effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. © 2013.

Amifostine Prophylaxis on Bone Densitometry, Biomechanical Strength and Union in Mandibular Pathologic Fracture Repair

PubMed Central

Tchanque-Fossuo, Catherine N.; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S.; Weiss, Daniela M.

2013-01-01

Background Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine’s effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Materials and Methods Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. Results All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Conclusion Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. PMID:23860272

Testosterone is an independent determinant of bone mineral density in men with type 2 diabetes mellitus.

PubMed

Vasilkova, Olga; Mokhort, Tatiana; Sanec, Igor; Sharshakova, Tamara; Hayashida, Naomi; Takamura, Noboru

2011-01-01

Although many reports have elucidated pathophysiological characteristics of abnormal bone metabolism in patients with type 2 diabetes mellitus (DT2), determinants of bone mineral density (BMD) in patients with DT2 are still controversial. We examined 168 Belarussian men 45-60 years of age. Plasma total cholesterol (TC), high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol, triglycerides, hemoglobin A(1c) (HbA(1c)), immunoreactive insulin, and C-reactive protein concentrations were assessed. BMD was measured using dual energy X-ray densitometry of the lumbar spine (L(1)-L(4)). Total testosterone (TT) and sex hormone-binding globulin were measured, and free testosterone (FT) was calculated. Using univariate linear regression analysis, BMD of the lumbar spine was significantly correlated with FT (r=0.32, p<0.01) and TT (r=0.36, p<0.01). Using multiple linear regression analysis adjusted for confounding factors, BMD was significantly correlated with TT (β=0.23, p<0.001) and TC (β=-0.029, p=0.005). Age (β=0.005, p=0.071), body mass index (β=0.005, p=0.053), HbA(1c) (β=-0.002, p=0.72) and duration of diabetes (β=0.001, p=0.62) were not significantly correlated with BMD. Our data indicate that androgens are independent determinants of BMD in male patients with DT2.

Fertility desires, choice of hormone replacement and the effect of length of time since menopause on bone density in women with premature ovarian insufficiency: a review of 223 consecutive new referrals to a tertiary centre.

PubMed

Mittal, Monica; Kreatsa, Maria; Narvekar, Nitish; Savvas, Michael; Hamoda, Haitham

2014-09-01

Premature ovarian insufficiency can have significant implications for the affected women. This review assesses the fertility desires, choice of hormone replacement, and the effect of time since menopause on the bone density of these women. This is a retrospective analysis of 223 consecutive new referrals. The average age (mean [± standard deviation]) of the women was 37.35 (± 5.88) years, with 24.1% (n = 19/79) presenting within 12 months of the onset of symptoms, most commonly, vasomotor type symptoms (n = 98/223; 43.9%). Of the women included, 58.7% (n = 131/223) took hormone replacement therapy (HRT), most commonly, an oral (n = 90/131; 68.7%) sequential preparation (n = 91/131; 69.5%), with a significant number of women >40 years of age preferring the transdermal route (n = 26/54; 48.1%; p<0.01). A total of 37.7% (n = 84/223) of the women expressed concerns regarding their future fertility, more notable in women ≤ 40 years (n = 72/142; 50.7%; p < 0.01). Of these, 41.7% (n = 35/84) took HRT, most commonly, a sequential regimen (n = 26/35; 74.3%) with oral estradiol (n = 30/35; 85.7%); 69.5% (n = 155/223) of the women had had a bone densitometry scan performed, with 66.5% (n = 103/155) showing normal bone mineral density (BMD), but a greater likelihood of having reduced BMD the greater the time delay in presentation. No difference was seen for the three broad categories of BMD when further analysed for the cause of premature ovarian insufficiency, but a significant difference was noted for the spinal Z-scores, whereby women who underwent a surgically induced menopause were noted to have lower BMD compared with the other causes (p < 0.01). These findings can be useful in counselling women and guiding clinicians in their management of women with premature ovarian insufficiency. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

The value of hypercalciuria in patients with osteopenia versus osteoporosis.

PubMed

Girón-Prieto, María Sierra; Del Carmen Cano-García, María; Poyatos-Andújar, Antonio; Arias-Santiago, Salvador; de Haro-Muñoz, Tomás; Arrabal-Martín, Miguel; Arrabal-Polo, Miguel Ángel

2017-06-01

The aim of this study was to analyze the presence of lithogenic metabolic factors in the blood and urine of patients with osteopenia versus osteoporosis. This is a cross-sectional study including 67 patients who were divided into two groups according to the presence of either osteopenia or osteoporosis as measured by bone densitometry: group 1-40 patients with osteopenia (22 men and 18 women) and group 2-27 patients with osteoporosis (13 men and 14 women). Metabolic studies were performed on the blood and urine; statistical analysis was performed comparing means and conducting linear correlation and multivariate analyses with SPSS. Statistical significance was considered to be p ≤ 0.05. The mean age of patients in group 1 was 52.9 ± 12.8 years versus 50.3 ± 11.4 in group 2; the difference was not statistically significant. In group 2, higher levels of osteocalcin, β-crosslaps, urinary calcium, fasting urine calcium/creatinine, 24 h urine calcium/creatinine and 24 h oxaluria were observed compared to group 1. In the multivariate analysis, only the β-crosslaps and urinary calcium were independently associated with osteoporosis. It would be advisable to determine the urinary calcium levels in patients with osteoporosis since altered levels may necessitate modifying the diagnostic and therapeutic approach to osteoporosis.

Deficiency of Retinaldehyde Dehydrogenase 1 Induces BMP2 and Increases Bone Mass In Vivo

PubMed Central

Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W.; Brown, Jonathan D.; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J.; Plutzky, Jorge

2013-01-01

The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1−/−) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1−/− mice. In serum assays, Aldh1a1−/− mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1−/− mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1−/− mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1−/− mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling. PMID:23951127

Body composition of adult cystic fibrosis patients and control subjects as determined by densitometry, bioelectrical impedance, total-body electrical conductivity, skinfold measurements, and deuterium oxide dilution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newby, M.J.; Keim, N.L.; Brown, D.L.

1990-08-01

This study contrasts body compositions (by six methods) of eight cystic fibrosis (CF) subjects with those of eight control subjects matched for age, height, and sex. CF subjects weighed 84% as much as control subjects. Densitometry and two bioelectrical impedance-analysis methods suggested that reduced CF weights were due to less lean tissue (10.7, 9.5, and 10.4 kg). Total-body electrical conductivity (TOBEC) and skinfold-thickness measurements indicated that CF subjects were leaner than control subjects and had less fat (5.4 and 3.6 kg) and less lean (5.2 and 7 kg) tissue. D2O dilution showed a pattern similar to TOBEC (8.3 kg lessmore » lean, 2.7 kg less fat tissue). Densitometry estimates of fat (mass and percent) were not correlated (r less than 0.74, p greater than 0.05) with any other method for CF subjects but were correlated with all other methods for control subjects. CF subjects contained less fat and lean tissue than did control subjects. Densitometry by underwater weighing is unsuitable for assessing body composition of CF patients.« less

Low bone mineral density in Greek patients with inflammatory bowel disease: prevalence and risk factors.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios Z; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-01-01

A high prevalence of osteopenia and osteoporosis is observed in patients with inflammatory bowel disease (IBD). Various risk factors of bone loss have been suggested in IBD. The aim of the present study was to investigate the prevalence of low bone mineral density (BMD) and to identify related risk factors in Greek patients with IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy X-ray absorptiometry at the femoral neck and lumbar spine levels. Serum levels of 25 hydroxyvitamin D (25 OH D), 1.25 dihydroxyvitamin D (1.25 OH 2D), osteocalcin, calcitonin and homocysteine were measured in all participants. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. No significant differences between IBD patients with osteopenia or osteoporosis and those with normal BMD concerning the use of steroids and the examined biochemical markers were found. Statistically significant differences among the three groups were found for body mass index (BMI), age and disease duration (P=0.002, P<0.0001 and P=0.03 respectively). Multivariate analysis revealed that the most significant factors associated with BMD were age and BMI (P<0.0001). A weak but statistically significant correlation was also found for disease duration (P=0.04). There is a high prevalence of osteopenia and osteoporosis in Greek patients with IBD. Low BMI, age and disease duration are the most important independent risk factors for osteoporosis in Greek IBD patients.

Radiographic morphometry and densitometry predict strength of cadaveric proximal humeri more reliably than age and DXA scan density.

PubMed

Skedros, John G; Knight, Alex N; Pitts, Todd C; O'Rourke, Peter J; Burkhead, Wayne Z

2016-02-01

Methods are needed for identifying poorer quality cadaver proximal humeri to ensure that they are not disproportionately segregated into experimental groups for fracture studies. We hypothesized that measurements made from radiographs of cadaveric proximal humeri are stronger predictors of fracture strength than chronological age or bone density values derived from dual-energy x-ray absorptiometry (DXA) scans. Thirty-three proximal humeri (range: 39-78 years) were analyzed for: (1) bone mineral density (BMD, g/cm(2)) using DXA, (2) bulk density (g/cm(3)) using DXA and volume displacement, (3) regional bone density in millimeters of aluminum (mmAl) using radiographs, and (4) regional mean (medial+lateral) cortical thickness and cortical index (CI) using radiographs. The bones were then fractured simulating a fall. Strongest correlations with ultimate fracture load (UFL) were: mean cortical thickness at two diaphyseal locations (r = 0.71; p < 0.001), and mean mmAl in the humeral head (r = 0.70; p < 0.001). Weaker correlations were found between UFL and DXA-BMD (r = 0.60), bulk density (r = 0.43), CI (r = 0.61), and age (r = -0.65) (p values <0.01). Analyses between UFL and the product of any two characteristics showed six combinations with r-values >0.80, but none included DXA-derived density, CI, or age. Radiographic morphometric and densitometric measurements from radiographs are therefore stronger predictors of UFL than age, CI, or DXA-derived density measurements. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Assessment of vitamin K2 levels in osteoporotic patients: a case control study.

PubMed

Noori, Akram; Lashkari, Mahin; Oveisi, Sonia; Khair Khah, Mohamad Reza; Zargar, Ali

2014-07-14

The aim of this study was to measure the level of Vitamin K2 (Vit K2) in osteoporotic patients and individuals with normal bone density as controls. This case-control study was done in Outpatient Department of Rheumatology at Qazvin Boo-ali Sina Hospital in 2013. Participants were 50 patients with osteoporotic densitometry measured by DEXA (T score? -2.5) who were matched with 48 persons in control group with normal bone density (T score> -1). The level of Vit K2 in samples was measured using enzyme linked immunosorbent assay (ELISA). Data were analyzed by Mann-Whitney U test and Chi-square test. The level of Vit K2 in patients with osteoporosis was not significantly different from the control group (Median: 75.95 vs. 71.35 nmol/L, respectively; P-value: 0.709). The authors determined cut-offs 75 percentile of vitamin K2 in all participants that was 85 nmol/L and percentages of persons in two groups were similar. Although Vit K2 level in patients with osteoporosis was not significantly different from the control group, further studies are necessary to confirm the association of osteoporosis and Vit K2.

Association between duration of playing video games and bone mineral density in Chinese adolescents.

PubMed

Shao, Haiyu; Xu, Shaonan; Zhang, Jun; Zheng, Jiayin; Chen, Jinping; Huang, Yazeng; Ru, Bin; Jin, Yongming; Zhang, Qi; Ying, Qifeng

2015-01-01

The aim of the study was to investigate the association between duration of playing video games and bone mineral density (BMD) in Chinese adolescents. Three hundred eighty-four Chinese adolescents aged 14-18 yr (148 males and 236 females) were analyzed. Anthropometric measurements were obtained using standard procedures. Total body and regional BMD were measured using dual-energy X-ray absorptiometry. Duration of playing video games, defined as hours per day, was measured by a self-report questionnaire. We examined the association between duration of playing video games and BMD using multiple linear regression analysis. After adjustment for age, sex, pubertal stage, parental education, body mass index, adolescents with longer video game duration were more likely to have lower legs, trunk, pelvic, spine, and total BMD (p < 0.05). We concluded that duration of video game was negatively associated with BMD in Chinese adolescents. These findings provide support for reducing duration of playing video games as a possible means to increase BMD in adolescents. Future research is needed to elucidate the underlined mechanisms linking playing video games and osteoporosis. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Primary hyperparathyroidism: recent advances.

PubMed

Walker, Marcella D; Bilezikian, John P

2018-07-01

The purpose of this review is to describe recent advances and changes in the evaluation and management of primary hyperparathyroidism (PHPT). Although it has long been recognized that asymptomatic PHPT is associated with bone loss, particularly at cortical skeletal sites when evaluated with dual-energy X-ray absorptiometry, new imaging techniques suggest that trabecular skeletal deterioration as well as clinically silent vertebral fractures and nephrolithiasis are common. Nonclassical targets of asymptomatic PHPT as well as the effect of vitamin D deficiency and treatment upon PHPT presentation have been the subject of recent intense investigation. Randomized clinical trials are now available regarding the effect of parathyroidectomy (PTX) upon both classical and nonclassical target organs. They have confirmed results from observational studies with regard to the skeletal benefits of PTX but have not consistently shown improvements in nonclassical symptoms. These findings have led to recommendations for more extensive renal and skeletal evaluation and broader criteria for PTX in PHPT. In addition to dual-energy X-ray absorptiometry, vertebral and renal imaging is recommended. When available, trabecular imaging techniques may be helpful. PTX criteria now include subclinical kidney stones, vertebral fractures and hypercalciuria, in addition to those based on age, serum calcium, bone densitometry and renal function.

Functional Effects of Prebiotic Fructans in Colon Cancer and Calcium Metabolism in Animal Models.

PubMed

Rivera-Huerta, Marisol; Lizárraga-Grimes, Vania Lorena; Castro-Torres, Ibrahim Guillermo; Tinoco-Méndez, Mabel; Macías-Rosales, Lucía; Sánchez-Bartéz, Francisco; Tapia-Pérez, Graciela Guadalupe; Romero-Romero, Laura; Gracia-Mora, María Isabel

2017-01-01

Inulin-type fructans are polymers of fructose molecules and are known for their capacity to enhance absorption of calcium and magnesium, to modulate gut microbiota and energy metabolism, and to improve glycemia. We evaluated and compared the effects of Chicory inulin "Synergy 1®" and inulin from Mexican agave "Metlin®" in two experimental models of colon cancer and bone calcium metabolism in mice and rats. Inulins inhibited the development of dextran sulfate sodium-induced colitis and colon cancer in mice; these fructans reduced the concentration of tumor necrosis factor alpha and prevented the formation of intestinal polyps, villous atrophy, and lymphoid hyperplasia. On the other hand, inulin treatments significantly increased bone densitometry (femur and vertebra) in ovariectomized rats without altering the concentration of many serum biochemical parameters and urinary parameters. Histopathology results were compared between different experimental groups. There were no apparent histological changes in rats treated with inulins and a mixture of inulins-isoflavones. Our results showed that inulin-type fructans have health-promoting properties related to enhanced calcium absorption, potential anticancer properties, and anti-inflammatory effects. The use of inulin as a prebiotic can improve health and prevent development of chronic diseases such as cancer and osteoporosis.

Skeletal changes during and after spaceflight.

PubMed

Vico, Laurence; Hargens, Alan

2018-03-21

Space sojourns are challenging for life. The ability of the human body to adapt to these extreme conditions has been noted since the beginning of human space travel. Skeletal alterations that occur during spaceflight are now better understood owing to tools such as dual-energy X-ray densitometry and high-resolution peripheral quantitative CT, and murine models help researchers to understand cellular and matrix changes that occur in bone and that are difficult to measure in humans. However, questions remain with regard to bone adaptation and osteocyte fate, as well as to interactions of the skeleton with fluid shifts towards the head and with the vascular system. Further investigations into the relationships between the musculoskeletal system, energy metabolism and sensory motor acclimatisation are needed. In this regard, an integrated intervention is required that will address multiple systems simultaneously. Importantly, radiation and isolation-related stresses are gaining increased attention as the prospect of human exploration into deep space draws nearer. Although space is a unique environment, clear parallels exist between the effects of spaceflight, periods of immobilization and ageing, with possibly irreversible features. Space travel offers an opportunity to establish integrated deconditioning and ageing interventions that combine nutritional, physical and pharmaceutical strategies.

Official Positions for FRAX(®) clinical regarding glucocorticoids: the impact of the use of glucocorticoids on the estimate by FRAX(®) of the 10 year risk of fracture from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®).

PubMed

Leib, Edward S; Saag, Kenneth G; Adachi, Jonathan D; Geusens, Piet P; Binkley, Neil; McCloskey, Eugene V; Hans, Didier B

2011-01-01

Given the significant impact the use of glucocorticoids can have on fracture risk independent of bone density, their use has been incorporated as one of the clinical risk factors for calculating the 10-year fracture risk in the World Health Organization's Fracture Risk Assessment Tool (FRAX(®)). Like the other clinical risk factors, the use of glucocorticoids is included as a dichotomous variable with use of steroids defined as past or present exposure of 3 months or more of use of a daily dose of 5 mg or more of prednisolone or equivalent. The purpose of this report is to give clinicians guidance on adjustments which should be made to the 10-year risk based on the dose, duration of use and mode of delivery of glucocorticoids preparations. A subcommittee of the International Society for Clinical Densitometry and International Osteoporosis Foundation joint Position Development Conference presented its findings to an expert panel and the following recommendations were selected. 1) There is a dose relationship between glucocorticoid use of greater than 3 months and fracture risk. The average dose exposure captured within FRAX(®) is likely to be a prednisone dose of 2.5-7.5 mg/day or its equivalent. Fracture probability is under-estimated when prednisone dose is greater than 7.5 mg/day and is over-estimated when the prednisone dose is less than 2.5 mg/day. 2) Frequent intermittent use of higher doses of glucocorticoids increases fracture risk. Because of the variability in dose and dosing schedule, quantification of this risk is not possible. 3) High dose inhaled glucocorticoids may be a risk factor for fracture. FRAX(®) may underestimate fracture probability in users of high dose inhaled glucocorticoids. 4) Appropriate glucocorticoid replacement in individuals with adrenal insufficiency has not been found to increase fracture risk. In such patients, use of glucocorticoids should not be included in FRAX(®) calculations. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Volleyball and Basketball Enhanced Bone Mass in Prepubescent Boys.

PubMed

Zouch, Mohamed; Chaari, Hamada; Zribi, Anis; Bouajina, Elyès; Vico, Laurence; Alexandre, Christian; Zaouali, Monia; Ben Nasr, Hela; Masmoudi, Liwa; Tabka, Zouhair

2016-01-01

The aim of this study was to examine the effect of volleyball and basketball practice on bone acquisition and to determine which of these 2 high-impact sports is more osteogenic in prepubertal period. We investigated 170 boys (aged 10-12 yr, Tanner stage I): 50 volleyball players (VB), 50 basketball players (BB), and 70 controls. Bone mineral content (BMC, g) and bone area (BA, cm(2)) were measured by dual-energy X-ray absorptiometry at different sites. We found that, both VB and BB have a higher BMC at whole body and most weight-bearing and nonweight-bearing sites than controls, except the BMC in head which was lower in VB and BB than controls. Moreover, only VB exhibited greater BMC in right and left ultra-distal radius than controls. No significant differences were observed between the 3 groups in lumbar spine, femoral neck, and left third D radius BMC. Athletes also exhibited a higher BA in whole body, limbs, lumbar spine, and femoral region than controls. In addition, they have a similar BA in head and left third D radius with controls. The VB exhibited a greater BA in most radius region than controls and a greater femoral neck BA than BB. A significant positive correlation was reported between total lean mass and both BMC and BA in whole body, lumbar spine, total hip, and right whole radius among VB and BB. In summary, we suggest that volleyball and basketball have an osteogenic effect BMC and BA in loaded sites in prepubescent boys. The increased bone mass induced by both volleyball and basketball training in the stressed sites was associated to a decreased skull BMC. Moreover, volleyball practice produces a more sensitive mechanical stress in loaded bones than basketball. This effect seems translated by femoral neck expansion. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Effects of high-impact exercise on the physical properties of bones of ovariectomized rats fed to a high-protein diet.

PubMed

Shimano, R C; Yanagihara, G R; Macedo, A P; Yamanaka, J S; Shimano, A C; Tavares, J M R S; Issa, J P M

2018-05-01

The aim of this study was to evaluate the effects of high-impact physical exercise as a prophylactic and therapeutic means in osteopenic bones of rats submitted to ovariectomy and protein diet intake. A total of 64 Wistar rats were divided into eight groups (n = 8 each), being: OVX, ovx, standard diet and sedentary; OVXE, ovx, standard diet and jump; OVXP, ovx, high-protein diet and sedentary; and OVXEP, ovx, high-protein diet and jump; SH, sham, standard diet and sedentary; SHE, sham, standard diet and jump; SHP, sham, high-protein diet and sedentary; and SHEP, sham, high-protein diet and jump. OVX surgery consists of ovariectomy, and sham was the control surgery. The jumping protocol consisted of 20 jumps/day, 5 days/week. The bone structure was evaluated by densitometry, mechanical tests, histomorphometric, and immunohistochemical analyses. A high-protein diet resulted in increased bone mineral density (P = .049), but decreased maximal load (P = .026) and bone volume fraction (P = .023). The benefits of physical exercise were demonstrated by higher values of the maximal load in the trained groups compared to the sedentary groups (P < .001). The sham groups had decreased immunostaining of osteocalcin (P = .004) and osteopontin (P = .010) compared to ovx groups. However, the high-protein diet (P = .005) and jump exercise (P = .017) resulted in lower immunostaining of osteopontin compared to the standard diet and sedentary groups, respectively. In this experimental model, it was concluded that ovariectomy and a high-fat diet can negatively affect bone tissue and the high-impact exercise was not enough to suppress the deleterious effects caused by the protein diet and ovariectomy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rapid and selective determination of multi-sulfonamides by high-performance thin layer chromatography coupled to fluorescent densitometry and electrospray ionization mass detection.

PubMed

Chen, Yisheng; Schwack, Wolfgang

2014-02-28

In the European Union (EU), sulfonamides are among the most widely administrated groups of antibiotics in animal husbandry. Therefore, monitoring their residues in edible animal tissues plays an important role in the EU food safety framework. In this work, a simple and efficient method for the rapid screening of twelve prior sulfonamides frequently prescribed as veterinary drugs by high-performance thin-layer chromatography (HPTLC) was established. Sample extracts obtained with acetonitrile were tenfold concentrated and applied to HPTLC without any further cleanup. Following separation and fluram derivatization, sensitive and selective quantitation of the analytes can readily be accomplished with fluorescent densitometry. Limits of detection and quantitation were 15-40 and 35-70μg/kg, respectively. Additionally, a confirmative detection by HPTLC-electrospray ionization mass spectrometry (HPTLC-ESI/MS) was optimized, offering straightforward identification of target zones. Therefore, the risk of potential false positive findings can efficiently be reduced. The method was validated to meet the enforced commission regulation (EU) No. 37/2010, regarding different matrix complexities (bovine milk, porcine liver and kidney). Copyright © 2014 Elsevier B.V. All rights reserved.

Validation Thin Layer Chromatography for the Determination of Acetaminophen in Tablets and Comparison with a Pharmacopeial Method

PubMed Central

Pyka, Alina; Budzisz, Marika; Dołowy, Małgorzata

2013-01-01

Adsorption thin layer chromatography (NP-TLC) with densitometry has been established for the identification and the quantification of acetaminophen in three leading commercial products of pharmaceutical tablets coded as brand: P1 (Product no. 1), P2 (Product no. 2), and P3 (Product no. 3). Applied chromatographic conditions have separated acetaminophen from its related substances, namely, 4-aminophenol and and 4′-chloroacetanilide. UV densitometry was performed in absorbance mode at 248 nm. The presented method was validated by specificity, range, linearity, accuracy, precision, detection limit, quantitative limit, and robustness. The TLC-densitometric method was also compared with a pharmacopeial UV-spectrophotometric method for the assay of acetaminophen, and the results confirmed statistically that the NP-TLC-densitometric method can be used as a substitute method. It could be said that the validated NP-TLC-densitometric method is suitable for the routine analysis of acetaminophen in quantity control laboratories. PMID:24063006

Genome size estimates for crustaceans using Feulgen image analysis densitometry of ethanol-preserved tissues.

PubMed

Jeffery, Nicholas W; Gregory, T Ryan

2014-10-01

Crustaceans are enormously diverse both phylogenetically and ecologically, but they remain substantially underrepresented in the existing genome size database. An expansion of this dataset could be facilitated if it were possible to obtain genome size estimates from ethanol-preserved specimens. In this study, two tests were performed in order to assess the reliability of genome size data generated using preserved material. First, the results of estimates based on flash-frozen versus ethanol-preserved material were compared across 37 species of crustaceans that differ widely in genome size. Second, a comparison was made of specimens from a single species that had been stored in ethanol for 1-14 years. In both cases, the use of gill tissue in Feulgen image analysis densitometry proved to be a very viable approach. This finding is of direct relevance to both new studies of field-collected crustaceans as well as potential studies based on existing collections. © 2014 International Society for Advancement of Cytometry.

[Prevalence of osteoporosis, estimation of probability of fracture and bone metabolism study in patients with newly diagnosed prostate cancer in the health area of Lugo].

PubMed

Miguel-Carrera, Jonatan; García-Porrua, Carlos; de Toro Santos, Francisco Javier; Picallo-Sánchez, Jose Antonio

2018-03-01

To study the prevalence of osteoporosis and fracture probability in patients diagnosed with prostate cancer. Observational descriptive transversal study. SITE: Study performed from Primary Care of Lugo in collaboration with Rheumatology and Urology Services of our referral hospital. Patients diagnosed with prostate cancer without bone metastatic disease from January to December 2012. Epidemiologic, clinical, laboratory and densitometric variables involved in osteoporosis were collected. The likelihood of fracture was estimated by FRAX ® Tool. Eighty-three patients met the inclusion criteria. None was excluded. The average age was 67 years. The Body Mass Index was 28.28. Twenty-five patients (30.1%) had previous osteoporotic fractures. Other prevalent risk factors were alcohol (26.5%) and smoking (22.9%). Eighty-two subjects had vitamin D below normal level (98.80%). Femoral Neck densitometry showed that 8.9% had osteoporosis and 54% osteopenia. The average fracture risk in this population, estimated by FRAX ® , was 2.63% for hip fracture and 5.28% for major fracture. Cut level for FRAX ® major fracture value without DXA >5% and ≥7.5% proposed by Azagra et al. showed 24 patients (28.92%) and 8 patients (9.64%) respectively. The prevalence of osteoporosis in this population was very high. The more frequent risk factors associated with osteoporosis were: previous osteoporotic fracture, alcohol consumption, smoking and family history of previous fracture. The probability of fracture using femoral neck FRAX ® tool was low. Vitamin D deficiency was very common (98.8%). Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

[Parity and menarche as risk factors for osteoporosis in postmenopausal women].

PubMed

Mendoza-Romo, Miguel Angel; Ramírez-Arriola, Mariá Cleofás; Velasco-Chávez, José Fernando; Rivera-Martínez, José Guillermo; de Jesús, Rafael Natividad Nieva; Valdez-Jiménez, Luis Alvaro

2014-02-01

Worldwide studies, even in our country, have thrown discrepant results about the relation between osteoporosis, parity and age of menarche. To investigate the relation of osteoporosis in postmenopausal mexican women with multiparity and age of menarche. Transversal, retrospective and analytical study. Non-probabilistic sampling technique was performing with users women of the IMSS in San Luis Potosí. Reproductive history and age of menarche were obtained by the addition of these items to the previously validated Albrand questionnaire. Women were divided into groups according to the number of pregnancies in: normal parity (0 to 3 childbirths) conformed by 112 patients (46%) and multiparity (> or = 4 pregnancies), 131 women (54%). In relation to menarche with an average of 12.98 years, from this number we divided them in: early menarche (before the age of 13) and late menarche (at 13 years of age or after). It was measured bone mineral density with dual distal forearm x-ray absorptiometry to all patients. 243 women were studied, with an average of age of 55.92, rank 31 to 80 years. Using the criteria, of the World Health Organization, 18% of posmenopausal women had osteoporosis, 39% had osteopenia and 41% had bone normality. No association was found between the number of deeds and osteoporosis. Additionally we observed that the women who had 4 or more children were older than the other women. average 57.42 against 54.16. Also there was significant negative correlation (r = -0.43) between age and densitometry. In addition we found that an age greater to 13 years in the appearance of the menarche was related to osteoporosis (OR 4.46; p = 0.035). In posmenopausal women a menarche at the age of 13 years or after is a risk factor for osteoporosis.

[DEFINITION OF INTERRELATION BETWEEN AMINOACID COMPOSITION OF URINE AND BONE TISSUE DENSITY AT CHILDREN WITH ACUTE LEUKAEMIA FOR ONCOHEMATOLOGICAL PATHOLOGY RISK GROUP FORMATION].

PubMed

Bebeshko, V G; Bruslova, E M; Volodina, T T; Tsvietkova, N M; Lyashenko, L A; Pushkareva, T I; Voloshko, V I; Veselskaya, L P; Chernysh, T A; Trikhleb, I V

2014-12-01

Age and sexual indexies of densitometry at patients with acute leukemia (AL) and healthy children are presented. 31% of children with AL during the initial period of disease had manifestations of the osteopenic syndrome. At patients with AL more often than at healthy children anomalies of development of front part of skull are defined. The partial contribution of free and peptides-connencted oxyproline in urine at AL patients differs in comparison with control group that is caused by modification or deficiency of the corresponding enzymes. 30% of patients with AL had raised concentration of free oxyproline in urine, and lowered glycine concentration that testifies to the increased disintegration of collagen and deficiency of tile plastic material necessary for collagene-forming processes. The obtained data should be considered for forming of risk group on oncohematological pathology at children.

[Influence of occupational factors on the bone and joint functional state in the upper extremities and cervical spine in female workers of clothing manufacture].

PubMed

Druzhinin, V N; Shardakova, É F; Cherniĭ, A N

2014-01-01

The studies using multiple X-ray methods covered influence of complex containing working process and occupational environment factors on locomotory apparatus of upper limbs and cervical spine in female seamers engaged into various productions. Comparative analysis involved results of regular (standard X-ray) and special X-ray methods (stereoroentgenography, high definition roentgenography, roentgen densitometry, roentgenogrammetry) in 370 examinees with early and moderate clinical symptoms of occupationally mediated diseases of the stated areas. X-ray studies of locomotory apparatus of upper limbs and cervical spine in clothing manufacture workers, with special diagnostic methods, enabled to determine incidence and severity of functional and structural changes more reliably than via standard examination. The changes revealed were assigned mostly in "early" and "moderate" categories and matched with occupational peculiarities of the workers examined.

Premature greying of the hair is not associated with low bone mineral density.

PubMed

Beardsworth, S A; Kearney, C E; Steel, S A; Newman, J; Purdie, D W

1999-01-01

In two recent case-control studies premature greying of the hair was associated with a lowering of bone mineral density (BMD) and osteopenia, suggesting that this might be a clinically useful risk marker for osteoporosis. We report a further re-examination of this proposal in 52 prematurely grey-haired women from East Yorkshire who responded to an advertisement inviting them for bone densitometry. Thirty-five had no clinical or drug history that could influence bone density. All were Caucasian with a mean age of 52.8 years. In the group as a whole the mean BMD values at the lumbar spine and femoral neck were no different from those of a young adult, but there was a trend toward a greater than average BMD than that of the local age-matched population (p = 0.097 and 0.218, respectively). Twenty women were premenopausal, with an average age of 45.3 years. Mean BMD values at the lumbar spine and femoral neck in this group were no different from those of young adults. There was, however, a trend toward a BMD greater than that of the local age-matched population at the femoral neck (p = 0.117). Fifteen women were postmenopausal with an average age of 62.9 years and an average age at menopause of 51.1 years. Mean BMD values at both the lumbar spine and femoral neck in this group were lower than those of young adults, but no different from those of the local age-matched population. In conclusion, our group of prematurely grey-haired women had average BMD for their age, and we are therefore unable to support the proposed clinical usefulness of premature greying as a risk marker for osteoporosis.

Cost-minimization study comparing annual infusion of zoledronic acid or weekly oral alendronate in women with low bone mineral density.

PubMed

Chávez-Valencia, Venice; Arce-Salinas, César Alejandro; Espinosa-Ortega, Fabricio

2014-01-01

Cost-minimization study to assess the annual direct costs of 2 antiresorptive strategies in postmenopausal women with low bone mineral densities (BMDs). Patients were randomly assigned to receive 70 mg of oral weekly alendronate or a 1-time 5mg of intravenous zoledronic acid. All medical and nonmedical direct costs were recorded for 1 yr. Student's t-test or the Chi-squared test was used. A total of 101 postmenopausal women were enrolled with a mean age of 58.3 ± 7.6 yr and a postmenopausal period of 13.5 ± 8.3 yr. A total of 50 patients completed 1 yr of alendronate and 51 patients received zoledronic acid. At baseline, no differences were seen between the 2 groups in anthropometric measures, comorbidities, and bone mineral density. The costs for medical attention for low bone mass were $81,532 (US Dollars) for the alendronate group and $69,251 for the zoledronic acid group; the cost per patient was $1631 in the alendronate group vs $1358 in the zoledronic acid group (p<0.0001). Therefore, zoledronic acid treatment provided an annual savings of 15% of the direct costs compared with oral alendronate treatment. Moreover, there was a significant increase in lumbar spine T-scores in the zoledronic acid group when compared with the alendronate group. Annual zoledronic acid infusion as an antiresorptive treatment in women with low BMD provides significant monetary savings when compared with weekly alendronate therapy for 1 yr. Zoledronic acid infusion is also linked to higher increase in BMD and compliance. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Number of teeth and hormonal profile of postmenopausal women with osteoporosis, osteopenia and normal bone mineral density--a preliminary study].

PubMed

Stagraczyński, Maciej; Kulczyk, Tomasz; Leszczyński, Piotr; Męczekalski, Błażej

2015-10-01

Profound hypoestrogenism causes increased risk of osteoporosis and bone fracture in menopause. This period of women life is also characterized by decrease number of teeth and deterioration of oral cavity health. The aim of the study was to assess the number of teeth, hormonal profile (Follicle-stimualting hormone (FSH), estradiol (E2), testosterone (T) and dehydroepiandrosterone sulphate (DHEA-S) and the bone mineral density (BMD) of the lumbar part of the spine in postmenopausal women with osteoporosis, osteopenia and normal BMD. The next step of the study was to determine whether there was a correlation between vertebral mineral bone density, the hormonal profile and the number of teeth. A total number of 47 women was involved in the study. Based on the results of densitometry tests (DEXA) of vertebral column the subjects were divided into 3 groups: 10 with osteoporosis, 20 with osteopenia and 17 with normal BMD. All the subjects had undergone a hormonal assessment which included blood serum estimation for FSH, E2, DHEA-S and T levels. Also the total number of teeth present was recorded. Serum estradiol and testosterone levels in postmenopausal women were found to be positively correlated with the number of teeth present. A negative correlation was found between age and the number of maxillary teeth in postmenopausal women with osteopenia. There was no influence of serum FSH, estradiol, testosterone and DHEA-S levels on vertebral BMD loss in postmenopausal women. There was no correlation between teeth number and BMD of vertebral column. Serum levels of estradiol and testosterone in postmenopausal women positively correlate with teeth numbers. Age is the main risk factor for teeth loss in postmenopausal women. © 2015 MEDPRESS.

Risk factors for stress fracture among young female cross-country runners.

PubMed

Kelsey, Jennifer L; Bachrach, Laura K; Procter-Gray, Elizabeth; Nieves, Jeri; Greendale, Gail A; Sowers, Maryfran; Brown, Byron W; Matheson, Kim A; Crawford, Sybil L; Cobb, Kristin L

2007-09-01

To identify risk factors for stress fracture among young female distance runners. Participants were 127 competitive female distance runners, aged 18-26, who provided at least some follow-up data in a randomized trial among 150 runners of the effects of oral contraceptives on bone health. After completing a baseline questionnaire and undergoing bone densitometry, they were followed an average of 1.85 yr. Eighteen participants had at least one stress fracture during follow-up. Baseline characteristics associated (P<0.10) in multivariate analysis with stress fracture occurrence were one or more previous stress fractures (rate ratio [RR] [95% confidence interval]=6.42 (1.80-22.87), lower whole-body bone mineral content (RR=2.70 [1.26-5.88] per 1-SD [293.2 g] decrease), younger chronologic age (RR=1.42 [1.05-1.92] per 1-yr decrease), lower dietary calcium intake (RR=1.11 [0.98-1.25] per 100-mg decrease), and younger age at menarche (RR=1.92 [1.15-3.23] per 1-yr decrease). Although not statistically significant, a history of irregular menstrual periods was also associated with increased risk (RR=3.41 [0.69-16.91]). Training-related factors did not affect risk. The results of this and other studies indicate that risk factors for stress fracture among young female runners include previous stress fractures, lower bone mass, and, although not statistically significant in this study, menstrual irregularity. More study is needed of the associations between stress fracture and age, calcium intake, and age at menarche. Given the importance of stress fractures to runners, identifying preventive measures is of high priority.

Comparative effects of denosumab or bisphosphonate treatment on bone mineral density and calcium metabolism in postmenopausal women.

PubMed

Augoulea, A; Tsakonas, E; Triantafyllopoulos, I; Rizos, D; Armeni, E; Tsoltos, N; Tournis, S; Deligeoroglou, E; Antoniou, A; Lambrinoudaki, I

2017-03-01

To clarify potential differences between denosumab (DNS) and bisphosphonates (BIS) in terms of bone density and bone metabolism, in a sample of postmenopausal women. A total of 113 postmenopausal women aged 53-66 years were treated with either DNS or BIS for 12 months. Bone densitometry and laboratory tests were compared between baseline and follow-up. Femoral neck BMD increased in both treatment-arms (FN-BMD, DNS: 0.69±0.07 g/cm 2 to 0.75±0.09 g/cm 2 ; BIS: 0.69±0.06 g/cm 2 to 0.71±0.07 g/cm 2 ; p≤0.001 in both cases). Lumbar spine BMD (LS-BMD) increased significantly only in the DNS-group (0.83±0.14 g/cm 2 to 0.89±0.14 g/cm 2 , p=0.0001). Only women under treatment with DNS had a significant increase in serum parathyroid hormone (PTH: 44.87±17.54 pg/mL to 53.27±15.77 pg/mL, p=0.04), independently of baseline vitamin D levels. DNS-administration resulted in higher increase from baseline in FN-BMD compared to BIS (DNS vs BIS: 8.7%±8.5 vs 3.8%±7.3, p=0.004). Finally, baseline 25OH vitamin D levels did not determine the extent of PTH-increase following administration of DNS- or BIS-treatment. Both treatments increased BMD, however, the effect of DNS on FN-BMD was superior compared to that of BIS. DNS-treatment increased serum PTH. Baseline 25OH vitamin D levels did not predict the extent of PTH increase at follow-up.

Quantitative coronary angiography using image recovery techniques for background estimation in unsubtracted images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Jerry T.; Kamyar, Farzad; Molloi, Sabee

2007-10-15

Densitometry measurements have been performed previously using subtracted images. However, digital subtraction angiography (DSA) in coronary angiography is highly susceptible to misregistration artifacts due to the temporal separation of background and target images. Misregistration artifacts due to respiration and patient motion occur frequently, and organ motion is unavoidable. Quantitative densitometric techniques would be more clinically feasible if they could be implemented using unsubtracted images. The goal of this study is to evaluate image recovery techniques for densitometry measurements using unsubtracted images. A humanoid phantom and eight swine (25-35 kg) were used to evaluate the accuracy and precision of the followingmore » image recovery techniques: Local averaging (LA), morphological filtering (MF), linear interpolation (LI), and curvature-driven diffusion image inpainting (CDD). Images of iodinated vessel phantoms placed over the heart of the humanoid phantom or swine were acquired. In addition, coronary angiograms were obtained after power injections of a nonionic iodinated contrast solution in an in vivo swine study. Background signals were estimated and removed with LA, MF, LI, and CDD. Iodine masses in the vessel phantoms were quantified and compared to known amounts. Moreover, the total iodine in left anterior descending arteries was measured and compared with DSA measurements. In the humanoid phantom study, the average root mean square errors associated with quantifying iodine mass using LA and MF were approximately 6% and 9%, respectively. The corresponding average root mean square errors associated with quantifying iodine mass using LI and CDD were both approximately 3%. In the in vivo swine study, the root mean square errors associated with quantifying iodine in the vessel phantoms with LA and MF were approximately 5% and 12%, respectively. The corresponding average root mean square errors using LI and CDD were both 3%. The standard deviations in the differences between measured iodine mass in left anterior descending arteries using DSA and LA, MF, LI, or CDD were calculated. The standard deviations in the DSA-LA and DSA-MF differences (both {approx}21 mg) were approximately a factor of 3 greater than that of the DSA-LI and DSA-CDD differences (both {approx}7 mg). Local averaging and morphological filtering were considered inadequate for use in quantitative densitometry. Linear interpolation and curvature-driven diffusion image inpainting were found to be effective techniques for use with densitometry in quantifying iodine mass in vitro and in vivo. They can be used with unsubtracted images to estimate background anatomical signals and obtain accurate densitometry results. The high level of accuracy and precision in quantification associated with using LI and CDD suggests the potential of these techniques in applications where background mask images are difficult to obtain, such as lumen volume and blood flow quantification using coronary arteriography.« less

Calcium supplementation does not augment bone gain in young women consuming diets moderately low in calcium.

PubMed

Barger-Lux, M Janet; Davies, K Michael; Heaney, Robert P

2005-10-01

In earlier observational work, the dietary calcium:protein ratio was directly related to bone accrual in healthy postadolescent women. In this study, we sought to test the hypothesis that augmented calcium intake would increase postadolescent skeletal consolidation, using a double-blind, randomized, placebo-controlled design. We recruited 152 healthy young women (age 23.1 +/- 2.7 y, BMI 22.5 +/- 3.0 kg/m2); their usual diets, as assessed by 7-d food diaries, were low in calcium (605 +/- 181 mg/d; 15.1 +/- 4.5 mmol/d) and in the calcium:protein ratio (10.1 +/- 2.0 mg/g). The subjects were randomly assigned to supplemental calcium [500 mg calcium (12.5 mmol) as the carbonate, 3 times/d, with meals] or placebo capsules identical in appearance; all participants also took a daily multivitamin, and they were followed for up to 36 mo with bone densitometry (dual energy X-ray absorptiometry; DXA) at 6-mo intervals. A total of 121 subjects remained in the study for at least 12 mo (median time in the study, 35 mo), with a mean compliance level (observed/expected tablet consumption) of 87.7%. DXA data for these 121 subjects indicated modest but significant mean rates of increase (i.e., 0.24 to 1.10%/y) in bone mineral content (BMC; total body, total hip, and lumbar spine) and in lumbar spine bone mineral density (BMD) but no change in total hip BMD. None of these rates of change differed by group, i.e., calcium supplementation did not have any measurable effect on bone mass accrual. By midstudy, the calcium content of the subjects' usual diets for both groups had risen by approximately 15%. The combined effect of improved intakes of dietary calcium and the small amount of calcium added by the multivitamin tablets resulted in a mean calcium intake for the control group > 800 mg (20 mmol)/d, possibly at or near the threshold beyond which additional calcium has no further effect on bone accrual.

Please Don't Move-Evaluating Motion Artifact From Peripheral Quantitative Computed Tomography Scans Using Textural Features.

PubMed

Rantalainen, Timo; Chivers, Paola; Beck, Belinda R; Robertson, Sam; Hart, Nicolas H; Nimphius, Sophia; Weeks, Benjamin K; McIntyre, Fleur; Hands, Beth; Siafarikas, Aris

Most imaging methods, including peripheral quantitative computed tomography (pQCT), are susceptible to motion artifacts particularly in fidgety pediatric populations. Methods currently used to address motion artifact include manual screening (visual inspection) and objective assessments of the scans. However, previously reported objective methods either cannot be applied on the reconstructed image or have not been tested for distal bone sites. Therefore, the purpose of the present study was to develop and validate motion artifact classifiers to quantify motion artifact in pQCT scans. Whether textural features could provide adequate motion artifact classification performance in 2 adolescent datasets with pQCT scans from tibial and radial diaphyses and epiphyses was tested. The first dataset was split into training (66% of sample) and validation (33% of sample) datasets. Visual classification was used as the ground truth. Moderate to substantial classification performance (J48 classifier, kappa coefficients from 0.57 to 0.80) was observed in the validation dataset with the novel texture-based classifier. In applying the same classifier to the second cross-sectional dataset, a slight-to-fair (κ = 0.01-0.39) classification performance was observed. Overall, this novel textural analysis-based classifier provided a moderate-to-substantial classification of motion artifact when the classifier was specifically trained for the measurement device and population. Classification based on textural features may be used to prescreen obviously acceptable and unacceptable scans, with a subsequent human-operated visual classification of any remaining scans. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Clinical relevance of radiologic examination of the skeleton and bone density measurements in osteoporosis of old age

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuester, W.; Seidl, G.; Linkesch, W.

1981-10-01

For the diagnosis of primary osteoporosis, various semiquantitative radiologic methods were compared in 149 unselected patients, aged over 50 years. Crush fracture syndrome (CFS), lumbar spine index (LSI), and Singh Index (SI) were assessed by three radiologists and after reevaluation, the intra- and interobserver errors were calculated. The reliability of the subjective grading was improved by joint and repeated reading of the radiographs. Additionally, the peripheral trabecular bone content was measured by photon absorption densitometry (PAD). To test the value of the various semiquantitative methods. LSI, Si, and PAD have been compared with sex-matching before and after separation into agemore » in decades in CFS-positive and CFS-negative patients. In an attempt to differentiate osteoporotics and non-osteoporotics by CFS, our results indicate that CFS-positive and CFS-negative males cannot be separated by LSI, Si, and PAD, whereas in females these methods can discriminate irrespective of the age in decades. However, in age related groups, only SI can discriminate significantly between CFS-positive and CFS-negative females. Correlation of the semiquantitative methods, regardless of the diagnosis of a CFS, revealed a significant correlation-between SI and PAD, but no correlation between LSI and SI, and LSI and PAD, respectively.« less

Effect of Clothing on Measurement of Bone Mineral Density.

PubMed

McNamara, Elizabeth A; Feldman, Anna Z; Malabanan, Alan O; Abate, Ejigayehu G; Whittaker, LaTarsha G; Yano-Litwin, Amanda; Dorazio, Jolene; Rosen, Harold N

2016-01-01

It is unknown whether allowing patients to have BMD (bone mineral density) studies acquired while wearing radiolucent clothing adlib contributes appreciably to the measurement error seen. To examine this question, a spine phantom was scanned 30 times without any clothing, while draped with a gown, and while draped with heavy winter clothing. The effect on mean BMD and on SD (standard deviation) was assessed. The effect of clothing on mean or SD of the area was not significant. The effect of clothing on mean and SD for BMD was small but significant and was around 1.6% for the mean. However, the effect on BMD precision was much more clinically important. Without clothing the spine phantom had an least significant change of 0.0077 gm/cm(2), while when introducing variability of clothing the least significant change rose as high as 0.0305 gm/cm(2). We conclude that, adding clothing to the spine phantom had a small but statistically significant effect on the mean BMD and on variance of the measurement. It is unlikely that the effect on mean BMD has any clinical significance, but the effect on the reproducibility (precision) of the result is likely clinically significant. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Cartilage Degeneration, Subchondral Mineral and Meniscal Mineral Densities in Hartley and Strain 13 Guinea Pigs

PubMed Central

Sun, Yubo; Scannell, Brian P; Honeycutt, Patrick R; Mauerhan, David R; H, James Norton; Hanley Jr, Edward N

2015-01-01

Osteoarthritis is a joint disease involved in articular cartilage, subchondral bone, meniscus and synovial membrane. This study sought to examine cartilage degeneration, subchondral bone mineral density (BMD) and meniscal mineral density (MD) in male Hartley, female Hartley and female strain 13 guinea pigs to determine the association of cartilage degeneration with subchondral BMD and meniscal MD. Cartilage degeneration, subchondral BMD and meniscal MD in 12 months old guinea pigs were examined with histochemistry, X-ray densitometry and calcium analysis. We found that male Hartley guinea pigs had more severe cartilage degeneration, subchondral BMD and meniscal MD than female Hartley guinea pigs, but not female strain 13 guinea pigs. Female strain 13 guinea pigs had more severe cartilage degeneration and higher subchondral BMD, but not meniscal MD, than female Hartley guinea pigs. These findings indicate that higher subchondral BMD, not meniscal MD, is associated with more severe cartilage degeneration in the guinea pigs and suggest that abnormal subchondral BMD may be a therapeutic target for OA treatment. These findings also indicate that the pathogenesis of OA in the male guinea pigs and female guinea pigs are different. Female strain 13 guinea pig may be used to study female gender-specific pathogenesis of OA. PMID:26401159

Basketball Affects Bone Mineral Density Accrual in Boys More Than Swimming and Other Impact Sports: 9-mo Follow-Up.

PubMed

Agostinete, Ricardo R; Lynch, Kyle R; Gobbo, Luís A; Lima, Manoel Carlos Spiguel; Ito, Igor H; Luiz-de-Marco, Rafael; Rodrigues-Junior, Mario A; Fernandes, Romulo A

2016-01-01

The objective of this study was to analyze the effect of different sports on bone mineral density (BMD) accrual among male adolescents during a 9-mo follow-up. The sample was composed of 82 boys (control [n = 13], basketball [n = 14], karate [n = 9], soccer [n = 18], judo [n = 12], and swimming [n = 16]) who were followed up for 9 mo (from October 2013 to August 2014). BMD (gram per square centimeter) was assessed at baseline and follow-up using a dual-energy X-ray absorptiometry scanner, whereas somatic maturation was estimated through the use of the peak height velocity. Vitamin D consumption was assessed by questionnaire. After 9 mo of follow-up, all groups (including the control group) presented significant BMD accrual (overall sample: 4.5% in the whole body). On the other hand, the basketball group presented higher BMD accrual in the upper limbs (17.6%) than the control group (7.2%). A similar difference was observed in whole-body BMD (control group: 4.1% vs basketball group: 7.1%). The basketball group had significantly higher BMD gains than the control group and other sports groups. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Lung densitometry: why, how and when

PubMed Central

Camiciottoli, Gianna; Diciotti, Stefano

2017-01-01

Lung densitometry assesses with computed tomography (CT) the X-ray attenuation of the pulmonary tissue which reflects both the degree of inflation and the structural lung abnormalities implying decreased attenuation, as in emphysema and cystic diseases, or increased attenuation, as in fibrosis. Five reasons justify replacement with lung densitometry of semi-quantitative visual scales used to measure extent and severity of diffuse lung diseases: (I) improved reproducibility; (II) complete vs. discrete assessment of the lung tissue; (III) shorter computation times; (IV) better correlation with pathology quantification of pulmonary emphysema; (V) better or equal correlation with pulmonary function tests (PFT). Commercially and open platform software are available for lung densitometry. It requires attention to technical and methodological issues including CT scanner calibration, radiation dose, and selection of thickness and filter to be applied to sections reconstructed from whole-lung CT acquisition. Critical is also the lung volume reached by the subject at scanning that can be measured in post-processing and represent valuable information per se. The measurements of lung density include mean and standard deviation, relative area (RA) at −970, −960 or −950 Hounsfield units (HU) and 1st and 15th percentile for emphysema in inspiratory scans, and RA at −856 HU for air trapping in expiratory scans. Kurtosis and skewness are used for evaluating pulmonary fibrosis in inspiratory scans. The main indication for lung densitometry is assessment of emphysema component in the single patient with chronic obstructive pulmonary diseases (COPD). Additional emerging applications include the evaluation of air trapping in COPD patients and in subjects at risk of emphysema and the staging in patients with lymphangioleiomyomatosis (LAM) and with pulmonary fibrosis. It has also been applied to assess prevalence of smoking-related emphysema and to monitor progression of smoking-related emphysema, alpha1 antitrypsin deficiency emphysema, and pulmonary fibrosis. Finally, it is recommended as end-point in pharmacological trials of emphysema and lung fibrosis. PMID:29221318

Assessment of liver volume with computed tomography and comparison of findings with ultrasonography.

PubMed

Bora, Aydın; Alptekin, Cem; Yavuz, Alpaslan; Batur, Abdussamet; Akdemir, Zülküf; Berköz, Mehmet

2014-12-01

In this study, we aimed to investigate the impact of non-alcoholic hepatic steatosis on the liver volume. As investigating hepatic steatosis, we utilized computed tomography (CT) to determine the degree of steatosis and we utilized hepatobiliary ultrasonography (USG) for densitometry and correlation. As hepatosteatosis group, 35 patients over 18 years of age and whose abdominal CT scans were requested by several clinics and performed routinely were included in this study, and as control group, 40 healthy subjects without hepatosteatosis (clinically and radiologically) and correlated with hepatosteatosis group in terms of age and gender were included in this study. CT densitometry and liver attenuation index (LAI) of all individuals who participated in our study were calculated, and contrast images of patients were transferred to CT-Volume Software (Siemens Syngo Multimodality Workplace; Version VE52A). In this study, interactive and automated volume measurement techniques were used together. The volumes were measured separately in patient and control group. In this study for each stage in USG, there was found a direct correlation in terms of LAI and volume, and this correlation was statistically significant (p < 0.01). Furthermore, statistical significance between size and USG stage draws attention (p < 0.05). A significance relationship between USG stage and age could not be determined. As a result, we have reached the conclusion that CT densitometry can be used as an assistive technique along with USG to determine the degree of steatosis in the non-alcoholic fatty liver disease, and there is a positive linear correlation between the liver size and volume, and liver volume increases in the non-alcoholic fatty liver disease.

Frequency, risk factors, and adverse sequelae of bone loss in patients with ostomy for inflammatory bowel diseases.

PubMed

Gupta, Supriya; Wu, Xianrui; Moore, Travis; Shen, Bo

2014-02-01

Bone loss in patients with inflammatory bowel disease (IBD) with ostomy has not been systemically studied. The aims of the study were to evaluate the frequency, risk factors, and sequelae of bone loss in patients with IBD and stomas and to monitor the change in bone mineral density (BMD) over time after ostomy. A total of 126 patients met the inclusion criteria (i.e., those with IBD diagnosis and stoma), including ileostomy (N = 120), colostomy (N = 3), and jejunostomy (N = 3). BMD was measured on dual-energy X-ray absorptiometry (DEXA). Patients were classified as having normal or low BMD based on the International Society for Clinical Densitometry criteria. Thirty-two demographic and clinical variables were evaluated with logistic regression models. At a median of 6.6 years (interquartile range, 2-18.7 yr) after stoma, 37 (29.4%) patients had a low BMD. On univariate analysis, there were no significant differences between the normal and low BMD groups in the following variables: gender, race, age at diagnosis of IBD, prevalence of Crohn's disease and ulcerative colitis, age at ostomy, duration from diagnosis to DEXA and from ostomy to DEXA, menopausal age, diabetes, hypothyroidism, renal stones, short bowel syndrome, history of smoking or excessive alcohol use, family history of IBD or osteoporosis, daily calcium and vitamin D supplement, estrogen replacement, and steroid use. Body mass index was significantly lower in the low BMD group than the normal BMD group (23.3 ± 5.5 versus 26.0 ± 5.2, P = 0.013). Fragility fracture occurred in 8 (21.6%) patients in low BMD group and 4 (4.5%) patients in normal BMD group (P = 0.006). In a multivariate analysis, low body mass index was the only covariate-adjusted factor associated with low BMD. In patients with multiple DEXA scans available over time after ostomy, hip BMD was found to improve marginally, and the lumbar and femoral BMD remained stable. Low BMD was common in patients with IBD after ostomy, largely based on the findings in patients with CD with ileostomy. Fragility fracture was 5 times more frequent in patients with ostomy with low BMD compared with those with normal BMD. The low BMD was associated with a low body mass index. Screening and surveillance of BMD should routinely be performed, particularly in these patients at risk. Bone mass tends to stabilize over time after stoma.

Osteoporosis in men.

PubMed

Binkley, Neil

2006-08-01

Osteoporosis is defined as "a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue with a consequent increase in bone fragility and susceptibility to fracture". Approximately 40-50% of women sustain osteoporotic fractures in their lifetime; as such, it is appropriate that studies initially focused upon females. Despite an increased recognition of osteoporotic fractures in men, there continues to be neglect of this disease in males. This ongoing neglect is inappropriate as 25-33% of men in some populations will sustain osteoporotic fractures in their lifetime. Testosterone plays an important role in male skeletal health. However, recent data suggest that estrogen may in fact be the dominant hormone regulating skeletal status in both men and women. BMD measurement may be utilized for osteoporosis diagnosis and to assist with fracture risk prediction in men prior to their sustaining a fracture. Recognizing this need, the International Society for Clinical Densitometry (ISCD) recommended and recently reaffirmed use of a BMD T-score of -2.5 or below be utilized to diagnose osteoporosis in men. Androgen therapy of hypogonadal men may be considered with the caveat that data do not exist to document that this treatment reduces fracture risk. At this time, the data is inadequate to support use of androgen treatment in eugonadal men with osteoporosis. Parathyroid hormone treatment does increase BMD; existing studies have not been of adequate size or duration to document fracture reduction efficacy. Bisphosphonate therapy increases BMD, reduces vertebral fracture risk and is considered the standard of care for osteoporotic men at this point in time.

Approach to the Child with Fractures

PubMed Central

Boyce, Alison M.

2011-01-01

Evaluation of the child with fractures is challenging, as no clear guidelines exist to distinguish traumatic from pathological fractures. Although most fractures in childhood are benign, recurrent fractures may be associated with a wide variety of primary skeletal diseases as well as secondary causes, necessitating a careful history and physical exam to guide the evaluation. There is no “gold standard” for the evaluation and treatment of children with fractures and low bone mineral density (BMD); therefore, the diagnosis of osteoporosis in a pediatric patient should be made using a combination of clinical and radiographic features. Interpretation of bone densitometry in growing patients presents a unique set of challenges because areal BMD measured by dual-energy x-ray absorptiometry depends on multiple dynamic variables. Interpretation of pediatric dual-energy x-ray absorptiometry should be based on Z-scores (sd scores compared to age, sex, and ethnicity-matched controls), using normative databases specific to the brand of densitometer and the patient population. Given the skeleton's ability to recover from low BMD through modeling and remodeling, optimizing management of underlying conditions leading to bone fragility is the initial step. Conservative measures including calcium and vitamin D supplementation and weight-bearing physical activity are important interventions that should not be overlooked. The use of bisphosphonates in children and adolescents is controversial due to lack of long-term efficacy and safety data and should be limited to clinical trials and compassionate therapy in children with significantly compromised quality of life. Close monitoring is required, and further study is necessary to assess their long-term safety and efficacy in children. PMID:21734001

Osteoporosis: the emperor has no clothes

PubMed Central

Järvinen, T L N; Michaëlsson, K; Aspenberg, P; Sievänen, H

2015-01-01

Current prevention strategies for low-trauma fractures amongst older persons depend on the notions that fractures are mainly caused by osteoporosis (pathophysiology), that patients at high risk can be identified (screening) and that the risk is amenable to bone-targeted pharmacotherapy (treatment). However, all these three notions can be disputed. Pathophysiology Most fracture patients have fallen, but actually do not have osteoporosis. A high likelihood of falling, in turn, is attributable to an ageing-related decline in physical functioning and general frailty. Screening Currently available fracture risk prediction strategies including bone densitometry and multifactorial prediction tools are unable to identify a large proportion of patients who will sustain a fracture, whereas many of those with a high fracture risk score will not sustain a fracture. Treatment The evidence for the viability of bone-targeted pharmacotherapy in preventing hip fracture and other clinical fragility fractures is mainly limited to women aged 65–80 years with osteoporosis, whereas the proof of hip fracture-preventing efficacy in women over 80 years of age and in men at all ages is meagre or absent. Further, the antihip fracture efficacy shown in clinical trials is absent in real-life studies. Many drugs for the treatment of osteoporosis have also been associated with increased risks of serious adverse events. There are also considerable uncertainties related to the efficacy of drug therapy in preventing clinical vertebral fractures, whereas the efficacy for preventing other fractures (relative risk reductions of 20–25%) remains moderate, particularly in terms of the low absolute risk reduction in fractures with this treatment. PMID:25809279

Bone mineral measurement: Skylab experiment M-078.

PubMed

Vogel, J M

1975-01-01

The observation that bone mineral is lost in patients who are either immobilized or remain in bed for extended periods of time formed the basis for the concern that large amounts of bone mineral may be lost during long periods of weightlessness. This concern was magnified when early X-ray densitometry studies suggested that rather large amounts of mineral could be lost during rather short periods of weightlessness (4-14 days). Even though these Gemini results have recently been modified, they still reflect substantial losses in the upper extremity. This led to a series of prolonged bed-rest studies (30-36 weeks) which, in addition to careful calcium balance, also employed a newer, more precise method of estimating bone mineral in the radius, ulna, and os calcis. It employed an essentially monoenergetic photon source (125I) and a scintillation detector operating in a rectilinear scanning mode to measure bone mineral by the absorptiometric technique. Bed-rest studies revealed variable mineral losses but suggested that little if any is lost during 4-6 weeks, with variable amounts being lost in 8 weeks. Losses up to 40% were noted in the os calcis after 9 months, with essentially none in the radius and ulna. When this technique was employed during the Apollo 14, 15, and 16 missions, only one crewman (CMP Apollo 15) showed significant losses in the os calcis and none in the radius or ulna. These results were, therefore, in concert with the bed-rest data but at variance with the earlier Gemini data. The variability observed during bed rest was reconciled when it was observed that the rate of loss could be correlated with the initial 24-hour urinary hydroxyproline excretion and the initial os calcis mineral content. Prediction terms were established. Measurements of the SL-II crew after 28 days of weightlessness revealed no significant bone mineral losses. The Skylab data lie within the predicted limits obtained from the bed-rest data. The relevance of the prediction terms to the Skylab and longer missions discussed.

Secondary osteoporosis.

PubMed

Boyle, I T

1993-10-01

Osteoporosis with attendant increased fracture risk is a common complication of many other diseases. Indeed, almost all chronic diseases make some impact on life-style, usually by restricting physical activity and hence reducing the anabolic effect of exercise and gravitational strains on the skeleton. Restricted appetite and modified gastrointestinal tract function is another commonplace finding that has an impact on bone nutrition and synthesis, as on other systems. Sex hormone status is of particular importance for the maintenance of the normal skeleton, and the postmenopausal woman is at particular risk for most causes of secondary osteoporosis. In dealing with secondary osteoporosis in the hypo-oestrogenic woman, the question of giving hormone replacement therapy in addition to other disease-specific therapy should always be considered, as, for example, in a young amenorrhoeic woman with Crohn's disease. Similarly, in hypogonadal men the administration of testosterone is useful for bone conservation. The wider availability of bone densitometry ought to make us more aware of the presence of osteoporosis in the many disease states discussed above. This is particularly important as the life span of such patients is now increased by improved management of the underlying disease process in many instances. Even in steroid-induced osteoporosis--one of the commonest and most severe forms of osteoporosis--we now have some effective therapy in the form of the bisphosphonates and other anti-bone-resorbing drug classes. The possibility of prophylaxis against secondary osteoporosis has therefore become a possibility, although the very long-term effects of such drug regimens are still unknown. In some situations, such as thyrotoxicosis, Cushing's syndrome and immobilization, spontaneous resolution of at least part of the osteoporosis is possible after cure of the underlying problem. The shorter the existence of the basic problem, the more successful the restoration of the skeleton appears to be. A useful credo for clinicians with respect to secondary osteoporosis is: to think of it; to use specific therapy for the underlying disease; to reduce or remove completely any relevant drug or toxic material; to optimize physical activity and general nutrition; to treat hypogonadism if present and feasible; and to consider the use of specific anti-bone-resorbing or other bone active drugs.

Interest of a prescreening questionnaire to reduce the cost of bone densitometry.

PubMed

Ben Sedrine, W; Broers, P; Devogelaer, J P; Depresseux, G; Kaufman, J M; Goemaere, S; Reginster, J Y

2002-05-01

Bone mineral density (BMD) measurement is widely recognized as the best single tool to identify patients with a high lifetime risk of developing an osteoporosis-related fracture. However, the cost/benefit value of screening the whole population has been repeatedly challenged and demonstrated to be rather poor. In many countries, BMD scan is not or no longer reimbursed because of lack of validated criteria to identify patients who should benefit from this procedure. Based on the proposals of a nationwide expert panel, a simple questionnaire identifying historical, clinical and behavioral risk factors for osteoporosis was developed. The aim of this study was to assess the diagnostic accuracy of the proposed criteria; to determine the extent to which this questionnaire could be useful for optimizing the use of densitometry tests; and, more specifically, to estimate the diagnostic costs per osteoporotic or osteopenic patient detected. For this purpose, we applied the questionnaire to 3998 consecutive individuals at least 20 years old, of both genders, either consulting spontaneously or referred for a BMD measurement to an outpatient osteoporosis center. BMD was measured by dual-energy X-ray absorptiometry (DXA) at the lumbar spine and at the hip (both total hip and femoral neck). Diagnostic accuracies were evaluated through measures of sensitivity, specificity, and positive and negative predictive values. After determining a benchmark value for age, different strategies were compared in order to identify the most cost-effective one in terms of cost per patient detected. According to the WHO operational definition of osteoporosis (T-score <-2.5), 31% of the subjects were classified as osteoporotic at one or more of the measured sites. If only patients with at least one of the proposed risk factors had been referred for scans, 33.3% of the BMD measurements would have been avoided. Among those, less than 5% were missclassified as they did have osteoporosis at the total hip and up to 23% at one or more of the considered sites. On the other hand, of the subjects who would be recommended for a densitometry test, only a small fraction were identified correctly (the positive predictive values varied from 11.3% at the total hip to 34.8% at any site). In this first setting, the suggested criteria seem useful chiefly for excluding subjects who do not need a DXA scan rather than selecting osteoporotic patients. When applied only to patients aged 61 years or more, the positive predictive values rose to 15.1% (total hip) and 42.9% (any site), whereas the corresponding negative predictive values were set at 93% and 68.6%. In comparison, with a mass screening scenario the estimated diagnostic costs (costs associated with the DXA procedure) per osteoporotic patient detected at any of the considered sites would be reduced by more than 9% (59.4 instead of 65.3 Euros) if the suggested indications are taken into account for prescreening patients. And when the questionnaire is applied only to women over the age of 60 years these costs would be further reduced to 50.6 Euros, representing a 23% decrease. Then, a prescreening strategy based on these indications concomitantly with an age-selective criterion could represent a promising way toward a more rational use of BMD measurement.

Bioindicators in the MIDUS National Study: Protocol, Measures, Sample, and Comparative Context

PubMed Central

Love, Gayle Dienberg; Seeman, Teresa E.; Weinstein, Maxine; Ryff, Carol D.

2010-01-01

Objectives MIDUS is a national study of health and aging among individuals aged 25 to 74 at baseline(1995/96). Longitudinal survey assessments (2004/05), were followed by biological assessments on a subsample aged 35–85. To facilitate public use, we describe the protocol, measures, and sample. Methods Respondents traveled to clinics for a two-day data collection protocol that included fasting blood specimens, 12-hour urine specimen, medical history, physical exam, bone densitometry, a laboratory challenge (heart rate variability, blood pressure, respiration, salivary cortisol). Results Response rates for the biological protocol (N = 1,255) were 39.3%, or 43.1% (adjusting for those who could not be located or contacted). Reasons for non-participation were travel, family obligations, and being too busy. Respondents were comparable to the recruitment pool on most demographic characteristics and health assessments. Discussion Strengths of the protocol vis-à-vis other similar studies include opportunities to link biological factors with diverse content from other MIDUS projects. PMID:20876364

Automated cell disruption is a reliable and effective method of isolating RNA from fresh snap-frozen normal and malignant oral mucosa samples.

PubMed

Van der Vorst, Sébastien; Dekairelle, Anne-France; Irenge, Léonid; Hamoir, Marc; Robert, Annie; Gala, Jean-Luc

2009-01-01

This study compared automated vs. manual tissue grinding in terms of RNA yield obtained from oral mucosa biopsies. A total of 20 patients undergoing uvulectomy for sleep-related disorders and 10 patients undergoing biopsy for head and neck squamous cell carcinoma were enrolled in the study. Samples were collected, snap-frozen in liquid nitrogen, and divided into two parts of similar weight. Sample grinding was performed on one sample from each pair, either manually or using an automated cell disruptor. The performance and efficacy of each homogenization approach was compared in terms of total RNA yield (spectrophotometry, fluorometry), mRNA quantity [densitometry of specific TP53 amplicons and TP53 quantitative reverse-transcribed real-time PCR (qRT-PCR)], and mRNA quality (functional analysis of separated alleles in yeast). Although spectrophotometry and fluorometry results were comparable for both homogenization methods, TP53 expression values obtained by amplicon densitometry and qRT-PCR were significantly and consistently better after automated homogenization (p<0.005) for both uvula and tumor samples. Functional analysis of separated alleles in yeast results was better with the automated technique for tumor samples. Automated tissue homogenization appears to be a versatile, quick, and reliable method of cell disruption and is especially useful in the case of small malignant samples, which show unreliable results when processed by manual homogenization.

Bone and fall-related fracture risks in women and men with a recent clinical fracture.

PubMed

van Helden, Svenhjalmar; van Geel, Antonia C M; Geusens, Piet P; Kessels, Alfons; Nieuwenhuijzen Kruseman, Arie C; Brink, Peter R G

2008-02-01

Worldwide fracture rates are increasing as a result of the aging population, and prevention, both primary and secondary, is an important public health goal. Therefore, we systematically analyzed risk factors in subjects with a recent clinical fracture. All men and women over fifty years of age who had been treated in the emergency department of, or hospitalized at, our institution because of a recent fracture during a one-year period were offered the opportunity to undergo an evidence-based bone and fall-related risk-factor assessment and bone densitometry. The women included in this study were also compared with a group of postmenopausal women without a fracture history who had been included in another cohort study. Of the 940 consecutive patients, 797 (85%) were eligible for this study and 568 (60%) agreed to participate. The prevalence of fall-related risk factors (75% [95% confidence interval = 71% to 78%]; n = 425) and the prevalence of bone-related risk factors (53% [95% confidence interval = 49% to 57%]; n = 299) at the time of fracture were higher than the prevalence of osteoporosis (35% [95% confidence interval = 31% to 39%]; n = 201) as defined by a dual x-ray absorptiometry T score of

Simultaneous Feulgen densitometry and autoradiographic grain counting with the Quantimet 720D image-analysis system. III. Improvements in Feulgen densitometry.

PubMed

Sklarew, R J

1983-10-01

A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.

Nuclear medicine techniques in the assessment of alkaptonuria.

PubMed

Vinjamuri, Sobhan; Ramesh, Chandakacharla N; Jarvis, Jonathan; Gallagher, Jim A; Ranganath, Lakshminarayana L

2011-10-01

Alkaptonuria is a rare autosomal recessive disorder due to a lack of the enzyme homogentisate dioxygenase, leading to ochronosis, a process of accumulation of a melanin-like polymer of homogentisic acid in cartilage and other collagenous structures. Patients develop severe osteoarthropathy that resembles osteoarthritis. Although the diagnosis of alkaptonuria is not particularly challenging in view of the blue-black discolouration of visible connective tissue and the presence of homogentisic acid in urine, the natural history of alkaptonuria remains poorly understood. Patients would benefit immensely from an objective assessment of their disease status and from a clearer understanding of the pathophysiology and associated physical changes. Isotope bone scans, which are commonly used to identify the extent of involvement of bones in cancerous processes, have also been increasingly used for characterizing the extent of arthropathy in conditions such as osteoarthritis and rheumatoid arthritis. Semiquantitative scores based on the extent of involvement of joints have been used to describe the involvement of large joints in the context of symptomatic treatment for osteoarthritis. A similar semiquantitative isotope bone scan score depending on the involvement of the number of large joints in patients with alkaptonuria can be formulated and validated in a suitable cohort of patients. Bone densitometry measurement using dual-energy X-ray absorptiometry scanning is an internationally accepted tool to assess the risk and extent of osteoporosis, and is increasingly used to assess the additional fracture risk in patients with arthropathy. We believe that, currently, nuclear medicine techniques can provide useful information, which can be incorporated into disease severity scores for alkaptonuria. Once the biological basis for alkaptonuria is better understood, it is feasible that nuclear medicine techniques of even greater sensitivity and specificity can be developed, thereby taking advantage of the vast advances in the fields of radiochemistry, radiopharmacy, positron emission tomography-computed tomography and positron emission tomography-magnetic resonance imaging scanning.

Muscular Maximal Strength Indices and Bone Variables in a Group of Elderly Women.

PubMed

Nasr, Riad; Al Rassy, Nathalie; Watelain, Eric; Matta, Joseph; Frenn, Fabienne; Rizkallah, Maroun; Maalouf, Ghassan; El Khoury, César; Berro, Abdel-Jalil; El Hage, Rawad

2018-03-22

The aim of the present study was to explore the relations between muscular maximal strength indices and bone parameters (bone mineral density [BMD], hip geometry indices, and trabecular bone score [TBS]) in a group of elderly women. This study included 35 healthy elderly women whose ages range between 65 and 75 yr (68.1 ± 3.1 yr). BMD (in gram per square centimeter) was determined for each individual by dual-energy X-ray absorptiometry at the whole body, lumbar spine (L1-L4), total hip (TH), and femoral neck (FN). L1-L4 TBS and hip geometry indices were also evaluated by dual-energy X-ray absorptiometry. Maximal muscle strength of bench press (1-repetition maximum [RM] bench press), maximal muscle strength of leg press (1-RM leg press), and handgrip were measured using validated methods. 1-RM bench press was positively correlated to TH BMD (r = 0.40; p < 0.05), FN BMD (r = 0.41; p < 0.05), FN section modulus (r = 0.33; p < 0.05), and FN cross-sectional moment of inertia (r = 0.35; p < 0.05). 1-RM leg press was positively correlated to TH BMD (r = 0.50; p < 0.01), FN BMD (r = 0.35; p < 0.05), FN cross-sectional area (r = 0.38; p < 0.05), and TBS (r = 0.37; p < 0.05). Handgrip was correlated only to FN cross-sectional moment of inertia (r = 0.43; p < 0.01). This study suggests that 1-RM bench press and 1-RM leg press are positive determinants of BMD in elderly women. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The utility of changes in serum levels of C-terminal telopeptide of type I collagen in predicting patient response to oral monthly ibandronate therapy.

PubMed

Hochberg, Marc C; Silverman, Stuart L; Barr, Charles E; Miller, Paul D

2010-01-01

Bone turnover markers may provide a more rapid indication of patient response to osteoporosis treatment than bone mineral density (BMD) measurements. This post hoc analysis of data from the MOBILE (Monthly Oral iBandronate In LadiEs) study assessed the relationship between increases in BMD at 12 mo from baseline after starting ibandronate treatment and changes in bone resorption marker serum C-terminal telopeptide of type I collagen (sCTX) from baseline at 3 and 6 mo. MOBILE enrolled postmenopausal women aged 55-80 yr with mean lumbar spine (LS) BMD T-score of -2.5 to -5.0. This analysis included women who received 150-mg monthly oral ibandronate (n=323). A high proportion of women were classified as BMD responders after 1 yr (BMD increase was >/=0%, i.e., 74-91% depending on skeletal site; BMD increase was >/=3%, i.e., 34-67%). Women with larger decreases in sCTX were more likely to be BMD responders. The percent increase in LS BMD at 12 mo was significantly associated with the percent decrease in sCTX at 3 mo from baseline (Pearson correlation coefficient: -0.19, p=0.0016). In linear regression models, percent decrease in sCTX at 3 mo from baseline was a significant predictor of 1-yr LS BMD response (R(2)=0.61, p=0.0007). These data suggest that 3-mo changes in sCTX levels are associated with 1-yr LS BMD increases in postmenopausal women treated with once-monthly oral ibandronate. The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

In vivo precision of the GE Lunar iDXA densitometer for the measurement of total-body, lumbar spine, and femoral bone mineral density in adults.

PubMed

Hind, Karen; Oldroyd, Brian; Truscott, John G

2010-01-01

Knowledge of precision is integral to the monitoring of bone mineral density (BMD) changes using dual-energy X-ray absorptiometry (DXA). We evaluated the precision for bone measurements acquired using a GE Lunar iDXA (GE Healthcare, Waukesha, WI) in self-selected men and women, with mean age of 34.8 yr (standard deviation [SD]: 8.4; range: 20.1-50.5), heterogeneous in terms of body mass index (mean: 25.8 kg/m(2); SD: 5.1; range: 16.7-42.7 kg/m(2)). Two consecutive iDXA scans (with repositioning) of the total body, lumbar spine, and femur were conducted within 1h, for each subject. The coefficient of variation (CV), the root-mean-square (RMS) averages of SDs of repeated measurements, and the corresponding 95% least significant change were calculated. Linear regression analyses were also undertaken. We found a high level of precision for BMD measurements, particularly for scans of the total body, lumbar spine, and total hip (RMS: 0.007, 0.004, and 0.007 g/cm(2); CV: 0.63%, 0.41%, and 0.53%, respectively). Precision error for the femoral neck was higher but still represented good reproducibility (RMS: 0.014 g/cm(2); CV: 1.36%). There were associations between body size and total-body BMD and total-hip BMD SD precisions (r=0.534-0.806, p<0.05) in male subjects. Regression parameters showed good association between consecutive measurements for all body sites (r(2)=0.98-0.99). The Lunar iDXA provided excellent precision for BMD measurements of the total body, lumbar spine, femoral neck, and total hip. Copyright © 2010 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between A163G osteoprotegerin gene polymorphism and other osteoporosis parameters in Roma and non-Roma postmenopausal women in eastern Slovakia.

PubMed

Mydlárová Blaščáková, Marta; Blaščáková, Ľudmila; Poráčová, Janka; Mydlár, Jozef; Vašková, Janka; Bernasovská, Jarmila; Boroňová, Iveta; Petrejčíková, Eva; Bernasovský, Ivan

2017-09-01

The study was focused on evaluating the possible correlation between biochemical, anthropometric, and genetic indicators of osteoporosis in postmenopausal women. The frequency of genotypes and differences in measured parameters were evaluated within two ethnically different groups of women in Slovakia. The study included 310 postmenopausal women divided into non-Roma and Roma groups. Based on results of densitometry, they were divided into control groups and women with osteoporosis and osteopenia. In all women, a genetic analysis of polymorphism of osteoprotegerin gene promotor region (A163G) was provided along with measurement of indicators of bone tissue metabolism. There is a particularly low incidence of osteoporosis in Roma women. We found a correlation between bone mineral density (BMD), body mass index, and waist and hip circumference in women with osteoporosis and in Roma women with osteopenia. The frequency of the AG genotype was higher in non-Roma women with osteoporosis, but reached only 10.7% in Roma women with osteopenia. While the presence of the G allele in the non-Roma population was accompanied by higher BMD and markers of osteoformation, it was accompanied by significantly higher concentrations of parathyroid hormone in the Roma population. The presence of the AG genotype has a different effect on bone metabolism in two ethnically diverse populations of women in Slovakia. In the general population, the presence of the G allele exhibited protective effects consistent with other studies, but in Roma population this appears to be the allele A. However, this requires a further study for confirmation and more detailed characterization of the differences between populations that have this work indicated. © 2016 Wiley Periodicals, Inc.

Grip strength is a predictor of bone mineral density among adolescent combat sport athletes.

PubMed

Nasri, Raouf; Hassen Zrour, Saoussen; Rebai, Haithem; Fadhel Najjar, Mohamed; Neffeti, Fadoua; Bergaoui, Naceur; Mejdoub, Hafedh; Tabka, Zouhair

2013-01-01

The aim of this study was firstly to investigate the correlation between bone parameters and grip strength (GS) in hands, explosive legs power (ELP), and hormonal parameters; second, to identify the most determinant variables of bone mineral density (BMD) among adolescent combat sport athletes. Fifty combat sport athletes aged 17.1 ± 0.2 year were compared with 30 sedentary subjects matched for age, height, and pubertal stage. For all subjects, the BMD in deferent sites associated with anthropometric parameters were measured by dual-energy X-ray absorptiometry. The growth hormone (GH) and testosterone (TESTO) concentrations were tested. The GS in dominant (GSDA) and nondominant arms (GSNDA) and ELP were evaluated. All BMD measured were greater in athletes than in sedentary group (p<0.01). The GS and ELP showed higher values in athletes than in sedentary group (p<0.01). The BMD in all sites were correlated with weight, but without correlation with height. The GSNDA and ELP were significantly correlated with BMD of both spine and legs. The GH was correlated with the BMD of whole body and spine (p<0.05). The TESTO was only correlated with BMD of the arms (p<0.01). The best predictor of BMD measurements is GSNDA. This study has proved the osteogenic effect of combat sports practice, especially judo and karate kyokushinkai. Therefore, children and adolescent should be encouraged to participate in combat sport. Moreover, it suggested that the best model predicting BMD in different sites among adolescent combat sports athletes was the GSNDA. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Precision of dual-energy X-ray absorptiometry of the knee and heel: methodology and implications for research to reduce bone mineral loss after spinal cord injury.

PubMed

Peppler, W T; Kim, W J; Ethans, K; Cowley, K C

2017-05-01

Methodological validation of dual-energy x-ray absorptiometry (DXA)-based measures of leg bone mineral density (BMD) based on the guidelines of the International Society for Clinical Densitometry. The primary objective of this study was to determine the precision of BMD estimates at the knee and heel using the manufacturer provided DXA acquisition algorithm. The secondary objective was to determine the smallest change in DXA-based measurement of BMD that should be surpassed (least significant change (LSC)) before suggesting that a biological change has occurred in the distal femur, proximal tibia and calcaneus. Academic Research Centre, Canada. Ten people with motor-complete SCI of at least 2 years duration and 10 people from the general population volunteered to have four DXA-based measurements taken of their femur, tibia and calcaneus. BMDs for seven regions of interest (RIs) were calculated, as were short-term precision (root-mean-square (RMS) standard deviation (g cm -2 ), RMS-coefficient of variation (RMS-CV, %)) and LSC. Overall, RMS-CV values were similar between SCI (3.63-10.20%, mean=5.3%) and able-bodied (1.85-5.73%, mean=4%) cohorts, despite lower absolute BMD values at each RIs in those with SCI (35%, heel to 54%, knee; P<0.0001). Precision was highest at the calcaneus and lowest at the femur. Except at the femur, RMS-CV values were under 6%. For DXA-based estimates of BMD at the distal femur, proximal tibia and calcaneus, these precision values suggest that LSC values >10% are needed to detect differences between treated and untreated groups in studies aimed at reducing bone mineral loss after SCI.

Imbalanced expression of RANKL and osteoprotegerin mRNA in pannus tissue of rheumatoid arthritis.

PubMed

Ainola, M; Mandelin, J; Liljeström, M; Konttinen, Y T; Salo, J

2008-01-01

To test if the pannus tissue is characterized by a high receptor activator of nuclear factor kappaB ligand to osteoprotegerin (RANKL:OPG) ratio, which could explain local osteoclastogenesis and formation of bony erosions. Messenger RNA and protein expressions of RANKL and OPG in rheumatoid and osteoarthritic tissue samples were measured using quantitative real-time RT-PCR and Western blot/densitometry. Pannus and synovitis fibroblasts explanted from tissue samples were cultured in vitro without and with TNF-alpha, IL-1Beta or IL-17 and analyzed quantitatively for RANKL expression. The ability of pannus fibroblasts to induce formation of multinuclear osteoclast-like cells from human monocytes, with macrophage-colony stimulating factor (M-CSF) but without RANKL added, was tested. Histochemical staining was used to assess the eventual presence of RANKL and tartrate resistant acid phosphatase positive osteoclast-like cells at the pannus-bone interface. RANKL:OPG ratios of messenger RNA (p<0.05) and protein level were high in pannus (2.06+/-0.73 and 2.2+/-0.65) compared to rheumatoid (0.62+/-0.13 and 1.31+/-0.69) and osteoarthritis (0.62+/-0.32 and 0.52+/-0.16) synovial membranes. Resting and stimulated (p dependent on the cytokine used) pannus fibroblasts produced RANKL in excess (p=0.0005) and unstimulated pannus fibroblasts also effectively induced osteoclast-like cell formation from monocytes in vitro without any exogenous RANKL added. Compatible with these findings, multinuclear osteoclasts-like cells were frequent in the fibroblast- and macrophage-rich pannus tissue at the soft tissue-to-bone interface. The high RANKL:OPG ratio, together with close fibroblast-to-monocyte contacts in pannus tissue, probably favor local generation of bone resorbing osteoclasts at the site of erosion in rheumatoid arthritis.

Validation of a thin-layer chromatography/densitometry method for the characterization of invertase activity.

PubMed

Ferey, Justine; Da Silva, David; Bravo-Veyrat, Sophie; Lafite, Pierre; Daniellou, Richard; Maunit, Benoît

2016-12-16

This paper presents a kinetic study of invertase, a specific fructofuranosidase cloned from the Leishmania major genome. The kinetic parameters of the β-d-fructofuranosidase from Leishmania major (BfrA) were determined using Thin-Layer Chromatography (TLC) and UV-densitometry (TLC@UV) specifically developed for the separation and detection of three carbohydrates namely sucrose, glucose and fructose. Separation was performed on TLC silica gel 60 F254 plates impregnated with sodium bisulphate and citrate and heated prior to development. This fast and easy separation was performed with two successive developments using ACN/H 2 O 80/20 (v/v) as mobile phase. Sensitive and repeatable derivatization of sugars was achieved by dipping the plates in a solution of 4-aminobenzoic acid. Quantification was performed by UV-detection. The method was validated according to ICH guidelines Q2(R1) in terms of specificity, limits of detection and quantification, precision and robustness (with n=3 replicates and CV ≤10%). The characterization of BfrA reaction kinetic was performed by monitoring the accumulation of either glucose or fructose detected by TLC@UV. Hydrolysis of sucrose was described by the Michaelis-Menten kinetic parameters (K M ; V max ) respectively equal to 63.09±7.590mM; 0.037±0.00094mM/min using glucose production and 83.01±14.39mM; 0.031±0.0021mM/min monitoring fructose. Hydrolyses of three alternative substrates, raffinose, stachyose and inulin, were also compared and the regiospecificity of the reaction was characterized. This TLC@UV method is shown to be suitable for the refined kinetic analysis of different reactions related to the hydrolysis of sugars. Copyright © 2016. Published by Elsevier B.V.

Clinical practice guidelines for the diagnosis and management of osteoporosis. Scientific Advisory Board, Osteoporosis Society of Canada.

PubMed Central

1996-01-01

OBJECTIVE: To recommend clinical practice guidelines for the assessment of people at risk for osteoporosis, and for effective diagnosis and management of the condition. OPTIONS: Screening and diagnostic methods: risk-factor assessment, clinical evaluation, measurement of bone mineral density, laboratory investigations. Prophylactic and corrective therapies: calcium and vitamin D nutritional supplementation, physical activity and fall-avoidance techniques, ovarian hormone therapy, bisphosphonate drugs, other drug therapies. Pain-management medications and techniques. OUTCOMES: Prevention of loss of bone mineral density and fracture; increased bone mass; and improved quality of life. EVIDENCE: Epidemiologic and clinical studies and reports were examined, with emphasis on recent randomized controlled trials. Clinical practice in Canada and elsewhere was surveyed. Availability of treatment products and diagnostic equipment in Canada was considered. VALUES: Cost-effective methods and products that can be adopted across Canada were considered. A high value was given to accurate assessment of fracture risk and osteoporosis, and to increasing bone mineral density, reducing fractures and fracture risk and minimizing side effects of diagnosis and treatment. BENEFITS, HARMS AND COSTS: Proper diagnosis and management of osteoporosis minimize injury and disability, improve quality of life for patients and reduce costs to society. Rationally targeted methods of screening and diagnosis are safe and cost effective. Harmful side effects and costs of recommended therapies are minimal compared with the harms and costs of untreated osteoporosis. Alternative therapies provide a range of choices for physicians and patients. RECOMMENDATIONS: Population sets at high risk should be identified and then the diagnosis confirmed through bone densitometry. Dual-energy x-ray absorptiometry is the preferred measurement technique. Radiography can be adjunct when indicated. Calcium and vitamin D nutritional supplementation should be at currently recommended levels. Patients should be counselled in fall-avoidance techniques and exercises. Immobilization should be avoided. Guidelines for management of acute pain are listed. Ovarian hormone therapy is the therapy of choice for osteoporosis prevention and treatment in postmenopausal women. Bisphosphonates are an alternative therapy for women with established osteoporosis who cannot or prefer not to take ovarian hormone therapy. PMID:8873639

Effects of physical exercise on bone mass, balance skill and aerobic capacity in women and men with low bone mineral density, after one year of training--a prospective study.

PubMed

Kronhed, A C; Möller, M

1998-10-01

Vadstena is a small community in the county of Ostergötland, Sweden, where a project began in 1989 to prevent osteoporosis and to lower the expected incidence of osteoporotic fractures. Persons aged 40-70 years who had a low bone mineral density (BMD) value at screening of the distal radius by single-photon absorptiometry (SPA) were invited to participate in a training study during one year. The definition of low BMD was a densitometry value below -1 SD (standard deviation) from a sex- and age-specific reference value (z-score). Fifteen persons wanted to exercise in a group and 15 persons wanted to become a control group. All participants answered a questionnaire about lifestyle, occupation, diseases, medication and heredity. Clinical tests were made regarding mobility of the joints and muscles, balance and physical fitness. BMD for the hip and the lumbar spine were assessed by dual-energy X-ray absorptiometry (DXA) before and after the investigation period. The training programme was carried out for 60 min twice a week during one year and had the intention to improve bone mass, muscle strength and flexibility, balance skill and aerobic capacity. After the training period there was a significant increase in BMD at the greater trochanter (P < 0.01), in balance skill (standing on one leg with closed eyes and "ski step"-test) (P < 0.05) and in oxygen uptake capacity (P < 0.05) in the exercise group. In the control group, there was a significant increase in BMD at the lumbar spine (P < 0.05). However, these results should be judged with caution because several participants were over the age of 60, and at that age degenerative changes in the lumbar spine may increase to a greater or lesser extent. Regular weight-bearing exercises during one year seem to influence BMD at the greater trochanter in a training group comprising both women and men. However, our study was small in number and further training studies are needed to assess the effect of weight-bearing training on bone mass in different sex- and age-specific groups.

Impact of Vitamin D Supplementation during Lactation on Vitamin D Status and Body Composition of Mother-Infant Pairs: A MAVID Randomized Controlled Trial

PubMed Central

Czech-Kowalska, Justyna; Latka-Grot, Julita; Bulsiewicz, Dorota; Jaworski, Maciej; Pludowski, Pawel; Wygledowska, Grazyna; Chazan, Bogdan; Pawlus, Beata; Zochowska, Anna; Borszewska-Kornacka, Maria K.; Karczmarewicz, Elzbieta; Czekuc-Kryskiewicz, Edyta; Dobrzanska, Anna

2014-01-01

Objective The optimal vitamin D intake for nursing women is controversial. Deterioration, at least in bone mass, is reported during lactation. This study evaluated whether vitamin D supplementation during lactation enhances the maternal and infant’s vitamin D status, bone mass and body composition. Design and Methods After term delivery, 174 healthy mothers were randomized to receive 1200 IU/d (800 IU/d+400 IU/d from multivitamins) or 400 IU/d (placebo+400 IU/d from multivitamins) of cholecalciferol for 6 months while breastfeeding. All infants received 400 IU/d of cholecalciferol. Serum 25-hydroxyvitamin D [25(OH)D], iPTH, calcium, urinary calcium, and densitometry were performed in mother-offspring pairs after delivery, and at 3 and 6 months later. Results A total of 137 (79%) (n = 70; 1200 IU/d, n = 67; 400 IU/d) completed the study. 25(OH)D was similar in both groups at baseline (13.7 ng/ml vs. 16.1 ng/ml; P = 0.09) and at 3 months (25.7 ng/ml vs. 24.5 ng/ml; P = 0.09), but appeared higher in the 1200 IU/d group at 6 months of supplementation (25.6 ng/ml vs. 23.1 ng/ml; P = 0.009). The prevalence of 25(OH)D <20 ng/ml was comparable between groups at baseline (71% vs. 64%, P = 0.36) but lower in the 1200 IU/d group after 3 months (9% vs. 25%, P = 0.009) and 6 months (14% vs. 30%, P = 0.03). Maternal and infants’ iPTH, calciuria, bone mass and body composition as well as infants’ 25(OH)D levels were not significantly different between groups during the study. Significant negative correlations were noted between maternal 25(OH)D and fat mass (R = −0.49, P = 0.00001), android fat mass (R = −0.53, P = 0.00001), and gynoid fat mass (R = −0.43, P = 0.00001) after 6 months of supplementation. Conclusions Vitamin D supplementation at a dose of 400 IU/d was not sufficient to maintain 25(OH)D >20 ng/ml in nursing women, while 1200 IU/d appeared more effective, but had no effect on breastfed offspring vitamin D status, or changes in the bone mass and the body composition observed in both during breastfeeding. Trial Registration ClinicalTrials.gov NCT01506557 PMID:25232839

Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel

NASA Astrophysics Data System (ADS)

Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.

2014-04-01

Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.

Seasonal vegetation differences from ERTS imagery

NASA Technical Reports Server (NTRS)

Ashley, M. D.; Rea, J.

1975-01-01

Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.

Chlorogenic acid content, essential oil compositions, and in vitro antioxidant activities of Chromolaena odorata leaves

PubMed Central

Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2016-01-01

Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150

The subchondral bone plate.

PubMed

Müller-Gerbl, M

1998-01-01

Pauwels (1965) and subsequent workers in the same field have shown that the distribution of the subchondral density within a joint surface can serve as a parametric measurement which reflects the main stress acting on a joint. Our own investigations on anatomical specimens have demonstrated that this subchondral mineralization does indeed show regular distribution patterns from which conclusions about the mechanical situation within an individual joint may be drawn. Since radiographical densitometry and histological methods are only available for determining the adaptive reaction of the bone to the particular mechanical situation in a joint after death, the information obtained applies only to an end situation and tells us nothing about the development of the changes with time. Furthermore, investigations carried out on human specimens by radiographical densitometry mostly apply to samples of a particular age, since such specimens can be acquired only from departments of pathology, forensic medicine or anatomy. The functional reactions of the bone tissue to repeated long-term changes in the loading--lengthy immobilization and subsequent remobilization, for instance, or heavy loading over a considerable period of time--cannot be followed by any ordinary method in experimental animals, since the death of the animal is a prerequisite for the precise quantitative examination of the bone tissue. This applies also to attempts to follow the process by means of animal experiments. CT OAM has been developed as a method which, based on CT, can provide a surface representation of the 3-D density distribution in the joints of living subjects. Comparative studies were carried out to establish and confirm the validity of the procedure. These have shown (1) that the results obtained from anatomical specimens are identical with those obtained in the living; (2) that secondary CT sections are suitable for evaluation and that the spectrum of joint surfaces examined can be extended to include the whole joint (if this were not so, effects caused by the apparatus--particularly the partial-volume effect--would render the procedure impossible); and finally (3) that the distribution of the Hounsfield density within the subchondral bone represents the distribution of the mineralization. The mineralization patterns found by us in different joints of normal subjects have shown that these patterns can be brought into line with current models of joint mechanics. The radiocarpal joint, for instance, has revealed the various types of loading occurring within physiological limits. Information has also been obtained about the age-related changes taking place in the hip, wrist and ankle joints. The increase of the total mineralization in gymnasts can be related to the qualitative and quantitative adaptation to an increased peak loading, and reduced mineralization to a lengthy reduction in use during, for instance, postoperative immobilization. In groups of patients with various diseases of mechanical origin (shoulder instability, malalignment of the main axis, defective repositioning of healed fractures, rupture of the rotator cuff, meniscectomy or rupture of the anterior cruciate ligament), a pattern of mineralization is found which is different from the normal picture. These findings reflect the abnormal mechanical situation. The mineralization pattern of the femoropatellar joint has revealed the differing etiologies of medial and lateral cartilage damage and the examination of patients with lunatomalacia has made it possible to recognize a genetic disposition. The postoperative comparison of the mineralization patterns of patients with genu varum who have undergone a correction osteotomy and the results of animal experiments on various procedures for reconstructing the anterior cruciate ligament or a primary replacement of the meniscus, have produced results which make it possible to judge the success or failure of the operation. (ABSTRACT TRUNCATED)

Increased rate of osteoporosis, low lean mass, and fragility fractures in COPD patients: association with disease severity.

PubMed

Graumam, R Q; Pinheiro, M M; Nery, L E; Castro, C H M

2018-03-21

A very high rate of osteoporosis, fractures, and low lean mass was observed in patients with chronic obstructive pulmonary disease (COPD). Disease severity was associated with bone and muscle adverse outcomes, while age ≥ 63.5 years old, low lean mass, higher iPTH, and a T-score below - 2.5 were all associated with higher risk of fracture. Osteoporosis is frequently neglected in patients with COPD. We aimed at evaluating the rate of osteoporosis, fractures, and low lean mass in patients with COPD. Ninety-nine patients with COPD (53 women, 64.5 ± 9.6 years old, and 46 men, 65.9 ± 8.0 years old) underwent bone densitometry (DXA) with body composition analyses. Healthy individuals (N = 57) not exposed to tobacco matched by sex, age, and body mass index (BMI) were used as controls. Spirometry, routine laboratory workout, and conventional thoracolumbar radiography surveying for vertebral deformities were performed in all patients. Osteoporosis was found in 40.4% of the COPD patients against only 13.0% of the healthy controls (p = 0.001). Vertebral fractures were seen in 24.4% of the men and 22.0% of the women with COPD. Disease severity (GOLD 3 and 4) was significantly associated with higher risk of vitamin D deficiency (p = 0.032), lower BMD (both men and women at all sites), higher frequency of osteoporosis (in women at all sites), lower skeletal mass index, and higher rate of low lean mass (in both men and women) than healthy controls and COPD patients with milder disease (GOLD 1 and 2). Age was a main predictor of vertebral fractures (OR = 1.164 (1.078-9.297); p < 0.001), while high plasma iPTH (OR = 1.045 (1.005-1.088); p = 0.029) and low ALM (OR = 0.99965 (0.99933-0.99997); p = 0.031) were predictors of non-vertebral fractures. Highly prevalent in COPD, osteoporosis and low lean mass were associated with FEV 1% < 50%. Age, low lean mass, high iPTH, and low bone mass were all significantly associated with fractures in COPD patients.

A Monte Carlo simulation to study a design of a gamma-ray detector for neutron resonance densitometry

NASA Astrophysics Data System (ADS)

Tsuchiya, H.; Harada, H.; Koizumi, M.; Kitatani, F.; Takamine, J.; Kureta, M.; Iimura, H.

2013-11-01

Neutron resonance densitometry (NRD) has been proposed to quantify nuclear materials in melted fuel (MF) that will be removed from the Fukushima Daiichi nuclear power plant. The problem is complex due to the expected presence of strong neutron absorbing impurities such as 10B and high radiation field that is mainly caused by 137Cs. To identify the impurities under the high radiation field, NRD is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). We investigated with Geant4 the performance of a gamma-ray detector for NRCA in NRD. The gamma-ray detector has a well shape, consisting of cylindrical and tube type LaBr3 scintillators. We show how it measures 478 keV gamma rays derived from 10B(n, αγ) reaction in MF under a high 137Cs-radiation environment. It was found that the gamma-ray detector was able to well suppress the Compton edge of 662-keV gamma rays of 137Cs and had a high peak-to-Compton continuum ratio, by using the tube type scintillator as a back-catcher detector. Then, we demonstrate that with this ability, detection of 478-keV gamma rays from 10B is accomplished in realistic measuring time.

Hypocalcemia development in patients operated for primary hyperparathyroidism: Can it be predicted preoperatively?

PubMed

Kaya, Cafer; Tam, Abbas Ali; Dirikoç, Ahmet; Kılıçyazgan, Aylin; Kılıç, Mehmet; Türkölmez, Şeyda; Ersoy, Reyhan; Çakır, Bekir

2016-10-01

Primary hyperparathyroidism (PHP) is a common endocrine disease, and its most effective treatment is surgery. Postoperative hypocalcemia is a morbidity of parathyroid surgeries, and it may extend hospitalization durations. The purpose of this study is to determine the predictive factors related to the development of hypocalcemia and hungry bone syndrome (HBS) in patients who underwent parathyroidectomy for PHP. Laboratory data comprising parathyroid hormone (PTH), calcium, phosphate, 25-OHD, albumin, magnesium, alkaline phosphatase (ALP), blood urea nitrogen (BUN), and thyroid stimulating hormone (TSH) of the patients were recorded preoperatively, on the 1st and 4th days postoperatively, and in the 6th postoperative month, and their neck ultrasound (US) and bone densitometry data were also recorded. Hypocalcemia was seen in 63 patients (38.4%) on the 1st day after parathyroidectomy. Ten patients (6.1%) had permanent hypocalcemia in the 6th month after surgery. Out of the patients who underwent parathyroidectomy for PHP, 22 (13.4%) had HBS. The incidence of postoperative hypocalcemia was higher in patients who underwent parathyroidectomy for PHP, who had parathyroid hyperplasia, and who had osteoporosis. Preoperative PTH, ALP, and BUN values were higher in those patients who developed HBS. Furthermore, HBS was more common in patients who had osteoporosis, who had parathyroid hyperplasia, and who underwent thyroidectomy simultaneously with parathyroidectomy. As a result, patients who have the risk factors for development of hypocalcemia and HBS should be monitored more attentively during the perioperative period.

Is It Possible to Increase the Clinical Effectiveness of the Fracture Risk Assessment Tool in Osteopenia Patients by Taking Into Account Bone Mineral Density Values?

PubMed

Park, Jin-Sung; Lee, Jaewon; Park, Ye-Soo

2016-01-01

The study aimed to investigate the effectiveness of the clinical use of the Fracture Risk Assessment Tool (FRAX(®)) developed by the World Health Organization identifying patients at risk of osteoporotic fracture and to evaluate changes in osteoporotic fracture risk prediction according to bone mineral density (BMD) values. We identified the occurrence of osteoporotic fracture among patients whose BMD was measured in our hospital between April 2003 and March 2013. We then analyzed FRAX(®) scores obtained with or without BMD on the day before the occurrence of an osteoporotic fracture in actual osteoporotic fracture patients. According to the National Osteoporosis Foundation high-risk criteria, we identified the percentage of high-risk patients before the actual fracture. Among 445 osteoporotic fracture patients, when FRAX(®)-BMD was used, 281 patients (63%) were identified as high-risk before an actual osteoporotic fracture, and when FRAX(®) without BMD was used, 258 patients (58%) were identified (p = 0.115). In the 84 osteopenia patients, 39 patients (46.4%) were identified as high-risk when FRAX(®) without BMD was used, and 19 patients (22.6%) were identified when FRAX(®)-BMD was used (p = 0.001). The use of BMD in FRAX(®) does not seem to increase the clinical effectiveness of predicting osteoporotic fracture in osteopenia patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors in daily physical activity related to calcaneal mineral density in men.

PubMed

Hutchinson, T M; Whalen, R T; Cleek, T M; Vogel, J M; Arnaud, S B

1995-05-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g.cm-2) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry (SXA, Osteon, Inc., Wahiawa, HI). Subjects walked a mean (+/- SD) of 7902 (+/- 2534) steps per day or approximately 3.9 (+/- 1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143 (2-772) (median and range) min.wk-1 exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRFz) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRFz less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g.cm-2 vs 0.597 +/- 0.062 g.cm-2, P < 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P < 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Factors in Daily Physical Activity Related to Calcaneal Mineral Density in Men

NASA Technical Reports Server (NTRS)

Hutchinson, Teresa M.; Whalen, Robert T.; Cleek, Tammy M.; Vogel, John M.; Arnaud, Sara B.

1995-01-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g/sq cm) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry. Subjects walked a mean (+/- SD) of 7902(+/-2534) steps per day or approximately 3.9(+/-1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143(2-772) (median and range) min/wk exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRF(sub z)) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRF(sub z) less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g/sq cm vs 0.597 +/- 0.062 g/sq cm, P less than 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P less than 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Cortical Porosity Identifies Women with Osteopenia at Increased Risk for Forearm Fractures

PubMed Central

Bala, Yohann; Zebaze, Roger; Ghasem-Zadeh, Ali; Atkinson, Elizabeth J.; Iuliano, Sandra; Peterson, James M.; Amin, Shreyasee; Bjørnerem, Åshild; Melton, L. Joseph; Johansson, Helena; Kanis, John A.; Khosla, Sundeep; Seeman, Ego

2014-01-01

Background Most fragility fractures arise among the many women with osteopenia, not the smaller number with osteoporosis at high risk for fracture. Thus, most women at risk for fracture assessed only by measuring areal bone mineral density (aBMD) will remain untreated. Methods We measured cortical porosity and trabecular bone volume/total volume (BV/TV) of the ultradistal radius (UDR) using high-resolution peripheral quantitative computed tomography, aBMD using densitometry, and 10-year fracture probability using the country-specific FRAX tool in 68 postmenopausal women with forearm fractures and 70 age-matched community controls in Olmsted County, Minnesota. Results Women with forearm fractures had 0.4 standard deviations (SD) higher cortical porosity and 0.6 SD lower trabecular BV/TV. Compact-appearing cortical porosity predicted fracture independent of aBMD; odds ratio [OR] 1.92 (95%CI, 1.10–3.33). In women with osteoporosis at the UDR, cortical porosity did not distinguish those with, from those without, fractures because high porosity was present in 92% and 86% of each group respectively. By contrast, in women with osteopenia at the UDR, high porosity of the compact-appearing cortex conferred an OR for fracture of 4.00 (95%CI, 1.15–13.90). Conclusion In women with osteoporosis, porosity is captured by aBMD and so measuring UDR cortical porosity does not improve diagnostic sensitivity. However, in women with osteopenia, cortical porosity was associated with forearm fractures. PMID:24519558

Phenotype of sarcopenic obesity in older individuals with a history of falling.

PubMed

Huo, Ya Ruth; Suriyaarachchi, Pushpa; Gomez, Fernando; Curcio, Carmen L; Boersma, Derek; Gunawardene, Piumali; Demontiero, Oddom; Duque, Gustavo

2016-01-01

Although sarcopenic obesity is associated with disability in middle-aged community-dwelling individuals, the phenotype of sarcopenic obesity in people 65 and older, especially those with a history of falls, remain unknown. To fill this knowledge gap, the goal of this study was to obtain a comprehensive phenotype of sarcopenic obesity in this high-risk population. Cross-sectional study of 680 subjects (mean age=79±9, 65% female) assessed between 2009 and 2013 at the Falls and Fractures Clinic, Nepean Hospital (Penrith, Australia). The assessment included a comprehensive examination, posturography, gait velocity, grip strength, bone densitometry and body composition by DXA, and blood tests for biochemical status. Patients were divided into four groups based on DXA and clinical criteria: 1) sarcopenic obese; 2) non-sarcopenic obese; 3) sarcopenic and; 4) non-sarcopenic/non-obese. The difference between groups was assessed by one-way ANOVA, chi-square analysis, and multivariable linear regression. Sarcopenic obese subjects were older (81.1±7.3), mostly female and more likely to have lower bone mineral density, lower grip strength, slower gait velocity, and poor balance. Sarcopenic obese individuals also showed significantly higher parathyroid hormone and lower vitamin D. We identified a particular set of clinical and biochemical characteristics in our subgroup of sarcopenic obese older fallers. Identification of these particular characteristics in the clinical setting is essential in order to prevent poor outcomes in this high-risk population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

[Sufficiency with water-soluble vitamins and state of bone in pregnant women].

PubMed

Vrzhesinskaya, O A; Pereverzeva, O G; Gmoshinskaya, M V; Kodentsova, V M; Safronova, A I; Korosteleva, M M; Aleshina, I V; Fandeeva, T A

2015-01-01

Vitamin status and bone strength have been estimated in 91 pregnant women (29.3 ± 4.6 years old) from Moscow by non-invasive methods. Sufficiency with vitamins C, B2, B6 has been evaluated by morning urinary excretion of ascorbic acid, riboflavin and 4-piridoxic acid determined by visual titration and fluorimetric methods. The rate of bone resorption has been measured by the ratio of urinary calcium and creatinine, determined by complexometric titration and spectrophotometrically. The study of the bone strength has been conducted using an ultrasonic densitometer (the speed of the ultrasonic waves along the cortical layer). The lack of vitamin C was found in 20.4% .of the women surveyed, vitamin B2--in 27.4%. Vitamin B6 deficiency was detected most frequently (90%). Excretion of vitamins B2 and B6 in women in the third trimester of pregnancy was lower as compared with the women in the first and second trimester. In 53.3% of the women surveyed an increase in urinary excretion of calcium per creatinine has been observed. Excretion of group B vitamins (especially vitamin B6, 1.75 fold, p < 0.05) in women taking vitamin supplements was higher compared to non-taking vitamins that indicates the better sufficiency of the organism with these vitamins. Among women who took vitamin complexes, inadequate supply with water-soluble vitamins C, B2 and B6 was detected less frequently (the difference was significant for vitamin B2) than among women who did not intake vitamin complexes (in 11.9, 27.7 and 42.4% vs 16.1, 54.8 and 48.8 %). The rate of bone resorption (Ca/creatinine) in women taking vitamins was smaller (0.19 ± 0.09 vs 0.24 ± 0.14, p > 0.05). Ca/creatinine ratio was within normal range in 40% of women who intake vitamins, while in women not taking vitamins--only in 22.2%; this value exceeded the upper limit of norm in the rest. The strength of bone was broken in women in the second and third trimester of pregnancy, having worse supply of vitamins. The percentage of agreement of the results of osteopenia diagnosis assessment (ultrasound densitometry and urinary Ca/creatinine) was 42.2%. Thus, the conclusion has been confirmed that the evaluation of the status of bone is possible only basing on the results of determination of several parameters.

Accommodating brightness and exposure levels in densitometry of stained polyacrylamide electrophoresis gels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, Han Yen; Ng, Tuck Wah; Liew, Oi Wah

2010-03-20

Flatbed scanner densitometers can be operated under various illumination and recording exposure levels. In this work, we show that optical density measurement accuracy, sensitivity, and stability of stained polyacrylamide electrophoresis gel densitometry are crucially dependent on these two factors (brightness and exposure level), notwithstanding that the source is monochromatic, spatially uniform, and the measurements are made using an accurately calibrated step wedge in tandem. We further outline a method to accommodate the intensity deviations over a range of illumination and exposure levels in order to maintain sensitivity and repeatability in the computed optical densities. Comparisons were also made with resultsmore » from a commercial densitometer.« less

Development of HPTLC-UV absorption densitometry method for the analysis of alprazolam and sertraline in combination and its application in the evaluation of marketed preparations.

PubMed

Venkateswarlu, K; Venisetty, R K; Yellu, N R; Keshetty, S; Pai, M G

2007-09-01

A new simple, sensitive, and reproducible high-performance thin-layer chromatography method for the estimation of alprazolam and sertraline in combination is developed using silica gel plates with fluorescent indicators. The system is equipped with an automated sample applicator, and the detection was performed at 254 nm by using UV absorption densitometry. The mobile phase consists of carbon tetrachloride, methanol, acetone, and ammonia in the ratio 12:3:5:0.1. The retention factor values for alprazolam and sertraline are found to be 0.52 and 0.70, respectively. The limit of detection of alprazolam and sertraline in the mixture of given proportion is observed to be 0.05 microg/mL and 2.5 microg/mL and the limit of quantitation is 0.2 microg/mL and 10 microg/mL, respectively. The method has shown good linearity in the range of 0.2 microg/mL to 0.65 pg/mL for alprazolam (R2 > 0.9953) and 10 pg/mL to 32.5 microg/mL for sertraline (R2 > 0.9942). The intra- and inter-assay (n=5) variations in the linear range are less than 4% for alprazolam and 6% for sertraline. Three pharmaceutical products containing this combination are analyzed to test the applicability of the new method. The percentage of alprazolam and sertraline in the tablets studied range from 97.7% to 102.82% and 96.5% to 99.9%, respectively.

Heterogeneity in Spinal Bone Mineral Density Among Young Adults From Three Eastern Provincial Capital Cities in Mainland China.

PubMed

Cheng, Xiao-Guang; Li, Kai; Ou, Shan-Xing; Tang, Guang-Yu; Wang, Qian-Qian; Wang, Chao; Wang, Ling; Tian, Wei

This study compares spinal volumetric bone mineral density (vBMD) with spinal areal bone mineral density (aBMD) among young adults from 3 eastern provincial capital cities in Mainland China. A total of 416 young adults (age range: 20-40 yr) from 3 eastern provincial capital cities (Beijing, Shanghai, and Guangzhou) in Mainland China were recruited in this study. From each subject, the vBMD of the lumbar spine was measured by the Mindways quantitative computed tomography system. Moreover, the aBMD of the lumbar spine, measured by the dual-energy X-ray absorptiometry, was extracted from a previous multicenter large-scale study, and the 420 participants were matched by age, gender, height, weight, as well as geographic territory. The vBMD and the aBMD values were further compared and analyzed. Generally, the bone mineral density (BMD) results were significantly different among participants from the 3 cities (p <0.05). Specifically, both vBMD and aBMD values of participants from Beijing were significantly different from those from Guangzhou (p <0.05). Additionally, a statistically significant difference in aBMD values was also found between participants from Beijing and Shanghai (p <0.05). However, no significant differences were found between participants from Shanghai and Guangzhou in terms of the aBMD and vBMD values (p 1  > 0.05 and p 2  > 0.05). Interestingly, the overall mean vBMD value was 5.9% greater in women than those in men for all the 3 cities (p <0.001). This study demonstrated an overall heterogeneity in spinal BMD among young adults from 3 eastern provincial capital cities in Mainland China. Specifically, the taller and heavier young adults from the northern part of China have smaller spinal vBMD but higher spinal aBMD values than those who were shorter and lighter from the southern part of China. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Persistent tumor-induced osteomalacia confirmed by elevated postoperative levels of serum fibroblast growth factor-23 and 5-year follow-up of bone density changes.

PubMed

Zimering, Mark B; Caldarella, Felice A; White, Kenneth E; Econs, Michael J

2005-01-01

To describe a case of persistent tumor-induced osteomalacia, determine whether serum fibroblast growth factor-23 (FGF-23) levels postoperatively indicate incomplete tumor resection, and report lumbar spine and forearm bone mineral density (BMD) changes during 5 years of follow-up. We present clinical, radiologic, histologic, and bone densitometry data as well as serum FGF-23 levels (determined with use of a novel C-terminal enzyme-linked immunosorbent assay) from the study patient and discuss these findings in the context of previous literature. A 52-year-old man, who presented with muscle weakness and multiple fractures, was found to have low values for serum phosphorus, serum 1,25-dihydroxyvitamin D, and maximal tubular reabsorption of phosphate per glomerular filtration rate, a high level of serum alkaline phosphatase, and a normal serum concentration of parathyroid hormone, characteristic of tumor-induced osteomalacia. Magnetic resonance imaging to evaluate an abnormality of the left foot revealed a soft tissue mass, biopsy of which confirmed the presence of a benign, phosphaturic, mesenchymal tumor. The baseline serum FGF-23 level (2,050 RU/mL) was more than 17 times the upper limit of normal for adults (23 to 118 RU/mL) and decreased substantially within 1 day after partial resection of the tumor but remained above normal postoperatively. BMD changes indicated rapid substantial recovery of vertebral BMD but ongoing loss of forearm bone density. The serum FGF-23 level is high in a substantial proportion of patients with tumor-induced osteomalacia. The postoperative above normal levels of serum FGF-23 correlated with known persistence of tumor in our study patient. In a patient with normal renal function, such as our study patient, levels of serum FGF-23 studied with use of the C-terminal enzyme-linked immunosorbent assay reached their nadir within 24 hours postoperatively. This result suggests that this assay can provide clinicians with rapid prognostic information in patients with known or suspected residual tumor. BMD should be assessed at both appendicular and axial sites in patients with persistent tumor-induced osteomalacia.

Validated electrochemical and chromatographic quantifications of some antibiotic residues in pharmaceutical industrial waste water.

PubMed

Ibrahim, Heba K; Abdel-Moety, Mona M; Abdel-Gawad, Sherif A; Al-Ghobashy, Medhat A; Kawy, Mohamed Abdel

2017-03-01

Realistic implementation of ion selective electrodes (ISEs) into environmental monitoring programs has always been a challenging task. This could be largely attributed to difficulties in validation of ISE assay results. In this study, the electrochemical response of amoxicillin trihydrate (AMX), ciprofloxacin hydrochloride (CPLX), trimethoprim (TMP), and norfloxacin (NFLX) was studied by the fabrication of sensitive membrane electrodes belonging to two types of ISEs, which are polyvinyl chloride (PVC) membrane electrodes and glassy carbon (GC) electrodes. Linear response for the membrane electrodes was in the concentration range of 10 -5 -10 -2  mol/L. For the PVC membrane electrodes, Nernstian slopes of 55.1, 56.5, 56.5, and 54.0 mV/decade were achieved over a pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. On the other hand, for GC electrodes, Nernstian slopes of 59.1, 58.2, 57.0, and 58.2 mV/decade were achieved over pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. In addition to assay validation to international industry standards, the fabricated electrodes were also cross-validated relative to conventional separation techniques; high performance liquid chromatography (HPLC), and thin layer chromatography (TLC)-densitometry. The HPLC assay was applied in concentration range of 0.5-10.0 μg/mL, for all target analytes. The TLC-densitometry was adopted over a concentration range of 0.3-1.0 μg/band, for AMX, and 0.1-0.9 μg/band, for CPLX, NFLX, and TMP. The proposed techniques were successfully applied for quantification of the selected drugs either in pure form or waste water samples obtained from pharmaceutical plants. The actual waste water samples were subjected to solid phase extraction (SPE) for pretreatment prior to the application of chromatographic techniques (HPLC and TLC-densitometry). On the other hand, the fabricated electrodes were successfully applied for quantification of the antibiotic residues in actual waste water samples without any pretreatment. This finding assures the suitability of the fabricated ISEs for environmental analysis.

Combined Effects of Spaceflight and Age in Astronauts as Assessed by Areal Bone Mineral Density [BMD] and Trabecular Bone Score

NASA Technical Reports Server (NTRS)

Sibonga, Jean D.; Spector, Elizabeth R.; Ploutz-Snyder, R.; Evans, H. J.; King, L.; Watts, N. B.; Hans, D.; Smith, S. A.

2013-01-01

Spaceflight is a potential risk factor for secondary osteoporosis in astronauts. Although lumbar spine (LS) BMD declines rapidly, more than expected for age, there have been no fragility fractures in astronauts that can clearly be attributed to spaceflight. Recently, astronauts have been returning from 6-month spaceflights with absolute BMD still above young adult mean BMD. In spite of these BMD measurements, we project that the rapid loss in bone mass over long-duration spaceflight affects the bone microarchitecture of the LS which might predispose astronauts to premature vertebral fractures. Thus, we evaluated TBS, a novel texture index correlated with vertebral bone microarchitecture, as a means of monitoring changes to bone microarchitecture in astronauts as they age. We previously reported that TBS detects an effect of spaceflight (6-month duration), independent of BMD, in 51 astronauts (47+/-4 y) (Smith et al, J Clin Densitometry 2014). Hence, TBS was evaluated in serial DXA scans (Hologic Discovery W) conducted triennially in all active and retired astronauts and more frequently (before spaceflight, after spaceflight and until recovery) in the subset of astronauts flying 4-6- month missions. We used non-linear models to describe trends in observations (BMD or TBS) plotted as a function of astronaut age. We fitted 1175 observations of 311 astronauts, pre-flight and then postflight starting 3 years after landing or after astronaut's BMD for LS was restored to within 2% of preflight BMD. Observations were then grouped and defined as follows: 1) LD: after exposure to at least one long-duration spaceflight > 100 days and 2) SD: before LD and after exposure to at least one short-duration spaceflight < 30 days. Data from males and females were analyzed separately. Models of SD observations revealed that TBS and BMD had similar curvilinear declines with age for both male and female astronauts. However, models of LD observations showed TBS declining with age while BMD appeared stable or trending upward. For females (n=8) LD observations were too few to discern a trend. Notably, models describing trends in TBS appeared to be more sensitive to the effects of age than the models for BMD. We conclude that TBS may provide an additional index for the lumbar spine to monitor the combined changes due to spaceflight and due to aging. This increased knowledge may enhance the ability to identify an intervention trigger for premature vertebral fractures in astronauts.

Soccer increases bone mass in prepubescent boys during growth: a 3-yr longitudinal study.

PubMed

Zouch, Mohamed; Zribi, Anis; Alexandre, Christian; Chaari, Hamada; Frere, Delphine; Tabka, Zouhair; Vico, Laurence

2015-01-01

The aim of this study was to examine the effect of 3-yr soccer practice on bone acquisition in prepubescent boys. We investigated 65 boys (aged 10-13 yr, Tanner stage I) at baseline, among which only 40 boys (Tanner stages II and III) have continued the 3-yr follow-up: 23 soccer players (F) completed 2-5 h of training plus 1 competition game per week and 17 controls (C). Bone mineral density (BMD, g/cm(2)) and bone mineral content (BMC, g) were measured by dual-energy X-ray absorptiometry at different sites. At baseline, BMD was higher in soccer players than in controls in the whole body and legs. In contrast, there was nonsignificant difference BMD in head, femoral neck, arms, and BMC in all measured sites between groups. At 3-yr follow-up, soccer players were found to have higher BMD and BMC at all sites than controls, except for head BMD and BMC and arms BMC in which the difference was nonsignificant between groups. During the 3-yr follow-up, the soccer players were found to gain significantly more in lumbar spine (31.2% ± 2.9% vs 23.9% ± 2.1%; p < 0.05), femoral neck (24.1% ± 1.8% vs 11.4% ± 1.9%; p < 0.001), whole body (16.5% ± 1.4% vs 11.8% ± 1.5%; p < 0.05), and nondominant arm BMD (18.2% ± 1.4% vs 13.6% ± 1.7%; p < 0.05) as well as lumbar spine (62.5% ± 20.1% vs 39.5% ± 20.1%; p < 0.001), femoral neck, (37.7% ± 14.2% vs 28.9% ± 12.8%; p < 0.05) and nondominant arm BMC (68.6% ± 22.9% vs 50.1% ± 22.4%; p < 0.05) than controls. In contrast, soccer players have less %BMD and %BMC changes in the head than controls. A nonsignificant difference was found in legs, dominant arm, head %BMD and %BMC changes, and whole-body %BMC changes between groups. In summary, we suggest that soccer has an osteogenic effect BMD and BMC in loaded sites in pubertal soccer players. The increased bone mass induced by soccer training in the stressed sites was associated to a decreased skull bone mass after 3 yr of follow-up. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Bone accretion in adolescents using the combined estrogen and progestin transdermal contraceptive method Ortho Evra: a pilot study.

PubMed

Harel, Zeev; Riggs, Suzanne; Vaz, Rosalind; Flanagan, Patricia; Harel, Dalia; Machan, Jason T

2010-02-01

To date, there are no data regarding the effect of the transdermal combined estrogen and progestin contraceptive Ortho Evra on bone mineral content (BMC) and bone mineral density (BMD). We examined the effects of transdermally delivered ethinyl estradiol and norelgestromin on whole body (WB) BMC and BMD of the hip and lumbar spine (LS) of adolescent girls. In a matched case-control study, girls (n = 5) who applied Ortho Evra for days 1-21 followed by days 22-28 free of medication for 13 cycles (about 12 months) were compared with 5 age- and ethnicity-matched control girls. Evaluations of calcium intake; bone-protective physical activity; bone densitometry (DXA, QDR 4500A, Hologic); bone formation markers serum osteocalcin (OC) and bone-specific alkaline phosphatase (BAP); bone resorption marker urinary N-telopeptide (uNTX); insulin growth factor-1 (IGF-1); and sex hormone binding globulin (SHBG) were carried out at initiation, 6 months, and 12 months. Changes from baseline were compared using mixed models, adjusting for follow-up comparisons using the Holm Test (sequential Bonferroni). There were no significant differences (SD) between groups at baseline in age, gynecologic age, WBBMC, hip BMD, and LSBMD. Girls on Ortho Evra did not change significantly in WBBMC (12-month mean increase 0.2% +/- 0.8%), whereas controls did (3.9% +/- 1.8%, P < or = .001, adjusted P = .002), with SD between the 2 groups (P = .007, adjusted P = .036). Adolescents on Ortho Evra did not change significantly in hip BMD (12-month mean increase 0.5% +/- 0.6%), whereas controls did (2.7% +/- 0.6%, P < or = .001, adjusted P = .004), with SD between the 2 groups (P = .024) prior to adjustment for multiple comparisons, but no SD after adjustment (P = .096). Similarly, although the increase in LSBMD within the control group after 12 months (mean increase 2.8% +/- 1.0%) was statistically significant (P = .009, adjusted P = .044), the change within the treatment group (12-month mean increase 0.8% +/- 0.8%) was not. However, percent LSBMD changes after 12 months did not significantly differ between the 2 groups before or after adjustment for multiple comparisons. Calcium intake and bone-protective physical activity did not significantly predict BMC and BMD changes of study participants. There was a significantly greater increase in SHBG levels in the treatment group after 6 months (P = .003, adjusted P = .013) and 12 months (P < or = .001, adjusted P < or = .001) than in controls. Changes in levels of OC, BAP, uNTX, and IGF-1 were not significantly different between the 2 groups. Ortho Evra use attenuates bone mass acquisition in young women who are still undergoing skeletal maturation. This attenuation may be attributed in part to increased SHBG levels, which reduce the concentrations of free estradiol and free testosterone that are available to interact with receptors on the bone. Clinical implications remain to be determined in studies with a larger number of adolescents. Copyright 2010 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

Prevalence of osteoporosis, vertebral fractures and hypovitaminosis D in postmenopausal women living in a rural environment.

PubMed

Gómez-de-Tejada Romero, María-Jesús; Navarro Rodríguez, María-del-Carmen; Saavedra Santana, Pedro; Quesada Gómez, José-Manuel; Jódar Gimeno, Esteban; Sosa Henríquez, Manuel

2014-03-01

First, to study the difference between two groups of postmenopausal women living in different population centres (rural vs urban) in the prevalence of osteoporosis, fragility fractures and factors which may influence them: hypovitaminosis D, bone mineral density, coexistence of other diseases which predispose to their appearance; secondly, to observe the influence of low socioeconomic status, categorised as poverty. 1229 postmenopausal women were studied, of whom 390 (31.7%), were living in rural areas and 839 (68.3%), in urban areas. Data regarding risk factors related to osteoporosis were obtained, and, among other biochemical measures, 25 hydroxyvitamin D and parathyroid hormone were determined. Bone densitometry was carried out in the lumbar spine and proximal femur, as well as lateral X-rays of the dorsal and lumbar spine. The women who lived in rural areas were older, shorter, heavier and had a higher body mass index than those from urban areas. Among the women from rural areas there was a higher prevalence of poverty, and higher levels of obesity, arterial hypertension and diabetes mellitus were observed, as well as a higher prevalence of densitometric osteoporosis. The rural women had lower values of bone mineral density in the lumbar spine and a higher prevalence of vertebral fractures and hypovitaminosis D. The variables which were associated independently with living in rural areas were poverty, obesity, vertebral fractures, BMD in the lumbar spine and levels of 25 hydroxyvitamin D. In our study, postmenopausal women who live in rural populations have more poverty, lower values of vitamin D, lower BMD in the lumbar spine and a higher prevalence of vertebral fractures and of osteoporosis. The higher prevalence of obesity, arterial hypertension and diabetes mellitus observed in these women may be adjuvant factors, all fostered by their socioeconomic state of poverty. Copyright © 2014. Published by Elsevier Ireland Ltd.

The frequency of low muscle mass and its overlap with low bone mineral density and lipodystrophy in individuals with HIV--a pilot study using DXA total body composition analysis.

PubMed

Buehring, Bjoern; Kirchner, Elizabeth; Sun, Zhiyuan; Calabrese, Leonard

2012-01-01

As a result of the advances in antiretroviral therapy, the life span of human immunodeficiency virus (HIV)-infected patients has increased dramatically. Attendant to these effects are signs of premature aging with notable changes in the musculoskeletal system. Although changes in bone and fat distribution have been studied extensively, far less is known about changes in muscle. This study examined the extent of low muscle mass (LMM) and its relationship with low bone mineral density (BMD) and lipodystrophy (LD) in HIV-positive males. As such, HIV-positive males on therapy or treatment naive underwent dual-energy X-ray absorptiometry total body composition measurements. Appendicular lean mass/(height)2 and lowest 20% of residuals from regression analysis were used to define LMM. BMD criteria defined osteopenia/osteoporosis, and the percent central fat/percent lower extremity ratio defined LD. Several potential risk factors were assessed through chart review. Sixty-six males (57 with treatment and 9 treatment naive) volunteered. Treated individuals were older than naive (44 vs 34 yr) and had HIV longer (108 vs 14 mo). When definitions for sarcopenia (SP) in elderly individuals were applied, the prevalence of LMM was 21.9% and 18.8% depending on the definition used. Low BMD was present in 68.2% of participants. LD with a cutoff of 1.5 and 1.961 was present in 54.7% and 42.2% of participants, respectively. LMM and LD were negatively associated. In conclusion, this study shows that LMM is common in males with HIV and that SP affecting muscle function could be present in a substantial number of individuals. Future research needs to examine what impact decreased muscle mass and function has on morbidity, physical function, and quality of life in individuals with HIV. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The association of endogenous hormone concentrations and bone mineral density measures in pre- and perimenopausal women of four ethnic groups: SWAN.

PubMed

Sowers, M R; Finkelstein, J S; Ettinger, B; Bondarenko, I; Neer, R M; Cauley, J A; Sherman, S; Greendale, G A

2003-01-01

We evaluated bone mineral density (BMD), hormone concentrations and menstrual cycle status to test the hypothesis that greater variations in reproductive hormones and menstrual bleeding patterns in mid-aged women might engender an environment permissive for less bone. We studied 2336 women, aged 42-52 years, from the Study of Women's Health Across the Nation (SWAN) who self-identified as African-American (28.2%), Caucasian (49.9%), Japanese (10.5%) or Chinese (11.4%). Outcome measures were lumbar spine, femoral neck and total hip BMD by dual-energy X-ray densitometry (DXA). Explanatory variables were estradiol, testosterone, sex hormone binding globulin (SHBG) and follicle stimulating hormone (FSH) from serum collected in the early follicular phase of the menstrual cycle or menstrual status [premenopausal (menses in the 3 months prior to study entry without change in regularity) or early perimenopause (menstrual bleeding in the 3 months prior to study entry but some change in the regularity of cycles)]. Total testosterone and estradiol concentrations were indexed to SHBG for the Free Androgen Index (FAI) and the Free Estradiol Index (FEI). Serum logFSH concentrations were inversely correlated with BMD (r = -10 for lumbar spine [95% confidence interval (CI): -0.13, -0.06] and r = -0.08 for femoral neck (95% CI: -0.11, -0.05). Lumbar spine BMD values were approximately 0.5% lower for each successive FSH quartile. There were no significant associations of BMD with serum estradiol, total testosterone, FEI or FAI, respectively, after adjusting for covariates. BMD tended to be lower (p values = 0.009 to 0.06, depending upon the skeletal site) in women classified as perimenopausal versus premenopausal, after adjusting for covariates. Serum FSH but not serum estradiol, testosterone or SHBG were significantly associated with BMD in a multiethnic population of women classified as pre- versus perimenopausal, supporting the hypothesis that alterations in hormone environment are associated with BMD differences prior to the final menstrual period.

Sarcopenia is related to increased risk for low bone mineral density.

PubMed

Wu, Chia-Hung; Yang, Kun-Cheh; Chang, Hao-Hsiang; Yen, Jo-Fang; Tsai, Ko-Sung; Huang, Kuo-Chin

2013-01-01

Lean body mass is positively correlated with bone mineral density (BMD). The association between sarcopenia and BMD is less studied. The aim of the study is to investigate the association between sarcopenia and abnormal BMD. A total of 600 community residents aged 40-85 years (mean=63.63 ± 10.12) from Taipei, Taiwan were included. Abnormal and normal BMD groups were categorized by T-score of femoral neck and lumbar spine (L2-L4) measured by dual-energy X-ray absorptiometry. Skeletal muscle mass (SM) index (SMI) was obtained from SM divided by height squared using bioelectrical impedance analysis (BIA) method. Sarcopenia was defined as SMI less than 8.87 kg/m² in men and 6.42 kg/m² in women according to previous Taiwanese sarcopenia study. The association between BMD groups and sarcopenia was examined using binary logistic regression analyses after controlling potential confounders. Subjects with sarcopenia were at higher risk for low BMD (odds ratio (OR) = 1.59, 95% confidence interval (CI)=1.06-2.39 for femoral neck BMD and OR=1.72, 95% CI=1.09-2.72 for lumbar BMD) compared with the nonsarcopenia group. Even in different gender groups with age categorized, sarcopenia was still an important independent factor in female group. The least square (LS) means of BMD of femoral neck and lumbar spine were significantly lower in sarcopenia group. The risk of low BMD increased significantly with sarcopenia. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Iatrogenic osteoporosis, bilateral HIP osteonecrosis, and secondary adrenal suppression in an HIV-infected man receiving inhaled corticosteroids and ritonavir-boosted highly active antiretroviral therapy.

PubMed

Kaviani, Nargess; Bukberg, Phillip; Manessis, Anastasios; Yen, Vincent; Young, Iven

2011-01-01

To report the first case of severe osteoporosis associated with a vertebral pathologic fracture and osteonecrosis of femoral heads in an HIV-infected man receiving inhaled corticosteroids and ritonavir-boosted antiretroviral therapy. We describe an HIV-infected man with severe osteoporosis, bilateral hip osteonecrosis, and secondary adrenal suppression, including detailed clinical, laboratory, and radiographic data, and review the related literature. A 60-year-old man with a 15-year history of HIV infection and a medical history of long-standing bronchiectasis treated with inhaled corticosteroids and hypogonadism treated with testosterone was referred to the endocrinology clinic after experiencing an osteoporotic vertebral fracture. He was taking ritonavir-boosted antiretroviral therapy. Osteonecrosis of both hips was also diagnosed, which required total hip replacement therapy. Laboratory evaluation revealed adrenal insufficiency due to increased effect of exogenous inhaled steroids and no other secondary causes of osteoporosis. A bone densitometry study showed osteoporosis of both hips and the lumbar spine. He was treated with intravenous pamidronate. During treatment, he developed bilateral femoral fractures after minor trauma. Given the potential for increased serum levels of inhaled corticosteroids in patients taking ritonavir-boosted highly active antiretroviral therapy, attention must be paid to the risk of bone loss in HIV-infected patients taking inhaled corticosteroids. Prescribing calcium and vitamin D supplementation and considering early osteoporosis screening are reasonable measures for this patient population. Interaction between inhaled corticosteroids and ritonavir may increase risk of hypothalamus-pituitary-adrenal axis suppression.

Outcomes of Corneal Cross-Linking Correlate With Cone-Specific Lysyl Oxidase Expression in Patients With Keratoconus.

PubMed

Shetty, Rohit; Rajiv Kumar, Nimisha; Pahuja, Natasha; Deshmukh, Rashmi; Vunnava, KrishnaPoojita; Abilash, Valsala Gopalakrishnan; Sinha Roy, Abhijit; Ghosh, Arkasubhra

2018-03-01

To evaluate the correlation of visual and keratometry outcomes after corneal cross-linking (CXL) in patients with keratoconus with cone epithelium-specific gene expression levels. Corneal epithelium was obtained from 35 eyes that underwent accelerated CXL (KXLII, 9 mW/cm for 10 min). Using corneal topography, epithelium over the cone and periphery was obtained separately from each subject. The ratio of gene expression for lysyl oxidase (LOX), matrix metalloproteinase 9 (MMP9), bone morphogenic protein 7, tissue inhibitor of metalloproteinase 1, collagen, type I, alpha 1, and collagen, type IV, alpha 1 (COL IVA1) from the cone and peripheral cornea was correlated with the outcome of cross-linking surgery. Patients were assessed for visual acuity, keratometry, refraction, and corneal densitometry before and 6 months after surgery. Based on the change in corneal flattening indicated by ΔKmax, the outcomes were classified as a higher response or lower response. Reduction in keratometric indices correlated with improved spherical equivalent after CXL. Preoperative levels of cone-specific LOX expression in cases with a higher response were significant (P = 0.001). COL IVA1, bone morphogenic protein 7, and tissue inhibitor of metalloproteinase 1 gene expressions were reduced in the cones of the subjects with a lower response. MMP9 levels were relatively lower in cases with a higher response compared with those with a lower response. Our study demonstrates that preoperative levels of molecular factors such as LOX, MMP9, and COL IVA1 aid in understanding CXL outcomes at the tissue level.

Definition of osteoporosis by bone density criteria in men: effect of using female instead of male young reference data depends on skeletal site and densitometer manufacturer.

PubMed

Schousboe, John T; Tanner, S Bobo; Leslie, William D

2014-01-01

Whether to use young male or young female reference data to calculate bone mineral density (BMD) T-scores in men remains controversial. The third National Health and Nutrition Examination and Survey (NHANES III) data show that the mean and standard deviation of femoral neck and total hip BMD is greater in young men than young women, and therefore differences in T-scores at these sites using NHANES III female vs male norms becomes less as BMD decreases. In contrast, manufacturer-specific reference databases generally assume similar standard deviations of BMD in men and women. Using NHANES III reference data for the femoral neck and total hip, respectively we found that men with T-scores of -2.5 when young male norms are used have T-scores of -2.4 and -2.3 when young female norms are used. Using manufacturer-specific reference data, we found that men with T-scores of -2.5 when young male norms are used at the femoral neck, total hip, lumbar spine, or one-third of the forearm would have T-scores ranging from -2.4 to -0.4 when young female norms are used, depending on skeletal site and densitometer manufacturer. The change of proportions of men diagnosed with osteoporosis when young female norms are used instead of young male reference data differs substantially according to skeletal site and densitometer manufacturer. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The effect of a histone deacetylase inhibitor - valproic acid - on nucleoli in human leukaemic myeloblasts.

PubMed

Smetana, K; Zápotocký, M

2010-01-01

The present study was undertaken to provide more information on nucleolar changes induced by a histone deacetylase inhibitor such as valproic acid in leukaemic myeloblasts at the single-cell level. For this study, RNA in nucleoli was visualized by a simple but sensitive cytochemical procedure in unfixed cytospins of short-term bone marrow cultures from patients suffering from acute myeloid leukaemia. Valproic acid in leukaemic myeloblasts markedly reduced the nucleolar size and also produced significant transformation of "active" to "resting" and "inactive" nucleoli that reflected the alteration of the nucleolar transcription in sensitive myeloblasts. On this occasion it should be added that valproic acid significantly increased the incidence of altered myeloblasts that changed to apoptotic cells or apoptotic bodies and cell ghosts. In contrast to the above-mentioned decreased nucleolar size, the nucleolar RNA concentration, expressed by computerassisted RNA image densitometry in valproic acidtreated myeloblasts, was not significantly changed. The results of the present study clearly indicated that the nucleolar size and transformation of "active" to "sleeping" or "inactive" nucleoli are convenient markers of the sensitivity and alteration of leukaemic myeloblasts produced by a histone deacetylase inhibitor, valproic acid, at the single-cell level.

Transient peripartum osteoporosis of the femoral head in first and third pregnancy.

PubMed

Truszczyńska, Aleksandra; Walczak, Piotr; Rapała, Kazimierz

2012-01-01

The aim of this article was to present transient peripartum femoral head osteoporosis. This very rare condition occurred twice in our patient-a woman in her 30s. The cases described in the literature were mostly unilateral, with bilateral hip involvement noted much less frequently. In our patient, transient osteoporosis occurred in the third trimester of her first pregnancy in the right hip, her second pregnancy was uncomplicated, and in the third trimester of the patient's third pregnancy, osteoporotic changes were noted in the left hip joint. The patient breastfed her first and third babies only 3 wk each. She breastfed her second baby for 4 mo. The diagnostic workup was based on the clinical examination and radiographic/magnetic resonance imaging, which revealed bone marrow edema, and the dual-energy X-ray absorptiometry scans. The treatment consisted in core decompression of the femoral head (foragé), unloading of the hip using crutches as well as administration of calcitonin and calcium supplements. Complete recovery of the femoral heads was achieved. The follow-up time was 7 yr. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

High-performance thin-layer chromatographic methods for the determination of febuxostat and febuxostat/diclofenac combination in human plasma.

PubMed

El-Yazbi, Fawzi A; Amin, Omayma A; El-Kimary, Eman I; Khamis, Essam F; Younis, Sameh E

2018-06-01

Two simple, sensitive and specific high-performance thin-layer chromatographic (HPTLC) methods were developed for the determination of febuxostat (FEB) individually, and simultaneously with diclofenac (DIC) in human plasma. Method A presents the first HPTLC-ultraviolet attempt for FEB determination in human plasma. FEB was separated from endogenous plasma components (at hR F  = 70) with ethyl acetate-methanol-water (9:2:1, v/v) mixture as mobile phase and quantified by densitometry at its λ max (315 nm). Method B is considered the first attempt for the simultaneous determination of FEB and DIC in human plasma. A mixture of petroleum ether-chloroform-ethyl acetate-formic acid (7.5:1:2.5:0.25, v/v) was used as the mobile phase. The two drugs were separated at hR F of 39 and 60 for FEB and DIC, respectively. FEB and DIC were quantified by densitometry at their isoabsorptive point (289 nm). FEB calibration plots were linear between 0.1 and 7 μg mL -1 in both methods A and B. In method B, DIC showed linear response in the range of 0.08-8 μg mL -1 . Sample preparation was performed by liquid-liquid extraction using diethyl ether. Both methods did not record any interference from plasma matrix, the studied drugs' metabolites or their decomposition products. They were successfully applied for the determination of the studied drugs in healthy male volunteers after oral administration of FEB or FEB/DIC dosage forms. FEB plasma concentration increased significantly when given with DIC. The proposed methods provided very simple, rapid and cheap approaches that might be attractive for the future pharmacokinetic and bioavailability studies of FEB and/or DIC. Copyright © 2018 Elsevier B.V. All rights reserved.

[Computed tomography semiotics of osteonecrosis and sequestration in chronic hematogenic osteomyelitis].

PubMed

D'iachkova, G V; Mitina, Iu L

2007-01-01

Based on the data of computed tomography, radiography and densitometry in 39 patients the authors describe in detail the signs of osteonecrosis and sequestration of different localization and extension.

Simultaneous Determination of Soyasaponins and Isoflavones in Soy (Glycine max L.) Products by HPTLC-densitometry-Multiple Detection.

PubMed

Shawky, Eman; Sallam, Shaimaa M

2017-11-01

A new high-throughput method was developed for the simultaneous analysis of isoflavones and soyasaponnins in Soy (Glycine max L.) products by high-performance thin-layer chromatography with densitometry and multiple detection. Silica gel was used as the stationary phase and ethyl acetate:methanol:water:acetic acid (100:20:16:1, v/v/v/v) as the mobile phase. After chromatographic development, multi-wavelength scanning was carried out by: (i) UV-absorbance measurement at 265 nm for genistin, daidzin and glycitin, (ii) Vis-absorbance measurement at 650 nm for Soyasaponins I and III, after post-chromatographic derivatization with anisaldehyde/sulfuric acid reagent. Validation of the developed method was found to meet the acceptance criteria delineated by ICH guidelines with respect to linearity, accuracy, precision, specificity and robustness. Calibrations were linear with correlation coefficients of >0.994. Intra-day precisions relative standard deviation (RSD)% of all substances in matrix were determined to be between 0.7 and 0.9%, while inter-day precisions (RSD%) ranged between 1.2 and 1.8%. The validated method was successfully applied for determination of the studied analytes in soy-based infant formula and soybean products. The new method compares favorably to other reported methods in being as accurate and precise and in the same time more feasible and cost-effective. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Lateral spine densitometry in obese women.

PubMed

Brooks, E R; Heltz, D; Wozniak, P; Partington, C; Lovejoy, J C

1998-08-01

The lateral (LAT) spine scan has been suggested as a more sensitive measure than posterior-anterior (PA) scanning for assessing age-related bone loss in normal-weight postmenopausal women. The measurement error of PA and LAT bone mineral density (BMD) using dual energy X-ray absorptiometry (DXA) has also been shown to rise with incremental increases in fat and from large variance in fat thickness, respectively. The purpose of this cross-sectional study was to determine specific affects of obesity on paired PA and LAT lumbar (L2-L4) BMD and Z score (BMD of patient versus age-matched reference data-base) correlation in 30 obese postmenopausal women (mean BMI +/- SD = 33.3 +/- 4.06). The mean PA and LAT BMD +/- SD were 0.946 +/- 0.123 and 0.749 +/- 0.134, respectively. The mean PA and LAT Z scores were -0.17 +/- 1.15 and 0.80 +/- 1.7. The correlation between PA and LAT BMD was significantly lower (r = 0.55; P < 0.05) than previously reported, and PA and LAT Z score correlation was (r = 0.57; P = 0.0016). After adjusting for body mass index (BMI), percent body fat, fat mass, and truncal fat by DXA, waist:hip ratio (WHR) and visceral and subcutaneous abdominal fat by computerized axial tomography (CT), PA and LAT Z score correlation increased to r = 0.62; P = 0.0065. In our subjects, the mean LAT Z score was 4.6 times higher than the mean AP Z, contrary to previous observations in normal-weight postmenopausal women. Our findings may be due to increased soft tissue composition and fat inhomogeneity in the LAT scanning field resulting in increased X-ray attenuation in obesity.

Bone mineral density reference standards for Chinese children aged 3-18: cross-sectional results of the 2013-2015 China Child and Adolescent Cardiovascular Health (CCACH) Study.

PubMed

Liu, Junting; Wang, Liang; Sun, Jinghui; Liu, Gongshu; Yan, Weili; Xi, Bo; Xiong, Feng; Ding, Wenqing; Huang, Guimin; Heymsfield, Steven; Mi, Jie

2017-05-29

No nationwide paediatric reference standards for bone mineral density (BMD) are available in China. We aimed to provide sex-specific BMD reference values for Chinese children and adolescents (3-18 years). Data (10 818 participants aged 3-18 years) were obtained from cross-sectional surveys of the China Child and Adolescent Cardiovascular Health in 2015, which included four municipality cities and three provinces. BMD was measured using Hologic Discovery Dual Energy X-ray Absorptiometry (DXA) scanner. The DXA measures were modelled against age, with height as an independent variable. The LMS statistical method using a curve fitting procedure was used to construct reference smooth cross-sectional centile curves for dependent versus independent variables. Children residing in Northeast China had the highest total body less head (TBLH) BMD while children residing in Shandong Province had the lowest values. Among children, TBLH BMD was higher for boys as compared with girls; but, it increased with age and height in both sexes. Furthermore, TBLH BMD was higher among US children as compared with Chinese children. There was a large difference in BMD for height among children from these two countries. US children had a much higher BMD at each percentile (P) than Chinese children; the largest observed difference was at P50 and P3 and the smallest difference was at P97. This is the first study to present a sex-specific reference dataset for Chinese children aged 3-18 years. The data can help clinicians improve interpretation, assessment and monitoring of densitometry results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

[BREAST FEEDING AS PREVENTIVE FACTOR FOR OSTEOPOROSIS IN ADULT WOMEN].

PubMed

Jiménez-Arreola, Jazmín; Aguilera Barreiro, Ma de los Angeles

2015-12-01

breastfeeding is considered protective of osteoporosis, by endocrine changes, such as the rise of intestinal absorption of calcium and the renal conservation of the same, however, other studies demonstrate that with more one child they present a loss of bone mineral density (BMD) (2-9%). to determine if breastfeeding is a protective factor or a risk in osteoporosis in Queretaro's women. retrospective study of cases y controls. 114 women from 35 to 60 years divided in control group (without breastfeeding) and women those that breastfeed. Diagnostic of BMD by bone densitometry of two regions: Hip (femur) and lumbar. Clinical history applies. Criteria of inclusion: age 35-60 years. Criteria of exclusion: consumption: calcium, hormonal replacement therapy, treatment for osteoporosis: breastfeeding or pregnant. It will provide evidence of a central trend, T couplet, correlations, Chi2 y profitable reasons. breastfeeding was found to have a protection factor con 0.903 OR (0.768-1.006). Inverse correlation of BMI/BMD in hip and lumbar regions, in women that did not breast contrary to those that did breastfeed. In both groups in was determined a greater age of pregnancy with greater BMD in the hips and greater size of the child, only in women that breastfeed. Being the obesity factor of the women that breastfeed. However, a inverse correlation was found among Age/BMD in three regions from women that breasted, contrary to those that did not breastfeed specifically in the BMD lumbar. breastfeeding is beneficial for the mother as it is a protective factor against osteoporosis, as long as it holds the first 6 months and for newborn optimal linear growth. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

[Clinical importance of semi-quantitative monitoring of lymphomas using the comparative polymerase chain reaction].

PubMed

Slavícková, A; Ivánek, R; Cerný, J; Sálková, J; Trnĕný, M

2002-11-22

PCR techniques detecting interchromosomal translocation and clonal immunoglobulin gene rearrangement (IgH) as disease markers in non-Hodgkin's lymphomas (NHL) has been utilised past ten years. However, qualitative PCR detection of persisted minimal residual disease cannot provide clinically useful prognostic information and presently, quantitative approaches are required to predict patient outcome and assess response to the treatment. In some cases, "end-point" quantifying techniques, such as comparative PCR, are applicable and the relative estimation of differences in target quantity may serve in disease monitoring rather than absolute number of target copies. Our method of comparative PCR employs co-amplification of sequences of interest (clonal CDR3, bcl2/Jh) and the segment of Hras 1 gene(ras) as an internal standard. Serial dilutions of stored diagnostic DNAs from blood and bone marrow are examined in the same PCR and, after gel densitometry, the amount of initial target is assessed by comparing exponential products of co-amplification. The comparative PCR assay was utilized in monitoring of NHL patients cured either with conventional therapy, or with high-dose regimens and transplantation with stem cells, or with chimaeric anti-CD20 monoclonal antibody (Rituximab). Results from 50 monitored intervals obtained during several months up to several years were supplemented with clinical statements retrospectively. Some of patients became PCR-negative, reappearance of PCR-positivity was observed as well. The decrease or increase of disease marker corresponded to clinical observations. Results obtained from bone marrow were in agreement with those obtained from blood. End-point quantifying PCR comparative assay may provide an information on the increased risk of relapse and impact of the therapy. The predictive value of these methods depends on the frequency of sample taking and on the sensitivity of the method, which should be monitored in negative cases.

The epidemiology and management of postmenopausal osteoporosis: a viewpoint from Brazil.

PubMed

Baccaro, Luiz Francisco; Conde, Délio Marques; Costa-Paiva, Lúcia; Pinto-Neto, Aarão Mendes

2015-01-01

Brazil has an aging population, with an associated increase in the prevalence of chronic diseases. Postmenopausal osteoporosis is of particular concern because it leads to an increased risk of fractures, with subsequent negative impacts on health in older women. In recent years, efforts have been made to better understand the epidemiology of osteoporosis in Brazil, and to manage both direct and indirect costs to the Brazilian health care system. The reported prevalence of osteoporosis among postmenopausal women in Brazil varies from 15% to 33%, depending on the study methodology and the use of bone densitometry data or self-reporting by participants. A diagnosis of osteoporosis can be made on the basis of fractures occurring without significant trauma or on the basis of low bone mineral density measured by dual energy X-ray absorptiometry. To reduce the risk of osteoporosis, all postmenopausal women should be encouraged to maintain a healthy lifestyle, which includes physical activity and a balanced diet. Smoking and alcohol use should also be addressed. Special attention should be given to interventions to reduce the risk of falls, especially among older women. Calcium intake should be encouraged, preferably through diet. The decision to recommend calcium supplementation should be made individually because there is concern about a possible increased risk of cardiovascular disease associated with this treatment. Brazilian women obtain a minimal amount of vitamin D from their diet, and supplementation is warranted in women with little exposure to solar ultraviolet-B radiation. For women diagnosed with osteoporosis, some form of pharmacologic therapy should be initiated. Compliance with treatment should be monitored, and the treatment period should be individualized for each patient. The Brazilian government provides medication for osteoporosis through the public health system free of charge, but without proper epidemiological knowledge, the implementation of public health programs is impaired.

[Parity and menarche as risk factors of osteoporosis in postmenopausal Mexican women].

PubMed

Mendoza-Romo, Miguel Angel; Ramírez-Arriola, María Cleofas; Velasco-Chávez, José Fernando; Rivera-Martínez, José Guillermo; Nieva-de Jesús, Rafael Natividad; Valdez-Jiménez, Luis Alvaro

2013-03-01

At the moment the studies lead at world-wide level and even in our country have thrown discrepant results about the relation between osteoporosis, parity and age of menarche. To investigate the relation of osteoporosis in postmenopausal Mexican women with multiparity and age of menarche. A retrospective and analytical cross-sectional study, with a non-probabilistic sampling technique in women rightful claimants of the IMSS, San Luis Potosi. In all of them the bone mineral density was measured with X-ray dual absorptiometry in the distal forearm. Reproductive history and age of menarche were obtained by the addition of these items to the previously validated Albrand questionnaire. Women were divided into groups according to the number of pregnancies in: normal parity (0 to 3 childbirths) conformed by 112 patients (46%) and multiparity (> or = 4 pregnancies), 131 women (54%). In relation to menarche with an average of 12.98 years, from this number we divided them in: early menarche (< 13 yrs) and late menarche (> or = 13 yrs). 243 women were studied, with an average of age of 55.92, rank 31 to 80 years. Using the criteria of the World Health Organization, 18% of postmenopausal women had osteoporosis, 39% had osteopenia and 43% had bone normality. No association was found between the number of pregnancies and osteoporosis. Additionally we observed that the women who had four or more children were older than the other women, average 57.42 against 54.16. Also there was significant negative correlation (r = -0.43) between age and densitometry. We found that an age greater to 13 years in the appearance of the menarche was related to osteoporosis (OR 4.46, p: 0.035). In postmenopausal women a menarche older than 13 years is a risk factor for osteoporosis.

Modifying a Rodenstock scanning laser ophthalmoscope for imaging densitometry.

PubMed

Tornow, R P; Beuel, S; Zrenner, E

1997-08-01

The necessary modifications and technical requirements are described for using a commercially available scanning laser ophthalmoscope (Rodenstock Model 101 SLO) as an imaging densitometer to assess human photopigment distribution. The main requirements are a linear detector amplifier, fast shutters for the laser beams, and a trigger unit. Images must be compensated for varying laser intensity. Both rod and cone photopigments are measured with the 514-nm argon laser of the SLO. Discrimination is possible owing to the different spatial distribution. The cone pigment density peaks in the foveal center (D = 0.40) with a steep decrease with increasing eccentricity E (full width at half-maximum, 2.5 degrees ). Rod photopigment increases with increasing eccentricity (D = 0.23 for E = 11 degrees ). These values are in agreement with previous reported results obtained with scanning laser ophthalmoscopes specially designed for retinal densitometry and high stability.

Alternative light source (polilight) illumination with digital image analysis does not assist in determining the age of bruises.

PubMed

Hughes, V K; Ellis, P S; Langlois, N E I

2006-05-10

The age of a bruise may be of interest to forensic investigators. Previous research has demonstrated that an alternative light source may assist in the visualisation of faint or non-visible bruises. This project aimed to determine if an alternative light source could be utilised to assist investigators estimate the age of a bruise. Forty braises, sustained from blunt force trauma, were examined from 30 healthy subjects. The age of the bruises ranged from 2 to 231 h (mean = 74.6, median = 69.0). Alternative light source (polilight) illumination at 415 and 450 nm was used. The black and white photographs obtained were assessed using densitometry. A statistical analysis indicated that there was no correlation between time and the mean densitometry values. The alternative light source used in this study was unable to assist in determining the age of a bruise.

Prevalence of Comorbidities in Rheumatoid Arthritis and Evaluation of Their Monitoring in Clinical Practice: The Spanish Cohort of the COMORA Study.

PubMed

Balsa, Alejandro; Lojo-Oliveira, Leticia; Alperi-López, Mercedes; García-Manrique, María; Ordóñez-Cañizares, Carmen; Pérez, Lorena; Ruiz-Esquide, Virginia; Corrales, Alfonso; Narváez, Javier; Rey-Rey, José; Rodríguez-Lozano, Carlos; Ojeda, Soledad; Muñoz-Fernández, Santiago; Nolla, Joan M; García-Torrón, José; Gamero, Fernando; García-Vicuña, Rosario; Hernández-Cruz, Blanca; Campos, José; Rosas, José; García-Llorente, José Francisco; Gómez-Centeno, Antonio; Cáliz, Rafael; Sanmartí, Raimon; Bermúdez, Alberto; Abasolo-Alcázar, Lydia; Fernández-Nebro, Antonio; Rodríguez-Rodríguez, Luis; Marras, Carlos; González-Gay, Miguel Ángel; Hmamouchi, Ihsane; Martín-Mola, Emilio

2017-07-12

To describe the prevalence of comorbidities in patients with RA in Spain and discuss their management and implications using data from the Spanish cohort of the multinational study on COMOrbidities in Rheumatoid Arthritis (COMORA). This is a national sub-analysis of the COMORA study. We studied the demographics and disease characteristics of 200 adults patients diagnosed with RA (1987 ACR), and routine practices for screening and preventing the following selected comorbidities: cardiovascular, infections, cancer, gastrointestinal, pulmonary, osteoporosis and depression. Patients had a mean age of 58 years and a mean RA duration of 10 years. Mean DAS28 score was 3.3 and approximately 25% of patients were in remission (DAS28 <2.6). Forty-four (22%) patients had ≥1 comorbidity, the most frequent being depression (27%) and obesity (26%). A history of myocardial infarction or stroke was observed in 5% and 1% of patients, respectively, and any solid tumor in 6%. Having a Framingham Risk Score >20% (51%), hypercholesterolemia (46%) or hypertension (41%) and smoking (25%) were the most common CV risk factors. For prostate, colon and skin cancers, only 9%, 10% and 18% of patients, respectively, were optimally monitored. Infections were also inadequately managed, with 7% and 17% of patients vaccinated against influenza and pneumococcal, respectively, as was osteoporosis, with 47% of patients supplemented with vitamin D and 56% with a bone densitometry performed. In Spain, the prevalence of comorbidities and CV risk factors in RA patients with established and advanced disease is relatively high, and their management in clinical daily practice remains suboptimal. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Cronkhite-Canada syndrome associated with rib fractures: a case report.

PubMed

Yuan, Bosi; Jin, Xinxin; Zhu, Renmin; Zhang, Xiaohua; Liu, Jiong; Wan, Haijun; Lu, Heng; Shen, Yunzhu; Wang, Fangyu

2010-10-18

Cronkhite-Canada syndrome (CCS) is a rare multiple gastrointestinal polyposis. Up till now, many complications of CCS have been reported in the literature, but rib fracture is not included. We report a case of a 58-year-old man who was admitted to our hospital with a 6-month history of frequent diarrhea, intermittent hematochezia and a weight loss of 13 kg. On admission, physical examination revealed alopecia of the scalp, hyperpigmentation of the hands and soles, and dystrophy of the fingernails. Laboratory data revealed hypocalcaemia and hypoproteinemia. Esophagogastroduodenoscopy, video capsule endoscopy and colonoscopy revealed various sizes of generalized gastrointestinal polyps. Histological examination of the biopsy specimens obtained from the stomach and the colon showed adenomatous polyp and inflammatory polyp respectively. Thus, a diagnosis of CCS was made. After treatment with corticosteroids for 24 days and nutritional support for two months, his clinical condition improved. Two months later, he was admitted to our hospital for the second time with frequent diarrhea and weight loss. The chest radiography revealed fractures of the left sixth and seventh ribs. Examinations, including emission computed tomography, bone densitometry test, and other serum parameters, were performed, but could not identify the definite etiology of the rib fractures. One month later, the patient suffered from aggravating multiple rib fractures due to the ineffective treatment, persistent hypocalcaemia and malnutrition. This is the first case of a CCS patient with multiple rib fractures. Although the association between CCS and multiple rib fractures in this case remains uncertain, we presume that persistent hypocalcaemia and malnutrition contribute to this situation, or at least aggravate this rare complication. Besides, since prolonged corticosteroid therapy will result in an increased risk of osteoporotic fracture, CCS patients who accept corticosteroid therapy could be potential victims of rib fracture.

Risk factors for falls in older patients with cancer.

PubMed

Zhang, Xiaotao; Sun, Ming; Liu, Suyu; Leung, Cheuk Hong; Pang, Linda; Popat, Uday R; Champlin, Richard; Holmes, Holly M; Valero, Vicente; Dinney, Colin P; Tripathy, Debu; Edwards, Beatrice J

2018-03-01

A rising number of patients with cancer are older adults (65 years of age and older), and this proportion will increase to 70% by the year 2020. Falls are a common condition in older adults. We sought to assess the prevalence and risk factors for falls in older patients with cancer. This is a single-site, retrospective cohort study. Patients who were receiving cancer care underwent a comprehensive geriatric assessments, including cognitive, functional, nutritional, physical, falls in the prior 6 months and comorbidity assessment. Vitamin D and bone densitometry were performed. Descriptive statistics and multivariable logistic regression. A total of 304 patients aged 65 or above were enrolled in this study. The mean age was 78.4±6.9 years. They had haematological, gastrointestinal, urological, breast, lung and gynaecological cancers. A total of 215 patients with available information about falls within the past 6 months were included for final analysis. Seventy-seven (35.8%) patients had at least one fall in the preceding 6 months. Functional impairment (p=0.048), frailty (p<0.001), dementia (p=0.021), major depression (p=0.010) and low social support (p=0.045) were significantly associated with the fall status in the univariate analysis. Multivariate logistic regression analysis identified frailty and functional impairment to be independent risk factors for falls. Falls are common in older patients with cancer and lead to adverse clinical outcomes. Major depression, functional impairment, frailty, dementia and low social support were risk factors for falls. Heightened awareness and targeted interventions can prevent falls in older patients with cancer. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Physical tests for patient selection for bone mineral density measurements in postmenopausal women.

PubMed

Kärkkäinen, Matti; Rikkonen, Toni; Kröger, Heikki; Sirola, Joonas; Tuppurainen, Marjo; Salovaara, Kari; Arokoski, Jari; Jurvelin, Jukka; Honkanen, Risto; Alhava, Esko

2009-04-01

There is a need for cost-effective clinical methods to select women for bone densitometry. The aim of the present study was to determine whether relatively simple and clinically applicable physical tests could be useful in prediction of bone density in postmenopausal women. A total of 606 women (age range 66-71 years) taking part in the population based OSTPRE Fracture Prevention Study were investigated. Spinal and femoral bone mineral density (BMD) was measured by Dual X-ray Absorptiometry (DXA). Physical tests included the standing-on-one-foot (SOOF), grip strength (GS), leg extension strength, ability to squat down, standing 10 s eyes closed, chair rising, regular walk for 10 m and tandem walk for 6 m. All linear regression models were adjusted for age, body mass index, years on hormone therapy, years since menopause, current smoking and use of oral glucocorticoids. The SOOF was associated with lumbar spine BMD (r2=0.16, p=0.004) and the femoral regions (r2 values from 0.17 to 0.23 and p-values all<0.001). The GS was associated with lumbar spine BMD (r2=0.16, p=0.011) and the femoral regions (r2 values from 0.16 to 0.21 and p-values from <0.001 to 0.004). The ability to squat down on the floor was associated with the femoral regions (r2 values from 0.15 to 0.21 and p-values from 0.028 to 0.040). In addition, functional capacity was decreased in women with femoral neck osteoporosis (WHO classification) compared to women with normal or osteopenic BMD: SOOF -39% (p=0.001), GS -18% (p<0.001), leg extension strength -19% (p=0.007) and ability to squat down on the floor -40% (p=0.004). For osteoporosis prediction (ROC analysis) a threshold of a 22 kg in GS would yield a true-positive rate (sensitivity) of about 58% and a true-negative rate (specificity) of 86% (AUC 0.76). We suggest that grip strength could be used in medical decision making to identify those women who would benefit from BMD measurements albeit alone it may not provide accurate enough tool for osteoporosis screening.

Changes in Corneal Density After Accelerated Corneal Collagen Cross-linking With Different Irradiation Intensities and Energy Exposures: 1-Year Follow-up.

PubMed

Akkaya Turhan, Semra; Toker, Ebru

2017-11-01

To determine and compare the changes in corneal density after 2 different protocols of accelerated corneal collagen cross-linking (A-CXL) in patients with progressive keratoconus. Two groups of eyes received A-CXL treatment; 20 eyes received A-CXL using continuous UVA light exposure at 9 mW/cm for 10 minutes with a total energy dose of 5.4 J/cm, and 24 eyes received A-CXL using continuous UVA light exposure at 30 mW/cm for 4 minutes with a total energy dose of 7.2 J/cm. Corneal density was measured with Scheimpflug tomography at 1, 3, 6, and 12 months of follow-up. Densitometry peaked at 1 month (mean: 16.34 ± 3.80, P = 0.006, 9-mW/cm A-CXL; mean: 20.90 ± 2.81, P < 0.0001, 30-mw/cm A-CXL) in both groups, and it decreased over time in 30-mW/cm A-CXL. However, in 9-mW/cm A-CXL, increased corneal densitometry plateaued until 6 months postoperatively and started to decrease thereafter. Densitometry completely returned to baseline after 12 months in both groups. The mean change in density at 1- and 3-month follow-up was higher in the 30-mW A-CXL group than in the 9-mW A-CXL group (P = 0.003, P = 0.044; respectively). High-energy exposure tends to induce more haze in the early posttreatment period, but it is reversible.

New Wrinkles in Retinal Densitometry

PubMed Central

Masella, Benjamin D.; Hunter, Jennifer J.; Williams, David R.

2014-01-01

Purpose. Retinal densitometry provides objective information about retinal function. But, a number of factors, including retinal reflectance changes that are not directly related to photopigment depletion, complicate its interpretation. We explore these factors and suggest a method to minimize their impact. Methods. An adaptive optics scanning light ophthalmoscope (AOSLO) was used to measure changes in photoreceptor reflectance in monkeys before and after photopigment bleaching with 514-nm light. Reflectance measurements at 514 nm and 794 nm were recorded simultaneously. Several methods of normalization to extract the apparent optical density of the photopigment were compared. Results. We identified stimulus-related fluctuations in 794-nm reflectance that are not associated with photopigment absorptance and occur in both rods and cones. These changes had a magnitude approaching those associated directly with pigment depletion, precluding the use of infrared reflectance for normalization. We used a spatial normalization method instead, which avoided the fluctuations in the near infrared, as well as a confocal AOSLO designed to minimize light from layers other than the receptors. However, these methods produced a surprisingly low estimate of the apparent rhodopsin density (animal 1: 0.073 ± 0.006, animal 2: 0.032 ± 0.003). Conclusions. These results confirm earlier observations that changes in photopigment absorption are not the only source of retinal reflectance change during dark adaptation. It appears that the stray light that has historically reduced the apparent density of cone photopigment in retinal densitometry arises predominantly from layers near the photoreceptors themselves. Despite these complications, this method provides a valuable, objective measure of retinal function. PMID:25316726

Integrating a gender dimension into osteoporosis and fracture risk research.

PubMed

Geusens, Piet; Dinant, Geertjan

2007-01-01

Sex (referring to the strict biological sense) and gender (referring to the sociocultural dimension) are major determinants of health and disease. This review examines similarities and differences between the sexes in the prevalence of osteoporosis and fractures, bone- and fall-related risk factors for incident fractures, and the possibilities of fracture prevention, as well as gender differences in the perception of osteoporosis. We reviewed recent English-language publications on sex and gender differences in the context of osteoporosis and fracture risk. We refer to several reviews that provide extensive reference lists on the topics discussed. The incidence of fractures is higher in boys than in girls. The burden of fractures in adults increases with age, and it starts earlier and is higher in adult women than in adult men. With life expectancy increasing, the annual number of fractures is likely to increase substantially. Fractures in adults contribute to increased mortality (more in men than in women), increased morbidity (equal in men and women), and high costs (greater for women than for men). Adult men experience fewer fractures than women do. Men build larger bones with better microarchitecture while they are growing and thereafter have less increase in bone remodeling. Furthermore, they develop bone loss at a later age. Compared with their female counterparts, fewer older men are hypogonadic, and life expectancy is shorter for men than for women. There are multiple reasons for the differences in the incidences of fractures between men and women, related to the many factors associated with both bone and falls that influence fracture risk from the molecular and cellular level to the organ level. Sex hormones play a central and essential role in the physiology of bone by direct and indirect mechanisms (eg, by interfering with the growth hormone and insulin-like growth factor-1 axis). Case-finding strategies to identify patients at highest risk for fractures, including bone densitometry and clinical risk factors, are much better documented at the population level in women than in men. Drug therapies that reduce the risk of a broad spectrum of fractures, even in the short term, are more clearly demonstrated in randomized controlled studies in women than in men. Drug therapy is more widely available for women with osteoporosis,but it is rarely given to men with osteoporosis. Differences in the perception of osteoporosis between men and women are even less well documented. In general, osteoporosis is underdiagnosed and undertreated in women but even more so in men, and is related to limits in the patient's and the physician's awareness at all clinical stages, from case finding to compliance with and persistence of therapy. Furthermore, the lay perception of a healthy lifestyle, the level of social isolation, networking within the health care system, and opportunities for screening appear to contribute to gender differences in participating in osteoporosis prevention and therapy. These aspects of health care deserve further attention and research.

Simultaneous quantification of withanolides in Withania somnifera by a validated high-performance thin-layer chromatographic method.

PubMed

Srivastava, Pooja; Tiwari, Neerja; Yadav, Akhilesh K; Kumar, Vijendra; Shanker, Karuna; Verma, Ram K; Gupta, Madan M; Gupta, Anil K; Khanuja, Suman P S

2008-01-01

This paper describes a sensitive, selective, specific, robust, and validated densitometric high-performance thin-layer chromatographic (HPTLC) method for the simultaneous determination of 3 key withanolides, namely, withaferin-A, 12-deoxywithastramonolide, and withanolide-A, in Ashwagandha (Withania somnifera) plant samples. The separation was performed on aluminum-backed silica gel 60F254 HPTLC plates using dichloromethane-methanol-acetone-diethyl ether (15 + 1 + 1 + 1, v/v/v/v) as the mobile phase. The withanolides were quantified by densitometry in the reflection/absorption mode at 230 nm. Precise and accurate quantification could be performed in the linear working concentration range of 66-330 ng/band with good correlation (r2 = 0.997, 0.999, and 0.996, respectively). The method was validated for recovery, precision, accuracy, robustness, limit of detection, limit of quantitation, and specificity according to International Conference on Harmonization guidelines. Specificity of quantification was confirmed using retention factor (Rf) values, UV-Vis spectral correlation, and electrospray ionization mass spectra of marker compounds in sample tracks.

Soluble scute proteins of healthy and ill desert tortoises (Gopherus agassizii)

USGS Publications Warehouse

Homer, B.L.; Li, C.; Berry, K.H.; Denslow, N.D.; Jacobson, E.R.; Sawyer, R.H.; Williams, J.E.

2001-01-01

Objectives - To characterize protein composition of shell scute of desert tortoises and to determine whether detectable differences could be used to identify healthy tortoises from tortoises with certain illnesses. Animals - 20 desert tortoises. Procedures - Complete postmortem examinations were performed on all tortoises. Plastron scute proteins were solubilized, scute proteins were separated by use of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and proteins were analyzed, using densitometry. Two-dimensional immobilized pH gradient-PAGE (2D IPG-PAGE) and immunoblot analysis, using polyclonal antisera to chicken-feather ?? keratin and to alligator-scale ?? keratin, were conducted on representative samples. The 14-kd proteins were analyzed for amino acid composition. Results - The SDS-PAGE and densitometry revealed 7 distinct bands, each with a mean relative protein concentration of > 1 %, ranging from 8 to 47 kd, and a major protein component of approximately 14 kd that constituted up to 75% of the scute protein. The 2D IPG-PAGE revealed additional distinct 62-and 68-kd protein bands. On immunoblot analysis, the 14-, 32-, and 45-kd proteins reacted with both antisera. The 14-kd proteins had an amino acid composition similar to that of chicken ?? keratins. There was a substantial difference in the percentage of the major 14-kd proteins from scute of ill tortoises with normal appearing shells, compared with 14-kd proteins of healthy tortoises. Conclusions and Clinical Relevance - The major protein components of shell scute of desert tortoises have amino acid composition and antigenic features of ?? keratins. Scute protein composition may be altered in tortoises with certain systemic illnesses.

Comparison of fresh fuel experimental measurements to MCNPX calculations using self-interrogation neutron resonance densitometry

NASA Astrophysics Data System (ADS)

LaFleur, Adrienne M.; Charlton, William S.; Menlove, Howard O.; Swinhoe, Martyn T.

2012-07-01

A new non-destructive assay technique called Self-Interrogation Neutron Resonance Densitometry (SINRD) is currently being developed at Los Alamos National Laboratory (LANL) to improve existing nuclear safeguards measurements for Light Water Reactor (LWR) fuel assemblies. SINRD consists of four 235U fission chambers (FCs): bare FC, boron carbide shielded FC, Gd covered FC, and Cd covered FC. Ratios of different FCs are used to determine the amount of resonance absorption from 235U in the fuel assembly. The sensitivity of this technique is based on using the same fissile materials in the FCs as are present in the fuel because the effect of resonance absorption lines in the transmitted flux is amplified by the corresponding (n,f) reaction peaks in the fission chamber. In this work, experimental measurements were performed in air with SINRD using a reference Pressurized Water Reactor (PWR) 15×15 low enriched uranium (LEU) fresh fuel assembly at LANL. The purpose of this experiment was to assess the following capabilities of SINRD: (1) ability to measure the effective 235U enrichment of the PWR fresh LEU fuel assembly and (2) sensitivity and penetrability to the removal of fuel pins from an assembly. These measurements were compared to Monte Carlo N-Particle eXtended transport code (MCNPX) simulations to verify the accuracy of the MCNPX model of SINRD. The reproducibility of experimental measurements via MCNPX simulations is essential to validating the results and conclusions obtained from the simulations of SINRD for LWR spent fuel assemblies.

Void fraction, bubble size and interfacial area measurements in co-current downflow bubble column reactor with microbubble dispersion

DOE PAGES

Hernandez-Alvarado, Freddy; Kalaga, Dinesh V.; Turney, Damon; ...

2017-05-06

Micro-bubbles dispersed in bubble column reactors have received great interest in recent years, due to their small size, stability, high gas-liquid interfacial area concentrations and longer residence times. The high gas-liquid interfacial area concentrations lead to high mass transfer rates compared to conventional bubble column reactors. In the present work, experiments have been performed in a down-flow bubble column reactor with micro-bubbles generated and dispersed by a novel mechanism to determine the gas-liquid interfacial area concentrations by measuring the void fraction and bubble size distributions. Gamma-ray densitometry has been employed to determine the axial and radial distributions of void fractionmore » and a high speed camera equipped with a borescope is used to measure the axial and radial variations of bubble sizes. Also, the effects of superficial gas and liquid velocities on the two-phase flow characteristics have been investigated. Further, reconstruction techniques of the radial void fraction profiles from the gamma densitometry's chordal measurements are discussed and compared for a bubble column reactor with dispersed micro-bubbles. The results demonstrate that the new bubble generation technique offers high interfacial area concentrations (1,000 to 4,500 m 2/m 3) with sub-millimeter bubbles (500 to 900 µm) and high overall void fractions (10% – 60%) in comparison with previous bubble column reactor designs. The void fraction data was analyzed using slip velocity model and empirical correlation has been proposed to predict the Sauter mean bubble diameter.« less

Void fraction, bubble size and interfacial area measurements in co-current downflow bubble column reactor with microbubble dispersion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez-Alvarado, Freddy; Kalaga, Dinesh V.; Turney, Damon

Micro-bubbles dispersed in bubble column reactors have received great interest in recent years, due to their small size, stability, high gas-liquid interfacial area concentrations and longer residence times. The high gas-liquid interfacial area concentrations lead to high mass transfer rates compared to conventional bubble column reactors. In the present work, experiments have been performed in a down-flow bubble column reactor with micro-bubbles generated and dispersed by a novel mechanism to determine the gas-liquid interfacial area concentrations by measuring the void fraction and bubble size distributions. Gamma-ray densitometry has been employed to determine the axial and radial distributions of void fractionmore » and a high speed camera equipped with a borescope is used to measure the axial and radial variations of bubble sizes. Also, the effects of superficial gas and liquid velocities on the two-phase flow characteristics have been investigated. Further, reconstruction techniques of the radial void fraction profiles from the gamma densitometry's chordal measurements are discussed and compared for a bubble column reactor with dispersed micro-bubbles. The results demonstrate that the new bubble generation technique offers high interfacial area concentrations (1,000 to 4,500 m 2/m 3) with sub-millimeter bubbles (500 to 900 µm) and high overall void fractions (10% – 60%) in comparison with previous bubble column reactor designs. The void fraction data was analyzed using slip velocity model and empirical correlation has been proposed to predict the Sauter mean bubble diameter.« less

Influence of education, marital status, occupation, and the place of living on skeletal status, fracture prevalence, and the course and effectiveness of osteoporotic therapy in women in the RAC-OST-POL Study.

PubMed

Pluskiewicz, Wojciech; Adamczyk, Piotr; Czekajło, Aleksandra; Grzeszczak, Władysław; Drozdzowska, Bogna

2014-01-01

The RAC-OST-POL population-based, epidemiological study provided data concerning the influence of education, marital status, occupation, and the place of living (residence) on skeletal status, fracture prevalence, and the course and effectiveness of osteoporotic therapy in 625 women older than 55 years, all of them recruited from the District of Raciborz in Poland. Their mean age was 66.4 ± 7.8 years. All the women completed a specially designed questionnaire. The skeletal status was assessed by femoral neck (FN) and total hip (TH) densitometry, using a Lunar DPX system (USA). In univariate analyses, taking into consideration the age differences, bone mineralization was dependent on marital status (Z score for FN and TH was significantly higher in widows than in divorcees; p < 0.05), place of residence (better results in rural areas; p < 0.05), and occupation (better in standing than sitting jobs; p < 0.05 for FN Z score and p < 0.01 for TH Z score). The multivariate model allowed us to verify that only place of living and type of occupation had a significant influence on densitometry results. In direct comparison, fracture prevalence seemed to be borderline significantly more common in widows (33.5%) and least common among divorcees (11.8%) (χ(2) = 6.9, df = 3, p = 0.07), but reanalysis performed after age adjustment excluded a true impact of marital status on fracture occurrence. Other factors did not affect fracture occurrence. Some factors influenced the use of medications for osteoporosis: higher level of education was associated with a more frequent use of vitamin D (χ(2) = 8.49, df = 3, p < 0.05) and of hormone replacement therapy (HRT) (χ(2) = 35.7, df = 3, p < 0.00001). HRT was most commonly used by unmarried women (30%) and least commonly by divorcees (11.8%) (χ(2) = 11.7, df = 3, p = 0.01). Vitamin D was more often used among women from the urban area of Raciborz than by those from surrounding rural areas (χ(2) = 9.2, df = 1, p < 0.01). The frequency of use of the three aforementioned medications was associated with the character of occupation. Women with sedentary jobs demonstrated the highest frequency of intake for vitamin D (χ(2) = 9.92, df = 3, p < 0.05) and HRT (χ(2) = 19.48, df = 3, p < 0.001) as well as for other antiresorptive medications (χ(2) = 8.18, df = 3, p < 0.05). We concluded that the results of the epidemiological study demonstrate that both skeletal status and use of antiosteoporotic medications were partially modified by analyzed social factors, whereas fracture prevalence was generally independent from those factors. These data suggest that education, marital status, place of living, and type of occupation may have impacts on implementation of osteoporosis-preventing health programs.

The microcomputer in cell and neurobiology research

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mize, R.R.

1985-01-01

This book contains 21 chapters. They are divided into the following sections: The Microcomputer as a Research Tool, Microcomputer Uses in Light and Electron Microscopy, Microcomputer Uses in Morphometry, Serial Section Reconstruction, Microcomputer Uses in Imaging and Densitometry, and Microcomputer Uses in Electrophysiology.

Managing osteoporosis in ulcerative colitis: Something new?

PubMed Central

Piodi, Luca Petruccio; Poloni, Alessandro; Ulivieri, Fabio Massimo

2014-01-01

The authors revise the latest evidence in the literature regarding managing of osteoporosis in ulcerative colitis (UC), paying particular attention to the latest tendency of the research concerning the management of bone damage in the patient affected by UC. It is wise to assess vitamin D status in ulcerative colitis patients to recognize who is predisposed to low levels of vitamin D, whose deficiency has to be treated with oral or parenteral vitamin D supplementation. An adequate dietary calcium intake or supplementation and physical activity, if possible, should be guaranteed. Osteoporotic risk factors, such as smoking and excessive alcohol intake, must be avoided. Steroid has to be prescribed at the lowest possible dosage and for the shortest possible time. Moreover, conditions favoring falling have to been minimized, like carpets, low illumination, sedatives assumption, vitamin D deficiency. It is advisable to assess the fracture risk in all UC patient by the fracture assessment risk tool (FRAX® tool), that calculates the ten years risk of fracture for the population aged from 40 to 90 years in many countries of the world. A high risk value could indicate the necessity of treatment, whereas a low risk value suggests a follow-up only. An intermediate risk supports the decision to prescribe bone mineral density (BMD) assessment and a subsequent patient revaluation for treatment. Dual energy X-ray absorptiometry bone densitometry can be used not only for BMD measurement, but also to collect data about bone quality by the means of trabecular bone score and hip structural analysis assessment. These two indices could represent a method of interesting perspectives in evaluating bone status in patients affected by diseases like UC, which may present an impairment of bone quality as well as of bone quantity. In literature there is no strong evidence for instituting pharmacological therapy of bone impairment in UC patients for clinical indications other than those that are also applied to the patients with osteoporosis. Therefore, a reasonable advice is to consider pharmacological treatment for osteoporosis in those UC patients who already present fragility fractures, which bring a high risk of subsequent fractures. Therapy has also to be considered in patients with a high risk of fracture even if it did not yet happen, and particularly when they had long periods of corticosteroid therapy or cumulative high dosages. In patients without fragility fractures or steroid treatment, a medical decision about treatment could be guided by the FRAX tool to determine the intervention threshold. Among drugs for osteoporosis treatment, the bisphosphonates are the most studied ones, with the best and longest evidence of efficacy and safety. Despite this, several questions are still open, such as the duration of treatment, the necessity to discontinue it, the indication of therapy in young patients, particularly in those without previous fractures. Further, it has to be mentioned that a long-term bisphosphonates use in primary osteoporosis has been associated with an increased incidence of dramatic side-effects, even if uncommon, like osteonecrosis of the jaw and atypical sub-trochanteric and diaphyseal femoral fractures. UC is a long-lasting disease and the majority of patients is relatively young. In this scenario primary prevention of fragility fracture is the best cost-effective strategy. Vitamin D supplementation, adequate calcium intake, suitable physical activity (when possible), removing of risk factors for osteoporosis like smoking, and avoiding falling are the best medical acts. PMID:25339798

Utilization of DXA Bone Mineral Densitometry in Ontario: An Evidence-Based Analysis.

PubMed

2006-01-01

Systematic reviews and analyses of administrative data were performed to determine the appropriate use of bone mineral density (BMD) assessments using dual energy x-ray absorptiometry (DXA), and the associated trends in wrist and hip fractures in Ontario. DUAL ENERGY X-RAY ABSORPTIOMETRY BONE MINERAL DENSITY ASSESSMENT: Dual energy x-ray absorptiometry bone densitometers measure bone density based on differential absorption of 2 x-ray beams by bone and soft tissues. It is the gold standard for detecting and diagnosing osteoporosis, a systemic disease characterized by low bone density and altered bone structure, resulting in low bone strength and increased risk of fractures. The test is fast (approximately 10 minutes) and accurate (exceeds 90% at the hip), with low radiation (1/3 to 1/5 of that from a chest x-ray). DXA densitometers are licensed as Class 3 medical devices in Canada. The World Health Organization has established criteria for osteoporosis and osteopenia based on DXA BMD measurements: osteoporosis is defined as a BMD that is >2.5 standard deviations below the mean BMD for normal young adults (i.e. T-score <-2.5), while osteopenia is defined as BMD that is more than 1 standard deviation but less than 2.5 standard deviation below the mean for normal young adults (i.e. T-score< -1 & ≥-2.5). DXA densitometry is presently an insured health service in Ontario.   BURDEN OF DISEASE: The Canadian Multicenter Osteoporosis Study (CaMos) found that 16% of Canadian women and 6.6% of Canadian men have osteoporosis based on the WHO criteria, with prevalence increasing with age. Osteopenia was found in 49.6% of Canadian women and 39% of Canadian men. In Ontario, it is estimated that nearly 530,000 Ontarians have some degrees of osteoporosis. Osteoporosis-related fragility fractures occur most often in the wrist, femur and pelvis. These fractures, particularly those in the hip, are associated with increased mortality, and decreased functional capacity and quality of life. A Canadian study showed that at 1 year after a hip fracture, the mortality rate was 20%. Another 20% required institutional care, 40% were unable to walk independently, and there was lower health-related quality of life due to attributes such as pain, decreased mobility and decreased ability to self-care. The cost of osteoporosis and osteoporotic fractures in Canada was estimated to be $1.3 billion in 1993. With 2 exceptions, almost all guidelines address only women. None of the guidelines recommend blanket population-based BMD testing. Instead, all guidelines recommend BMD testing in people at risk of osteoporosis, predominantly women aged 65 years or older. For women under 65 years of age, BMD testing is recommended only if one major or two minor risk factors for osteoporosis exist. Osteoporosis Canada did not restrict its recommendations to women, and thus their guidelines apply to both sexes. Major risk factors are age greater than or equal to 65 years, a history of previous fractures, family history (especially parental history) of fracture, and medication or disease conditions that affect bone metabolism (such as long-term glucocorticoid therapy). Minor risk factors include low body mass index, low calcium intake, alcohol consumption, and smoking. The Ontario Health Insurance Program (OHIP) Schedule presently reimburses DXA BMD at the hip and spine. Measurements at both sites are required if feasible. Patients at low risk of accelerated bone loss are limited to one BMD test within any 24-month period, but there are no restrictions on people at high risk. The total fee including the professional and technical components for a test involving 2 or more sites is $106.00 (Cdn). This review consisted of 2 parts. The first part was an analysis of Ontario administrative data relating to DXA BMD, wrist and hip fractures, and use of antiresorptive drugs in people aged 65 years and older. The Institute for Clinical Evaluative Sciences extracted data from the OHIP claims database, the Canadian Institute for Health Information hospital discharge abstract database, the National Ambulatory Care Reporting System, and the Ontario Drug Benefit database using OHIP and ICD-10 codes. The data was analyzed to examine the trends in DXA BMD use from 1992 to 2005, and to identify areas requiring improvement. The second part included systematic reviews and analyses of evidence relating to issues identified in the analyses of utilization data. Altogether, 8 reviews and qualitative syntheses were performed, consisting of 28 published systematic reviews and/or meta-analyses, 34 randomized controlled trials, and 63 observational studies. Analysis of administrative data showed a 10-fold increase in the number of BMD tests in Ontario between 1993 and 2005.OHIP claims for BMD tests are presently increasing at a rate of 6 to 7% per year. Approximately 500,000 tests were performed in 2005/06 with an age-adjusted rate of 8,600 tests per 100,000 population.Women accounted for 90 % of all BMD tests performed in the province.In 2005/06, there was a 2-fold variation in the rate of DXA BMD tests across local integrated health networks, but a 10-fold variation between the county with the highest rate (Toronto) and that with the lowest rate (Kenora). The analysis also showed that:With the increased use of BMD, there was a concomitant increase in the use of antiresorptive drugs (as shown in people 65 years and older) and a decrease in the rate of hip fractures in people age 50 years and older.Repeat BMD made up approximately 41% of all tests. Most of the people (>90%) who had annual BMD tests in a 2-year or 3-year period were coded as being at high risk for osteoporosis.18% (20,865) of the people who had a repeat BMD within a 24-month period and 34% (98,058) of the people who had one BMD test in a 3-year period were under 65 years, had no fracture in the year, and coded as low-risk.Only 19% of people age greater than 65 years underwent BMD testing and 41% received osteoporosis treatment during the year following a fracture.Men accounted for 24% of all hip fractures and 21 % of all wrist fractures, but only 10% of BMD tests. The rates of BMD tests and treatment in men after a fracture were only half of those in women.In both men and women, the rate of hip and wrist fractures mainly increased after age 65 with the sharpest increase occurring after age 80 years. SERIAL BONE MINERAL DENSITY TESTING FOR PEOPLE NOT RECEIVING OSTEOPOROSIS TREATMENT: A systematic review showed that the mean rate of bone loss in people not receiving osteoporosis treatment (including postmenopausal women) is generally less than 1% per year. Higher rates of bone loss were reported for people with disease conditions or on medications that affect bone metabolism. In order to be considered a genuine biological change, the change in BMD between serial measurements must exceed the least significant change (variability) of the testing, ranging from 2.77% to 8% for precisions ranging from 1% to 3% respectively. Progression in BMD was analyzed, using different rates of baseline BMD values, rates of bone loss, precision, and BMD value for initiating treatment. The analyses showed that serial BMD measurements every 24 months (as per OHIP policy for low-risk individuals) is not necessary for people with no major risk factors for osteoporosis, provided that the baseline BMD is normal (T-score ≥ -1), and the rate of bone loss is less than or equal to 1% per year. The analyses showed that for someone with a normal baseline BMD and a rate of bone loss of less than 1% per year, the change in BMD is not likely to exceed least significant change (even for a 1% precision) in less than 3 years after the baseline test, and is not likely to drop to a BMD level that requires initiation of treatment in less than 16 years after the baseline test. Seven published meta-analysis of randomized controlled trials (RCTs) and 2 recent RCTs on BMD monitoring during osteoporosis therapy showed that although higher increases in BMD were generally associated with reduced risk of fracture, the change in BMD only explained a small percentage of the fracture risk reduction.Studies showed that some people with small or no increase in BMD during treatment experienced significant fracture risk reduction, indicating that other factors such as improved bone microarchitecture might have contributed to fracture risk reduction.There is conflicting evidence relating to the role of BMD testing in improving patient compliance with osteoporosis therapy.Even though BMD may not be a perfect surrogate for reduction in fracture risk when monitoring responses to osteoporosis therapy, experts advised that it is still the only reliable test available for this purpose.A systematic review conducted by the Medical Advisory Secretariat showed that the magnitude of increases in BMD during osteoporosis drug therapy varied among medications. Although most of the studies yielded mean percentage increases in BMD from baseline that did not exceed the least significant change for a 2% precision after 1 year of treatment, there were some exceptions. A review of 3 published pooled analyses of observational studies and 12 prospective population-based observational studies showed that the presence of any prevalent fracture increases the relative risk for future fractures by approximately 2-fold or more. (ABSTRACT TRUNCATED)

Greater association of peak neuromuscular performance with cortical bone geometry, bone mass and bone strength than bone density: A study in 417 older women.

PubMed

Belavý, Daniel L; Armbrecht, Gabriele; Blenk, Tilo; Bock, Oliver; Börst, Hendrikje; Kocakaya, Emine; Luhn, Franziska; Rantalainen, Timo; Rawer, Rainer; Tomasius, Frederike; Willnecker, Johannes; Felsenberg, Dieter

2016-02-01

We evaluated which aspects of neuromuscular performance are associated with bone mass, density, strength and geometry. 417 women aged 60-94years were examined. Countermovement jump, sit-to-stand test, grip strength, forearm and calf muscle cross-sectional area, areal bone mineral content and density (aBMC and aBMD) at the hip and lumbar spine via dual X-ray absorptiometry, and measures of volumetric vBMC and vBMD, bone geometry and section modulus at 4% and 66% of radius length and 4%, 38% and 66% of tibia length via peripheral quantitative computed tomography were performed. The first principal component of the neuromuscular variables was calculated to generate a summary neuromuscular variable. Percentage of total variance in bone parameters explained by the neuromuscular parameters was calculated. Step-wise regression was also performed. At all pQCT bone sites (radius, ulna, tibia, fibula), a greater percentage of total variance in measures of bone mass, cortical geometry and/or bone strength was explained by peak neuromuscular performance than for vBMD. Sit-to-stand performance did not relate strongly to bone parameters. No obvious differential in the explanatory power of neuromuscular performance was seen for DXA aBMC versus aBMD. In step-wise regression, bone mass, cortical morphology, and/or strength remained significant in relation to the first principal component of the neuromuscular variables. In no case was vBMD positively related to neuromuscular performance in the final step-wise regression models. Peak neuromuscular performance has a stronger relationship with leg and forearm bone mass and cortical geometry as well as proximal forearm section modulus than with vBMD. Copyright © 2015 Elsevier Inc. All rights reserved.

Changes in dynamic embryonic heart wall motion in response to outflow tract banding measured using video densitometry

NASA Astrophysics Data System (ADS)

Stovall, Stephanie; Midgett, Madeline; Thornburg, Kent; Rugonyi, Sandra

2016-11-01

Abnormal blood flow during early cardiovascular development has been identified as a key factor in the pathogenesis of congenital heart disease; however, the mechanisms by which altered hemodynamics induce cardiac malformations are poorly understood. This study used outflow tract (OFT) banding to model increased afterload, pressure, and blood flow velocities at tubular stages of heart development and characterized the immediate changes in cardiac wall motion due to banding in chicken embryo models with light microscopy-based video densitometry. Optical videos were used to acquire two-dimensional heart image sequences over the cardiac cycle, from which intensity data were extracted along the heart centerline at several locations in the heart ventricle and OFT. While no changes were observed in the synchronous contraction of the ventricle with banding, the peristaltic-like wall motion in the OFT was significantly affected. Our data provide valuable insight into early cardiac biomechanics and its characterization using a simple light microscopy-based imaging modality.

A new background subtraction method for Western blot densitometry band quantification through image analysis software.

PubMed

Gallo-Oller, Gabriel; Ordoñez, Raquel; Dotor, Javier

2018-06-01

Since its first description, Western blot has been widely used in molecular labs. It constitutes a multistep method that allows the detection and/or quantification of proteins from simple to complex protein mixtures. Western blot quantification method constitutes a critical step in order to obtain accurate and reproducible results. Due to the technical knowledge required for densitometry analysis together with the resources availability, standard office scanners are often used for the imaging acquisition of developed Western blot films. Furthermore, the use of semi-quantitative software as ImageJ (Java-based image-processing and analysis software) is clearly increasing in different scientific fields. In this work, we describe the use of office scanner coupled with the ImageJ software together with a new image background subtraction method for accurate Western blot quantification. The proposed method represents an affordable, accurate and reproducible approximation that could be used in the presence of limited resources availability. Copyright © 2018 Elsevier B.V. All rights reserved.

Creep and fatigue behavior of a novel 2-component paste-like formulation of acrylic bone cements.

PubMed

Köster, Ulrike; Jaeger, Raimund; Bardts, Mareike; Wahnes, Christian; Büchner, Hubert; Kühn, Klaus-Dieter; Vogt, Sebastian

2013-06-01

The fatigue and creep performance of two novel acrylic bone cement formulations (one bone cement without antibiotics, one with antibiotics) was compared to the performance of clinically used bone cements (Osteopal V, Palacos R, Simplex P, SmartSet GHV, Palacos R+G and CMW1 with Gentamicin). The preparation of the novel bone cement formulations involves the mixing of two paste-like substances in a static mixer integrated into the cartridge which is used to apply the bone cement. The fatigue performance of the two novel bone cement formulations is comparable to the performance of the reference bone cements. The creep compliance of the bone cements is significantly influenced by the effects of physical ageing. The model parameters of Struik's creep law are used to compare the creep behavior of different bone cements. The novel 2-component paste-like bone cement formulations are in the group of bone cements which exhibit a higher creep resistance.

Bionic Design, Materials and Performance of Bone Tissue Scaffolds

PubMed Central

Wu, Tong; Yu, Suihuai; Chen, Dengkai; Wang, Yanen

2017-01-01

Design, materials, and performance are important factors in the research of bone tissue scaffolds. This work briefly describes the bone scaffolds and their anatomic structure, as well as their biological and mechanical characteristics. Furthermore, we reviewed the characteristics of metal materials, inorganic materials, organic polymer materials, and composite materials. The importance of the bionic design in preoperative diagnosis models and customized bone scaffolds was also discussed, addressing both the bionic structure design (macro and micro structure) and the bionic performance design (mechanical performance and biological performance). Materials and performance are the two main problems in the development of customized bone scaffolds. Bionic design is an effective way to solve these problems, which could improve the clinical application of bone scaffolds, by creating a balance between mechanical performance and biological performance. PMID:29039749

Bionic Design, Materials and Performance of Bone Tissue Scaffolds.

PubMed

Wu, Tong; Yu, Suihuai; Chen, Dengkai; Wang, Yanen

2017-10-17

Design, materials, and performance are important factors in the research of bone tissue scaffolds. This work briefly describes the bone scaffolds and their anatomic structure, as well as their biological and mechanical characteristics. Furthermore, we reviewed the characteristics of metal materials, inorganic materials, organic polymer materials, and composite materials. The importance of the bionic design in preoperative diagnosis models and customized bone scaffolds was also discussed, addressing both the bionic structure design (macro and micro structure) and the bionic performance design (mechanical performance and biological performance). Materials and performance are the two main problems in the development of customized bone scaffolds. Bionic design is an effective way to solve these problems, which could improve the clinical application of bone scaffolds, by creating a balance between mechanical performance and biological performance.

[The role of a pediatric endocrinologist in diagnostics and therapeutic management of anorexia nervosa--own experiences and review of literature].

PubMed

Roztoczyńska, Dorota; Starzyk, Jerzy

2009-01-01

Anorexia nervosa and bulimia nervosa are counted among psychosomatic diseases, whose incidence has been rapidly increasing in the last decades. To date, the etiology, diagnostic and therapeutic management of eating disorders have not been uniformly determined. The objective of the study is determination of the role of a pediatric endocrinologist in diagnostics and management of eating disorders. In the years 1992-2007 in Department of Pediatric and Adolescent Endocrinology Chair of Pediatrics, Polish-American Institute of Pediatrics, Collegium Medicum, Jagiellonian University in Krakow, Poland were hospitalized 164 patients with suspected anorexia nervosa, aged 9-20 years, 150 girls, and 14 boys. All girls were included in psychological and dietetic treatment. Additionally, in group of 36 girls, the 3-years observation of bone mineralization changes was performed. The indications for hospitalization included the assessment of nutritional status, particularly electrolyte imbalance, cardiovascular complications and nutritional treatment. II. Procedure included on department: 1) Correction of general children's state. 2) Monitoring of cardiovascular system disorders. 3) Nutritional treatment. 4) Differential diagnosis. III. Prevention and treatment of late complications was performed in group of 36 girls. In this group, every 6 months were evaluated: body mass index, duration of secondary amenorrhea, serum sex hormone, IGF-I and cortisol levels and 24-hour urine cortisol. Spine densitometry in the AP projection was performed every 12 months, using a Lunar unit (DEXA). The pharmacological treatment of osteoporosis was introduced in girls with duration of secondary amenorrhea lasted for more than 6 months, with decreased bone mineralization BMD < (-) 1SD and body mass deficit < 20%. 16 girls which did not presented disorders of bone mineralization, or refused treatment have not got the pharmacological treatment, while in 20 girls the pharmacological therapy (calcium and vitamin D3 supplementation and hormonal treatment - Estraderm TTS and Provera 5 mg) was provided. Anorexia nervosa was diagnosed in 150 cases, bulimia in 6 cases, in 2 children was diagnosed celiac disease, in 2 patients adrenal insufficiency, in 1 girl myasthenia, in 1 girl diabetes mellitus type 1, in 1 boy hypothalamo-pituitary tumor and in 1 boy psychosis was diagnosed. The nutritional improvement was evaluated in group of 36 girls, which continued treatment in time 3 years. At the beginning of the observation period the mean value of the body mass index (BMI) was 15.95 kg/m2, and after 36 months of the treatment the mean BMI value was 20 kg/m2. Before the treatment one patient was still menstruated despite her body mass loss, 8 girls were pre-menarche, and the remaining 27 patients had secondary amenorrhea of the mean duration of 11.14 months. In the initial period of the follow-up, all the anorectic patients demonstrated a decreased bone mineral density. Before treatment the median Z score in the entire experimental group was (-)1,2 SD whereas after 3 years of treatment value of Z score decreased by 0,5 SD in group of 16 girls without the pharmacological treatment and increased by 0,5 SD in 20 girls on pharmacological treatment. The significant, negative correlation between secondary amenorrhea and Z score value was observed. The role of a pediatrician in therapeutic management of eating disorders is intervention in life-threatening conditions, treatment of acute complications, differential diagnosis, nutritional treatment, prevention and management of late complications. Because of etiology and special way of treatment the management of anorexia nervosa should have been taken by psychiatrist. The duty of endocrinologists and gynecologists is the late complications treatment, such as an amenorrhea and osteoporosis.

Linear Dichroism Characteristics of Ethidium and Proflavine Supercoiled DNA Complexes

DTIC Science & Technology

1990-01-01

of Ethidium-and Proflavine -Supercoi led DNA Complexes CHARLES E. SWENBERG, 1 SUSAN E. CARBERRV, 2 * and NICHOLAS E. GEACINTOV’ SRadliationl Biochenitr...drug were stained with EB, photographed under uv light, molecules, EB and proflavine (PF) (Figure 1), and the bands were quantitated by densitometry

A simple 96 well microfluidic chip combined with visual and densitometry detection for resource-poor point of care testing

PubMed Central

Yang, Minghui; Sun, Steven; Kostov, Yordan

2010-01-01

There is a well-recognized need for low cost biodetection technologies for resource-poor settings with minimal medical infrastructure. Lab-on-a-chip (LOC) technology has the ability to perform biological assays in such settings. The aim of this work is to develop a low cost, high-throughput detection system for the analysis of 96 samples simultaneously outside the laboratory setting. To achieve this aim, several biosensing elements were combined: a syringe operated ELISA lab-on-a-chip (ELISA-LOC) which integrates fluid delivery system into a miniature 96-well plate; a simplified non-enzymatic reporter and detection approach using a gold nanoparticle-antibody conjugate as a secondary antibody and silver enhancement of the visual signal; and Carbon nanotubes (CNT) to increase primary antibody immobilization and improve assay sensitivity. Combined, these elements obviate the need for an ELISA washer, electrical power for operation and a sophisticated detector. We demonstrate the use of the device for detection of Staphylococcal enterotoxin B, a major foodborne toxin using three modes of detection, visual detection, CCD camera and document scanner. With visual detection or using a document scanner to measure the signal, the limit of detection (LOD) was 0.5ng/ml. In addition to visual detection, for precise quantitation of signal using densitometry and a CCD camera, the LOD was 0.1ng/ml for the CCD analysis and 0.5 ng/ml for the document scanner. The observed sensitivity is in the same range as laboratory-based ELISA testing. The point of care device can analyze 96 samples simultaneously, permitting high throughput diagnostics in the field and in resource poor areas without ready access to laboratory facilities or electricity. PMID:21503269

Anti-inflammatory activity of Crateva adansonii DC on keratinocytes infected by Staphylococcus aureus: From traditional practice to scientific approach using HPTLC-densitometry.

PubMed

Ahama-Esseh, Kplolali; Bodet, Charles; Quashie-Mensah-Attoh, Akossiwa; Garcia, Magali; Théry-Koné, Isabelle; Dorat, Joelle; De Souza, Comlan; Enguehard-Gueiffier, Cécile; Boudesocque-Delaye, Leslie

2017-05-23

Leaves of Crateva adansonii DC (Capparidaceae), a small bush found in Togo, are widely used in traditional medicine to cure infectious abscesses. Traditional healers of Lomé harvest only budding leaves early in the morning, in specific area in order to prepare their drugs. The main goal was to validate the ancestral picking practices, and to assess the activity of C. adansonii medicine towards infectious abscesses. A phytochemical screening of various C. adansonii leaf samples was performed using an original HPTLC-densitometry protocol and major flavonoids were identified and quantified. C. adansonii samples were collected in different neighborhoods of Lomé, at different harvesting-times and at different ages. Radical scavenging capacity, using DPPH assay, was used to quickly screen all extracts. Extracts were tested for anti-Staphylococcus aureus activity and anti-inflammatory effect on human primary keratinocytes infected by S. aureus. IL6, IL8 and TNFα expression and production were assessed by RT-PCR and ELISA assays. Using antioxidant activity as selection criteria, optimal extracts were obtained with budding leaves, collected at 5:00am in Djidjolé neighborhood. This extract showed the strongest anti-inflammatory effect on S. aureus-infected keratinocytes by reducing IL6, IL8 and TNFα expression and production. None of the extracts inhibited the growth of S. aureus. Those results validate the traditional practices and the potential of C. adansonii as anti-inflammatory drug. Our findings suggest that traditional healers should add to C. adansonii leaves an antibacterial plant of Togo Pharmacopeia, in order to improve abscess healing. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Sarcopenia: a chronic complication of type 2 diabetes mellitus.

PubMed

Trierweiler, Heloísa; Kisielewicz, Gabrielle; Hoffmann Jonasson, Thaísa; Rasmussen Petterle, Ricardo; Aguiar Moreira, Carolina; Zeghbi Cochenski Borba, Victória

2018-01-01

Diabetics are at increased risk for impaired mobility and strength, frequently related to the disease control. Sarcopenia is the reduction of muscle mass associated with the decrease in muscle strength and/or performance, resulting in worse morbidity in chronic diseases. The objectives of this paper was to assess the prevalence of sarcopenia in patients with type 2 diabetes mellitus (T2DM) and determine its association with diabetes characteristics, progression, and complications, as well as changes in bone mineral density. The sample consisted of patients with T2DM followed at the outpatient clinics of the Serviço de Endocrinologia e Metabologia do Hospital de Clínicas da Universidade Federal do Paraná, from March to August 2016. Participants were men and women above 18 years with T2DM diagnosed at least 1 year earlier. Individuals with chronic diseases, users of any drug that modifies body composition, patients with body mass index (BMI) > 35 or < 18 kg/m 2 , and users of illicit drugs or hormonal or nutritional supplementation were excluded. The selected patients answered questionnaires about demographics, eating habits, and disease characteristics, and performed a bone densitometry exam in a dual energy absorptiometry (total body; spine and femur (total and neck)), a handgrip test by manual dynamometer, and an evaluation of the abdominal circumference (AC). The medical records were reviewed seeking diabetes data and laboratory test results. Patients were matched for sex, age, and race with healthy controls [Control Group (CG)]. The diagnosis of sarcopenia was conducted according to the criteria of the Foundation for National Institute of Health. The final sample consisted of 83 patients in the DG and 83 in the CG. The DG had higher BMI, WC, past history of fractures and lower calcium and healthy diet intake (p < 0.005), compared to the CG. The DG presented a higher frequency of abnormal BMD (osteopenia in 45 (53%), and osteoporosis in 14 (19%)) and comorbidities than the CG (p < 0.005). Pre-sarcopenia was not different between groups, but muscle weakness was present in 25 diabetics (18 women) and only in 5 controls (4 men) (p = 0.00036). Sarcopenia was diagnosed in 13 (16.2%) patients in the DG and 2 (2.4%) in the CG (p = 0.01168). Pre-sarcopenia and sarcopenia were associated with altered BMD (p < 0.005), with no association with diabetes duration or control. Body mass index and osteoporosis increased the likelihood to have sarcopenia, but hypertension and healthy diet decreased it. The DG had altered BMD associated with worse glycemic control, and a higher prevalence of sarcopenia, suggesting the need to look for their presence in diabetics.

Evaluation of a vaccination regimen and care in relation to follow-up and treatment of patients with inflammatory bowel disease.

PubMed

Yamamoto-Furusho, J K; Sarmiento-Aguilar, A; Parra-Holguín, N N; Bozada-Gutiérrez, K E

2018-03-28

During the clinical course of inflammatory bowel disease, different causes can compromise kidney, liver, and bone marrow function and increase the risk for osteoporosis, infections, and neoplasias. The aim of the present study was to describe the follow-up of Mexican patients with inflammatory bowel disease in relation to their vaccination regimen, treatment-associated risks, and cancer screening. A retrospective cross-sectional study was conducted within the time frame of February and June 2017. One hundred patients that had a histopathologic diagnosis of inflammatory bowel disease were surveyed about their follow-up vaccination regimen, treatment-associated risks, and cancer screening. SPSS v24 software was employed for the statistical analysis. One hundred patients with inflammatory bowel disease were studied (90% with ulcerative colitis and 10% with Crohn's disease; 60% women, 40% men): 75% stated that they had no vaccination regimen. A total of 71.4% of the women had at least one Pap smear in their lives and 28.6% did not have them done annually. Twenty-four percent of the patients wore sun block daily. A total of 18.2% of the patients with more than a 10-year progression of ulcerative colitis had an annual colonoscopy. Yearly kidney function was registered in 57.1% of the patients, 92.9% had a yearly complete blood count, and 78.6% had yearly liver function tests. A total of 34.8% of patients had no bone densitometry in their case records. These results are a red flag suggesting the need to reinforce the role of the primary healthcare providers in relation to vaccination follow-up and the need to improve the education of the patient in relation to inflammatory bowel disease. Copyright © 2018 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

Overuse of short-interval bone densitometry: assessing rates of low-value care.

PubMed

Morden, N E; Schpero, W L; Zaha, R; Sequist, T D; Colla, C H

2014-09-01

We evaluated the prevalence and geographic variation of short-interval (repeated in under 2 years) dual-energy X-ray absorptiometry tests (DXAs) among Medicare beneficiaries. Short-interval DXA use varied across regions (coefficient of variation = 0.64), and unlike other DXAs, rates decreased with payment cuts. The American College of Rheumatology, through the Choosing Wisely initiative, identified measuring bone density more often than every 2 years as care "physicians and patients should question." We measured the prevalence and described the geographic variation of short-interval (repeated in under 2 years) DXAs among Medicare beneficiaries and estimated the cost of this testing and its responsiveness to payment change. Using 100 % Medicare claims data, 2006-2011, we identified DXAs and short-interval DXAs for female Medicare beneficiaries over age 66. We determined the population rate of DXAs and short-interval DXAs, as well as Medicare spending on short-interval DXAs, nationally and by hospital referral region (HRR). DXA use was stable 2008-2011 (12.4 to 11.5 DXAs per 100 women). DXA use varied across HRRs: in 2011, overall DXA use ranged from 6.3 to 23.0 per 100 women (coefficient of variation = 0.18), and short-interval DXAs ranged from 0.3 to 8.0 per 100 women (coefficient of variation = 0.64). Short-interval DXA use fluctuated substantially with payment changes; other DXAs did not. Short-interval DXAs, which represented 10.1 % of all DXAs, cost Medicare approximately US$16 million in 2011. One out of ten DXAs was administered in a time frame shorter than recommended and at a substantial cost to Medicare. DXA use varied across regions. Short-interval DXA use was responsive to reimbursement changes, suggesting carefully designed policy and payment reform may reduce this care identified by rheumatologists as low value.

Severity of aortic calcification is positively associated with vertebral fracture in older men—a densitometry study in the STRAMBO cohort

PubMed Central

Samelson, E. J.; Sornay-Rendu, E.; Chapurlat, R.; Kiel, D. P.

2013-01-01

Summary In older men, severe abdominal aortic calcification and vertebral fracture (both assessed using dual-energy X-ray absorptiometry) were positively associated after adjustment for confounders including bone mineral density. Introduction Abdominal aortic calcification (AAC) is associated with higher fracture risk, independently of low bone mineral density (BMD). Dual-energy X-ray absorptiometry (DXA) can be used to assess both vertebral fracture and AAC and requires less time, cost, and radiation exposure. Methods We conducted a cross-sectional study of the association between AAC and prevalent vertebral fractures in 901 men ≥50 years old. We used DXA (vertebral fracture assessment) to evaluate BMD, vertebral fracture, and AAC. Results Prevalence of vertebral fracture was 11 %. Median AAC score was 1 and 12 % of men had AAC score >6. After adjustment for age, weight, femoral neck BMD, smoking, ischemic heart disease, diabetes, and hypertension, AAC score >6 (vs ≤6) was associated with 2.5 (95 % CI, 1.4–4.5) higher odds of vertebral fracture. Odds of vertebral fracture for AAC score >6 increased with vertebral fracture severity (grade 1, OR=1.8; grade 2, OR=2.4; grade 3, OR=4.4; trend p<0.01) and with the number of vertebral fractures (1 fracture, OR=2.0, >1 fracture, OR=3.5). Prevalence of vertebral fracture was twice as high in men having both a T-score<−2.0 and an AAC score>6 compared with men having only one of these characteristics. Conclusions Men with greater severity AAC had greater severity and greater number of vertebral fractures, independently of BMD and co-morbidities. DXA can be used to assess vertebral fracture and AAC. It can provide a rapid, safe, and less expensive alternative to radiography. DXA may be an important clinical tool to identify men at high risk of adverse outcomes from osteoporosis and cardiovascular disease. PMID:22872071

Comparison of Indian Council for Medical Research and Lunar Databases for Categorization of Male Bone Mineral Density.

PubMed

Singh, Surya K; Patel, Vivek H; Gupta, Balram

2017-06-19

The mainstay of diagnosis of osteoporosis is dual-energy X-ray absorptiometry (DXA) scan measuring areal bone mineral density (BMD) (g/cm 2 ). The aim of the present study was to compare the Indian Council of Medical Research database (ICMRD) and the Lunar ethnic reference database of DXA scans in the diagnosis of osteoporosis in male patients. In this retrospective study, all male patients who underwent a DXA scan were included. The areal BMD (g/cm 2 ) was measured at either the lumbar spine (L1-L4) or the total hip using the Lunar DXA machine (software version 8.50) manufactured by GE Medical Systems (Shanghai, China). The Indian Council of Medical Research published a reference data for BMD in the Indian population derived from the population-based study conducted in healthy Indian individuals, which was used to analyze the BMD result by Lunar DXA scan. The 2 results were compared for various values using statistical software SPSS for Windows (version 16; SPSS Inc., Chicago, IL). A total 238 male patients with a mean age of 57.2 yr (standard deviation ±15.9) were included. Overall, 26.4% (66/250) and 2.8% (7/250) of the subjects were classified in the osteoporosis group according to the Lunar database and the ICMRD, respectively. Out of the 250 sites of the DXA scan, 28.8% (19/66) and 60.0% (40/66) of the cases classified as osteoporosis by the Lunar database were reclassified as normal and osteopenia by ICMRD, respectively. In conclusion, the Indian Council of Medical Research data underestimated the degree of osteoporosis in male subjects that might result in deferring of treatment. In view of the discrepancy, the decision on the treatment of osteoporosis should be based on the multiple fracture risk factors and less reliably on the BMD T-score. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The epidemiology and management of postmenopausal osteoporosis: a viewpoint from Brazil

PubMed Central

Baccaro, Luiz Francisco; Conde, Délio Marques; Costa-Paiva, Lúcia; Pinto-Neto, Aarão Mendes

2015-01-01

Brazil has an aging population, with an associated increase in the prevalence of chronic diseases. Postmenopausal osteoporosis is of particular concern because it leads to an increased risk of fractures, with subsequent negative impacts on health in older women. In recent years, efforts have been made to better understand the epidemiology of osteoporosis in Brazil, and to manage both direct and indirect costs to the Brazilian health care system. The reported prevalence of osteoporosis among postmenopausal women in Brazil varies from 15% to 33%, depending on the study methodology and the use of bone densitometry data or self-reporting by participants. A diagnosis of osteoporosis can be made on the basis of fractures occurring without significant trauma or on the basis of low bone mineral density measured by dual energy X-ray absorptiometry. To reduce the risk of osteoporosis, all postmenopausal women should be encouraged to maintain a healthy lifestyle, which includes physical activity and a balanced diet. Smoking and alcohol use should also be addressed. Special attention should be given to interventions to reduce the risk of falls, especially among older women. Calcium intake should be encouraged, preferably through diet. The decision to recommend calcium supplementation should be made individually because there is concern about a possible increased risk of cardiovascular disease associated with this treatment. Brazilian women obtain a minimal amount of vitamin D from their diet, and supplementation is warranted in women with little exposure to solar ultraviolet-B radiation. For women diagnosed with osteoporosis, some form of pharmacologic therapy should be initiated. Compliance with treatment should be monitored, and the treatment period should be individualized for each patient. The Brazilian government provides medication for osteoporosis through the public health system free of charge, but without proper epidemiological knowledge, the implementation of public health programs is impaired. PMID:25848234

Relationship Between BMD and Prevalent Vertebral Fractures in Indian Women Older Than 50 Yr.

PubMed

Gupta, Yashdeep; Marwaha, Raman K; Kukreja, Subhash; Bhadra, Kuntal; Narang, Archana; Mani, Kalaivani; Mithal, Ambrish; Tandon, Nikhil

2016-01-01

The purpose of the study was to study the relationship of morphometric vertebral fractures with bone mineral density (BMD) in Indian women older than 50 yr. Four hundred fifteen healthy Indian women older than 50 yr (mean age: 62.8 yr) underwent lateral X-rays of the lumbar and thoracic spine. Genant's semiquantitative method was used to diagnose and classify morphometric vertebral fractures. BMD was measured by DXA at lumbar spine and total hip. Recruited subjects underwent anthropometric, biochemical, and hormonal evaluation. Vertebral fractures were present in 17.1% (95% confidence interval: 13.5, 20.8) subjects. Prevalence of osteoporosis based on BMD was 35.7%. By adding those with prevalent fractures, the number of women requiring therapy for osteoporosis would increase to 46.5%. The BMD measured at femur neck, total hip, and lumbar spine (L1eL4) was not found to be lower in women with vertebral fractures as compared with those without fractures. BMD was not found to be lower in women with vertebral fractures as compared with those without fractures. Significant number of additional subjects with BMD in the normal or osteopenic range become eligible for osteoporosis treatment when presence of vertebral fracture is used as an independent indication for such treatment. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Calcaneal quantitative ultrasound value for middle-aged and elderly Malaysian Chinese men and its association with age and body anthropometry.

PubMed

Chin, Kok-Yong; Ima-Nirwana, Soelaiman; Isa Naina, Mohamed; Norazlina, Mohamed; Ahmad Nazrun, Shuid; Norliza, Muhammad; Faizah, Othman; Farihah, H Suhaimi; Elvy Suhana, Mohd Ramli; Wan Zurinah, Wan Ngah

2012-01-01

Quantitative ultrasound (QUS) is a relatively easy, reliable, and safe method for bone status assessment, but reference data for Asian males remain scarce. Our study aimed to determine the values for one QUS parameter, the speed of sound (SOS) at the calcaneus, in Malaysian Chinese men and to determine the association between the SOS and several demographic characteristics, such as age, weight, height, and body mass index. Three hundred forty-eight Malaysian Chinese men aged 40 yr and older were recruited, and their calcaneal QUS value was determined using the CM-200 densitometer (Furuno Electric, Nishinomiya City, Japan). The results indicated a significant correlation between SOS and age, and multiple stepwise regression analysis indicated that age and height were important predictors of SOS. A significant reduction in SOS value was observed when men 60 yr and older were compared with men aged 40-49 yr. Compared with the reference data for Japanese males, Chinese men in Malaysia showed higher SOS values across all the age groups studied. In conclusion, there is an age-related decrease in SOS values in Malaysian Chinese men, and the SOS values established in this study can be used as a reference for future studies. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Colour thresholding and objective quantification in bioimaging

NASA Technical Reports Server (NTRS)

Fermin, C. D.; Gerber, M. A.; Torre-Bueno, J. R.

1992-01-01

Computer imaging is rapidly becoming an indispensable tool for the quantification of variables in research and medicine. Whilst its use in medicine has largely been limited to qualitative observations, imaging in applied basic sciences, medical research and biotechnology demands objective quantification of the variables in question. In black and white densitometry (0-256 levels of intensity) the separation of subtle differences between closely related hues from stains is sometimes very difficult. True-colour and real-time video microscopy analysis offer choices not previously available with monochrome systems. In this paper we demonstrate the usefulness of colour thresholding, which has so far proven indispensable for proper objective quantification of the products of histochemical reactions and/or subtle differences in tissue and cells. In addition, we provide interested, but untrained readers with basic information that may assist decisions regarding the most suitable set-up for a project under consideration. Data from projects in progress at Tulane are shown to illustrate the advantage of colour thresholding over monochrome densitometry and for objective quantification of subtle colour differences between experimental and control samples.

Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

PubMed

Sobanska, Anna W; Pyzowski, Jaroslaw

2012-01-01

Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafleur, Adrienne M.; Ulrich, Timothy J. II; Menlove, Howard O.

Objective is to investigate the use of Passive Neutron Albedo Reactivity (PNAR) and Self-Interrogation Neutron Resonance Densitometry (SINRD) to quantify fissile content in FUGEN spent fuel assemblies (FAs). Methodology used is: (1) Detector was designed using fission chambers (FCs); (2) Optimized design via MCNPX simulations; and (3) Plan to build and field test instrument in FY13. Significance was to improve safeguards verification of spent fuel assemblies in water and increase sensitivity to partial defects. MCNPX simulations were performed to optimize the design of the SINRD+PNAR detector. PNAR ratio was less sensitive to FA positioning than SINRD and SINRD ratio wasmore » more sensitive to Pu fissile mass than PNAR. Significance was that the integration of these techniques can be used to improve verification of spent fuel assemblies in water.« less

Comparison of Sub-Bowman Keratoplasty Laser In situ Keratomileusis Flap Properties between Microkeratome and Femtosecond Laser.

PubMed

Fazel, Farhad; Ghoreishi, Mohammad; Ashtari, Alireza; Arefpour, Reza; Namgar, Mohammad

2017-01-01

Since thin and high-quality flaps produce more satisfactory surgical outcomes, flaps created by mechanical microkeratomes are more economical as compared with femtosecond lasers, and no Iranian study has concentrated laser in situ keratomileusis (LASIK) flap peculiarities between Moria Sub-Bowman keratoplasty (SBK) microkeratomes and LDV femtoseconds, the present study compares and contrasts them. This cross-sectional study was done on all patients who underwent LASIK surgery 1-month before this study. Thirty eyes were divided into per group. Flaps in the first group and second group were created, respectively, using Moria SBK microkeratome and LDV femtosecond laser. The other stages of LASIK were done equally in both groups. One month after surgery, the thickness of flaps was measured by anterior segment optical coherence tomography in five regions of flaps. Corneal anterior density was calculated and recorded 1-month after surgery using pentacam and by employing optical densitometry in a distance in the limit range of 0-6 mm from cornea center. Densitometry measurements were obtained and expressed in standardized grayscale units (GSUs). Postsurgery densitometry results reveal that anterior densities of cornea in limit range of 0-2 mm in groups of LDV femtosecond laser and Moria microkeratome are 21.35 ± 0.87 GSU and 22.85 ± 1.25 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P < 0.001). Moreover, anterior densities of the cornea in the limit range of 2-6 mm in these groups are 19.66 ± 0.99 GSU and 20.73 ± 1.24 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P = 0.04). There is a lower mean of flap thickness in the case of LDV femtosecond laser. Femtosecond laser method is greatly preferred as compared with Moria microkeratome because of greater homogeneity in flap thickness, smaller thickness, and lower density in optical zone.

FRAX® International Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

Cauley, Jane A; El-Hajj Fuleihan, Ghada; Luckey, Marjorie M

2011-01-01

Osteoporosis is a serious worldwide epidemic. FRAX® is a web-based tool developed by the Sheffield WHO Collaborating Center team, that integrates clinical risk factors and femoral neck BMD and calculates the 10 year fracture probability in order to help health care professionals identify patients who need treatment. However, only 31 countries have a FRAX® calculator. In the absence of a FRAX® model for a particular country, it has been suggested to use a surrogate country for which the epidemiology of osteoporosis most closely approximates the index country. More specific recommendations for clinicians in these countries are not available. In North America, concerns have also been raised regarding the assumptions used to construct the US ethnic specific FRAX® calculators with respect to the correction factors applied to derive fracture probabilities in Blacks, Asians and Hispanics in comparison to Whites. In addition, questions were raised about calculating fracture risk in other ethnic groups e.g., Native Americans and First Canadians. The International Society for Clinical Densitometry (ISCD) in conjunction with the International Osteoporosis Foundation (IOF) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX® usage. As part of the process, the charge of the FRAX® International Task Force was to review and synthesize data regarding geographic and race/ethnic variability in hip fractures, non-hip osteoporotic fractures, and make recommendations about the use of FRAX® in ethnic groups and countries without a FRAX® calculator. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the International Task Force composition and charge is presented here. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Vitamin D-Dependent Rickets Type 1B (25-Hydroxylase Deficiency): A Rare Condition or a Misdiagnosed Condition?

PubMed

Molin, Arnaud; Wiedemann, Arnaud; Demers, Nick; Kaufmann, Martin; Do Cao, Jérémy; Mainard, Laurent; Dousset, Brigitte; Journeau, Pierre; Abeguile, Geneviève; Coudray, Nadia; Mittre, Hervé; Richard, Nicolas; Weryha, Georges; Sorlin, Arthur; Jones, Glenville; Kottler, Marie-Laure; Feillet, Francois

2017-09-01

Vitamin D requires a two-step activation by hydroxylation: The first step is catalyzed by hepatic 25-hydroxylase (CYP2R1, 11p15.2) and the second one is catalyzed by renal 1α-hydroxylase (CYP27B1, 12q13.1), which produces the active hormonal form of 1,25-(OH) 2 D. Mutations of CYP2R1 have been associated with vitamin D-dependent rickets type 1B (VDDR1B), a very rare condition that has only been reported to affect 4 families to date. We describe 7 patients from 2 unrelated families who presented with homozygous loss-of-function mutations of CYP2R1. Heterozygous mutations were present in their normal parents. We identified a new c.124_138delinsCGG (p.Gly42_Leu46delinsArg) variation and the previously published c.296T>C (p.Leu99Pro) mutation. Functional in vitro studies confirmed loss-of-function enzymatic activity in both cases. We discuss the difficulties in establishing the correct diagnosis and the specific biochemical pattern, namely, very low 25-OH-D suggestive of classical vitamin D deficiency, in the face of normal/high concentrations of 1,25-(OH) 2 D. Siblings exhibited the three stages of rickets based on biochemical and radiographic findings. Interestingly, adult patients were able to maintain normal mineral metabolism without vitamin D supplementation. One index case presented with a partial improvement with 1alfa-hydroxyvitamin D 3 or alfacalcidol (1α-OH-D 3 ) treatment, and we observed a dramatic increase in the 1,25-(OH) 2 D serum concentration, which indicated the role of accessory 25-hydroxylase enzymes. Lastly, in patients who received calcifediol (25-OH-D 3 ), we documented normal 24-hydroxylase activity (CYP24A1). For the first time, and according to the concept of personalized medicine, we demonstrate dramatic improvements in patients who were given 25-OH-D therapy (clinical symptoms, biochemical data, and bone densitometry). In conclusion, the current study further expands the CYP2R1 mutation spectrum. We note that VDDR1B could be easily mistaken for classical vitamin D deficiency. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

Age dependence of the normal/abnormal difference of bone mineral density in osteoporotic women.

PubMed

Bagur, A; Vega, E; Mautalen, C

1994-09-01

Bone mineral density (BMD) is the major factor in bone strength and in the risk of suffering osteoporotic fractures. The aim of this study was to examine the normal/abnormal difference for antero-posterior (AP) spine, lateral spine, proximal femur and total body BMD to assess if age influences discrimination at three different decades between 50 and 80 years of age. The BMD was determined in 61 control women and 60 osteoporotic women (at least one vertebral wedge fracture readily visible in the lateral X-rays of the thoracic or lumbar spine). Measurements were made by DEXA with a total body scanner. The BMD of the whole group of osteoporotic women was markedly lower than that of age-matched controls at all skeletal areas (P < 0.001) except at the arms where the difference was smaller (P < 0.02). The Z-score (the difference between osteoporotic patients and age-matched control divided by the intrapopulation S.D.) was similar (approximately -1.7) over the AP spine, femoral neck, Ward's triangle, total body and legs. It was significantly lower at the arms (-0.8, P < 0.001), lateral spine (-1.4, P < 0.01) and trochanter (-1.3, P < 0.001) compared with the Z-score of the AP spine. The analysis of the results by decades of age disclosed that the higher Z-score on the 6th and 7th decades corresponded to the AP lumbar spine (approximately -2.0). A high descrimination was also observed for the femoral neck, Ward's triangle and legs while the Z-score of the lateral lumbar spine, total body, trochanter and arms were significantly lower than that of the AP lumbar spine. However on the 8th decade the Z-score of the AP lumbar spine diminished to -1.2 and was only significantly higher than the Z-score of the arms (P < 0.01). The study showed that, in women 50-60 years of age--the period where the majority of studies are made for prevention of osteoporosis, none of the other skeletal areas were superior to the AP spine in discrimination for spinal osteoporosis. Proximal femur and legs densitometry gave lower but not significantly different Z-score than the AP spine, while the remaining areas were significantly inferior to AP spine in separating osteoporotic and normal women.

Spanish consensus on the risks and detection of antipsychotic drug-related hyperprolactinaemia.

PubMed

Montejo, Ángel L; Arango, Celso; Bernardo, Miguel; Carrasco, José L; Crespo-Facorro, Benedicto; Cruz, Juan J; Del Pino, Javier; García Escudero, Miguel A; García Rizo, Clemente; González-Pinto, Ana; Hernández, Ana I; Martín Carrasco, Manuel; Mayoral Cleries, Fermin; Mayoral van Son, Jaqueline; Mories, M Teresa; Pachiarotti, Isabella; Ros, Salvador; Vieta, Eduard

2016-01-01

Iatrogenic hyperprolactinaemia (IHPRL) has been more frequently related to some antipsychotic drugs that provoke an intense blockade of dopamine D2 receptors. There is a wide variation in clinical practice, and perhaps some more awareness between clinicians is needed. Due to the high frequency of chronic treatment in severe mental patients, careful attention is recommended on the physical risk. IHPRL symptoms could be underestimated without routine examination. An intense scientific literature search was performed in order to draw up a multidisciplinary consensus, including different specialists of psychiatry, endocrinology, oncology and internal medicine, and looking for a consensus about clinical risk and detection of IHPRL following evidence-based medicine criteria levels (EBM I- IV). Short-term symptoms include amenorrhea, galactorrhoea, and sexual dysfunction with decrease of libido and erectile difficulties related to hypogonadism. Medium and long-term symptoms related to oestrogens are observed, including a decrease bone mass density, hypogonadism, early menopause, some types of cancer risk increase (breast and endometrial), cardiovascular risk increase, immune system disorders, lipids, and cognitive dysfunction. Prolactin level, gonadal hormones and vitamin D should be checked in all patients receiving antipsychotics at baseline although early symptoms (amenorrhea-galactorrhoea) may not be observed due to the risk of underestimating other delayed symptoms that may appear in the medium term. Routine examination of sexual dysfunction is recommended due to possible poor patient tolerance and low compliance. Special care is required in children and adolescents, as well as patients with PRL levels >50ng/ml (moderate hyperprolactinaemia). A possible prolactinoma should be investigated in patients with PRL levels >150ng/ml, with special attention to patients with breast/endometrial cancer history. Densitometry should be prescribed for males >50 years old, amenorrhea>6 months, or early menopause to avoid fracture risk. Copyright © 2016 SEP y SEPB. Published by Elsevier España. All rights reserved.

[The influence of continuous magnetic field on periodontal tissues under overdentures].

PubMed

Brković-Popović, Snezana; Stamenković, Dragoslav; Stanisić-Sinobad, Darinka; Rakocević, Zoran; Zelić, Obra

2009-01-01

Last remained teeth with reduced alveolar support do not have long-term prognosis, which is the reason for prolonging the life and thus providing a stable support of overdenture. The data from literature point out that static magnetic field has certain possibilities in resolving such problems. Having in mind the pathogenetic factors which cause the reduction of the alveolar ridge and periodontal problems in our population, as well as osteoblastic and antiinflamatory activity, the aim of this investigation was to assess the effect of static magnetic field on periodontal tissue under the overdenture. The investigation involved 38 partially edentulous patients, of both sexes and similar oral status who were bearers of a lower complete overdenture and upper classic complete denture as antagonist restoration. In the base of the lower overdenture the micromagnets were installed in the region of the remained teeth, which had static concentrated field of 60-80 mT power. The evaluation was done after 3, 6 and 12 months using the method of light densitometry. Periodontologic analysis was performed by standard and modified periodontologic tests. In patients with overdentures, after exposure to a magnetic field, the density of bone was not significantly changed, but the use of ANOVA disclosed changes in the observed interval. The tendency of increased density of the alveolar part of the observed region was noted. The region of the corresponding tooth of the contralateral side without magnetic influence showed decreased density of this region in the observed intervals. Plaque index and gingival index were improved underthe influence of the magnetic field, while after 6 and 12 months following the magnet insertion statistically significant changes were confirmed. The magnetic devices did not show any influence on the level of the gingival margin and junction epithelium. Static magnetic field is to be considered as a noninvasive procedure which is recommended to patients with reduced number of teeth and alveolar support.

Bone grafts.

PubMed

Hubble, Matthew J W

2002-09-01

Bone grafts are used in musculoskeletal surgery to restore structural integrity and enhance osteogenic potential. The demand for bone graft for skeletal reconstruction in bone tumor, revision arthroplasty, and trauma surgery, couple with recent advances in understanding and application of the biology of bone transplantation, has resulted in an exponential increase in the number of bone-grafting procedures performed over the last decade. It is estimated that 1.5 million bone-grafting procedures are currently performed worldwide each year, compared to a fraction of that number 20 years ago. Major developments also have resulted in the harvesting, storage, and use of bone grafts and production of graft derivatives, substitutes, and bone-inducing agents.

Validation of a reversed phase high performance thin layer chromatographic-densitometric method for secoisolariciresinol diglucoside determination in flaxseed.

PubMed

Coran, Silvia A; Bartolucci, Gianluca; Bambagiotti-Alberti, Massimo

2008-10-17

The validation of a HPTLC-densitometric method for the determination of secoisolariciresinol diglucoside (SDG) in flaxseed was performed improving the reproducibility of a previously reported HPTLC densitometric procedure by the use of fully wettable reversed phase plates (silica gel 60 RP18W F(254S), 10cmx10cm) with MeOH:HCOOH 0.1% (40:60, v/v) mobile phase. The analysis required only the alkaline hydrolysis in aqueous medium of undefatted samples and densitometry at 282nm of HPTLC runs. The method was validated following the protocol proposed by the Société Francaise des Sciences et Techniques Pharmaceutiques (SFSTP) giving rise to a dependable and high throughput procedure well suited to routine application. SDG was quantified in the range of 321-1071ng with RSD of repeatability and intermediate precision not exceeding 3.61% and accuracy inside the acceptance limits. Flaxseed of five cultivars of different origin was elected as test-bed.

How to improve x-ray scattering techniques to quantify bone mineral density using spectroscopy

PubMed Central

Krmar, M.; Ganezer, K.

2012-01-01

Purpose: The purpose of this study was to develop a new diagnostic technique for measuring bone mineral density (BMD) for the assessment of osteoporosis, which improves upon the coherent to Compton scattering ratio (CCSR) method, which was first developed in the 1980s. To help the authors achieve these goals, they have identified and studied two new indices for CCSR, the forward scattered to backward scattered (FS-BS) and the forward scattered to transmitted (FS-T) ratios. They believe that, at small angles, these two parameters can offer a practical in vivo determination of BMD that can be used to overcome the limitations of past CCSR systems, including high radiation dosages, costs, and examination durations. Methods: In previous CCSR studies, a high-activity radioactive source with a long half-live (usually 241Am) and an expensive and bulky cryogenic HPGe detector were applied to both in vivo and in vitro measurements. To make this technique more suitable for clinical applications, the possibility of using a standard diagnostic x-ray tube generating a continuous spectrum was investigated in this paper. Scattered radiation from trabecular bone-simulating phantoms containing various mineral densities that span the normal range of in vivo BMD was collected in this study using relatively inexpensive noncryogenic CdTe or NaI detectors. Results: The initial results demonstrate that a modified version of CCSR can be successfully applied to trabecular bone assessment using a diagnostic x-ray tube with a continuous spectrum in two variations, the FS-BS and the FS-T ratio. When FS-BS is measured, intensity spectra in the forward and backward directions must be collected while FS-T requires only the integral intensity of the scattered and transmitted (T) spectra in the energy region above 40 keV. For both of these methods, forward scattering angles less than or equal to 15° and backward scattering angles greater than or equal to (165°= 180° − 15°) are needed. Conclusions: The authors determined that FS-T is more sensitive to changes in BMD than transmission or absorption alone and that the FS-BS method can yield an absolute measurement of the mean atomic number of the scattering medium, after a correction for path-dependent attenuation. Since this study determined that the FS-T ratio is independent of the incident energy over a broad energy region, it will be possible to apply FS-T to bone densitometry using inexpensive integral photon detectors. The authors believe that, by replacing the radionuclide source with an x-ray tube and the cryogenically cooled HPGe detector with a single solid state CdTe, NaI, or silicon detector or an annular array of detectors, as suggested in this study, the past difficulties of CCSR concerning high radiation exposure, costs, and durations as well as lack of convenience can be overcome and that CCSR could eventually become popular in clinical settings. PMID:22482605

Shape Optimization of Bone-Bonding Subperiosteal Devices with Finite Element Analysis.

PubMed

Ogasawara, Takeshi; Uezono, Masayoshi; Takakuda, Kazuo; Kikuchi, Masanori; Suzuki, Shoichi; Moriyama, Keiji

2017-01-01

Subperiosteal bone-bonding devices have been proposed for less invasive treatments in orthodontics. The device is osseointegrated onto a bone surface without fixation screws and is expected to rapidly attain a bone-bonding strength that successfully meets clinical performance. Hence, the device's optimum shape for rapid and strong bone bonding was examined in this study by finite element analyses. First, a stress analysis was performed for a circular rod device with an orthodontic force parallel to the bone surface, and the estimate of the bone-bonding strength based on the bone fracture criterion was verified with the results of an animal experiment. In total, four cross-sectional rod geometries were investigated: circular (Cr), elliptical (El), semicircular (Sc), and rectangular (Rc). By changing the height of the newly formed bone to mimic the progression of new bone formation, the estimation of the bone-bonding strength was repeated for each geometry. The rod with the Rc cross section exhibited the best performance, followed by those with the Sc, El, and Cr cross sections, from the aspects of the rapid acquisition of strength and the strength itself. Thus, the rectangular cross section is the best for rod-like subperiosteal devices for rapid bone bonding.

Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

PubMed Central

Sobanska, Anna W.; Pyzowski, Jaroslaw

2012-01-01

Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot−1. Both methods were validated. PMID:22629203

Effect of Teriparatide, Vibration and the Combination on Bone Mass and Bone Architecture in Chronic Spinal Cord Injury

DTIC Science & Technology

2014-10-01

Cord Injury PRINCIPAL INVESTIGATOR: Thomas J. Schnitzer, M.D., Ph.D. CONTRACTING ORGANIZATION : Northwestern University, Evanston, IL 60208 REPORT...Bone Architechture in Chronic Spinal Cord Injury Effect of Teriparatide, Vibration and the Combination on Bone Mass and Bone Architechture in Chronic...PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Northwestern University, 633 Clark St., Evanston,IL 60208-0001 AND ADDRESS(ES) 8. PERFORMING ORGANIZATION

Radial growth and wood density of white pine in relation to fossil-fired power plant operations

Treesearch

W. T. Lawhon; F. W. Woods

1976-01-01

The objectives of this study were twofold: (1) to develop a gamma densitometry technique for measuring the relative wood density and radial growth of trees from 12 mm increment cores; and (2) to determine whether changes in the relative wood density and radial growth of "resistant" eastern white pine (Pinus strobus L.) occurred after...

Modeling corewood-outerwood transition in loblolly pine using wood specific gravity

Treesearch

Christian R. Mora; H. Lee Allen; Richard F. Daniels; Alexander Clark

2007-01-01

A modified logistic function was used for modeling specific-gravity profiles obtained from X-ray densitometry analysis in 675 loblolly pine (Pinus taeda L.) trees in four regeneration trials. Trees were 21 or 22 years old at the time of the study. The function was used for demarcating corewood, transitional, and outerwood zones. Site and silvicultural effects were...

Wood densitometry in 17th and 18th century Dutch, German, Austrian and French violins, compared to classical Cremonese and modern violins.

PubMed

Stoel, Berend C; Borman, Terry M; de Jongh, Ronald

2012-01-01

Classical violins produced by makers such as Antonio Stradivari and Guarneri del Gesu have long been considered the epitome of the luthier's art and the expressive tool of choice for the most celebrated violinists. It has been speculated these makers had access to wood that was unique in some way and that this was responsible for their acclaimed tonal characteristics. In an attempt to discern whether the above conjecture is true, we analyzed 17 modern and classical Dutch, German, Austrian and French violins by wood densitometry using computed tomography and correlated these results with our previous study of modern and Cremonese violins; in all studying 30 instruments of the violin family. In order to make this comparison possible we developed methods to cross calibrate results from different CT manufacturers using calibration wood pieces. We found no significant differences in median densities between modern and classical violins, or between classical violins from different origins. These results suggest that it is unlikely classical Cremonese makers had access to wood with significantly different wood density characteristics than that available to contemporaneous or modern makers.

Automation of film densitometry for application in personal monitoring.

PubMed

Taheri, M; Movafeghi, A; Rastkhah, N

2011-03-01

In this research work, a semi-automatic densitometry system has been developed for large-scale monitoring services by use of film badge dosemeters. The system consists of a charge-coupled device (CCD)-based scanner that can scan optical densities (ODs) up to 4.2, a computer vision algorithm to improve the quality of digitised films and an analyser program to calculate the necessary information, e.g. the mean OD of region of interest and radiation doses. For calibration of the system, two reference films were used. The Microtek scanner International Color Consortium (ICC) profiler is applied for determining the colour attributes of the scanner accurately and a reference of the density step tablet, Bundesanstalt für Materialforschung und-prüfung (BAM) is used for calibrating the automatic conversion of gray-level values to OD values in the range of 0.2-4.0 OD. The system contributes to achieve more objectives and reliable results. So by applying this system, we can digitise a set of 20 films at once and calculate their relative doses less than about 4 min, and meanwhile it causes to avoid disadvantages of manual process and to enhance the accuracy of dosimetry.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis

PubMed Central

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-01-01

Background and Aims Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Methods Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Key Results Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. Conclusions A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. PMID:27107414

Consensus of official position of IOF/ISCD FRAX initiatives in Asia-Pacific region.

PubMed

Wu, Chih-Hsing; McCloskey, Eugene V; Lee, Joon Kiong; Itabashi, Akira; Prince, Richard; Yu, Wei; Li-Yu, Julie; Chionh, Siok Bee; Zhao, Yanling; Shin, Chan Soo; Gunawan, Tirtarahardja; Tsai, Keh-Sung; Chieng, Poon-Ung; Changlai, Sheng-Pin; Chan, Ding-Cheng; Chen, Jung-Fu; Tanner, S Bobo; Hans, Didier B; Kanis, John A; Chang, Yin-Fan; Sun, Zih-Jie; Yang, Rong-Sen

2014-01-01

The fracture risk assessment tool (FRAX(®)) has been developed for the identification of individuals with high risk of fracture in whom treatment to prevent fractures would be appropriate. FRAX models are not yet available for all countries or ethnicities, but surrogate models can be used within regions with similar fracture risk. The International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) are nonprofit multidisciplinary international professional organizations. Their visions are to advance the awareness, education, prevention, and treatment of osteoporosis. In November 2010, the IOF/ISCD FRAX initiative was held in Bucharest, bringing together international experts to review and create evidence-based official positions guiding clinicians for the practical use of FRAX. A consensus meeting of the Asia-Pacific (AP) Panel of the ISCD recently reviewed the most current Official Positions of the Joint Official Positions of ISCD and IOF on FRAX in view of the different population characteristics and health standards in the AP regions. The reviewed position statements included not only the key spectrum of positions but also unique concerns in AP regions. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Composite uranium carbide targets at TRIUMF: Development and characterization with SEM, XRD, XRF and L-edge densitometry

NASA Astrophysics Data System (ADS)

Kunz, Peter; Bricault, Pierre; Dombsky, Marik; Erdmann, Nicole; Hanemaayer, Vicky; Wong, John; Lützenkirchen, Klaus

2013-09-01

The production of radioactive ion beams (RIB) from spallation targets by irradiation with a continuous 500 MeV proton beam, has been routine at TRIUMF for several years. Based on the experience with composite refractory carbide targets a procedure for the fabrication of UC2/C targets was developed. It includes the preparation of UC2 by carbothermal reduction of UO2, the slip-casting of fine-grained UC2/C slurry on graphite foil under inert gas atmosphere and the cutting of composite target discs which are stacked up to a lamellar structure. The thermal properties of such an arrangement are adequate to withstand the high power deposition of an intense, continuous proton beam and also beneficial for the fast release of short-lived radioactive isotopes. Molecular structure, particle size and the impact of sintering of the target discs were investigated via XRD and SEM. Thickness and mass distribution were measured with position-sensitive LIII-edge densitometry. The results confirm that the properties of the UC2/C target material are well suited for RIB production at TRIUMF while there is still room for improvement with regard to uniformity of mass distribution in target disc thickness.

Parameters affecting mechanical and thermal responses in bone drilling: A review.

PubMed

Lee, JuEun; Chavez, Craig L; Park, Joorok

2018-04-11

Surgical bone drilling is performed variously to correct bone fractures, install prosthetics, or for therapeutic treatment. The primary concern in bone drilling is to extract donor bone sections and create receiving holes without damaging the bone tissue either mechanically or thermally. We review current results from experimental and theoretical studies to investigate the parameters related to such effects. This leads to a comprehensive understanding of the mechanical and thermal aspects of bone drilling to reduce their unwanted complications. This review examines the important bone-drilling parameters of bone structure, drill-bit geometry, operating conditions, and material evacuation, and considers the current techniques used in bone drilling. We then analyze the associated mechanical and thermal effects and their contributions to bone-drilling performance. In this review, we identify a favorable range for each parameter to reduce unwanted complications due to mechanical or thermal effects. Copyright © 2018 Elsevier Ltd. All rights reserved.

Does Guided Bone Regeneration Prevent Unfavorable Bone Shapes in Distraction Gap?

PubMed

Demetoglu, Umut; Alkan, Alper; Kiliç, Erdem; Ozturk, Mustafa; Bilge, Suheyb

2018-03-01

Complications related to distraction osteogenesis can cause degradation of newly regenerated bone. Additionally, an unfavorable shape of the regenerated bone at the distraction gap can reduce the quantity of regenerated bone. The aim of the present study was to report on the prevention of unfavorable shapes of regenerated bone using guided bone regeneration during distraction. Bilateral alveolar distraction was performed in 10 beagle dog mandibles. One side of the mandible formed the experimental group and the other side served as the control group. In the experimental group, guided bone regeneration was performed simultaneously with distraction osteogenesis. In the control group, only alveolar distraction was applied. At the end of a 1-week latent period, all mandibles were distracted 10 mm (1 mm/day). After the distraction period, 3 months were allowed for consolidation. After consolidation, all the dogs were euthanized, and the shape of the regenerated bone was determined to be either favorable or unfavorable. Densitometric evaluation and area measurements were performed using computed tomography scans. Statistical evaluation was performed using the independent t test, with a significance level of P < .05. In the experimental group, no unfavorable bone shape developed in the distraction gap, and the new bone had a surface and volume similar to those of the segments. In contrast, in the control group, 4 mandibles had an unfavorable bone shape in the distraction gap and 4 showed favorable bone healing with no defect. The surface area of the regenerating bone in the experimental group was significantly greater than that in the control group. Also, the surface area differed significantly between the experimental and control groups (P < .05). However, the densitometric values did not differ between the 2 groups (P < .05). Concomitant use of guided bone regeneration with distraction osteogenesis could be an optimal method for generating a favorable bone shape within the distraction gap. Copyright © 2017 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Evaluating the Effect of Virtual Reality Temporal Bone Simulation on Mastoidectomy Performance: A Meta-analysis.

PubMed

Lui, Justin T; Hoy, Monica Y

2017-06-01

Background The increasing prevalence of virtual reality simulation in temporal bone surgery warrants an investigation to assess training effectiveness. Objectives To determine if temporal bone simulator use improves mastoidectomy performance. Data Sources Ovid Medline, Embase, and PubMed databases were systematically searched per the PRISMA guidelines. Review Methods Inclusion criteria were peer-reviewed publications that utilized quantitative data of mastoidectomy performance following the use of a temporal bone simulator. The search was restricted to human studies published in English. Studies were excluded if they were in non-peer-reviewed format, were descriptive in nature, or failed to provide surgical performance outcomes. Meta-analysis calculations were then performed. Results A meta-analysis based on the random-effects model revealed an improvement in overall mastoidectomy performance following training on the temporal bone simulator. A standardized mean difference of 0.87 (95% CI, 0.38-1.35) was generated in the setting of a heterogeneous study population ( I 2 = 64.3%, P < .006). Conclusion In the context of a diverse population of virtual reality simulation temporal bone surgery studies, meta-analysis calculations demonstrate an improvement in trainee mastoidectomy performance with virtual simulation training.

Characterization of controlled bone defects using 2D and 3D ultrasound imaging techniques.

PubMed

Parmar, Biren J; Longsine, Whitney; Sabonghy, Eric P; Han, Arum; Tasciotti, Ennio; Weiner, Bradley K; Ferrari, Mauro; Righetti, Raffaella

2010-08-21

Ultrasound is emerging as an attractive alternative modality to standard x-ray and CT methods for bone assessment applications. As of today, however, there is a lack of systematic studies that investigate the performance of diagnostic ultrasound techniques in bone imaging applications. This study aims at understanding the performance limitations of new ultrasound techniques for imaging bones in controlled experiments in vitro. Experiments are performed on samples of mammalian and non-mammalian bones with controlled defects with size ranging from 400 microm to 5 mm. Ultrasound findings are statistically compared with those obtained from the same samples using standard x-ray imaging modalities and optical microscopy. The results of this study demonstrate that it is feasible to use diagnostic ultrasound imaging techniques to assess sub-millimeter bone defects in real time and with high accuracy and precision. These results also demonstrate that ultrasound imaging techniques perform comparably better than x-ray imaging and optical imaging methods, in the assessment of a wide range of controlled defects both in mammalian and non-mammalian bones. In the future, ultrasound imaging techniques might provide a cost-effective, real-time, safe and portable diagnostic tool for bone imaging applications.

American Association of Clinical Endocrinologists Medical Guidelines for clinical practice for the evaluation and treatment of hypogonadism in adult male patients--2002 update.

PubMed

Petak, Steven M; Nankin, Howard R; Spark, Richard F; Swerdloff, Ronald S; Rodriguez-Rigau, Luis J

2002-01-01

In these clinical practice guidelines, specific recommendations are made for determining the most effective methods of diagnosing and treating hypogonadism in adult male patients. The target populations for these guidelines include the following: (1) men with primary testicular failure requiring testosterone replacement (hypergonadotropic hypogonadism); (2) male patients with gonadotropin deficiency or dysfunction who may have received testosterone replacement therapy or treatment for infertility (hypogonadotropic hypogonadism); and (3) aging men with symptoms relating to testosterone deficiency who could benefit from testosterone replacement therapy. Initial hormonal evaluation generally consists of a testosterone determination, in conjunction with a free testosterone or sex hormone-binding globulin level, inpatients with clear symptoms and signs but normal-range total testosterone, follicle-stimulating hormone, luteinizing hormone, and prolactin levels. Other possible tests include semen analysis, pituitary imaging studies, genetic studies, bone densitometry, testicular ultrasonography,testicular biopsy, and specialized hormonal dynamic testing. Therapeutic options generally consist of testosterone replacement by injections, patches, or topically applied gel in hypergonadotropic patients and in hypogonadotropic patients not interested in fertility. In hypogonadotropic patients interested in fertility, gonadal stimulation option scan be considered, including human chorionic gonadotropin stimulation therapy with or without human menopausal gonadotropin (or follicle-stimulating hormone) or gonadotropin-releasing hormone pump therapy. These therapies may be combined with assisted reproductive technologies such as in vitro fertilization with intracytoplasmic sperm injection, which may allow pregnancy to occur with very low numbers of sperm.

Total and regional body volumes derived from dual-energy X-ray absorptiometry output.

PubMed

Wilson, Joseph P; Fan, Bo; Shepherd, John A

2013-01-01

Total body volume is an important health metric used to measure body density, shape, and multicompartmental body composition but is currently only available through underwater weighing or air displacement plethysmography (ADP). The objective of this investigation was to derive an accurate body volume from dual-energy X-ray absorptiometry (DXA)-reported measures for advanced body composition models. Volunteers received a whole body DXA scan and an ADP measure at baseline (N = 25) and 6 mo (N = 22). Baseline measures were used to calibrate body volume from the reported DXA masses of fat, lean, and bone mineral content. A second population (N = 385) from the National Health and Nutrition Examination Survey was used to estimate the test-retest precision of regional (arms, legs, head, and trunk) and total body volumes. Overall, we found that DXA-volume was highly correlated to ADP-volume (R² = 0.99). The 6-mo change in total DXA-volume was highly correlated to change in ADP-volume (R² = 0.98). The root mean square percent coefficient of variation precision of DXA-volume measures ranged from 1.1% (total) to 3.2% (head). We conclude that the DXA-volume method can measure body volume accurately and precisely, can be used in body composition models, could be an independent health indicator, and is useful as a prospective or retrospective biomarker of body composition. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Inverse relationship between central obesity and osteoporosis in osteoporotic drug naive elderly females: The Tianliao Old People (TOP) Study.

PubMed

Chang, Chin-Sung; Chang, Yin-Fan; Wang, Mei-Wen; Chen, Chuan-Yu; Chao, Yu-Jang; Chang, Hsuan-Jui; Kuo, Po-Hsiu; Yang, Yi-Ching; Wu, Chih-Hsing

2013-01-01

To examine the relationship between central obesity and osteoporosis in elderly females in a rural community, a total of 368 ambulatory elderly women were recruited by random sampling during July 2009. Structured questionnaires were completed to survey possible osteoporosis-related risk factors. Subjects were dichotomized into either noncentral obese (waist circumference [WC]<80cm) or central obese subgroups (WC≥80cm) for further analysis. Bone mineral densities were scanned by dual-energy X-ray absorptiometry installed in a mobile bus. Thoracolumbar spine X-ray examination was interpreted by the same radiologist. Of the 365 subjects with completed data, 275 (75.3%) aged women were classified as having osteoporosis based on diagnostic Model III. Compared with the nonosteoporosis subjects, the subjects with osteoporosis had relatively higher mean age, lower body mass index, and a lower percentage of central obesity. Using the binary logistic regression method, central obesity was negatively associated with osteoporosis in all 3 models (odds ratios in the 3 models were 0.348, 95% confidence interval [CI]: 0.130-0.927; 0.444, 95% CI: 0.218-0.905; and 0.415, 95% CI: 0.184-0.936, respectively; p<0.05). Our study suggests that the paradox between central obesity and osteoporosis in elderly women should be of concern and warrants further study. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Cohort Profile: The JS High School study (JSHS): a cohort study of Korean adolescents.

PubMed

Choi, Dong Phil; Lee, Joo Young; Kim, Hyeon Chang

2017-04-01

Major aetiologies of atherosclerotic cardiovascular diseases begin in childhood and atherosclerotic vascular abnormalities can be observed among children and adolescents. Adolescent cohort studies have important advantages because they can observe earlier changes in vascular structure and function. The purpose of the JS High School study (JSHS) is to identify biomarkers predicting or indicating early structural and functional vascular change in adolescents. The JSHS is a prospective cohort study of a Korean adolescent population. The target population of the JSHS was first-graders (aged 14 to17 years) at a high school of South Korea. Enrolment and baseline examinations were conducted in years 2007, 2010, 2011 and 2012. Among the total eligible population of 1115 students, 1071 (96.1%) participated in the study and completed all baseline examinations. Informed consent forms were obtained from each participant and his/her parent or guardian. Baseline examinations include: questionnaires on demographics, health behaviours, medical history, and depression symptoms; fasting blood analysis; anthropometric measurement; body impedance analysis; blood pressure measurement; radial artery tonometry; bone densitometry; pulmonary function tests; and carotid ultrasonography. Participants enrolled from 2007 through 2012 were re-examined after 30 months of follow-up, and those who enrolled in 2012 were re-examined after 24 months of follow-up. The corresponding author may be contacted for potential collaboration and data access. © The Author 2015; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association.

Patient questionnaires in rheumatoid arthritis: advantages and limitations as a quantitative, standardized scientific medical history.

PubMed

Pincus, Theodore; Yazici, Yusuf; Bergman, Martin J

2009-11-01

In many chronic diseases, objective gold standard measures such as blood pressure, cholesterol, and bone densitometry often provide most of the information used to establish a diagnosis and guide therapy. By contrast, in inflammatory rheumatic diseases, information from a patient history usually is considerably more prominent in clinical management. Patient history data can be recorded as standardized, quantitative scientific data through use of validated self-reported questionnaires. Patient questionnaires address the primary concerns of patients and their families. Questionnaire scores distinguish active from control treatments in clinical trials at similar levels to swollen and tender joint counts or laboratory tests. Patient questionnaire data are correlated significantly with joint counts, radiographic scores, and laboratory tests, but usually are far more significant than these measures in the prognosis of severe outcomes of rheumatoid arthritis (RA), including work disability, costs, and premature death. Limitations of patient questionnaires are based on cultural features involving variation in responses among ethnic groups, and a need for translation, although translated questionnaires can be as valuable as a translator. Patient questionnaires do not replace further medical history, physical examination, laboratory tests, and imaging data, and they require interpretation in a context of these standard sources of information at any clinical encounter. Patient questionnaires are useful to monitor patient status in usual clinical care, with almost no effort on the part of the physician and staff if distributed by the receptionist in the infrastructure of office practice.

Official Positions for FRAX® clinical regarding prior fractures from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Blank, Robert D

2011-01-01

The 2010 Position Development Conference addressed four questions related to the impact of previous fractures on 10-year fracture risk as calculated by FRAX(®). To address these questions, PubMed was searched on the keywords "fracture, epidemiology, osteoporosis." Titles of retrieved articles were reviewed for an indication that risk for future fracture was discussed. Abstracts of these articles were reviewed for an indication that one or more of the questions listed above was discussed. For those that did, the articles were reviewed in greater detail to extract the findings and to find additional past work and citing works that also bore on the questions. The official positions and the supporting literature review are presented here. FRAX(®) underestimates fracture probability in persons with a history of multiple fractures (good, A, W). FRAX(®) may underestimate fracture probability in individuals with prevalent severe vertebral fractures (good, A, W). While there is evidence that hip, vertebral, and humeral fractures appear to confer greater risk of subsequent fracture than fractures at other sites, quantification of this incremental risk in FRAX(®) is not possible (fair, B, W). FRAX(®) may underestimate fracture probability in individuals with a parental history of non-hip fragility fracture (fair, B, W). Limitations of the methodology include performance by a single reviewer, preliminary review of the literature being confined to titles, and secondary review being limited to abstracts. Limitations of the evidence base include publication bias, overrepresentation of persons of European descent in the published studies, and technical differences in the methods used to identify prevalent and incident fractures. Emerging topics for future research include fracture epidemiology in non-European populations and men, the impact of fractures in family members other than parents, and the genetic contribution to fracture risk. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Wood density of young-growth western hemlock: relation to ring age, radial growth, stand density, and site quality.

Treesearch

Dean S. DeBell; Ryan Singleton; Barbara L. Gartner; David D. Marshall

2004-01-01

Breast-high stem sections were sampled from 56 western hemlock (Tsuga heterophylla (Raf.) Sarg.) trees growing in 15 plots representing a wide range of tree and site conditions in northwestern Oregon. Growth and wood density traits of individual rings were measured via X-ray densitometry, and relationships of ring density and its components to age...

Photographic consulting services to the Earth Resources program. [using aerial photography as a tool for scientific measurement

NASA Technical Reports Server (NTRS)

1976-01-01

The recommendations, procedures, and techniques are summarized which provided by the Kodak Apparatus Division to the Ames Research Center to support the Earth Resources Aircraft Program at that facility. Recommendations, procedures, and calibration data are included for sensitometry, densitometry, laboratory cleanliness, and determination of camera exposure. Additional comments are made regarding process control procedures and general laboratory operations.

Temperature and time variations during osteotomies performed with different piezosurgical devices: an in vitro study.

PubMed

Delgado-Ruiz, R A; Sacks, D; Palermo, A; Calvo-Guirado, J L; Perez-Albacete, C; Romanos, G E

2016-09-01

The aim of this experimental in vitro study was to evaluate the effects of the piezoelectric device in temperature and time variations in standardized osteotomies performed with similar tip inserts in bovine bone blocks. Two different piezosurgical devices were used the OE-F15(®) (Osada Inc., Los Angeles, California, USA) and the Surgybone(®) (Silfradent Inc., Sofia, Forli Cesena, Italy). Serrated inserts with similar geometry were coupled with each device (ST94 insert/test A and P0700 insert/test B). Osteotomies 10 mm long and 3 mm deep were performed in bone blocks resembling type II (dense) and type IV (soft) bone densities with and without irrigation. Thermal changes and time variations were recorded. The effects of bone density, irrigation, and device on temperature changes and time necessary to accomplish the osteotomies were analyzed. Thermal analysis showed significant higher temperatures during piezosurgery osteotomies in hard bone without irrigation (P < 0.05). The type of piezosurgical device did not influence thermal variations (P > 0.05). Time analysis showed that the mean time values necessary to perform osteotomies were shorter in soft bone than in dense bone (P < 0.05). Within the limitations of this in vitro study, it may be concluded that the temperature increases more in piezosurgery osteotomies in dense bone without irrigation; the time to perform the osteotomy with piezosurgery is shorter in soft bone compared to hard bone; and the piezosurgical device have a minimal influence in the temperature and time variations when a similar tip design is used during piezosurgery osteotomies. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Aging and loading rate effects on the mechanical behavior of equine bone

NASA Astrophysics Data System (ADS)

Kulin, Robb M.; Jiang, Fengchun; Vecchio, Kenneth S.

2008-06-01

Whether due to a sporting accident, high-speed impact, fall, or other catastrophic event, the majority of clinical bone fractures occur under dynamic loading conditions. However, although extensive research has been performed on the quasi-static fracture and mechanical behavior of bone to date, few high-quality studies on the fracture behavior of bone at high strain rates have been performed. Therefore, many questions remain regarding the material behavior, including not only the loading-rate-dependent response of bone, but also how this response varies with age. In this study, tests were performed on equine femoral bone taken post-mortem from donors 6 months to 28 years of age. Quasi-static and dynamic tests were performed to determine the fracture toughness and compressive mechanical behavior as a function of age at varying loading rates. Fracture paths were then analyzed using scanning confocal and scanning-electron microscopy techniques to assess the role of various microstructural features on toughening mechanisms.

Selective determination of aloin in different matrices by HPTLC densitometry in fluorescence mode.

PubMed

Coran, Silvia A; Bartolucci, Gianluca; Bambagiotti-Alberti, Massimo

2011-01-25

A novel method based on the fluorescence excited solely on aloin by a H₃BO₃ derivatizing procedure, allowed its rapid and selective determination among the co-occurring components in a variety of complex matrices as several Aloes dried extracts and related commercial products. HPTLC LiChrospher silica gel 60 F254S, 20 cm x 10 cm, plates with ethyl formate: CH₃OH:H₂O (100:14.5:10, v/v) as the mobile phase were used. Densitometric determinations were performed in fluorescence mode, exciting wavelength 365 nm, optical filter K540 after derivatization with H₃BO₃. The method was validated giving rise to a dependable and high throughput procedure well suited to routine application. Aloin was quantified in the range of 110-330 ng with RSD of repeatability and intermediate precision not exceeding 2.3% and accuracy inside the acceptance limits. Copyright © 2010 Elsevier B.V. All rights reserved.

Raman spectroscopy for DNA quantification in cell nucleus.

PubMed

Okotrub, K A; Surovtsev, N V; Semeshin, V F; Omelyanchuk, L V

2015-01-01

Here we demonstrate the feasibility of a novel approach to quantify DNA in cell nuclei. This approach is based on spectroscopy analysis of Raman light scattering, and avoids the problem of nonstoichiometric binding of dyes to DNA, as it directly measures the signal from DNA. Quantitative analysis of nuclear DNA contribution to Raman spectrum could be reliably performed using intensity of a phosphate mode at 1096 cm(-1) . When compared to the known DNA standards from cells of different animals, our results matched those values at error of 10%. We therefore suggest that this approach will be useful to expand the list of DNA standards, to properly adjust the duration of hydrolysis in Feulgen staining, to assay the applicability of fuchsines for DNA quantification, as well as to measure DNA content in cells with complex hydrolysis patterns, when Feulgen densitometry is inappropriate. © 2014 International Society for Advancement of Cytometry.

Results of a collaborative study on DNA identification of aged bone samples

PubMed Central

Vanek, Daniel; Budowle, Bruce; Dubska-Votrubova, Jitka; Ambers, Angie; Frolik, Jan; Pospisek, Martin; Al Afeefi, Ahmed Anwar; Al Hosani, Khalid Ismaeil; Allen, Marie; Al Naimi, Khudooma Saeed; Al Salafi, Dina; Al Tayyari, Wafa Ali Rashid; Arguetaa, Wendy; Bottinelli, Michel; Bus, Magdalena M.; Cemper-Kiesslich, Jan; Cepil, Olivier; De Cock, Greet; Desmyter, Stijn; El Amri, Hamid; El Ossmani, Hicham; Galdies, Ruth; Grün, Sebastian; Guidet, Francois; Hoefges, Anna; Iancu, Cristian Bogdan; Lotz, Petra; Maresca, Alessandro; Nagy, Marion; Novotny, Jindrich; Rachid, Hajar; Rothe, Jessica; Stenersen, Marguerethe; Stephenson, Mishel; Stevanovitch, Alain; Strien, Juliane; Sumita, Denilce R.; Vella, Joanna; Zander, Judith

2017-01-01

Aim A collaborative exercise with several institutes was organized by the Forensic DNA Service (FDNAS) and the Institute of the Legal Medicine, 2nd Faculty of Medicine, Charles University in Prague, Czech Republic, with the aim to test performance of different laboratories carrying out DNA analysis of relatively old bone samples. Methods Eighteen laboratories participating in the collaborative exercise were asked to perform DNA typing of two samples of bone powder. Two bone samples provided by the National Museum and the Institute of Archaelogy in Prague, Czech Republic, came from archeological excavations and were estimated to be approximately 150 and 400 years old. The methods of genetic characterization including autosomal, gonosomal, and mitochondrial markers was selected solely at the discretion of the participating laboratory. Results Although the participating laboratories used different extraction and amplification strategies, concordant results were obtained from the relatively intact 150 years old bone sample. Typing was more problematic with the analysis of the 400 years old bone sample due to poorer quality. Conclusion The laboratories performing identification DNA analysis of bone and teeth samples should regularly test their ability to correctly perform DNA-based identification on bone samples containing degraded DNA and potential inhibitors and demonstrate that risk of contamination is minimized. PMID:28613037

Mild cognitive impairment is associated with poor physical function but not bone structure or density in late adulthood: findings from the Hertfordshire cohort study.

PubMed

Patel, A; Jameson, K A; Edwards, M H; Ward, K; Gale, C R; Cooper, C; Dennison, Elaine M

2018-04-24

This study investigated the association between mild cognitive impairment (MCI) and physical function and bone health in older adults. MCI was associated with poor physical performance but not bone mineral density or bone microarchitecture. Cross-sectional study to investigate the association between mild cognitive impairment (MCI) and physical performance, and bone health, in a community-dwelling cohort of older adults. Cognitive function of 222 men and 221 women (mean age 75.5 and 75.8 years in men and women, respectively) was assessed by the Strawbridge questionnaire and Mini Mental State Exam (MMSE). Participants underwent dual-energy X-ray absorptiometry (DXA), peripheral-quantitative computed tomography (pQCT) and high-resolution peripheral-quantitative computed tomography (HR-pQCT) scans to assess their bone density, strength and microarchitecture. Their physical function was assessed and a physical performance (PP) score was recorded. In the study, 11.8% of women and 8.1% of men were cognitively impaired on the MMSE (score < 24). On the Strawbridge questionnaire, 24% of women were deemed cognitively impaired compared to 22.3% of men. Cognitive impairment on the Strawbridge questionnaire was associated with poorer physical performance score in men but not in women in the unadjusted analysis. MMSE < 24 was strongly associated with the risk of low physical performance in men (OR 12.9, 95% CI 1.67, 99.8, p = 0.01). Higher MMSE score was associated with better physical performance in both sexes. Poorer cognitive function, whether assessed by the Strawbridge questionnaire, or by MMSE score, was not associated with bone density, shape or microarchitecture, in either sex. MCI in older adults was associated with poor physical performance, but not bone density, shape or microarchitecture.

Intrinsic material properties of cortical bone.

PubMed

Lopez Franco, Gloria E; Blank, Robert D; Akhter, Mohammed P

2011-01-01

The G171V mutation (high bone mass, HBM) is autosomal dominant and is responsible for high bone mass in humans. Transgenic HBM mice in which the human LRP5 G171V gene is inserted also show a similar phenotype with greater bone mass and biomechanical performance than wild-type mice, as determined by whole bone testing. Whole bone mechanics, however, depend jointly on bone mass, architecture, and intrinsic bone tissue mechanical properties. To determine whether the HBM mutation affects tissue-level biomechanical performance, we performed nano-indentation testing of unembedded cortical bone from HBM mice and their nontransgenic (NTG) littermates. Femora from 17-week-old mice (female, 8 mice/genotype) were subjected to nano-indentation using a Triboscope (Hysitron, Minneapolis, MN, USA). For each femoral specimen, approximately 10 indentations were made on the midshaft anterior surface with a target force of either 3 or 9 mN at a constant loading rate of 400 mN/s. The load-displacement data from each test were used to calculate indentation modulus and hardness for bone tissue. The intrinsic material property that reflected the bone modulus was greater (48%) in the HBM as compared to the NTG mice. Our results of intrinsic properties are consistent with the published structural and material properties of the midshaft femur in HBM and NTG mice. The greater intrinsic modulus in HBM reflects greater bone mineral content as compared to NTG (wild-type, WT) mice. This study suggests that the greater intrinsic property of cortical bone is derived from the greater bone mineral content and BMD, resulting in greater bone strength in HBM as compared to NTG (WT) mice.

Improvement of adynamic bone disease after renal transplantation.

PubMed

Abdallah, K A; Jorgetti, V; Pereira, R C; Reis, L M dos; Pereira, L M; Corrêa, P H S; Borelli, A; Ianhez, L E; Moysés, R M A; David-Neto, E

2006-01-01

Low bone remodeling and relatively low serum parathyroid hormone (PTH) levels characterize adynamic bone disease (ABD). The impact of renal transplantation (RT) on the course of ABD is unknown. We studied prospectively 13 patients with biopsy-proven ABD after RT. Bone histomorphometry and bone mineral density (BMD) measurements were performed in the 1st and 12th months after RT. Serum PTH, 25-hydroxyvitamin D, 1,25-dihydroxyvitamin D, and osteocalcin were measured regularly throughout the study. Serum PTH levels were slightly elevated at transplantation, normalized at the end of the third month and remained stable thereafter. Bone biopsies performed in the first month after RT revealed low bone turnover in all patients, with positive bone aluminum staining in 5. In the 12th month, second biopsies were performed on 12 patients. Bone histomorphometric dynamic parameters improved in 9 and were completely normalized in 6, whereas no bone mineralization was detected in 3 of these 12 patients. At 12 months post-RT, no bone aluminum was detected in any patient. We also found a decrease in lumbar BMD and an increase in femoral BMD. Patients suffering from ABD, even those with a reduction in PTH levels, may present partial or complete recovery of bone turnover after successful renal transplantation. However, it is not possible to positively identify the mechanisms responsible for the improvement. Identifying these mechanisms should lead to a better understanding of the physiopathology of ABD and to the development of more effective treatments.

Assessment of Mechanical Performance of Bone Architecture Using Rapid Prototyping Models

NASA Astrophysics Data System (ADS)

Saparin, Peter; Woesz, Alexander; Thomsen, Jasper S.; Fratzl, Peter

2008-06-01

The aim of this on-going research project is to assess the influence of bone microarchitecture on the mechanical performance of trabecular bone. A testing chain consist-ing of three steps was established: 1) micro computed tomography (μCT) imaging of human trabecular bone; 2) building of models of the bone from a light-sensitive polymer using Rapid Prototyping (RP); 3) mechanical testing of the models in a material testing machine. A direct resampling procedure was developed to convert μCT data into the format of the RP machine. Standardized parameters for production and testing of the plastic models were established by use of regular cellular structures. Next, normal, osteoporotic, and extreme osteoporotic vertebral trabecular bone architectures were re-produced by RP and compression tested. We found that normal architecture of vertebral trabecular bone exhibit behaviour characteristic of a cellular structure. In normal bone the fracture occurs at much higher strain values that in osteoporotic bone. After the fracture a normal trabecular architecture is able to carry much higher loads than an osteoporotic architecture. However, no statistically significant differences were found in maximal stress during uniaxial compression of the central part of normal, osteoporotic, and extreme osteoporotic vertebral trabecular bone. This supports the hypothesis that osteoporotic trabecular bone can compensate for a loss of trabeculae by thickening the remaining trabeculae in the loading direction (compensatory hypertrophy). The developed approach could be used for mechanical evaluation of structural data acquired non-invasively and assessment of changes in performance of bone architecture.

HPTLC-FLD-SERS as a facile and reliable screening tool: Exemplarily shown with tyramine in cheese.

PubMed

Wang, Liao; Xu, Xue-Ming; Chen, Yi-Sheng; Ren, Jie; Liu, Yun-Tao

2018-04-01

The serious cytotoxicity of tyramine attracted marked attention as it induced necrosis of human intestinal cells. This paper presented a novel and facile high performance thin-layer chromatography (HPTLC) method tailored for screening tyramine in cheese. Separation was performed on glass backed silica gel plates, using methanol/ethyl acetate/ammonia (6/4/1 v/v/v) as the mobile phase. Special efforts were focused on optimizing conditions (substrate preparation, laser wavelength, salt types and concentrations) of surface enhanced Raman spectroscopy (SERS) measurements directly on plates after derivatization, which enabled molecule-specific identification of targeted bands. In parallel, fluorescent densitometry (FLD) scanning at 380

Provider Distribution Changes in Dual-Energy X-Ray Absorptiometry in the Medicare Population Over the Past Decade.

PubMed

Intenzo, Charles M; Parker, Laurence; Levin, David C; Kim, Sung M; Rao, Vijay M

2016-01-01

Both radiologists as well as nonimaging physicians perform dual-energy X-ray absorptiometry (DXA) imaging in the United States. This study aims to compare provider distribution between these physician groups on the Medicare population, which is the predominant age group of patients evaluated by this imaging procedure. Using the 2 relevant Current Procedural Terminology, Fourth Edition codes for DXA scans, source data were obtained from the CMS Physician Supplier Procedure Summary Master Files from 2003 through 2013. DXA scan procedure volumes for radiologists and nonradiologists on Medicare patients were tabulated. Utilization rates were calculated. From 2003 to 2013, the total number of DXA scans performed on Medicare patients decreased by 2%. However, over the same period, the number of scans performed by radiologists had increased by 25% over nonimaging specialists, whose utilization had declined by approximately the same amount. From 2003 to 2013, the rate of utilization of DXA scans in the Medicare fee-for-service population declined somewhat. However, radiologists continue to gain market share from other specialists and now predominate in this type of imaging by a substantial margin. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

PROLONGED PERFORMANCE OF A HIGH REPETITION LOW FORCE TASK INDUCES BONE ADAPTATION IN YOUNG ADULT RATS, BUT LOSS IN MATURE RATS

PubMed Central

Massicotte, Vicky S; Frara, Nagat; Harris, Michele Y; Amin, Mamta; Wade, Christine K; Popoff, Steven N; Barbe, Mary F

2015-01-01

We have shown that prolonged repetitive reaching and grasping tasks lead to exposure-dependent changes in bone microarchitecture and inflammatory cytokines in young adult rats. Since aging mammals show increased tissue inflammatory cytokines, we sought here to determine if aging, combined with prolonged performance of a repetitive upper extremity task, enhances bone loss. We examined the radius, forearm flexor muscles, and serum from 16 mature (14–18 mo of age) and 14 young adult (2.5–6.5 mo of age) female rats after performance of a high repetition low force (HRLF) reaching and grasping task for 12 weeks. Young adult HRLF rats showed enhanced radial bone growth (e.g., increased trabecular bone volume, osteoblast numbers, bone formation rate, and mid-diaphyseal periosteal perimeter), compared to age-matched controls. Mature HRLF rats showed several indices of radial bone loss (e.g., decreased trabecular bone volume, and increased cortical bone thinning, porosity, resorptive spaces and woven bone formation), increased osteoclast numbers and inflammatory cytokines, compared to age-matched controls and young adult HRLF rats. Mature rats weighed more yet had lower maximum reflexive grip strength, than young adult rats, although each age group was able to pull at the required reach rate (4 reaches/min) and required submaximal pulling force (30 force-grams) for a food reward. Serum estrogen levels and flexor digitorum muscle size were similar in each age group. Thus, mature rats had increased bone degradative changes than in young adult rats performing the same repetitive task for 12 weeks, with increased inflammatory cytokine responses and osteoclast activity as possible causes. PMID:26517953

Drilling resistance: A method to investigate bone quality.

PubMed

Lughmani, Waqas A; Farukh, Farukh; Bouazza-Marouf, Kaddour; Ali, Hassan

2017-01-01

Bone drilling is a major part of orthopaedic surgery performed during the internal fixation of fractured bones. At present, information related to drilling force, drilling torque, rate of drill-bit penetration and drill-bit rotational speed is not available to orthopaedic surgeons, clinicians and researchers as bone drilling is performed manually. This study demonstrates that bone drilling force data if recorded in-vivo, during the repair of bone fractures, can provide information about the quality of the bone. To understand the variability and anisotropic behaviour of cortical bone tissue, specimens cut from three anatomic positions of pig and bovine were investigated at the same drilling speed and feed rate. The experimental results showed that the drilling force does not only vary from one animal bone to another, but also vary within the same bone due to its changing microstructure. Drilling force does not give a direct indication of bone quality; therefore it has been correlated with screw pull-out force to provide a realistic estimation of the bone quality. A significantly high value of correlation (r2 = 0.93 for pig bones and r2 = 0.88 for bovine bones) between maximum drilling force and normalised screw pull-out strength was found. The results show that drilling data can be used to indicate bone quality during orthopaedic surgery.

National Health and Nutrition Examination Survey whole-body dual-energy X-ray absorptiometry reference data for GE Lunar systems.

PubMed

Fan, Bo; Shepherd, John A; Levine, Michael A; Steinberg, Dee; Wacker, Wynn; Barden, Howard S; Ergun, David; Wu, Xin P

2014-01-01

The National Health and Nutrition Examination Survey (NHANES 1999-2004) includes adult and pediatric comparisons for total body bone and body composition results. Because dual-energy x-ray absorptiometry (DXA) measurements from different manufacturers are not standardized, NHANES reference values currently are applicable only to a single make and model of Hologic DXA system. The purpose of this study was to derive body composition reference curves for GE Healthcare Lunar DXA systems. Published values from the NHANES 1999-2004 survey were acquired from the Centers for Disease Control and Prevention website. Using previously reported cross-calibration equations between Hologic and GE-Lunar, we converted the total body and regional bone and soft-tissue measurements from NHANES 1999-2004 to GE-Lunar values. The LMS (LmsChartMaker Pro Version 3.5) curve fitting method was used to generate GE-Lunar reference curves. Separate curves were generated for each sex and ethnicity. The reference curves were also divided into pediatric (≤20 years old) and adult (>20 years old) groups. Adult reference curves were derived as a function of age. Additional relationships of pediatric DXA values were derived as a function of height, lean mass, and bone area. Robustness was tested between Hologic and GE-Lunar Z-score values. The NHANES 1999-2004 survey included a sample of 20,672 participants' (9630 female) DXA scans. A total of 8056 participants were younger than 20 yr and were included in the pediatric reference data set. Participants enrolled in the study who weighed more than 136 kg (over scanner table limit) were excluded. The average Z-scores comparing the new GE-Lunar reference curves are close to zero, and the standard deviation of the Z-scores are close to one for all variables. As expected, all measurements on the GE-Lunar reference curves for participants younger than 20 yr increase monotonically with age. In the adult population, most of the curves are constant at younger age and drop moderately as age increases. We have presented NHANES reference curves applicable to DXA whole-body scans acquired on GE Healthcare Lunar systems by age, sex and ethnicity. Users of GE Healthcare GE-Lunar DXA systems can now benefit from the large body composition reference data set collected in the NHANES 1999-2004 study. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Regional blood flow and bone uptake of methylene-diphosphonate-technetium-99m].

PubMed

Vattimo, A; Martini, G; Pisani, M

1983-05-30

Sudeck's atrophy of the foot is an acute, patchy osteoporosis that, on bone scan, shows an increase in both bone blood flow and local bone uptake of bone-seeking radionuclides. The purpose of this study was to evaluate the relationship between bone uptake of 99mTc-MDP and local bone blood flow. In some patients with Sudeck's atrophy of one foot we measured local bone blood flow and bone uptake of 99mTc-MDP. External counting of radioactivity, with a count-rate of 1 second was performed for 60 minutes after i.v. injection of a known dose of 99mTc-MDP in some patients with Sudeck's atrophy of the foot. The regions of interest (ROI) were selected on the basis of a bone scan performed 24 hours earlier. We assumed that the data recorded during the first seconds (7-10) reflect local blood flow and the data at 60 minutes reflect the bone uptake. The ratio between the local blood flow in the involved and healthy foot was higher than the local bone uptake ratio. The ratio between bone uptake and local bone blood flow was higher in the normal foot than in the affected one. These results suggest that the bone avidity for bone-seeking radionuclides is lower in Sudeck's atrophy than in normal bone.

Dry immunochemical sensor for the detection of PETN vapor

NASA Astrophysics Data System (ADS)

Lukens, Herbert Richard

1992-05-01

Giaever (1973) showed that an indium semi-mirror coated with a monolayer of a substance would undergo reduced optical reflectance after incubation with a solution of the substance's antibody. He was able to see the effect with the naked eye. Lukens and Williams (1977) reversed the process by first attaching the target substance's antibody to the semi-mirror, after which the device would show a decline in optical density when exposed to a solution of the target substance. Lukens and Williams (1982) subsequently found that the device could also be used as an immunochemical film badge (IFB) to detect an airborne target substance. Early efforts to develop the IFB for the detection of airborne substances were plagued by such a high degree of performance variability that there were doubts in some quarters that an airborne target substance could bind to its antibody until Lukens (1990) demonstrated such binding in experiments with radiolabeled cocaine and morphine. Recently improved semi-mirrors and densitometry have been obtained and have led to improved performance of IFB's. As shown in this paper, IFB's can now be constructed that detect PETN vapor in a few seconds.

Local effect of zoledronic acid on new bone formation in posterolateral spinal fusion with demineralized bone matrix in a murine model.

PubMed

Zwolak, Pawel; Farei-Campagna, Jan; Jentzsch, Thorsten; von Rechenberg, Brigitte; Werner, Clément M

2018-01-01

Posterolateral spinal fusion is a common orthopaedic surgery performed to treat degenerative and traumatic deformities of the spinal column. In posteriolateral spinal fusion, different osteoinductive demineralized bone matrix products have been previously investigated. We evaluated the effect of locally applied zoledronic acid in combination with commercially available demineralized bone matrix putty on new bone formation in posterolateral spinal fusion in a murine in vivo model. A posterolateral sacral spine fusion in murine model was used to evaluate the new bone formation. We used the sacral spine fusion model to model the clinical situation in which a bone graft or demineralized bone matrix is applied after dorsal instrumentation of the spine. In our study, group 1 received decortications only (n = 10), group 2 received decortication, and absorbable collagen sponge carrier, group 3 received decortication and absorbable collagen sponge carrier with zoledronic acid in dose 10 µg, group 4 received demineralized bone matrix putty (DBM putty) plus decortication (n = 10), and group 5 received DBM putty, decortication and locally applied zoledronic acid in dose 10 µg. Imaging was performed using MicroCT for new bone formation assessment. Also, murine spines were harvested for histopathological analysis 10 weeks after surgery. The surgery performed through midline posterior approach was reproducible. In group with decortication alone there was no new bone formation. Application of demineralized bone matrix putty alone produced new bone formation which bridged the S1-S4 laminae. Local application of zoledronic acid to demineralized bone matrix putty resulted in significant increase of new bone formation as compared to demineralized bone matrix putty group alone. A single local application of zoledronic acid with DBM putty during posterolateral fusion in sacral murine spine model increased significantly new bone formation in situ in our model. Therefore, our results justify further investigations to potentially use local application of zoledronic acid in future clinical studies.

Variation in sensitivity, absorption and density of the central rod distribution with eccentricity.

PubMed

Tornow, R P; Stilling, R

1998-01-01

To assess the human rod photopigment distribution and sensitivity with high spatial resolution within the central +/-15 degrees and to compare the results of pigment absorption, sensitivity and rod density distribution (number of rods per square degree). Rod photopigment density distribution was measured with imaging densitometry using a modified Rodenstock scanning laser ophthalmoscope. Dark-adapted sensitivity profiles were measured with green stimuli (17' arc diameter, 1 degrees spacing) using a T ubingen manual perimeter. Sensitivity profiles were plotted on a linear scale and rod photopigment optical density distribution profiles were converted to absorption profiles of the rod photopigment layer. Both the absorption profile of the rod photopigment and the linear sensitivity profile for green stimuli show a minimum at the foveal center and increase steeply with eccentricity. The variation with eccentricity corresponds to the rod density distribution. Rod photopigment absorption profiles, retinal sensitivity profiles, and the rod density distribution are linearly related within the central +/-15 degrees. This is in agreement with theoretical considerations. Both methods, imaging retinal densitometry using a scanning laser ophthalmoscope and dark-adapted perimetry with small green stimuli, are useful for assessing the central rod distribution and sensitivity. However, at present, both methods have limitations. Suggestions for improving the reliability of both methods are given.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis.

PubMed

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-06-01

Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Is there a role of whole-body bone scan in patients with esophageal squamous cell carcinoma

PubMed Central

2012-01-01

Background Correct detection of bone metastases in patients with esophageal squamous cell carcinoma is pivotal for prognosis and selection of an appropriate treatment regimen. Whole-body bone scan for staging is not routinely recommended in patients with esophageal squamous cell carcinoma. The aim of this study was to investigate the role of bone scan in detecting bone metastases in patients with esophageal squamous cell carcinoma. Methods We retrospectively evaluated the radiographic and scintigraphic images of 360 esophageal squamous cell carcinoma patients between 1999 and 2008. Of these 360 patients, 288 patients received bone scan during pretreatment staging, and sensitivity, specificity, positive predictive value, and negative predictive value of bone scan were determined. Of these 360 patients, surgery was performed in 161 patients including 119 patients with preoperative bone scan and 42 patients without preoperative bone scan. Among these 161 patients receiving surgery, 133 patients had stages II + III disease, including 99 patients with preoperative bone scan and 34 patients without preoperative bone scan. Bone recurrence-free survival and overall survival were compared in all 161 patients and 133 stages II + III patients, respectively. Results The diagnostic performance for bone metastasis was as follows: sensitivity, 80%; specificity, 90.1%; positive predictive value, 43.5%; and negative predictive value, 97.9%. In all 161 patients receiving surgery, absence of preoperative bone scan was significantly associated with inferior bone recurrence-free survival (P = 0.009, univariately). In multivariate comparison, absence of preoperative bone scan (P = 0.012, odds ratio: 5.053) represented the independent adverse prognosticator for bone recurrence-free survival. In 133 stages II + III patients receiving surgery, absence of preoperative bone scan was significantly associated with inferior bone recurrence-free survival (P = 0.003, univariately) and overall survival (P = 0.037, univariately). In multivariate comparison, absence of preoperative bone scan was independently associated with inferior bone recurrence-free survival (P = 0.009, odds ratio: 5.832) and overall survival (P = 0.029, odds ratio: 1.603). Conclusions Absence of preoperative bone scan was significantly associated with inferior bone recurrence-free survival, suggesting that whole-body bone scan should be performed before esophagectomy in patients with esophageal squamous cell carcinoma, especially in patients with advanced stages. PMID:22853826

Aspiration and Biopsy: Bone Marrow

MedlinePlus

... Print What It Is Bone marrow aspirations and biopsies are performed to examine bone marrow, the spongy liquid part of the bone where blood cells are ... you might also feel the pressure of the biopsy needle pushing in. Some ... sharp cramp as the liquid bone marrow is withdrawn for the aspiration or ...

Whole bone mechanics and bone quality.

PubMed

Cole, Jacqueline H; van der Meulen, Marjolein C H

2011-08-01

The skeleton plays a critical structural role in bearing functional loads, and failure to do so results in fracture. As we evaluate new therapeutics and consider treatments to prevent skeletal fractures, understanding the basic mechanics underlying whole bone testing and the key principles and characteristics contributing to the structural strength of a bone is critical. We therefore asked: (1) How are whole bone mechanical tests performed and what are the key outcomes measured? (2) How do the intrinsic characteristics of bone tissue contribute to the mechanical properties of a whole bone? (3) What are the effects of extrinsic characteristics on whole bone mechanical behavior? (4) Do environmental factors affect whole bone mechanical properties? We conducted a PubMed search using specific search terms and limiting our included articles to those related to in vitro testing of whole bones. Basic solid mechanics concepts are summarized in the context of whole bone testing and the determinants of whole bone behavior. Whole bone mechanical tests measure structural stiffness and strength from load-deformation data. Whole bone stiffness and strength are a function of total bone mass and the tissue geometric distribution and material properties. Age, sex, genetics, diet, and activity contribute to bone structural performance and affect the incidence of skeletal fractures. Understanding and preventing skeletal fractures is clinically important. Laboratory tests of whole bone strength are currently the only measures for in vivo fracture prediction. In the future, combined imaging and engineering models may be able to predict whole bone strength noninvasively.

Effect of cisplatin on bone transport osteogenesis in dogs.

PubMed

Ehrhart, Nicole; Eurell, Jo Ann C; Tommasini, Matteo; Constable, Peter D; Johnson, Ann L; Feretti, Antonio

2002-05-01

To document effects of cisplatin on regenerate bone formation during the distraction and consolidation phases of bone transport osteogenesis. 10 skeletally mature hounds. Bone transport osteogenesis was performed to reconstruct a 3-cm defect in the radius of each dog. Five dogs were randomly selected to receive cisplatin (70 mg/m2, IV, q 21 d for 4 cycles), and 5 were administered saline (0.9% NaCl) solution. Bone mineral density was measured by use of dual-energy x-ray absorptiometry (DEXA) on days 24, 55, and 90 after surgery. Dogs were euthanatized 90 days after surgery. Histomorphometry was performed on nondecalcified sections of regenerate bone. Bone mineral density and histomorphometric indices of newly formed bone were compared between groups. Densitometric differences in regenerate bone mineral density were not detected between groups at any time period. Cisplatin-treated dogs had decreased mineralized bone volume, decreased percentage of woven bone volume, decreased percentage of osteoblast-covered bone, increased porosity, and increased percentage of osteoblast-covered surfaces, compared with values for control dogs. Lamellar bone volume and osteoid volume did not differ significantly between groups. Regenerate bone will form and remodel during administration of cisplatin. Results of histomorphometric analysis suggest that bone formation and resorption may be uncoupled in cisplatin-treated regenerate bone as a result of increased osteoclast activity or delayed secondary bone formation during remodeling. These histomorphometric differences were modest in magnitude and did not result in clinically observable complications or decreased bone mineral density as measured by use of DEXA.

[Noncollagen bone proteins use in the composition of osteoplactic material Gapkol modified by vacuum].

PubMed

Volozhin, A I; Grigor'ian, A S; Desiatnichenko, K S; Ozhelevskaia, S A; Doktorov, A A; Kurdiumov, S G; Fionova, E V; Gurin, A N; Karakov, K G

2008-01-01

In rat experiments the ability of noncollagen bone proteins (NCBP) in the composition of osteoplactic modified material Gapkol (not tanned in formalin and subjected to vacuum extraction) to increase bone reparation in comparison with traditional Gapkol was studied. Quantitative evaluation was performed on rat parietal bone and qualitative evaluation was performed on rat mandible. It was shown that Gapkol with NCBP (not tanned in formalin and subjected to vacuum extraction) increased reparative osteogenesis.

Bone ingrowth in bFGF-coated hydroxyapatite ceramic implants.

PubMed

Schnettler, Reinhard; Alt, Volker; Dingeldein, Elvira; Pfefferle, Hans-Joachim; Kilian, Olaf; Meyer, Christof; Heiss, Christian; Wenisch, Sabine

2003-11-01

This experimental study was performed to evaluate angiogenesis, bone formation, and bone ingrowth in response to osteoinductive implants of bovine-derived hydroxyapatite (HA) ceramics either uncoated or coated with basic fibroblast growth factor (bFGF) in miniature pigs. A cylindrical bone defect was created in both femur condyles of 24 miniature pigs using a saline coated trephine. Sixteen of the 48 defects were filled with HA cylinders coated with 50 microg rhbFG, uncoated HA cylinders, and with autogenous transplants, respectively. Fluorochrome labelled histological analysis, histomorphometry, and scanning electron microscopy were performed to study angiogenesis, bone formation and bone ingrowth. Complete bone ingrowth into bFGF-coated HA implants and autografts was seen after 34 days compared to 80 days in the uncoated HA group. Active ring-shaped areas of fluorochrome labelled bone deposition with dynamic bone remodelling were found in all cylinders. New vessels could be found in all cylinders. Histomorphometric analysis showed no difference in bone ingrowth over time between autogenous transplants and bFGF-coated HA implants. The current experimental study revealed comparable results of bFGF-coated HA implants and autogenous grafts regarding angiogenesis, bone synthesis and bone ingrowth.

Bone formation in sinus augmentation procedures using autologous bone, porcine bone, and a 50 : 50 mixture: a human clinical and histological evaluation at 2 months.

PubMed

Cassetta, Michele; Perrotti, Vittoria; Calasso, Sabrina; Piattelli, Adriano; Sinjari, Bruna; Iezzi, Giovanna

2015-10-01

The aim of this study was to perform a 2 months clinical and histological comparison of autologous bone, porcine bone, and a 50 : 50 mixture in maxillary sinus augmentation procedures. A total of 10 consecutive patients, undergoing two-stage sinus augmentation procedures using 100% autologous bone (Group A), 100% porcine bone (Group B), and a 50 : 50 mixture of autologous and porcine bone (Group C) were included in this study. After a 2-month healing period, at the time of implant insertion, clinical evaluation was performed and bone core biopsies were harvested and processed for histological analysis. The postoperative healing was uneventful regardless of the materials used for the sinus augmentation procedures. The histomorphometrical analysis revealed comparable percentages of newly formed bone, marrow spaces, and residual grafted material in the three groups. The clinical and histological results of this study indicated that porcine bone alone or in combination with autologous bone are biocompatible and osteoconductive materials and can be successfully used in sinus augmentation procedures. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Audit of the Douglas Hocking Research Institute bone bank: ten years of non-irradiated bone graft.

PubMed

Love, David; Pritchard, Michael; Burgess, Tanya; Van Der Meer, Gavin; Page, Richard; Williams, Simon

2009-01-01

An audit performed in the use of non-irradiated femoral head bone graft at the Geelong Hospital over a 10-year period. While it is thought the non-irradiated bone graft provides a better structural construct there is theoretical increased risk of infection transmission. We performed a retrospective review of prospectively collected data in the use of non-irradiated bone allograft used from the Geelong Hospital Douglas Hocking Research Institute bone bank over a 10-year period. The review was performed using data collected from the bone bank and correlating it with the patient's medical record. All complications, including infections, related to the use of the allograft were recorded. We found that over the 10 years to 2004 that 811 femoral heads were donated, with 555 being used over 362 procedures in 316 patients. We identified a total of nine deep infections, of which seven were in joint replacements. Overall this was a 2.5% deep infection rate, which was lowered to 1.4% if the previously infected joints that were operated on were excluded. The use of non-irradiated femoral head bone graft was safe in a regional setting.

Noninvasive evaluation system of fractured bone based on speckle interferometry

NASA Astrophysics Data System (ADS)

Yamanada, Shinya; Murata, Shigeru; Tanaka, Yohsuke

2010-11-01

This paper presents a noninvasive evaluation system of fractured bone based on speckle interferometry using a modified evaluation index for higher performance, and the experiments are carried out to examine the feasibility in evaluating bone fracture healing and the influence of some system parameters on the performance. From experimental results, it is shown that the presence of fractured part of bone and the state of bone fracture healing are successfully estimated by observing fine speckle fringes on the object surface. The proposed evaluation index also can successfully express the difference between the cases with cut and without it. Since most system parameters are found not to affect the performance of the present technique, the present technique is expected to be applied to various patients that have considerable individual variability.

Micro-finite-element method to assess elastic properties of trabecular bone at micro- and macroscopic level.

PubMed

Rieger, R; Auregan, J C; Hoc, T

2018-03-01

The objective of the present study is to assess the mechanical behavior of trabecular bone based on microCT imaging and micro-finite-element analysis. In this way two methods are detailed: (i) direct determination of macroscopic elastic property of trabecular bone; (ii) inverse approach to assess mechanical properties of trabecular bone tissue. Thirty-five females and seven males (forty-two subjects) mean aged (±SD) 80±11.7 years from hospitals of Assistance publique-Hôpitaux de Paris (AP-HP) diagnosed with osteoporosis following a femoral neck fracture due to a fall from standing were included in this study. Fractured heads were collected during hip replacement surgery. Standardized bone cores were removed from the femoral head's equator by a trephine in a water bath. MicroCT images acquisition and analysis were performed with CTan ® software and bone volume fraction was then determined. Micro-finite-element simulations were per-formed using Abaqus 6.9-2 ® software in order to determine the macroscopic mechanical behaviour of the trabecular bone. After microCT acquisition, a longitudinal compression test was performed and the experimental macroscopic Young's Modulus was extracted. An inverse approach based on the whole trabecular bone's mechanical response and micro-finite-element analysis was performed to determine microscopic mechanical properties of trabecular bone. In the present study, elasticity of the tissue was shown to be similar to that of healthy tissue but with a lower yield stress. Classical histomorphometric analysis form microCT imaging associated with an inverse micro-finite-element method allowed to assess microscopic mechanical trabecular bone parameters. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Comparison of parameters of bone profile and homocysteine in physically active and non-active postmenopausal females.

PubMed

Tariq, Sundus; Lone, Khalid Parvez; Tariq, Saba

2016-01-01

Optimal physical activity is important in attaining a peak bone mass. Physically active women have better bone mineral density and reduce fracture risk as compared to females living a sedentary life. The objective of this study was to compare parameters of bone profile and serum homocysteine levels in physically active and non-active postmenopausal females. In this cross sectional study postmenopausal females between 50-70 years of age were recruited and divided into two groups: Physically inactive (n=133) performing light physical activity and Physically active (n=34) performing moderate physical activity. Physical activity (in metabolic equivalents), bone mineral density and serum homocysteine levels were assessed. Spearman's rho correlation was applied to observe correlations. Two independent sample t test and Mann Whitney U test were applied to compare groups. P-value ≤ 0.05 was taken statistically significant. Parameters of bone profile were significantly higher and serum homocysteine levels were significantly lower in postmenopausal females performing moderate physical activity as compared to females performing light physical activity. Homocysteine was not significantly related to T-score and Z-score in both groups. Improving physical activity could be beneficial for improving the quality of bone, decreasing fracture risk and decreasing serum homocysteine levels.

Silicon in broiler drinking water promotes bone development in broiler chickens.

PubMed

Sgavioli, S; de Faria Domingues, C H; Castiblanco, D M C; Praes, M F F M; Andrade-Garcia, Giuliana M; Santos, E T; Baraldi-Artoni, S M; Garcia, R G; Junqueira, O M

2016-10-01

Skeletal abnormalities, bone deformities and fractures cause significant losses in broiler production during both rearing and processing. Silicon is an essential mineral for bone and connective tissue synthesis and for calcium absorption during the early stages of bone formation. Performance was not affected by the addition of silicon. However, broilers receiving silicon showed a significant increase of phosphorus, zinc, copper, manganese and ash in the tibia. In conclusion, broiler performance was not impaired by adding the tested silicon product to the drinking water. In addition, bone development improved, as demonstrated by higher mineral and ash content. Further studies are required to determine the optimal concentration of silicon, including heat stress simulations, to better understand the effects of silicon on bone development.

Effect of strontium addition and chitosan concentration variation on cytotoxicity of chitosan-alginate-carbonate apatite based bone scaffold

NASA Astrophysics Data System (ADS)

Perkasa, Rilis Eka; Umniati, B. Sri; Sunendar, Bambang

2017-09-01

Bone scaffold is one of the most important component in bone tissue engineering. Basically, bone scaffold is a biocompatible structure designed to replace broken bone tissue temporarily. Unlike conventional bone replacements, an advanced bone scaffold should be bioactive (e.g: supporting bone growth) and biodegradable as new bone tissue grow, while retain its mechanical properties similarity with bone. It is also possible to add more bioactive substrates to bone scaffold to further support its performance. One of the substrate is strontium, an element that could improve the ability of the bone to repair itself. However, it must be noted that excessive consumption of strontium could lead to toxicity and diseases, such as osteomalacia and hypocalcemia. This research aimed to investigate the effect of strontium addition to the cytotoxic property of chitosan-alginate-carbonate apatite bone scaffold. The amount of strontium added to the bone scaffold was 5% molar of the carbonate apatite content. As a control, bone scaffold without stronsium (0% molar) were also made. The effect of chitosan concentration variation on the cytotoxicity were also observed, where the concentration varies on 1% and 3% w/v of chitosan solution. The results showed an optimum result on bone scaffold sample with 5% molar of strontium and 3% chitosan, where 87.67% cells in the performed MTS-Assay cytotoxicity testing survived. This showed that the use of up to 5% molar addition of strontium and 3% chitosan could enhance the survivability of the cell.

Luminol testing in detecting modern human skeletal remains: a test on different types of bone tissue and a caveat for PMI interpretation.

PubMed

Caudullo, Giorgio; Caruso, Valentina; Cappella, Annalisa; Sguazza, Emanuela; Mazzarelli, Debora; Amadasi, Alberto; Cattaneo, Cristina

2017-01-01

When forensic pathologists and anthropologists have to deal with the evaluation of the post-mortem interval (PMI) in skeletal remains, luminol testing is frequently performed as a preliminary screening method. However, the repeatability of this test on the same bone, as well as comparative studies on different bones of the same individual, has never been performed. Therefore, with the aim of investigating the influence that different types of bones may exert on the response to the luminol test, the present study analysed three different skeletal elements (femoral diaphysis, vertebra and cranial vault), gathered from ten recent exhumed skeletons (all with a 20-year PMI). The analysis was performed twice on the same bone after 2 months: the analysis at time 0 concerned the whole bone, whereas the second concerned only a part of the same bone taken during the first test (which already had been broken). The overall results showed different responses, depending on the type of bone and on the integrity of the samples. Negative results at the first analysis (6.6% out of the total of samples) are consistent with what is reported in the literature, whilst at the second analysis, the increase of about 20% of false-negative results highlights that the luminol test ought to be performed with caution in case of broken bones or elements which are taphonomically altered. Results have thus proven that the exposition to environmental agents might result in haemoglobin (Hb) loss, as detected even after only 2 months. The study also focused on the crucial issue of the type of bone subjected to testing, remarking the suitability of the femoral diaphysis (100% of positive responses at the first analysis vs only 18% of false-negative results at the second test, corresponding to 5% of total false-negative results) as opposed to other bone elements that showed a low yield. In particular, the cranial vault gave poor results, with 40% of discrepancy between results from the two analyses, which suggests caution in choosing the type of bone sample to test. In conclusion, luminol testing should be used with caution on bones different from long bones or on non-intact bones.

Is Breast Densitometry a Measure of Breast Cancer Risk

DTIC Science & Technology

2001-09-01

preparing the same or similar computer software, or (c) used by a party other than the Government, except that the Government may release or disclose...compositional density. This increases the accuracy, dynamic range and precision of the measurement. This is the principal difference between...vivo whole body %FAT. By subtracting two x-ray images acquired at different x-ray energies, one component (say soft tissue) of a two component model (say

Successful correction of tibial bone deformity through multiple surgical procedures, liquid nitrogen-pretreated bone tumor autograft, three-dimensional external fixation, and internal fixation in a patient with primary osteosarcoma: a case report.

PubMed

Takeuchi, Akihiko; Yamamoto, Norio; Shirai, Toshiharu; Nishida, Hideji; Hayashi, Katsuhiro; Watanabe, Koji; Miwa, Shinji; Tsuchiya, Hiroyuki

2015-12-07

In a previous report, we described a method of reconstruction using tumor-bearing autograft treated by liquid nitrogen for malignant bone tumor. Here we present the first case of bone deformity correction following a tumor-bearing frozen autograft via three-dimensional computerized reconstruction after multiple surgeries. A 16-year-old female student presented with pain in the left lower leg and was diagnosed with a low-grade central tibial osteosarcoma. Surgical bone reconstruction was performed using a tumor-bearing frozen autograft. Bone union was achieved at 7 months after the first surgical procedure. However, local tumor recurrence and lung metastases occurred 2 years later, at which time a second surgical procedure was performed. Five years later, the patient developed a 19° varus deformity and underwent a third surgical procedure, during which an osteotomy was performed using the Taylor Spatial Frame three-dimensional external fixation technique. A fourth corrective surgical procedure was performed in which internal fixation was achieved with a locking plate. Two years later, and 10 years after the initial diagnosis of tibial osteosarcoma, the bone deformity was completely corrected, and the patient's limb function was good. We present the first report in which a bone deformity due to a primary osteosarcoma was corrected using a tumor-bearing frozen autograft, followed by multiple corrective surgical procedures that included osteotomy, three-dimensional external fixation, and internal fixation.

Trained nurses can obtain satisfactory bone marrow aspirates and trephine biopsies.

PubMed Central

Lawson, S; Aston, S; Baker, L; Fegan, C D; Milligan, D W

1999-01-01

AIMS: To assess the feasibility of training nurse practitioners to perform bone marrow aspiration and trephine biopsy, and to compare the quality of these samples with those obtained by medical staff. METHODS: A retrospective audit was undertaken of nurse practitioner and medical staff performance in bone marrow procedures in a busy haematology day unit. RESULTS: Nurse practitioners fared favourably in comparison with medical staff in performing bone marrow trephine biopsies, with mean biopsy lengths of 11 mm and 10.7 mm respectively. However, only 78% of the smears obtained by the nurses were judged technically satisfactory, compared with 91% prepared by doctors. This discrepancy was thought to be due largely to the quality of slide spreading. CONCLUSIONS: With motivated staff and a structured educational and training programme it is possible for nurse practitioners to perform the techniques of bone marrow aspiration and biopsy, and obtain specimens of satisfactory quality, thus improving efficiency of the haematology day unit and increasing quality of patient care. Images PMID:10396248

Classification of micro-CT images using 3D characterization of bone canal patterns in human osteogenesis imperfecta

NASA Astrophysics Data System (ADS)

Abidin, Anas Z.; Jameson, John; Molthen, Robert; Wismüller, Axel

2017-03-01

Few studies have analyzed the microstructural properties of bone in cases of Osteogenenis Imperfecta (OI), or `brittle bone disease'. Current approaches mainly focus on bone mineral density measurements as an indirect indicator of bone strength and quality. It has been shown that bone strength would depend not only on composition but also structural organization. This study aims to characterize 3D structure of the cortical bone in high-resolution micro CT images. A total of 40 bone fragments from 28 subjects (13 with OI and 15 healthy controls) were imaged using micro tomography using a synchrotron light source (SRµCT). Minkowski functionals - volume, surface, curvature, and Euler characteristics - describing the topological organization of the bone were computed from the images. The features were used in a machine learning task to classify between healthy and OI bone. The best classification performance (mean AUC - 0.96) was achieved with a combined 4-dimensional feature of all Minkowski functionals. Individually, the best feature performance was seen using curvature (mean AUC - 0.85), which characterizes the edges within a binary object. These results show that quantitative analysis of cortical bone microstructure, in a computer-aided diagnostics framework, can be used to distinguish between healthy and OI bone with high accuracy.

The Tromsø Eye Study: study design, methodology and results on visual acuity and refractive errors.

PubMed

Bertelsen, Geir; Erke, Maja G; von Hanno, Therese; Mathiesen, Ellisiv B; Peto, Tunde; Sjølie, Anne K; Njølstad, Inger

2013-11-01

To describe the study design and methodology of the Tromsø Eye Study (TES), and to describe visual acuity and refractive error in the study population. The Tromsø Eye Study is a sub-study of the Tromsø Study, a population-based multipurpose longitudinal study in the municipality of Tromsø, Norway. The Tromsø Eye Study was a part of the sixth survey of the Tromsø Study, conducted from October 2007 through December 2008. The eye examination included information on self-reported eye diseases, assessment of visual acuity and refractive errors, retinal photography and optical coherence tomography. Retinal images were graded for diabetic retinopathy and age-related macular degeneration, and with computer-assisted measurements of arteriolar and venular diameters. In addition, TES researchers have access to the large comprehensive Tromsø Study database including physical examination results, carotid artery ultrasound, electrocardiogram, bone densitometry, cognitive tests, questionnaires, DNA, blood and urine samples and more from the present and the five previous surveys. Visual acuity was assessed in 6459 subjects and refraction in 6566 subjects aged 38-87 years. Snellen visual acuity <20/60 was found in 1.2% (95% CI 0.95-1.5) of the participants and there was no gender difference. Visual impairment increased with age, and in the age group 80-87 years, the overall visual acuity <20/60 was 7.3% (95% CI 3.3-11.2). Spherical equivalent showed an increasing trend with age and there was no clinically relevant difference between men and women. Retinal photography was performed in 6540 subjects. Prevalence of visual impairment was low but increased with age. There was a trend towards hyperopia with age and no clinically relevant difference in refraction between the sexes. TES aims to provide epidemiological research on several eye and eye-related diseases. Owing to a comprehensive data collection, it has the opportunity to explore issues related to environmental factors, cognition and their interaction with diseases in this community. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.

Chinese Herbal Medicine for Osteoporosis: A Meta-analysis of Randomized Controlled Trials.

PubMed

Jin, Yong-Xiang; Wu, Peng; Mao, Yi-Fan; Wang, Bo; Zhang, Jia-Feng; Chen, Wen-Liang; Liu, Zhong; Shi, Xiao-Lin

Osteoporosis is a major public health problem in the elderly population. Several studies have suggested that Chinese herbal medicine has antiosteoporotic activities that might be beneficial for osteoporosis. This study aimed to assess the effectiveness of Chinese herbal medicine in osteoporosis patients. We comprehensively searched for randomized controlled trials (until December 2016) that compared Chinese herbal medicine with Western medicine in adults with osteoporosis and reported bone mineral densities (BMDs). A total of 10 randomized controlled trials were included. The pooled results suggested that the increased spine BMD was lower but not significant in the Chinese herbal medicine group than in the Western drug group (standard mean difference [SMD] = -0.11, 95% confidence interval [CI]: -0.62 to 0.39, p > 0.05). In the subgroup analysis, in postmenopausal women, Chinese herbal medicine also showed a insignificantly higher increment in BMD than the control group (SMD = 0.22, 95% CI: -0.00 to 0.43, p = 0.05). For different treatment durations, subgroups over 6 mo (SMD = 0.09, 95% CI: -0.24 to 0.41, p > 0.05) and less than 6 mo (SMD = -0.25, 95% CI: -1.14 to 0.64, p > 0.05) showed comparable BMDs between the 2 therapies. Our study demonstrated that Chinese herbal medicine alone did not significantly increase lumbar spine BMD. Further studies with better adherence to the intervention are needed to confirm the results of this meta-analysis. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Establishing an integrated gastroenterology service between a medical center and the community.

PubMed

Niv, Yaron; Dickman, Ram; Levi, Zohar; Neumann, Gadi; Ehrlich, Dorit; Bitterman, Haim; Dreiher, Jacob; Cohen, Arnon; Comaneshter, Doron; Halpern, Eyran

2015-02-21

To combine community and hospital services in order to enable improvements in patient management, an integrated gastroenterology service (IGS) was established. Referral patterns to specialist clinics were optimized; open access route for endoscopic procedures (including esophago-gastro-duodenoscopy, sigmoidoscopy and colonoscopy) was established; family physicians' knowledge and confidence were enhanced; direct communication lines between experts and primary care physicians were opened. Continuing education, guidelines and agreed instructions for referral were promoted by the IGS. Six quality indicators were developed by the Delphi method, rigorously designed and regularly monitored. Improvement was assessed by comparing 2010, 2011 and 2012 indicators. An integrated delivery system in a specific medical field may provide a solution to a fragmented healthcare system impaired by a lack of coordination. In this paper we describe a new integrated gastroenterology service established in April 2010. Waiting time for procedures decreased: 3 mo in April 30th 2010 to 3 wk in April 30th 2011 and stayed between 1-3 wk till December 30th 2012. Average cost for patient's visit decreased from 691 to 638 NIS (a decrease of 7.6%). Six health indicators were improved significantly comparing 2010 to 2012, 2.5% to 67.5%: Bone densitometry for patients with inflammatory bowel disease, preventive medications for high risk patients on aspirin/NSAIDs, colonoscopy following positive fecal occult blood test, gastroscopy in Barrett's esophagus, documentation of family history of colorectal cancer, and colonoscopy in patients with a family history of colorectal cancer. Establishment of an IGS was found to effectively improve quality of care, while being cost-effective.

Obesity and Fractures in Postmenopausal Women: A Primary-care Cross-Sectional Study at Santa Maria, Brazil.

PubMed

Copês, Rafaela Martinez; Comim, Fabio Vasconcellos; Langer, Felipe Welter; Codevilla, Antonio Aurelio da Silveira; Sartori, Giovani Ruviaro; de Oliveira, Cristina; Cocco, Aline Rubin; de Almeida, Adriana Maria; de Almeida, Luciana Leiria; Dal Osto, Léo Canterle; Compston, Juliet Elizabeth; Premaor, Melissa Orlandin

2015-01-01

Obesity and osteoporosis are chronic disorders with increasing prevalence worldwide. The aim of this study was to investigate the association between obesity and fracture in postmenopausal women from Santa Maria, Brazil. A cross-sectional study was carried out at Santa Maria (parallel 29° south), Brazil. Postmenopausal women aged ≥55 yr who had at least 1 appointment at the primary care in the 2 years before the study were recruited from March 1, 2013 to August 31, 2013. The Global Longitudinal Study of Osteoporosis in Women study questionnaire was applied with permission of The Center for Outcomes Research, University of Massachusetts Medical School. Height and weight were measured according to the World Health Organization protocol. Bone fractures (excluding hand, feet, and head) that occurred after the age of 45 yr were considered as the outcome. Overall, 1057 women completed the study, of whom 984 had body mass index measured. The mean (standard deviation) age and body mass index of the women included in the study were 67.1 (7.6) yr and 29.2 (5.5) kg/m(2), respectively. The prevalence of fractures in obese and nonobese women was similar (17.3% vs 16.0%); 41.4% of all fractures occurred in obese women. Obese postmenopausal women make a substantial contribution to the overall burden of prevalent fractures in this population. Our results provide further evidence in support of the concept that obesity is not protective against fracture. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Supporting skill acquisition in cochlear implant surgery through virtual reality simulation.

PubMed

Copson, Bridget; Wijewickrema, Sudanthi; Zhou, Yun; Piromchai, Patorn; Briggs, Robert; Bailey, James; Kennedy, Gregor; O'Leary, Stephen

2017-03-01

To evaluate the effectiveness of a virtual reality (VR) temporal bone simulator in training cochlear implant surgery. We compared the performance of 12 otolaryngology registrars conducting simulated cochlear implant surgery before (pre-test) and after (post-tests) receiving training on a VR temporal bone surgery simulator with automated performance feedback. The post-test tasks were two temporal bones, one that was a mirror image of the temporal bone used as a pre-test and the other, a novel temporal bone. Participant performances were assessed by an otologist with a validated cochlear implant competency assessment tool. Structural damage was derived from an automatically generated simulator metric and compared between time points. Wilcoxon signed-rank test showed that there was a significant improvement with a large effect size in the total performance scores between the pre-test (PT) and both the first and second post-tests (PT1, PT2) (PT-PT1: P = 0.007, r = 0.78, PT-PT2: P = 0.005, r = 0.82). The results of the study indicate that VR simulation with automated guidance can effectively be used to train surgeons in training complex temporal bone surgeries such as cochlear implantation.

Image processing, geometric modeling and data management for development of a virtual bone surgery system.

PubMed

Niu, Qiang; Chi, Xiaoyi; Leu, Ming C; Ochoa, Jorge

2008-01-01

This paper describes image processing, geometric modeling and data management techniques for the development of a virtual bone surgery system. Image segmentation is used to divide CT scan data into different segments representing various regions of the bone. A region-growing algorithm is used to extract cortical bone and trabecular bone structures systematically and efficiently. Volume modeling is then used to represent the bone geometry based on the CT scan data. Material removal simulation is achieved by continuously performing Boolean subtraction of the surgical tool model from the bone model. A quadtree-based adaptive subdivision technique is developed to handle the large set of data in order to achieve the real-time simulation and visualization required for virtual bone surgery. A Marching Cubes algorithm is used to generate polygonal faces from the volumetric data. Rendering of the generated polygons is performed with the publicly available VTK (Visualization Tool Kit) software. Implementation of the developed techniques consists of developing a virtual bone-drilling software program, which allows the user to manipulate a virtual drill to make holes with the use of a PHANToM device on a bone model derived from real CT scan data.

Detection of changes in bone quality of osteoporotic model induced by sciatic nerve resection by using Raman spectroscopy

NASA Astrophysics Data System (ADS)

Ishimaru, Yasumitsu; Oshima, Yusuke; Imai, Yuuki; Iimura, Tadahiro; Takanezawa, Sota; Hino, Kazunori; Miura, Hiromasa

2018-02-01

To detect the bone quality loss in osteoporosis, we performed Raman spectroscopic analysis of sciatic nerve resection (NX) mice. Eight months after surgery, lower limbs were collected from the mice and fixed with 70% ethanol. Raman spectra of anterior cortical surface of the proximal tibia at 5 points in each bone were measured by RENISHAW inVia Raman Microscope. Excitation wave length was 785 nm. We also performed DXA and micro CT measurement to confirm the bone mineral density and bone microstructure in the osteoporotic model induced by sciatic nerve resection. In the result of Raman spectroscopy, we detected changes of Raman peak intensity ratio in carbonate/phosphate, mineral/combined proline and hydroxyproline and mineral/phenylalanine. In addition, in the result of micro CT, we found significant changes in VOX BV/TV, Trabecular number, thickness, cancellous bone mineral density, cortical thickness and cortical bone mineral density. The results suggest that not only the bone mineral density but also bone quality reduced in the NX mice. We conclude that Raman spectroscopy is a useful for bone quality assessment as a complementary technique for conventional diagnostics.

Bone suppression technique for chest radiographs

NASA Astrophysics Data System (ADS)

Huo, Zhimin; Xu, Fan; Zhang, Jane; Zhao, Hui; Hobbs, Susan K.; Wandtke, John C.; Sykes, Anne-Marie; Paul, Narinder; Foos, David

2014-03-01

High-contrast bone structures are a major noise contributor in chest radiographic images. A signal of interest in a chest radiograph could be either partially or completely obscured or "overshadowed" by the highly contrasted bone structures in its surrounding. Thus, removing the bone structures, especially the posterior rib and clavicle structures, is highly desirable to increase the visibility of soft tissue density. We developed an innovative technology that offers a solution to suppress bone structures, including posterior ribs and clavicles, on conventional and portable chest X-ray images. The bone-suppression image processing technology includes five major steps: 1) lung segmentation, 2) rib and clavicle structure detection, 3) rib and clavicle edge detection, 4) rib and clavicle profile estimation, and 5) suppression based on the estimated profiles. The bone-suppression software outputs an image with both the rib and clavicle structures suppressed. The rib suppression performance was evaluated on 491 images. On average, 83.06% (±6.59%) of the rib structures on a standard chest image were suppressed based on the comparison of computer-identified rib areas against hand-drawn rib areas, which is equivalent to about an average of one rib that is still visible on a rib-suppressed image based on a visual assessment. Reader studies were performed to evaluate reader performance in detecting lung nodules and pneumothoraces with and without a bone-suppression companion view. Results from reader studies indicated that the bone-suppression technology significantly improved radiologists' performance in the detection of CT-confirmed possible nodules and pneumothoraces on chest radiographs. The results also showed that radiologists were more confident in making diagnoses regarding the presence or absence of an abnormality after rib-suppressed companion views were presented

Bone stress injury of the ankle in professional ballet dancers seen on MRI

PubMed Central

Elias, Ilan; Zoga, Adam C; Raikin, Steven M; Peterson, Judith R; Besser, Marcus P; Morrison, William B; Schweitzer, Mark E

2008-01-01

Background Ballet Dancers have been shown to have a relatively high incidence of stress fractures of the foot and ankle. It was our objective to examine MR imaging patterns of bone marrow edema (BME) in the ankles of high performance professional ballet dancers, to evaluate clinical relevance. Methods MR Imaging was performed on 12 ankles of 11 active professional ballet dancers (6 female, 5 male; mean age 24 years, range 19 to 32). Individuals were imaged on a 0.2 T or 1.5 T MRI units. Images were evaluated by two musculoskeletal radiologists and one orthopaedic surgeon in consensus for location and pattern of bone marrow edema. In order to control for recognized sources of bone marrow edema, images were also reviewed for presence of osseous, ligamentous, tendinous and cartilage injuries. Statistical analysis was performed to assess the strength of the correlation between bone marrow edema and ankle pain. Results Bone marrow edema was seen only in the talus, and was a common finding, observed in nine of the twelve ankles imaged (75%) and was associated with pain in all cases. On fluid-sensitive sequences, bone marrow edema was ill-defined and centered in the talar neck or body, although in three cases it extended to the talar dome. No apparent gender predilection was noted. No occult stress fracture could be diagnosed. A moderately strong correlation (phi = 0.77, p= 0.0054) was found between edema and pain in the study population. Conclusion Bone marrow edema seems to be a specific MRI finding in the talus of professional ballet dancers, likely related to biomechanical stress reactions, due to their frequently performed unique maneuvers. Clinically, this condition may indicate a sign of a bone stress injury of the ankle. PMID:18371230

Special distraction osteogenesis before bone grafting for alveolar cleft defects to correct maxillary deformities in patients with bilateral cleft lips and palates: distraction osteogenesis performed separately for each bone segment.

PubMed

Mitsukawa, Nobuyuki; Saiga, Atsuomi; Morishita, Tadashi; Satoh, Kaneshige

2014-07-01

Patients with bilateral cleft lips and palates have premaxillary protrusion and characteristic jaw deformities involving three-dimensional malposition of the premaxilla and bilateral maxillary bone segments. This study examined patients with bilateral cleft lips and palates who had deviation and hypoplasia of the premaxillas and bilateral maxillary segments. Before bone grafting, the patients were treated with special distraction performed separately for each bone segment using a halo-type external device. This report describes this novel treatment method which produced good results. The subjects were five patients with severe jaw deformities due to bilateral cleft lip and palate. They were treated with maxillary Le Fort I osteotomy and subsequent distraction performed separately for each bone segment using a halo device. In three of five patients, premaxillary osteotomy was not performed, and osteotomy and distraction were performed only for the right and left lateral segments with severe hypoplasia. All patients achieved distraction close to the desired amount. The widths of the alveolar clefts were narrowed, and satisfactory occlusion and maxillary arch form were achieved. After the surgery, three of five patients underwent bone grafting for bilateral alveolar cleft defects and the bone graft survival was satisfactory. This method had many benefits, including narrowing of alveolar clefts, improvement of maxillary hypoplasia, and achievement of a good maxillary arch form. In addition, subsequent bone grafting for alveolar cleft defects was beneficial, dental prostheses were unnecessary, and frequency of surgery and surgical invasiveness were reduced. This method is a good surgical procedure that should be considered for patients with bilateral cleft lips and palates who have premaxillary protrusion and hypoplasia of the right and left lateral segments. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Bone x-ray

MedlinePlus

... different views of the bone may be uncomfortable. Why the Test is Performed A bone x-ray ... neoplasia (MEN) II Multiple myeloma Osgood-Schlatter disease Osteogenesis imperfecta Osteomalacia Paget's disease Primary hyperparathyroidism Rickets Risks There ...

[Is bone biopsy necessary for the diagnosis of metabolic bone diseases? Necessity of bone biopsy].

PubMed

Ito, Akemi; Yajima, Aiji

2011-09-01

Histological analysis of undecalcified bone biopsy specimens is a valuable clinical and research tool for studying the etiology, pathogenesis and treatment of metabolic bone diseases. In case of osteoporosis, bone biopsy is not usually required for the diagnosis ; however, bone histomorphometry may be useful in rare cases with unusual skeletal fragility. Bone histomorphometry also provides valuable information on the mechanism of action, safety and efficacy of new anti-osteoporosis drugs. Bone histomorphometry is useful for the diagnosis and the assessment of treatment response in rickets/osteomalacia and in CKD-MBD (chronic kidney disease-mineral and bone disorders) . In Japan, bone biopsy is often performed to establish the diagnosis of Paget's disease of bone, especially to differentiate it from metastatic bone disease.

Optimization of multiple quality characteristics in bone drilling using grey relational analysis

PubMed Central

Pandey, Rupesh Kumar; Panda, Sudhansu Sekhar

2014-01-01

Purpose Drilling of bone is common during bone fracture treatment to fix the fractured parts with screws wires or plates. Minimally invasive drilling of the bone has a great demand as it helps in better fixation and quick healing of the broken bones. The purpose of the present investigation is to determine the optimum cutting condition for the minimization of the temperature, force and surface roughness simultaneously during bone drilling. Method In this study, drilling experiments have been performed on bovine bone with different conditions of feed rate and drill rotational speed using full factorial design. Optimal level of the drilling parameters is determined by the grey relational grade (GRG) obtained from the GRA as the performance index of multiple quality characteristics. The effect of each drilling parameter on GRG is determined using analysis of variance (ANOVA) and the results obtained are validated by confirmation experiment. Results Grey relational analysis showed that the investigation with feed rate of 40 mm/min and spindle speed of 500 rpm has the highest grey relational grade and is recommended setting for minimum temperature, force and surface roughness simultaneously during bone drilling. Feed rate has the highest contribution (59.49%) on the multiple performance characteristics followed by the spindle speed (37.69%) as obtained from ANOVA analysis. Conclusions The use of grey relational analysis will simplify the complex process of optimization of the multi response characteristics in bone drilling by converting them into a single grey relational grade. The use of the above suggested methodology can greatly minimize the bone tissue injury during drilling. PMID:25829751

Optimization of multiple quality characteristics in bone drilling using grey relational analysis.

PubMed

Pandey, Rupesh Kumar; Panda, Sudhansu Sekhar

2015-03-01

Drilling of bone is common during bone fracture treatment to fix the fractured parts with screws wires or plates. Minimally invasive drilling of the bone has a great demand as it helps in better fixation and quick healing of the broken bones. The purpose of the present investigation is to determine the optimum cutting condition for the minimization of the temperature, force and surface roughness simultaneously during bone drilling. In this study, drilling experiments have been performed on bovine bone with different conditions of feed rate and drill rotational speed using full factorial design. Optimal level of the drilling parameters is determined by the grey relational grade (GRG) obtained from the GRA as the performance index of multiple quality characteristics. The effect of each drilling parameter on GRG is determined using analysis of variance (ANOVA) and the results obtained are validated by confirmation experiment. Grey relational analysis showed that the investigation with feed rate of 40 mm/min and spindle speed of 500 rpm has the highest grey relational grade and is recommended setting for minimum temperature, force and surface roughness simultaneously during bone drilling. Feed rate has the highest contribution (59.49%) on the multiple performance characteristics followed by the spindle speed (37.69%) as obtained from ANOVA analysis. The use of grey relational analysis will simplify the complex process of optimization of the multi response characteristics in bone drilling by converting them into a single grey relational grade. The use of the above suggested methodology can greatly minimize the bone tissue injury during drilling.

Utilization of fish bone as adsorbent of Fe3+ ion by controllable removal of its carbonaceous component

NASA Astrophysics Data System (ADS)

Nurhadi, M.; Kusumawardani, R.; Widiyowati, I. I.; Wirhanuddin; Nur, H.

2018-05-01

The performance of fish bone to adsorb Fe3+ ion in solution was studied. Powdered fish bone and carbonized fish bone were used as adsorbent. All absorbents were characterized by X-ray diffraction (XRD), IR spectroscopy, nitrogen adsorption, scanning electron microscopy (SEM) and TG analysis. Powdered fish bone and carbonized fish bone were effective as adsorbent for removing Fe3+ ion in solution. The metal adsorptions of Fe3+ ion were 94 and 98% for powdered fish bone and fish bone which carbonized at 400 and 500 °C.

A fundamental study of cryoablation on normal bone: diagnostic imaging and histopathology.

PubMed

Yoshimoto, Yuta; Azuma, Kazuo; Miya, Atsushi; Makino, Eiichi; Nakamoto, Hidekazu; Abe, Nobutaka; Kaburagi, Masashi; Ueda, Hisaki; Kuroda, Kohei; Tsuka, Takeshi; Sugiyama, Akihiko; Imagawa, Tomohiro; Murahata, Yusuke; Itoh, Norihiko; Osaki, Tomohiro; Shimizu, Tadashi; Okamoto, Yoshiharu

2014-10-01

Cryoablation is a minimally invasive cancer treatment. In this study, the effects of cryoablation on normal rabbit bone were evaluated using imaging and histopathological examinations. Cryoablation was performed using a Cryo-Hit (Galil Medical, Yokneam, Israel). Under anesthesia, one cryoablation needle was inserted at the center of the femur (day 0). To create an ice ball (2 x 3 cm), two 10-min freeze cycles were performed, separated by a 5-min thaw cycle. During cryoablation, changes in the bone and regional tissue were monitored using magnetic resonance imaging (MRI). MRI scans, computed tomography (CT) scans, and collections from the femur (for histopathological evaluation) were performed on days 7, 14, 28, and 56. In terms of the all rabbits' general conditions, we did not observe lameness, decreased appetite, or any other side effects during the experimental periods. Histopathological evaluations of the femur were performed using hematoxylin and eosin staining. MRI indicated inflammation around the ice ball on day 7. Subsequently, the area of inflammation gradually decreased from days 14 to 56. In the histopathological examination, necrosis of bone marrow cells and endosteum were observed from days 7 to 56. No regeneration of bone marrow cells was observed during the experimental period. On the other hand, cryoablation did not influence osteoblasts. Furthermore, there was no pathologic fracture during the experimental period. Our results suggest that cryoablation does not induce severe adverse effects on normal bone, and therefore has potential as a therapeutic option for bone tumors, including metastatic tumors to bone. Copyright © 2014 Elsevier Inc. All rights reserved.

Systems to Detect Bacterial Contamination of Banked Blood in a Rapid, Non-Invasive Low Technology Manner. Phase 1.

DTIC Science & Technology

1994-08-25

Department of the Army position, policy or decision unless so designated by other documentation. 94-30800 IIV III !111 IiI I ’ I foron Appr •vedREPORT...copyrighted material is quoted, permission has been obtained to use such material. Where material from documents designated for limited distribution is...Laser Scanning Densitometry for quantitation of the color changes. (6) Narrative: a. Eperimental Methods: 1. Bacteria: Ten bacterial species

Journal of Special Operations Medicine. Volume 10, Edition 4, Fall 2010

DTIC Science & Technology

2010-01-01

Prior To Ascent? ● Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier ● Public Health Foodborne Illness Case Study...Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier LTC K. David Thompson, MPAS, PA-C Public Health Foodborne Illness...consistent measurements were achieved. Predicted lung vol- ume and an appropriate densitometry equation were used to calculate percent body fat (% BF

Comparison between the effects of platelet-rich plasma and bone marrow concentrate on defect consolidation in the rabbit tibia

PubMed Central

Batista, Marco Antonio; Leivas, Tomaz Puga; Rodrigues, Consuelo Junqueira; Arenas, Géssica Cantadori Funes; Belitardo, Donizeti Rodrigues; Guarniero, Roberto

2011-01-01

OBJECTIVE: To perform a comparative analysis of the effects of platelet-rich plasma and centrifuged bone marrow aspirate on the induction of bone healing in rabbits. METHOD: Twenty adult, male New Zealand rabbits were randomly separated into two equal groups, and surgery was performed to create a bone defect (a cortical orifice 3.3 mm in diameter) in the proximal metaphysis of each rabbit's right tibia. In the first group, platelet-rich plasma was implanted in combination with β-tricalcium phosphate (platelet-rich plasma group), and in the second group, centrifuged bone marrow in combination with β-tricalcium phosphate (centrifuged bone marrow group) was implanted. After a period of four weeks, the animals were euthanized, and the tibias were evaluated using digital radiography, computed tomography, and histomorphometry. RESULTS: Seven samples from each group were evaluated. The radiographic evaluation confirmed the absence of fractures in the postoperative limb and identified whether bone consolidation had occurred. The tomographic evaluation revealed a greater amount of consolidation and the formation of a greater cortical bone thickness in the platelet-rich plasma group. The histomorphometry revealed a greater bone density in the platelet-rich plasma group compared with the centrifuged bone marrow group. CONCLUSION: After four weeks, the platelet-rich plasma promoted a greater amount of bone consolidation than the bone marrow aspirate concentrate. PMID:22012052

Assessment of osteoinduction using a porous hydroxyapatite coating prepared by micro-arc oxidation on a new titanium alloy.

PubMed

Jing, Wensen; Zhang, Minghua; Jin, Lei; Zhao, Jian; Gao, Qing; Ren, Min; Fan, Qingyu

2015-12-01

Surface modification and material improvement is now an important way to improve the osseointegration between bone and uncemented prothesis. The purpose of this study was to investigate the bone ingrowth potential of porous hydroxyapatite (HA) coatings prepared by micro-arc oxidation (MAO) on Ti-3Zr-2Sn-3Mo-25Nb, a new titanium alloy. HA-coated specimens were implanted in the left proximal femoral medullary canal of beagles for 4, 12, and 24 weeks, and uncoated specimens were implanted in the right as a control. The surface morphology and phase composition were investigated with environmental scanning electron microscopy and X-ray diffractometry. The bone ingrowth was assessed by histomorphometry. A pull-out test was performed to assess the mechanical performance of the bone-implant interface. A porous coating was well prepared on the new titanium alloy by using the MAO method. The bone-to-implant contact was significantly higher for the HA-coated group compared to that in the uncoated group. Mechanical tests showed that the HA-coated group had significantly higher maximum force at the bone-implant interface compared to the uncoated specimens. MAO is a suitable coating approach for this new titanium alloy. The HA coating prepared by this approach can significantly promote bone ingrowth and the mechanical performance of the bone-implant interface. Copyright © 2015. Published by Elsevier Ltd.

Bone-marrow transplant - series (image)

MedlinePlus

Bone-marrow transplants are performed for: deficiencies in red blood cells (aplastic anemia) and white blood cells (leukemia or ... Bone-marrow transplants prolong the life of patients who might otherwise die. As with all major organ transplants, however, ...

Development of self-interrogation neutron resonance densitometry (sinrd) to measure the fissile content in nuclear fuel

NASA Astrophysics Data System (ADS)

LaFleur, Adrienne Marie

The development of non-destructive assay (NDA) capabilities to directly measure the fissile content in spent fuel is needed to improve the timely detection of the diversion of significant quantities of fissile material. Currently, the International Atomic Energy Agency (IAEA) does not have effective NDA methods to verify spent fuel and recover continuity of knowledge in the event of a containment and surveillance systems failure. This issue has become increasingly critical with the worldwide expansion of nuclear power, adoption of enhanced safeguards criteria for spent fuel verification, and recent efforts by the IAEA to incorporate an integrated safeguards regime. In order to address these issues, the use of Self-Interrogation Neutron Resonance Densitometry (SINRD) has been developed to improve existing nuclear safeguards and material accountability measurements. The following characteristics of SINRD were analyzed: (1) ability to measure the fissile content in Light Water Reactors (LWR) fuel assemblies and (2) sensitivity and penetrability of SINRD to the removal of fuel pins from an assembly. The Monte Carlo Neutral Particle eXtended (MCNPX) transport code was used to simulate SINRD for different geometries. Experimental measurements were also performed with SINRD and were compared to MCNPX simulations of the experiment to verify the accuracy of the MCNPX model of SINRD. Based on the results from these simulations and measurements, we have concluded that SINRD provides a number of improvements over current IAEA verification methods. These improvements include: (1) SINRD provides absolute measurements of burnup independent of the operator's declaration. (2) SINRD is sensitive to pin removal over the entire burnup range and can verify the diversion of 6% of fuel pins within 3o from LWR spent LEU and MOX fuel. (3) SINRD is insensitive to the boron concentration and initial fuel enrichment and can therefore be used at multiple spent fuel storage facilities. (4) The calibration of SINRD at one reactor facility carries over to reactor sites in different countries because it uses the ratio of fission chambers (FCs) that are not facility dependent. (5) SINRD can distinguish fresh and 1-cycle spent MOX fuel from 3- and 4-cycles spent LEU fuel without using reactor burnup codes.

Expected count rate for the Self- Interrogation Neutron Resonance Densitometry measurements of spent nuclear fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rossa, Riccardo; Universite libre de Bruxelles, Ecole polytechnique de Bruxelles - Service de Metrologie Nucleaire, CP 165/84, Avenue F.D. Roosevelt, 50 - B1050 Brussels; Borella, Alessandro

The Self-Interrogation Neutron Resonance Densitometry (SINRD) is a passive neutron technique that aims at a direct quantification of {sup 239}Pu in the fuel assemblies by measuring the attenuation of the neutron flux in the energy region close to the 0.3 eV resonance of {sup 239}Pu. The {sup 239}Pu mass is estimated by calculating the SINRD signature, that is the ratio between the neutron flux integrated over the fast energy region and around the 0.3 eV resonance region. The SINRD measurement approach considered in this study consists in introducing a small neutron detector in the central guide tube of a PWRmore » 17x17 fuel assembly. In order to measure the neutron flux in the energy regions defined in the SINRD signature, different detector types are used. The response of a bare {sup 238}U fission chamber is considered for the determination of the fast neutron flux, while other thermal-epithermal detectors wrapped in neutron absorbers are envisaged to measure the neutron flux around the resonance region. This paper provides an estimation of the count rate that can be achieved with the detector types proposed for the SINRD measurement. In the first section a set of detectors are evaluated in terms of count rate and sensitivity to the {sup 239}Pu content, in order to identify the optimal measurement configuration for each detector type. Then a study is performed to increase the count rate by increasing the detector size. The study shows that the highest count rate is achieved by using either {sup 3}He or {sup 10}B proportional counters because of the high neutron efficiency of these detectors. However, the calculations indicate that the biggest contribution to the measurement uncertainty is due to the measurement of the fast neutron flux. Finally, similar sensitivity to the {sup 239}Pu content is obtained by using the different detector types for the measurement of the neutron flux close to the resonance region. Therefore, the count rate associated to each detector type will play a major role in the selection of the detector types used for the SINRD measurement. (authors)« less

A Comparison of Limb-Socket Kinematics of Bone-Bridging and Non-Bone-Bridging Wartime Transtibial Amputations

DTIC Science & Technology

2012-05-16

each successive loading interval. Subset analysis was performed on the basis of amputation type (bone bridging or non bone bridging) and suspension...fitting, patient care. Washington, DC: US Government Printing Office; 1969. 2. Ertl J. Uber amputationsstumpfe. Chirurg. 1949;20:218 24. 3. Pinto MA

Bone texture analysis on dental radiographic images: results with several angulated radiographs on the same region of interest

NASA Astrophysics Data System (ADS)

Amouriq, Yves; Guedon, Jeanpierre; Normand, Nicolas; Arlicot, Aurore; Benhdech, Yassine; Weiss, Pierre

2011-03-01

Bone microarchitecture is the predictor of bone quality or bone disease. It can only be measured on a bone biopsy, which is invasive and not available for all clinical situations. Texture analysis on radiographs is a common way to investigate bone microarchitecture. But relationship between three-dimension histomorphometric parameters and two-dimension texture parameters is not always well known, with poor results. The aim of this study is to performed angulated radiographs of the same region of interest and see if a better relationship between texture analysis on several radiographs and histomorphometric parameters can be developed. Computed radiography images of dog (Beagle) mandible section in molar regions were compared with high-resolution micro-CT (Computed-Tomograph) volumes. Four radiographs with 27° angle (up, down, left, right, using Rinn ring and customized arm positioning system) were performed from initial radiograph position. Bone texture parameters were calculated on all images. Texture parameters were also computed from new images obtained by difference between angulated images. Results of fractal values in different trabecular areas give some caracterisation of bone microarchitecture.

Modeling the effects of inflammation in bone fracture healing

NASA Astrophysics Data System (ADS)

Kojouharov, H. V.; Trejo, I.; Chen-Charpentier, B. M.

2017-10-01

A new mathematical model is presented to study the early inflammatory effects in bone healing. It consists of a system of nonlinear ordinary differential equations that represents the interactions among macrophages, mesenchymal stem cells, and osteoblasts. A qualitative analysis of the model is performed to determine the equilibria and their corresponding stability properties. A set of numerical simulations is performed to support the theoretical results. The model is also used to numerically monitor the evolution of a broken bone for different types of fractures and to explore possible treatments to accelerate bone healing by administrating anti-inflammatory drugs.

[Radionuclide bone scan in patients with newly diagnosed prostate cancer. Clinical aspects and cost analysis].

PubMed

Klatte, T; Klatte, D; Böhm, M; Allhoff, E P

2006-10-01

The indication for a radionuclide bone scan in patients with newly diagnosed, untreated prostate cancer remains controversial. In this retrospective study we examined 406 patients who had received a staging bone scan irrespective of their PSA serum level and histology. We evaluated different guidelines and recommendations with respect to their usefulness. The costs were calculated according to EBM and GOA. We evaluated the classification systems of bone metastases according to Soloway, Crawford, and Rigaud. The bone scan was positive in 41 (10%) of 406 patients. The EAU guidelines turned out to be useful with respect to both clinical value and cost efficiency. The Rigaud classification of bone metastases predicted outcome better than the Soloway or Crawford classification. The EAU guidelines from 2005 are a useful tool to decide whether to perform a bone scan in patients with newly diagnosed, untreated prostate cancer. A bone scan should be performed if PSA levels exceed 20 ng/ml in patients with a G1/G2 histology, and in patients with G3 histology and locally advanced disease irrespective of PSA level. Bone scan metastases should be classified according to Rigaud.

True Color Image Analysis For Determination Of Bone Growth In Fluorochromic Biopsies

NASA Astrophysics Data System (ADS)

Madachy, Raymond J.; Chotivichit, Lee; Huang, H. K.; Johnson, Eric E.

1989-05-01

A true color imaging technique has been developed for analysis of microscopic fluorochromic bone biopsy images to quantify new bone growth. The technique searches for specified colors in a medical image for quantification of areas of interest. Based on a user supplied training set, a multispectral classification of pixel values is performed and used for segmenting the image. Good results were obtained when compared to manual tracings of new bone growth performed by an orthopedic surgeon. At a 95% confidence level, the hypothesis that there is no difference between the two methods can be accepted. Work is in progress to test bone biopsies with different colored stains and further optimize the analysis process using three-dimensional spectral ordering techniques.

Osteomesopyknosis: report of a new case with bone histology.

PubMed

Hardouin, P; Flautre, B; Sutter, B; Leclet, H; Grardel, B; Fauquert, P

1994-01-01

A new case of osteomesopyknosis, a rare autosomal dominant axial osteosclerosis is reported, with 4 affected members of the same family. Biochemical investigations, bone mineral content (BMC) measurement, 99mTc HMDP bone scan and microscopy of iliac crest bone and femoral head have been performed on 1 subject. A marked increase of BMC was found, without abnormality of biochemical data. Microscopy of bone showed an increase of trabecular thickness, and a low rate of bone turnover. No abnormality of mineralization was found on microradiographs.

Using a virtual reality temporal bone simulator to assess otolaryngology trainees.

PubMed

Zirkle, Molly; Roberson, David W; Leuwer, Rudolf; Dubrowski, Adam

2007-02-01

The objective of this study is to determine the feasibility of computerized evaluation of resident performance using hand motion analysis on a virtual reality temporal bone (VR TB) simulator. We hypothesized that both computerized analysis and expert ratings would discriminate the performance of novices from experienced trainees. We also hypothesized that performance on the virtual reality temporal bone simulator (VR TB) would differentiate based on previous drilling experience. The authors conducted a randomized, blind assessment study. Nineteen volunteers from the Otolaryngology-Head and Neck Surgery training program at the University of Toronto drilled both a cadaveric TB and a simulated VR TB. Expert reviewers were asked to assess operative readiness of the trainee based on a blind video review of their performance. Computerized hand motion analysis of each participant's performance was conducted. Expert raters were able to discriminate novices from experienced trainees (P < .05) on cadaveric temporal bones, and there was a trend toward discrimination on VR TB performance. Hand motion analysis showed that experienced trainees had better movement economy than novices (P < .05) on the VR TB. Performance, as measured by hand motion analysis on the VR TB simulator, reflects trainees' previous drilling experience. This study suggests that otolaryngology trainees could accomplish initial temporal bone training on a VR TB simulator, which can provide feedback to the trainee, and may reduce the need for constant faculty supervision and evaluation.

Paget's disease of bone resembling bone metastasis from gastric cancer.

PubMed

Shimoyama, Yasuyuki; Kusano, Motoyasu; Shimoda, Yoko; Ishihara, Shingo; Toyomasu, Yoshitaka; Ohno, Tetsuro; Mochiki, Erito; Sano, Takaaki; Hirato, Junko; Mori, Masatomo

2011-08-01

A 74-year-old man had an endoscopic type 0'-IIc tumor in the upper gastric body on the greater curvature and biopsy showed the tumor to be a well-differentiated adenocarcinoma (Group 5). He was referred to us for endoscopic submucosal dissection (ESD). Endoscopy revealed fold convergency, fold swelling, and fusion of the fold, indicating tumor invasion into the submucosa, which was outside the indications for ESD. In addition, there was an increase of serum bone-type alkaline phosphatase (ALP-III and ALP-IV) and urinary cross-linked N-terminal telopeptide of type I collagen (a bone metabolism marker), while (18)F-fluorodeoxyglucose positron emission tomography showed increased uptake in the left pelvis and Th10, suggesting bone metastases. We first diagnosed gastric cancer with bone metastases; however, the symptoms suggested pathological bone fracture and no bone pain. Therefore, a computed tomography-guided aspiration bone biopsy was performed to exclude the possibility of Paget's disease of bone. Biopsy specimens revealed no tumor and a mosaic pattern. No increased uptake of (18)F-FAMT (L-[3-(18)F] α-methyltyrosine) supported a diagnosis of no bone metastases from gastric cancer. We finally diagnosed gastric cancer accompanied by Paget's disease of bone and performed a laparoscopy-assisted proximal gastrectomy. The pathological diagnosis was U less 0-IIb, and U post 0-IIc ypT1a (M) N0H0P0M0 yp stage IA. In gastric cancer patients with suspected bone metastasis, we also need to consider Paget's disease of bone.

Lateral approach for maxillary sinus membrane elevation without bone materials in maxillary mucous retention cyst with immediate or delayed implant rehabilitation: case reports.

PubMed

Han, Ji-Deuk; Cho, Seong-Ho; Jang, Kuk-Won; Kim, Seong-Gwang; Kim, Jung-Han; Kim, Bok-Joo; Kim, Chul-Hun

2017-08-01

This case series study demonstrates the possibility of successful implant rehabilitation without bone augmentation in the atrophic posterior maxilla with cystic lesion in the sinus. Sinus lift without bone graft using the lateral approach was performed. In one patient, the cyst was aspirated and simultaneous implantation under local anesthesia was performed, whereas the other cyst was removed under general anesthesia, and the sinus membrane was elevated in a second process, followed by implantation. In both cases, tapered 11.5-mm-long implants were utilized. With all of the implants, good stability and appropriate bone height were achieved. The mean bone level gain was 5.73 mm; adequate bone augmentation around the implants was shown, the sinus floor was moved apically, and the cyst was no longer radiologically detected. Completion of all of the treatments required an average of 12.5 months. The present study showed that sufficient bone formation and stable implantation in a maxilla of insufficient bone volume are possible through sinus lift without bone materials. The results serve to demonstrate, moreover, that surgical treatment of mucous retention cyst can facilitate rehabilitation. These techniques can reduce the risk of complications related to bone grafts, save money, and successfully treat antral cyst.

Lateral approach for maxillary sinus membrane elevation without bone materials in maxillary mucous retention cyst with immediate or delayed implant rehabilitation: case reports

PubMed Central

2017-01-01

This case series study demonstrates the possibility of successful implant rehabilitation without bone augmentation in the atrophic posterior maxilla with cystic lesion in the sinus. Sinus lift without bone graft using the lateral approach was performed. In one patient, the cyst was aspirated and simultaneous implantation under local anesthesia was performed, whereas the other cyst was removed under general anesthesia, and the sinus membrane was elevated in a second process, followed by implantation. In both cases, tapered 11.5-mm-long implants were utilized. With all of the implants, good stability and appropriate bone height were achieved. The mean bone level gain was 5.73 mm; adequate bone augmentation around the implants was shown, the sinus floor was moved apically, and the cyst was no longer radiologically detected. Completion of all of the treatments required an average of 12.5 months. The present study showed that sufficient bone formation and stable implantation in a maxilla of insufficient bone volume are possible through sinus lift without bone materials. The results serve to demonstrate, moreover, that surgical treatment of mucous retention cyst can facilitate rehabilitation. These techniques can reduce the risk of complications related to bone grafts, save money, and successfully treat antral cyst. PMID:28875144

The Mice Drawer System Tissue Sharing Program (MDS-TSP): osteobiology in microgravity

NASA Astrophysics Data System (ADS)

Ruggiu, Alessandra; Cancedda, Ranieri; Biticchi, Roberta; Cilli, Michele; Cotronei, Vittorio; Costa, Delfina; Liu, Yi; Piccardi, Federica; Pignataro, Salvatore; Tasso, Roberta; Tavella, Sara

The capacity of bone tissue to alter its mass and architecture in response to mechanical request has long been known. Bone not only develops as a structure designed specifically for mechanical demands, but it can adapt during life toward more efficient mechanical performance. In partic-ular, the skeletal effects of microgravity result in the development of an osteoporotic phenotype with several bone defects including a bone mass decrease resembling the bone modifications occurring in elder people and in bed rest conditions. This is particularly true for weight bearing bones such as spine, femur and tibiae. In contrast non-weight bearing bones like calvaria etc didn't show bone mineral density decrease in weightlessness. Given the interest of our labora-tory in the microgravity induced skeleton alterations, we focused our attention on a transgenic mouse overexpressing pleiotrophin (PTN) under the control of the bone specific human os-teocalcin promoter. This protein is a heparin-binding cytokine with different functions. In particular PTN-transgenic mice (PTN-Tg) show an increase in the bone mass and mineral-ization, with a calcium content/mg bone of 10We used this mouse model in the MDS flight experiment to study the PTN potential role in counteracting bone loss in microgravity. Three PTN-transgenic mice (Tg) and three wild type (Wt) mice were housed in the MDS (Mouse Drawer System) at the ISS for three months. During these three months two wt and one tg mice died and therefore could be only frozen for subsequent skeletal analysis. The other three mice, daily checked for their health status, were viable and in good condition throughout the all three months at the ISS. At the end of November 2009 the three mice came back to Earth and after blood collection were immediately sacrificed and the different bones isolated. From blood cell analysis no major hematological alterations were noticed in the blood cell count except a slight increase in the number of erythrocytes. The serum collected from these mice is being used in a Luminex panel assay for several cytokine and bone metabolism markers. A ground replica of the flight experiment ("ground control") was performed at the University of Genova from November 2009 to the second week of February 2010 during which we collected the bone samples. To study the microgravity effects on both wt and PTN-Tg mice we are performing morphological analysis by classical histological technique. A finer microarchitectural study by synchrotron and bench microCT has been initiated both at the Grenoble and the Trieste facil-ities. With this last technique we are analyzing both weight and non-weight bearing bones and we are evaluating bone mineral density, mineralization amount, trabecular architecture. We are also in the process of obtaining a holotomographic reconstruction of the trabecular and cortical bone from both the flight and the ground control mice. In addition we extracted RNA from long bones and bone marrow of the same mice and we are performing Real-time PCR analysis to determine the expression of bone marker such as osteocalcin, runx2, bone sialoprotein and of markers of bone turnover such as RankL, TRAP, cathepsin K, IL6 in the different animals.

Piezosurgery as a further technical adjunct in minimally invasive supraorbital keyhole approach and lateral orbitotomy.

PubMed

Iacoangeli, Maurizio; Di Rienzo, Alessandro; Nocchi, Niccolo; Balercia, Paolo; Lupi, Ettore; Regnicolo, Luana; Di Somma, Lucia Giovanna Maria; Alvaro, Lorenzo; Scerrati, Massimo

2015-03-01

One of the problems in neurosurgery is how to perform rapid and effective craniotomies that minimize the risk of injury to underlying eloquent structures. The traditional high-powered pneumatic tools and saws are efficient in terms of speed and penetration, but they can provoke bone necrosis and sometimes damage neurovascular structures. As an alternative, we evaluated the piezoelectric bone scalpel (piezosurgery), a device that potentially allows thinner and more precise bone cutting without lesioning neighboring delicate structures, even in the case of accidental contact. From January 2009 to December 2011, 20 patients (8 men and 12 women), 19 to 72 years of age (mean: 49.3 years) were treated using piezosurgery. Surgery was performed for the removal of anterior cranial fossa meningiomas, orbital tumors, and sinonasal lesions with intracranial extension. The time required to perform craniotomy using piezosurgery is a few minutes longer than with traditional drills. No damage was observed using the piezoelectric device. Follow-up clinical and neuroradiologic evaluation showed a faster and better ossification of the bone flap with good esthetic results. Piezosurgery is a new promising technique for selective bone cutting with soft tissue preservation. This instrument seems suitable to perform precise thin osteotomies while limiting damage to the bone itself and to the underlying delicate structures even in the case of unintentional contact. These advantages make the piezoelectric bone scalpel a particularly attractive instrument in neurosurgery. Georg Thieme Verlag KG Stuttgart · New York.

Rapid prototyping for tissue-engineered bone scaffold by 3D printing and biocompatibility study.

PubMed

He, Hui-Yu; Zhang, Jia-Yu; Mi, Xue; Hu, Yang; Gu, Xiao-Yu

2015-01-01

The prototyping of tissue-engineered bone scaffold (calcined goat spongy bone-biphasic ceramic composite/PVA gel) by 3D printing was performed, and the biocompatibility of the fabricated bone scaffold was studied. Pre-designed STL file was imported into the GXYZ303010-XYLE 3D printing system, and the tissue-engineered bone scaffold was fabricated by 3D printing using gel extrusion. Rabbit bone marrow stromal cells (BMSCs) were cultured in vitro and then inoculated to the sterilized bone scaffold obtained by 3D printing. The growth of rabbit BMSCs on the bone scaffold was observed under the scanning electron microscope (SEM). The effect of the tissue-engineered bone scaffold on the proliferation and differentiation of rabbit BMSCs using MTT assay. Universal testing machine was adopted to test the tensile strength of the bone scaffold. The leachate of the bone scaffold was prepared and injected into the New Zealand rabbits. Cytotoxicity test, acute toxicity test, pyrogenic test and intracutaneous stimulation test were performed to assess the biocompatibility of the bone scaffold. Bone scaffold manufactured by 3D printing had uniform pore size with the porosity of about 68.3%. The pores were well interconnected, and the bone scaffold showed excellent mechanical property. Rabbit BMSCs grew and proliferated on the surface of the bone scaffold after adherence. MTT assay indicated that the proliferation and differentiation of rabbit BMSCs on the bone scaffold did not differ significantly from that of the cells in the control. In vivo experiments proved that the bone scaffold fabricated by 3D printing had no acute toxicity, pyrogenic reaction or stimulation. Bone scaffold manufactured by 3D printing allows the rabbit BMSCs to adhere, grow and proliferate and exhibits excellent biomechanical property and high biocompatibility. 3D printing has a good application prospect in the prototyping of tissue-engineered bone scaffold.

Rapid prototyping for tissue-engineered bone scaffold by 3D printing and biocompatibility study

PubMed Central

He, Hui-Yu; Zhang, Jia-Yu; Mi, Xue; Hu, Yang; Gu, Xiao-Yu

2015-01-01

The prototyping of tissue-engineered bone scaffold (calcined goat spongy bone-biphasic ceramic composite/PVA gel) by 3D printing was performed, and the biocompatibility of the fabricated bone scaffold was studied. Pre-designed STL file was imported into the GXYZ303010-XYLE 3D printing system, and the tissue-engineered bone scaffold was fabricated by 3D printing using gel extrusion. Rabbit bone marrow stromal cells (BMSCs) were cultured in vitro and then inoculated to the sterilized bone scaffold obtained by 3D printing. The growth of rabbit BMSCs on the bone scaffold was observed under the scanning electron microscope (SEM). The effect of the tissue-engineered bone scaffold on the proliferation and differentiation of rabbit BMSCs using MTT assay. Universal testing machine was adopted to test the tensile strength of the bone scaffold. The leachate of the bone scaffold was prepared and injected into the New Zealand rabbits. Cytotoxicity test, acute toxicity test, pyrogenic test and intracutaneous stimulation test were performed to assess the biocompatibility of the bone scaffold. Bone scaffold manufactured by 3D printing had uniform pore size with the porosity of about 68.3%. The pores were well interconnected, and the bone scaffold showed excellent mechanical property. Rabbit BMSCs grew and proliferated on the surface of the bone scaffold after adherence. MTT assay indicated that the proliferation and differentiation of rabbit BMSCs on the bone scaffold did not differ significantly from that of the cells in the control. In vivo experiments proved that the bone scaffold fabricated by 3D printing had no acute toxicity, pyrogenic reaction or stimulation. Bone scaffold manufactured by 3D printing allows the rabbit BMSCs to adhere, grow and proliferate and exhibits excellent biomechanical property and high biocompatibility. 3D printing has a good application prospect in the prototyping of tissue-engineered bone scaffold. PMID:26380018

Automatic lung lobe segmentation of COPD patients using iterative B-spline fitting

NASA Astrophysics Data System (ADS)

Shamonin, D. P.; Staring, M.; Bakker, M. E.; Xiao, C.; Stolk, J.; Reiber, J. H. C.; Stoel, B. C.

2012-02-01

We present an automatic lung lobe segmentation algorithm for COPD patients. The method enhances fissures, removes unlikely fissure candidates, after which a B-spline is fitted iteratively through the remaining candidate objects. The iterative fitting approach circumvents the need to classify each object as being part of the fissure or being noise, and allows the fissure to be detected in multiple disconnected parts. This property is beneficial for good performance in patient data, containing incomplete and disease-affected fissures. The proposed algorithm is tested on 22 COPD patients, resulting in accurate lobe-based densitometry, and a median overlap of the fissure (defined 3 voxels wide) with an expert ground truth of 0.65, 0.54 and 0.44 for the three main fissures. This compares to complete lobe overlaps of 0.99, 0.98, 0.98, 0.97 and 0.87 for the five main lobes, showing promise for lobe segmentation on data of patients with moderate to severe COPD.

Percutaneous magnetic resonance imaging-guided bone tumor management and magnetic resonance imaging-guided bone therapy.

PubMed

Sequeiros, Roberto Blanco; Fritz, Jan; Ojala, Risto; Carrino, John A

2011-08-01

Magnetic resonance imaging (MRI) is promising tool for image-guided therapy. In musculoskeletal setting, image-guided therapy is used to direct diagnostic and therapeutic procedures and to steer patient management. Studies have demonstrated that MRI-guided interventions involving bone, soft tissue, joints, and intervertebral disks are safe and in selected indications can be the preferred action to manage clinical situation. Often, these procedures are technically similar to those performed in other modalities (computed tomography, fluoroscopy) for bone and soft tissue lesions. However, the procedural perception to the operator can be very different to other modalities because of the vastly increased data.Magnetic resonance imaging guidance is particularly advantageous should the lesion not be visible by other modalities, for selective lesion targeting, intra-articular locations, cyst aspiration, and locations adjacent to surgical hardware. Palliative tumor-related pain management such as ablation therapy forms a subset of procedures that are frequently performed under MRI. Another suitable entity for MRI guidance are the therapeutic percutaneous osseous or joint-related benign or reactive conditions such as osteoid osteoma, epiphyseal bone bridging, osteochondritis dissecans, bone cysts, localized bone necrosis, and posttraumatic lesions. In this article, we will describe in detail the technical aspects of performing MRI-guided therapeutic musculoskeletal procedures as well as the clinical indications.

Maintaining Bone Health in Patients With Multiple Myeloma: Survivorship Care Plan of the International Myeloma Foundation Nurse Leadership Board

PubMed Central

Miceli, Teresa S.; Colson, Kathleen; Faiman, Beth M.; Miller, Kena; Tariman, Joseph D.

2014-01-01

About 90% of individuals with multiple myeloma will develop osteolytic bone lesions from increased osteoclastic and decreased osteoblastic activity. Severe morbidities from pathologic fractures and other skeletal events can lead to poor circulation, blood clots, muscle wasting, compromised performance status, and overall poor survival. Supportive care targeting bone disease is an essential adjunct to antimyeloma therapy. In addition, the maintenance of bone health in patients with multiple myeloma can significantly improve quality of life. Oncology nurses and other healthcare providers play a central role in the management of bone disease and maintenance throughout the course of treatment. Safe administration of bisphosphonates, promotion of exercise, maintenance of adequate nutrition, vitamin and mineral supplementation, scheduled radiographic examinations, and monitoring of bone complications are among the important functions that oncology nurses and healthcare providers perform in clinical practice. PMID:21816707

Global spectral graph wavelet signature for surface analysis of carpal bones

NASA Astrophysics Data System (ADS)

Masoumi, Majid; Rezaei, Mahsa; Ben Hamza, A.

2018-02-01

Quantitative shape comparison is a fundamental problem in computer vision, geometry processing and medical imaging. In this paper, we present a spectral graph wavelet approach for shape analysis of carpal bones of the human wrist. We employ spectral graph wavelets to represent the cortical surface of a carpal bone via the spectral geometric analysis of the Laplace-Beltrami operator in the discrete domain. We propose global spectral graph wavelet (GSGW) descriptor that is isometric invariant, efficient to compute, and combines the advantages of both low-pass and band-pass filters. We perform experiments on shapes of the carpal bones of ten women and ten men from a publicly-available database of wrist bones. Using one-way multivariate analysis of variance (MANOVA) and permutation testing, we show through extensive experiments that the proposed GSGW framework gives a much better performance compared to the global point signature embedding approach for comparing shapes of the carpal bones across populations.

Maintaining bone health in patients with multiple myeloma: survivorship care plan of the International Myeloma Foundation Nurse Leadership Board.

PubMed

Miceli, Teresa S; Colson, Kathleen; Faiman, Beth M; Miller, Kena; Tariman, Joseph D

2011-08-01

About 90% of individuals with multiple myeloma will develop osteolytic bone lesions from increased osteoclastic and decreased osteoblastic activity. Severe morbidities from pathologic fractures and other skeletal events can lead to poor circulation, blood clots, muscle wasting, compromised performance status, and overall poor survival. Supportive care targeting bone disease is an essential adjunct to antimyeloma therapy. In addition, the maintenance of bone health in patients with multiple myeloma can significantly improve quality of life. Oncology nurses and other healthcare providers play a central role in the management of bone disease and maintenance throughout the course of treatment. Safe administration of bisphosphonates, promotion of exercise, maintenance of adequate nutrition, vitamin and mineral supplementation, scheduled radiographic examinations, and monitoring of bone complications are among the important functions that oncology nurses and healthcare providers perform in clinical practice.

Global spectral graph wavelet signature for surface analysis of carpal bones.

PubMed

Masoumi, Majid; Rezaei, Mahsa; Ben Hamza, A

2018-02-05

Quantitative shape comparison is a fundamental problem in computer vision, geometry processing and medical imaging. In this paper, we present a spectral graph wavelet approach for shape analysis of carpal bones of the human wrist. We employ spectral graph wavelets to represent the cortical surface of a carpal bone via the spectral geometric analysis of the Laplace-Beltrami operator in the discrete domain. We propose global spectral graph wavelet (GSGW) descriptor that is isometric invariant, efficient to compute, and combines the advantages of both low-pass and band-pass filters. We perform experiments on shapes of the carpal bones of ten women and ten men from a publicly-available database of wrist bones. Using one-way multivariate analysis of variance (MANOVA) and permutation testing, we show through extensive experiments that the proposed GSGW framework gives a much better performance compared to the global point signature embedding approach for comparing shapes of the carpal bones across populations.

Healing of osteotomy sites applying either piezosurgery or two conventional saw blades: a pilot study in rabbits.

PubMed

Ma, Li; Stübinger, Stefan; Liu, Xi Ling; Schneider, Urs A; Lang, Niklaus P

2013-08-01

The purpose of this study was to compare bone healing of experimental osteotomies applying either piezosurgery or two different oscillating saw blades in a rabbit model. The 16 rabbits were randomly assigned into four groups to comply with observation periods of one, two, three and five weeks. In all animals, four osteotomy lines were performed on the left and right nasal bone using a conventional saw blade, a novel saw blade and piezosurgery. All three osteotomy techniques revealed an advanced gap healing starting after one week. The most pronounced new bone formation took place between two and three weeks, whereby piezoelectric surgery revealed a tendency to faster bone formation and remodelling. Yet, there were no significant differences between the three modalities. The use of a novel as well as the piezoelectric bone-cutting instrument revealed advanced bone healing with a favourable surgical performance compared to a traditional saw.

Simultaneous Analysis of Losartan Potassium, Amlodipine Besylate, and Hydrochlorothiazide in Bulk and in Tablets by High-Performance Thin Layer Chromatography with UV-Absorption Densitometry

PubMed Central

Santhana Lakshmi, Karunanidhi; Lakshmi, Sivasubramanian

2012-01-01

A Simple high-performance thin layer chromatography (HPTLC) method for separation and quantitative analysis of losartan potassium, amlodipine, and hydrochlorothiazide in bulk and in pharmaceutical formulations has been established and validated. After extraction with methanol, sample and standard solutions were applied to silica gel plates and developed with chloroform : methanol : acetone : formic acid 7.5 : 1.3 : 0.5 : 0.03 (v/v/v/v) as mobile phase. Zones were scanned densitometrically at 254 nm. The R f values of amlodipine besylate, hydrochlorothiazide, and losartan potassium were 0.35, 0.57, and 0.74, respectively. Calibration plots were linear in the ranges 500–3000 ng per spot for losartan potassium, amlodipine and hydrochlorothiazide, the correlation coefficients, r, were 0.998, 0.998, and 0.999, respectively. The suitability of this method for quantitative determination of these compounds was by validation in accordance with the requirements of pharmaceutical regulatory standards. The method can be used for routine analysis of these drugs in bulk and in formulation. PMID:22567550

Three-dimensional visualization and characterization of bone structure using reconstructed in-vitro μCT images: A pilot study for bone microarchitecture analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Latief, Fourier Dzar Eljabbar, E-mail: fourier@fi.itb.ac.id; Dewi, Dyah Ekashanti Octorina; Shari, Mohd Aliff Bin Mohd

Micro Computed Tomography (μCT) has been largely used to perform micrometer scale imaging of specimens, bone biopsies and small animals for the study of porous or cavity-containing objects. One of its favored applications is for assessing structural properties of bone. In this research, we perform a pilot study to visualize and characterize bone structure of a chicken bone thigh, as well as to delineate its cortical and trabecular bone regions. We utilize an In-Vitro μCT scanner Skyscan 1173 to acquire a three dimensional image data of a chicken bone thigh. The thigh was scanned using X-ray voltage of 45 kVmore » and current of 150 μA. The reconstructed images have spatial resolution of 142.50 μm/pixel. Using image processing and analysis e.i segmentation by thresholding the gray values (which represent the pseudo density) and binarizing the images, we were able to visualize each part of the bone, i.e., the cortical and trabecular regions. Total volume of the bone is 4663.63 mm{sup 3}, and the surface area of the bone is 7913.42 mm{sup 2}. The volume of the cortical is approximately 1988.62 mm{sup 3} which is nearly 42.64% of the total bone volume. This pilot study has confirmed that the μCT is capable of quantifying 3D bone structural properties and defining its regions separately. For further development, these results can be improved for understanding the pathophysiology of bone abnormality, testing the efficacy of pharmaceutical intervention, or estimating bone biomechanical properties.« less

Bone Formation is Affected by Matrix Advanced Glycation End Products (AGEs) In Vivo.

PubMed

Yang, Xiao; Mostafa, Ahmed Jenan; Appleford, Mark; Sun, Lian-Wen; Wang, Xiaodu

2016-10-01

Advanced glycation end products (AGEs) accumulate in bone extracellular matrix as people age. Although previous evidence shows that the accumulation of AGEs in bone matrix may impose significant effects on bone cells, the effect of matrix AGEs on bone formation in vivo is still poorly understood. To address this issue, this study used a unique rat model with autograft implant to investigate the in vivo response of bone formation to matrix AGEs. Fluorochrome biomarkers were sequentially injected into rats to label the dynamic bone formation in the presence of elevated levels of matrix AGEs. After sacrificing animals, dynamic histomorphometry was performed to determine mineral apposition rate (MAR), mineralized surface per bone surface (MS/BS), and bone formation rate (BFR). Finally, nanoindentation tests were performed to assess mechanical properties of newly formed bone tissues. The results showed that MAR, MS/BS, and BFR were significantly reduced in the vicinity of implant cores with high concentration of matrix AGEs, suggesting that bone formation activities by osteoblasts were suppressed in the presence of elevated matrix AGEs. In addition, MAR and BFR were found to be dependent on the surrounding environment of implant cores (i.e., cortical or trabecular tissues). Moreover, MS/BS and BFR were also dependent on how far the implant cores were away from the growth plate. These observations suggest that the effect of matrix AGEs on bone formation is dependent on the biological milieu around the implants. Finally, nanoindentation test results indicated that the indentation modulus and hardness of newly formed bone tissues were not affected by the presence of elevated matrix AGEs. In summary, high concentration of matrix AGEs may slow down the bone formation process in vivo, while imposing little effects on bone mineralization.

Interstitial ultrasound ablation of tumors within or adjacent to bone: Contributions of preferential heating at the bone surface

NASA Astrophysics Data System (ADS)

Scott, Serena J.; Prakash, Punit; Salgaonkar, Vasant; Jones, Peter D.; Cam, Richard N.; Han, Misung; Rieke, Viola; Burdette, E. Clif; Diederich, Chris J.

2013-02-01

Preferential heating of bone due to high ultrasound attenuation may enhance thermal ablation performed with cathetercooled interstitial ultrasound applicators in or near bone. At the same time, thermally and acoustically insulating cortical bone may protect sensitive structures nearby. 3D acoustic and biothermal transient finite element models were developed to simulate temperature and thermal dose distributions during catheter-cooled interstitial ultrasound ablation near bone. Experiments in ex vivo tissues and tissue-mimicking phantoms were performed to validate the models and to quantify the temperature profiles and ablated volumes for various distances between the interstitial applicator and the bone surface. 3D patient-specific models selected to bracket the range of clinical usage were developed to investigate what types of tumors could be treated, applicator configurations, insertion paths, safety margins, and other parameters. Experiments show that preferential heating at the bone surface decreases treatment times compared to when bone is absent and that all tissue between an applicator and bone can be ablated when they are up to 2 cm apart. Simulations indicate that a 5-7 mm safety margin of normal bone is needed to protect (thermal dose < 6 CEM43°C and T < 45°C) sensitive structures behind ablated bone. In 3D patient-specific simulations, tumors 1.0-3.8 cm (L) and 1.3-3.0 cm (D) near or within bone were ablated (thermal dose > 240 CEM43°C) within 10 min without damaging the nearby spinal cord, lungs, esophagus, trachea, or major vasculature. Preferential absorption of ultrasound by bone may provide improved localization, faster treatment times, and larger treatment zones in tumors in and near bone compared to other heating modalities.

Restoration of small bone defects at craniotomy using autologous bone dust and fibrin glue.

PubMed

Matsumoto, K; Kohmura, E; Kato, A; Hayakawa, T

1998-10-01

Bone gaps or burr holes often result in small but undesirable scalp or skin depressions after craniotomy. Whereas a number of reports have discussed cranioplasties to avoid large bone defects, little has been written about the problem of small bone defects which, despite their minor size, could result in bothersome cosmetic problems. This study was designed to assess a simple method to repair burr hole defects and bridge bone gaps with autologous bone dust and fibrin glue. Bone dust was collected when burr holes were created or craniectomy was performed. After replacement of the bone flap, the burr holes or bone gap were filled with a mixture of bone dust and fibrin glue. The mixture of bone dust and fibrin glue was easily shaped to fit bone defects, resulting in favorable cosmetic outcomes 1 to 5 years after operation.

Performance of Er:YAG laser ablation of hard bone under different irrigation water cooling conditions

NASA Astrophysics Data System (ADS)

Beltrán Bernal, Lina M.; Shayeganrad, Gholamreza; Kosa, Gabor; Zelechowski, Marek; Rauter, Georg; Friederich, Niklaus; Cattin, Philippe C.; Zam, Azhar

2018-02-01

The biological applicability of the Erbium-doped Yttrium Aluminum Garnet (Er:YAG) laser in surgical processes is so far limited to hard dental tissues. Using the Er:YAG laser for bone ablation is being studied since it has shown good performance for ablating dental hard tissues at the wavelength 2.94 μm, which coincides with the absorption peak of water, one of the main components of hard tissue, like teeth and bone. To obtain a decent performance of the laser in the cutting process, we aim at examining the influence of sequenced water jet irrigation on both, the ablation rate and the prevention of carbonization while performing laser ablation of bone with fixed laser parameters. An Er:YAG laser at 2.94 μm wavelength, 940 mJ energy per pulse, 400 μs pulse width, and 10 Hz repetition rate is used for the ablation of a porcine femur bone under different pulsed water jet irrigation conditions. We used micro-computed tomography (micro-CT) scans to determine the geometry of the ablated areas. In addition, scanning electron microscopy (SEM) is used for qualitative observations for the presence of carbonization and micro-fractures on the ablated surfaces. We evaluate the performance of the laser ablation process for the different water jet conditions in terms of the ablation rate, quantified by the ablated volume per second and the ablation efficiency, calculated as the ablated volume per pulse energy. We provide an optimized system for laser ablation which delivers the appropriate amount of water to the bone and consequently, the bone is ablated in the most efficient way possible without carbonization.

Measurement of Human Blood and Plasma Volumes

NASA Technical Reports Server (NTRS)

Greenleaf, J. E.; Szalkay, H. G. H.

1987-01-01

Report reviews techniques for measuring blood-plasma volume in humans. Common technique of using radioactive iodine isotope to label plasma albumin involves unwarranted risks from low-level radiation. Report emphasizes techniques using Evans-blue-dye (T-1824) labeling of albumin, hematocrit or hemoglobin/hematocrit measurements, or blood densitometry. In Evans-blue-dye technique, plasma volume determined from decrease in dye concentration occurring after small amount of dye solution injected into circulatory system. Subjection of Evans blue dye to test for carcinogenicity gave negative results.

Ultrasonic fluid densitometry and densitometer

DOEpatents

Greenwood, Margaret S.; Lail, Jason C.

1998-01-01

The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface.

Ultrasonic fluid densitometry and densitometer

DOEpatents

Greenwood, M.S.; Lail, J.C.

1998-01-13

The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface. 6 figs.

Histomorphological analysis of the variability of the human skeleton: forensic implications.

PubMed

Cummaudo, Marco; Cappella, Annalisa; Biraghi, Miranda; Raffone, Caterina; Màrquez-Grant, Nicholas; Cattaneo, Cristina

2018-01-20

One of the fundamental questions in forensic medicine and anthropology is whether or not a bone or bone fragment is human. Surprisingly at times for the extreme degradation of the bone (charred, old), DNA cannot be successfully performed and one must turn to other methods. Histological analysis at times can be proposed. However, the variability of a single human skeleton has never been tested. Forty-nine thin sections of long, flat, irregular and short bones were obtained from a well-preserved medieval adult human skeleton. A qualitative histomorphological analysis was performed in order to assess the presence of primary and secondary bone and the presence, absence and orientation of vascular canals. No histological sections exhibited woven or fibro-lamellar bone. Long bones showed a higher variability with an alternation within the same section of areas characterized by tightly packed secondary osteons and areas with scattered secondary osteons immersed in a lamellar matrix. Flat and irregular bones appeared to be characterized by a greater uniformity with scattered osteons in abundant interstitial lamellae. Some cases of "osteon banding" and "drifting osteons" were observed. Although Haversian bone represent the most frequent pattern, a histomorphological variability between different bones of the same individual, in different portions of the same bone, and in different parts of the same section has been observed. Therefore, the present study has highlighted the importance of extending research to whole skeletons without focusing only on single bones, in order to have a better understanding of the histological variability of both human and non-human bone.

Tibial Tray Thickness Significantly Increases Medial Tibial Bone Resorption in Cobalt-Chromium Total Knee Arthroplasty Implants.

PubMed

Martin, J Ryan; Watts, Chad D; Levy, Daniel L; Miner, Todd M; Springer, Bryan D; Kim, Raymond H

2017-01-01

Stress shielding is an uncommon complication associated with primary total knee arthroplasty. Patients are frequently identified radiographically with minimal clinical symptoms. Very few studies have evaluated risk factors for postoperative medial tibial bone loss. We hypothesized that thicker cobalt-chromium tibial trays are associated with increased bone loss. We performed a retrospective review of 100 posterior stabilized, fixed-bearing total knee arthroplasty where 50 patients had a 4-mm-thick tibial tray (thick tray cohort) and 50 patients had a 2.7-mm-thick tibial tray (thin tray cohort). A clinical evaluation and a radiographic assessment of medial tibial bone loss were performed on both cohorts at a minimum of 2 years postoperatively. Mean medial tibial bone loss was significantly higher in the thick tray cohort (1.07 vs 0.16 mm; P = .0001). In addition, there were significantly more patients with medial tibial bone loss in the thick tray group compared with the thin tray group (44% vs 10%, P = .0002). Despite these differences, there were no statistically significant differences in range of motion, knee society score, complications, or revision surgeries performed. A thicker cobalt-chromium tray was associated with significantly more medial tibial bone loss. Despite these radiographic findings, we found no discernable differences in clinical outcomes in our patient cohort. Further study and longer follow-up are needed to understand the effects and clinical significance of medial tibial bone loss. Copyright © 2016 Elsevier Inc. All rights reserved.

Virtual temporal bone dissection system: OSU virtual temporal bone system: development and testing.

PubMed

Wiet, Gregory J; Stredney, Don; Kerwin, Thomas; Hittle, Bradley; Fernandez, Soledad A; Abdel-Rasoul, Mahmoud; Welling, D Bradley

2012-03-01

The objective of this project was to develop a virtual temporal bone dissection system that would provide an enhanced educational experience for the training of otologic surgeons. A randomized, controlled, multi-institutional, single-blinded validation study. The project encompassed four areas of emphasis: structural data acquisition, integration of the system, dissemination of the system, and validation. Structural acquisition was performed on multiple imaging platforms. Integration achieved a cost-effective system. Dissemination was achieved on different levels including casual interest, downloading of software, and full involvement in development and validation studies. A validation study was performed at eight different training institutions across the country using a two-arm randomized trial where study subjects were randomized to a 2-week practice session using either the virtual temporal bone or standard cadaveric temporal bones. Eighty subjects were enrolled and randomized to one of the two treatment arms; 65 completed the study. There was no difference between the two groups using a blinded rating tool to assess performance after training. A virtual temporal bone dissection system has been developed and compared to cadaveric temporal bones for practice using a multicenter trial. There was no statistical difference between practice on the current simulator compared to practice on human cadaveric temporal bones. Further refinements in structural acquisition and interface design have been identified, which can be implemented prior to full incorporation into training programs and used for objective skills assessment. Copyright © 2012 The American Laryngological, Rhinological, and Otological Society, Inc.

Face and content validation of a virtual reality temporal bone simulator.

PubMed

Arora, Asit; Khemani, Sam; Tolley, Neil; Singh, Arvind; Budge, James; Varela, David A Diaz Voss; Francis, Howard W; Darzi, Ara; Bhatti, Nasir I

2012-03-01

To validate the VOXEL-MAN TempoSurg simulator for temporal bone dissection. Prospective international study. Otolaryngology departments of 2 academic health care institutions in the United Kingdom and United States. Eighty-five subjects were recruited consisting of an experienced and referent group. Participants performed a standardized familiarization session and temporal bone dissection task. Realism, training effectiveness, and global impressions were evaluated across 21 domains using a 5-point Likert-type scale. A score of 4 was the minimum threshold for acceptability. The experienced group comprised 25 otolaryngology trainers who had performed 150 mastoid operations. The referent group comprised 60 trainees (mean otolaryngology experience of 2.9 years). Familiarization took longer in the experienced group (P = .01). User-friendliness was positively rated (mean score 4.1). Seventy percent of participants rated anatomical appearance as acceptable. Trainers rated drill ergonomics worse than did trainees (P = .01). Simulation temporal bone training scored highly (mean score 4.3). Surgical anatomy, drill navigation, and hand-eye coordination accounted for this. Trainees were more likely to recommend temporal bone simulation to a colleague than were trainers (P = .01). Transferability of skills to the operating room was undecided (mean score 3.5). Realism of the VOXEL-MAN virtual reality temporal bone simulator is suboptimal in its current version. Nonetheless, it represents a useful adjunct to existing training methods and is particularly beneficial for novice surgeons before performing cadaveric temporal bone dissection. Improvements in realism, specifically drill ergonomics and visual-spatial perception during deeper temporal bone dissection, are warranted.

Relationship Between Bariatric Surgery and Bone Mineral Density: a Meta-analysis.

PubMed

Ko, Byung-Joon; Myung, Seung Kwon; Cho, Kyung-Hwan; Park, Yong Gyu; Kim, Sin Gon; Kim, Do Hoon; Kim, Seon Mee

2016-07-01

A meta-analysis regarding bone loss after bariatric surgery, designed to compare surgical and nonsurgical groups, has not yet been performed. Therefore, we performed a meta-analysis to compare the differences between bariatric surgical groups and nonoperated controls with regard to bone mineral density. In March 2015, we performed a review of the literature using PubMed, EMBASE, and the Cochrane Library. The search focused on retrospective and prospective studies, including but not limited to randomized studies published in English. Among 1299 studies that were initially screened, ten met the selection criteria. For all types of bariatric surgery, bone density at the femoral neck was lower in the surgical group than in the nonsurgical control group (mean difference [MD] -0.05 g/cm(2); 95 % confidence interval [CI], -0.07 to -0.02; p = 0.001); no difference in bone density was found between the two groups at the lumbar spine (MD -0.01 g/cm(2); 95 % CI -0.07 to 0.05; p = 0.661). The analysis of Roux-en-Y gastric bypass showed similar results. Bone density at the femoral neck decreased after bariatric surgery, compared to that in nonsurgical controls, whereas bone density at the lumbar spine did not show a difference between groups. Further larger scale studies with comparative nonsurgical controls are warranted to overcome the heterogeneity among studies in this analysis and to add evidence of possible bone loss subsequent to bariatric surgical procedures.

The interaction of force and repetition on musculoskeletal and neural tissue responses and sensorimotor behavior in a rat model of work-related musculoskeletal disorders

PubMed Central

2013-01-01

Background We examined the relationship of musculoskeletal risk factors underlying force and repetition on tissue responses in an operant rat model of repetitive reaching and pulling, and if force x repetition interactions were present, indicative of a fatigue failure process. We examined exposure-dependent changes in biochemical, morphological and sensorimotor responses occurring with repeated performance of a handle-pulling task for 12 weeks at one of four repetition and force levels: 1) low repetition with low force, 2) high repetition with low force, 3) low repetition with high force, and 4) high repetition with high force (HRHF). Methods Rats underwent initial training for 4–6 weeks, and then performed one of the tasks for 12 weeks, 2 hours/day, 3 days/week. Reflexive grip strength and sensitivity to touch were assayed as functional outcomes. Flexor digitorum muscles and tendons, forelimb bones, and serum were assayed using ELISA for indicators of inflammation, tissue stress and repair, and bone turnover. Histomorphometry was used to assay macrophage infiltration of tissues, spinal cord substance P changes, and tissue adaptative or degradative changes. MicroCT was used to assay bones for changes in bone quality. Results Several force x repetition interactions were observed for: muscle IL-1alpha and bone IL-1beta; serum TNFalpha, IL-1alpha, and IL-1beta; muscle HSP72, a tissue stress and repair protein; histomorphological evidence of tendon and cartilage degradation; serum biomarkers of bone degradation (CTXI) and bone formation (osteocalcin); and morphological evidence of bone adaptation versus resorption. In most cases, performance of the HRHF task induced the greatest tissue degenerative changes, while performance of moderate level tasks induced bone adaptation and a suggestion of muscle adaptation. Both high force tasks induced median nerve macrophage infiltration, spinal cord sensitization (increased substance P), grip strength declines and forepaw mechanical allodynia by task week 12. Conclusions Although not consistent in all tissues, we found several significant interactions between the critical musculoskeletal risk factors of force and repetition, consistent with a fatigue failure process in musculoskeletal tissues. Prolonged performance of HRHF tasks exhibited significantly increased risk for musculoskeletal disorders, while performance of moderate level tasks exhibited adaptation to task demands. PMID:24156755

The interaction of force and repetition on musculoskeletal and neural tissue responses and sensorimotor behavior in a rat model of work-related musculoskeletal disorders.

PubMed

Barbe, Mary F; Gallagher, Sean; Massicotte, Vicky S; Tytell, Michael; Popoff, Steven N; Barr-Gillespie, Ann E

2013-10-25

We examined the relationship of musculoskeletal risk factors underlying force and repetition on tissue responses in an operant rat model of repetitive reaching and pulling, and if force x repetition interactions were present, indicative of a fatigue failure process. We examined exposure-dependent changes in biochemical, morphological and sensorimotor responses occurring with repeated performance of a handle-pulling task for 12 weeks at one of four repetition and force levels: 1) low repetition with low force, 2) high repetition with low force, 3) low repetition with high force, and 4) high repetition with high force (HRHF). Rats underwent initial training for 4-6 weeks, and then performed one of the tasks for 12 weeks, 2 hours/day, 3 days/week. Reflexive grip strength and sensitivity to touch were assayed as functional outcomes. Flexor digitorum muscles and tendons, forelimb bones, and serum were assayed using ELISA for indicators of inflammation, tissue stress and repair, and bone turnover. Histomorphometry was used to assay macrophage infiltration of tissues, spinal cord substance P changes, and tissue adaptative or degradative changes. MicroCT was used to assay bones for changes in bone quality. Several force x repetition interactions were observed for: muscle IL-1alpha and bone IL-1beta; serum TNFalpha, IL-1alpha, and IL-1beta; muscle HSP72, a tissue stress and repair protein; histomorphological evidence of tendon and cartilage degradation; serum biomarkers of bone degradation (CTXI) and bone formation (osteocalcin); and morphological evidence of bone adaptation versus resorption. In most cases, performance of the HRHF task induced the greatest tissue degenerative changes, while performance of moderate level tasks induced bone adaptation and a suggestion of muscle adaptation. Both high force tasks induced median nerve macrophage infiltration, spinal cord sensitization (increased substance P), grip strength declines and forepaw mechanical allodynia by task week 12. Although not consistent in all tissues, we found several significant interactions between the critical musculoskeletal risk factors of force and repetition, consistent with a fatigue failure process in musculoskeletal tissues. Prolonged performance of HRHF tasks exhibited significantly increased risk for musculoskeletal disorders, while performance of moderate level tasks exhibited adaptation to task demands.